i

EMERGING THEMES IN FUNDAMENTAL AND APPLIED SCIENCES

Edited by Rosimah Nulit Faridah Qamaruz Zaman Hishamuddin Omar Yap Chee Kong

Faculty of Science UPM Press Universiti Putra Malaysia Universiti Putra Malaysia Serdang Serdang Selangor Selangor Malaysia Malaysia

ii

Volume Pertama /First volume 2018

Hak Cipta Universiti Putra Malaysia/

Copyright Universiti Putra Malaysia, 2018

Universiti Putra Malaysia

Hak cipta terpelihara.

Tiada bahagian daripada buku ini boleh diterbitkan semula, disimpan untuk pengeluaran atau ditukarkan ke dalam sebarang bentuk atau dengan sebarang alat, sama ada dengan cara elektonik, gambar serta rakaman dan sebagainya tanpa kebenaran bertulis daripada Penerbit UPM terlebih dahulu

All right reserved.

No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical including photocopy, recording, or any information storage and retrieval system, without permission in writing from UPM Press

Diterbitkan di Malaysia oleh/Published in Malaysia by

Penerbit UPM

Universiti Putra Malaysia

43400 UPM, Serdang Selangor

Hakcipta terpelihara: www.science.upm.edu.my/ebook-3213

Perpustakaan Negara Malaysia Data pengkatalogan-dalam- Penerbitan

Emerging Themes in Fundamental and Applied Sciences

Editor: Rosimah Nulit, Faridah Qamaruz zaman, Hishamuddin Omar, Yap Chee Kong e-ISBN 978-967-344-829-6

iii

CONTENTS PREFACE v CONTRIBUTORS vi CHAPTER 1 INTRODUCTION 1

CHAPTER 2 BIODIVERSITY AND NATURAL RESOURCES 3

2.1 Diversity Of Mixed Microalgae In Catfish Tanks Under Different Weather Conditions

2.2 Physico-Chemical Properties And Amplification Of 16s rDNA From An Acidic Lake, Puchong

2.3 Lichens And The Environment: Preliminary Study On Fraser’s Hill, Malaysia

2.4 Diversity of invertebrates in different agricultural of soils

2.5 Anuran Species Diversity And Distribution At Compartment 12 In Ayer Hitam Forest Reserve, Puchong, Selangor

2.6 Relationship Between Water Quality And Diversity Of Anurans In Compartment 12, Ayer Hitam Forest Reserve, Puchong

2.7 Fish Fauna Composition and Water Quality at Long Kesseh, Baram, Sarawak

2.8 Antioxidant activity of Cymodocea rotundata from various habitats

2.9 Nutrient content of wild pepper, Piper umbellatum from Sg. Asap Koyan, Belaga, Sarawak

2.10 Morphological Characteristics of Wild Pepper, Piper umbellatum L. from Belaga, Sarawak

2.11 Preliminary Phytochemical Screening Of Chrysanthemum morifolium Under Different Extraction Methods

CHAPTER 3 ECOLOGY 82

3.1 Comparison of Length-Weight Relationship of Cyclocheilichthys apogon (Valenciennes, 1842) between Tail Waters of Bakun Hydroelectric Dam and Batang Ai Hydroelectric Dam

3.2 Threats and Conservation of Tropical Peat Swamp Forests

ii

3.3 Fire Threat in Peat Swamp Forest in Malaysia

3.4 Biological Effects of Tributyltin Chloride (TBTCl) on Juveniles Stage of Life cycle Artemia salina

3.6 Bioaccumulation of lead and cadmium in catfish tissues (Arius thalassinus) from Kuala Gula, Perak, Peninsular Malaysia

3.7 Soil Morphological Properties in Acacia mangium Plantation Area, Bintulu, Sarawak

3.8 Optimal method to introduce faeces sample for olfactory-cues studies in Malayan tapir (Tapirus indicus)

CHAPTER 4 ANIMAL PHYSIOLOGY 137

4.1 Reproductive Status of Bats Species in Compartment 15, Ayer Hitam Forest Reserve, Puchong, Selangor

4.2 Reproductive Pattern of Cynopterus brachyotis from Secondary Forest in Ayer Hitam Forest Reserve, Puchong, Selangor

4.3 A Review on Polyamine Analogues and Its Cytotoxicity Effect Against Selected Human Cancer Cell Lines

4.4 Distribution Pattern of Brucella melitensis in Organs of Bucks Following Experimental Acute Brucellosis

4.5 Effect of Minerals on β-galactosidase activity of Lactobacillus fermentum Isolated from Raw Cow Milk

4.6 Extremely Low Electromagnetic Field (1.0 mT, 50 Hz) Exposure Effects Osteoblasts Growth on Nanobiocomposite Bone Scaffold

4.7 Design and evaluation of PCR primer and protocol for progesterone receptor in ovaries tissue of female goats

4.8 Evaluation of Magnetized Water (MW) on the Growth Performance and Survival of Hybrid Red Tilapia Oreochromis spp.

4.9 LCMS/MS Detection of Faecal progestogens in Female Malayan Tapir

iii

CHAPTER 5 PLANT PHYSIOLOGY 212

5.1 Impact Of Potassium Fertilizaton On The Growth And Secondary Metabolites Of Orthosiphon stamineus (Misai Kucing)

5.2 Carbon Assimilation, Leaf Gas Exchange And Quality Of Ipomea aquatica As Affected By Nitrogen Rates

5.3 Morphological, physicochemical and functional properties of cattail (Typha angustifolia L.) starch

5.4 Morphological changes and nutrients enrichment on Halophila ovalis (R.Br.) Hooker f. and Halophila beccarii Aschers (Hydrocharitaceae) under laboratory condition

5.5 Lasiodiplodia theobromae, L. pseudotheobromae and Pseudofusicoccum adansoniae causing fruit rot disease of commercial fruits

5.6 Screening of potential antagonistic Trichoderma species from soil against Fusarium oxysporum f. sp. Lycopersici

5.7 Spatial distribution of Bacterial Heart Rot (BHR) disease of pineapple

5.8 Influence of lead on seed germination and plant growth of Acacia auriculiformis species

iv

PREFACE This book is the first volume of research papers presented at the Fundamental Science Congress 2017 (FSC 2017). The Congress was held by the Faculty of Science on November 21-22, 2017. In the first volume, thirty-six (36) manuscripts had been received from participants and are categorized into four subfields in biological sciences. Chapter 2 presented the biodiversity and natural resources. The diversity of microorganism to algae, invertebrate and vertebrate from different ecosystems is discussed. The natural resources in Malaysia, especially from Sabah and Sarawak and the benefits of these natural resources on mankind also discovered. Chapter 3 contains the multidisciplinary field in ecology, from freshwater fish, the ecotoxicity of fish and brimp shrimp. The relationship between plant and soil also discussed. Chapter 4 comprises studies on animal physiology. The reproductive status and pattern of bats, the potential compounds as anti-cancer agents, and causative agents of brucellosis in animals was studied.

Chapter 5 presented research works on the growth, physiology, morphology of selected herb, vegetable, and seagrasses. Study on the pathogens from fruits and the potential antagonistic Trichoderma isolates against Fusarium oxysporum f. sp. lycopersici condition is presented. Epidemiology study on the spread and management strategies for Bacterial heart rot (BHR) disease also discussed in this chapter. The potential of Acacia auriculiformis as phytoremediator of lead was presented.

We would like to express our thank you to all authors for articles contribution. It is hoped that the book will be benefit to other.

R. Nulit

v

CONTRIBUTORS PREFACE Rosimah Nulit Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia Email:[email protected] CHAPTER 1 INTRODUCTION Rosimah Nulit*, Faridah Qamaruz Zaman, Hishamuddin Omar, Yap Chee Kong Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia Email:[email protected] CHAPTER 2 BIODIVERSITY

2.1 M. Weeraphong1, N.B.M. Yusoff1, H. Omar1, S.Z.B. Zulkifli1, M.N.A.B. Azmai1, and A. Ismail1*

Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia Email: [email protected]

2.2 N. N. F. Mat Lazim1 and S. Zulkifly1,2

1Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor

2Institut Penyelidikan Matematik Universiti Putra Malaysia 43400 UPM Serdang, Selangor Email: [email protected]

2.3 S. Rohadi and S. Zulkifly

Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia Email: [email protected]

vii

2.4 A. Maqtan, H. Omar, M. Mustafa, N.A. Izzati, A. Ismail1*, D. S. Karam2

1 Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM, Serdang, Selangor, Malaysia

2 Dept. of Land Management Faculty of Agriculture Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia Email: [email protected]

2.5 Nadia Simon1, Nadirah Rosli3, Siti Fara Najua Mohd. Nasir1, Muhammad Faris Abdul Aziz1, Mohamad Azani Alias2, Mohamad Roslan Mohamad Kasim3, Marina Mohd. Top @ Mohd. Tah1,2

1 Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia

2Centre of Foundation Studies for Agricultural Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia

3 Dept. of Forest Management Faculty of Forestry Universiti Putra Malaysia 43400 UPM Serdang, Selangor Email: [email protected]

2.6 Nadirah Rosli1, Nadia Simon2, Siti Fara Najua Mohd. Nasir2, Muhammad Faris Abdul Aziz2, Mohamad Azani Alias1, Mohamad Roslan Mohamad Kasim1, Marina Mohd. Top @ Mohd. Tah2,3

1Dept. of Forest Management Faculty of Forestry Universiti Putra Malaysia 43400 UPM Serdang, Selangor

2Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor

3Centre of Foundation Studies for Agricultural Science, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor Email: [email protected]

vii

2.7 S. Juliana1*, L. Nyanti1 and G. Jongkar2

1Aquatic Science and Resource Management Program Faculty of Resource Science and Technology Universiti Malaysia Sarawak 94300 Kota Samarahan, Sarawak, Malaysia

2Institute of Biodiversity and Environmental Conservation, Universiti Malaysia Sarawak, 94300 Kota Samarahan,Sarawak, Malaysia Email: [email protected]

2.8 L.S.H. Emmclan1, Z. Muta Harah2 and B. Japar Sidik3

1Laboratory of Marine Biotechnology Institute of Bioscience Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia

2Dept. of Aquaculture Faculty of Agriculture Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia

3Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia Email: [email protected]

2.9 Noorasmah, S., Fatin Nadhirah, A.R. and Ainul Asyira, S.

Dept. of Crop Science Faculty of Agriculture and Food Sciences Universiti Putra Malaysia Bintulu Sarawak Campus 97008 Sarawak, Malaysia Email: [email protected]

2.10 Ainul Asyira, S., Nur Aishah, W., Noorasmah, S. and Philip, L.

Dept. of Crop Science Faculty of Agriculture and Food Sciences Universiti Putra Malaysia Bintulu Sarawak Campus 97008 Sarawak, Malaysia Email: [email protected]

viii

2.11 S. Y. Teh1 and P. Furzani1* Dept. of Technology and Natural Resources Faculty of Applied Sciences and Technology Universiti Tun Hussein Onn Malaysia, Pagoh Educational Hub 84600 Pagoh, Johor, Malaysia Email: [email protected]

CHAPTER 3 ECOLOGY

3.1 I. Noor1*, L. Nyanti1 and L. Teck Yee2

1Aquatic Science and Resource Management Program Universiti Malaysia Sarawak, 94300 Kota Samarahan, Sarawak, Malaysia

2Chemistry Department Universiti Malaysia Sarawak 94300 Kota Samarahan, Sarawak, Malaysia Email: [email protected]

3.2 Hussein Aliu Sule1,2, Ahmad Ismail1*,Mohammad Noor Azmai Amal1 and Syaizwan Zahmir Zulkifli1

1 Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia

2 Dept. of Integrated Science School of Sciences Kogi State College of Education, P.M.B. 1033 Ankpa, Nigeria Email:[email protected]

3.3 Dayang Nur Sakinah Musa1*, Syafiqa Nur Ramli1

1Faculty Science and Natural Resources Universiti Malaysia Sabah. Email: [email protected]

3.4 N. M. AbuShaala1,2, *S. Z. Zulkifli2, A. Ismail2, M. N. A. Azmai2, H. Omar2 and F. Mohamat-Yusuff3

1Zoology Department Faculty of Science University of Tripoli, Libya, Tripoli

2 Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia.

ix

Dept. of Environmental Sciences Faculty of Environmental Studies 43400 UPM Serdang, Selangor, Malaysia Email: [email protected]

3.5 Azlan Azizi Muhamad Nor1, Rozeita Laboh2, Raziyah Abdullah1, Nur Sulastri Jaffa 3, Muhammad Zamir Abdul Rasid2, Norsyuhaida Ahmad Shafawi4 and Muhamad Fahrul Razi Shamsudin1

1Crop and Soil Science Research Centre MARDI Kluang Station, P.O. Box 525 86009 Kluang, Johor, Malaysia

2Crop and Soil Science Research Centre MARDI Serdang, P.O. Box 12301 50774 Kuala Lumpur, Malaysia

3Horticulture Research Centre MARDI Serdang P.O. Box 12301, 50774 Kuala Lumpur, Malaysia

4Horticulture Research Centre MARDI Kluang Station P.O. Box 525, 86009, Kluang, Johor, Malaysia Email: [email protected]

3.6 Amani Mohammed, Ahmad Ismail*, Hishamuddin Omar, Shahrizad Yusof and Syaizwan ZahmirZulkifli

Dept. of Biology Faculty of Science Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia Email: [email protected]

3.7 N. Afifi1*, J. Ismail2 and W. Mohd Effendi3

University Malaysia Sarawak 94300 Kota Samarahan, Sarawak, Malaysia Email: [email protected]

3.8 Rekha Krishnan, Kalai Arasi Arumugam, Nurul Adilah Ismail, Wan Norhamidah Wan Ibrahim, Geetha Annavi*

Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia Email: [email protected]

x

CHAPTER 4 ANIMAL PHYSIOLOGY

4.1. Noraini Che Ahmad Nordin1, Nazura Natasha Abdullah1, Marina Mohd. Top @ Mohd. Tah1,2

1 Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor

2Centre of Foundation Studies for Agricultural Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor Email: [email protected]

4.2 Siti Fara Najua Mohd. Nasir1, Nadia Simon1, Nadirah Rosli3, Muhammad Faris Abdul Aziz1, Marina Mohd. Top @ Mohd. Tah1,2

1 Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia

2Centre of Foundation Studies for Agricultural Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor

3 Dept. of Forest Management Faculty of Forestry, Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia Email: [email protected]

4.3 Radiah Abdul Ghani, Suhana Halim, Masnizahani Jamil, Adzly Hairee Sahabudin

Dept. of Biomedical Science Kulliyyah of Allied Health Sciences International Islamic University Malaysia 25200 Kuantan, Pahang Email: [email protected]

xi

4.4 N.N. Shaqinah1,2, M. Mazlina1, M. Zamri-Saad1, H. Hazilawati3 and S. Jasni4

1Research Centre for Ruminant Diseases Faculty of Veterinary Medicine Universiti Putra Malaysia 43400 UPM Serdang, Selangor

2 Dept. of Clinical Oral Biology Faculty of Dentistry Universiti Kebangsaan Malaysia Jalan Raja Muda Abdul Aziz Kuala Lumpur

Dept. of Veterinary Pathology and Microbiology Faculty of Veterinary Medicine Universiti Putra Malaysia 43400 UPM Serdang, Selangor

4Faculty of Veterinary Medicine University Malaysia Kelantan, Locked Bag 36, Pengkalan Chepa, 16100 Kota Baharu, Kelantan Email: [email protected]

4.5 Shao Yin Ooi 1, Sy-Bing Choi 2, Lisa Gaik Ai Ong 3, Boon Yin Khoo4 and Huey Shi Lye 1

1 Dept. of Agricultural and Food Science Faculty of Science Universiti Tunku Abdul Rahman Jalan Universiti, Bandar Barat 31900 Kampar, Perak, Malaysia

2School of Pharmaceutical Sciences Universiti Sains Malaysia 11800 Penang, Malaysia

3 Dept. of Biological Science Faculty of Science Universiti Tunku Abdul Rahman Jalan Universiti, Bandar Barat 31900 Kampar, Perak, Malaysia

4Institute for Research in Molecular Medicine Universiti Sains Malaysia 11800 Penang, Malaysia Email: [email protected]

4.6 Mustaffa, M.F.1, Rosli, Y.1 & Bharatham, B.H.1

1Universiti Kebangsaan Malaysia 50300 Kuala Lumpur Email: [email protected]

xi

4.7 N. H. Mohammed, N. I. Ab Ghani, C. Yong Seok Yien and M. Shikh Maidin* Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia Email: [email protected]

4.8 Vean Salih Mohammad1,2, Yuzine Esa1,*, Mohd Salleh Kamarudin1 and Annie Christianus1

1 Dept. of Aquaculture Faculty of Agriculture Universiti Putra Malaysia 43400 Serdang, Selangor, Malaysia

2 Dept. of Fish Resource and Aquatic Animal College of Agriculture University of Salahaddin Erbil 44002, Kurdistan Region, Iraq Email: [email protected]

4.9 M. N. Ruslan1, R. Salfarina2,3, M. Shikh Maidin1*

1Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia

2Faculty of Pharmacy Universiti Teknologi MARA Selangor 42300 Puncak Alam, Selangor, Malaysia

3Integrative Pharmacogenomics Institute (iPROMISE) Universiti Teknologi MARA Selangor Puncak Alam, Selangor, Malaysia Email: [email protected]

Chapter 5 Plant Physiology

5.1 Ibrahim MH1, Hisham MN1, Mohd Zain NA2, Roslan N1

1Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia

2Institute of Biological Science Faculty of Science University Malaya 50603 Kuala Lumpur Email: [email protected]

xii

5.2 NA Mohd Zain1, MH Ibrahim2 NY Abdul Rahman1

1Institute of Biological Science Faculty of Science University Malaya 50603 Kuala Lumpur Malaysia

2Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia Email: [email protected]

5.3 N.S. Nur Farahin1, Z. Muta Harah1 and B. Japar Sidik2

1Dept. of Aquaculture Faculty of Agriculture Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia

2Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia Email: [email protected]

5.4 I.M. Fakhrulddin1, B. Japar Sidik2, Z. Muta Harah3, D.R. Shiamala4 and K. Hayashizaki5

1Centre of Marine Science Universiti Putra Malaysia 71050 Port Dickson, Negeri Sembilan, Malaysia

2Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia

3Dept. of Aquaculture Faculty of Agriculture Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia

4Dept. of Crop Science Faculty of Agriculture and Food Sciences Universiti Putra Malaysia Bintulu Sarawak Campus, Sarawak

5School of Marine Biosciences Kitasato University Kitasato, Minami-ku, Sagamihara, Kanagawa, 228-8555, Japan Email: [email protected]

xiii

5.5 Munirah M. S. and Nur Ain Izzati M. Z.*

Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia Email: [email protected]

5.6 Zainap, H.1, Nur Ain Izzati, M. Z.1*, Mohd Hafiz, I.1 and Mohd Termizi Y2

1Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia

2Microbiology Department Faculty of Biotechnology and Biomolecular Science Universiti Putra Malaysia 43400 UPM Serdang, Selangor, Malaysia Email: [email protected]

5.7 Azlan Azizi Muhamad Nor1, Rozeita Laboh2, Raziyah Abdullah1, Nur Sulastri Jaffar 3, Muhammad Zamir Abdul Rasid 2, Norsyuhaida Ahmad Shafawi 4 and Muhamad Fahrul Razi Shamsudin 1.

1Crop and Soil Science Research Centre MARDI Kluang Station, P.O. Box 525, 86009, Kluang, Johor, Malaysia

2Crop and Soil Science Research Centre MARDI Serdang, P.O. Box 12301, 50774 Kuala Lumpur, Malaysia

3Horticulture Research Centre MARDI Serdang, P.O. Box 12301, 50774 Kuala Lumpur, Malaysia

4Horticulture Research Centre MARDI Kluang Station, P.O. Box 525, 86009, Kluang, Johor, Malaysia E-mail: [email protected]

5.8 Abderrahmane Zerkout*, Hishamuddin Omar, Mohd Hafiz Ibrahim, Muskhazli Mustafa

Dept. of Biology Faculty of Science Universiti Putra Malaysia 43400 Serdang, Selangor, Malaysia Email: [email protected]

xi

CHAPTER 1 INTRODUCTION Malaysia is blessed with the richness and uniqueness of its ecosystem. Continous discovery the biodiversity in Malaysia especially in Sabah and Sarawak is crucial for economic values such as in agricultural, ecotourism, adding the diversity and productivity to food crops. The continuous research on the diversity also important for conservation and sustainable purpose. Biodiversity and natural resources are interrelated disciplines which are biodiversity discover the natural resources that have potential to be explored and commercialized. Malaysia contains a repository of beneficial compounds. The land and sea ecosystems provide ample resources to be explored and determine its usage. This book covers the study of natural resources that are beneficial to human consumption. The nutritional values of a plant used in Sarawak called Piper umbellatum were studied. It contains a good source of carbohydrates and fiber. Despite the high anti-nutrient levels of oxalate and phytates, the leafy vegetable can be consumed by soaking and cooking it properly. The level of antioxidant activity from the seagrass Cymodocea rotundata from Negeri Sembilan, Sarawak, and Sabah was explored. Natural antioxidants from marine plants are considered cheaper, safer, and shows strong pharmacological effects to fight human diseases. High seawater nitrate increased the length of the leaf and this, in turn, has strong anti-oxidant activity. It is paramount that the humans value these natural resources and ensure their survival. Biology researchers can also help to find leads to further enhance the utilization of our flora and fauna to improve our lives. The steady increase in human population and the never ending quest for economic development has caused untold damage to the environment. Lack of understanding on the value of our environment causes some people exploited the nature, not knowing that they are destroying the environment more than what they get. Hence, it is very important to know about our environment and the interaction between living and non-living in order to have sustainable management. This book covers presented seven interesting ecological related papers, ranging from ecological distribution of fishes, conservation biology of Tropical Peat Swamp Forests (TPSFs), peat ecology influenced by fire on the physical characteristics, biological effects of Tributyltin Chloride (TBTCl) on juveniles of A. salina, ecotoxicology of lead and cadmium in the different parts of catfish, the ecology of A. mangium in relation to the soil morphological properties, and the ecological behaviors of tapirs.

Abiotic and biotic factors directly and indirectly influence the well being of all living organisms particularly animal where the response can be easily observed than plant. The bodily function such as respiration, heartbeat, digestion, hormonal secretion, and many others are likely affected by abiotic factors like water, light, radiation, temperature, humidity, atmosphere, and soil. The presence of other organisms such as animals, plant, fungi, bacteria, and viruses also may trigger positive or negative physiological response.

Plant physiology is the wide array in sub-discipline in botany. Study of the plant metabolisms responsible for the growth, development, and production of economic yield by crop plants (maize, wheat, and rice), herbs, and vegetables have received tremendous attention from plant physiologist and agriculturist. To meet the high demand for these kinds of plants, intergrate management and sustainable strategies is important. These efforts including maximizing the cultivation stage such as choosing the ideal soil, compost, mulching, and fertilizers. In this book, the ideal rate of potassium and nitrogen fertilizer to

1 produce high quality of Orthosiphon stamineus (Misai kucing) and Ipomea aquatica (kangkung) was discovered in order to fullfil the high domestic demand in Malaysia. Plant produces lipid, protein, sugars, and starch which is energy stored. These primary metabolites are used for plant cell metabolism and also for human and animal. Different plant species contain different type of these molecules, therefore discovery the sources of these molecules is crucial for human consumption. In Malaysia, cattail (Typha angustifolia), a kind of aquatic plants has been traditionally consumed by rural communities Its rhizome and pollen are edible and content about 66.02 % and 7.02 % starch respectively. Until to date, the morphological, physicochemical and functional characteristics of starch isolated from this plant is still limited. In this book, the starch characteristics of cattail (Typha angustifolia) was discovered. Halophila ovalis (R.Br) Hooker f. and Halophila beccarii Aschers are two fast-growing seagrasses in Malaysia. Culturing both seagrasses under laboratory conditions (artificial habitat) had the big effect on the growth, physiology and eventually will cause oligotrophic (low nutrient) of this species. In this book, the application of selected nutrients which are NPK, organic, sodium nitrite, ammonium chloride in order to reduce oligotrophic on seagrass also presented. Agricultural sector which is oil palm, banana, pineapple, and rice are threatened to various kinds of diseases caused by fungal, bacteria, and other microorganisms. Consequently, reduced the physiology, production, and quality. In addition, decrease the income, marketability, and the consumer’s confidence. Therefore, it is necessary to identify and to control the pathogen each crop. Fruit rot disease is one of the diseases in Malaysia, however, the basic information is still limited. In this book, the fundamental findings of Lasiodiplodia theobromate, L. pseudotheobromae, and Pseudofusicoccum adansoniae that causing fruit rot disease on commercial fruits (banana, pear, apple, guava, mandarins, musk lime and sapodilla) is presented. The application of chemical pesticides for controlling plant and fruit diseases found harmful to the environment, high cost and lower the diseases resistance for long-term usage. As alternative, the biological control or biocontrol is proposed. This book presented the potential antagonistic Trichoderma isolates against Fusarium oxysporum f. sp. lycopersici in vitro as an eco-friendly approach. Bacterial heart rot (BHR) disease caused by Erwinia chrysanthemi was reported decreased the pineapple production in Malaysia. So far, there is no exact solution to overcome this disease, therefore, epidemiology study was conducted to understand the spread and management strategies for Bacterial heart rot (BHR) disease Using plants as phytoremediation offer many advantages to mankind due to cheaper, easy to handle and eco-friendly. There is the need for identification on plant species that have potential as remediator the pollutants. In this book, the capability of Acacia auriculiformis as a photoremediator of lead pollution is presented.

2

CHAPTER 2 BIODIVERSITY AND NATURAL RESOURCES

2.1 Diversity Of Mixed Microalgae In Catfish Tanks Under Different Weather Conditions

Summary

Global warming is the pressing issue that caused risingearth temperature due to accumulation of greenhouse gases namely carbon dioxide (CO2) and other gasses. Studies have shown that microalgae can potentially fixed CO2 and produce other useful products. Sustainable aquaculture can contribute in minimizing the effect of global warming by utilizing mixed microalgae to fix CO2, produce O2, minimized water usage and promoting fish growth. Therefore, the aim of this study is to document diversity of microalgae in catfish tanks under three weather conditions (wet, mix and dry). This study was conducted in four tanks: two tanks covered (no light penetration) serve as control and another two tanks exposed to light serve as treatment group. Light intensity and temperature were recorded to reflect different weather conditions. Hybrid African catfish Clarias gariepinus 10 cm and 18.50 g initial size and weight were stocked in each tank. Microalgae samples were collected every two days. Water quality parameters measured by using HACH kit every three days. The mixed microalgae in catfish tank consist of 25 genera 36 species in 4 divisions (Chlorophyta, Chrysophyta, Cyanophyta and Euglenophyta). The common genus in all weathers conditions were Chlorella, Scenedesmus, and Monoraphidium. Shannon diversity index (H’) ranged from 0.65-1.82, with highest diversity in exposed tank under dry weather conditions. This study concluded that weather conditions influenced microalgae diversity and the most common microalgae genus in all weather conditions were Chlorella, Scenedesmus and Monoraphidium.

Keywords: Mixed Microalgae; Sustainable Aquaculture; Catfish; Different Weather Conditions

Introduction

Global warming is a phenomenon where the average earth temperatures steadily increase and the climate models predicted that the global temperature will rise from 1.1 to 6.4 degree Celsius in 2001-2100 (IPCC, 2007; 2014). The impacts of global warming are related to extreme weather or climate change, for example: droughts, floods, cyclones and wildfires (IPCC, 2014). Their impacts will be affected to many sectors, especially agricultural sector.This sector provide food sources for human and other organisms. Other countries around the world are aware about the impact of global warming and trying to solve the agricultural production by trying to improve food productions. Many aquaculture methods focus on fast growing species such as fish and shrimp but experienced some limitations such as the need to change water regularly to remove harmful fish excrement, high ammonia that can kill fish. The discharge water eventually contaminates the aquatic environment and caused extensive degradation to the aquatic environment and other aquatic organisms. These unsustainable aquaculture practicedirectly and indirectly produce negative impacts on food security and lead to the pollution issues in the future. At present, there is some developments for promoting sustainable aquaculture to supply protein source or known as “blue revolution” for addressing the climate change, water scarcity, food

3

security and environmental pollutions (Bush et al., 2013). One approach is to incorporate culture of microalgae in aquaculture, thereby solving many problems simultaneously without additional capital investment and economic sacrifice. Integration ofmicroalgae in fish culture is the dynamic approach to achieve more sustainable aquaculture to reduce waste, save water and minimizing contamination of aquatic environment. Moreover, by allowing naturally occurring microalgae existing in the cultural system will use the nutrient produced by uneaten feed and fish excrement in the fish tank, preventing ammonia buildup which can kill fish. This will allows the water to remain in the fish tank longer without replacing it. Microalgae are the promising organisms which are photosynthetic microorganisms that have ability to fixing CO2 emissions, accumulate lipids that suitable for biodiesel production, methane, hydrogen, and ethanol (Ugwu et al., 2008; Sudhakar et al., 2011; Naqqiuddin et al., 2014), and microalgae are high protein content (50% on dry weight) which are potentially good substitute for fishmeal (Backer, 2007). Moreover, microalgae in fish cages are shown to be improved the water quality as well as aqua crop by utilizing wastes from fish (Brune et al., 2004) and at the same time, fish will feed on microalgae that decrease the volume of fishmeal (Becker, 2007) and enhance the survival and growth rates in other aquatic animals like prawn (Ju et al., 2012). Since there is no publish report on what type of microalgae exist in catfish tank and in different weather condition, the study was conducted to microalgae diversity in catfish tanks under different weather conditions (wet, mix and dry weather).

Materials and methods

Location of study

The experiment was set up at warehouse of the Department of Biology, Faculty of Science, Universiti Putra Malaysia.

Experimental facilities

Four tanks with the similar dimension (length of 0.75 m; width of 0.90 m; depth of 0.50 m). Initial water was filled at 200 L per tanks. There were two tanks as replicate for treatment group which was exposed to the light and two tanks served as control which was covered and no light penetration. These tanks were placed under the rain shelter. The densities of catfishes were similar in all tanks. Twenty Clarias gariepinus fingerling about 10cm long and 18.50 g in weight were stocked in each tank with stocking density of 75/m3 (Dasuki et al., 2013). The aeration was supplied continously. The growth performance and each of the diets were fed to the fishes at 5 % body weight twice daily with starter feed high in protein for first 4 weeks and then grower feed until end of experiment (34%, 25% crude protein content respectively, Star Feed brand) at 09.00 am and 5 pm. for 82 days.

Environmental Parameters Measurement

Light intensity and environment temperature was measured initially by using light meter (Licor Li-250) and thermometer for the first 40 days and commenced withautomatic measurement every 10 minutes by using HOBO Pendant data logger UA-002-64. The HOBO Pendant data logger was placed outdoor near the fish tank area and the data retrieved at the end of the experiment.

Sampling and analytic methods

Water quality analysis was conducted every 2 days by taking the water sample bottles at 09.00 am. Tank water samples was analyzed for pH by using a pH meter (Thermo, USA). The concentration of ammonia, nitrate and phosphate was quantified by kit method (Hach,

4

USA). Microalgae samples were collected from culture media for every 2 days until end of experiment. Microalgae sampling were be done in duplicates for each treatment at late afternoon around 4.00-5.00 pm. Each 100 ml samples were collected in plastic bottle and adding two drops of glutaraldehyde solution for preservation.

Microalgae identification and species diversity

The microalgae suspension undisturbed for at least 48 hours to settle down the phytoplankton (Graham et al., 2008). Then the upper 50 ml water was removed gradually and the remaining used to observe algae using compound microscope. The mixed microalgae samples were observed and identified using compound microscope Leica Model (DM750) under 100X magnification. All species of algae were identified based on Van den Hoek et al. (1998) and Prescott (1970).

For microalgae species diversity were studies in biodiversity index (Shannon, 1948); Shannon diversity index, H’ = -Σ (pi) x ln (pi) Where, Σ = Summation Pi = Number of individuals of species i/total number of samples In = natural logarithm

Results and Discussion

Data of average temperature and intensity for each different weather conditions is presented in Table 1. There were clear pattern in term of temperature and light intensity for dry, mixed and wet weather. Temperature and light intensity were highest in dry weather conditions (37.30oC ±0.758, 779.62±69.089µmol m2s-1) followed by mixed weather (32.93±0.462oC, 418.31±27.020µmol m2s-1) and lowest in wet weather (30.11±0.182oC, 360.63±10.323µmol m2s-1).

Table 1: Average of environmental parameters under different weather condition

Parameter Dry Weather Wet Weather Mix Weather Temperature (oC) 37.30±0.758 30.11±0.182 32.93±0.462 Light intensity (µmol 779.62±69.089 360.63±10.323 418.31±27.020 m2s-1) *Each value is presented as Mean ± SE.

Based on Table 2, data showed that the water quality under three weather conditions (dry, wet and mix) were most likely caused by uneaten feed and fish wastes. Nitrogen originate from protein content in fish feed which was consumed by catfish and excreted as ammonia- nitrogen form (Yildiz et al., 2017).Phosphorus source were derived from bio-compound in fish body such as protein, carbohydrate and fish feed. From the table 2, higher level of nitrogen and phosphorus were found in control 1 and 2 (73.3±0.1, 553.967±2.985; 77.627± 0.806, 540.567±3.48, respectively) than treatment 1 and 2 because there were no microalgae in control tank to utilize nitrogen and phosphorus. In treatment exposed to light and with microalgae, the microalgae utilized nitrogen and phosphorus from fish excrement and uneaten feed, utilize the CO2 from fish respiration and produce O2 from photosynthesis (Brune et al., 2004). This finding showed that the presence of microalgae improved pond water quality as well as producing useful crop that can be used as animal feed (Perschbacher, 1995; Yi et al., 2001). The results also showed that higher level of nitrogen

5 and phosphorus were produced in dry than wet and mix weather probably due to fish feeding activities. Therefore, when water temperature is higher, fish consumed more feed, produce more metabolites, and produce more excrement and thus more organic matter decomposition (Beristain, 2005). Water temperature also affected the rate of decomposition (Yildiz et al., 2017).

Table 2: Average of water quality under different weather condition

Treat Dry Weather Wet Weather Mix Weather ment Total Total Tota Total Tota Total Nitro phosph l phosph l phospho gen orus Nitr orus Nitr rus (mg/ (mg/l) oge (mg/l) oge (mg/l) l) n n (mg (mg /l) /l) Contro 73.3± 553.967 59.0 96.433± 27.4 169.51± l 1 0.1 ± 2.985 67± 0.759 33± 3.436 0.33 0.54 0 4 Contro 77.62 540.567 57.0 95.467± 36.0 147.5± l 1 7± ± 3.48 57± 0.903 23± 1.930 0.806 0.08 0.11 2 1 Treat 45.56 175.4±1. 34.3 68.777± 45.5 135.15± ment 1 7± 497 ±0.2 0.565 77± 2.638 0.478 73 0.70 2 Treat 42.35 160.867 28.0 58.333± 43.9 126.563± ment 2 ± ± 1.173 93± 0.573 08± 0.755 0.642 0.19 0.67 1 7 * control : catfish (covered and no light penetration), Treatment : catfish with microalgae (exposed to the light) ** Each value is presented as Mean ± SE.

Diversity of microalgae

Total 25 genera and 4 divisions were identified from exposed tanks. Based on weather conditions there are 20 genera 27 species in dry weather, 15 genera 17 species in mix weather and 8 genera 13 species in wet weather. There were clear distinction on algal composition based on weather conditions. Chlorophyta was found in all three weather conditions. Chlorophyta was the most dominant comprising (75%) of the microalgal presence. The dominant genus groups were Chlorella, Scenedesmus, and Monoraphidium. Chrysophyta was the second abundant group (10%) represented by Navicula, Nitzschiaand Pinnularia. Cyanophyta and Euglenophyta were the third (8%) and fourth (5%), respectively. The dominant genus of Cyanophyta and Euglenophyta were Microcystisand Euglena, respectively. Unknown species comprised only 2% of the total microalgae sampled. Chlorella, Scenedesmus and Monoraphidium (Division Chlorophyta) were the dominant genus groups all weather conditions. Chlorella was always present in lighted tank and in all weather conditions probably due to small size with excellent surface/volume for better

6 nutrient uptake, fast growth and better tolerating light and temperature (Yang et al., 2008) thus allow them to dominate in such environments.

Diversity index (Table 3) was shown the highest data on exposed tanks (treatment 1 and 2) under dry weather conditions (H’= 1.82 and 1.74, respectively). It means that the dry atmosphere was the best condition for microalgae by increasing the diversity and biomass of mixed microalgae. Sahab et al. (2015) reported the weight biomass and optical density of microalgae were higher in sunny weather compared to wet and mixed weather. Dry weather conditions provide suitable environmental factors such as light intensity, temperature which were stimulate higher photosynthetic process for microalgae’s food production in nutrient rich environment. Chlorophyta were the dominant division in all weathers which are similar to report of Sahab et al. (2015). This could be attributed to smaller size, higher chlorophyll content for efficient photosynthesis and better adaptation to varying weather condition and water quality in fish tank.

Table 3: Diversity index under three weather conditions

Control 1 Control 2 Treatment 1 Treatment 2 D W M D W M D W M D W M r e i r e i r e i r e i y t x y t x y t x y t x Sha ------1 0 1 1 0 0 nn ...... on 8 7 0 7 6 9 div 2 2 1 4 5 2 ers ity ind ex, H’ * control: catfish (covered and no light penetration), Treatment : catfish with microalgae (exposed to the light) ** Shannon diversity index, H’ (Shannon, 1948).

Conclusion

There are 25 genera and 36 species of microalgae in catfish tanks in 4 divisions; Chlorophyta, Chrysophyta, Cyanophyta and Euglenophyta which consist of 20 genera 27 species in dry weather, 15 genera 17 species in mix weather and 8 genera 13 species in wet weather.The most common species in different weather conditions are Chlorella, Scenedesmus and Monoraphidium. The weather conditions have some influenced on microalgae diversity by providing the appropriate environmental factors such as light intensity, temperature which stimulate photosynthesis and cell growth. Moreover, integration of microalgae in fish culture is the promising process to achieve more sustainable aquaculture to reduce waste, improve water quality, save water and make benefit for catfish growing.

Acknowledgements

This research was funded by laboratory of Plant Physiology, Department of Biology, Faculty of Science, Universiti Putra Malaysia.

7

References

Becker, E. W. (2007). Microalgae as a source of protein. Biotechnology Advances, 25, 207‐210.

Beristain B.T. (2005). Organic matter decomposition in simulated aquaculture ponds. Fish Cultures and Fisheries Group, Department of Animal Science, Wageningen University. Retrieved from http://edepot.wur.nl/121646

Brune, D. E., Schwartz, G., Eversole, A. G., Collier, J. A., & Schwedler, T. E. (2004). Partitioned Aquaculture Systems. Southern Regional Aquaculture Center Publication No. 4500.

Bush, S.R., Belton, B., Hall, D., Vandergeest, P., Murray, F.J., Ponte, S., Oosterveer, P., Islam, M.S., Mol, A.P.J., Hatanaka, M., Kruijssen, F., Ha, T.T.T., Little, D.C., Kusumawati, R. (2013). Certify sustainable aquaculture. Science, 34, 1067-1068.

Dasuki, A., Auta, J., & Oniye, S. J. (2013). Effect of Stocking Density on Production of Clarias gariepinus (Tuegels) in Floating Bamboo Cages at Kubanni Reservior, Zaria, Nigeria, Bayero. Journal of Pure and Applied Sciences, 6, 112 –123.

IPCC. (2007). Climate Change. Synthesis Report. Contribution of Working Groups I, II and III to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change.

IPCC. (2014). Climate change 2014: Impacts, Adaptation And Vulnerability. Cambridge University Press, Cambridge.

Ju Z.Y., Deng, D.F. & Dominy, W. (2012). A defatted microalgae (Haematococcus pluvialis) meal as a protein ingredient to partially replace fishmeal in diets of Pacific white shrimp (Litopenaeus vannamei, Boone, 1931). Aquaculture, 354–355, 50–55.

Naqqiuddin, M.A., Nor, N.M., Omar, H., & Ismail, A. (2014). Development of simple floating photobioreactor design for mass culture of Arthrospira platensis in outdoor conditions: Effects of simple mixing variation. Journal of Algal Biomass Utilization, 5, 46- 58.

Perschbacher, P.W. (1995). Algal management in intensive channel catfish production trials. World Aquaculture, 26:65–68.

Prescott, G.W. (1970). How to know the freshwater algae. IOWA. Brown company Publishers.

Sahab, H.M., Naqiuddin, M. A., Azmai, M.N.A., Omar, H. &Ismail. (2015). The Productivity of microalgae with different fish stocking density in three weather conditions. Retrieved from https://www.researchgate.net/publication/282979021.

Sudhakar, K., Suresh, S., & Premalatha, M. (2011). An overview of CO2 mitigation using algae cultivation technology. International Journal of Chemical Research, 3, 110–117.

Ugwu, C.U., Aoyagi, H., & Uchiyama H. (2008). Photobioreactors for mass cultivation of algae. BioresourceTechnology, 99, 4021–4028.

Van den Hoek, C., Mann, D.G. & Jahns. (1998). Algae: An Introduction to phycology. Cambridge University Press, Cambridge.

8

Yang, Z., Wang, W., Liu, Y., Kong, F., Zhang, M., Shi, X., & Cao, H. (2008).Increased Growth of Chlorella pyrenoidosa (Chlorophyta) in Response to Substances from the Rotifer Brachionus calyciflorus. Journal of Freshwater Ecology, 23, 545- 552.

Yi, Y. & Lin, K.C. (2001). Integrated recycle system for catfish and tilapia culture. Eighteenth Annual Technical Report. Pond Dynamics/Aquaculture CRSP, Oregon State University, Corvallis, Oregon.

9

2.2 Physico-Chemical Properties and Amplification Of 16s rDNA from An Acidic Lake, Puchong

Summary

This study was conducted as one of the steps towards identifying cyanobacteria species by using 16S ribosomal DNA (rDNA) amplification in the North Lake of Hutan Simpan Ayer Hitam, Puchong. The sampling was carried out in two different seasons, wet and dry which was on November, 2016 (wet) and February, 2017 (dry). 16S ribosomal DNA (rDNA) was successfully amplified as the size of the DNA bands for both wet and dry seasons were recorded between 400 bp - 600 bp, in the expected range of ~460 bp. For the wet season, 7 out of 9 samples showed clear DNA banding patterns. The clear bands were observed in all samples except in S1R1 and S2R3. For the second sampling, which was in dry season, all the samples showed clear and thick bands which corresponded to ~460 bp. Pearson correlation analysis showed that Cyanobacteria, Calothrix sp., had a strong correlation with increased of nitrate (0.760) while the dominating species, Glenodinium sp. had a strong correlation with the increased of temperature (0.866), pH (0.866), dissolved oxygen (0.918), nitrate (0.813) and silica (0.737). PCR was used to amplify the targeted genes. Although the bands might not have identified cyanobacteria up to species level, this will be the first step towards metagenomics sequencing for that purpose. Further research includes purification, second PCR, DNA sequencing and analysis. The findings of this study showed that the 16S ribosomal RNA (rRNA) gene was a suitable molecular marker as the first step towards the identification of cyanobacteria.

Keywords: Cyanobacteria; Molecular Marker; 16S ribosomal RNA Gene; PCR

Introduction

National Policy on Biological Diversity 2016-2025 stated that Malaysia has of an immense variety of biological diversity such as the terrestrial plants as well as in aquatic ecosystems that needed to be conserved. Among the goals to be achieved by 2025 is to ensure and protect the key resilience species and genetic diversity. Biodiversity provides several significant services by stabilizing the environment with the diversity of organisms in ecosystems, provides the food and medicine to the nation and helps them to sustain their economies such as through the application of biotechnology, forestry, and tourism.

Algae are a group of photosynthetic oxygen producing organisms which range from unicellular to multicellular organisms that needed to be conserved as they provide many ecological and economic importances. Microalgae consist of green, brown and red algae while cyanobacteria or blue-green algae are considered as both algae and bacteria. Cyanobacteria are important as they are the primary source of oxygen in the atmosphere. Nowadays, algae are cultivated on a large scale as they are needed for industrial health products. They have been commercialized as the health food and nutritional supplement in industries for over 20 years (Borowitzka, 2013).

Most prokaryotes, algae, and bacteria are too small to be identified and seen with the naked eye. Numerous microorganisms are mobile and their positions can change continuously. Hence, taxonomic identification can be used to identify the species, genus or higher taxonomic level through morphological and molecular identification (Rimet, 2012). Morphological identification uses the various different features observed under a microscope while molecular analysis uses an assortment of gene regions for identification. Both methods can be used to identify the algae and bacteria species. Majority or about 99% of prokaryotes species could not be cultured in the laboratory. By

10 using molecular analysis, the majority of the bacteria species can be identified accurately.

Molecular method as a tool provides rapid detection and reliable bacterial and algal species identification. Ribosomal ribonucleic acid (rRNA) is a ribosomal protein that is important in living things for protein synthesis while ribosomal deoxyribonucleic acid (rDNA) is a DNA sequence that codes for ribosomal DNA. In a molecular identification, 16S rRNA is one of the molecular markers that can be used to detect the existence of blue-green algae and bacteria. It is highly conserved in prokaryotes. Besides, it is the most prominent target that has been used to classify bacteria at the molecular level for genus (Clarridge, 2004) and species classification (Conlan, Kong, & Segre, 2012).

Metagenomics are the study of direct genetic material of samples from the environment. These approaches aim for explaining the interactions of bacteria community and analyzing the whole genome for metabolic pathways (Tringe et al., 2005) instead of targeting specific gene. They are suitable for culture-independent microorganisms (Riesenfeld, Schloss & Handlesman, 2004). Culture independent technique rely on molecular analysis to study bacteria within their environment that includes the amplification of 16S rRNA gene, cloning, and running gel electrophoresis for differentiation (Adrados et al., 2014).

Based on the microscopic morphology, physiology and staining characteristics traditionally, prokaryotes have been identified as inadequate and inaccurate species, leading to the misidentification due to their similarities. There has been no research done on the identification of bacteria by using a molecular technique in the preserved forest North Lake of Hutan Simpan Ayer Hitam. Therefore, this study aimed to amplify 16S ribosomal RNA (rRNA) gene as the first step in identification of cyanobacteria species and to determine the effect of physico-chemical properties on the diversity of cyanobacteria and algae species by using Pearson Correlation Coefficient Analysis.

Materials and Methods

Sampling site and sample collection

The study was conducted in the North Lake of Hutan Simpan Ayer Hitam, Puchong which is located approximately 20 km from Universiti Putra Malaysia and it is situated near to the housing area which is Kinrara Hills. Triplicate water samples of 500 ml were collected from the lake during the wet and dry season. It was then brought to the laboratory for further analysis.

Physico-chemical analysis

The water samples were analyzed for physico-chemical analysis after sampling. Several physical properties such as conductivity and temperature were measured at each site by using YSI SCT parameter probe while pH and light intensity were measured using portable pH meter and light meter. Nutrients analyses which include ammonia, phosphate, silica, and nitrate-nitrogen were analyzed following APHA (1999) method.

DNA Extraction

For each replicate, the water samples (500 ml) were filtered using filtration pump and membrane filter paper with a pore size of 0.2 μm (Whatman ® filter No. 1). The extraction of DNA was carried out by using E.Z.N.A. ® Soil DNA Kit (Omega Bio-Tek,

11

Incorporation), as per manufacturer’s instruction. Then, tDNA was quantified using an Eppendorf Biospectrometer.

PCR Amplification

Polymerase chain reaction (PCR) was performed using a Thermal Cycler in order to amplify the DNA samples templates. The Primer sequences used for bacteria target the 16S V3 and V4 region (Klindworth et al., 2013). The primer sequences of the 16S Amplicon PCR Forward and Reverse are shown in Table 1. The PCR using 16S ribosomal RNA (rRNA) gene as a molecular marker was carried out as follows: initial denaturation at 95 °C for 3 min, 25 cycles of denaturation at 95 °C for 3 sec, annealing temperature ranging from 55 °C to 72 °C for 30 sec, and 5 min of final extension at 72°C. All PCR products were electrophoresed at 80 V for 40 min on a gel electrophoresis with 1000 bp DNA HyperLadder™ in the first lane that acts as a marker to detect the size of the DNA fragments.

Table 1: 16S rDNA Amplicon Primers used for PCR reaction.

Primer Primer sequence (5’-3’)

16S TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG Forward Primer 16S GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVG Reverse GGTATCTAATCC Primer

Data analysis

Pearson Correlation Coefficient Pearson correlation coefficient was run using SPSS window version 21 to determine the correlation between microalgae and bacteria species found in the North Lake of HSAHP with the physico-chemical properties.

Results and Discussion

In this study, the physico-chemical analysis (Table 2) revealed this lake was slightly acidic. Several factors could attribute to lowering of the pH level. According to Gharibreza & Ashraf (2016), a number of heavy metals dissolved in the water will lower the pH value. Hakanson (2005), reported that high concentration of carbon dioxide in the lake can also cause the lowering of the pH. The current water temperature was slightly high due to the high penetration of heat from the sun that ranged between 30.1°C - 30.8°C. Weather conditions and cloud cover has a huge influence on the water temperature. Higher water temperature may affect the biological and chemical reactions as well as the survival of organisms and life stages (Brian & Calculating, 2010). The current water conductivity in the North Lake increased in the second season due to the warmer conditions of the lake which was recorded between 12.7 µs/cm - 19.4 µs/cm. This was probably due to the high amount of total dissolved salts in the lake. The conductivity will increase as the water temperature increases (Langland & Cronin, 2003). The concentration of dissolved oxygen ranged from 3.2 mg/L - 8.0 mg/L. The current research showed the depletion of oxygen concentration during the wet season compared to the dry season. This was due to the many organisms such as planktons and bacteria that were present in this lake and used oxygen for their

12 respiration and decomposition of organic matter. During the wet season, the intensity was 498 µmol and 918 µmol during the the dry season. Both cyanobacteria and algae need light to conduct photosynthesis for their growth. However, cyanobacteria will grow at maximum rate if they were given high light intensity in comparison to other algae (Loogman, 1982).

Physico-chemical properties and correlation between phytoplankton

Table 2: Physico-chemical properties in North Lake of Hutan Simpan Ayer Hitam, Puchong.

Physico-chemical properties North Lake of HSAHP pH 4.4 - 5.6 Temperature 30.1 - 30.8°C Conductivity 12.7 - 19.4 µs/cm Dissolved Oxygen 3.2 - 8.0 mg/L Light intensity 498 - 918 µmol Ammonia 0.033 - 0.850 mg/L Phosphate 0.129 - 0.341 mg/L Silica 3.267 - 9.40 mg/L Nitrate 0.048 - 0.192 mg/L

Chemical analysis of the water in this lake revealed concentrations of ammonia (0.033 - 0.850 mg/L), phosphate (0.129 - 0.341 mg/L), silica (3.267 - 9.40 mg/L), and nitrate (0.048 - 0.192 mg/L. The current research reported that all of the nutrients concentration showed a high value except nitrate in comparison with the previous research (Ismail, 2016). Correlation between various physico-chemical properties and phytoplankton species in North Lake are shown in tables 3 and 4. For both seasons, dinoflagellate, Glenodinium sp., was found to be the dominant species. For wet season, Glenodinium sp. had a strong correlation with increased of temperature (0.866). A study conducted in Lake Tovel, Italy showed that high penetration of light into the water and availability of phosphorus have resulted to the higher diversity of Glenodinium sanguineum in the lake (Cantonati, Tardio, Tolotti & Corradini, 2003). For dry season, Pearson correlation coefficient analyses showed that Glenodinium sp. have a strong correlation with pH (0.866), dissolved oxygen (0.918), nitrate (0.813) and silica (0.737). High correlation with pH indicated that Glenodinium sp. increased with the increase of pH, in this case from an acidic condition to near neutral condition of the lake. Rapid dinoflagellates growth in the lake are possibly due to the ability of the dinoflagellates to assimilate and retain phosphorus.

Cyanobacteria, Calothrix sp., was present during the wet season and not the dry season is possibly because of the ability of the species to fix nitrogen. Pearson correlation coefficient analysis showed the Calothrix sp. had a strong correlation with increased of nitrate (0.760). Cyanobacteria assimilate nitrate, nitrite and ammonium for their growth (Flores & Herrero, 1994).

13

Table 3: Pearson correlation coefficients between cyanobacteria and microalgae species density with physico-chemical properties for wet season (Values in bold are different from 0 with a significant level of p<0.05 for*).

Variables pH T C DO PO4 NO3 Si NH4

Calothrix 1.00 -1.000 0.38 - 0.00 0.760 - - sp. 0 1 0.82 0 * 0.26 0.62 2 5 3 Glenodiniu - 0.866 - 0.42 - -0.983 - 0.14 m sp. 0.86 * 0.79 7 0.50 0.25 8 6 2 0 3

Table 4: Pearson correlation coefficients between cyanobacteria and microalgae species density with physico-chemical properties for dry season (Value in bold are different from 0 with a significant level p<0.05 for*).

Variables pH T C DO PO4 NO3 Si NH4

Glenodiniu 0.866 - - 0.918 - 0.813 0.737 - m sp. * 0.32 0.96 * 0.82 * * 0.10 7 1 1 7

Amplification of 16S rRNA

Figure 1 and 2 below showed the banding patterns of 16S ribosomal RNA (rRNA) gene for the identification of cyanobacteria in the North Lake of Hutan Simpan Ayer Hitam, Puchong by using 16S Amplicon Primers.

Figure 1: Banding patterns of 16S (rRNA) gene of cyanobacteria isolated from North Lake of (HSAHP) for the wet season. Lane 0: 1kb DNA ladder. Lane 1-9: SIRI, S1R2, S1R3, S2RI, S2R2, S2R3, S3RI, S3R2, S3R3.

14

Figure 2: Banding patterns of 16S (rRNA) gene of cyanobacteria isolated from North Lake of (HSAHP) for the dry season. Lane 0: 1kb DNA ladder. Lane 1-9: SIRI, S1R2, S1R3, S2RI, S2R2, S2R3, S3RI, S3R2, S3R3. Lane 10: Positive Control.

In this study for the wet season, from Lane 1 to 9, 7 out of 9 samples showed clear DNA banding patterns.The clear bands were observed in all sampling sites S1, S2, and S3. However there was no amplification in Lane 1 and 6 for Site 1 Replicate 1 (S1R1) and Site 2 Replicate 3 (S2R3). From the ladder, the size of the DNA bands was measured and ranged from 400 bp – 600 bp while the expected size was ~460 bp as (16S Metagenomic Sequencing Library Preparation). Hence, 16S ribosomal RNA (rRNA) was successfully amplified as the size of the DNA bands was in the expected range. There were no amplification in Lane 1 and 6 probably due to the low concentration of DNA template. According to Hellman & Fried (2007), if the concentration of DNA template was low, there was no band on agarose gel.

For the second sampling conducted in dry season, 16S primer was successfully amplified at the targeted DNA region, 16S ribosomal RNA (rRNA) gene. All of the samples from Lane 1-9 showed clear and thick bands. The size of the bands was recorded in the in the expected range between 400 bp – 600 bp as the expected size was ~460 bp as stated in the 16S Metagenomic Sequencing Library Preparation manual (Amplicon, Clean‐Up & Index, 2013). PCR was considered a success based on the PCR product band which has a size of about ~460 bp.

Conclusion

The study findings indicate that the North Lake of Hutan Simpan Ayer Hitam, Puchong as an acidic lake based on the physico-chemical analysis and the existence of microalgae and bacteria species in the lake. Molecular analysis revealed that 16S ribosomal (rRNA) was successfully amplified in the expected range of ~460 bp and can be used as a molecular marker for the identification of cyanobacteria in the lake. Therefore, further research should be carried out by doing the purification, second PCR, and sequencing of the DNA to determine the species identification in the North Lake.

15

Acknowledgements

The authors would like to acknowledge Universiti Putra Malaysia for funding for this project. This project was financially supported by UPM PUTRA IPM grant (9424300). We also would like to acknowledge the Faculty of Forestry, Universiti Putra Malaysia and Sultan Idris Shah Forestry Education Centre (SISFEC) for the permission to do a research in the North Lake of Hutan Simpan Ayer Hitam, Puchong.

References

Adrados, B. Á. R. B. A. R. A., Sánchez, O. L. G. A., Arias, C. A., Becares, E. L. O. Y., Garrido, L. A. U. R. A., Mas, J. O. R. D. I., & Morató, J. O. R. D. I. (2014). Microbial communities from different types of natural wastewater treatment systems: Vertical and horizontal flow constructed wetlands and biofilters. Water Research, 55, 304-312.

American Public Health Association. (1999). Water Environment Federation. Standard Methods for the Examination of Water and Wastewater, 19.

Amplicon, P. C. R., Clean‐Up, P. C. R., & Index, P. C. R. (2013). 16S Metagenomic Sequencing Library Preparation.

Borowitzka, M. A. (2013). Energy from microalgae: a short history. In Algae for Biofuels and Energy (pp. 1-15). Springer Netherlands.

Brian, O., & Calculating, N. S. F. (2010). The water quality index. BF Environmental Consultants.

Cantonati, M., Tardio, M., Tolotti, M., & Corradini, F. (2003). Blooms of the dinoflagellate Glenodinium sanguineum obtained during enclosure experiments in Lake Tovel (N. Italy). Journal of Limnology, 62(1), 79-87.

Clarridge, J. E. (2004). Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clinical Microbiology Reviews, 17(4), 840-862.

Conlan, S., Kong, H. H., & Segre, J. A. (2012). Species-level analysis of DNA sequence data from the NIH Human Microbiome Project. Plos One, 7(10), e47075.

Flores, E., & Herrero, A. (1994). Assimilatory nitrogen metabolism and its regulation. In The Molecular Biology of Cyanobacteria (pp. 487-517). Springer Netherlands.

Gharibreza, M., & Ashraf, M. A. (2016). Bera Lake water quality, past and present situation. Journal of Environmental Biology, 37(5), 1097.

Hakanson, L. (2005). The relationship between salinity, suspended particulate matter and water clarity in aquatic systems. In The Ecological Society of Japan. Retrieved from http://www.met.uu.se/miljoanalys/pdf/sal_spm_secchi.pdf

Hellman, L. M., & Fried, M. G. (2007). Electrophoretic mobility shift assay (EMSA) for detecting protein–nucleic acid interactions. Nature Protocols, 2(8), 1849-1861.

Langland, M., & Cronin, T. (2003). A summary report of sediment processes in Chesapeake Bay and watershed (No. 2003-4123).

16

Loogman, J. G. (1982). Influence of photoperiodicity on algal growth kinetics. Krips Repro Preparation.

Riesenfeld, C. S., Schloss, P. D., & Handelsman, J. (2004). Metagenomics: genomic analysis of microbial communities. Annu. Rev. Genet., 38, 525-552.

Rimet, F. (2012). Recent views on river pollution and diatoms. Hydrobiologia, 683(1), 1-24.

Tringe, S. G., Von Mering, C., Kobayashi, A., Salamov, A. A., Chen, K., Chang, H. W., & Bork, P. (2005). Comparative metagenomics of microbial communities. Science, 308(5721), 554-557.

17

2.3 Lichens and The Environment: Preliminary Study on Fraser’s Hill, Malaysia Summary

Summary Lichen is a symbiotic association between an alga and a fungus. Lichens are extremely sensitive and have the ability to respond to different levels of air pollution. Lichens are good bioindicators of air pollution because of their slow growth rate, their longevity and their ability to indicate the presence and the concentrations of the pollutants. In this research, a survey was done to find out the species diversity and the relationship with environmental factors in Fraser’s Hill. Lichens were collected from several sites in Fraser’s Hill such as Bishop’s Trail, Hemmant Trail, Abu Suradi Trail and also the Lodge. The methods used to identify the lichen specimens were macroscopic and microscopic examination, chemical colour tests and microcrystal tests. Among the lichen species identified were Usnea filipendula, Heterodermia leucomela, Parmotrema stuppeum, Cladonia coniocraea, Cladonia caespiticia and Leprocaulon arbuscula. Lichen diversity is usually influenced by the environment. The ability to absorb toxic materials such as sulphur dioxide (SO2) into the thallus make the lichens good indicators of air pollution. Most lichens disappear from urban centres where the levels of SO2 is dominant in the air. Lichens are also able to bind cadmium, lead, tin and zinc at higher concentrations compared to other plants including mosses. Not all lichens are sensitive to the air pollutants; some are highly tolerant to specific atmospheric pollutants. Based on preliminary collections, the presence of a pollution sensitive lichen Usnea filipenula in Fraser’s Hill may indicate that the air quality in Fraser’s Hill is good.

Keywords: Lichen; Environment; Bioindicator; Biomonitor; Fraser’s Hill; Malaysia

Introduction

Lichen is a combination of an alga and a fungus which live together in symbiotic association. The organism developed a specialized nutritional mode by a combination of the photobiont green algae and/or cyanobacteria that undergo photosynthesis thus provide food and the mycobionts forming a structure in which the fungal tissues provide a protection (Hawksworth, 1988). The lichen body develops but lacks the differentiation of leaves and stems unlike the other plant (Hale, 1979).

Lichens have been used as biomonitors and bioindicators to the air quality since 1866 (Nylander, 1866). They are excellent bioindicators of air pollution that have been used around the world. The methods that may be used include observing specific lichen thallus types (Batic & Mayrhofer, 1996), recording the lichen species diversity, investigating phyto- sociological relationships between different lichen species and their environmental conditions. The use of lichens as biomonitors and bioindicators to the environment is due to the sensitivity of the lichen to any change in the air and micro-climatic conditions such as air pollution and climate change (Wolseley & Aguirre-Hudson, 1997a). Species of lichen correspond to the environment condition. The distribution of lichens gives an indicator of the environment status of the area. This is due to the potential of lichens to take the toxic materials on the surface of the thallus such as sulphur dioxide (SO2), fluorine (F2) and nitrogen dioxide gas (NO2).

Fraser’s Hill is highland rainforest lies on the Titiwangsa Range. Formed by seven rolling hills with peaks ranging between 852 meters (m) above sea level (asl) to 1,456m asl. There are three major hill stations along the Titiwangsa range and Fraser’s Hill is the lowest and least disturbed of the three. Located 100 kilometers (km) from Kuala Lumpur, in the district

18 of Raub, Pahang, the Fraser’s Hill Town Board covers an area of approximately 2,829 hectares (ha).

Materials and Methods

Lichen samples were collected from Fraser’s Hill from four different trails such as Bishop’s Trail, Hemmant Trail, Abu Suradi Trail and also the Lodge. The Bishop Trail is 1.3km long with the elevation of 1246m asl is an area of critical conservation importance for flora. The Hemmant Trail is 1km long has an altitude of 1271m asl, Abu Suradi Trail is at 1309m asl and about 500m long. The Lodge was the last point of the collection with the height of 1283m.

All types of lichen were collected and the habitats were noted. The samples were temporarily placed in the paper envelopes with the notes of the name and location of collected specimen. Then the samples were subjected to the cleaning process. The dirt, mosses and leaves were removed from the lichens using forceps. Cleaned lichen specimens were placed into envelopes with and labelled with species collection number. Morphological examinations were conducted using a hand lens and dissecting set to determine the presence of the silia, cephellae, apothecium, rhizines and asexual reproduction. The size of thallus lobes, shape and colour of thallus were also examined. Color tests wer e done to identify the reaction of the lichen using: I (Iodine solution), K (potassium hydroxide, C/ “Clorox” (calcium hypochlorite) and the combination of KC. Under a dissecting microscope, the upper cortex was scraped away with a razor blade to expose the medulla, then touched with test solutions using a thin pipette or fine medicine dropper. The colour changes were observed after the reagent been applied. Microcrystal test was conducted where the fragments of lichen were first, extracted with acetone on a microscope slide. Two types of crystallizing agent were applied with a coverslip which were G.E. (glycerin, acetic acid: 3:1) and G.A.W. (glycerin, alcohol, water: 1:1:1). Then the slides were heated gently then allowed to cool. Crystal formation (shape, colour) was observed under the compound microscope.

Results and Discussion

A total of six species of lichen was found in Fraser’s Hill which were Usnea filipendula, Heterodermia leucomela, Parmotrema stuppeum, Cladonia coniocraea, Cladonia caespiticia and Leprocaulon arbuscula. Based on the results, two foliose and four fruticose lichen were recorded (Table 1). These macrolichens represent species diversity in Fraser’s Hill. Lichens were used as a biomonitor and bioindicator to indicate air quality in Fraser’s Hill. Evaluation of the lichen diversity and environmental conditions of the habitat could be made. For example, the presence of Usnea filipendula and Cladonia coniocraea could be used as an excellent marker to access the environmental condition of the habitat. Lichen species are excellent as biomonitoring species due to their various susceptibility to the air pollutants, their ability to respond to air pollutants at different levels, their slow growth rate, their longevity and their ability to indicate the presence and the concentrations of the pollutants (Van derWat & Forbes, 2015).

Lichens fully depend upon the environment for the nutrition. They directly obtain their nutrient supply through the surface absorption directly from the atmospheric precipitation (Kularatne, and de Freitas, 2013; Demiray, Yolcubal, Akyol, & Cobanoglu 2012; Wolterbeek, Sarmento, & Verburg, 2010; Garty, 2001). The structure of lichen itself contributes to the adsorption of various pollutants into the thallus. The lack of cuticle or stoma allowed different contaminants being absorbed over the entire surface of the organism (Hale, 1983). The absence of a cuticular wax layer on lichens enables them to absorb pollutants much

19 more easily than other higher plants. The presence of rhizines or cilia in certain species or well-developed cuticle means that they could accumulate the pollutant in the atmosphere into the thallus. Lichens that are sensitive would accumulate a lot of pollution and damage with the symptom of discolouring and cause the death of the photosynthetic part.

The factors that affect the diversity of lichens include the type of pollutant input, climate factors, such as temperature, drought and local environmental factors such as vegetation, quality of the substrate and altitude of the area and the mean annual rainfall and mean annual temperature (Giordani, 2007). Lichens are very sensitive to SO2. In urban areas, SO2 is the main limiting factors that contribute to the declining of lichens. Lichens are also sensitive to other low levels of many atmospheric pollutants including high levels of nitrogen oxides, fluorides or ozone alone or in various combinations. But sensitivity of lichens to SO2 is a factor in most classifications. According to LeBlanc, Rao and Comeau (1972), levels of sulphur dioxide as low as 13 µg/cubic meter (annual average) will cause fatality of some lichens. Although some lichens can tolerate high levels of sulphur dioxide over 300 µg/cubic meter (Trass, 1973; Laundon, 1967).

Limited amount of lichens were collected in Fraser’s Hill. Based on the selected lichens present, the presence of Usnea filipendula in Fraser’s Hill may indicate that the level of sulphur dioxide in the area is within the low range of 15 ppb or below. Report on the United States Forest Service - National Lichens & Air Quality Database and Clearinghouse had stated that the sensitivity of Usnea filipendula towards sulphur dioxide is in the low range of 5-15 ppb (Trass, 1973). Cladonia coniocraea presence also brings about the indication that Fraser’s Hill has a low SO2 level. Cladonia coniocraea has the sensitivity towards the SO2 at 13-20 ppb or absent at 20-29 ppb (LeBlanc et al., 1974). If the level of sulphur dioxide pollution is higher than the sensitivity standard of a lichen species, a greater amount of sulphur would accumulate in the lichens and cause greater damage to the thalli (Wadleigh, 2003). High concentrations of atmospheric SO2 and particulate material were responsible for the decline in lichen diversity.

Lichens range from highly sensitive to the highly tolerant Perlmutter, 2010). The most sensitive are fruticose and foliose while the tolerant one is crustose lichen. In a clean atmospheric condition areas, shrubby, hairy and leafy lichens were abundant while polluted areas, the most commonly found were crustose lichens. In Fraser’s Hill, fruticose and foliose lichens were found that indicate good quality air in the area.

20

Table 1: Lichen species identified and their descriptions

Species Descriptions 1. Parmotrema Thallus is foliose, thallus uniformly pale gray, without stuppeum maculae; lobes rounded and very broad (10 mm) with rather erect, ruffled edges having narrowly marginal soralia; cilia often sparse, lower surface black in the center. soredia is present on margins or surface of lobes, black cilia present on lobe margins, lower surface dark brown, upper cortex continuous, cilia longer, produced in the axils and on lobes tips. Cortex K+ yellow, medulla K+ red.

2. Heterodermia Thallus foliose, thallus light mineral grey, loosely leucomela attached, 2-8cm broad, lower surface white and cottony, cortex lacking, apothecia rare. Upper cortex is K+ yellow, medulla K+ yellow. Lobes are narrow and linear, lower surface is white, lobes broad, not finely branches. Cilia is long 2-4mm, lobes long and almost subfruticose, soralia on the lower surface or tips. Margins of lobes ciliate.

3. Usnea filipendula Thallus pendent, commonly 20 cm or more, with several slender main branches, 0.4 mm thick, and many side branches and fibrils, distinctly blackened at the base, surface abundantly papillate with rather tall, cylindrical papillae; abundance isidia arising in clusters or singly, thallus K- or K+ red.

4. Leprocaulon Thallus fruticose, thallus yellow green, growing on the arbuscula soil, thallus yellowish green, mineral to brownish gray or white, K+ yellow, thallus consisting of erect cup-shaped, branches solid or hollow, round or flattened; collected on trees and rocks more rarely free growing on soil, branches round in cross sections, branches densely covered with numerous lobulelike phyllocladia, surface of branche often tomentose, leprose-sorediate, thallus is densely powdery-leprose, floccose-tomentose granules or squamule-like structures superficially somewhat similar to phyllocladia of Stereocaulon, 0.3-1.0cm long. 5. Cladonia coniocraea Thallus squamulose, podetia whitish green, grow on soil, k-, thallus consist of pointed hollow podetia arise from basal squamules, podetia not cup-shaped, but forming pointed or blunt clubs, apothecia and pycnidia brown, surface of podetia without soredia, common on humus and rotting logs.

21

6. Cladonia caespiticia Thallus squamulose, thallus green, podetia very tiny, up to 0.1 cm tall, primary squamulose 0.3-0.5 cm long, incised, forming a dense mat, apothecia common, dark brown, common on the rotting logs and on mosses over rocks in shady woods.

Conclusion

Based on a preliminary collection of lichens on Fraser’s Hill, six macrolichens were identified. The lichen diversity and environmental factors in Fraser’s Hill are correlated. Lichens are excellent in biomonitoring of air quality due to their sensitivity to air pollutants. Lichens represent excellent markers in assessing the quality of the environment in Fraser’s Hill. Bioindicator lichens found in Fraser’s Hill such as Usnea filipendula and Cladonia coniocraea may indicate the air in Fraser’s Hill has low levels of SO2 as both species are sensitive towards SO2. The use of lichens as bioindicators of the air quality in Fraser’s Hill may indicate that the air quality in Fraser’s Hill is good.

References

Batic, F. & Mayrhofer, H. (1996). Bio-indication of air pollution by epiphytic lichens in forest decline studies in Slovenia. Phyton, 36, 85-90.

Demiray, A.D., Yolcubal, I., Akyol, N.H., & Cobanoglu, G., (2012). Biomonitoring of airborne metals using the lichen Xanthoria parietina in Kocaeli Province, Turkey. Ecological Indicators, 18, 632-64.

Garty, J., (2001). Biomonitoring atmospheric heavy metals with lichens: theory and application. Critical Reviews in Plant Sciences 20 (4), 309e371.

Giordani, P. (2007). Is the diversity of epiphytic lichens a reliable indicator of air pollution? A case study from Italy. Environmental Pollution, 146, 317-323.

Hale, M. E. (1979). How To Know The Lichens (Pictured Key Nature Series). McGraw-Hill Science. 2th Ed. p.1-2.

Hale, M. E. (1983). The Biology of Lichens. E. Arnold, London.

Hawksworth, D. L. (1988). The Variety of Fungal-Algal Symbioses, Their Evolutionary Significance, and the Nature of Lichens. Botanical Journal of the Linnean Society, 96, 3–20.

Kularatne, K.I.A. & de Freitas, C.R. (2013). Epiphytic lichens as biomonitors of airborne heavy metal pollution. Environmental and Experimental Botany, 88, 24-32.

Laundon, J. R. (1967). A study of the lichen flora of London. Lichenologist, 3:277-327.

22

LeBlanc, F., Rao, D. N., & Comeau, G. (1972). The epiphytic vegetation of Populus balsamifera and its significance as an air pollution indicator in Sudbury, Ontario. Canadian Journal of Botany, 50(3), 519-528.

Nylander, W. (1866). The Lichens of Luxembourg Garden. Bulletin of the Société Botanique de France, 13, 364-372.

Perlmutter, G.B., (2010). Bioassessing air pollution effects with epiphytic lichens in Raleigh, North Carolina, USA. Bryologist, 113, 39–50.

Trass, H. (1973). Lichen sensitivity to air pollution and index of poleotolerance (I.P.). Folia Cryptogamica Estonica, Tartu, 3, 19-22.

United States Forest Service-National Lichens & Air Quality Database and Clearinghouse. Air Pollution Sensitivity Ratings for Pacific Northwest Macrolichens. Retrieved from http://gis.nacse.org/lichenair/?page=sensitivity#Usnfil

Van derWat, L. & Forbes, P. B. C., (2015). Lichens as biomonitors for organic air pollutants. Trends in Analytical Chemistry, 64, 165–172. http://dx.doi.org/10.1016/j.trac.2014.09.006

Wadleigh, M. A., (2003). Lichens and atmospheric sulphur: what stable isotopes can tell us. Environmental Pollution, ICPEP-II Special Issue.

Wolseley, P. A., & Aguirre-Hudson, B. (1997). Fire in tropical dry forests: corticolous lichens as indicators of recent ecological changes in Thailand. Journal of Biogeography, 24, 345–362.

Wolterbeek, B., Sarmento, S., & Verburg, T., (2010). Is there a future for biomonitoring of elemental air pollution? A review focused on a larger-scaled health-related (epidemiological) context. Journal of Radioanalytical and Nuclear Chemistry, 286, 195-210.

23

2.4 Diversity of invertebrates in different agricultural of soils

Summary

Soil invertebrates play a major role in the soil ecosystem and are sensitive to the alterations in soil conditions. This attributes can serve as valuable indicators of soil disturbances. Seri Serdang is considered as one of the premier agriculture research areas in Malaysia but very little is known about soil fauna. The main objective of this work was to compare the morphospace composition, diversity and density of soil invertebrates between cultivated field (Ladang 2) and uncultivated field (adjacent of Department of Biology) UPM main campus using pitfall traps and tullgren funnel as sampling method. Invertebrates were preserved in 70% ethanol and identified using soil invertebrate morphological classification. The species composition and diversity in each sampling location were different. A total of 616 individuals were collected, belonging to 24 different morphospecies. A total of 10 morphospecies were collected in the cultivated Ladang 2, while 14 morphospecies were collected in the uncultivated area adjacent to Department of Biology. Out of 14 morphospecies found in this area, 4 (16.7%) were exclusive to this environment. Order Acarina, order Aranea and class Insecta were the dominant groups in site 1, but order Acarina, subclass Collembola, order Isopoda and class Insecta in site 2. The diversity was higher in the uncultivated field (H = 2.032) than in the cultivated field (H = 1.721). This study showed to maintain natural habitat with reasons the effects of agricultural practices on soil invertebrate diversity and suggest practice management in soil ecosystems. So, one of important factors of healthy ecosystem services is local biodiversity of the area.

Keywords: Soil invertebrates; Acarina; Aranea; Collembola; Isopoda; Insecta

Introduction

Soil is one of the most heterogeneous environmental systems on the earth. It plays an indispensable role in the biosphere i.e. it governs plant productivity and allows the degradation of organic matter and nutrient cycles (Eisenbeis, 2006). Soil invertebrates are an important part of the soil components which interact with various biotic and abiotic environment of the soil (Franklin et al., 2005). The ability of an ecosystem to resist extreme perturbations and stress conditions is partly dependent on the diversity within the system (Fakruddin and Mannan, 2013). There is a wide variety of roles played by invertebrates in the soil system (i.e. the breaking organic matter, nutrient cycling and bioturbation). Additionally, the invertebrates are plentiful, relatively easy to sample and has the ability to respond quickly to soil disturbance (Santorufo et al., 2012). Among the micro invertebrates, nematodes, collembols, and mites are popular biological indices candidates for its role in the core soil ecological processes which include nutrient cycling and decomposition (Blakely et al., 2002). Beneficial organisms in the soil also plays important role in cleaning and monitoring environmental change because it offers objective measurement that integrate the physical, chemical, and biological factors and indicate the impact of chemical pollution in the soil (Blakely et al., 2002). In agriculture, human activities such as tilling, planting, fertilizing, applying pesticide and herbicide, salinization of soil often produce negative impact to the soil as much as the climate change. As invertebrates are sensitive to alterations in soil conditions, they can be considered valuable indicators of soil disturbances (Santorufo et al., 2012). Additionally, various agricultural activities, construction, and transportation also adversely affect the functions of the soil which leads to changes in many of the processes that can weaken the ecosystem (Fragoso et al., 1997; Santorufo et al., 2012). Both the increase in human activities and changes in environmental conditions caused by global climate change directly or indirectly influenced the local communities of

24 soil invertebrates (Nielsen and King, 2015). Farm management practice may also affect the diversity of soil invertebrates and its function through direct (litter quality) and indirect impacts (microhabitats and environmental factors such as pH, moisture in the soil and soil fertility (Kinasih et al., 2016).

In soil studies, the insurance hypothesis refers to soil biodiversity as an insurance against ecosystem malfunctioning under stress or disturbance and gradually receiving much attention (Loreau, 2001). As part of the soil management, it is important relate the soil activity with soil fauna composition and biodiversity. Therefore there is a need greater knowledge and understanding of the current diversity and distribution of soil biodiversity. It is also to serve as to the valuation of the fundamental role of biodiversity value in the soil. As part of the soil management exercise, there is lack of information on soil fauna composition, diversity, its role in soil health and the impact of soil activities on them (Fakruddin and Mannan, 2013). Understanding the soil fauna and the factors affecting soil fauna eventually complement the existing knowledge on soil physico-chemical characteristic of soil leading to better soil management and hopefully contribute to better agriculture productivity. Therefore, the objective of this study is to compare the morphospace composition, diversity and density of soil invertebrates in Ladang 2 (agriculture experimental plot) and patches of land (unused land) near the Department of Biology, Faculty of Science, UPM.

Methods and materials

Study area

This work was carried out in May - June, 2017 on two different areas in UPM main campus of Universiti Putra Malaysia. The first study area is Ladang 2 (3°0´31”25” N 101°42´13,50” E), the second is behind Dept. of Biology, Faculty of Science (3°000´04.5” N 101°42´16.0” E). This area is nature without human intervention.

Procedures

Two methods were employed to collect samples used: Pitfall traps for invertebrates’ surface soil (Maftu’ah et al., 2005) and Berlese funnels (Owen, 1982) to separate micro invertebrates from soil samples. The large invertebrates were then sorted manually in the laboratory, Pitfall traps which was made up of a 10.5 cm length and 7.5 cm diameter plastic receptacle, with holes on the soil level. Each trap contains liquid with few drops of detergent and left for about 26 hours.

In each sampling location, the traps were marks for easy identification and samples from 10 traps were collected. Distance between trap was 2 meters. All invertebrates’ samples were collected and preserved in 70% ethanol. Each invertebrate sample was observed under dissecting microscope at 30-40 magnification and photograph taken for future reference. Key for identification followed Triplehorn & Johnson 2004. Since very little documentation available on local soil invertebrates, identification is based on lowest category, using the ecological pattern (morphologically based classification), and categorize them as adult or immature. The abundance in each sample was recorded by counting the total number for each taxon or morphotype.

25

Data analysis

The species diversity index was calculated for comparison diversity between sampling areas. The variety was species represented by the Shannon Diversity Index (Ludwig and Reynolds 1988). Data is entered into the spreadsheet that can be setup to automatically calculate the diversity index: 푠 Shannon Index (H) = − ∑푖=1 푝푖 푙푛푝푖 1 Dominance indicators is the Simpson index: Simpson Index (D) = 푠 2 ∑푖=1 푝 2∗퐶 Similarity index:Sorenson’s index(QS)= 퐴+퐵

Results

Collected 616 individuals were during sampling period. Among two study areas, site 2 had the highest abundance of individuals (311 individuals, 50.5%), followed by site 1 (305 individuals, 49.5%). Statistical test showed that mean abundance of soil invertebrates at site 2 was significantly higher than site 1(Table1) and according of diversity index site 2 more diverse (H = 2.032) than site 1 (H = 1.721). the Similarity index, between two site was (QS= 0.0455) Normality sampling area as soil invertebrate population at each sampling area dominated by some taxa, like Acarins, Aranes and insects were the dominant groups in site 1, but Acarins, Collembols, isopods and insects in site 2. Furthermore, (Table1), shows the abundance of different individuals of soil invertebrates that are not present at the first site (Table 1) as Pseudoscorpions, Isopods, Gasteropods and Porataris. The different patterns were observed on the number of morphospecies and the soil invertebrate categories (Figure 1).

SITE1 SITE2

120 100 80 60 40 20

0 NUMBER OF MORPHOSPECIES OF NUMBER

SOIL FAUNA CATEGORIES

Figure 1: Abundance And Diversity Of Soil Invertebrates Per Sampling Area

26

Table 1: Number Of Individual, Fauna Categories And Diversity Index of Two Sites

Taxon No. morphospecies No. morphospecies Ladang 2 Dept. of Biology, Faculty of Science Insect larva 23 6 Annelida 8 4 Nematoda 24 7 Collembola 7 49 Myriapoda 4 10 Acarina 80 61 Aranea 49 6 Insects 105 71 Pseudoscorpiona 0 3 Taradigada 1 2 Isopoda 0 67 Porataria 0 2 Gasteropoda 0 15 Unknown 4 8 Total 305 311 Shannon Index H=1.721 H=-2.0328 Simpson Index D=0.009 D=5.9724 Sorenson’s index QS=0.0455

Discussion

Malaysia is one of the tropics where local soil fauna is less valued and suffer some human influence and thus need more scientific information that can allow political decisions to be made related conservation. This study showed human activities lead to a deterioration in a reduction in the abundance of soil fauna, where stress-tolerant species prevail, and scarce varieties fall in abundance or disappearance, a form of gradually lost control with intensification of agriculture (Jeffery et al., 2010; Cristina 2012; Kumar 1997; Eisenbeis 2006). Both site exhibit difference in diversity and distribution of soil fauna which possibly attributed to the land use and soil type, diversity is greatly affected when natural systems are modified. In general, the number of species decreases in the anthropic systems (Fragoso et al., 1997; Cardoso et al., 2013). Table 1 suggested that land use and soil type can influence fauna number and diversity. Ladang 2 is the experimental plot which experienced ploughing from time to time, application of herbicide and pesticide whereas soli beside Department of Biology is virtually undisturbed, free from agricultural activities such as soil tilling, herbicide and pesticide (Mishra et al., 2001; Ubuoh et al., 2012; Cristina 2012) that land disturbance and the use of herbicide and pesticide are affecting diversity. Despite the clarity of the disorder in the first site, the study showed dominance in some species as Acarins and insects. However, if a soil environment becomes extreme, mesofaunal (as Acari, some insects smaller groups, and smaller Araneida) become more and more dominant, the Acarins (mites) are an extremely diverse group of arachnids which have successfully adapted to a wide range of habitats (Blakely et al., 2002; Eisenbeis, 2006).

The effects on arthropod communities are complex and difficult to analyze because different taxonomic groups are affected and interact differently (Bird et al., 2002; Cristina

27

2012). For these reasons, it is necessary to identify agricultural systems that allow the integration of production objectives, environmentally friendly management practices, soil protection and biodiversity to prevent degradation of fauna communities in soil ecosystems Conclusion

This basic study provides record of soil fauna in disturbed and undisturbed soil around UPM campus. These data can be used as baseline information for future study. It is imperative to preserve the soil and with an increasing emphasis on the restoration of degraded areas through the use of soil fauna indicator.

Acknowledgements

This research was supported by the Department of Biology, Faculty of Science Universiti Putra Malaysia.

References

Bird, S., Robert, N C., Crossley, D A., (2000) Impacts of silvicultural practices on soil and litter arthropod diversity in a Texas pine plantation. Forest Ecol. Manag. 131, 65-80.

Blakely, J. K., Neher, D.A., Spongberg, A. L., (2002). Soil invertebrate and microbial communities, and decomposition as indicators of polycyclic aromatic hydrocarbon contamination. Applied Soil Ecology. 21, 71–88.

Cardoso, E J. B, Vasconcellos, R. L. F, Bini, D, Miyauchi, M. Y. H, Santos, C. A, Alves, P. R. L, Paula, A. M, Nakatani, A. S., Pereira, J. M and Nogueira, M. A.,(2013). Soil health: looking for suitable indicators. What should be considered to assess the effects of use and management on soil health? Scientia Agricola, 70(4), 274-289.

Cristina Menta., (2012). Soil Fauna Diversity - Function, Soil Degradation, Biological Indices, Soil Restoration, Biodiversity Conservation and Utilization in a Diverse World, Dr. Gbolagade Akeem Lameed (Ed.), InTech, DOI: 10.5772/51091. Available from: https://www.intechopen.com/books/biodiversity-conservation-and-utilization-in-a- diverse-world/soil-fauna-diversity-function-soil-degradation-biological-indices-soil- restoration.

Eisenbeis, G., (2006). Biology of Soil Invertebrates. Springer-Verlag Berlin Heidelberg.

Fakruddin, M. d. and Mannan, K. S., (2013). Methods for Analyzing Diversity of Microbial Communities in Natural Environments. Ceylon Journal of Science (Bio. Sci.) 42, 19-33.

Fragoso, C., Brown, G.G., Patren, J.C., Blanchart, E., Lavelle, P., Pashanasi, B. Senapati B., Kuma,r T., (1997). Agricultural intensification, soil biodiversity and agroecosystem function in the tropics" the role of earthworms. Applied Soil Ecology, 6, 17-35.

Jeffery, S., Gardi, C., Jones, A., Montanarella, L., Marmo, L., Miko, L., Ritz, K., Peres ,G., Römbke, J., van der Putten, WH., editors., (2010). European Atlas of Soil Biodiversity. Publications Office of the European Union, Luxembourg.

Kinasih, I., Cahyanto, T., Widiana, A., Kurnia, D. N. I., Julita, U., Putra, R. E., (2016). Soil invertebrate diversity in coffee-pine agroforestry system at Sumedang, West Java. Bio Diversit., 17(2), 473-478.

28

Loreau, M., Naeem, S., Inchausti, P., Bengtsson, J., Grime, J.P.,Hector, A. et al., (2001). Biodiversity and ecosystem functioning: current knowledge and future challenges. Science, 294, 804–808.

Ludwig, J.A., Reynolds, J.F., (1988). Statistical ecology: A primer on methods and computing. Wiley, New York.

Maftu’ah, E., Alwi, M., Willis, M. (2005). Potential of soil macrofauna as bioindicator of peat land quality. Bioscientiae, 2 (1), 1-14.

Mishra, P.C., (2001). Soil Population and Organisms. Ashish Publishing House, PunjabiBagh, New Delhi, 3-34.

Nielsen, U. N., and King, C. K., (2015). Abundance and diversity of soil invertebrates in the Windmill Islands region, East Antarctica. Polar Biol. ©Springer-Verlag Berlin Heidelberg 2015 doi:10.1007/s00300-015-1703-2.

Owen Bishop., (1982). Adventures small animals. John Murray (Publishers) Ltd: 60.

Santorufo, L., Van Gestel, C. A.M., Rocco, A., Maisto, G., Julia. (2012). Soil invertebrates as bio indicators of urban soil quality. Environmental Pollution, 161, 57-63.

Triplehorn, C.A., & Johnson, N.F., (2004). (Seventh Edition) An Introduction to the Study of Insects. Thomson Brooks/Cole, Belmont, CA. 864.

Ubuoh, E. A., Akhionbare, S. M.O., and Akhionbare, E. W., (2012). Effects of Pesticide Application on Soil Microbial Spectrum: Case Study- Fecolart Demonstration Farm, Owerri- West, Imo State, Nigeria. International Journal Of Multidisciplinary Sciences And Engineering, 3, 2.

Yildiz, H.Y., Robaina, L., Pirhonen, J., Mente, E., Domínguez, D., & Parisi, G. (2017). Fish Welfare in Aquaponic Systems: Its Relation to Water Quality with an Emphasis on Feed and Faeces-A Review. Water, 9, 1-17.

29

2.5 Anuran Species Diversity And Distribution At Compartment 12 In Ayer Hitam Forest Reserve, Puchong, Selangor Summary This study investigated anuran species diversity and distribution in Compartment 12 of Ayer Hitam Forest Reserve, Puchong, Selangor. Sampling was carried out from October 2016 to February 2017 and was conducted twice a month investing five to six person of sampling effort. Nine of 300 m nocturnal transect lines have been used in this inventory of frogs at three different areas; trails, streams and swampy. A total of 64 individuals comprising of 17 species from five families were recorded. The two most abundant species were Occidozyga laevis and Pulchrana laterimaculata. Three species, namely Amnirana nicobariensis, Kalophrynus pleurostigma, and Pulchrana laterimaculata were the newly added species in Ayer Hitam Forest Reserve, Puchong. The Shannon-Wiener Diversity Index (H’) and Evenness (E) showed high values of 2.658 and 0.938. The presence of clean water species such as Chalcorana labialis showed that the habitat at Compartment 12 of Ayer Hitam Forest Reserve was low in anthropogenic disturbances. Further research is needed by increasing forest coverage for the anuran diversity study as a reference for future study. Keywords: Anuran; Ayer Hitam Forest Reserve; inventory; diversity; distribution Introduction Anura is currently the most widely represented group of amphibians comprising of tailless frogs and toads possessing limbs with soft moist skin without external scales. Anurans are largely distributed in the tropical habitat, and Peninsular Malaysia is known as one of the regions with high amphibian fauna diversity and endemism due its complex and rugged topography (Berry, 1975; Duellman & Trueb, 1986; Grismer et al., 2010). According to Onn et al. (2010), about 107 amphibians (104 anurans; three caecilians) were recorded in Peninsular Malaysia representing six families of anurans, namely Bufonidae, Megophryidae, Microhylidae, Ranidae and Rhacophoridae followed by Ichthyophiidae of caecilian family. In Borneo, there are 138 species of amphibians comprising of only anurans, (Inger & Tan, 1996) represented by eight families, namely Bombinatoridae, Bufonidae, Ceratobatrachidae, Dicroglossidae, Megophryidae, Microhylidae, Ranidae and Rhacophoridae. Ayer Hitam Forest Reserve, Puchong is a host to a variety of amphibians. It houses six Anuran families, namely Megophrydae (Litter frogs), Bufonidae (Toads), Microhylidae (Narrow-mouthed frogs), Ranidae (True frogs), Dicroglossidae (True frogs) and Rhacophoridae (Afro-asian Tree frogs) (Paiman & Yaman, 2007). The forest reserve is located in the centre of a rapidly developing urban region, a natural treasure under threat as such development is seen as a potential deprivation to the flora and fauna.

A study carried out in Ayer Hitam Forest Reserve, Puchong showed that despite long active urbanisation and logging activities surrounding the forest before, this forest is still rich in wildlife (Mohd & Yaman, 2001). However, the exact number of wildlife recorded are still scarce.

A previous study in anurans back in 1999, conducted by Jambari et al., showed 13 species collected in Ayer Hitam Forest Reserve, Puchong. A recent research in 2016 by Muhammad Faris from October 2015 to January 2016 revealed 24 species of anurans recorded only in Compartment 15 of Ayer Hitam Forest Reserve, Puchong (Muhammad Faris, 2016). The research inventory checklist listed about 33 species in Ayer Hitam Forest Reserve, Puchong. This paper provides information on the diversity and

30 distribution of anuran in Compartment 12 of Ayer Hitam Forest Reserve, Puchong as a reference for future study.

Materials and Methods Study Site Compartment 12 of Ayer Hitam Forest Reserve is located at 03° 00’ 792’’ N, 100° 38’ 821’’ E. The study was conducted from October 2016 to February 2017. Compartment 12 have a landmass and productive land area of 220 ha and 219 ha. This compartment was once faced with logging activities, and several rehabilitation programs have been undertaken during the period of 1936 to 1951 for the purpose of improving the availability of forest resources (Paiman & Amat, 2007).

This study area is a lowland dipterocarp forest, and is a habitat for a great diversity of amphibian fauna. The topography in general, is rugged and hilly with a sloping slant of 10- 20%. The Rasau River of south and Bohol River of north is the primary source of irrigation for this forest (Paiman & Amat, 2007). In a recent interview with the Forestry student COMPARTMENT 12 (Nadirah, 2017), the plant species that dominates both these compartments are Dipterocarpus spp. (Keruing), Agrostistachys spp. (Jenjulong), Pandanus spp. (Pandan), Calameae spp. (Rotan), and Eugeissona spp. (Bertam).

Figure 1: Location of Compartment 12, Ayer Hitam Forest Reserve, Puchong, Selangor. Source: Google Maps (2017)

According to an interview with forest officer (Siti Zurina, 2017) the compartment was said to be less disturbed and have been used by the Orang Asli of the Temuan tribe in search for their needs for survival.

Study Area

The three different study areas where the study was carried out were the walking trails, streams and swampy area. Each area was studied three times each which totals for nine times per compartment.

31

The dense vegetation of the forest floor and clear water of the streams were a condusive place for certain species of anurans to survive. Less to no anthropogenic activities occur in both compartments (Siti Zurina, 2017).

Sampling Method

Nine nocturnal 300 m transect lines were used to survey anuran species in Compartment 12. Each site was surveyed on Friday and Saturday for four months of sampling period starting from 29th October 2016 to 25th February 2017. Five to six people participated in this sampling activity. One transect was surveyed from 2000 until 0000 each night with the use of handheld torchlight along 300 m long transects within each study area. Transects were walked slowly to search for anurans to ensure replication of each sites.

Upon capturing, the anurans were placed in individual plastic containers and were sent to the laboratory for further identification. Anurans were identified by referring to “The Amphibian Fauna in Peninsular Malaysia (Berry 1975)” and an online database “Amphibians and Reptiles of Peninsular Malaysia” for every species identification process. Every details of the captured anurans were recorded carefully for accurate identification and data collection. Before releasing captured anurans back in the original location, cutex was stained on the animal’s tibia to avoid redundancy.

Statistical Analysis

Shannon Diversity Indices (H’= Shannon Diversity Index, S= total number of species in the Family No Species Common name Numb er of indivi duals Bufonidae 1 Ingerophrynus parvus Dwarf Stream Toad 2 Dicroglossi 2 Fejervarya limnocharis Asian Grass Frog 5 dae 3 Fejervarya cancrivora Crab-eating Frog 3 4 Limnonectes ibanorum Rough-backed River Frog 3 5 Limnonectes malesianus Lesser Swamp Frog 4 6 Limnonectes plicatellus Rhinoceros’s Frog 3 7 Occidozyga laevis Puddle Frog 7 Megophryi 8 Leptobrachium Spotted Litter Frog 6 dae hendricksoni 9 Leptobrachium ingeri Inger’s Black-eyed Litter 2 Frog Microhylid 1 Kalophrynus palmatissimus Lowland Grainy Frog 4 ae 0 1 Kalophrynus pleurostigma Black-spotted Sticky Frog 3 1 1 Microhyla mantheyi Manthey’s Narrow- 1 2 mouthed Frog Ranidae 1 Amnirana nicobariensis Nicobar Frog 3 3 1 Chalcorana labialis White-lipped Frog 4 4 1 Pulchrana glandulosa Rough-sided Frog 2 5 1 Pulchrana laterimaculata Lesser Rough-sided Frog 11 6 1 Pulchrana baramica32 Brown Marsh Frog 1 7 TOTAL 64 community (richness)) was used in this study. This measurement takes into account the species richness and proportion of each species within local species community. It is calculated by using Multi-Variate Statistical Package (MVSP) Version 3.22 software to run the analysis.

Results and Discussion Table 1: List of species and individuals collected

A total of 64 anurans comprising of 17 species from five families were found at Compartment 12, Ayer Hitam Forest Reserve, Puchong (Table 1). From this number, six species (9.38%) belonged to the family Dicroglossidae, five species (7.81%) from the family Ranidae, three species (4.69%) from the family Microhylidae, two species (3.13%) from the family Megophryidae and one species (1.56%) from the family Bufonidae. Pulchrana laterimaculata (11 individuals) was the most abundant species followed by Occidozyga laevis (seven individuals).

Table 1: List of species and individuals collected Table 2 shows the number of frog species recorded based on three different locations (trails, streams, and swampy) in Compartment 12. The highest number of frog species captured was at the stream with 26 individuals followed by the trail with 20 individuals, and 18 individuals at the swampy area.

No Scientific name Trail Stream Swampy T T T S S S S S S 1 2 3 T T T W W W 1 2 3 1 2 3 1 Amnirana 0 0 0 0 3 0 0 0 0 nicobariensis 2 Chalcorana labialis 0 0 0 1 1 0 0 1 1 3 Fejervarya cancrivora 1 2 0 0 0 0 0 0 0 4 Fejervarya 0 1 0 4 0 0 0 0 0 limnocharis 5 Ingerophrynus parvus 2 0 0 0 0 0 0 0 0 6 Kalophrynus 1 1 1 0 0 1 0 0 0 palmatissimus 7 Kalophrynus 1 1 1 0 0 0 0 0 0 pleurostigma 8 Leptobrachium 2 0 0 2 0 2 0 0 0 hendricksoni 9 Leptobrachium ingeri 0 0 0 0 0 1 1 0 0 1 Limnonectes 1 0 0 2 0 0 0 0 0 0 ibanorum 1 Limnonectes 0 0 0 0 0 4 0 0 0 1 malesianus 1 Limnonectes 0 0 0 0 0 3 0 0 0 2 plicatellus

33

1 Microhyla mantheyi 0 0 0 0 0 0 0 1 0 3 1 Occidozyga laevis 4 0 0 1 0 0 2 0 0 4 1 Pulchrana baramica 0 0 0 0 0 0 1 0 0 5 1 Pulchrana glandulosa 0 1 0 0 1 0 0 0 0 6 1 Pulchrana 0 0 0 0 0 0 9 1 1 7 laterimaculata TOTAL 1 6 2 1 5 1 1 3 2 2 0 1 3 20 26 18 Table 2: The number of anurans recorded according to three different

The highest species recorded at the trail was Occidozyga laevis with four individuals. This species was found in group in a small puddle produced after heavy rain, where the heads were half-submerged in the puddle. The three species (four individuals) that were recorded at a higher location of the stream were Fejervarya limnocharis, Leptobrachium hendricksoni, and Limnonectes malesianus. These species were found individually at the sand bank and on the forest litter 1m away from the stream bank. Pulchrana laterimaculata, with 11 recorded individuals was the most abundant species at the swampy area. This species was predominantly an inhabitant of peat swamp (IUCN, 2017), a location hard to be accessed, but it can be recognized through its unique call “Yip, Yip”. This research showed that frogs needed water sources not only to keep their skin moist but to also influence the presence of abundant frog species for gaseous exchange (Duellman & Trueb, 1994) and in providing a conducive place to live and breed as well (Ibrahim, Ektella, Mashhor & Shariza, 2002). The Shannon-Wiener Diversity Index (H= 2.658, E= 0.938) shows that Compartment 12 is diverse with anuran species. Among three different sites surveyed, it was found that streams show the highest species number (11 species) and diversity (H=2.258), but a slightly lower value in evenness (E=0.942) compared to trail (E=0.949) (Table 3). This is due to some species dominating in certain locations of the stream area (Table 2).

Table 3: Shannon-Wiener Diversity Index table

Parameter Compartment 12 Trail Stream Swampy Taxon (species) 9 11 6 Individuals 20 26 18 Shannon-Weiner index 2.085 2.258 1.271 (H) Evenness (E) 0.949 0.942 0.709

Figure 1 shows the distributions of the anurans in Compartment 12 marked with TR= trail, ST= stream, and SW= swampy. The distributions of the anurans were more concentrated at the stream area. The highest distributions of frog species at the (trail : Kalophrynus

34 palmatissimus and Kalophrynus pleurostigma, stream : Leptobrachium hendricksoni, and swampy : Pulchrana laterimaculata)

Figure 1: The distributions of anuran species in Compartment 12. Source: Google Earth (2017)

Three species added into the checklist were Amnirana nicobariensis, Kalophrynus pleurostigma, and Pulchrana laterimaculata. The presence of clean water species such as Chalcorana labialis (Ibrahim et al., 2012) showed that Compartment 12 of Ayer Hitam Forest Reserve, Puchong is low in anthropogenic disturbances. An endemic species to Malaysia, Kalophrynus palmatissimus is classified as ‘Endangered’ under the IUCN ‘Red List’ status is also recorded here as well as two other ‘Near Threatened’ species, namely Limnonectes ibanorum and Limnonectes malesianus. In Compartment 12 of Ayer Hitam Forest Reserve, Puchong, the level of anthropogenic disturbance is low. Based on Nadirah (2017) findings, the water quality of the streams are quite good and is classified under Class I and II. This provides a condusive condition for the anurans to live and breed. Therefore, it is crucial for this compartment to retain its preserved environment and increase forest coverage for anuran species diversity for future study.

Acknowledgments We would like to thank the Faculty of Forestry, Universiti Putra Malaysia, Serdang and Sultan Idris Shah Forestry Education Centre (SISFEC) for the research facilities provided and to the staffs and rangers, namely Mr. Kamarul, Mr. Mohd. Naeem, Mohd. Noor Hafiz, Ranger Fazli, Ranger Mohd. Fakhrullah, Ranger Fazrul, Ranger Siti Zurina, and Ranger Nor Azlina for their cooperations and warm hospitality. We also thank our friends and colleagues who were involved in this project.

35

References Berry, P.Y. 1975. The Amphibian Fauna of Peninsular Malaysia. Kuala Lumpur: Tropical Press. Pg 29. Duellman, W. E., & Trueb, L. (1986). Biology of Amphibians. The McGraw Hill, New York. Google Earth (2017). Retrieved May 4, 2017, from https://www.google.com/earth/ Google Maps (2017). Retrieved May 4, 2017, from https://maps.google.com/ Grismer, L. L., Chan, K. O., Grismer, J. L., Wood, P. L. Jr., & Norhayati, A. (2010). A checklist of the herpetofauna of the Banjaran Bintang, Peninsular Malaysia. Russian Journal of Herpetology, 17 (2), 147-160. Ibrahim, J., Ektella, A., Mashhor, M., & Shariza, S. (2002). A comparative study of the amphibian community at three sites in Penang State, Malaysia. Froglog, 50, 7-8. Ibrahim, J., Shahrul Anuar, M. S., Norhayati, A., Shukor, M. N., Shahriza, S., Nurul Ain, E., Nor Zalipah, M., & Rayan, M. (2006). An Annotated Checklist of the Herpetofauna of Langkawi Island, Kedah, Malaysia. Malayan Nature Journal, 57, 369-381. Inger, R. F., & Tan, F. L. (1996). Checklist of the frogs of Borneo. Raffles Bull. Zool, 44, 551- 574. IUCN, S. (2017). Amphibian Specialist Group. 2017. Pulchrana laterimaculata, The IUCN Red List of Threatened Species 2017. Downloaded on 18 September 2017. Jambari Ali, S. Rajagopal & Azmi Yaacob. (1999). Short Notes the Vertebrates Fauna Of Ayer Hitam Forest Reserve, Puchong, Selangor. Pertanika Journal Tropical Agric. Science 22(2) September 1999. 179-184.

Mohd, A., & Yaman, A. R. (2001). Potential of Ayer Hitam Forest Reserve, Selangor as a wildlife reserve. Pertanika Journal Tropical Agricultural Science, 24(1), 49–52.

Muhammad Faris, A. A. (2016). Frog Species Diversity and Distribution in Compartment 15 of Ayer Hitam Forest Reserve, Puchong, Selangor. B. Sc. Thesis, Faculty of Science, Universiti Putra Malaysia.

Nadirah, R. (2017, Jan 2). Personal interview.

Onn, C.K., Belabut, D. & Ahmad, N. (2010). A revised checklist of the amphibians of Peninsular Malaysia. Russian Journal of Herpetology 17:202-206. Paiman, B., & Yaman, A. R. (2007). Ayer Hitam Forest Reserve: Multimedia Super Corridor Community Heritage, Faculty of Forestry, University Putra Malaysia, Serdang, Selangor.

36

2.6 Relationship between Water Quality and Diversity Of Anurans in Compartment 12, Ayer Hitam Forest Reserve, Puchong

Summary Water is a basic necessity for every living thing to ensure sustainability and has remained important in supporting aquatic organisms by providing habitat and food resources. Aquatic life such as anurans have potential to become biological indicators for environmental health.The relationship between water quality and anurans species diversity of Compartment 12 was investigated. A total of 7 stations were chosen in Compartment 12 of Ayer Hitam Forest Reserve, Puchong where four stations were set at swampy areas and three at streams. The six parameters to determine the Water Quality Index (WQI) such as pH level, Dissolved Oxygen (DO), Biological Oxygen Demand (BOD), Ammoniacal Nitrogen (NH3-N), Total Suspended Solids (TSS) and Chemical Oxygen Demand (COD) were recorded in each sampling points. Anurans were observed at the same sampling stations for water samples at night from 8.00 pm - 11.00 pm. Based on the findings, the water quality in Compartment 12 is classified under Class I and II, where it could be regarded as an undisturbed area, suitable for recreational activicty and does not require treatment for water supply. Study also recorded 51 individual anurans, consisting of 14 species from four families captured at the study area. The correlation analysis showed two species of anurans were significantly related with the water quality, which were Limnonectes malesianus and Pulchrana laterimaculata. Further study is recommended to establish anurans as a bio- indicator. Keywords: Water quality; Anuran; Ayer Hitam Forest Reserve; Biological Indicator; Diversity Introduction Water is one of the most important element for every living beings and hence, having good water quality available is crucial. Water quality can be described as the suitable water that sustains use for various function (Bartram et al., 1996). Changes in chemical elements and compound of water were influenced by a variety of natural processes in physical, chemical, hydrological and biological terms (Bartram et al., 1996). In Malaysia, water quality can be measured by using parameters such as pH level, Biochemical Oxygen (BOD), Chemical Oxygen Demand (COD), Dissolved Oxygen (DO), Total Suspended Solids (TSS) and Ammoniacal Nitrogen (NH3-N), based on Department of Environment-Water Quality Index (DOE, 2009). Frogs are classified under the order anura and are of amphibian class. The word Anura originates from the Greek word (an-, without + oura, tail) and it consists of tailless amphibian such as frogs and toads (Hee and Park, 2005). The distribution of anurans is extensive in the world, ranging from the tropics to subarctic regions, but most of them are located in tropical rainforests. Hee and Park (2005) reported that there are 5,743 anurans species that exist in this world (cited in Fagan, 2005), with 150 species from families such as Bombinatoridae, Bufonidae, Megophryidae, Microhylidae, Ranidae and Rhacophoridae occurring in Borneo. Norhayati (2009) stated that Peninsular Malaysia is home to 103 species of anurans that can be classified into six families, namely Bufonidae, Dicroglossidae, Megophryidae, Microhylidae, Ranidae, and Rhacophoridae, with 18, 19, 9, 19, 18 and 20 species of frogs and toads respectively (cited in Shahriza et al., 2011). The rich diversity of frog species in Malaysia is due to the climatic condition which is warm and moist throughout the year (Rahman et al., 2008).

37

During the tadpole stage, anurans are sensitive to changes in water borne substances where they act as bio-indicators, in indicating the health of the aquatic environment (Kotwal et al., 2008). Anurans absorb chemicals through their moist skin and the thin moist linings of their mouth and throat. As a result, toxins in the environment build up faster in their bodies and interferes with their growth; in terms of growth, such toxins are more likely to cause more defects in anurans compared to other vertebrates sharing the same habitat. This makes amphibians very sensitive to environmental pollution. Moreover, since anurans are very sensitive to water-borne pollutants, they can be used to measure the presence of pollutants as well heavy metals, as heavy metals are one of the factors of anurans abnormalities (White, 1999). The Department of Environmental (DOE) uses chemicals to determine the level of water quality. However, the presence of fauna such frog and fish is also beneficial as an indicator of water quality. According to McGeoch et al. (2002) the use of certain plant and animal species as bio-indicators in monitoring the health of forest ecosystems is relatively new. The use of anurans as biological indicators of metal pollution is becoming more common (Burger & Snodgrass, 1998). There are about 95% of frog species that need pollution free areas which have clean and clear water with minimum pollution and disturbance rate (Shahriza et al., 2011). Hence, this study was conducted to determine the relationship between water quality and anurans species diversity at Compartment 12, Ayer Hitam Forest Reserve, Puchong.

Materials and Methods The research was conducted at Compartment 12 (220 ha), Ayer Hitam Forest Reserve, Puchong (Figure 1) from October 2016 to March 2017. The sampling was conducted at least twice per month for six months. There are seven stations with 18 sampling points at Compartment 12. This compartment has two different stations, swampy (SW) and stream (ST), to indicate the water quality differences between sampling stations. Every sampling stations have one to four sampling points and which are marked on GPS (Arneson, 2013) as sampling point, SW1, SW2 and SW3.

38

Figure 1: Map Location of stations at Ayer Hitam Forest Reserve [Note:1, Station 1;2, Station 2; 3; Station 3; 4; Station 4; 5; Station 5; 6; Station 6; 7; Station 7;]. Each sampling stations are of 300 m in length and was divided into a few sampling points which are 50 to 100 m in length. The water samples were collected every 50 to 100 m for stream site. As it seems that the sites are homogeneous, in swampy area, the samples were collected from the accessibility area (5 m radius from each sampling point). The water samples were collected prior to anurans being captured and identified at night which is when they are active. (Shahriza et al., 2011). The technique of locating with visual and sound was applied to identify the location of anurans. Any caught anurans were then released back at captured point after measurements were recorded and pictures taken. Results and Discussion Water quality Figure 2 shows the average value of WQI in Compartment 12 is 85.36, categorized under Class II. The highest water quality index is 100 (refer Table 1) because all parameters were under control and were influenced by high the value of Dissolve Oxygen (DO). However the lowest water quality index (61.26) which was recorded at the swampy station, consists of low-lying regions (with poor drainage), close to the river which supplies the swamp with water resulting in the muddy environment. The high density of vegetation at the study area also resulted in the poor water quality due to the presence of forest litter that undergoes decomposition processes in water. The residues of these chemicals slowly sink to the bottom and blend with sand and sediment (Rutledge et al., 2017).

Table 1: The average WQI values and class types of water sampling at Compartment 12 of Ayer Hitam Forest Reserve, Puchong

Sampling Station WQI Class Average point Stream 1 ST1 a 99.08 I ST1 b 99.24 I 99.44 ST1 c 100.00 I Swampy 2 SW2 a 70.81 III 77.46 SW2 b 80.09 II Swampy 3 SW3 a 81.47 II 81.47 Swampy 4 SW4 a 84.54 II SW4 b 77.12 II 80.83 Stream 5 ST5 a 92.00 II ST5 b 94.59 I 93.25 ST5 c 93.16 I Stream 6 ST6 a 98.64 I ST6 b 76.10 III 88.14 ST6 c 85.13 II ST6 d 92.69 I Swampy 7 SW7 a 82.10 II SW7 b 61.26 III 70.53 SW7 c 68.22 III

39

110 100 Class II 90 80 Class II 70 60 Class III 50 40 Class IV 30

20 Average ofWQIAverage 10 0 ST1 SW 1 SW 3 SW 4 ST 5 ST 6 SW 7 Stream Station Swampy

Figure 2: Average Water Quality Index values at different sampling points at Compartment 12 of Ayer Hitam Forest Reserve, Puchong. Table 2: Correlation of WQI classes and anurans species at Compartment 12 of Ayer Hitam Forest Reserve, Puchong

Abberviation Anuran species Total No WQI classes Correlation of I II III Coefficient p- individual value AN Amnirana 3 3 0 1 nicobariensis FC Fejervarya cancrivora 1 1 0.866 0.333 FL Fejervarya limnocharis 4 4 0.866 0.333 HL Hylarana/ chalcorana 5 1 3 1 0 1 labialis HG Hylarana glandulosa 1 1 0 1 KPAL Kalophrynus 2 1 1 0.866 0.333 palmatissimus LH Leptobrachium 6 5 1 0.5 0.667 hendricksoni LIB Limnonectes ibanorum 2 2 0.866 0.333 LING Leptobrachium ingeri 2 1 1 0 1 LPARA Limnonectes 4 3 1 0 0.01 malesianus LPLICA Limnonectes plicatellus 3 1 1 1 0 1 MM Microhyla mantheyi 1 1 0 1 OLA Occidozyga laevis 6 5 1 0.5 0.667 PL Pulchrana 11 3 8 0 0.01 laterimaculata 51 24 14 13

40

The Correlation between Water Quality Classes and Anurans Species 14 species of anurans from four families were recorded at Compartment 12. The families recorded are Dicroglossidae, Megophyridae, Microhylidae and Ranidae. The total number of anurans encountered during the period of six months from October 2016 to March 2017 is 51. The highest individuals recorded were Pulchrana laterimaculata with 11 individuals while the least were Fejervarya cancrivora, Microhyla mantheyi and Hylarana glandulosa with only one of each individual present.

Based on this study’s objective, which is to study the relationship between water quality and anurans species diversity in both compartments, it was found that, according to Table 2 almost all anurans species in Ayer Hitam Forest Reserve do not have a significant relationship with WQI. However, only two species of anurans, L. malesianus and P. laterimaculata have a significant relationship with WQI class, where their p-values are less than 0.05. The Limnonectes malesianus species only exists in Class I and II of water, which shows that they prefer the clean water environment compared to P. laterimaculata which was only found in Class II and III water, especially at the swampy area. The water quality analysis shows that this area was not polluted with chemicals or toxic pollutants, but had a poor drainage system, containing high Total Suspended Solids and Ammoniacal Nitrogen concentration. Nevertheless, Pulchrana laterimaculata inhabits swampy areas in lowland primary and good secondary rainforests (Nick, 2016) and can be located by its distinctive call that sounds 'yip- yip-yip'. Based on observation, this species was found in swampy area only. The temperature and rainfall may also influence the number of species encountered at a given site as well. The high frequency of P. laterimaculata is presented in Table 2, which means that it is able to act as an indicator for water quality (Class II and III), especially water resources around their habitat. Based on observation, if P. laterimaculata was found in swampy area, then it could be classified under Class III, due to the swamps having poor drainage and high concentration of nutrients from decomposition processes by microorganisms. Limnonectes malesianus indicates the high water quality that are of Class I and II of WQI. It shows that the compartment is largely undisturbed and pristine. This species belongs to the family Megophryidae, where it lives by the riverbank or river plain, and has a fingertip that allows it to cling to a slick stone. It is able to inhabit forests that have been disturbed like Ayer Hitam Forest Reserve (secondary forest). The skin is reddish brown to chocolate brown. Several wide black bars run from eye across lips. Most have thin white line running from the tip of snout, between eyes and down the middle of back, often with a fine whitish line on upper surface of legs (Paul, 2014). As for other species of anurans, they are not significantly related due to their presence being too small which does not provide enough evidence to make them as indicators of water quality or environmental health.

41

Conclusion From this research, the range of water quality index is from 60.26 to 100. The mean value of WQI in Compartment 12 (85.35) of Ayer Hitam Forest Reserve, Puchong, Selangor is categorized as clean water that belongs to Class II. Meanwhile, the Class II water is suitable for sensitive aquatic species and recreational activity but need conventional treatment for water supply. In addition, there are 14 species of anurans from four families that were recorded in Compartment 12. The families recorded include Dicroglossidae, Megophyridae, Microhylidae and Ranidae.

For the determination of relationship between water quality and anurans, it can be concluded that in general, there is no significant relationship between the two. However, the two anuran species that had significant relationship with water quality were Limnonectes malesianus and Pulchrana malesianus. They can be deservedly declared as bio-indicators of water quality; L. malesianus as an indicator for clean water (Class I and II), and P. laterimaculata as an indicator for poor water quality (Class II and III).

Acknowledgements We would like to thank the Faculty of Forestry for granting permission to carry out the project in Sultan Idris Shah Forest Education Centre (SISFEC), Selangor.

References Anon. (2005). Ecosystems and Human Well Being: Biodiversity synthesis, GreenFacts Scientific Board. Retrieved from http://www.greenfacts.org/en/biodiversity/l-3/1-define- biodiversity.htm Arneson, N. (2013). Amphibian Community Composition and Its Relationship to Salinity along The Salt Creek In Wilderness Park, Lancaster County, Nebraska. Retrieved from //digitalcommons.unl.edu/envstudtheses. Bartram, J., Ballance, R., Meybeck, M., Kuusisto, E., Makela, A., & Malkki, E. (1996). Water Quality. Water Quality Monitoring -A Practical Guide to the Design and Implementation of Freshwater Quality Studies and Monitoring Programmes, 1–27. Burger, J., & Snodgrass, J. (1998). Heavy Metals in Bullfrog (Rana catesbeiana) tadpoles: Effects of Depuration before Analysis. Environmental Toxicology and Chemistry, 17, 2203- 2209. http://onlinelibrary.wiley.com/doi/10.1002/etc.5620171110/Summary Department of Environment, (DOE). (2009). Kuala Lumpur: Environment Quality report 2009. Kuala Lumpur: Ministry of Science, Technologies and Environment. Department of Environment. Fagan, G. (2005). Silence of the frogs. Asian Geographic, 2, 52 – 63. Hee, K. B., & Park, R. (2005). Anurans Tourism in Crocker Range Park: Convergence of Research and Local People Involvement Towards Conservation, 1–11. Retrieved from http://eprints.ums.edu.my/1464/ Henry, P. F. P. (2000). Aspects of amphibian anatomy and physiology: Ecotoxicology of Amphibians and Reptiles. Pensacola, FL: Society of Environmental Toxicology and Chemistry (SETAC), 71-111. Kotwal, P. C., Kandari, L. S., & Dugaya, D. (2008). Bioindicators in sustainable management of tropical forests in India. Plant Science, 2, 99–104.

42

McGeoch, M. A., VanRensburg, B.J., & Botes, A. (2002). The verification and application of bioindicators: a case study of dung beetles in a savanna ecosystem. Journal of Applied Ecology, 39, 661-672. Norhayati, A. (2009), Amphibia my: Amphibians and Reptiles of Peninsular Malaysia. On-line reference (available July 15, 2009): http:amphibia.my. Paul, Y.I. (2014). Amfibia Sabah. Dewan Bahasa dan Pustaka. Kuala Lumpur Rutledge, K., McDaniel, M., Boudreau, D., Ramroop, T., Teng, S., Sprout, E., Costa, H., Hall, H., & Hunt, J. (2017). Swamp. National Geogrpahic. Retrieved from https://www.nationalgeographic.org/encyclopedia/swamp/ Rahman, W. A., Tan, A., & Sufina, I. (2008). On the parasitic fauna of two species of anurans collected from Sungai Pinang, Penang Island, Malaysia. Tropical Biomedicine, 25(2), 160–165. Saulovic, D., Biocanin, R., & Rodriguez, B. (2015). Bioindicators in human environment. University of Belgrade, 140–147. Retrieved from https://ess1.wikispaces.com/file/view/15.pdf. Shahriza, S., Ibrahim, J., & Anuar, M. S. S. (2011). The Amphibian Fauna of Lata Bukit Hijau, Kedah, Malaysia. Russian Journal of Herpetology, 18(3), 221–227. White, A. W. (1999). Frogs as Bioindicators. Blue Mountains Bioindicators Project. NSW National Parks and Wildlife Service, 114–142.

43

2.7 Fish Fauna Composition and Water Quality at Long Kesseh, Baram, Sarawak

Summary

The study on composition and distribution of freshwater fishes at Long Kessehwas carried out from 13th to 15th January 2016 with the aim to document the fish fauna composition and water quality. Samples were collected from eight stations; one each at Batang Baram and seven tributaries namely, Sungai Nakan, Sungai Kemenyih, Sungai Kesseh, Sungai Liseng, Sungai Jertang, Sungai Piping and Sungai Kahah. Fishes were caught using variety of gears including a3 layered net, cast nets and gill nets of various mesh sizes and later identified with the help of relevant taxonomic guides. A total of 186 fish individuals comprising of 22 species from 8 families were sampled throughout the entire study period. The fish fauna in Long Kesseh was dominated by species belonging to the family Cyprinidae (67.20%), followed by Pangasiidae (25.81%) and Siluridae (3.76%). Among the fish species collected, Barbonymus schwanenfeldii from the family Cyprinidae was the most dominant species with 53 individual comprising of 28.5% of the total fish caught, followed by Pseudolais micronemus with 25.8% and Luciosoma setigerum (8.6%). Some selected physico-chemical water quality parameters recorded were dissolved oxygen concentration ranged from 7.40 to 8.01mg/L, conductivity ranged from 8.01 to 7.40µS/cm, pH ranged from 7.1 to 7.4,temperature ranged from 25.67 to 27.74 °C and total suspended solids ranged from 5.17 to 46.30mg/L.

Keywords: Cyprinidae; Freshwater Fish; Physico-chemical; Baram

Introduction

Highly diverse streams in Malaysia inhabit a wide range of fish diversity. The earliest ichthyo faunal study in Sarawak was carried out at Rajang River with 59 species, Batang Ai come up with 31 species while Baram River recorded 43 fish species (Salam & Gopinath, 2006). Recent research conducted by Chong et al. (2010) in Malaysia came up with 521 fish species in Malaysia freshwater ecosystem. Although many surveys have been done on the Sarawak freshwater fishes, only a few of these were carried out in the uppermost catchment of the Baram River watershed. According to Salam and Gopinath (2006), the upper reaches are the least known riverine habitats and there are probably more species that await discovery.

Baram River is the second longest river in Sarawak after the Rajang River with a length of 402 km and catchment of 22,325 km2 (Yusoff et al., 2006). Long Kesseh is one of the settlements along Batang Baram and like all other settlements located at the river bank, they rely on the rivers for their daily activities, including water supply for washing, food, means of transport and irrigation for agricultural land. However, increase in human population and large scale land uses have caused the pollution of ecosystems and deterioration of water quality. However, the composition and abundance of fish in the river is directly linked with the physiochemical properties of the water, land use activities and physical component of the river. Therefore, it is timely and relevant to document the current information on fish species composition and diversity in Long Kesseh, Baram.

44

Materials and Methods

Study Areas

This study was carried out at Long Kesseh which is located at the upstream of Baram River. Eight stations were selected for fish sampling and water quality parameters namely,Sungai Kemenyih (LK2) (N03°28’20.1’’E114°25’30.7’’),Sungai Nakan (LK1) (N03°28’19.1’’ E114°23’29.7’’), Sungai Kesseh (LK4) (N03°27’22.2’’ E114°30’39.5’’),Main River (LK3) (N03°27’30’’ E114°30’49’’), Sungai Liseng (LK5) (N03°26’25.9’’ E114°31’58.2’’), Sungai Jertang (LK6) (N03°26’21.5’’ E114°32’17.2’’), Sungai Piping (LK7) (N03°24’46.1’’E114°33’29.6’’), and Sungai Kahah (LK8) (N03°23’49’’E114°33’16.2’’) (Figure 1).

N Sg Kemenyih Sg Kesseh

Sg Liseng Main River

Sg Nakan Baram River

Sg Jertang Sg Piping

Sarawak 0 2 4 KM Sg Kahah

Figure 1: Location of the eight sampling stations at Long Kesseh, Baram.

Data Collection

Fish samples were collected from 13thto15th January 2016usingmonofilament gill nets with different mesh sizes (2.54 cm, 5.08 cm, 7.06 cm, 10.16 cm, and 12.7 cm), cast net, and three layered net. At each station, an equal number of nets were placed and were left overnight. Fish specimens were fixed in 10% formalin before being brought back to the laboratory. The fishes were washed and identified before being stored in 70% ethanol for long term preservation. Species identification follows the taxonomic keys suggested by Mohsin and Ambak (1983), Roberts (1989), Kotellat et al. (1993), Inger and Chin (2002), and Tan (2006). In-situ physicochemical parameters were measured using multi-parameter Sonde Model YSI 6820 V2. Total suspended solids (TSS) concentrations were calculated using the standard method APHA (2005).

45

Data Analysis

All statistical analyses were carried out using Statistical Package for Social Sciences (SPSS) software version 23.0. One-way analysis of variance (ANOVA) was used to determine the statistically significant difference that was set at p<0.05.

Results

Overall, a total of 186 individuals from 22 species belonging to 8 families were caught at eight sampling stations in Long Kesseh. The fish fauna was dominated by Barbonymus schwanenfeldii with a total of 53 individuals representing 28.49 % of the total number of individuals caught (Figure 2). The fish composition in this area was mainly dominated by the family Cyprinidae which accounted for 67.20% of the species sampled. The presence and absence of each fish species are summarized in Table 1.

Figure 2: Percentages of fish species caught at Long Kesseh, Baram.

Table 1: Fish fauna composition and at Long Kesseh, Baram.

Sampling stations Species LK1 LK2 LK3 LK4 LK5 LK6 LK7 LK8 Ambassidae Ambassis kopsii - - - + - - + - Bagridae Hemibragus planicep - - - - + - - - Cynoglossidae Cynoglossus - - - + - - - - waandersii Cyprinidae Barbonymus + + + + + + + + schwanenfeldii Cyclocheilichthys - - - - - + + + apogon Hampala bimaculata - - - + + - - - Hampala - - + + - + - - macrolepidota 46

Leptobarbus hoevenii - - + + - - - + Lobocheilus bo - - - + - + - + Lobocheilus hispidus - - - + - - - - Luciosoma setigerum - - - - + + - + Osteochilus vittatus - - - + + + - + Puntioplites + - + - - + + + waandersii Rasbora ------+ caudimaculata Osteochilus ------+ melanopleura Tor tambroides - - - - + - - + Mastacembelidae Mastacembelus ------+ unicolor Pangasiidae Pseudolais - + + - + - + + micronemus Siluridae Kryptopterus - - - + - - - - micronema Kryptopterus apogon - + - - - - + + Kryptopterus lais - - - - + - + - Osphronemidae Osphronemus - + ------scptemfasciatus

Presence and absence of each species is indicated by (+) and (-) respectively.

The mean values for selected physico-chemical water parameters are shown in Table 3. The value of dissolved oxygen concentration ranged from 7.40±0.00 at Sungai Kemenyih (LK2) and Sungai Liseng (LK5) to 8.01±0.00 at Sungai Piping (LK7) and Sungai Kahah (LK8). The level of conductivity varied from 8.01±0.00 µS/cm at Sungai Kahah) to 87.00±0.00 µS/cm at Sungai Nakan. The highest pH value was recorded at Sungai Nakan (LK1) at 7.40±0.00 and the lowest was at Sungai Kemenyih (LK2) and Sungai Liseng (LK5) at 7.10±0.00. Higher water temperature was recorded at Sungai Nakan (LK1) with a mean of 27.74±0.00 °C while the lowest was recorded at Sungai Piping (LK7) at 25.67±0.00°C.The highest TSS concentration was recorded at Sungai Jertang (LK6) at 46.30±2.67mg/L and the lowest concentrationat 5.17±0.06 mg/L was recorded at Sungai Kesseh (LK4).

Table 3: The mean values of selected water parameters at each sampling station in Long Kesseh.

Sampling DO Conductivity pH Temperature TSS station (mg/L) (µS/cm) (°C) (mg/L) Sungai 7.54±0.00b 87.00±0.00h 7.40±0.00g 27.74±0.00g 5.57±0.65a,b Nakan Sungai 7.40±0.00a 68.00±0.00f 7.10±0.00b 26.47±0.00d 9.73±0.64b Kemenyih Main River 7.64±0.00c 42.00±0.00c 7.30±0.00f 27.60±0.00f 27.13±0.76c Sungai 7.70±0.00d 61.00±0.00e 7.20±0.00d 26.14±0.00c 5.17±0.06a Kesseh Sungai 7.40±0.00a 78.00±0.00g 7.10±0.00b 26.47±0.00d 36.40±2.86d Liseng Sungai 7.90±0.00e 25.89±0.00a 7.20±0.00c 25.89±0.00b 46.30±2.67e Jertang Sungai 8.01±0.00f 50.00±0.00d 7.30±0.00e 25.67±0.00a 45.47±1.39e 47

Piping Sungai 8.01±0.00f 8.01±0.00b 7.30±0.00a 27.25±0.00e 32.60±0.40d Kahah Mean on the same column with the same superscript was not significantly different at 5% significant level.

48

Discussion

Overall, the fish composition at Long Kesseh was dominated by cyprinids which comprised 67.20% of the total fish sampledand consisted of 13 species. All other families only consisted of one to three species each. Several studies also have reported that cyprinids were the most abundance species found in Malaysian freshwater bodies (Nyanti et al., 1999, Khairul-Adha et al., 2009 and Hashim et al., 2012). This is also a common pattern of fish species distribution for the Southeast Asian region (Samat et al., 2005). The abundance of cyprinids within Malaysian water bodies is associated with their high adaptive variability such as the highly adapted body forms and mouth structures (Ward- Campbell et al., 2005). The highest number of fish was collected at Sungai Piping with a total of 49 individuals, followed by Sungai Kahah with 35 individuals, Sungai Jertang with 28 individuals, Batang Baram with 24 individuals, Sungai Liseng (20 individuals), Sungai Kesseh (17 individuals), Sungai Nakan (9 individuals) and Sungai Kemenyih(4 individuals).Throughout this study, Barbonymus schwanenfeldii occurred in greater abundance and can be found in all sampling stations and representing 28.49% of the total fish caught, followed by Pseudolais micronemus (25.81%) and Luciosoma setigerum (8.60%). Barbonymus schwanenfeldii is also commonly found in tropical and subtropical areas including Malaysia (Mansour et al., 2017). This species is well-known and preferred due to its tender meat and is therefore an important commercial species.

Almost all physico-chemical parameters are significantly different (p<0.05) among all sampling stations. Dissolved oxygen values ranged from 7.40 to 8.01 mg/L, and Sungai Piping and Sungai Kahah show significantly (p<0.05) higher DO values. A high number of fish was collected at these stations especially Pseudolais micronemus and Barbonymus schwanenfeldii showing that both species prefer higher concentration of DO. Water conductivity in Baram area varied from 8.01 to 87.00 µS/cm. This value is common in most of the freshwaters as conductivity normally range from 10 to 1000 µS/cm while a concentration exceeding 1000 µS/cm indicates the area receives pollution (Al-Badaii et al., 2013). Results show that pH values for all area in Long Kesseh (7.10 to 7.40) fall within the standard limit of 6 to 8.5 (Cleophas et al., 2013).Water temperature at Long Kesseh area especially at smaller streams was influenced by riparian cover as it reduced the direct penetration of sunlight. The colder water of Sungai Piping is favourable to Pseudolais micronemus while the warmer temperature of Sungai Nakan is favourable to Barbonymus schwanenfeldii. The high TSS values in Sungai Jertang and Sungai Piping may be due to the soil erosion that occurred at the river bank. The siltation of the stream became more obvious during the rainy season. Hence, only tolerable species can be found abundantly at this station.

Conclusion

Cyprinidae had the highest number of species and is represented in all sampling stations in Long Kesseh due to their high adaptive variability. The overall water quality can be classified as good and fall within an acceptable limit for the survival of aquatic species. Large scale land clearing activities is the main factor that affects water quality in the river and subsequently its function as habitat for aquatic organisms. Protection and conservation of the area is importantsince a few streams in Long Kesseh area have the potential to be used for recreational activities.

Acknowledgements

Financial support by Sarawak Energy through research grant no. GL(F07)/SEB/3A/2013 (20) and UNIMAS for facilities is gratefully acknowledged.

49

References

Al-Badaii, F., Shuhaimi-Othman, M., & Gasim, M. B. (2013). Water quality assessment of the Semenyih River, Selangor, Malaysia. Journal of Chemistry, 1-10.

APHA. (2005). Standard methods for the examination of water and waste water (21th ed.). Washington, DC: American Public Health Association.

Chong, V. C., Lee, P. K., & Lau, C. M. (2010). Diversity, extinction risk and conservation of Malaysians fishes. Journal of Fish Biology, 76 (9), 2009-2066.

Cleophas, F. N., Isidore, F., Lee, K. H., & Bidin, K. (2013). Water quality status of Liwagu River, Tambunan, Sabah, Malaysia. Journal of Tropical Biology and Conservation, 10, 67-73.

Hashim, Z. H., Zainuddin, R. Y., Shah, A. S. R. M., Sah, S. A. M., Mohammad, M. S., & Mansor, M. (2012). Fish checklist of Perak River, Malaysia. Journal of Species Lists and Distribution, 8(3), 408-413.

Inger, R. F., & Chin, P. K. (2002). The freshwater fishes of North Borneo. (Revised edition with supplementary chapter by P.K. Chin). Kota Kinabalu, Malaysia: Natural History Publication (Borneo).

Khairul Adha, K., Siti, A. K., Siti, S. S., Aziz, A., Yuzine, E., & Eza, R. I. (2009). Freshwater fish diversity and composition in Batang Kerang floodplain, Balai Ringin, Sarawak. Pertanika Journal of Tropical Agricultural Science, 32(1), 7-16.

Kottelat, M., Whitten, T., Kartikasari, S. N., & Wirjoatmodjo, S. (1993). Freshwater fishes of western Indonesia and Sulawesi. Singapore: Periplus Publisher.

Mansour, O., Idris, M., Noor, M. N., &Das, S. K. Growth performance of tinfoil barb (Barbonymus schwanenfeldii) fry feeding with different protein content diets. ACCL Bioflux, 10(3), 475-479.

Mohsin, A. K. M., & Ambak, M. A. (1983). Freshwater fishes of Peninsular Malaysia. Selangor, Malaysia: Penerbit Universiti Pertanian.

Nyanti, L., Ling, T. Y., & Adha, K. (1999). Freshwater fishes from Bario, Kelabit Highlands Sarawak. ASEAN Review of Biodiversity and Environmental Conservation, 4, 1-6.

Roberts, T. R. (1989). The freshwater fishes of western Borneo. San Francisco, USA: California Academy of Science.

Salam, M. N. A., & Gopinath, N. (2006). Riverine and fisheries in Malaysia: An ignored resource. Aquatic Ecosystem Health & Management, 9(2), 159–164.

Samat, A., Shukor, M.N., Siti–Farahayu, A.B. & Mazlan, A.G. (2005). A snapshot study on community structure of fishes inhabiting a small forest stream of Sungai rengit in Krau Wildlife Reserve, Pahang Malaysia. Journal of Wildlife and Parks, 22, 97-109.

Tan, H. H. (2006). The Borneo suckers. Kota Kinabalu. Borneo, Malaysia: Natural History Publications.

Ward-Campbell, B. M. S., Beamish, F. W. H., Kongchaiya, C. (2005). Morphological characteristics in relation to diet in five co-existing Thai fish species. Journal of Fish Biology, 67, 1266–1279.

Yusoff, F. M., Shariff, M. & Gopinath, N. (2006). Diversity of Malaysian aquatic ecosystems and resources. Aquatic Ecosystem Health & Management, 9(2), 119–135.

50

2.8 Antioxidant activity of Cymodocea rotundata from various habitats

Summary

Cymodocea rotundata Ehrenb. & Hempr. ex Aschers. (Family: Cymodoceacea) is a flowering plant which inhabit Malaysian coastal waters. The seagrass is of ecological importance which forms dense meadow supporting high biodiversity and food to a variety of aquatic organisms. The species can adapt to certain level of anthropogenic disturbances, and thus is an important bio-indicator to examine the marine health condition. The aim of the present study is to determine the antioxidant activity of C. rotundata from several seagrass beds, and their relationship between morphometric and water quality characteristics. The seagrass was collected from 6 sites; (1) Teluk Pelanduk, Negeri Sembilan, (2) Pantai Punang-Sari-Lawas, Sarawak, (3) Pantai Sungai Bangat, Sarawak, (4) Teluk Sepanggar, Sabah, (5) Pantai Kampung Kelawat, Sabah and (6) Pulau Mabul, Sabah. Morphometric measurement of leaf blade length and blade width was taken from dry herbarium of the seagrass. Water samples were analyzed for ammonia, nitrate and nitrite. Seagrass methanol leaf extracts were evaluated for antioxidant activity including total phenolic content (TPC), total flavonoid content (TFC), DPPH and FRAP activities. This present study showed that C. rotundata leaf blade length was strongly correlated with nitrate (r=0.82) and inversely correlated with DPPH activity (r=-0.97). Long-leaved C. rotundata (13.6±2.3 cm) from Teluk Pelanduk (S1) possessed a very strong antioxidant DPPH EC50 (41.58±7.87 µg/mL). This suggests that the leaf morphometric of C. rotundata can be used as references for monitoring the water quality and antioxidant status of the seagrass.

Keywords: Antioxidant; Cymodocea rotundata; Seagrass; Morphometric

Introduction

The search for natural antioxidant from marine plants (e.g., seaweed, seagrass and mangrove plants) has gained considerable attention in the past few decades, since the phytochemicals are cheaper, safer and displayed potent pharmacological effects against human diseases (Sithranga Boopahty & Kathiresan, 2010). Interest in employing natural antioxidant derived from marine source not only limited for commercial biomedicine industry, but also for their application in food production and cosmetic industry (Wells et al., 2016). Marine macroalgae, seaweed has been the center of focus in many research fields especially for the discovery of new drugs (Kavita, Singh, & Jha, 2014) due to its edibility and preference for human consumption, unlike seagrass and mangrove plants. However, this does not implies that other marine plants have no such beneficial values. In fact, seagrass has been long utilized as food (de la Torre-Castro & Rönnbäck, 2004; Bujang, Zakaria, & Arshad, 2006) and is an important traditional medicine for the coastal people (Newmaster et al., 2011). Seagrass extracts also exhibit antioxidant property on various antioxidant assays (e.g., total antioxidant activity, DPPH scavenging activity and reducing power) (Kannan, Arumugam, Thangaradjou, & Anantharaman, 2013). Few studies have been performed on antioxidant activity of seagrass from Tropical Indo-Pacififc bioregion (Santoso et al., 2012; Kannan, Arumugam, Thangaradjou, & Anantharaman, 2013; Jeyapragash, Subhashini, Raja, Abirami, & Thangaradjou, 2016); however, comparison between the antioxidant activities of seagrass from various habitats is still lacking. Previous study conducted by Grignon-Dubois, Rezzonico and Alcoverro (2012) on seagrass Zostera noltii from Atlantic and Mediterranean coasts showed that the extreme changes in physical parameter (e.g.,

51 temperature, light intensity and salinity) can greatly influences the accumulation of phenolic acids (rosmarinic acid, zosteric acid and caffeic acid) in the seagrass. Hence, the present study aims to investigate the morphometric and antioxidant properties of seagrass Cymodocea rotundata from various habitats.

Materials and Methods

Seagrass collection

Cymodocea rotundata was collected from 6 seagrass beds; (S1) Teluk Pelanduk, Negeri Sembilan (2°25'7.2659"N, 101°53'2.928"E), (S2) Pantai Sungai Bangat, Sarawak (4°54'48.2880"N, 115°23'6.9540"E), (S3) Pantai Punang-Sari-Lawas, Sarawak (4°56'49.7459"N, 115°24'21.0360"E), (S4) Teluk Sepanggar, Sabah (6°3'17.4720"N, 116°6'43.2660"E), (S5) Pantai Kampung Kelawat, Sabah (6°18'49.2498"N, 116°19'39.9284"E) and (S6) Pulau Mabul, Sabah (4°14'53.6820"N, 118°37' 52.8659"E). In-situ water quality parameters (salinity, atmospheric pressure, temperature, dissolved oxygen, pH, conductivity and total dissolved solid) were measured using YSI multiparameter professional series (YSI, USA).

Morphometric measurement

Morphometric measurement of C. rotundata including leaf blade length (L, cm), leaf blade width (W, mm) and leaf sheath length (LS, mm) were measured from the dry herbarium deposited at Laboratory of Aquatic Botany, Department of Aquaculture, Faculty of Agriculture, Universiti Putra Malaysia (UPM) (Voucher specimen: TPCR01-03, PPSCR01-04, PSBCR01-04, TSCR01-03, PKKCR01-04 and PMCR01-03). Leaf blade length to width ratio (L/W) was calculated from the recorded values.

Water nutrient

Seawater ammonia (NH3), nitrate (NO3-) and nitrite (NO2-) concentration were measured by using a portable spectrophotometer Hach DR/2400 (Hach, USA) according to developer protocol (Hach Company, 2004).

Antioxidant activity

Fresh leaves of C. rotundata were carefully cleaned with distilled water from unwanted debris. The leaves were oven-dried at 40°C in an air recirculating oven (Memmert UF160, Germany), and then powderized using an electric blender. The powder was extracted with methanol for 24 hours on an orbital shaker at speed 150 rpm. The mixtures were filtered thrice through Whatman filter paper no. 1. The filtrates were pooled and dried under vacuum at 55ºC and 200-250 mbar in a rotary vacuum evaporator (IKA® RV 10, Germany). The extracts were assessed for antioxidant activity of total phenolic content (Zhang et al., 2006), total flavonoid content (He, He, He, & Wan, 2012), DPPH scavenging activity (Cheng, Moore, & Yu, 2006) and ferric reducing antioxidant power activity (Benzie & Strain, 1996). Statistical analysis

Morphometric measurement, water quality and antioxidant activity parameters were statistically analyzed with one-way analysis of variance (DMRT, p<0.05), principal component analysis (PCA, Pearson type) and agglomerative hierarchical clustering (AHC, similarities of Pearson correlation coefficient) using XLSTAT 2014 (Addinsoft, 2015).

52

Results and Discussion

Antioxidant activity

Seagrass C. rotundata collected from S2 and S1 possessed the highest total phenolic content (TPC) with the values of 28.20±0.38 and 27.82±1.14 mg gallic acid equivalent (GAE) per g extract, respectively > S3 (26.17±1.23 mg GAE/g extract) and S4 (25.37±1.87 mg GAE/g extract) > S5 (17.63±0.0.65 mg GAE/g extract) > S6 (13.87±0.57 mg GAE/g extract) (Figure 1a). This present study showed higher TPC values (S1-S4) compared to studied sample from Palk Bay, India (15.38 mg GAE/g extract, Jeyapragash, Subhashini, Raja, Abirami, & Thangaradjou, 2016), Chinapallam, India (12.64 mg GAE/g extract, Kannan, Arumugam, Thangaradjou, & Anantharaman, 2013) and Pramuka Island, Indonesia (0.02-3.35 mg GAE/g extract, Santoso et al., 2012). Polyphenols in seagrass tends to dissolve in polar and semi- polar solvent, as reported by Santoso et al. (2012) which demonstrated high phenolic content in methanol as compared to a more non-polar solvent ethyl acetate and n-hexane. This present study also showed that extraction using absolute methanol yielded more polyphenol content compared to using aqueous ethanol (15.38 mg, Jeyapragash, Subhashini, Raja, Abirami, & Thangaradjou, 2016) and aqueous methanol (12.64 mg GAE/g extract, Kannan, Arumugam, Thangaradjou, & Anantharaman, 2013). Production of phenolic content may also highly associated with the seagrass environmental conditions, e.g., tidal nature, temperature, light intensity and salinity, by which inter-tidal seagrass contained high phenolic acids compared to sub-tidal (Grignon-Dubois, Rezzonico, & Alcoverro, 2012). Total flavonoid content (TFC) of sample collected from S2 (53.93±4.42 mg quercetin equivalent (QE) per g extract), S4 (50.16±2.67 mg QE/g extract) and S5 (51.08±2.63 mg QE/g extract) were significantly higher (p<0.05) than > S3 (41.56±3.63) and S6 (41.01±1.08) > S1 (33.78±2.53 mg QE/g extract). The TFC values were higher than aqueous methanol extract as reported by Kannan, Arumugam, Thangaradjou and Anantharaman (2013) for C. roundata (4.56 mg QE/g extract) and C. serrulata (5.12 mg QE/g extract).

DPPH EC50 is the effective concentration quenching 50% of generated DPPH radical. EC50 value can be categorized according to its quenching ability; very strong (<50 µg/mL), strong (50–100 µg/mL), intermediate (100-150 µg/mL), strong (150–200 µg/mL) and (>200 µg/mL) (Blois, 1958). Sample collected from S1 had the lowest EC50 value of 41.58±7.87 µg/mL and was categorized as a very strong antioxidant agent. Sample from S2, S3 and S4 demonstrated strong antioxidant activity, and required twice the concentration to achieve S1 DPPH activity, with values of 90.51±3.70, 99.46±2.21 and 95.05±3.30 µg/mL, respectively. Sample from S5 (109.17±0.45 µg/mL) and S6 (141.59±17.37 µg/mL) demonstrated intermediate antioxidant activity. Antioxidant activities of seagrass were comparable to tropical edible seaweed Caulerpa racemosa with TPC, TFC and DPPH EC50 values of 19.8±2.01 mg GAE/g, 16.0 mg cathecin equivalents/ g and 90.00 µg/mL, respectively (Chia, et al., 2015).

53

Besides, Pearson’s correlation analysis showed that the leaf blade length of C. rotundata was inversely strong correlated with DPPH activity (r=-0.97, p<0.05) (Figure 1b). This proved that extract from long-leaved C. rotundata exhibited a very strong antioxidant activity. Moreover, TPC was also inversely correlated with DPPH (r=-0.80, p<0.05). The high TPC contribute to high DPPH antioxidant activity similar to Santoso et al. (2012) and Jeyapragash, Subhashini, Raja, Abirami and Thangaradjou (2016). Reducing power of the seagrass extracts were evaluated based FRAP assay using Fe2+ as equivalent standard. Cymodocea rotundata collected from S4 possessed high FRAP activity with value 3.71±0.69 mM Fe2+E/g extract, followed by S1 (2.86±0.18 mM Fe2+E/g extract) > S2 (1.90±0.06) and S3 (1.90±0.16 mM Fe2+E/g extract) > S5 (1.15±0.05) and S6 (0.71±0.06 mM Fe2+E/g extract). Direct comparison of FRAP activity with available literature was difficult due to different standard and unit used. However, previous study showed that effective concentration (EC50) of C. rotundata leaves (2.58 µg/mL) exhibited more potent FRAP activity than rhizomes (1.39 µg/mL) (Jeyapragash, Subhashini, Raja, Abirami, & Thangaradjou, 2016).

0.71 (d) S6 141.59 (a) 41.01 (b) 13.87 (d) 1.15 (d) S5 109.17 (bc) 51.08 (a) 17.63 (c) 3.71 (a) S4 95.05 (c) 50.16 (a) 25.37 (b) 1.90 (c) S3 99.46 (bc) 41.56 (b) TPC (mg GAE/g 26.17 (b) extract) 1.90 (c) 90.51 (c) TFC (mg QE/g S2 extract) 53.93 (a) 28.20 (a) DPPH (µg/mL) 2.86 (b) 41.58 (d) S1 FRAP (mM 33.78 (c) Fe2+E/g extract) 27.82 (a) 0.00 50.00 100.00 150.00 200.00

54

3- 2- Var L W LS L/W T P DO C TDS S pH NH3 NO NO TPC TFC DPPH FRAP L 1 W 1 LS 1 L/W 1 Correlation matrix (Pearson (n)) T -0.85 1 P 1 0 1 DO 1 C -0.86 0.86 1 TDS -0.85 0.88 0.99 1 S -0.82 0.95 0.90 1 pH 0.94 1 NH3 1 NO3- 0.82 0.98 1 NO2- 0.94 0.92 1 TPC 1 TFC 1 DPPH -0.97 -0.80 -0.80 1 FRAP 1

Figure 1. (a) Antioxidant activity of seagrass Cymodocea rotundata from various seagrass beds. Bars sharing the same alphabets (a>b>c>d) are not significantly different (p<0.05, DMRT). (b) Pearson’s correlation matrix (n) of the variables with values in bold are different from 0 with a significance level alpha=0.05. Abbreviation: L= leaf length, W= leaf width, LS= leaf sheath length, L/W: leaf length to width ratio, T= temperature, P= atmospheric pressure, DO= dissolved oxygen, C= conductivity, TDS= total dissolved solid, S= salinity, NH3= ammonia, NO3-= nitrate, NO2-= nitrite, TPC= total phenolic content

Habitat influence on seagrass morphometric and antioxidant activity

Seagrasses under studied are clustered into 3 groups according to the PCA and AHC variables (Figure 2a-c). PCA factor of F1 (37.52%) and F2 (31.40%) were accounted for 68.93% of the total variance (Figure 2a & b). LS, pH, DPPH, DO and TFC, were positively correlated with F1, while L/W, T, TDS, S, C, DPPH and DO were positively correlated with F2. Based on the PCA score biplot and AHC dendogram, the seagrasses are clustered into 3 groups. Group A comprises of sample from S1 and S2 which were characterized with long leaf blade (13.6±2.3 cm and 9.4±1.6 cm, respectively), short leaf sheath (29.29±3.63 and 33.71±4.37 mm, respectively) and inhabit high water salinity (26.07-32.78 PSU), nitrate (1.6-2.0 mg/mL) and nitrite (0.023-0.036 mg/mL) environments. Seagrasses collected from these areas exhibited a potent DPPH EC50 activity of very strong (S1) to strong (S2) according to antioxidant power classification (Blois, 1958). Nitrate was strongly correlated with leaf blade length (r=0.82, p<0.05) which proved that C. rotundata grows in high water nitrate environment possessed long leaf blade (13.6±2.3 cm). However, nitrate enrichment combined with low light treatment may reduce seagrass leaf growth rate, since the light, energy and carbon skeletons were insufficient to support nitrate reduction (Jiang, Huang, & Zhang, 2013). Group B includes samples from S4, S5 and S6 from Sabah, which inhabit clear water with high DO (5.97-7.59 mg/L), low nitrate (1.0-1.1 mg/mL) and low nitrite (0.002-0.013 mg/mL) level. Samples collected from Sabah possessed intermediate (S5 and S6) to strong (S4) DPPH EC50 activity. The absent of the nitrate stressor reduces the antioxidant activity of the seagrass. Group C consists only sample from S3 with longest leaf sheath (42.48±6.68 mm) inhabit in low water conductivity (21621±4209 S/cm), total dissolved solid (16380±4896 mg/L)

55 and salinity (10.69±3.15 PSU). Pearson’s correlation analysis showed that (Figure 1b) the water conductivity, total dissolved solid and salinity were inversely strong correlated with seagrass leaf sheath length (r= -0.86, -0.85 and -0.82, respectively), which suggest that seagrass lives under these parameter values could produce longer leaf sheath.

Figure 2. (a) Biplot of principal component analysis (PCA) variables, (b) Biplot of PCA score and (c) Dendogram of agglomerative hierarchical clustering (AHC) of variables.

Conclusion The findings from this present study showed that water nitrate influences the morphometric changes of C. rotundata’s leaf blade length (r=0.82, p<0.05). High seawater nitrate produced long-leaved C. rotundata, e.g., sample from Teluk Pelanduk (S1, 13.6±2.3 cm). Long-leaved C. rotundata also possessed a very strong DPPH antioxidant activity (r=-0.97, p<0.05) with EC50 value of 41.58±7.87 µg/mL. This suggests that the leaf morphometric of C. rotundata can be used as references for monitoring the water quality and antioxidant status of the seagrass.

56

Acknowledgement This project was funded by Forest City, Country Garden Pacific View, Johor entitled “Monitoring of Seagrass Species, Coverage and Adaptability”. We would like to acknowledge Universiti Putra Malaysia (UPM) for technical support and assistance in this research project.

References

Addinsoft. (2015). XLSTAT V. 2015.1. 01: Data Analysis and Statistics Software for Microsoft Excel. Addinsoft, USA.

Benzie, I. F. & Strain, J. J. (1996). The ferric reducing ability of plasma (FRAP) as a measure of “antioxidant power”: the FRAP assay. Analytical Biochemistry, 239(1), 70-76.

Blois, M. S. (1958). Antioxidant determinations by the use of a stable free radical. Nature, 181(4617), 1199-1200.

Bujang, J. S., Zakaria, M. H. & Arshad, A. (2006). Distribution and significance of seagrass ecosystems in Malaysia. Aquatic Ecosystem Health & Management, 9(2), 203-214.

Cheng, Z., Moore, J. & Yu, L. (2006). High-throughput relative DPPH radical scavenging capacity assay. Journal of Agricultural & Food Chemistry, 54(20), 7429- 7436.

Chia, Y. Y., Kanthimathi, M. S., Khoo, K. S., Rajarajeswaran, J., Cheng, H. M. & Yap, W. S. (2015). Antioxidant and cytotoxic activities of three species of tropical seaweeds. BMC Complementary & Alternative Medicine, 15(339), 1-14. de la Torre-Castro, M. & Rönnbäck, P. (2004). Links between humans and seagrasses—an example from tropical East Africa. Ocean & Coastal Management, 47(7), 361-387.

Grignon-Dubois, M., Rezzonico, B. & Alcoverro, T. (2012). Regional scale patterns in seagrass defences: Phenolic acid content in Zostera noltii. Estuarine, Coastal & Shelf Science, 114, 18-22.

Hach Company (2004). DR/2400 Spectrophotometer Procedure Manual. Colorado, USA.

He, Y., He, Z., He, F. & Wan, H. (2012). Determination of quercetin, plumbagin and total flavonoids in Drosera peltata Smith var. glabrata YZ Ruan. Pharmacognosy Magazine, 8(32), 263-267.

Jeyapragash, D., Subhashini, P., Raja, S., Abirami, K. & Thangaradjou, T. (2016). Evaluation of in-vitro antioxidant activity of seagrasses: signals for potential alternate source. Free Radicals & Antioxidants, 6(1), 77-89.

Jiang, Z., Huang, X. & Zhang, J. (2013). Effect of nitrate enrichment and salinity reduction on the seagrass Thalassia hemprichii previously grown in low light. Journal of Experimental Marine Biology & Ecology, 443, 114-122.

Kannan, R. R. R., Arumugam, R., Thangaradjou, T. & Anantharaman, P. (2013).

57

Phytochemical constituents, antioxidant properties and p-coumaric acid analysis in some seagrasses. Food Research International, 54, 1229-1236. Kavita, K., Singh, V. K. & Jha, B. (2014). 24-Branched Δ5 sterols from Laurencia papillosa red seaweed with antibacterial activity against human pathogenic bacteria. Microbiological Research, 169, 301-306.

Newmaster, A. F., Berg, K. J., Ragupathy, S., Palanisamy, M., Sambandan, K. & Newmaster, S. G. (2011). Local knowledge and conservation of seagrasses in the Tamil Nadu State of India. Journal Of Ethnobiology & Ethnomedicine, 7(37), 1-17.

Santoso, J., Anwariyah, S., Rumiantin, R. O., Putri, A. P., Ukhty, N. & Yoshie-Stark, Y. (2012). Phenol content, antioxidant activity and fibers profile of four tropical seagrasses from Indonesia. Journal of Coastal Development, 15(2), 189-196.

Sithranga Boopathy, N. & Kathiresan, K. (2015). Anticancer drugs from marine flora: an overview. Journal of Oncology, 2010, 1-18.

Wells, M. L., Potin, P., Craigie, J. S., Raven, J. A., Merchant, S. S., Helliwell, K. E., Smith, A. G., Camire, M. E. & Brawley, S. H. (2016). Algae as nutritional and functional food sources: revisiting our understanding. Journal of Applied Phycology, 29(2), 949-982.

Zhang, Q., Zhang, J., Shen, J., Silva, A., Dennis, D. A. & Barrow, C. J. (2006). A simple 96-well microplate method for estimation of total polyphenol content in seaweeds. Journal of Applied Phycology, 18(3), 445-450.

58

2.9 Nutrient content of wild pepper, Piper umbellatum from Sg. Asap Koyan, Belaga, Sarawak

Summary

Green leafy vegetables are great sources of nutrition that are good for human consumption. The consumption of green leafy vegetables from natural resources is very importance among the local community of Sarawak especially Kenyah and Orang Ulu people such as wild pepper, Piper umbellatum. The shoot of this plant has been collected in the nearest secondary forest floor for their own consumption and sell it in local wet market. However, there is no information available regarding on the consumption methods and nutrients status. This wild vegetable was bought from the local market in Sg. Asap Koyan, Belaga, Sarawak. Analyses were done using standard analytical methods. The leaves were cooked with fish together as a side dish so that the aroma and taste of the leaves can be absorbed by fish. The values of crude protein, crude fat, carbohydrate, moisture, ash and crude fiber were 6.57%, 1.78%, 58.32%, 75.66%, 15.00% and 18.33% respectively. The content of sodium was 31.33mg/100g, calcium (62.67mg/100g), potassium (138.00mg/100g), magnesium (24.00mg/100g), iron (0.75mg/100g), copper (0.12mg/100g) and manganese (2.57mg/100g). The anti-nutrient compositions are oxalate (637.50mg/100g) and phytate (974.60mg/100g). These results showed that this vegetable contained an appreciable amount of nutrient and mineral elements and should be included in diets to supplement our daily allowance needed by the body. The anti-nutrient level in this plant was higher however it can be consumed without harmful effect by soaking and cooking it properly.

Keywords: Piper umbellatum; leafy vegetable; nutrient content

Introduction

A vegetable can be defined as any an edible plant, usually succulent plant or a portion of plant eaten with staples as main course or as supplementary food in cooked or raw form (Jocelyn Tsao and Lo, 2003). Plant leaves eaten as a vegetable and also called it as leafy vegetables; potherbs, greens or leafy greens, sometimes accompanied by tender petioles and shoots. There are several types of plant species with edible leaves. Regularly they come from short-lived herbaceous plants such as lettuce, spinach and kale. Leafy vegetables also can be eaten raw or cooked. They can be processed into different kind of products such as minimally processed, canned, fermented, frozen and dehydrated product.

There are some species of Piper that has specific used in traditional medicine such as P. umbellatum. This species has several common names like lemba, lomba, segumbar urat, kiambai and cow-feet leaf (Quattrocchi, 2012). In Peninsular Malaysia, the native people which is Temuan ethnic or Proto-Malays ethnic group consumed this kind of plant. Besides that, in Sarawak, Kenyah ethnic in Belaga district consumed this plant as leafy vegetable. The plant has been collected in the nearest secondary forest floor for their own consumption and also sell it in local wet market. However, overharvesting in the forest will cause the decreasing population of the P. umbellatum. The main threat to the survival of local or indigenous vegetables is because of habitat loss due to the development activities such as timber harvesting, conversion into agricultural lands, and various activities related to human (Ong et al. 2011). Moreover, there is no information available regarding on the on its nutrients status.

59

Materials and Methods

Consumption Methods

The leaves of P. umbellatum were purchased from market at Sungai Asap Koyan, Belaga, Sarawak and used for this study (Figure 1). A personal conversation or informal interviews were correlated of five respondents selected randomly related to P. umbellatum. The questions were asked to local people such as the local names of plant, the habitat, plant part used, cooking recipe and taste of cooked vegetables.

a b

Figure 1: (a) Piper umbellatum and (b) location of study site at Sungai Asap Koyan, Belaga, Sarawak.

Nutrients and Anti-nutrients Content Analysis

All samples were clean and washed several times using tap water and distilled water. The samples were divided into fresh samples and dried samples. The fresh samples were chopped into smaller parts and then used for determination of moisture content, an also were grinded, sieved and stored for further analysis. Moisture, ash, crude protein, crude fiber, crude fat and carbohydrate were determined by using official methods of food analysis of the Association of Official Analytical Chemists (AOAC, 1992) while mineral content was determined using AOAC Method 975.03. The concentration of Na, K, Ca, Mg, Cu, Mn and Fe were analyzed using Atomic Absorption Spectrophotometer (AAS). The anti- nutrient content such as oxalate and phytic acid was determined by titration methods as described Day and Underwood (1986) and Ebana et al. (2016). Each analysis were used five replications.

Results and Discussion

Consumption Methods

Piper umbellatum has several common names, but it varies by region. Local name of this plant according to local or ethnic Kenyah people in Belaga is "Balung". The parts used are the young leaves and usually they cook the leaves before eating and no one eats it raw. The leaves were cut into small pieces and cooked with fish as a side dish. There are others opinion where they wrap fish with leaves and cooked together so that the aroma and taste of the leaves can be absorbed by fish.

60

Nutrients and Anti-nutrients Content

The results of proximate composition, mineral content and anti-nutrient contents of P. umbellatum is shown in Table 1. The moisture content is 75.66% while ash content is 15.00%. The moisture content recorded was similar with the study conducted by Maisarah et al. (2014) in Carica papaya leaves (75.40%). Fresh vegetables have high water activity and their neutral pH would lead to spoilage and reduced the shelf life of vegetables due to its susceptibility to microbial attack (Akpabio and Ikpe, 2013). Nevertheless, high ash content in the leaves would imply high mineral content, hence very nutritious (Chibuzo et.al. 2014). The ash content obtained in this study was slightly similar to the study done by Aletor et al. (2002) in Vernonia amygdalina (12.10%).

Crude protein obtained in this plant was low which is 6.57% and four times lower than the study conducted by Nwauzoma and Dawari (2013) in the same species. The recommended dietary intake of protein for male and female adults is in the range of 56000 mg/day and 46000 mg/day, respectively. For each 100g, only 14.28% meet recommended of Dietary Reference Intake (DRI) and 0.70 kg of the plant is needed to meet the requirement of DRI. Whereas, the fiber content of the studied leafy vegetable recorded higher amount of fiber when compared to other Malaysian leafy vegetables of Monochoria vaginalis (11.30%) and Neptunia oleracea (2.66%) (Saupi et al. 2015). Daily fiber recommendations intake is in range of 38000 mg/day for male adults and 25000 mg/day for female adults. For each 100g of this vegetable, the fiber was 73.32% of DRI and need 0.14 kg of to meet the requirement of daily intake.

Fat also needed to absorb vitamins A, D, E and K. Eating too much fat and cholesterol is bad for human health but if do not take reasonable fat intake in a food it can cause a shortage of vitamins that can be harmful to human health (Ong, 2006). Piper umbellatum has a very low amount of fat and not too high carbohydrate which only 8.90% and 44.86% of DRI respectively. This leafy vegetable is suitable for people who want to lose weight effortlessly while allowing for a bit of carbs in their diet.

The potassium (K) content in P. umbellatum is 138.00 mg/100g approximately 50 times lower than in Peperomia pellucida (6977.00 mg/100g) studied by Ooi et al. (2012).The recommended K intake for male and female adults is 4700 mg/day. However, for each 100g there are only 2.94% of DRI and required more than 3.40 kg to meet the daily requirement. Potassium is crucial to heart function and plays a key role in skeletal and smooth muscle contraction. Having too much potassium in the blood is called hyperkalemia and having too little is known as hypokalemia (Thompson and Ward, 2007).

The amount of sodium (Na) in this study is 31.33 mg/100g slightly similar compared to other Malaysian leafy vegetables such as P. pellucida (53.92 mg/100g) by Ooi et al. (2012). The recommended of Na intake for male and female adults is 1500 mg/day. The studied vegetable is good source of low Na since there are only meet 0.02% of DRI. Sodium helps to regulate fluid balance in the body, helping nerve and muscle function and hyponatremia is occurs when having low amount of sodium and too much of water in body (Ong, 2006). K/Na ratio for P. umbellatum is 4.52. A diet in rich of fruits and vegetables which contain high in K and low in Na are help in treating hypertension (Pizzorno et al. 2016).

61

Calcium (Ca) concentration in P. umbellatum is 62.67 mg/100g similar to study conducted by Saha et al. (2015) in Basella rubra (65.30 mg/100g). The recommended of Ca intake for female and male adults is 1000 mg/day and this vegetable contributed 6.27% of DRI in 100 g dish. About 1.59 kg is needed to meet the daily requirement intake. Calcium helps in blood clotting and muscle function, growth and maintenance of strong bones and teeth, important for postmenopausal women and prevent it from osteoporosis (Ong, 2006). Magnesium content obtained is 24.00 mg/100g. This mineral helps in protecting the heart and absorbing calcium in the bones (Suarez, 2014). Daily magnesium recommendations intake is in range of 400-420 mg/day for male adults and 310-360 mg/day for female adults respectively.

The manganese (Mn) amount in P. umbellatum is 2.57 mg/100g and exceeded the amount of recommended dietary intake for Mn which is 1.8-2.3 mg/day for adults. However, this element is important in activates many enzymes that help in controlling the metabolisms of cholesterol, amino acids, carbohydrates and some vitamins (Zeng, 2010). In this study, copper (Cu) concentration of P. umbellatum is 0.21 mg/100g and did not meet the standard of recommended dietary intake for children and adults and require 0.75 kg of this plant to meet the daily requirement. However, the excess of Cu in human system would lead to eczema, anemia, high blood pressure, stomach pain and severe damage to the central nervous system (Balch, 2006).

Based on the study, the oxalate content of P. umbellatum is 637.50 mg/100g and 19 times lower than Radek and Savage (2008) in Spinacia oleracea (12576.2 mg/100g). For each 100g of this vegetable, only 68.00% of oxalate is meet the DRI and the consumers should not to consume it more than 0.14 kg of P. umbellatum. Oxalates will be interfered with calcium absorption and caused crystalize in tissues if consumed regularly, creating arthritis- like symptoms and even kidney stones (Heaney and Weaver, 1989).

While, the phytate content obtained in this study is 974.50 mg/100g. The excessive amounts of phytic acid in the diet will form insoluble complexes with multi-charged metals such as copper (II), zinc (II), calcium (II) and iron (III) (Morris, 1986). This vegetable content high amount of phytate but only meet 21.66% of maximum level of DRI in 100g. The intake of phytate should be reduced for best health, ideally to 25 mg/100g or less or to about 0.035% of the phytate containing food eaten and at this level micronutrient losses are minimized (Onomi et al., 2004).

62

Table 1: The nutrients and anti-nutrients content in P. umbellatum presented in dry weight basis

Elements Concentration DRI (%) Estimated weight (kg) Proximate (%) Moisture* 75.66 + 2.51 - - Ash 15.00 + 0.23 - - Protein 6.57 + 0.88 14.28 0.70 Fiber 18.33 + 1.67 73.32 0.14 Fat 1.78 + 0.11 8.90 1.12 Carbohydrate 58.32 + 2.33 44.86 0.22 Mineral Content (mg/100g) Na 31.33 + 4.06 6.27 1.59 K 138.00 + 8.72 2.94 3.41 Ca 62.67 + 4.67 6.27 1.59 Mg 24.00 + 2.31 7.50 1.33 Cu 0.12 + 0.01 13.33 0.75 Mn 2.57 + 0.28 142.78 - Fe 0.75 + 0.04 4.17 2.40 K/Na 4.52 Anti-nutrient (mg/100g) Oxalate 637.50 + 143.09 68.55 0.14 Phytate 974.60 + 61.38 21.66 0.46 *values with asterisk represented in wet weight basis, percentage of contribution to DRI as reported by Institute of Medicine of National Academies (2010) and estimated weight to meet DRI

Conclusion

As a conclusion, P. umbellatum has contained good source of carbohydrates and fiber, however the minerals content like calcium, iron, and magnesium is not sufficient for human consumption. The anti-nutrient level in this plant was higher however it can be consumed without harmful effect by soaking and cooking it properly. Therefore, this plant should be included in diets to supplement our daily allowance needed by the body. Besides that, analysis on vitamins, anti-oxidant and other anti-nutrients such as tannin and saponin can be recommended to assess further on the plant nutritive properties.

Acknowledgements

The authors wish to acknowledge the Faculty of Agriculture and Food Sciences, Universiti Putra Malaysia Bintulu Sarawak Campus, Malaysia for technical support and the laboratory facilities provided. This research is funded by the Geran Putra - Inisiatif Putra Muda (IPM), UPM.

63

References

Akpabio, U., & Ikpe, E. (2013). Proximate composition and nutrient analysis of Aneilema aequinoctiale leaves. Asian Journal of Plant Science Resource, 3(2), 55–61.

Aletor, O., Oshodi, A., & Ipinmoroti, K. (2002). Chemical composition of common leafy vegetables and functional properties of their leaf protein concentrates. Food Chemistry, 78(1), 63–68.

AOAC. (1992). AOAC Official Methods of Analysis. Association of Official Agricultural Chemists. 15th (Volume 1). Washington, D.C. pp.136–138.

Balch, P. A. (2006). Prescription for nutritional healing. Penguin.

Chibuzo, N.S., Ebenezer, I.A., Ikpeama, A.I. Francess, A.O. (2014). The Nutritional and Anti - Nutritional Values of Two Culinary Herbs – Uziza Leaf (Piper guineense) and Scent Leaf (Ocimum gratissium) Popularly Used in Nigeria. International Journal of Scientific & Engineering Research, 5(12), 1160-1163.

Day, R.A. & Underwood, A.L. (1986). Quantitative Analysis. 5th Edition, Prentice Hall Publication, Upper Saddle River.

Ebana, R., Asamudo, N., Etok, C., Edet, U., & Onyebuisi, C. (2016). Phytochemical Screening, Nutrient Analysis and Antimicrobial Activity of the Leaves of Lasianthera africana and Dennettia tripetala on Clinical Isolates. Journal of Advance Biology and Biotechnology, 8(4), 1–9.

Heaney, R., & Weaver, C. M. (1989). Oxalate: effect on calcium absorbability. The American Journal of Clinical Nutrition, 50(4), 830–832.

Zeng, H. (2010). Nutrition Optimization for Health and Longevity. Universe, Inc. New York.

Jocelyn Tsao, S.J., & Lo, H.-F. (2003). Vegetables. In Handbook of Vegetable Preservation and Processing (Vols. 1–0). CRC Press.

Maisarah, A.M., Asmah, R., Fauziah, O. (2014). Proximate analysis, antioxidant and antiproliferative activities of different parts of Carica papaya. Journal of Nutrition and Food Science, 4, 267.

Morris, E. R. (1986). Phytate and dietary mineral bioavailability. In Graf, S. Phytic acid: Chemistry and Application. Minneapolis.

Institute of Medicine of National Academies. (2010). Dietary Reference Intakes: The Essential Guide to Nutrient Requirements. Washington, DC: National Academies Press.

Nwauzoma, A., & Dawari, S. L. (2013). Study on the phytochemical properties and proximate analysis of Piper umbellatum (LINN) from Nigeria. American Journal of Research Communication, 1(7), 164–177.

Ong, H. C. (2006). Sayuran: khasiat makanan & ubatan. Utusan Publications.

Ong, C.H., Chua, S., & Milow, P. (2011). Ethno-medicinal plants used by the Temuan villagers in Kampung Jeram Kedah, Negeri Sembilan, Malaysia. Ethno Med, 5(2), 95–100.

Onomi, S., Okazaki, Y., & Katayama, T. (2004). Effect of dietary level of phytic acid on hepatic and serum lipid status in rats fed a high-sucrose diet. Bioscience, Biotechnology, and Biochemistry, 68(6), 1379–1381.

64

Ooi, D.-J., Iqbal, S., & Ismail, M. (2012). Proximate composition, nutritional attributes and mineral composition of Peperomia pellucida L. (Ketumpangan Air) grown in Malaysia. Molecules, 17(9), 11139–11145.

Pizzorno, J. E., Murray, M. T., & Joiner-Bey, H. (2016). The Clinician’s Handbook of Natural Medicine E-Book. Elsevier Health Sciences.

Quattrocchi, U. (2012). CRC world dictionary of medicinal and poisonous plants: common names, scientific names, eponyms, synonyms, and etymology (5 Volume Set). CRC Press.

Radek, M., & Savage, G. (2008). Oxalates in some Indian green leafy vegetables. International Journal of Food Sciences and Nutrition, 59(3), 246–260.

Saha, J., Biswal, A., & Deka, S. (2015). Chemical composition of some underutilized green leafy vegetables of Sonitpur district of Assam, India. International Food Research Journal, 22(4), 1466-1473.

Saupi, N., Zakaria, M. H., Bujang, J. S., & Arshad, A. (2015). The proximate compositions and mineral contents of Neptunia oleracea Loureiro, an aquatic plant from Malaysia. Emirates Journal of Food and Agriculture, 27(3), 266.

Suarez, F. (2014). The Power of Your Metabolism. EBookit.com. Retrieved from https://books.google.com.my/books?id=zB50MIz84D8C

Thompson, L. U., & Ward, W. E. (2007). Optimizing women’s health through nutrition. CRC Press.

65

2.10 Morphological Characteristics of Wild Pepper, Piper umbellatum L. from Belaga, Sarawak

Piper umbellatum L. is one of the wild pepper plant that has been locally used by Orang Ulu community in Sg. Asap, Belaga, Sarawak as a leafy vegetables. The plant has only been collected from nearest secondary forest floor from four different locations which are near to river stream, on the dead trunk, at steep hill and rocky area. The objective of this study is to determine the environmental condition and morphological characteristics of P. umbellatum correspond to the location found. Moreover, there is lacking information available regarding on its environmental condition and morphological characteristics. Many previous studies done in other areas of Malaysia has only been focused on its medicinal values. The dimension analysis has been conducted on the vegetative part such as stem, leaf, petiole and reproductive part such as inflorescence and fruit. The environmental condition studied suggest that P. umbellatum prefer shady, moist habitats with moderate light penetrating through the forest gaps. Piper umbellatum grown at rocky area significantly had bigger size of stem, petiole, leaf, inflorescence and fruit when compared with other locations. Whereas, P. umbellatum grown at steep hill area significantly had smallest leaf, shortest petiole and absent of inflorescence and fruits. Piper umbellatum found at river stream and dead trunk had no significantly difference in stem and inflorescence size. This fundamental study can contribute a guidance and new information for the communities in order to domestic this plant as a source of food and also income.

Keywords: Piper umbellatum; wild pepper; morphological characteristics

Introduction

Piper umbellatum is a perennial scrambling shrub or woody herb that can reach up to 1.0 to 2.5 m tall (Roersch, 2010). According to Tawan et al. (2002) and da Silva et al. (2014), several common names are associated with this plant, such as Segumbar urat (Peninsular Malaysia), Lemba (Moluccas), Capeba or Pariparoba (Brazil), and Bumbu, Domboo, Tombo and Ucheng-ucheng (Java). Piper umbellatum is mostly grown wild in the forest, where it prefer shady, moist habitats with moderate light penetrating through the forest gaps. It is often creeping on the forest floors, fallen trunks and up on the living trees. In Malaysia, it can be found occasionally at the forest floor of Sungai Asap, Belaga Sarawak. Local people especially Kenyah ethnic used P. umbellatum as a leafy vegetable as it is sold at Sungai Asap, Belaga native market. Recently, the population of the plant was decreasing due to the overharvesting from the forest floor. They only collected this plant at wild for their consumption.

Most of the researches done on P. umbellatum are mainly focused only on its medicinal value purposes. As for example, the crushed fresh leaves of P. umbellatum can be applied to the wounds. Besides, it has been used in the treatment of peptic ulcers (da Silva Junior et al., 2016). In addition, there is less scientific data available on morphological characteristics are reported on previous studies. Therefore, this research was conducted to determine the morphological characteristics of P. umbellatum from four different locations which are near to river stream, on the dead trunk, at steep hill and rocky area in Sungai Asap forest in Belaga, Sarawak. The findings can be applied by the local communities as a new information in order to domestic the plants.

Materials and Methods

Piper umbellatum samples were collected at four different locations in Sg. Asap secondary forest, Belaga Sarawak. They are near to river banks (1), on dead trunks (2), at steep hill (3), and rocky area (4) as presented in Plate 1. Three plant found from each location was chosen

66 as samples. The soil pH, light intensity and soil moisture was measured using portable Takemura soil pH/moisture meter and lux meter respectively. The dimension of various parts of P. umbellatum samples was assessed and the traits studied presented in Table 1. This included vegetative structures such as stem, leaves and petiole also reproductive parts such as inflorescence and fruits (Plate 2). The traits of this plant were measured by using metric ruler and Mitutoya Digimatic Vernier Caliper whereas trichome length on leaf surface was measured under Keyence Digital Microscope VHX-600. The morphological characteristics of P. umbellatum were compared with significant differences at p≤0.05 (ANOVA, LSD) by using SAS window version 9.4.

1 2 3 4

Plate 1: The studied area: (1) near to river stream, (2) on dead trunk, (3) in steep hill, and (4) at rocky area

1 2 3

Plate 2: Various part of P. umbellatum studied: (1) leaf, (2) fruits or berries, (3) spike and peduncle

67

Table 1: The traits measured for various part of P. umbellatum plant

Plant part Quantitative traits Stem Plant height (m) Stem diameter (cm) Internode length (cm)

Leaf Leaf length (cm) Leaf width (mm) Trichome length on adaxial and abaxial surface (mm)

Petiole Petiole length (cm) Petiole basal diameter (mm) Petiole mid diameter (mm) Petiole apex diameter (mm)

Inflorescence Spike length (cm) Spike width (mm) Peduncle length (cm) Peduncle width (mm)

Fruit (berry) Berry diameter (mm) Pedicel length (cm) Pedicel width (mm)

Results and Discussion

Generally, the findings suggest that P. umbellatum growth was favorable in slightly acidic soil (Table 2). The result obtained showed that P. umbellatum collected from all four different locations had pH within the range of 6.23 to 6.70 with the highest reading was on dead trunk habitat. Soil pH was an important factor for the growth of native plant and most plant require an optimum pH of 5.5 to 7.0 (Islam et al.,1980). The pH recorded at all locations fall within this optimum range. Specifically, soil pH affecting the nutrient availability and organic matter decomposition, thus may influence the growing rate of plant (McCauley et al., 2017).

Piper umbellatum grown in all locations received light intensity in the ranged of 257 to 1356 W/m2 .The plant collected at area near to river stream had significantly the highest exposure to light. In contrast, rocky area was least exposed to light compared with other areas. This indicated that rocky area was more shaded than other areas and this condition was favorable for P. umbellatum growth. This suggest that P. umbellatum grown wild in the forest, where it prefer shady, moist habitats with moderate light penetrating through the forest gaps.

Besides, rocky area also was the moistest area as compared to other locations. This was due to the area was shaded and received the lowest light intensity compared to other location. The soil moisture at all location was low ranged from 0.00 to 0.53 (m3. m-3). According to Ali (2010) soil water are responsible for aeration, temperature, nutrient transport, uptake and formation. Thus, this factors may influence the growth of P. umbellatum at these areas.

68

Table 2: Latitude and longitude of studied location, soil pH, light intensity and soil moisture condition at different growth location of P. umbellatum in Sg. Asap forest, Belaga Sarawak.

Location Latitude N Soil pH Light Moisture and intensity content Longitude E (W/m2) (m3. m-3) Near to N 02° 56.566’ 6.23 ± 1356 ± 0.00c river E 113° 52.072 0.09b 2.08a stream On the N 03° 09.474’ 6.70 ± 388 ± 0.53 ± 0.14b dead trunk E 113° 92.913’ 0.08a 0.88b Steep hill N 02° 56.588’ 6.60 ± 387 ± 0.00c E 113° 51.590 0.10a 2.08b Rocky area N 03° 09.471’ 6.50 ± 257 ± 3.50 ± 0.29a E 113° 92.950 0.10a 3.79c

All values are given as means ± S.E. Different superscript alphabets in the same row indicate significant differences at p≤0.05 (ANOVA, LSD), i.e., a > b > c > d

Result on morphological characteristics of P. umbellatum showed that the stem can reach from 13.3 to 95.8 cm long with diameter ranged from 10.4 to 28.6 cm (Table 3). As reported by (Nwauzoma and Dawari, 2013) on P. umbellatum plant grown in Nigeria, the plants can achieved to 4 m height. Usually, the stem is divided into one or two branch and consists of 3 or 14 nodes per plant. According to Roersch (2010), the stem of P. umbellatum are numerous, branching off, succulent and ribbed. The internode length varies from 0.3 to 11.0 cm. The plant height of P. umbellatum grown in all locations showed no significant different, same goes to stem diameter. Meanwhile, internode length of P. umbellatum that grew on dead trunks and rocky area had relatively higher as compared to the plant that grew near to river stream and at steep hill. The internode length determined the stem length and difference of its elongation between these two areas may because of several factors such as temperature, light intensity, light quality, photoperiod, relative humidity, CO2 concentration and plant density at the area (Carvalho et al., 2002; Carvalho and Heuvelink, 2001).

The length of P. umbellatum leaf ranged from 9.5 to 40.5 cm where the width recorded is from 7.3 to 39.3 cm. The leaf length and width recorded was comparable with reported by Roersch (2010) with measurement of 5-40 cm x 5-40 cm. Both of the leaf surfaces consist of hairy structure called as trichome which can reach from 1.14 up to 2.46 cm on the adaxial surface and 0.38 to 1.02 cm on the abaxial surface. Commonly, the hairy structure developed at leafy part functioning to adapt with biotic and abiotic stress, protect plants against insects or herbivores and UV-B radiation (Medeiros and Boligon, 2007; Manetas, 2003; Gurr and McGrath, 2002). Besides, it functioning to retain water use efficiency in tropical secondary forest during drought (Kenzo et al,. 2008). Other than that, the leaf length and width found at rocky area and on the dead trunks are relatively higher to steep hill. This is because of the availability of nutrient and organic matter present in the ground and the dead trunks itself. Furthermore, the rocky area received least light intensity as compared to other area which was favorable for the growth. There are also abundant of decaying leaves around these two locations, which also contributed to organic matter and nutrients for the growth of P. umbellatum.

69

Petiole is the stalk that joins a leaf to a stem. All of the petioles found in four locations are grooved adaxially with light green coloration. The diameter of petiole is narrower from basal where the basal (3.4-16.3 cm), intermediate (3.1-15.2 cm) and apices (2.6-14.4 cm). The length of petiole ranged from 2.2 to 25.5 cm similar with recorded by Nwauzoma and Dawari (2013). The length of petiole found at the rocky area is relatively higher than the other locations. The diameter of petiole is narrower from basal to apices where P. umbellatum found near to the river showed a comparatively shorter of basal, intermediate and apex diameter of petiole compared to the other locations. Furthermore, the environmental condition recorded at near river stream area exposed to the highest light intensity which may influence the growth rate of internodes.

The inflorescence of P. umbellatum found at the river stream, on the dead trunk and rocky area consist of oblongoid spike with creamy white to yellowish orange color. The length of spike recorded is 2.3 to 8.8 cm with the width 3.2 to 15.7 cm. The peduncle is ranged from 0.5 to 6.2 cm long with 2.6 to 8.8 cm width. Besides, spike length found near to the river stream, dead trunks and rocky area at Sg. Asap forest showed no significant different, same goes to spike width, peduncle length and peduncle width. Whereas, the P. umbellatum plant found at the steep hill not developed the inflorescence part, hence the data was not available for comparison. The orientation is erect and usually in false umbels with the pedicels bearing the bracts. The spike is attached to a peduncle that is light green in color (Nwauzoma and Dawari, 2013). According to Jaramillo and Manos (2001), P. umbellatum have tightly congested inflorescence and have as few as two stamens.

All of the plant specimens of P. umbellatum found in four different locations in Sg. Asap forest bear fruits. However, there are absent of fruits observed at steep hill. Basically, the fruits of P. umbellatum are usually three-angled fleshy drupe or berries form, which is 3.2 to 5.5 cm in diameter. There are 39 to 198 berries attached to light green color of pedicel in one spike. There are no significant difference observed on several traits like berries diameter and pedicel width are also the same. However, the length of pedicel found near to the river stream is relatively shorter than the other locations. Similarly, the higher light intensity recorded for this area are the factors that influence the pedicel length.

70

Table 3: Summary of the quantitative morphological characteristics of P. umbellatum at four different locations in Sg. Asap forest, Belaga Sarawak. Traits Location River Dead trunk Steep hill Rocky area stream STEM Height 43.83±21.10a 27.00±3.72a 35.43±11.28a 53.47±21.35a (cm)

Diameter 15.63±2.63a 25.03±1.79a 17.30±4.02a 21.73±2.98a (cm)

Internode 4.72±0.71ab 5.59±0.55a 3.86±0.27b 5.53±0.34a length (cm) LEAF Length 25.30±0.93a 25.89±1.56a 18.71±1.70b 25.71±1.70a (cm) Width (cm) 15.57±0.86b 20.15±1.92a 14.06±1.30b 22.40±1.41a

PETIOLE Length(cm) 8.74±1.07bc 11.70±0.97ab 7.56±1.36c 14.87±1.24a

Basal 6.38±0.36c 9.33±0.73b 8.84±0.71b 11.83±0.57a diameter (mm) Petiole mid 5.27±0.29c 6.72±0.35b 8.05±0.59a 8.83±0.52a diameter (mm) Petiole 4.40±0.22c 5.85±0.38b 7.28±0.46a 8.11±0.53a apex diameter (mm) INFLORESCENCE Spike 6.28±0.63a 5.88±1.29a - 6.21±0.76a length (cm) Spike 7.95±0.96a 7.88±1.26a - 10.23±1.37a width (mm) Peduncle 2.94±0.63a 3.88±1.21a - 3.19±0.54a length (cm) Peduncle 4.36±0.48a 4.73±0.80a - 5.20±0.77a width (mm) FRUITS (BERRIES) Berry 4.14±0.14a 4.22±0.13a - 4.22±0.12a diameter (mm) Pedicel 0.55±0.03b 0.64±0.03a - 0.69±0.03a length (cm) Pedicel 0.90±0.08a 0.86±0.04a - 0.96±0.03a width

71

(mm)

Different superscript alphabets in the same row indicate significant differences at p≤0.05 (ANOVA, LSD), i.e., a > b > c > d. All values are given as mean ± S.E. The symbol (-) indicated not available at the studied location.

72

Conclusion

As a conclusion, Piper umbellatum is found growing in different various habitats and environments in Sg. Asap forest, Belaga Sarawak. In addition, it influenced themorphological characteristics and growth habits of this plant. Based on the results, P. umbellatum grew well and bigger alongside the river stream and rocky area in Sg. Asap forest, where it prefer shady and moist habitats with moderate light penetrating through the forest gaps. Moreover, organic matter existed in the soil also helps in P. umbellatum growth. As this plant is lack of scientific data on the agronomic requirements, future study should be conducted in field to evaluate the life cycle and growing performances of P. umbellatum.

References

Ali, M. H. (2010). Soil: A Media for Plant Growth. In M. H. Ali (Ed.), Fundamentals of Irrigation and On-farm Water Management: Volume 1 (pp. 107–218). New York, NY: Springer New York. https://doi.org/10.1007/978-1-4419-6335-2_4

Carvalho, S., & Heuvelink, E. (2001). Influence of greenhouse climate and plant density on external quality of chrysanthemum (Dendranthema grandiflorum (Ramat.) Kitamura): first steps towards a quality model. The Journal of Horticultural Science and Biotechnology, 76(3), 249–258.

Carvalho, S. M. P., Heuvelink, E., Cascais, R., & van Kooten, O. (2002). Effect of Day and Night Temperature on Internode and Stem Length in Chrysanthemum: Is Everything Explained by DIF? Annals of Botany, 90(1), 111–118. https://doi.org/10.1093/aob/mcf154. da Silva, I. F., de Oliveira, R. G., Soares, I. M., da Costa Alvim, T., Ascêncio, S. D., & de Oliveira Martins, D. T. (2014). Evaluation of acute toxicity, antibacterial activity, and mode of action of the hydroethanolic extract of Piper umbellatum L. Journal of Ethnopharmacology, 151(1), 137–143. da Silva Junior, I. F., Balogun, S. O., de Oliveira, R. G., Damazo, A. S., & de Oliveira Martins, D. T. (2016). Piper umbellatum L.: A medicinal plant with gastric-ulcer protective and ulcer healing effects in experimental rodent models. Journal of Ethnopharmacology, 192, 123– 131.

Gurr, G., & McGrath, D. (2002). Foliar pubescence and resistance to potato moth, Phthorimaea operculella, in Lycopersicon hirsutum. Entomologia Experimentalis et Applicata, 103(1), 35–41.

Islam, A. K. M. S., Edwards, D. G., & Asher, C. J. (1980). pH optima for crop growth. Plant and Soil, 54(3), 339–357. https://doi.org/10.1007/BF02181830

Jaramillo, M. A., & Manos, P. S. (2001). Phylogeny and patterns of floral diversity in the genus Piper (Piperaceae). American Journal of Botany, 88(4), 706–716.

Kenzo, T., Yoneda, R., Azani, M. A., & Majid, N. M. (2008). Changes in leaf water use after removal of leaf lower surface hairs on Mallotus macrostachyus (Euphorbiaceae) in a tropical secondary forest in Malaysia. Journal of Forest Research, 13(2), 137–142.

73

Manetas, Y. (2003). The importance of being hairy: the adverse effects of hair removal on stem photosynthesis of Verbascum speciosum are due to solar UV‐B radiation. New Phytologist, 158(3), 503–508.

McCauley, A., Jones, C. & Olson-Rutz. (2017). Soil pH and organic matter. Nutrient Management. 4449(8), 1-13.

Medeiros, L., & Boligon, D. S. (2007). Adaptations of two specialist herbivores to movement on the hairy leaf surface of their host, Solanum guaraniticum Hassl (Solanaceae). Revista Brasileira de Entomologia, 51(2), 210–216.

Nwauzoma, A., & Dawari, S. L. (2013). Study on the phytochemical properties and proximate analysis of Piper Umbellatum (LINN) from Nigeria. American Journal of Research Communication, 1(7), 164–177.

Roersch, C. M. (2010). Piper umbellatum L.: A comparative cross-cultural analysis of its medicinal uses and an ethnopharmacological evaluation. Journal of Ethnopharmacology, 131(3), 522–537.

Tawan, C., Ipor, I., Fashihuddin, B., & Hamsawi, S. (2002). A brief account on the wild Piper (Piperaceae) of the Crocker Range, Sabah. ASEAN Review of Biodiversity and Environmental Conservation (ARBEC).

74

2.11 Preliminary Phytochemical Screening Of Chrysanthemum morifolium Under Different Extraction Methods

Summary Chrysanthemum morifolium (chrysanthemum) is a herbaceous perennial flowering plant species which is native to Southeast Asia. Chrysanthemum is widely used in Traditional Chinese medicine (TCM) as it is believed to have various pharmacological effects such as anti-pyretics, detox, anti-inflammatory and anti-microbial. In TCM, many Chinese community use chrysanthemum as tea to cool down their body. The common methods of chrysanthemum tea preparation are infusion, decoction and maceration. Appropriate methods of chrysanthemum extraction can protect the phytochemical contents of primary and secondary metabolites in chrysanthemum. The most suitable method of chrysanthemum extraction without affecting its benefits was determined. Ranges of primary and secondary metabolites were tested and it was found that only carbohydrates, phenols, flavonoids, tannins and saponins were detected in all extraction methods for qualitative phytochemical screening. Therefore, it is suggested that infusion and decoction methods are most effective in extracting the main phytochemicals in chrysanthemum due to time factor. Keywords: Chrysanthemum morifolium; Chrysanthemum; Maceration; Decoction; Infusion; Phytochemical Introduction Chrysanthemum morifolium Ramat. is one of the well-known herbaceous plant species from Asteraceae Family. In China, C. morifolium is known as Júhuā (Gui et al., 2014), whereas in Malaysia, it is called Kek Hwa. C. morifolium can grow up to 2 to 3 feet in height. Flowers of C. morifolium are yellow in colour. C. morifolium has been cultivated in China since more than 2000 years ago due to its importance in culinary, medicinal and pharmacological industries. The dried flowers of C. morifolium have become commercialized in food beverage sector such as chrysanthemum herbal tea (Júhuā chá) and pastry (Duh, 1999; Liu et al., 2013). Apart from that, the dried capitulum of C. morifolium is widely used in Traditional Chinese Medicine (Liu, Ong, & Li, 2013). Besides that, chrysanthemum tea is good for diabetic patients (Yamamoto et al., 2015). C. morifolium can prohibit blood clotting, facilitate myocardial blood circulation and phagocytosis of white blood cell. Therefore, C. morifolium can be used to treat boils (furuncle) (Wu et al., 2010). The effectiveness of C. morifolium in medicine can be due to the metabolite compounds of primary and secondary metabolites present in C. morifolium. Primary metabolites are the essential substances involved in growth, development and reproduction of the plants. The absence of these substances will affect the growth of the plants. The example of primary metabolites are carbohydrate, amino acids and lipids.

Carbohydrates are organic compound that are diverse and rich in nature which are the most important source of energy for human. There are three (3) types of carbohydrate compounds which can be chemically classified depending on the number of sugar units in the molecule which are monosaccharides, disaccharides and polysaccharides. Plants manufacture their own carbohydrates through the process of photosynthesis and these carbohydrates are stored in the form of starch as a source of energy for plants. Besides, carbohydrates contribute to the building of cellular structure in plants. In the meantime, carbohydrates are beneficial to human health in which it can control blood glucose, insulin metabolism and serum cholesterol (Herrero et al., 2011).

75

Meanwhile, the constituents of proteins are termed amino acids and amino acids are essential in which it serves as structural components. Besides that, these proteins function as enzymes, hormones, antibodies and facilitate in membrane transport. Some fat serve several vital functions and not all fats are culprits in the diet. Fats and other related compounds belong to a category of lipids. Fatty acids are the simplest type of lipid. Fatty acids can be categorized into two (2) types of saturated and unsaturated. Saturated fats such as butter, lard and beef fat increase blood cholesterol level which can lead to cardiovascular diseases (Briggs, Petersen, & Kris-Etherton, 2017). Meanwhile, the unsaturated fats such as vegetable oils and fish oils can reduce the risk of cardiovascular diseases by preventing blood clots.

Besides primary metabolites, secondary metabolites are also present in plants. Secondary metabolites are the chemical defences that produced by the plants. In addition, secondary metabolites are essential for some biological activities at which it contributes to the flavour, colour and other benefits to human health (Ahmed et al., 2017). C. morifolium is a nutrition- rich plants that is rich in flavonoids specifically luteolin. Luteolin poses great potential as anti-inflammatory agent for virus infection (Liu et al., 2013). Due to the abundant presence of luteolin, C. morifolium may be provided with the efficacy like antihypertensive, radical eradication and hypolipidemic (Nepali et al., 2015). Moreover, luteolin also plays important roles in anti-oxidant and anti-diabetic (Xie et al., 2012).

Degradation of plant metabolites in C. morifolium may happen due to improper extractions. For example, overheating can affect the quality of plant metabolites. The efficient time for the extraction of C. morifolium is within 30 minutes with the temperature range of water between 90-100oC, in order to protect and maintain the nutrients and essential oils of C. morifolium (Sun et al., 2005). Considering C. morifolium poses many pharmacological benefits to human, the aim of this study was to investigate the presence of various primary and secondary metabolites in C. morifolium under different extraction methods which are infusion, decoction and maceration.

Materials and Methods

Extraction of plant materials

Infusion 6 g of dried chrysanthemum were steeped in 200 mL of hot water at 100 oC for 15 minutes. The extracts were filtered using filter paper and labelled for further use.

Decoction 6 g of dried chrysanthemum were boiled in 200 ml of hot water for 15 minutes. The extracts were filtered using filter paper and labelled for further use.

Maceration 6 g of dried chrysanthemum were macerated in 200 ml of room temperature water in a covered container. The maceration was left for 24 hours and stirred occasionally to allow to dissolve. The extracts were filtered using filter paper and labelled for further use.

Qualitative phytochemical analysis

Detection of carbohydrate 1 mL of Benedict’s solution was added to 1 mL of plant extracts and heated gently in water bath. Formation of red-orange precipitate indicates the presence of carbohydrate.

76

Detection of amino acids Ninhydrin test was used to detect the presence of amino acids. Few drops of 0.1% Ninhydrin were added to 2 mL of plant extracts and boiled for 2 minutes. Formation of purple colour indicates the presence of amino acids.

Detection of fats or oils The presence of fats can be identified by using Spot test. A filter paper was divided into three (3) parts. The plant extracts were dropped on the first part of filter paper by using a pipette and followed by a drop of ethanol on another part of the same filter paper. A drop of distilled water was then pippeted on the third part of the same filter paper. The filter paper was dried by waving it through the air. Appearance of a translucent spot on the plant extract part indicates the presence of fats.

Detection of phenols Ferric chloride test was used to detect the presence of phenols. 3 to 4 drops of 0.1% ferric chloride solution were added to the plant extracts. Formation of bluish black colour indicates the presence of phenols.

Detection of flavonoids 5 drops of 0.5 M NaOH were added to the plant extracts followed by a few drops of 0.1 M HCl. The yellow colour formation when NaOH is added will turn colourless by the adding of HCl indicates the presence of flavonoids.

Detection of anthocyanins 3 to 5 drops of NaOH were added to 2 mL of plant extracts. Formation of blue colour indicates the presence of anthocyanins.

Detection of tannins Few drops of 0.1% ferric chloride were added to 1 ml of plant extract and the formation of bluish black colour indicates the presence of tannin.

Detection of saponins 5 ml of plant extracts were shaken vertically. Saponins are present if foam produced remains for 10 minutes.

Results and Discussion

Qualitative phytochemical screening of primary and secondary metabolites were conducted for C. morifolium extracts from three (3) different extraction methods which were decoction, infusion and maceration. Table 1 shows the detection of some primary and secondary metabolites of C. morifolium using different tests. All C. morifolium extracts have indicated its presence of carbohydrates, phenols, flavonoids and saponins. Based on colour intensity, carbohydrates were detected as moderately present for infusion extracts and highly present for maceration extracts. Meanwhile, saponins were detected moderately present in decoction extracts and highly present in infusion extracts. Amino acids, fats and oils and anthocyanin were not detected in the qualititatve phytochemical screening.

77

Table 1: Qualitative Phytochemical Screening of Primary and Secondary Metabolites of C. morifolium Using Different Extraction Methods

Metabolites Decoction Infusion Maceration Carbohydrates + ++ +++ Amino Acids - - - Fats and Oils - - - Phenols + + + Flavonoids + + + Anthocyanins - - - Tannins + + + Saponins ++ +++ + Notes: + (present); ++ (Moderately present); +++ (Highly present) and - (not detected)

Benedict’s test was used to detect the presence of carbohydrates of reducing sugars by changing the colour of plant extracts to red-orange. Figure 1 shows the formation of red- orange colour in C. morifolium extracts from three (3) different extractions.

Figure 1: The C. morifolium extracts (a) before and (b) after Benedict’s test. The formation of red-orange colour indicates the presence of carbohydrates in C. morifolium extracts. 1=Decoction; 2=Infusion; 3=Maceration.

Benedict’s solution contains copper sulphate and the copper sulphate can be reduced by the aldehyde group in reducing sugars. The aldehyde group in reducing sugar reduced the soluble blue copper ions in copper (II) sulphate to insoluble copper (I) ions which red precipitate formed as a result of reducing copper (I) oxide (Kiple & Ornelas, 2008). The changes of the solution from blue to yellow, orange and red indicated the presence of the reducing sugar when the reaction of Benedict’s solution with extracts proceeded. The amount of reducing sugars in chrysanthemum can be estimated by the colouration developed. As the concentration of the reducing sugar increased, the reaction will form a brick-red colour solution or precipitation.

78

Pigments that are responsible for colours are essentially flavonoids. These flavonoids are categorized into many groups of which one of them is anthocyanins. Anthocyanins are known to give colours to flowers of pink, orange, red, violet and blue. Meanwhile, chalcones, aurones and yellow flavonols may contribute to yellow flower colours (Harborne, 1994). C. morifolium has yellow flowers which is believed to possess low amount of anthocyanin which sometimes may be challenging to detect its presence. In addition, the formation and production of the anthocyanins can be influenced by the environmental factors such as temperature and light intensity (Winkel-Shirley, 2002). Anthocyanins are very vulnerable at which it may undergo chemical degradation during the preparation and processing (Chung et al., 2015). Therefore, the low amount of anthocyanin in the flower petals will be lost during that time resulting in no detection.

The detection of saponins was done by using the foam test. The foam persisted for 10 minutes indicating the presence of saponins. Infusion method has produced foams with the thickest layer followed by decoction and maceration (Figure 2). The thickness of the foam produced can distinguish the quantity of saponins present. The infusion extraction had highest amount of saponins as compared to decoction and maceration.

Figure 2: The foams produced on top of C. morifolium extracts indicating the presence of saponins. 1=Decoction; 2=Infusion; 3=Maceration.

Saponins are surface-active compounds which are mainly produced by plants. Many great pharmacological benefits of saponins to human health have proven that saponins are essential in human diet and healthy lifestyle. Many pharmacological properties have reported that saponins are involved in anti-obesity, anti-inflammatory, immunostimulant, hypoglycemic, antifungal and cytotoxic activities (Marrelli, Conforti, Araniti, & Statti, 2016).

Both detection of phenols and tannins were using the same test which was ferric chloride test. When few drops of 0.1 % ferric chloride were added to the plant extracts of decoction, infusion and maceration, the extracts immediately turned into bluish black colours. The decoction has intense colour of bluish black followed by infusion and maceration (Figure 3).

79

Figure 3: C. morifolium extracts were added with 0.1% ferric chloride and turned bluish black. The formation of bluish black colour indicates the presence of phenols and tannins. A=Decoction; B=Infusion; C=Maceration.

Conclusion

Preliminary phytochemicals screening were conducted on C. morifolium under three (3) different preparation methods which were decoction, infusion and maceration. From the data, it is concluded and suggested that decoction and infusion are more efficient in preparing chrysanthemum flower drinks than maceration. This is due its efficiency in extracting the beneficial metabolites of carbohydrates, phenols, flavonoids, tannins and saponins. In addition, the preparation time needed for decoction and infusion is far less than maceration. Thus, this study has met its objectives of determining the most efficient method to prepare chrysanthemum flower drinks.

Acknowledgements

We would like to thank the Chief of Laboratory and laboratory assistants of Food Instrumentation Lab in UTHM Main Campus, Parit Raja. Also, to others who have helped in this project.

References

Ahmed, E., Arshad, M., & Khan, M. Z. (2017). Secondary metabolites and their multidimensional prospective in plant life. Journal of Pharmacognosy and Phytochemistry, 6(2), 205-214.

Briggs, M., Petersen, K., & Kris-Etherton, P. (2017). Saturated Fatty Acids and Cardiovascular Disease: Replacements for Saturated Fat to Reduce Cardiovascular Risk. Healthcare, 5(2), 29. doi:10.3390/healthcare5020029

Chung, C., Rojanasasithara, T., Mutilangi, W., & McClements, D. J. (2015). Enhanced stability of anthocyanin-based color in model beverage systems through whey protein isolate complexation. Food Research International, 76, 761-768. doi:10.1016/j.foodres.2015.07.003

Duh, P. D., Tu, Y. Y., & Yen, G. C. (1999). Antioxidant activity of water extract of Harng Jyur (Chrysanthemum morifolium Ramat). LWT-Food Science and Technology, 32(5), 269-277.

80

Gui, M., Du, J., Guo, J., Xiao, B., Yang, W., & Li, M. (2014). Aqueous Extract of Chrysanthemum morifolium Enhances the Antimelanogenic and Antioxidative Activities of the Mixture of Soy Peptide and Collagen Peptide. Journal of Traditional and Complementary Medicine, 4(3), 171-176. doi:10.4103/2225- 4110.128897

Harborne, J. B. (1994). The Flavonoids: Advances in research since 1986. London: Chapman & Hall.

Herrero, Miguel, Cifuentes, Alejandro, Ibáñez, Elena, … M. Dolores del. (2015). Advanced analysis of carbohydrates in foods. CRC Press.

Kiple, K. F., & Ornelas, K. C. (2008). The Cambridge world history of food: Vol. 1. Cambridge: Cambridge University Press.

Liu, F., Ong, E. S., & Li, S. F. Y. (2013). A green and effective approach for characterisation and quality control of Chrysanthemum by pressurized hot water extraction in combination with HPLC with UV absorbance detection. Food chemistry, 141(3), 1807-1813.

Marrelli, M., Conforti, F., Araniti, F., & Statti, G. (2016). Effects of Saponins on Lipid Metabolism: A Review of Potential Health Benefits in the Treatment of Obesity. Molecules, 21(10), 1404. doi:10.3390/molecules21101404

Sun, Q., Liang, Y., Lu, J., & Ye, Q. (2005). Effects of Different Extracting Methods on Quality of Tea infusion [J]. Journal of Tea, 2, 010.

Winkel-Shirley, B. (2002) Biosynthesis of flavonoids and effects of stress. Curr. Opin. Plant Biol. 5, 218–223.

Wu, L. Y., Gao, H. Z., Wang, X. L., Ye, J. H., Lu, J. L., & Liang, Y. R. (2010). Analysis of chemical composition of Chrysanthemum indicum flowers by GC/MS and HPLC. Journal of Medicinal Plants Research, 4(5), 421-426.

Xie, F., Lang, Q., Zhou, M., Zhang, H., Zhang, Z., Zhang, Y., ... & Yu, L. (2012). The dietary flavonoid luteolin inhibits Aurora B kinase activity and blocks proliferation of cancer cells. European Journal of Pharmaceutical Sciences, 46(5), 388-396.

Yamamoto, J., Tadaishi, M., Yamane, T., Oishi, Y., Shimizu, M., & Kobayashi-Hattori, K. (2015). Hot water extracts of edible Chrysanthemum morifolium Ramat. exert antidiabetic effects in obese diabetic KK-Aymice. Bioscience, Biotechnology, and Biochemistry, 79(7), 1147-1154. doi:10.1080/09168451.2015.1008975

81

CHAPTER 3

ECOLOGY

3.1 Comparison of Length-Weight Relationship of Cyclocheilichthys apogon (Valenciennes, 1842) between Tail Waters of Bakun Hydroelectric Dam and Batang Ai Hydroelectric Dam

Summary

This study was carried out at waters located immediately downstream of Bakun Hydroelectric and Batang Ai Hydrolectric Dam. These areas were previously natural river systems that changed into regulated ecosystem after impoundment and operation of the dams. Changes in habitat have been shown to affect the state of health of fishes living in the area. However, fishes are able to adapt towards changes that occur around them, as part of the evolutionary process to ensure survival. How well these fishes gradually adapt to this change over long period of time is still unknown. Batang Ai Dam was impounded about 31 years ago and the tail water environment is considered to have stabilized as compared to Bakun Dam which was impounded about 10 years ago. Therefore, the objective of this study was to compare the length-weight relationship (LWR) of Cyclocheilichthys apogon living in the tail water environment of the two dams. Linear regression analysis of LWR was conducted using SPPS to obtain the b values of this species for each area. The results showed that C. apogon living in tail water of Batang Ai Dam has higher b value (3.122, N=190) as compared to those living below Bakun Dam (2.927, N=80). Although this result shows that it is possible for fishes that live at tail water to tolerate and adapt to the impact of changes in habitat due to impoundment over time, it is still not an ideal habitat as indicated by the K factor obtained for the two areas.

Keywords: Tail water; Cyclocheilichthys apogon; Length-Weight Relationship; Condition factor; Tropical Hydroelectric Dam

Introduction

Sarawak is a rapidly developing state, as many power intensive industries have established their presence in the state. Hydroelectric dams were built by the State government to meet the high demand of energy. Tail water environment refers to the environment that is located below a dam. Before a river is impounded, the tail water is a natural river ecosystem with non-regulated flow regime. Once the dam is operational, the whole environment changed into a regulated river ecosystem. This has a huge impact towards fish assemblages in that area. However, fishes are known to adapt towards changes that occur around them as part of the evolutionary process to ensure their survival. However, adaption of fishes to changes due to tail waters in tropical Sarawak is still unknown. Throughout 31 years of its operation, the status of fish health below Batang Ai Hydroelectric Dam tail water is still unclear. Although few researches have been conducted in the area, most studies were focus in the reservoir area. Meanwhile, Bakun Dam started it operation 10 years ago and is therefore relatively new. This allows a comparison on the temporal effect towards the well-being of fish in the tail water area.Therefore, the objective of this study was to compare the length- weight relationship (LWR) of Cyclocheilichthys apogon living in the tail water environment of the two dams.

Materials and Methods

This study was carried out at two locations namely, Batang Ai Hydroelectric Dam and Bakun Hydroelectric Dam. Batang Air Hydroelectric Dam is located 175km away from Kuching. The study site is located at the section of Batang Ai that is below the power house or its tail water starting from Skarok (N01˚06'42.8" E111˚51'49.20") to Rasau (N 01˚05'50.17" E111˚44'00.26"). Samplings were carried out in October 2014 and January 2015.

82

Bakun Hydroelectric Dam is located 780 km away from Kuching. The sampling area was also at the tail water of Bakun power house starting from Long Bangu (N2˚46’17.6” E114˚01’57.9”)to Long Segaham (N2˚46’39.6” E114˚56’ 05.1”). Samplings were carried out from February 2016 until February 2017.

Fish samples were collected using monofilament and 3 layered gill nets. The mesh sizes for monofilament nets used were 2.5 cm, 5.0 cm, 6.4 and 7.6 cm. For the three layered net, the outer mesh size was 17.8cm and the inner layer was 10.2 cm. Fish samples were labelled and placed into iced cooler box and were later identified to the species level following Kottelat et al. (1993) and Robert (1989).

The formula used for LWR analysis is as follows; log W= log a + b log L (Keys, 1928) where, W is the body mass of the fish sample, L is the total length and a and b are constants. The Condition factor (K) was calculated using the equation; K = 100W/L3 (Pauly, 1983)

Samples with gonads present were omitted for this analysis. Eighty individuals were selected from Bakun and 190 individuals from Batang Ai. All samples were measured and weighted. Total length was measured from the snout till the end of the caudal finand body mass was measured using Shimadzu ELB 300 balance. All significant difference between study areas were determined using 2 tail independent t-test using SPSS window version 22.0.

Results

LWR results showed that fish in Bakun recorded lower b value compared to fish in Batang Ai (Table 1). The b value recorded in Bakun was 2.927 (Figure 1), which indicates that the individuals are experiencing negative allometric growth (Wotton, 1991). Meanwhile the b value recorded in Batang Ai was 3.122 (Figure 2), which indicates that they are experiencing positive allometric growth (Wotton, 1991). The a value recorded in Bakun was 1.9 with r2= 0.95, while in Batang Ai was 2.0 with r2= 0.98.

The mean of both total length and body mass was significantly different between the study areas (p<0.01). The mean length recorded for C. apogon in Bakun was 16.4 ± 3.4 cm, while in Batang Ai was 14.5 ± 2.9 cm. The mean mass was 52.73 ± 32.44 g in Bakun and 43.93 ± 23.05 g in Batang Ai (Table 1). Although the average total length of fish in Bakun was longer compared to those in Batang Ai, greater variation of fish length or higher SD was observed for fishes in Bakun. Similar value was also recorded for fish body mass in Bakun area.

K factor was also significantly different between study areas(p<0.01). The K factor recorded in Bakun was 1.1, meanwhile in Batang Ai was 1.3 (Table 1). According to Baxter & Barnham (1998) and Hamid et al. (2015), K = 1.00 indicate a poor condition fish, K = 1.2 indicate a moderate condition fish and K = 1.4 indicate a well-proportion fish. This indicates that the environmental conditions at both areas are not ideal for this species to grow.

Table 1: LWR parameters of C. apogon recorded from both study areas.

Mean Length Mean Mass Mean b a Area r2 (cm) (g) K value value 0.9 Bakun 16.4 ± 3.4 52.73 ± 32.44 1.1 2.927 1.9 5 0.9 Batang Ai 14.5 ± 2.9 43.93 ± 23.05 1.3 3.122 2.0 8

83

Total length (cm) Total length (cm) 0.2386x 0.1761x y = 1.1318e y = 2.4543e R² = 0.961 R² = 0.9162

Body mass (g) Body mass (g)

Figure 1: The growth curve of C. apogon from Batang Ai (left) and Bakun (right)

Log body mass (cm) Log body mass (cm)

y = 2.9275x - 1.8853 R² = 0.9506

y = 3.1222x - 2.0374 R² = 0.9812

Logtotal length (g) Log total length (g)

Figure 2: The LWR regression plot of C. apogon from Batang Ai (left) and Bakun (right).

Discussion

Cyclocheilichthys apogon living in the tail water of Batang Ai Dam showed sign of adaptation towards the environment. Despite the unfavorable environmental condition in both areas as expressed by the K factor, C. apogon in Batang Ai experienced positive allometric growth. Individuals in Batang Ai were shorter in length to compensate for a relatively good body mass. However, this was not observed in C. apogon living in tail water of Bakun Dam. According to Pervin & Mortuza (2009) and Hamid et al. (2015), high b values indicate a good appetite and gonad content of the fish. However, since this study had excluded individuals with gonad, it showed better representation of appetite and food availability as important factors affecting LWR. Offem et al. (2007); Kamal et al. (2011) and Hamid et al. (2015) also 84

reported that body mass of fish increases through feeding for growth and energy. Moreover, Iskandar (2014) reported that C. apogon feeding habit in tail water of Batang Ai changed from carnivorous to omnivorous behavior. Therefore, it is postulated that fish in tail water of Batang Ai adapt towards the utilization of food availability within the area throughout time and develop new way of feeding strategies, which allow them to be more efficient for survival in that area.

In addition, it is possible that individuals living in tail water of Batang Ai reduced their somatic growth to preserved energy for reproduction. According to Lester et al. (2004), a fish is sexually matured will divert its energy expenditure from somatic growth into reproduction. This could be the reason for the decrease in total length of C. apogon in tail water of Batang Ai. In contrast, C. apogon in tail water of Bakun Dam were trying to attain their traditional body mass before becoming sexually matured. The growth curve of C. apogon living in tail water of Bakun Dam showed elongation trend to the right which indicated slower body mass gained as the fishes grow. Studies by Leunda et al. (2006), Hossain et al. (2006), Pervin &Mortuza (2009), Emanuel et al. (2013),Hamid et al. (2015) and Noor et al. (2017)also reported that sexual maturation affects LWR. It is possible that by trying to achieve earlier sexual maturation, C. apogon in Batang Ai showed greater b value according to the cube law. However, the overall environment still causes stunted growth for this species.

A significantly higher K factor was recorded in the tail water of Batang Ai Dam as compared to Bakun Dam. Nonetheless, both areas scored below ideal condition for fish survival. The primary factor that potentially affects fish health is water quality of the environment. The continuous input of the tail water comes from the released reservoir water. Studies conducted by Ling et al. (2016) and Ling et al. (2017) in Bakun Reservoir reported that tail water environment are susceptible to environmental impact due to changes in physicochemical parameters cause by the upstream reservoir. Important parameter that affects fish health such as pH and DO was reported to be low. Meanwhile, Iskandar (2014) reported that fluctuation of flow regime in tail water of Batang Ai Dam affects the water quality. Subsequently, this phenomenon affects fish survival. Therefore, it is believed that environmental condition especially less favorable water quality in tail water affects fish survival and growth.

Conclusion

Cyclocheilichthys apogon living in Batang Ai tail water showed better tolerance to the detrimental effect of impoundment through time as compared to fishes in tail water of more recently impounded Bakun Dam. However, the overall condition for both environments is still unfavorable for fish growth. Continuous studies, involving more species should be carried out to monitor this effect spatially and temporally.

Acknowledgements

The authors greatly appreciate the facilities and assistance provided by Universiti Malaysia Sarawak and Sarawak Energy Berhad for the financial support through research grants GL (F07)/SEB/5A/2013 (28) and GL(F07)/SEB/2A/2013 (16).

References

Barnham, C., & Baxter, A. (1998). Condition Factor, K, for Salmonid Fish (pp. 1-3, Rep.). Victoria, Australia: Department of Primary Industries.

Emmanuel, L., Oluwakemi, A., & Omobolaji, G. (2013). Aspects of the Biology of African Moony, Monodactylus sebae from Badagry Creek, Lagos, Nigeria. Advances in Life Science and Technology, 12, 5-12.

Hamid, M. A., Mansor, M., & Nor, S. A. (2015). Length-weight Relationship and Condition Factor of Fish Populations in Temengor Reservoir: Indication of Environmental Health. Sains Malaysiana, 44(1), 61-66.

85

Hossain, M. Y., Ahmed, Z. F., Leunda, P. M., Jasmine, S., Oscoz, J., Miranda, R., & Ohtomi, J. (2006). Condition, length-weight and length-length relationships of the Asian striped catfish Mystus vittatus (Bloch, 1794) (Siluriformes: Bagridae) in the Mathabhanga River, southwestern Bangladesh. Journal of Applied Ichthyology, 22(4), 304-307.

Iskandar, N. (2014). Fish Assemblages and Water Quality at Downstream of Batang Ai Hydroelectric Dam, Lubok Antu, Sarawak. Unpublished bachelor degree thesis. Universiti Malaysia Sarawak, Kota Samarahan.

Kamal, A. M., Kamaruddin, I., Christianu, A., Daud, S., Amin, S., & Abit, L. Y. (2011). Length-weight Relationship and Condition Factor of Three Dominant Species from the Lake Tasik Kenyir, Terengganu, Malaysia. Journal of Fisheries and Aquatic Science, 6(7), 852-856.

Keys, A. B. (1928). The Weight-Length Relation in Fishes. Proceedings of the National Academy of Sciences, 14(12), 922-925.

Lester, N. P., Shuter, B. J., & Abrams, P. A. (2004). Interpreting the von Bertalanffy model of somatic growth in fishes: the cost of reproduction. Proceedings of the Royal Society B: Biological Sciences, 271(1548), 1625- 1631.

Leunda, P. M., Oscoz, J., & Miranda, R. (2006). Length-weight relationships of fishes from tributaries of the Ebro River, Spain. Journal of Applied Ichthyology, 22(4), 299-300.

Ling, T., Gerunsin, N., Soo, C., Nyanti, L., Sim, S., & Grinang, J. (2017). Seasonal Changes and Spatial Variation in Water Quality of a Large Young Tropical Reservoir and Its Downstream River. Journal of Chemistry, 2017, 1-16.

Ling, T., Soo, C., Heng, T. L., Nyanti, L., Sim, S., & Grinang, J. (2016). Physicochemical Characteristics of River Water Downstream of a Large Tropical Hydroelectric Dam. Journal of Chemistry, 2016, 1-7.

Noor, I., Nyanti, L., Ling, T. K., & Jongkar, G. (2017). Comparison of Length-Weight Relationship and Condition Factor of Three Fish Species between Regulated and Natural Rivers.

Offem, B. O., Akegbejo-Samsons, Y. & Omoniyi, I. T. (2007). Biological assessment of Oreochromis niloticus (Pisces: Cichlidae; Linne, 1958) in a tropical floodplain river. African Journal of Biotechnology, 6(16), 1966- 1971.

Pauly, D. (1983). Some Simple Methods for the Assessment of Tropical Fish Stock (1st ed.). Rome: Food and Agriculture Organization.

Pervin, M. R., & Mortuza, M. G. (2009). Notes on Length-Weight Relationship and Condition Factor of Fresh Water Fish, Labeo boga(Hamilton) (Cypriniformes: Cyprinidae). University Journal of Zoology, Rajshahi University,27(2009), 97-98.

Wootton, R. J. (1991). Ecology of teleost fishes. Berlin: Springer.

86

3.2 Threats and Conservation of Tropical Peat Swamp Forests

Summary

Tropical peat swamp forests (PSF) are unique ecosystem facing severe degradation worldwide. In the South East Asian (SEA) region particularly, the ecosystems are being destroyed at an unprecedented rate through pollution, waste disposal, large scale land conversion for agriculture, industrialization and settlement urbanization. This destruction of PSFs had resulted in severe biodiversity loss and the increased risk of already threatened plant and animal species going into extinction. Considering the various services provided by PSFs, their destruction is also injurious to human health and is linked to some deleterious climatic problems such as transboundary haze pollution. This paper recognizes draining and clearing of PSFs for oil palm plantations, a green cancer raging throughout the SEA region, as the chief cause of PSFs degradation. Among others, an uncompromised improvement of the present inadequate PSFs conservation measures, involving the conservation of the entire PSFs, with particular attention to the hydrological integrity and strict enforcement are recommended.

Keywords: Conservation; Tropical Peat Swamp Forests; Degradation; Oil Palm; Biodiversity Loss

Introduction

Peat swamp forests (PSFs) are one of the most unusual ecosystem in the tropical rainforest. The substrate of these swamps is made of peat, which comprise of plant detritus releasing tannins and organic acids inside the poorly buffered swamp contributing to its low pH (Yule, 2010; Posa, Wijedasa, & Corlett, 2011; Wantzen, Yule, Mathooko, & Pringle, 2011). Peat are generally highly combustible natural mineral product, formed through varying degrees of decomposition (usually partial) of dead swamp vegetation under conditions of excess moisture and little oxidation. It has a characteristic dark color impacted by humus. Generally, peat by combustible weight, comprises of 50–60 % carbon, 5–6.5 % hydrogen, 30–40 % oxygen, 1–3 % nitrogen, and 0.1–2.5 % sulfur. By organic matter content, it is made up of 1–5 % water-soluble substances, 2–10 % bitumen, 20–40 % readily hydrolysable compounds, 4–10 % cellulose, 15–50 % humic acids, and 5–20 % lignin (Prokhorov, 1982; Chernow & Vallasi, 2003; Parker, 2003).

Peat swamps are deficient in oxygen, resulting from plant decay (Beamish, Beamish, & Lim, 2003; Irvine, Vermette, & Mustafa, 2013). As a result of the characteristic dark colour of peat swamps, they are generally referred to as 'black waters'. Johnson (1967ab, 1968) defined black water as “waters originating from PSFs, highly acidic with pH ranging from 3.6 to 5.9, tea-coloured when seen against transmitted light, and black when seen en masse via reflected light”.

This unusual characteristic of black waters, unique in every aspect (dark colour, low dissolved oxygen and high acidity) (IPT-AWB, 1993; Beamish et al., 2003) led to a misinterpretation that black waters are generally inhospitality, and as such will sustain very poor faunal diversity (Ng, Tay, Lim, & Yang, 1992; Ng, Tay, & Lim, 1994). Consequently, these habitats were considered as a hindrance to development. This perception resulted in many PSFs, especially in the South East Asia (SEA) region, being marked for conversion to agriculture and infrastructural developments. Peat swamp forests represent approximately 12% of Southeast Asian land area (more than 27 million hectares), with 83% in Indonesia. The Southeast Asian PSFs make up 60% of the world’s tropical peatlands, however there are being degraded at an unprecedented rate (WI, 2014).

Threats of Tropical Peat Swamp Forests

The main threats to tropical PSFs, especially in the SEAregion, are overexploitation for forestry products, illegal loging, pollution, waste deposition, land reclamation, large scale land conversion for agriculture, industrialization and settlement-urbanization (Ng & Shamsudin, 2001; Chong, Lee & Lau, 2010). Furthermore, uncontrollable peat land fires resulting from the draining and clearing of the PSFs for agriculture and palm oil plantations has been a trending issue (Parish, 2002; Lo & Parish, 2013; Yule, 2015), which is a major cause of the annually recurring deleterious haze pollution in the SEA region (Lo & Parish, 2013; Yule, 2015). 87

Most of the PSFs of Singapore and Peninsular Malaysia documented by Wyatt-Smith (1959, 1964), Johnson (1967a, 1968), Anderson (1983) and Whitmore (1984, 1988) are now almost completely degraded (Ng et al., 1994). Peat swamp forests of considerable size in Malaysia are now found in the state of Selangor, Perak, Johor, Pahang and Terengganu (Ng et al., 1994; GEC, 2014).

Pollution with pesticides, fertilizer and waste disposal

Pollution such as use of pesticides, excess fertilizer application leading to eutrophication, and waste disposal are common problem in peat swamps. These problems however are rarely reported as their effects are considered minor when compared to the huge loss caused by draining, peatland clearing and largescale conversion. Pesticides are highly applied in the agricultural areas of PSFs with the aim of increasing yield (Figure 1). This eventually gets washed into the aquatic ecosystem where its toxicity can lead to death of the peat swamps biodiversity. In the same vein, the chemicals can get consumed by humans through the food chain(Nowell, Norman, Moran, Martin, & Stone, 2014).

Similarly, fertilizer is regularly applied in the agricultural areas of PSFs, which leads to eutrophication (Figure 2). This can pose serious problems for the aquatic ecosystem (Craft, Krull, & Graham, 2007; Tekile, Kim, & Kim, 2015). Waste disposal in peat swamps is a very common, especially in Malaysia (Figure 3 &4). Waste deposited in peat swamps leads to reduction in water quality for sustaining the biodiversity and sedimentation (Bailey, Clark, Ferris, Krause, & Strong, 2002),which subsequently results in habitat loss.

Figure 1: Pesticide application in the Figure 2: Eutrophication at a peat swamp of agricultural zones of North Selangor Peat North Selangor Peat Swamp Forest. Source:

Swamp Forest. Source: Authors collection. Authors collection.

Figure 3: Waste disposal at North Selangor Figure 4: Waste disposal at North Selangor Peat Peat Swamp Forest. Source: Authors Swamp Forest. Source: Authors collection. collection.

88

Illegal logging

One rather conspicuous problems contributing to peatland degradation is illegal logging (Prentice & Parish, 1992; Ng et al., 1994; Ng & Shamsudin, 2001; Shah et al., 2006; Yule & Gomez, 2008; Giam et al., 2012; Mullally & Dunphy, 2015). Like most degradation issues of PSFs in the SEA region, illegal logging activities pose many unanswered questions. For instance, where do the trees logged from PSFs go? How do such activities, especially the transportation process evade security? Perhaps logging of PSFs is not really ‘illegal’, but ‘discreet’, to portray almost non-significant PSFs conservation efforts. Besides that, it is also possible that conservation strategists disregarded external effects such as a growing market demand for forest and wildlife products, demographic pressures and vested interests (Chapin, 2004).Figure 5 and 6 shows ‘illegal’ logging activities in the PSFs of Sumatra, Indonesia.

Large scale land conversion and peatland fire

Also, peat swamps are being drained and converted to oil palm all over SEA region at an alarming rate. Figure 7 shows a recently drained peatland in North Selangor Peat Swamp Forest, Selangor, getting dried. This can be particularly injurious to human and animal health, considering the fact that dried peatlands are highly inflammable (Parish, 2002; Lo & Parish, 2013).To buttress this fact, with the latest peatland fire in Indonesia in October 2015, the country surpasses Russia as world’s fourth largest emitter (Harris, Minnemeyer, Sizer, Mann, & Payne, 2015). Did the fire start accidentally or it was deliberate? However, the right question to ask is; What next after the fire, will there be a concerted effort to regrow the forest, or will it become useful in expanding oil palm plantation? There is always vested interest in some ‘deliberate’ biodiversity loss.

Figure 5: Logs stacked by excavators a cutting Figure 6: Logging truck loaded with rainforest through the deep peatland in Sumatra, logs in Sumatra, Indonesia, May 2010. Source: Indonesia. Source: Jufri, (2013). Jufri, (2013).

As pointed out by Yule (2015), this ‘open burning’ of PSFs in Sumatra, Boneo and Peninsular Malaysia for the purpose of clearing peat swamps for oil palm plantations resulted in a record breaking haze pollution exceeding 2000 (level >100 is considered unhealthy, 500+ calls for emergency). Despite this health threat, the green cancer known as oil palm plantation rages on. Figure 8 shows a PSF burned to give way for oil palm plantations in Indonesia, while Figure 9 and 10 shows raging peatland fire in Boneo and Sumatra respectively.

89

Figure 7: Recently drained and drying peatland Figure 8: Peat swamp forest in Indonesia is in North Selangor Peat Swamp Forest. Source: burned to make way for palm oil Authors collection. plantations.Source: Novis, (2010).

Importance of Conservation of Peat Swamp Forests

Carbon sequestration and global warming

The degradation of PSFs has profound impact on human health, regional economies and global climate change. Peatlands are important carbon sink. One hectare of tropical peat forest with peat thickness ranging from one meter to 13 meters store about 1,000 metric tons (MT) to 7,500 MT (average of 2,009 MT of carbon per hectare), which is equivalent to the greenhouse gases released in one year by 1,551 passenger vehicles in the United States (Bell, 2014). The PSFs of Malaysia and Indonesia alone store 67 gigatons of carbon in peat, representing 75% of total tropical peat soil carbon storage (Page et al., 2011).

Figure 9: Burning peat swamps in Kalimantan, Figure 10: Burning peat swamps forest of Borneo. Source: ESA, (2003). Tripa, Aceh, Sumatra. Source: Tree-Nation, (2012).

Once a peat swamp is drained, the peat becomes exposed to oxygen allowing microbes to disintegrate the organic matter which releases carbon into the atmosphere. In the same vein, a hectare of peatland converted to, say oil palm plantation, releases 10–20 MT of carbon per year, compared to 0.5–1 MT released from a hectare of a natural unconverted peatland (Bell, 2014) (Figure11). Degraded and dried peatlands are highly inflammable and therefore susceptible to fires, which are impossible to extinguish (Langner, Miettinen, & Siegert, 2007; Langner & Siegert, 2009; Page et al., 2009). The fires burn underground, inaccessible to firefighters, protected from rain, and can burn for years (Bell, 2014).

90

Figure 11: Illustration showing degradation of tropical peatlands. Source: Mallya, (2015).

Flood control

In coastal areas, PSFs serve as freshwater buffers against intrusion of saltwater, hence protecting valuable agricultural areas (WI, 2014). Peat swamps also act as sponge, absorbing and storing excess rainwater, minimising the effect of floods in neighbouring low-land areas, and preventing excess water from flowing into rivers (Zakaria, 2015).

Globally important biodiversity reservoir

Peat swamp forests are home to diverse groups of animals. Mammals such as the tapir (Tapirus indicus), sun bear (Helarctos malayanus), wild boar (Sus scrofa), white-handed gibbon (Hyloblates lar), long-tailed macaque (Macaca fascicularis), dusky-leaf monkey (Presbytis obscurus) and banded-leaf monkey (Presbytis melalophos) have been recorded in the PSFs of Malaysia (GEC, 2014).

Currently, at least 92 bird species have been recorded from the north Selangor peat swamp forest (NSPSF) of Peninsular Malaysia. Of these, 14 fish species were listed as near threatened by the IUCN Red List of Threatened Species (IUCN, 2015). Also recorded from the PSFs of Peninsular Malaysia, particularly the NSPSF, are 17 species of spiders from families such as Araneidae, Salticidae, Tetragnathidae, Lycosidae, Oxyopidae and Theridiidae. In addition,47 species of insects from nine families of dragonflies and damselflies (Order: Odonata), representing 19% of the species found in Peninsular Malaysia were recorded in NSPSF alone(GEC, 2014).

A total of 17 species of amphibians from family Bufonidae, Raniidae, Microhylidae, Megophrydae and Rhacophoridae, and 16 species of reptiles from the family Agamidae, Gekkonidae, Scincidae, Varanidae, Elapidae, Boidae and Colubridae also have been recorded in NSPSF. Peat swamp forests generally have unique fish diversity. Many of the species of fish in the forest are unique to peat swamp and are not found in other habitats. From the PSFs of Malaysia alone, 179 peat swamp fish species from 32 families have been recorded (Davies & Abdullah, 1989; IPT-AWB, 1993;Ng et al., 1994;Kottelat & Whitten, 1996; Zakaria, Mansor, & Ali, 1999; Beamish et al., 2003; Shah et al., 2006;Giam et al., 2012; Ahmad, Ahmad, & Nek, 2013; Ismail et al., 2013; Siow, Ramli, Shakori, & Asmuni, 2013), with 12 species listed as threatened and facing risk of extinction by the IUCN Red List (IUCN, 2015).

Furthermore, unique and endangered species such as the critically endangered Sumatran tiger (Panthera tigris sumatrae), Sumatran orangutan (Pongo pygmaeus abelii), Bornean orangutan (Pongo pygmaeus pygmaeus), and many endangered gibbon species are found in PSFs. Many of the mammals (45%) and birds (33%) recorded in peat swamps are listed as either near threatened, vulnerable, or endangered by the IUCN Red List of Threatened Species (Posa et al., 2011). Peat swamp forests therefore are important biodiversity reservoirs and the present peatland conversion if continued will result in the extinction of many unique species in the near future.

91

Conclusion

Tropical peat swamp forests are important, particularly for the immediate human populations and the world generally. They provide invaluable services and their continued destruction would be detrimental to human life. Considering the increased global warming in recent times, more degradation of PSFs would be disastrous, considering the millions of tons of carbon stored in peatlands. Besides, conserving this ecosystem will contribute immensely to actualization of the refined Convention on Biological Diversity (CBD) 2020 Target, aimed at reducing or halting the loss of the Earth’s biodiversity by the year 2020 (CBD, 2010a, 2010b; Jungcurt, 2013).

The existing measures aimed at conserving only some part of this unique ecosystem is definitely not enough, and large scale degradation continues. As such, the present ongoing global concerted effort for the conservation and sustainable use of PSFs should be improved. Policies and legislations should be put in place to protect the entire peat swamp forests of the world, and maintain their hydrological integrity. In addition, existing laws prohibiting ‘illegal’ logging of PSFs trees should be more strictly implemented and perpetrators should be prosecuted.

References

Ahmad, A. B., Ahmad, M. F., & Nek, S. A. R. T. (2013). Freshwater fishes recorded from north Selangor peat swamp forest, Selangor. In North Selangor Peat Swamp Forest Scientific Expedition (pp. 72–76). Selangor.

Anderson, J. A. R. (1983). The tropical peat swamps of Western Malesia. In A. J. P. Gore (Ed.), Systems of the World 4B. Mires: Swamp, Bog, Fen and Moor (4B ed., pp. 181–199). Amsterdam: Elsevier Sci. Publ.

Bailey, R. A., Clark, H. M., Ferris, J. P., Krause, S., & Strong, R. L. (2002). Chemistry of the Environment. Chemistry of the Environment. Elsevier. http://doi.org/10.1016/B978-012073461-0/50063-6.

Beamish, F. W. H., Beamish, R. B., & Lim, S. L. (2003). Fish assemblages and habitat in a Malaysian blackwater peat swamp. Environmental Biology of Fishes, 68, 1–13.

Bell, L. (2014). What is peat swamp, and why should I care? Retrieved January 11, 2016, from http://news.mongabay.com/2014/07/what-is-peat-swamp-and-why-should-i-care/

Chapin, M. (2004). A challenge to conservationists. World Watch, 17–31.

Chernow, B. A., & Vallasi, G. A. (2003). Columbia Electronic Encyclopedia. (G. A. V. Barbara Ann Chernow, Ed.) (6th ed.). Columbia University Press.

Chong, V. C., Lee, P. K. Y., & Lau, C. M. (2010). Diversity, extinction risk and conservation of Malaysian fishes. Journal of Fish Biology, 76, 2009–2066.

Convention on Biological Diversity (CBD). (2010a). COP 10 Decision X2. Retrieved November 29, 2015, from https://www.cbd.int/decision/cop/?id=12268

Convention on Biological Diversity (CBD). (2010b). Strategic plan for biodiversity 2011-2020, including Aichi Biodiversity Targets. Retrieved November 29, 2015, from https://www.cbd.int/sp/

Craft, C., Krull, K., & Graham, S. (2007). Ecological indicators of nutrient enrichment, freshwater wetlands, midwestern United States (U.S.). Ecological Indicators, 7(4), 733–750. http://doi.org/10.1016/j.ecolind.2006.08.004

92

Davies, J., & Abdullah, A. R. (1989). Freshwater fish survey of the north Selangor peat swamp forest. Kuala Lumpur: Asian Wetland Bureau Publication No:46 IPT Asian Wetland Bureau/WWF Malaysia, Kuala Lumpur.

European Space Agency (ESA). (2003). Envisat focuses on carbon-rich peat swamp forest fires. Retrieved January 27, 2016, from http://www.esa.int/Our_Activities/Observing_the_Earth/Envisat_focuses_on_carbon- rich_peat_swamp_forest_fires

Giam, X., Koh, L. P., Tan, H. H., Miettinen, J., Tan, H. T. W., & Ng, P. K. L. (2012). Global extinctions of peat swamp fishes follow peatland conversion in Sundaland. Frontiers in Ecology and the Environment, 10(9), 465–470.

Global Environment Centre (GEC). (2014). Integrated Management Plan for North Selangor Peat Swamp Forest 2014-2023 for Selangor State Forestry Department.

Harris, N., Minnemeyer, S., Sizer, N., Mann, S. A., & Payne, O. A. (2015, October 29). With latest fire crisis, Indonesia surpasses Russia as world’s fourth largest emitter. World Resources Institute. Washington, D.C.

IPT-Asian Wetland Bureau (IPT-AWB). (1993). Fish sampling demonstration in north Selangor peat swamp forest. AWB Publication No. 89.

Irvine, K., Vermette, S., & Mustafa, F. B. (2013). The “black waters” of Malaysia: tracking water quality from the peat swamp forest to the sea. Sains Malaysiana, 42(11), 1539–1548.

Ismail, A., Amal, M. N. A., Abdullah, T., Johari, S., Azizul, A., Nur Illiani, H., & Amiruddin, M. H. (2013). Fish diversity in north Selangor peat swamp forest. In North Selangor Peat Swamp Forest Scientific Expedition (pp. 57–71). Selangor.

IUCN. (2015). IUCN Red List of Threatened Species. Retrieved February 22, 2015, from www.iucnredlist.org

Johnson, D. S. (1967a). Distributional patterns of Malayan freshwater fish. Ecological Society of America, 48(5), 722–730.

Johnson, D. S. (1967b). On the chemistry of freshwaters in southern Malaya and Singapore. Archiv Fur Hydrobiologie, 63, 477–496.

Johnson, D. S. (1968). Malayan blackwaters. In R. Misra & B. Gopal (Eds.), Proceedings of the Symposium on recent advances in tropical ecology, Varanasi (pp. 303–310). Varanasi: International Society for Tropical Ecology.

Jufri, K. (2013). Peatland forest clearance in Sumatra. Retrieved January 27, 2016, from http://www.greenpeace.org/australia/en/photosandvideos/photos/slideshows/Forest-Beauty-- Destruction/Peatland-Forest-Clearance-in-Sumatra/

Jungcurt, S. (2013). Briefing note of the expert workshop on enhancing biodiversity data and observing systems in support of the implementation of the strategic plan for biodiversity 2011-2020. GEO BON/CBD Bulletin.

Kottelat, M., & Whitten, T. (1996). Freshwater biodiversity in Asia with special reference to fish.

Langner, A., Miettinen, J., & Siegert, F. (2007). Land cover change 2002–2005 in Borneo and the role of fire derived from MODIS imagery. Global Change Biology, 13, 2329–2340.

93

Langner, A., & Siegert, F. (2009). Spatiotemporal fire occurrence in Borneo over a period of 10 years. Global Change Biology, 15, 48–62.

Lo, J., & Parish, F. (2013, September). Peatlands and Climate Change in Southeast Asia. ASEAN Peatland Forests Project and Sustainable Management of Peatland Forests Project, 26.

Mallya, P. (2015). Illustration showing degradation of tropical peat swamp forest. Retrieved January 27, 2016, from http://mongabay-images.s3.amazonaws.com/graphics/peatlands_art_full.jpg

Mullally, G., & Dunphy, N. (2015). State of play review of Environmental Policy Integration literature, a report for the National Economic and Social Council. Cork.

Ng, P. K. L., Tay, J. B., & Lim, K. K. P. (1994). Diversity and conservation of blackwater fishes in Peninsular Malaysia, particularly in the north Selangor peat swamp forest. Hydrobiologia, 285(1-3), 203–218.

Ng, P. K. L., Tay, J. B., Lim, K. K. P., & Yang, C. M. (1992). The Conservation of the Fish and Other Aquatic Fauna of the North Selangor Peat Swamp Forest and Adjacent Areas. Kuala Lumpur: AWB Publication No. 81.

Ng, T. P., & Shamsudin, I. (2001). Common trees in peat swamp forests of Peninsular Malaysia. Kepong, Selangor: Research Pamphlet No. 124. Forest Research Institute Malaysia (FRIM).

Novis, J. (2010). United Nations warned that corruption is undermining grants to stop logging. Retrieved January 27, 2016, from http://www.theguardian.com/environment/2010/jul/04/united-nations- corruption-logging

Nowell, L. H., Norman, J. E., Moran, P. W., Martin, J. D., & Stone, W. W. (2014). Pesticide Toxicity Index - A tool for assessing potential toxicity of pesticide mixtures to freshwater aquatic organisms. Science of The Total Environment, 476-477, 144–157. http://doi.org/10.1016/j.scitotenv.2013.12.088

Page, S. E., Hoscilo, A., Langner, A., Tansey, K., Siegert, F., Limin, S., & Rieley, J. O. (2009). Tropical peatland fires in Southeast Asia. In M. A. Cochrane (Ed.), Tropical Fire Ecology: Climate Change, Land Use and Ecosystem Dynamics (pp. 263–287). Springer.

Page, S. E., Rieley, J. O., & Banks, C. J. (2011). Global and regional importance of the tropical peatland carbon pool. Glob Change Biol, 17, 798–818.

Parish, F. (2002). Overview on peat, biodiversity, climiate change and fire. In F. Parish, E. Padimanabhan, C. L. Lee, & H. C. Thang (Eds.), Prevention and control of fire in peatlands, 19-21 March 2002 (pp. 51–56). Cetaktama, Kuala Lumpur, Malaysia: Global Environmental Centre & Forestry Department, Peninsular Malaysia.

Parker, S. P. (2003). McGraw-Hill Dictionary of Scientific and Technical Terms (6th ed.). McGraw-Hill Education.

Posa, M. R. C., Wijedasa, L. S., & Corlett, R. T. (2011). Biodiversity and conservation of tropical peat swamp forests. BioScience, 61(1), 49–57.

Prentice, C., & Parish, D. (1992). Conservation of peat swamp forest: A forgotten ecosystem. Malayan Nature Journal, 45(Golden Jubilee Issue), 128–144.

Prokhorov, A. M. (1982). Great Soviet encyclopedia, Volume 30. Macmillan.

94

Shah, A. S. R. M., Zarul, H. H., Chan, K. Y., Zakaria, R., Khoo, K. H., & Mashhor, M. (2006). A recent survey of freshwater fishes of the Paya Beriah peat swamp forest, north Perak, Malaysia. Jurnal Biosains, 17(1), 51– 64.

Siow, R., Ramli, M. N., Shakori, M. H. M., & Asmuni, M. (2013). Fish fauna assemblages and their distribution patterns in the north Selangor peat swamp forest. In North Selangor Peat Swamp Forest Scientific Expedition (pp. 77–82). Selangor.

Tekile, A., Kim, I., & Kim, J. (2015). Mini-review on river eutrophication and bottom improvement techniques, with special emphasis on the Nakdong River. Journal of Environmental Sciences, 30, 113–121. http://doi.org/10.1016/j.jes.2014.10.014 Tree-Nation. (2012). Highlight a fact about peat swamp forest. Retrieved January 27, 2016, from http://www.tree-nation.com/forum/2092/highlight-a-fact-about-peat-swamp-forest

Wantzen, K. M., Yule, C. M., Mathooko, J. M., & Pringle, C. M. (2011). Organic matter processing in tropical streams. In Tropical Stream Ecology (pp. 44–60). Academic Press.

Wetlands International (WI). (2014). Tropical peat swamp forests. Retrieved January 11, 2016, from http://www.wetlands.org/Whatarewetlands/Peatlands/Tropicalpeatswampforests/tabid/2739/Default.a spx

Whitmore, T. C. (1984). Tropical Rain Forests of the Far East (Second). Oxford: Clarendon Press.

Whitmore, T. C. (1988). Forest types and forest zonation. In E. of Cranbrook (Ed.), Key Environments: Malaysia (pp. 20–30). Elsevier.

Wyatt-Smith, J. (1959). Peat swamp forests in Malaya. Forester, 22, 5–31.

Wyatt-Smith, J. (1964). A preliminary vegetation map of Malaya with description of the vegetation types. J. Trop. Geogr., (18), 200–213.

Yule, C. M. (2010). Loss of biodiversity and ecosystem functioning in Indo-Malayan peat swamp forests. Biodiversity and Conservation, 19(2), 393–409.

Yule, C. M. (2015). Stop the Haze: Protect our peat swamp forests. Retrieved January 11, 2016, from http://www.monash.edu.my/research/researchers-say/stop-the-haze-protect-our-peat-swamp-forests

Yule, C. M., & Gomez, L. N. (2008). Leaf litter decomposition in a tropical peat swamp forest in Peninsular Malaysia. Wetlands Ecology and Management, 17(3), 231–241.

Zakaria, R. (2015). Peat swamp forests, a real lifesaver. Retrieved January 11, 2016, from http://www.nst.com.my/news/2015/12/115585/peat-swamp-forests-real-lifesaver

Zakaria, R., Mansor, M., & Ali, A. B. (1999). Swamp-riverine tropical fish population : a comparative study of two spatially isolated freshwater ecosystems in Peninsular Malaysia. Wetlands Ecology and Management, 6, 261–268.

95

3.3 Fire Threat in Peat Swamp Forest in Malaysia

Summary

Peat swamp forest is exposed to fire incident every year. It leads to several cases of transboundary haze pollution, climate change, and also global warming, particularly with the help of El Nino phenomenon. In Sabah, Malaysia, the Binsulok Forest Reserve is one of the peat swamp areas that affected by fire. This study determined the physical characteristics of peat in Binsulok Forest Reserve include the bulk density (g cm-3) and water content (%). Three plots were selected in the burnt area of the peat swamp forest; samples were taken at four levels of peat layers, i.e., 0.5m, 1.0m, 1.5m, and 2.0m depths using an auger to determine the bulk density and water content of the peat. The mean bulk density was the highest at 0.5m (0.2801 g cm-3), followed by 1.0m, 1.5m, and 2.0m depth, respectively. The findings indicate the upper layer of peat is the most compacted peat compared to the lower levels of peat depths (1.0m, 1.5m, and 2.0m). The compactness of peat will have an effect on the water content. The mean water content of the peat was lowest at 0.5m depths with 209.88±0.18% and highest at 2.0m depths (1013.51±1.39%). The results show that water content was low when the bulk density is high. Fire affect the peat layers during burning that increase peat density, and emits huge forest gaps after a fire event that allows wind circulation to the forest floor, then eventually reduced the water content of peat at the top layer.

Keywords: Peat Swamp Forest; Forest Fire; Physical Properties

Introduction

Peat swamp forest in Malaysia are habitat for endangered species such as Orang Utan (Pongo pygmaeus), Proboscis Monkey (Nasalis larvatus), and Sumatran Rhinoceros (Dicerorhinus sumatrensis), nevertheless peat swamp forest are highly specified biodiversity (UNDP, 2006; Posa et al., 2011). Fire threat on Malaysia peat will affect the habitat of these endemic species.

In Malaysia, peatlands areas are about7.45% (2,457,730 ha) of the Malaysia’s total land area; in which69.08%(1,697,847 ha) in Sarawak, (26.16% (642,918 ha) in Peninsular Malaysia, and 4.76% (116,965 ha) in Sabah as shown in Table 1 (Wetlands International, 2010). Binsulok Forest Reserve cover 12, 106 ha (SFD, 2014) which is approximately 10.35% of Sabah protected peat swamp area (116,965 ha) (SFD, 2014).

Table 1: The Peatlands in Malaysia (Wetlands International, 2010)

Region Percent (%) Sarawak 69.08 Peninsular Malaysia 26.16 Sabah 4.76 Total

A forest fire was happening last year in early 2016 as it destroyed more than half of the area of Binsulok Forest Reserve, Sabah, Malaysia for several weeks (The Star, 2017). This situation was distressing with the help of El-Nino phenomenon thathappened at that time, in which cause the forest fire incident to be severe and hard to suppress by the fire fighter. The situation will lead the carbon sink forest to emitting carbon to the atmosphere, and contribute to the greenhouse gas emission from the fuel burning then eventually initiate global warming. Additionally, fire incident happened almost in every part of Sabah which approximately 73% of the state’s area (Isa, 2001). According to Phua et al. (2007), the Binsulok Forest reserve affected fire at almost 85% of the total undisturbed peat swamp area, and 31% the degraded peat swamp area.Draining peatbogs and swamp can increase fire frequency as dried peat is easily ignited which provides huge amount of fuel, and will smoulder down several metres below the surface (Rein et al., 2008; Knicker, 2007; Page et al., 2009). In addition, there is a not much published data on Binsulok peat swamp forest on physical characteristics. Hence, it is important to

96

determine the physical characteristics of the peat after the fire happened to see any twisted situation happened in that area. This paper aims to investigate the effect of fire on Malaysia peat at different levels of peat on its bulk density and water content.

Materials and Methods

Three plots were selected in the burnt area of the Binsulok Forest Reserve, Sabah, Malaysia. Samples were taken at four different levels of peat layers; 0.5m, 1.0m, 1.5m, and 2.0m depths using an auger to determine the bulk density and water content of the peat. The analysis was done using one-way-ANOVA by using SPSS to find the significant difference for the different layers of peat.

Results and Discussion

Table 2 shows the water content (%) and bulk density (g cm-3) of burnt peat in Binsulok Forest Reserve, Sabah. The result shows that the mean bulk density was the highest at 0.5m (0.28±0.17g cm-3), followed by 1.0m (0.25±0.09g cm-3), 1.5m (0.19±0.01g cm-3), and 2.0m (0.09±0.09g cm-3) depth, respectively. This is similar to Binkley and Fisher (2012) study, in which soil with high organic matter have a lower bulk density differs from 0.2-1.9g cm-3. The findings indicate the upper layer of peat are the most compacted peat compared to the lower levels of peat depths (1.0m, 1.5m, and 2.0m). Moreover, it shows that the density increase as it depends on the degree of decomposition, the mineral and moisture content during sampling (Silc and Stanek, 1977; Andriesse, 1988).

Table 2: Water content (%) and Bulk Density of peat in burnt area of Binsulok Forest Reserve.

Depth (m) Water Content (%) Bulk Density (g cm-3)

0.5 209.88±0.18a 0.28±0.17c

1.0 249.29±0.12a 0.25±0.09c

1.5 332.46±0.18a 0.19±0.01b

2.0 1013.51±1.39b 0.09±0.09a *means with the same letter at the same column are not significantly different (α=0.05)

Water content is an indicator of the amount of water present in the soil, and are extremely high water content in peat as it is the most significant physical characteristics which more than 90% of water by volume (FAO, 1988; O’Kelly and Sivakumar, 2014).The compactness of peat will have an effect on the water content. In this study, the mean water content of the peat was lowest at 0.5m depths with 209.88±0.18%and highest at 2.0m depths (1013.51±1.39%).The 1.0m and 1.5m are249.29±0.12% and 332.46±0.18%, respectively. Furthermore, study by Sa’don et al., (2015) stated that the moisture content of Batu Kawa hemic peat, Sarawak was ranged from 607% to 926%, and Kota Samarahan hemic peat, Sarawak ranged from 426% to 817%, which is nearly similar to this study, in which it ranged from 209% to 1013%. Besides, Wösten et al. (2008) stated that the peat are mostly shrink when dried and swell when re-wetted except when the water content falls below threshold value which enable the peat to dry. The dry conditions led to forest fire as the peat are easily to be ignited especially during the dry season. Moreover, USDA-NRSC, (2014) stated that the water content in soil is decreasing when soil compaction increase. Thus, the finding shows that moisture content is increasing down the depth as the bulk density decreased from 0.5m depth to 2.0m depth.

Conclusion

Peat swamp forest, specifically in Malaysia indicates that it’s natural state as high in organic matter, and has very high water content, but lower bulk density because of the decomposition rate in peat. It shows that Binsulok Forest Reserve have extremely high water content and low bulk density as it going down the depth at 2.0m. If a fire incident keeps happening in Binsulok Forest Reserve, the pattern of bulk

97 density might change to high bulk density compared to the current study as fire will increase the peat soil density. The forest fire emits a huge forest gaps that allows the wind circulation to the forest flow that will lower the water (moisture) content of the top peat layer. Further research on the carbon content and water resources availability will help researcher and also forest manager to manage the forest especially when fire happened in peat swamp forest in Malaysia.

Acknowledgement

The authors would like to thank Sabah Forestry Department, and Universiti Malaysia Sabah for the permission and cooperation during the research. Specifically, we thank the undergraduate students from International Tropical Forestry program, Universiti Malaysia Sabah, who help with the sampling.

References

Andriesse, J.P. (1988). Nature and Management of Tropical Peat Soils. Soil Resources Management and Conservation Service,FAO Land and Water Development Division. FAO Soils Bulletin 59, Rome, Italy.

FAO (1988). Nature and management of tropical peat soils. No. 59. Food & Agriculture Org., 1988.

Isa, A.Z.M. (2001). Forest fire in Malaysia - Its management impact on biodiversity. Asean Biodiversity (Special Reports), Laguna, 31-35.

Knicker, H. (2007). How does fire affect the nature and stability of soil organic nitrogen and carbon? A review. Biogeochemistry, 85(1), 91-118.

O’Kelly, B.C. and Sivakumar, V. (2014). Water content determinations for peat and other organic soils using the oven-drying method. Drying Technology: An International Journal, 32(6), 631-643.

Page, S.E., Hoscilo, A., Langner, A., Tansey, K., Siegert, F., Limin, S.H., and Rieley, J.O. (2009). Tropical peatland fires in Southeast Asia in Cochrane MA, ed. Tropical Fire Ecology: Climate Change, Land Use and Ecosystem Dynamics. Springer, 263–287.

Phua, M.H., Tsuyuki, S., Lee, J.S., and Sasakawa, H. (2007). Detection of burned peat swamp forest in heterogenous tropical landscape: A case study of the Klias Peninsula, Sabah, Malaysia. Landscape and Urban Planning, 82, 103-116.

Posa, M.R.C., Wijedasa, L.S., and Corlett, R.T.(2011). Biodiversity and conservation of tropical peat swamp forests. Bioscience, 61(1), 49-57.

Rein, G., Cleaver, N., Ashton, C., Pironi, P., and Torero, J. L. (2008). The severity of smouldering peat fires and damage to the forest soil. Catena, 74(3), 304-309.

Sa’don, N.M., Karim, A.A., Jaol, W., and Lili, W.W. (2015). Sarawak Peat Characteristics and Heat Treatment. UNIMAS e-Journal of Civil Engineering.

SFD. (2014). Fact Sheet, Sabah Forestry Department.

Silc, T. and Stanek, W. (1977). Bulk Density Estimation of Several Peats in Northern Ontario using the Von Post Humification Scale. Can. J. Soil. Sci, 57,75.

The Star. (2017). Forest fire ravages most of Binsuluk reserve. Retrieved from: http://www.thestar.com.my/news/nation/2016/04/14/forest-fire-ravages-most-of-binsuluk-reserve/ (1 October 2017).

UNDP, (2006). Malaysia’s Peat Swamp Forests: Conservation and Sustainable use. UNDP, Kuala Lumpur.

98

USDA – NRSC (United States Department of Agriculture – Natural Resource Conservation Service). (2014). Soil Quality Kit- Guides for Educator. Retrieved from: www.nrcs.usda.gov/Internet/FSE_DOCUMENTS/nrcs143_019165.pdf (17 April 2017)

Wősten, J.H.M., Clymans, E., Page, S.E., Rieley, J.O., and Limin, S.H. (2008). Peat-water Interrelationships in a Tropical Peatland Ecosystem in Southeast Asia. Journal Elsevier Catena, 73, 212-224.

99

3.4 Biological Effects of Tributyltin Chloride (TBTCl) on Juveniles Stage of Life cycle Artemia salina

Summary

Introduction of antifouling chemicals can pose a threat to non-targeted organisms. Utilization of bioindicator to monitor antifouling contamination is important by observing effects and mortality rate. Juveniles stage of Artemia salina is a critical period because it is sensitive to changes occurring in the surrounding. Elevation of anthropogenic originated chemicals could seriously affecting individuals at this lifestage. Present study aimed to use juveniles stage of A. salinaas bioindicator to environmental pollution by determine lethalconcentration 50 (LC50) and effects of tributyltin chloride (TBTCl) on morphological development of brine shrimp juveniles A. salina. They were exposed to different concentration of TBTCl. Morphological condition of every A. salina individuals was observed under a microscope. Results showed theLC50of TBTCl for A. Salina juveniles was LC50 (226.69 ng.L-1). There was significant differences inmorphologicalof juveniles exposed to different toxicant concentrations, however juveniles undergo certain developmental changes on total length, head width, abdominal width, tail width, occurred withinthe ages of 21days.These results indicate that TBTCl is environmentally toxic substances having negative effects on non-target organism. Further in-depth investigation should be conducted to establish A. salina juveniles as bioindicator for TBTCl contamination.

Keywords: Antifouling biocides; Artemia salina; Juveniles; Tributyltin; Morphology; Toxicity

Introduction

Organotin compounds (OTs) were widely used in antifouling paints since decades ago. During the last few decades, the BT had been used widely as antifouling agents in paints for aquaculture nets, ships, and boats (Ohji, 2009 and Amer,2014). Recently, it became clear that antifouling compound with biocide properties such as tributyltin (TBT) could cause negative impacts on the components of the marine ecosystem. These compounds have been detected in various marine organisms, frequently at concentrations higher than the chronic or acute toxicity levels (Alzieu, 1996). The TBT has negative effects on numerous aquatic organisms, including delayed molting, retardation of the regenerative growth, deformities in the limbs of the fiddler crab, and reduction in the burrowing activity, reduction in the larval growth in Silversidee, impairment of egg production in calanoid copepod (Ohji et al., 2003). In line with this, Sudaryanto et al. (2004) opined that continuous studies are needed to examine the environmental effects and toxicity of these anthropogenic tin compounds, with particular emphasis on their effects on the aquatic biota in the Malaysian coastal environment.

This issue needs to be carefully investigated because several recent studies have confirmed the coastal waters of Malaysia are widely contaminated with butyltin compounds (BTs), which consequently, can spread to a wide range of environmental media and biota (Sudaryanto et al., 2002). Sudaryanto et al. (2004) also reported that high concentrations of TBTs were recorded in Malaysian coastal waters, suggesting that there are ongoing inputs of TBTs to the coastal waters in Malaysia. Logically, the high levels of contamination with BTs reflect the lack of regulations of TBTs in Malaysia (Sudaryanto et al., 2004).

Furthermore, it has become evident lately that antifouling chemicals with biocide characteristics such as TBT have passive impacts on the marine ecosystem environment and these impacts have become worrying environmental issue worldwide (Champ and Wade, 1996). In order to prevent destruction of the marine ecosystems, application of BTs to fish-farming equipment and small boats has been regulated or banned in developing countries from the late 1980s (Champ and Wade, 1996; Bosselmann, 1996). However, a substantial accumulation of BTs has been observed at many trophic levels in the marine food chain, including algae, plankton, cetaceans, fish, and crustaceans, thus indicating that the effects of BTs in the marine ecosystems are long lasting. It has been reported that the tri-organotins and TBT are the most toxic compounds and that their toxicity is evident at the nanogram-per-liter level.

100

High concentrations of BTs have been detected in lower trophic animals such as caprellids. It appears that TBT accumulates specifically in caprellids in the marine ecosystem, irrespective of the trophic level in the food chain, and that it may establish breakpoint for disturbance in the natural food chain structure, therefore causing other organisms to accumulate BTs at elevated concentrations due to their lower metabolic capacities to degrade TBT (Ohji et al., 2002a). In addition, it seems that the BTs accumulate in a species specific manner. Hence, studying implications of the species specific accumulation and biological impacts of BTs on brine shrimp (Artemia salina) may provide clues for further understanding of the accumulation mechanisms in coastal ecosystems as well as of the mode of action of BTs in these organisms.

The use of juveniles of A. salina to monitor small spatial and temporal changes in the baseline concentrations of TBTs has been proposed as a crustacean watch (Ohji et al., 2002a). Nevertheless, little information is available at present about the biological effects of TBTCl on such features as growth, survival andmorphological of juveniles A. salina. The determination of such effects is prerequisite to credible Biomonitoring of the coastal ecosystem state using juveniles A. salina as a model.

Materials and methods

Procedures of Juveniles Stage of A. salina Cultivation

Approximately 0.5g cysts of A. salina was cultured in the bottle 5L artificial seawater at (35 ± 1‰) salinity at 28 ± 1 °C for 24 hours under standardized hatching conditions.The hatching procedures were based on the previously reported techniques reported by Sorgeloos et al. (2001). After 24 hours hatching nauplii was transferred to several small aquaria 500 ml, to each aquarium transferred 10 ml of the nauplii, with an air system composed of aquarium air pumps and air stones. Separation was based on following light attraction of some nauplii strains reported in aquaculture hatchery practices, continuous illumination of about 1000 Lux. Water temperature was maintained at 25 ± 1 °C and the pH range was 7.5 to 8.0. Finally, upon hatched nauplii were placed into aquaculture plastic containers with 1 liters of artificial seawater were used to grow nauplii and to complete its larval development.The A. salina feeding capability was fully developed after 24 hours. Once the feeding capability was reached food levels were established based on marine green algae Tetrasalimis sp. It was the single-celled algae available from Marine Science LAB (MARSLAB), Institute Bioscience Universiti Putra Malaysia and culture in the Ecotoxicology Laboratory, Department of Biology, Universiti Putra Malaysia. In addition, 1 ml per liter of a commercial liquid food suspension was added to aquaculture containers every day to provide other food(Toi et al. 2013).

Test organisms

After 21 days of growing the specimens, starting from the day of hatching of cysts, and before sexual maturity was reached; populations of juveniles stage organisms were selected randomly to conduct the acute toxicity tests (ALYÜRÜK and ÇAVAŞ 2013). Juveniles were allowed for 24 hours of preparation before starting the acute toxicity test. Dissolved oxygen concentration (DO), pH, salinity, was determined at the beginning the test. Dissolved oxygen (DO) averaged 8.0 ± 0.5 mg. L-1. The pH was observed to be between pH 7.8 to pH 8.0 and synthetic seawater with a salinity of (35 ± 1‰). DO, pH and salinity were measured with a YSI Model 58 Dissolved-Oxygen Meter (Yellow Springs Instrument Co. Inc., Yellow Springs, OH) in the laboratory, was used as either hatching procedure or culture medium. The commercial salt was dissolved in pretreated distal water, aerated for 24 hours before use in either for culture procedure or test solutions. The A. salina were handled and sacrificed according to the method approved by the Institutional Animal Care and Use Committee,Universiti Putra Malaysia.

Acute toxicity test for juveniles

A range finding test for TBTCl toxicants was conducted. Series concentrations of TBTCl dilutions used were 25ng.L-1, 50ng.L-1, 100 ng.L-1, 150 ng.L-1, 200 ng.L-1, 250 ng.L-1, 300 ng.L-1 to study effects TBTCl

101

on juvenile stage in toxicity testing.The test was carried out in tube 50 ml. The ten individuals of juvenile were transferred with a Pasteur pipette into each tube, five replicates in the two groups. The volume of seawater carried over with the A. salina was minimal followed by the toxicant dilutions. Each toxicant dilution was added to the tube. The tubes were filled with 50 ml of the respective concentrations of the toxin, and an incubated at a temperature of 25 ± 1 °C for 24 hours. Then, the mortality of A. salina was transferred and recorded in Petri dish was placed on the stage of the dissection microscope and estimate. After that, the mortality percentage was calculated from the total number of organisms in the test for each concentration. And the survivors were used to study the effects of toxicant on their morphological abnormalities. The morphological abnormality of exposed A. salina in each toxicant was observed under magnification (10x) using binocular microscopy attached to a camera with an aid of software (Dino-Lite Edge Digital Microscope – AM4515ZT). Total length for juveniles individuals were measured from their head to the tail andthe width of the body using a light microscope provided with an ocular micrometer.

Results and Discussion

Median lethal concentration (LC50) effects of (TBTCl) on A. salina juveniles stage

The juveniles stage of crustaceans including A. salina is a critical period because it is presumed sensitive to the changes occurring in the surrounding. In present study, juveniles of A. salina was exposed to TBTCl concentrations of 25 ng.L-1, 50 ng.L-1, 100 ng.L-1, 150 ng.L-1, 200 ng.L-1, 250 ng.L-1, 300 ng.L-1, respectively. Results in Table 1 shows the respective 24 hours mortality values of A. salina in juveniles stage after exposure to different concentrations of TBTCl. The percentage of mortality incline with the increase of TBTCl concentration and the value of LC50 for TBTCl determined in the present study according to probit analysis was 226.69 ng.L-1 for juveniles stage (Figure 1). AbuShaala et al. (2017) reported The percentage of mortality of adult stage of A. salina increase when TBTCl concentration increase. It was also observed that the percentage of mortality incline with the increase of TBTCl concentration in nauplii stageA. salina (AbuShaala et al. 2015a).Davidson et al. (1986) studied acute toxicity testing with (TBT) leachate derived from panels painted with antifouling paint was performed using the mysid species Acanthomy sissculpta (Crustacean, Mysidacea). Which a significantly reduced recruits of viable juveniles was apparent.This means the juveniles are more affected to TBTCl compared to mysid species.

Table 1: Mortality (%) of A. salina juveniles stage exposed to different concentration of TBTCl.

TBTCl (ng. L-1) Mortality (%) 25 00.00 50 13.33 100 23.33 150 33.33 200 43.33 250 60.00 300 66.67

102

Figure 1: Relationship between Mortality Rate and Concentrations of TBTCl among Juvenile stage.

Morphological effects of (TBTCl) on A. salina juveniles stage

The toxicity of TBTCl was tested on A. salina individuals at juveniles stage. Their morphological deformities were observed to include deformities in total length, width of head, width of the abdomen and width of the tail during the juvenile stage, which were at 21days of A. salinalife cycle. The variation was due to increase in concentration of TBTCl, thereby, increase the effects on the A. salina. One-way ANOVA indicated a significant difference at p˂0.05 between the mean measurement of selected body parameters of juveniles A. salina and different concentration of TBTCl. Due to the increase in concentration of TBTCl, which resulted in the decrease of morphological parameter among individuals of juveniles A. salina. The minimum and maximum toxicity concentration shown variation in the total length, width of head, width of the abdomen and width of the tail at a range of (0.0 5843.35 – 9922.43 µm), (0.0 719.39 – 1229.87 µm), (0.0 369.14 – 1194.66 µm), and (0.0 201.74 – 572.10µm) respectively (Table 2). In this present study, there are not enough studies about effect TBTCl on the morphological changes in the juveniles stage. Therefore, will be compare these findings with similar studies such as Davidson et al. (1986) they studied the acute effects of tributyltin on the mysid species, and their findings showed TBT was a significantly reduced release of viable juveniles was apparent. AbuShaala et al. (2017) they reported the TBTCL significantly reduced the total length, width of head, width of the abdomen and width of the tail during the adult stage of A. salina.Also, AbuShaala et al. (2015) they reported the TBTCL significantly reduced the total length and width body of A. salina nauplii stage.

103

Table 2: Mean measurement of selected body parameters of A. salina juveniles exposed to different concentration of TBTCl.

TBTCl N TL (µm) HW (µm) AW (µm) TW (µm) (ng. L-1) 3 610.09±23.46 0 7788.56±176.48f 875.12±19.29d 333.13±12.19d 0 d 3 618.07±20.01 25 7788.56±176.48f 852.15±15.94d 376.88±11.19d 0 d 3 579.36±48.48 50 6555.88±500.49e,f 794.54±61.87d 353.99±27.58d 0 d 3 5425.58±577.49d, 665.26±71.80c 537.41±61.50 100 283.09±30.66c,d 0 e,f ,d c,d 3 4650.80±620.18c, 582.70±78.30b 505.11±71.40 256.32±34.69b,c, 150 0 d,e ,c,d b,c,d d 3 4169.07±689.36b, 486.87±80.19a 311.61±53.80 181.59±30.15a,b, 200 0 c, ,b,c a,b,c c 3 2998.02±692.69a, 363.54±85.38a 284.88±70.82 250 147.54±34.75a,b 0 b,c,d ,b,c a,b 3 2584.82±684.70a, 304.25±80.23a 187.71±50.64 300 119.81±32.77a 0 b,c ,b a 3 1786.48±603.47a, 116.05±39.37 350 215.95±73.17a 87.25±29.79a 0 b a 3 400 1436.16±539.49a 188.93±70.51a 99.30±37.99a 70.71±27.25a 0 Remark: TL = Total length; HW = Head width; AW = Abdomen width; TW = Tail width.

These results demonstrated that TBTCl is responsible for the changes in total length and width of body of juveniles A. salina after 24 hours acute exposure. In general the regression analysis (r2) shown the highest regression values in morphological changes, and this demonstrates a strong inverse relationship between morphological measurements of selected body parameters of juveniles A. salina and increasing the TBTCl concentration. As shown in Figure 2. Shown a very strong inverse and more caricatures and sensitive to increasing the TBTCl in the juveniles stage.

Significant differences in morphology were observed in all survivors of A. salina juveniles exposed to all toxicants concentration of TBTCl. However, juveniles stage undergo certain developmental changes in total length, head width, abdominal width, tail width, occurred within the ages of 21 days as seen in (Figure 3). The deformity percentage in juveniles stage of A. salina body exposed to different concentration of TBTCl (ng.L-1). These findings shown a significant difference (p < 0.05) in different parts of the selected body parameters in individual of juveniles stage after exposed to TBTCl. And this result shows the first part and the most deformities part affected to TBTCl increased tail part in different concentration and increasing when the concentration of TBTCl. Then the second part affected was the head part also increasing deformities percentage when increase the concentration of TBTCl.

104

Figure 2: Relationship between TBTCl Concentration (ng. L-1) and Total Length, Head Width, Abdomen Width and Tail Width of Juveniles A. salina.

Figure 3: Relationship between the deformity percentage in juveniles A. salina body and different concentration of TBTCl.

Conclusion

In summary, this study elucidates the effects of TBTCl toxicity on juveniles stage of the model organisms A. salina, mortality rate and morphology changes. LC50 finding showed that juveniles are sensitive to TBTCl toxicity test. A result of LC50 value for TBTCl, was 226.69 ng.L-1 in juveniles. Most studies have focused on morphological changes in nauplii stage, but in the present study the toxicity of TBTCl was tested against A. salina in the juveniles stage of brine shrimp, which undergo certain changes in morphological characteristics, as well as total length, head width, abdominal width, tail width during the acute toxicity test for 24 hour period. The present study supports the idea of using brine shrimp, A. salina as a simple and accurate bioassay organism to assess the marine aquatic toxicity profile for any toxicant.

105

Acknowledgements

This study was jointly supported by the special Fundamental Research Grant Scheme (FRGS) Reference No. KPT.P.(S) 400-7/2/29-4 (65) for matching fund research between JSPS Asian CORE Program and Universiti Putra Malaysia (UPM), and FRGS (Reference No. FRGS/1/2014/STWN01/UPM/02/4) from the Ministry of Education, Malaysia.

References

AbuShaala, N. M. A., Zulkifli, S. Z., Ismail, A., Azmai, M. N. A., & Mohamat-Yusuff, F. (2015a). Selected Morphological Changes in Nauplii of Brine Shrimp (Artemia salina) after Tributyltin Chloride (TBTCL) Exposure. World Applied Sciences Journal, 33(8), 1334-1340.

AbuShaala, N. M. A., Zulkifli, S. Z., Ismail, A., Azmai, M. N. A., Mohamat-Yusuff, F., & Omar, H. (2017). Effects of tributyltin chloride (TBTCl) antifouliong biocide on adult males and females of brine shrimp (Artemia salina). International Journal of Biological Research, 5(1), 30-35.

Alyürük, H., & Çavaş, L. (2013). Toxicities of diuron and irgarol on the hatchability and early stage development of Artemia salina. Turkish Journal of Biology, 37(2), 151-157.

Amer, A. A. A. (2014). The Effect of Cadmium Chloride on the Biology of Gammarus pulex (Crustacea: Amphipoda).

Alzieu, C. (1996). Biological effects of tributyltin on marine organisms. Tributyltin: case study of an environmental contaminant, 8, 167-211.

Bosselmann, K. (1996). Environmental law and tributyltin in the environment. Tributyltin: case study of an environmental contaminant. Cambridge University Press, Cambridge, 237-263.

Champ, M. A., & Wade, T. L. (1996). Regulatory policies and strategies for organotin compounds Organotin (pp. 55-94): Springer.

Davidson, B., Valkirs, A., & Seligman, P. (1986). Acute and chronic effects of tributyltin of the mysid Acanthomysis sculpta (Crustacea, Mysidacea). Paper presented at the OCEANS'86.

Mercury, M. (1990). International programme on chemical safety. Environmental Health Criteria, 118.

Ohji, M. (2009). Biological Effects of Tributyltin on the Caprellidea (Crustacea: Amphipoda) Ecotoxicology of Antifouling Biocides (pp. 161-193): Springer.

Ohji, M., Arai, T., & Miyazaki, N. (2002a). Effects of tributyltin exposure in the embryonic stage on sex ratio and survival rate in the caprellid amphipod Caprella danilevskii. Marine Ecology Progress Series, 235, 171- 176.

Ohji, M., Arai, T., & Miyazaki, N. (2003). Chronic effects of tributyltin on the caprellid amphipod Caprella danilevskii. Marine Pollution Bulletin, 46(10), 1263-1272.

Sorgeloos, P., Dhert, P., & Candreva, P. (2001). Use of the brine shrimp, Artemia spp., in marine fish larviculture. Aquaculture, 200(1), 147-159.

Sudaryanto, A., Takahashi, S., Iwata, H., Tanabe, S., & Ismail, A. (2004). Contamination of butyltin compounds in Malaysian marine environments. Environmental Pollution, 130(3), 347-358.

106

Sudaryanto, A., Takahashi, S., Monirith, I., Ismail, A., Muchtar, M., Zheng, J., Hue, N. D. (2002). Asia‐Pacific mussel watch: monitoring of butyltin contamination in coastal waters of Asian developing countries. Environmental Toxicology and Chemistry, 21(10), 2119-2130.

Toi, H. T., Boeckx, P., Sorgeloos, P., Bossier, P., & Van Stappen, G. (2013). Bacteria contribute to Artemia nutrition in algae-limited conditions: A laboratory study. Aquaculture, 388, 1-7.

107

3.5 Bioaccumulation of lead and cadmium in catfish tissues (Arius thalassinus) from Kuala Gula, Perak, Peninsular Malaysia

Summary

Pollution of aquatic environments in Peninsular Malaysia has been identified as one of the major ecological problems associated with rapid urbanization and industrialization. The purpose of this study was to determine the levels of heavy metals (Pb and Cd) in muscle, gill, liver, stomach, and kidney tissues of catfish (Arius thalassinus) from Kuala Gula. Heavy metals concentration was determined by using atomic absorption spectrophotometer (AAS). The data shows the fate of Pb in different parts and sizes of catfish from different sites in Kuala Gula. The gills accumulated high concentrations of Pb with a mean of 51.44 µg/g-1 d.w., while the muscle accumulated low concentrations of Pb with a mean of 22.0 µg/g-1 d.w. for all sizes of fish evaluated. Similarly for Cd, the gills also recorded high concentrations (mean=1.45.90 µg/g-1 d.w.) while the muscle accumulated the lowest (mean=1.22 µg/g-1 d.w.) This study showed that Pb exceeded the permissible limits most likely through biomagnification in the food chain. Since this fish is a bottom dweller and bottom feeder that did not venture very far from their natural habitat, it is suitable to be used as bio-indicator of heavy metals in monitoring pollution in Kuala Gula. Keywords: Bioaccumulation; Lead; Cadmium; Arius thalassinus; Kuala Gula Introduction In the last two decades, Malaysia is fast transforming from agriculture-based economy to manufacturing. However, due to the lack of environmental awareness, expert in environmental monitoring and effluent management have resulted in degradation of environmental quality in certain areas (Hossen et al., 2015). Aquatic systems are exposed to a number of pollutants which are mainly released from effluents discharged of industries, sewage treatment plants and drainage from urban and agricultural areas (Kamaruzzaman et al., 2011). These pollutants can cause serious damages on aquatic life. The aquatic environment is under most threat because any human activity either aerial or terrestrial will end up in the aquatic environment (Vinodhini & Narayanan, 2009). For that reason, most of the environmental monitoring activities in Malaysia involve the aquatic environment. One of the most important aspects of pollution is heavy metal pollution (Edward et al. , 2008).The most common heavy metal pollution in aquatic environment in Malaysia consist of concentration Zn, Cu, Pb, Cd, and Ni (Taweel et al. , 2013). Numerous studies on heavy metals in aquatic environment have been conducted in Malaysia; for example, in mangrove (Udechukwu et al., 2014), benthos (Azrina et al., 2006; Hossen et al., 2015), gastropods (Ismail & Ramli, 1997) and bivalve (Yap et al. 2002; Berandah et al., 2010), shrimps (Rahouma et al., 2013), invertebrates (Alam et al., 2012) and fishes (Hajeb et al., 2009; Ismail & Yusof, 2011; Sow et al., 2013; Naji et al., 2014 and Mohamat-Yusuff et al., 2015). Several numbers studies has been practically conducted of biomonitoring of heavy metals in Malaysia, which focus on accumulation of the heavy metals on tissues of animal’s species. Yap et al. (2002) used Perna viridis for biomontoring of heavy metals because they have established the relationship between the sediments and concentration of Cd, Cu, and Pb.

Generally, there is no problem to originate heavy metals in the aquatic environment naturally. However, those are from anthropogenic sources are usually problematic and can damage the aquatic organisms directly and indirectly (Tchounwou et al., 2012). Heavy metals can be accumulated in different parts of the aquatic organisms (Squadron et al., 2013). Magnified concentration of heavy metals increases due escalation bioaccumulation and biomagnification through food chains (Mohamat-Yusuff et al., 2015). IF organisms can accumulate and magnify heavy metals, they can be used as bio-indicator (Yin et al., 2012).

Kuala Gula is a very important to place of feeding for the various species of migratory and resident birds (Rahman et al., 2013). Catfish is one of the many species of fish in Kuala Gula, and it can accumulate heavy metals in their tissues. It is considered as an interesting food, and is a very important component in the food chain. This catfish is a bottom feeder, feeding on small fishes, crustacean, gastropods, and

108

mollusc (Bruton, 1996). It can wander from coastal areas and further upstream, which make it an excellent candidate for biomonitoring of pollution. These species are commonly caught by fishermen and served as common source of animal protein. This fish is a secondary or tertiary consumer in the food chain, Saleh & Marie (2016) also justified its selection as bio-indicator. It was considered an appropriate bio-indicator of accumulation of heavy metals in their tissues. Nevertheless, there is no such report on catfish Arius thalassinus in Kuala Gula. For these reasons catfish is more susceptible than the others are to exposure and accumulation of heavy metals in their tissues. Therefore the aim of this study was to evaluate the levels of Cd and Pb in different parts of organs of catfish Arius thalassinus (muscle, gills, liver, stomach, and kidney), from Kuala Gula, Perak Peninsular of Malaysia.

Materials and Methods

Location Description

Arius thalassinus were collected from Kuala Gula, Perak, Peninsular Malaysia (N 410816’. 90” - N 40563/7.50 & E 10110854.320”- E 100028/47.89”). Human activities involved at the nearby rivers include activities related to fishing, holiday resort, restaurant and aquaculture. The land area surrounding the mangrove area is utilised as oil palm plantations. The major sources of contamination were from domestic effluents and sewage and anthropogenic inputs of pesticides and fertilizers used in aquaculture and farming activities. The sites are shown in Figure1.

Figure 1: Aerial photography showing sampling location in Kuala Gula (Source: Google Earth)

109

Sampling of Arius thalassinus

Thirty samples of catfish (Arius thalassinus) were caught by fisherman from five locations from Kuala Gula River. All samples were put in a clean polyethylene plastic bag separately, preserved in an icebox and transported to the laboratory. On the same day, the length (cm) and weight (g) of all fish were measured manually by scale meter and digital balance. Fishes were grouped according to length and weight: Group 1: 13.0 -16.5 cm and 29.3 – 40.0 g – Small Fish. Group 2: 18.4 -19.7 cm and 41.0 – 76.0 g – Medium Fish. Group 3: 19.8-25.5 cm and 55.0 - 261.7 g – Large Fish.

Heavy metals digestion Digestion of fish sample follows Yap et al. (2008). Dried samples were crushed by mortal and pastel. About 0.5g of fish as taken from each one and 5 ml of HNO3 (AnalaR Grade, BDH69 %) was added to each sample and was digested in digestion block at 40°C for one hour. Then, the temperature was increased to 140°C for three hours. Afterwards the samples were allowed to cool at room temperature, and then all samples were diluted with distilled water until a certain volume (20mL). The blanks were prepared for all samples. All samples were filtered through Whatman No.1 filter papers. Then all samples were cooled and stored for Cd and Pb analyses by using an air-acetylene flame atomic absorption spectrophotometer (AAS). To avoid possible contamination all glassware and equipment were acid-washed with 5% nitric acid then rinsed with distilled water before use (Yusof, 2005).

Statistical analysis

Statistical analyses of data were carried out using SPSS version22. One way analysis of variance (ANOVA) was used to assess whether metal concentrations varied as significantly with all tissues of fish. In addition Pearson’s correlation coefficient was done to check for significant relationships between heavy metal concentration and size (length and weight).

Results and discussion The results showed that significant differences (p<0.05) between heavy metals Pb, Cd and different tissues of catfish. There was a significant (p<0.05) positive relationship between the size (length and weight) of all the fish in Pb and Cd concentration. The highest accumulation of heavy metals was found in the large fish while the small fish showed the lowest accumulation Table 1. These results are in agreement with Bashir et al. (2011), who mentioned that metal concentrations were affected by fish length and weight. Accumulation of heavy metals in organisms is controlled by specific uptake, detoxification, elimination mechanisms and, size-specific metabolic rate of organisms. On the contrary, Mohamat-Yusuff et al. (2015) reported negative correlation between size and concentration of Pb and explained that it may be due to the ability of catfish to regulate and maintained these heavy metals concentration in their body by metabolic activity. The order of accumulation of Pb in the small fish was: gill >liver > kidney > stomach > muscle.The gills recorded high accumulation of Pb. The highest concentration of Pb was also found in the gill of the medium fish where the order of accumulation was: gill>liver>stomach>kidney> muscle. Meanwhile, the accumulation of Pb in the

110

organs of the large fish was: gill>stomach>liver>kidney>muscle. Stomach accumulated high concentration of Pb after gills in the large fish. Akan et al. (2012) reported that different accumulation of different metals such as Cd, Cu, and Ni in the stomach might due to different feeding or different metal isolated habits of fish. All sizes of the fish accumulated lowest concentration in the muscles, while the gills show high accumulation of Pb and Cd. The mean concentration of Pb and Cd in muscle, gill, liver, stomach and kidney of catfish (Arius thalassinus) in different size were presented in Table1. The results show higher concentrations of Pb in all catfish tissues. The concentration of Pb exceeded the permissible limit set by the Malaysian Food Regulation (1985). Cadmium concentration is still below the permissible limit. Gill recorded high bioaccumulation of Pb (46.54µg /g d.w.) and Cd was very much lower (1.47µg/g d.w.) Figure 2. Yin et al. (2012) and Kamaruzman et al. (2011) also reported high concentration of Pb and Cd in the gills. These heavy metals accumulated in the fish tissues through the food chain. Bottom feeders are likely exposed to the metals accumulated in the sediment but the predators can accumulate metals from surrounding water and also from feeding other organisms (Kidwell et al., 1995). Catfish Arius thalassinus not only are bottom-dwelling omnivores (Crafford & Avenant-Oldewage, 2010), but also feeds on molluscs, crustaceans and fish. Therefore the bioaccumulation and biomagnifcation of heavy metals in their tissues are very high in these animals (Law& Singh. 1991).

Sources of contamination of heavy metals in these fish may be done from fishing boat or fishing vessel, anthropogenic sources that drained into the water and sediment contaminated with these metals. In Malaysia, over 60% of the population live in coastal in another biomonitoring study, Perna virdis, Isognomon alatus and other gastropods were used to assess heavy metals in coastal and intertidal areas (Ismail, 2006). The study reported the containments, which released into the sea through estuaries and the effect of these containments on the organisms living there. Heavy metals are one of the contaminants released from the polluted water of rivers to the seas. Aquatic animals like fish have been shown that there are not to be contaminated while some bivalves and seaweeds may have elevated levels of Pb and Zn. Thus, Pb and Zn may be of primary concern in future environmental monitoring activity (Shazili et al., 2006).

111

Table 1: Average concentration of metals (µg/g d.w.) in the organs of fish with different size (means±SE, n= 150) Total length and Organs Pb Cd weight of fish Small Muscle 10.00±1.00a 0.61±.05a

(13.00-16.0) cm Gills 33.87±6.35b 1.31± .09d

(29.3- 48.00) g Liver 21.40±4.08a 1.11± .04c

Stomach 17.09±1.91a 1.00 ±.07b

Kidney 19.05±3.05a 1.15± .06cd

Medium Muscle 15.76±.95a 0.82± .04a

(18.4-19.7) cm Gills 40.88±1.87c 1.45± .09c

(41.0-76.00) g Liver 36.61±2.68bc 1.34± .08c

Stomach 33.40± 1.97b 1.26± .04bc

Kidney 32.11± 2.29b 1.19 ±0.03b

Large Muscle 40.23±4.90a 1.22±0.05a

(19.8-25.5)cm Gills 79.58±3.93b 1.79± 0.09a

(55.00-261.7) g Liver 70.37± 5.01b 1.35± 0.14a

Stomach 76.90± 4.04b 1.29±0.06a

Kidney 67.08±4.29b 1.32 ± 0.07b

Total 39.55 ±2.02 1.20±.02

Different letters in each column indicate statistically significant differences (p<0.05) by Duncan

The use of bio-indicator for monitoring heavy metals status of the environment in Malaysia was discussed by Market et al. (1999) and Ismail (2011). Biomonitoring can be applied through the biota of aquatic system as bio-indicators for pollution of heavy metals in such environment. Fish plays a vital role in detection of heavy metals and accumulated in their tissues. Many biomonitoring studies used fish and other organisms such as mussels (Perna viridis) as bio- indicator in Malaysia (Ismail, 2011). Telescopium telescopium is among the intertidal species of molluscs used as bio-indicator for monitoring heavy metals in another study in Lukut River (Ismail & Safahieh, 2005). Yap et al. (2004) mentioned that contamination of heavy metals occurs in water, sediment and the food chain. Domestic effluent waste discharged into the river may also have a contribution to polluting the fish species with heavy metals. Therefore, the high concentration of Pb in the tissues of catfish may be contributed by all the factors mentioned above. A similar observation was found by Yap et al. (2008) in

112 guppy fish and reported that the high Pb concentration might be due to anthropogenic sources such as effluents from domestic wastes. The high bioaccumulation of Pb in the gill tissue compared to other tissues could be due to the thin gill membrane that has very high surface area, which serves as respiratory membrane. According to this nature, there is very high possibility that heavy metals can enter the gills of fish in the water and sediment. Gills are metabolically active tissues. Thus, a high accumulation of heavy metals occurs in this organ (Yalmaz, 2009). Apart from the gill, the liver and kidney are also the target organs. The liver and kidney play very an important role in digestion system and filtration that leads to the transfer and bioaccumulation of heavy metals (Pourang, 1995). In other studies, it was explained that differences in heavy metal concentration in tissues of fish might be due to their capacity to induce metal- binding proteins such as metallothioneins (Bashir et al., 2011; Mohamat-Yusuff et al., 2015). Gills have higher tendency and capacity to accumulate Cd compared to liver and muscle tissues. Furthermore, Cd and Pb belong to the group of non-essential elements. They know as toxic metals, which were implying an anonymous function in biochemical processes (Yin et al., 2012).

Meanwhile muscle is recorded low bioaccumulation of Pb and Cd because it is non-active when it contrasted with different tissues; for example, gill, liver and kidney (Yap et al., 2005). As it was indicated by the investigations led by Rahman et al. (2013) in the sediment of Kuala Gula, the accumulation of these metals is site-particularly, which reflects ceaseless anthropogenic contributions to the aquatic ecosystem from aquaculture and manor activities. Moreover, the current pulverization of expansive and mangrove territory in Kuala Gula to help the expanding interest for aquaculture, which could be one of the reasons for higher grouping on overwhelming heavy metals in the fish in the area. The levels of Pb in muscle are higher than the recommended levels set by Malaysian Food Regulation (1985). Numerous issues may emerge from the dietary intake of Pb. Acute effects of Pb on the central nervous system are generally seen in children and are shown by by severe encephalopathy that can culminate in coma and death. Nevertheless, the potential hazards of metals transferred to humans are probably dependent on the amount (g wet weight) of food consumed by an individual (Yap et. al, 2004).

90 b b 80 b b 70 60 c aa 50 b b b b

40 a a aa a a 30 a 20

Conc.(µg/gd.w.) of Pb 10

0

Gills Gills Gills

Liver Liver Liver

Kidney Kidney Kidney

Muscle Muscle

Muscle

Stomach Stomach Stomach Small Medium Large Size

Figure 2: Concentration of Pb (mean μg/g dry weight ± SE) and different sample size and different organs of Arius thalassinus catfish collected from Kuala Gula River.

Cadmium is considered low as compared with the permissible limit Table 2. The highest concentration in the gill was 1.47µg/g d.w. and the lowest in the muscle was 1.22 µg/g d.w. According to the studies conducted by Tweel et al. (2013), the concentration of Cd is low in the organs of fish in relation to other elements. Furthermore, Cd and Pb belong to the group of non-essential elements and they are known as toxic metals. In addition they are implying as an anonymous function in biochemical processes (Yin et al., 2012). Figure 3 shows that the gills recorded high accumulation in three different sizes

113

(1.47µg/g d.w.) followed by the liver, kidney, stomach and muscle. Accumulation of Cd in small fish can be summarized as follows: gill>kidney>liver>stomach>muscle. The rank of accumulation in medium fish is: gill>liver>stomach>kidney> muscle and in the large fish: gill>liver>kidney>stomach>muscle.

Table 2: Guidelines stander of Cd and Pb in fish (µg/g dry weight) in fish and comparison with food safety by international stander in different countries: Location Metals Reference Cd Pb Malaysia 1 2 Malaysia Food Regulation(1985) ICES 1.80 3 Yap et al. (2004). Brazilian Ministry of 5 10 Hossen et al. (2015). Health Permissible limit set by - 6.67 Hossen et al. (2015). Ministry of Public Health Thailand

United States. 25 11.50 Yap et al. (2004). HKEPD (Hong Kong 2 6 Yap et al. (2004). Environmental Protection Department WHO 2 1.5 Yap et al. (2004). Kuala Gula 1.22 22.0 Current study

1.6 1.4 d c d bc 1.2 c b d 1 b b c c 0.8 a b a 0.6 a

0.4 Cd con.µg/g dry weight dry con.µg/g Cd 0.2

0

Gills Gills Gills

liver liver liver

Kidney Kidney Kidney

Muscle Muscle Muscle

Stomach Stomach Stomach Small Medium Large Different sample size

Figure 3: Concentration of Cd (mean μg/g dry weight ± SE) and different sample size of and different organs of Arius thalassinus catfish collected from Kuala Gula River.

114

The concentration of Cd was still low as compared to the guidelines inTable 2. Comparing this study with other studies as presented in Table 3, accumulation of Pb and Cd in muscle tissues are higher than study of Bashir et al. (2011). The accumulation of Pb and Cd in muscle tissues are still lower compared to the study byf Yin et al. (2012).

Table 3: Comparison of concentrations (µg/g dry weight) of Lead (Pb) and Cadmium (Cd) in Muscle in catfish from Kuala Gula with other studies of fish in Malaysia

Location Pb Cd Reference Kuala Gula 22.0 1.22 Current study KelanaJaya - 0.98-4.95 Yap et al. (2004) Pond Lake Chini, 0.00-1.14 0.15-047 Ahmad & Shuhimi- Pahang Othman, (2010) Costal water 0.1 2 0.088 Bashir et al. (2011) of Kapar Johor Bahru 0.02 0.02 Bashir et al. (2011) Kelantan 22.73 1.61 Yin et al. (2012)

Conclusion Current study provide baseline information for toxic heavy metals concentration in catfish from the Kuala Gula River. The gills recorded high concentration in Pb and Cd. Lead exceeded the permissible limits of Malaysian food Regulation (1985).The study suggests continuing biomonitoring status of heavy metals contamination and its effects on biota in Kuala Gula especially in Pb. It is also suggested that catfish is a suitable bio-indicator for monitoring heavy metals pollution.

Acknowledgement We express our thank to the Universiti Putra Malaysia (UPM) for contributing infrastructural facilities.

115

References

Akan, J. C., Salwa, M., Yikala, B. S., & Chellube, Z. M. (2012). Study on the distribution of heavy metals in different tissues of fishes from river benue in Vinikilang, Adamawa State, Nigeria. British Journal of Applied Science & Technology, 2(4), 311.

Alam, L., Mohamed, C. A. R., & Mokhtar, M. B. (2012). Accumulation pattern of heavy metals in marine organisms collected from a coal burning power plant area of Malacca Strait. Science Asia, 38, 331-339.

Azrina, M. Z., Yap, C. K., Ismail, A. R., Ismail, A., & Tan, S. G. (2006). Anthropogenic impacts on the distribution and biodiversity of benthic macroinvertebrates and water quality of the Langat River, Peninsular Malaysia. Ecotoxicology and environmental safety, 64(3), 337-347.

Bashir, F. A., Shuhaimi-Othman, M., & Mazlan, A. G. (2011). Evaluation of trace metal levels in tissues of two commercial fish species in Kapar and Mersing coastal waters, Peninsular Malaysia. Journal Of Environmental And Public Health, 2012.

Berandah, F. E., Kong, Y. C., & Ismail, A. (2010). Bioaccumulation and distribution of heavy metals (Cd, Cu, Fe, Ni, Pb and Zn) in the different tissues of Chicoreus capucinus lamarck (Mollusca: Muricidae) collected from Sungai Janggut, Kuala Langat, Malaysia. Environ Asia, 3(1), 65-71.

Bruton, M. N. (1996). Alternative life-history strategies of catfishes. Aquatic Living Resources, 9(S1), 35-41.

Crafford, D., & Avenant-Oldewage, A. (2010). Bioaccumulation of non-essential trace metals in tissues and organs of Clarias gariepinus (sharptooth catfish) from the Vaal River system–strontium, aluminium, lead and nickel. Water Sa, 36(5).

Edward, F. B., Yap, C. K., Ismail, A., & Tan, S. G. (2009). Interspecific variation of heavy metal concentrations in the different parts of tropical intertidal bivalves. Water, Air, And Soil Pollution, 196(1-4), 297.

Farkas, A., Salánki, J., & Specziár, A. (2003). Age-and size-specific patterns of heavy metals in the organs of freshwater fish Abramis brama L. populating a low-contaminated site. Water research, 37(5), 959-964.

Hajeb, P., Jinap, S., Ismail, A., Fatimah, A. B., Jamilah, B., & Rahim, M. A. (2009). Assessment of mercury level in commonly consumed marine fishes in Malaysia. Food Control, 20(1), 79-84.

Hossen, M. F., Hamdan, S., & Rahman, M. R. (2015). Review on the risk assessment of heavy metals in Malaysian clams. The Scientific World Journal, 2015.

Ismail, A., & Ramli, R. (1997). Trace metals in sediments and molluscs from an estuary receiving pig farms effluent. Environmental Technology, 18(5), 509-515.

Ismail, A., & Safahieh, A. (2005). Copper and zinc in intertidal surface sediment and Telescopium telescopium from Lukut River, Malaysia. Coastal Marine Science, 29(2), 111-115.

Ismail, A. (2006). The use of intertidal molluscs in the monitoring of heavy metals and organotin compounds in the west coast of Peninsular Malaysia.

Ismail, A. (2011). Coastal Biodiversity and Pollution: A Continuous Conflict. Penerbit Universiti Putra Malaysia.

Ismail, A., & Yusof, S. (2011). Effect of mercury and cadmium on early life stages of Java medaka (Oryzias javanicus): A potential tropical test fish. Marine Pollution Bulletin, 63(5), 347-349.

Kamaruzzaman, B. Y., Rina, Z., John, B. A., & Jalal, K. C. A. (2011). Heavy metal accumulation in commercially important fishes of South West Malaysian coast. Research Journal Of Environmental Sciences, 5(6), 595.

116

Kidwell, J. M., Phillips, L. J., & Birchard, G. F. (1995). Comparative analyses of contaminant levels in bottom feeding and predatory fish using the national contaminant biomonitoring program data. Bulletin of Environmental Contamination and Toxicology, 54(6), 919-923.

Law, A. T., & Singh, A. (1991). Relationships between heavy metal content and body weight of fish from the Kelang estuary, Malaysia. Marine Pollution Bulletin, 22(2), 86-89.

Malaysian Food Regulation. (1985). Malaysian law on food and drugs.Malaysian Law Publishers.

Markert, B., Wappelhorst, O., Weckert, V., Herpin, U., Siewers, U., Friese, K., & Breulmann, G. (1999). The use of bioindicators for monitoring the heavy-metal status of the environment. Journal of Radioanalytical and Nuclear Chemistry, 240(2), 425-429.

Mohamat-Yusuff, F., Yun, L. S., Wan, E. C. K., & Zulkifli, S. Z. (2015). Profile of Heavy Metals Level in Catfish (Hexanematichthys sagor) and Green Mussel (Perna viridis) from Kong Kong Laut, Johor Straits. Acta Biologica Malaysiana, 4(2), 46-50.

Naji, A., Ismail, A., Kamrani, E., & Sohrabi, T. (2014). Correlation of MT levels in livers and gills with heavy metals in wild tilapia (Oreochromis mossambicus) from the Klang River, Malaysia. Bulletin Of Environmental Contamination And Toxicology, 92(6), 674-679.

Pourang, N. (1995). Heavy metal bioaccumulation in different tissues of two fish species with regards to their feeding habits and trophic levels. Environmental Monitoring and Assessment, 35(3), 207-219.

Rahman, F., Ismail, A., & Yusof, S. (2013). Metals contamination in the foraging area of Milky Stork: evidence of anthropogenic inputs in the aquatic environment of Kuala Gula, Malaysia. Toxicological & Environmental Chemistry, 95(9), 1499-1505.

Rahouma, M., Shuhaimi-Othman, M., & Cob, Z. C. (2013). Assessment of selected heavy metals (Zn, Mn, Pb, Cd, Cr and Cu) in different species of Acetes shrimp from Malacca, Johor and Terengganu, Peninsular Malaysia. Journal of Environmental Science and Technology, 6(1), 50-56.

Saleh, Y. S., & Marie, M. A. S. (2016). Use of Arius thalassinus fish in a pollution biomonitoring study, applying combined oxidative stress, hematology, biochemical and histopathological biomarkers: A baseline field study. Marine Pollution Bulletin, 106(1), 308-322.

Shazili, N. A. M., Yunus, K., Ahmad, A. S., Abdullah, N., & Rashid, M. K. A. (2006). Heavy metal pollution status in the Malaysian aquatic environment. Aquatic Ecosystem Health & Management, 9(2), 137-145.

Sow, A. Y., Ismail, A., & Zulkifli, S. Z. (2013). An assessment of heavy metal bioaccumulation in Asian swamp eel, Monopterus albus, during plowing stages of a paddy cycle. Bulletin of environmental contamination and toxicology, 91(1), 6-12.

Squadrone, S., Prearo, M., Brizio, P., Gavinelli, S., Pellegrino, M., Scanzio, T., & Abete, M. C. (2013). Heavy metals distribution in muscle, liver, kidney and gill of European catfish (Silurus glanis) from Italian Rivers. Chemosphere, 90(2), 358-365.

Taweel, A., Shuhaimi-Othman, M., & Ahmad, A. K. (2013). Assessment of heavy metals in tilapia fish (Oreochromis niloticus) from the Langat River and Engineering Lake in Bangi, Malaysia, and evaluation of the health risk from tilapia consumption. Ecotoxicology and Environmental Safety, 93, 45-51.

Tchounwou, P. B., Yedjou, C. G., Patlolla, A. K., & Sutton, D. J. (2012). Heavy metal toxicity and the environment. In Molecular, Clinical And Environmental Toxicology (pp. 133-164). Springer Basel. Udechukwu, B. E., Ismail, A., Zulkifli, S. Z., & Omar, H. (2015). Distribution, mobility, and pollution assessment of Cd, Cu, Ni, Pb, Zn, and Fe in intertidal surface sediments of Sg. Puloh mangrove estuary, Malaysia. Environmental Science and Pollution Research, 22(6), 4242-4255.

117

Vinodhini, R., & Narayanan, M. (2009). The impact of toxic heavy metals on the hematological parameters in common carp (Cyprinus carpio L.). Journal of Environmental Health Science & Engineering, 6(1), 23-28.

Yap, C. K., Ismail, A., Tan, S. G., & Omar, H. (2002). Correlations between speciation of Cd, Cu, Pb and Zn in sediment and their concentrations in total soft tissue of green-lipped mussel Perna viridis from the west coast of Peninsular Malaysia. Environment International, 28(1), 117-126.

Yap, C. K., Ismail, A., & Tan, S. G. (2004). Heavy metal (Cd, Cu, Pb and Zn) concentrations in the green-lipped mussel Perna viridis (Linnaeus) collected from some wild and aquacultural sites in the west coast of Peninsular Malaysia. Food Chemistry, 84(4), 569-575.

Yap, C. K., Ismail, A., & Chiu, P. K. (2005). Concentrations of Cd, Cu and Zn in the fish tilapia Oreochromis mossambicus caught from a Kelana Jaya Pond. Asian Journal of Water, Environment and Pollution, 2(1), 65- 70.

Yap, C. K., Edward, F. B., Emila, R. A. A., Ainey, F. I., Ismail, A., Tan, S. G., & Sharizat, Y. (2008). Determination of contamination and bioavailabilities of heavy metals (Cu, Cd, Zn, Pb and Ni) in the Serdang Urban Lake by using guppy fish Poecilia reticulata. Trends in Applied Science and Research, 3, 69-75.

Yilmaz, F. (2009). The comparison of heavy metal concentrations (Cd, Cu, Mn, Pb, and Zn) in tissues of three economically important fish (Anguilla anguilla, Mugil cephalus and Oreochromis niloticus) inhabiting Koycegiz Lake-Mugla (Turkey). Turkish Journal of Science & Technology, 4(1).

Yin, S. A., Ismail, A., & Zulkifli, S. Z. (2012). Heavy metals uptake by Asian swamp eel, Monopterus albus from paddy fields of Kelantan, Peninsular Malaysia: preliminary study. Tropical life sciences research, 23(2), 27.

Yusof. S (2005) Distribution and accumulation of heavy metals in fish in cage system in Linggi Estuary Malaysia, Ph.D thesis, Universiti Putra Malaysia.

118

3.6 Soil Morphological Properties in Acacia mangium Plantation Area, Bintulu, Sarawak

Summary

Acacia mangium had been introduced for the timber plantation programme in Malaysia as it possesses a rapid growth and tolerance of very poor soils. Soil properties understanding is essential in ensuring the forest plantations productivity to become sustain. The objective of this study was to determine the soil morphological properties in an A. mangium plantation in Daiken Sarawak Sdn. Bhd located in Bintulu, Sarawak, Malaysia. Soil profiles in the study area were established in stand ages of 3.7, 5.8, 10.8, and 12.7 years old of A. mangium plantation including an unplanted area represented as a control plot. Soil profile description was conducted at each stand area. The soils in the study area was dominated by sandy clayey loam texture. The O horizon thickness increasing as the stands age increased. The control plot possessed the thickest O horizon among all soil profiles in the study area. The R horizon existed in 3.7, 8.5 and 12.7 years old area while 10.8 years old area had E horizon. The soil colour from the topsoil to the deeper horizons in all plots soil profile were observed to have small variation as within the range of dark yellowish brown (10YR 4/4) to Yellow (10YR 7/8). Most of A horizon in all plots were found to have similar degree level of stickiness but different in plasticity. The yellowish-red colour, rock fragment and clay content presence to the most of soil properties in the study area consistently to the common characteristics of Bekenu series of soil type.

Keywords: Acacia mangium Plantation, Rapid Growth, Soil Profile, Soil Morphology

Introduction

Soil is the essential component in ensuring the forest plantations productivity to become sustain (Bouma, 1994). Information on the soil characteristics and morphological properties on a given land can be determined by observing the soil profile development at various depths of the soil. Generally, soil morphological properties deal with the form and arrangement of soil features and can be observed at both field survey and laboratory analysis. In the field, in-situ observation, description and interpretation of the soil within various soil horizons can portray various soil attributes such as soil name, structure, parent materials, erosion, ground water, compaction, consistency and drainage of soils. Field observation on the soil morphological properties also can determine the land use history of the soil observed.

Based on the International Conference held in Kuching in 1998, the Sarawak government had made a policy to achieve one million ha of forest plantation development as the target for the next 15 to 20 years (Forest Department Sarawak, 2017). In this regard, A. mangium had been introduced as it possessed a rapid growth and tolerance of very poor soils which then playing an increasingly important role in efforts to sustain a commercial supply of tree products whilst reducing pressure on natural forest ecosystems. In fact, according to the official website of Forest Department Sarawak (2017), A. mangium hold the top ranking of selected species for planted forest program which 76% approved by the licence for planted forest (LPF) for this species. Previous studies have been conducted on the soil status in A. mangium plantation in Bintulu Sarawak such as Lee et al. (2015) and (Tanaka et al. (2015), but more information of morphological properties are required to determine the land use history of the A. mangium plantation and to describe the soil properties in general by taken into account the soil heterogeneity as well as the existing environment. Hence, the objective of this study was to determine the soil morphological properties of the actual plantation activity in Daiken Sarawak Sdn. Bhd plantation area located in Bintulu, Sarawak, Malaysia.

Materials and Methods

Study area

The study was conducted at a forest plantation owned by Daiken Sarawak Sdn. Bhd, the Malaysian and Japanese joint venture companies incorporated on February 15, 1994. The plantation area located approximately 60 km from the town of Bintulu in Sarawak, Malaysia at 03˚21.347’ N and 113°27.129’ E. The site receives a total annual rainfall of 2749 mm and the average temperature ranges from 23 to 32 °C. The plantation was originally a secondary forest and was planted with A. mangium. Field samplings were

119 conducted in the five different stand ages which are 3.7, 5.8, 8.5, 10.8, and 12.7 respectively. These stands were selected to represent growth performance spaced about two years apart. One unplanted area within the plantation area was sampled and act as control. The type of soil in the Daiken Sdn Bhd plantation is a well-drained Bekenu series characterized by fine, loamy, siliceous, isohyperthermic, and red-yellow to yellow. According to Paramanathan (2000), the main factor restricting the use of this soil is its low fertility status. The initial soil conditions were considered to be similar for all stands, as the terrain was undulating with a slope of less than 6˚ and was covered by the same type of vegetation.

Determination of Soil Morphological Properties

The general soil properties of each study plots in a greater detail were determined by collecting the soil samples at each plot and one representative area which has yet to be planted (area planned for plantation activities in the future). Soil profile is a vertical section of the soil extending through all its horizons and into the parent material. For soil profile description, a soil pit with the depth of 1m and 0.5m width was dug. Six pit locations (including one control area) were chosen within the centre of the plot study to represent the soil morphological status for each plantation age area. Soil profile descriptions were conducted adopting the standard procedures by International Soil Science Society (ISSS) (NRCS, 2002). The identification of major characteristics of the soil profiles were conducted through in situ method. Characteristics such as colour, texture, consistency, structure, presence of rock fragment mottling and organic matter were determined. The soil colour was determined by using Munsell Soil Colour chart while the texture was determined by ‘feel method’.

Results and Discussion

Descriptions and images of soil profiles are shown in Table 1 and Figure 2. In-situ observation showed that the area consisted of monodominance forest of A. mangium and some shrubs species. Soil profiles in all study sites (Table 1) showed the existence of sandy, clayey and loamy texture in the horizons. Thus, according to Applied Agriculture Resources (2004), the occurrence of Bekenu family is made from the mixed parent materials where a strong textural contrast is found as the thin sandstone and shale beds are in one profile. This family include soils that have developed in residuum or non-accreting alluvium derived from sedimentary rocks. The Bekenu Series soils are also defined to have several characteristics such as their depth level and the well-drained profiles which consist of subsoils that dominated with brownish yellow to yellow subsoil colours (Mohidin, Jack and Man, 2009). The structures of the soils are usually in medium weak to coarse subangular blocky while their consistency is always friable in the upper parts and firm in the lower parts (Mohidin, Jack and Man, 2009).

Results in Table 1 showed the increasing trend of thickness in O horizon with increasing of stand age in the study sites while control soil profiles were recorded to have the thickest among the others. The increase of thickness of O horizon was probably due to the increase amount of organic materials in the soil profiles that had been supplied by the decomposition of litterfalls that occurred over years after planting. It indicates that the age stand affected the accumulation of the litterfall which was decompose into organic materials. The O horizon covering the topsoil which the decomposition occurs reflect the activity of decomposer that soon returns nutrient back to the soil. Meanwhile, there was presence of R horizon in the sites of 3.7, 8.5 and 12.7 years old soil profiles. R horizon is the layer where the hard bedrock is existed within the soil (FAO, 2006). The non-calcareous sedimentary rocks are the common parent materials in Bekenu Series (Teng, 2004). The 10.8 years old area soil profile was found to have the presence of E horizon. It was observed within the depth of 21-41 cm of the soil pit. The presence of many mottling abundance was also observed to be appeared within the horizon.

The texture of the A horizon of all plots was observed to be dominated by sandy loam (Year 10.8, 12.7 and control area) and clay loam (Year 3.7, 5.8 and 8.5 area). While, the other subsoil horizons in all plots of the study were generally dominated with sandy clay loam texture. Clayey loam texture was observed in the study sites of 3.7 years old (R horizon), 8.5 years old (C horizon), 12.7 years old (R horizon) and control (C horizon). Meanwhile the presence of clay texture was observed in study sites of

120

8.5 R (horizon) and 12.7 years old (B horizon). Through this trend, it can be assumed that in the deeper soil horizons in 3.7, 5.8, 10.8 years old and control soil profiles may only have the presence of clay texture.

The soil colour trend from topsoil to the deeper horizon in all plots soil profile was observed to have not much different. The soil colour at A horizon in 8.5 years old and control sites were observed to be darker than that of other plots as the colour was yellowish brown (10YR 5/8) while the others were in the range of dark yellowish orange (10YR 6/6) to yellowish orange (10YR 7/6). Hence, the organic matters probably appeared to contribute significantly to the darker A horizon soil in 8.5 years old and control sites. Meanwhile, the lighter colour of the soil at A horizon in 3.7, 5.8, 10.8 and 12.7 years old sites might be due to tillage and subsequent erosion (Kadir et al. 2001; Heshmati et al. 2012). The existence of E horizon in 10.8 years old site soil horizon showed the significant different in colour (yellowish orange 10YR 7/8) compared to the other horizons within the pit.

The soil consistency of all plots in A horizon showed the similar degree level of stickiness but different in plasticity. The 8.5 years old and control sites were observed to be very plastic and plastic respectively while sites in 3.7, 10.8 and 12.7 years old were observed to be slightly plastic. Meanwhile, the soil horizon in 5.8 years old stand age site was observed to have the lowest degree level of plasticity at its A horizon soil profile.

Relative similarities of the soil structure and the soil roots in A horizon were observed in all soil profiles. Based on the Table 1, the A horizon of 3.7, 5.8 and 8.5 years old soil properties were observed to be as accordance to Tanaka et al. (2015) who reported from their study in secondary forest of 6 and 9 years old of A. mangium in Bintulu Sarawak. However, the other subsoil horizons in all plots of the current study were inconsistent to those of Tanaka et al. (2015) and Karyati et al. (2014) as the soil properties within the current study area was dominated with high clay content. In addition, Kadir et al. (2001) stated that the stickiness and plasticity increases mainly due to the increasing amount of clay content in the soils. Thus, the high level of soil plasticity and stickiness in 8.5 years old and control area indicates that they had high amount of clay content within the soil properties. The 10.8 years old area soil profile was found to have the presence of E horizon. The existence of E horizon is due to the main feature of the mineral horizons in which is loss of silicate clay, iron, or aluminium, or some combination of these, leaving a concentration of sand and silt particles (FAO, 2006). This horizon exhibit obliteration of all or much of the original rock structure. It is the mineral leached horizon in the upper part of the soil present underlies an O or A horizon which appeared in light coloured. The presence of R horizon in the 3.7, 8.5 and 12.7 years old soil profile indicates that the presence of sedimentary rocks is abundance within the study area. Thus, this is consistent to the common properties in Bekenu Series that the weathered rock fragments are usually present in the subsoil that will increasing with the soil depth (Sabang, 1996). The presence of clay content as well rock fragments in the shallow soil depth caused the low nutrient, low water retention capacity and shallow rooting depth to the plantation area. It may cause the fallen of non-mature stands which contributed to the loss of harvesting products.

121

Table 1: Summary of Morphological properties of the soils in Daiken Sarawak Sdn Bhd Plantation

Year H D C F.T S C. R B R.F M (c m) 3.7 (N03° 22’ 29.3”E 113° 27 27.1”) O 0-2 10YR ------5/4 A 2- 10YR CL 2/cr ss/sp f dw n n 20 6/6 /f B 20- 2.5YR SCL 2/cr ss/sp fe dw n c/p 59 7/6 /f C 59- 10YR SCL 2/cr s/p fe gb n c/p 71 6/6 /f R 71- 10YR CL 3/gr ss/sp n a/a/sl n 90 6/8 /m w 5.8 (n03° 19’ 17.1”e 113° 25’ 21”) O 0-2 10YR ------4/4 A 2- 10YR CL 1/cr ss/np f gb n n 27 6/6 /m B 27- 10YR SCL 2/cr ss/p fe gb n n 69 6/6 /m C 69- 10YR SCL 2/cr ss/sp fe n n 100 6/8 /m 8.5 (N03° 18’ 53.5”E 113° 26’ 00.9”) O 0-4 10YR ------5/6 A 4- 10YR CL 2/cr ss/vp f dw f/a/sl n 20 5/8 /m w B 20- 10YR SCL 3/cr ss/vp fe dw c/a/sl n 39 6/6 /c w C 39- 10YR CL 2/cr ss/p fe cs f/sr n 43 6/8 /m D 43- 10YR SCL 3/cr ss/vp fe cs m/sa n 60 7/8 /c R 60- 10YR C 3/cr ss/vp n c/sa/s n 94 6/2 /m lw 10.8 (N03° 19’ 03.8”E 113° 26’ 53.0”) O 0-6 10YR ------6/8 A 6- 10YR SL 2/cr ss/sp f aw n n 21 6/6 /f E 21- 10YR SCL 2/cr ns/np fe di n m/m 41 7/8 /f /d B 41- 10YR SCL 2/cr ns/np fe ds n n 51 5/6 /vf C 51- 10YR SCL 2/cr ns/np fe dw n n 100 7/6 /vf 12.7 (N03° 21’ 24.3”E 113° 27’ 20.95”) O 0-9 10YR ------6/3 A 9- 10YR SL 2/cr ss/sp f ds n n 22 7/6 /vf B 22- 10YR C 2/cr ss/p fe ds n n 59 7/6 /vf

122

R 59- 10YR7 CL 3/cr ss/sp n gs m/a/ n 90 /6 /m mw

Contr (N03° 20’ 34.1”E 113° 27’ 01.8”) ol O 0- 10YR ------17 4/6 A 17- 10YR SL 2/cr ss/p f db n n 44 5/8 /m B 44- 10YR6 SCL 2/cr ss/p fe Dw n n 78 /8 /f C 78- 10YR6 CL 3/cr ss/p fe f/sr/m n 97 /6 /m w

Abbreviations: H: Horizon, D: Depth, C: Colour, F.T: Field Texture, S: Structure, C: Consistency, R: Roots, B: Boundary, R.F:Rock Fragment, M: Mottling, SCL: Sandy Clay Loam, CL: Clay Loam, C: Clay, LS: Loamy sand, SL: Sandy Loam, SiCL: Silty Clay Loam, L: Loam, 1: weak. 2: medium, 3: strong, Type: cr: crumb, gr: granular, Size: f: fine, m: medium, c: common, s: sticky, ss: slightly sticky, ns: non-sticky, vp: very plastic, p: plastic, sp: slightly platic, np: non- plastic, vf: very fine, f: fine, fe: few, n: none, e) Boundary: a: abrupt, c: clear, g: gradual, d: diffuse, s: smooth, w: wavy, i: irregular, b: broken, fe: few, co: common, n: none, Shape: a: angular, sa: subangular, sr: subrounded, weathering: slw: slightly weathered, mw: medium weathered, Mottling abundance, and contrast: m: many, c: common, d: distinct, p: prominent. Value in parentheses refers to GPS reading and slope.

123

3.7 5.8 8.5 10.8 12.7 Control

Figure 1: Images of soil pit for various age of A. mangium plantation soil profiles description in the study sites.

Conclusion Our findings indicated that the organic materials on the A. mangium forest floor increasing as the stand age increase. Soils in the study area consisted of sand, silt, clay and loam texture in the horizons of the soil profiles. Mainly, 8.5 years old and control area soil properties had the high clay content with high level of soil plasticity and stickiness. The presence of E horizon in 10.8 years old soil profile showed the effect of post-activity of reforestation to the area. Abundance of sedimentary rocks that present in the most of soil properties within the study area (3.7, 8.5 and 12.7 years old) and the presence of Red-Yellow Podzolic soils to all plots deduced that the study area were covered with Bekenu series of soil type. This family include soils that have developed in residuum or non-accreting alluvium derived from sedimentary rocks. This study can be further continued to larger scale of homogenous timber plantation area by taking into consideration of physical and biological condition of the field in order to get more information on soil to enhance the sustainable management of long-term timber production.

Acknowledgement We wish to express our gratitude to Daiken Sarawak Sdn Bhd for their supportive assistance and companionship during the duration of this study. The study was funded by FRGST grant FRGS/STWN02(02)/1142/2014(09).

124

References Applied Agriculture Resources (2014). Retrieved 12 February 2017 from http://www.aarsb.com.my Bouma J. (1994). Sustainable Land Use as A Future Focus for Pedology. Soil Sci Soc Am J., 58,645–646.

FAO. (2006) Guide To Laboratory Establishment For Plant Nutrient Analysis. FAO paperwork Department. Rome.

Heshmati M., Arifin A., Shamshuddin J., Majid NM (2012). Predicting N, P, K and Organic Carbon Depletionin Soils Using MPSIAC Model at the Merek catchment, Iran. Geoderma,175-176, 64-77.

Kadir S., Ishizuka I., Sakurai K., Tanaka S., Kubota S., Hirota M., Priatna S.J. (2001). Characterization of Ultisols under different wildfire in South Sumatra, Indonesia, I. Physico-chemical properties. Tropics, 10,565-580.

Kollert, W., Norini, H. and Ismariah, A. (1994). Economics of Forest Plantations with quality timber species: preliminary results. Pp 152-167. In Appanah, S., Khoo, K.C., Chan, H.T. & L.T. Hong (eds).Proceedings of the Conference on Forestry and Forest Products Research. Kuala Lumpur.

Mohidin H., Jack R., & Man S. (2009). Soil and Agricultural Capability of UiTM Sarawak Campus Farm, Malaysia, 35–41.

Natural Resources Conservation Services, United States Department of Agriculture, (NRCS). (2002). In: Schoeneberger, P.J., Wysocki, D.A., Benham, E.C. & Broderson, W.D. Eds). Field Book for Describing and Sampling Soils, Version 2.0. Lincoln, NE: Natural Resources Conservation Service,National Soil Survey Center.

Official Website of Forest Department Sarawak. (n.d.). Retrieved August 10, 2017, from http://www.forestry.sarawak.gov.my

Paramananthan S. (2000). Soils of Malaysia: Their characteristics and identification Akademi Sains Malaysia, Kuala Lumpur. p. 1.

Sabang, J. (1996). Detailed soil survey of sungai muput kiba area, model forest management area (anap f.r.) (Vol. 2).

Tanaka S., Kano S., Lat J., Effendi W. M., Tan N. P., Arifin, and Kendawang J. J. (2015). Effects of Acacia Mangium on Morphological and Physicochemical Properties of Soil, 27(3), 357–368.

Teng S.C. (2004). Keys to Soil Classification of Sarawak. Agriculture Department of Sarawak.

125

3.7 Optimal method to introduce faeces sample for olfactory-cues studies in Malayan tapir (Tapirus indicus)

Summary

Studying the hidden meaning behind the behaviours of wildlife can provide plenty of information for the betterment of their conservation. In this research, a preliminary study had been conducted to find out whether Malayan tapir (Tapirus indicus) (1) sniffs on the faeces or not and (2) to identify the optimal method of presenting the faeces samples. Five individuals of Malayan tapirs were contributed to this research as the samples donors and/or the subject. Basically, for this experiment several replicates of faeces samples were collected from the donors and frozen at -20˚C, and the thawed samples were introduced to the subjects at different time slots (morning, afternoon and night). The results showed that tapirs exhibited both investigation and identification behaviours when sniff on faeces samples of other individuals. However, the sniffing was observed only during early in the morning and night when they were active due to their nocturnal characteristic. We found that, the location and the sample nature (i.e., thawed at sufficient period of time) had influenced the attractiveness of presented faeces sample to tapirs. Presenting the samples at feeding and sleeping areas increased the chance for the tapirs to sniff on samples and well thawed samples which emits strong odour drawn tapir’s attention. Thus, it is recommended to take into account the above factors for further investigation related to the individual recognition through olfactory cues in Malayan tapir. The findings of this study could be incorporated in ex-situ conservation mainly during the selection of mating partners prior to physical introduction of the animals (strategy to avoid any injuries to tapir due to fighting and inbreeding in captivity).

Keywords: Malayan Tapir; Olfactory-Cues; Faeces; Individual Recognition; Ex-Situ Conservation

Introduction

Malayan tapir (Tapirus indicus), also known as Asian tapir is classified under the order of perissodactyla in Tapiridae family together with other four related species from neotropical regions (e.g., Central and Southern America); Mountain tapir (Tapirus pinchaque), Lowland tapir (Tapirus terrestris), Baird’s tapir (Tapirus bairdii), and Kabomani tapir (Tapirus kabomani) (Cozzuol et al., 2013). Malayan tapir is the largest species of the Tapiridae family (Gilmore, 2001), native to Southeast Asia which distributed throughout Indonesia (Sumatra), Peninsular Malaysia, Myanmar and Thailand (Traeholt et al., 2016; Lynam et al., 2008). They consume a diverse range of vegetation and fruits (Lynam et al., 2012). Malayan tapir is a nocturnal mammal that actively finds food and mating partner at night (Lynam et al., 2012).

Malayan tapir is listed as endangered species by the International Union for Conservation of Nature (IUCN) Red List due to road kills, habitat loss as the result of

126

deforestation, tropical rain forest fragmentations, and accidental capture as it often fall in snare setup for other animals (Traeholt et al., 2016; Lynam et al., 2008). The current wild population is estimated to be less than 2500 mature individuals and it is anticipated the population size could decline further up to 20% within the upcoming two generations (Traeholt et al., 2016). As an effort to increase the population, Malayan tapirs are bred in captivity in the conservation centres (Traeholt et al., 2016). Individuals in captive breeding however are susceptible to inbreeding depression as most of them are related to each other (Traeholt et al., 2016).

Olfactory communication are vital for solitary-living species for exchanging of chemical signals on recognizing particular individual as potential mating partner, family member or competitor (Linklater, Mayer, & Swaisgood, 2013; Hurst, 2009; Swaisgood, Lindburg, White, Zhang, & Zhou, 2004). A study on the effects of sex, reproductive condition, and context on discrimination of conspecific odours concluded that olfactory cues aid Giant pandas for territorial, sex and reproductive condition discriminations (Swaigood, Lindburg, Zhou, & Owen, 2000). Urine, faeces, body odour, sweat and vaginal discharge are some sources that emit olfactory-cues. Previous study proposed that faeces is a suitable source to study olfactory communication as it is easy to locate and collect compared to other sources (Linklater et al., 2013). For example, black rhinoceros (Diceros bicornis) found to distinguish individuals of same species via presented faeces samples and it was concluded to be an important chemo-signal in that species (Linklater et al., 2013). However, it is unknown whether Malayan tapir will smell on the faeces for individual recognition through olfactory-cues and the appropriate method to introduce the faeces samples.

Therefore in this study, we assessed the ability of Malayan tapir to sniff on introduced faeces samples, the suitable time to conduct the experiment (morning, afternoon or night) and also tested the efficient way of introducing the samples (i.e., thawing duration and site of presentation).

Methodology

Study site

This study was conducted for four weeks in November/December 2016 at Zoo Negara, Ampang, Selangor (3°12'21.00" N 101°45'16.79" E). All the tapirs which were involved in this study were handled by following the animal handling procedures approved by the University of Putra Malaysia Ethics Committee (Reference No: UPM/IACUC/AUP-R033/2016). There were in total of five tapirs in Zoo Negara; three males and two females (Table 1: all the tapirs were given dummy names for confidential purpose). Tapir Jasper, Max and Felix were the donors of faeces samples while Tapir Domino and Daisy which live in the same enclosure were used as the experimental subjects.

127

Table 1: List of Malayan tapirs used as sample donor and experimental subject

Name Gender Role Domino Male Experimental subject Daisy Female Experimental subject Jasper Male Sample donor Max Male Sample donor Felix Female Sample donor

Sample Collection And Experiment Design

Six replicates of faeces samples were collected from each donor and kept at -20˚C in the freezer (Table 1, Figure 1). Refrigerated samples were thawed before present. All three faeces samples from different individuals as mentioned above were introduced to the selected experimental individuals (Domino and Daisy) at the same time. The samples were presented on the floor inside the enclosure as shown in Figure 2. This experiment was conducted on every Monday for four consecutive weeks.

The experiment was conducted at two sessions; morning and afternoon on the first two weeks; only in the morning on third week; and morning and night on the fourth week (for further explanation see result section). During morning and afternoon session, direct observations and video recordings using handy camera (Brand: Sony, Model: FDR-AXP35) were conducted to capture the duration of sniffing and the behaviours throughout the study period (Figure 3). Night observation was recorded on the fourth week from 2000 to 0800 on the following morning by using camera traps (Brand: Scout Camera, Model: DTC-560K) because direct observation at night was not allowed.

128

Figure 1: (a) Fresh sample of Malayan tapir, (b) Thick plastic bags used to store the faeces samples, (c) Segregation of collected samples, and (d) Sample labelling.

Figure 2: Faeces samples introduction pattern and two different sites (a and b) where samples were presented within their enclosure.

129

Figure 3: (a) Camera setup up and (b) camera positioning.

Behavioural Ethogram Of Malayan Tapir

An ethogram was reconstructed including all possible behaviours that tapirs may exhibit when they smell the samples by referring to previous studies (Tortato, Santos, Carlos, Machado, & Hotzel, 2007; Gilmore, 2001; Dawkins, 2000; McDonnell & Haviland, 1995; Hunsaker & Hahn, 1965; Table 2).

130

Table 2: Behavioural ethogram of Malayan Tapir.

Behavioural Behavioural Description grouping subgrouping The body is stationary position Alert/Observing either sitting or standing, raising its head and staring on another species or object with eye wide open and alert to surrounding. Investigating The inhalation of air- either Sniffing/smelling directed at an object, determined site, or in the air. Head elevated and neck extended, with the eyes rolled back, the ears Flehmen rotated to the side, and the upper lip curled exposing the upper incisors and adjacent gums. The head may roll to one side or from side to side. Typically occurs in association with olfactory investigation. Identification Smelling of urine or Smelling of urine or faeces; may dung be followed by flehmen. Vocalization Vocalization Sound produced through the oral or sinus cavity. Animal shown a violent behaviour Aggression Aggression and in an attack gesture towards conspecific, another species or object. Fear Startled Animal show scared behaviour as it is in a threatening or dangerous situation.

Results

On the first week, we found the pair-living tapirs (Domino and Daisy) did not sniff on any of the presented samples due to some technical issues such as the presented samples were still frozen (thawed for 3 hours) thus no odour and environmental issues (tapirs movement restricted due to rain) (Table 3).

131

We found that the thawing time of the faeces samples from freezer to reach ambient temperature should be increased. Therefore, from second week onwards the samples were thawed one day earlier (minimum of 24 hours before the presentation).

Table 3: Overall result of the study for four consecutive weeks.

Session Week Morning Evening Night 1 (14/11/20 No result No result 17) 2 Sniffing (21/11/20 No result observed 17) 3 Sniffing No experiment (28/11/20 observed conducted 17) 4 Sniffing No experiment Sniffing (05/12/20 observed conducted observed 17)

The sleeping pattern of both tapirs became a major problem too in our study. On the first week, the experiment was conducted after husbandry works and feeding time from 1000 to 1200 o’clock in the morning, as for the courtesy not to interfere the keeper’s regular routines and for the welfare of the animals. Unfortunately, after feeding (usually served with pellet and leaves, commonly called as daun balik angin) the tapirs often sleep and did not turn up to any of the samples presented. Following from the discussion with the zookeepers, we was suggested to start the experiment early in the morning from 0800 to 1000 o’clock, while the tapirs were actively fed with leave only. The leaves was kept near to the area where the faeces samples were presented and we observed both tapirs sniffed on the faeces samples for a number of occasions. No behavioural responses were recorded during the observation period on the first and second weeks between 1400 and 1600 o’clock in the afternoon because the tapirs were sleeping throughout the experiment time and didn’t look up at the sample presented site (Table 3). Thus, the evening session was discontinued in the following weeks due to their lack of activity during the afternoon highly due to their nocturnal behaviours.

132

On the second week, Domino (male) was recorded to show an interest to sniff on a female sample (Felix) compared to the other two males samples. On the third week, both tapirs were sniffed and investigated the surrounding before started to feed on the leaves, which was not observed during the first and second week of the study. However, both tapirs showed no further respond after the investigation by playing in the pool after fed on the leaves. On the fourth week both tapirs responded several behaviours such as being alert, sniffing in the air and moving the snout, vocals and investigated before and after fed on the leaves that located in the middle of sample site or when they passed by the site.

We also noticed that Daisy (female tapir) often startled each time it passed by the sample site on the third week of experiment and after some time, Daisy had completely stopped the movement towards the sample site. Following this observation, on the fourth week of the experiment, we changed the sample introducing site from Figure 2(a) to Figure 2(b) to reconfirm whether the female tapir tend to avoid or frightened to pass by the sample site or due any other factors. As per expected, the female turned away from the sample site and both tapirs did not approach the leaves at the sample presented site to fed after their first visit of the day to the area (Figure 4).

Figure 4: (a) the leaves were fully eaten by both tapirs on the fourth week and (b) the samples presented site where the leaves were not eaten by both tapirs on the fourth week.

133

The night experiment was only conducted for one day due to some reasons such as the availability of camera traps at that time, limited days of permission given to conduct the studies at Zoo Negara and also limited samples to present. Based on the recorded videos, we found that tapirs showed frequent investigating, sniffing in the air and observing around the sample sites at night.

Table 4: Results for night time experiment on the fourth week.

Tapir Domino Tapir Daisy Individual Attempt Duration Attempt Duration Tapir Jasper 1 1s 1 1s Tapir Max 1 1s 2 4s Tapir Felix 1 4s 2 7s Total 3 6s 5 12s

Discussion

Animal responses will be vary based on the situations such as time (day or night), temperature of the atmosphere (rainy or sunny) and presence of predators or conspecifics (Johnston 2003). Hereby, Domino and Daisy’s poor responses towards the presented faeces samples on the first week could be explained by the weather, time, sample presented site and icy condition of the samples. Based on our four consecutive week’s sniffing observations, we found night study shows more sniffing agendas (refer table 4) compared to daytime where during daytime sniffing occurred was less than 5 seconds in 2 to 3 attempts for four consecutive weeks by both tapirs. So, night-time can be considered as most suitable time for this study in this nocturnal mammal. Sample presenting site should be at the places where the tapirs more frequently visited such as near to the feeding or sleeping site. Furthermore, thawing period of the samples must be long enough to produce smell and draw the animal’s attention.

Previous study found that introducing scent marks of neighbouring individuals to individuals from another enclosure or cage have the chance to create and increase the familiar feeling towards one another (Roberts and Gosling (2004). This means they will be aware of the existence of the other individuals in the enclosure which creates a communication network among them and they might be less surprised and aggressive when they are put into the same enclosure or when encounter each other as escape from their enclosure which will helps in safe conservations. According to the zoo keeper, the experimental female tapir is suspected to be pregnant. So, this might indicate that the female tapir frightened of the presented samples assuming there could be other individuals that might be harmful to her.

134

Furthermore, vocalisations always can be related with calling sign in animals (Macedonia and Evans, 1993). They suggest that vocalisation must always be related with the animal's behaviour and condition while vocals. From our result, the experimental subjects vocalize while investigating the surrounding and after, sniffing the presented samples in which means that presented samples could possibly triggers the tapirs to think as there must be another individual near or invade their territory. Overall, our preliminary study has proved that Malayan tapir do sniffs on faeces and recognise individuals through it and it will be helpful to further study in this area.

Conclusion

We observed tapirs can sniff on the faeces that able to help them for individual recognition. Weather, time, sample presented site, and condition of presented samples affects the responses of tapirs. The factors mentioned above must be taken into account when conducting olfactory-cue related experiments. Furthermore, number of individuals should be increased to get more reliable results.

Acknowledgments

We are grateful to Zoo Negara, Selangor for permitting us to conduct our research. We thank the zoo staffs, keepers as well as the veterinarians Dr. Mat Naim Bin Haji Ismail and Dr. Kavita Jayaseelan for their kind support in this research. Finally, our utmost gratitude to Malaysia Nature Society (MNS) for funding this research under Malayan Tapir Project Grant.

References

Cozzuol, M. a., Clozato, C. L., Holanda, E. C., Rodrigues, F. H. G., Nienow, S., de Thoisy, B., … Santos, F. R. (2013). A new species of tapir from the Amazon. Journal of Mammalogy, 94(6), 1331–1345. https://doi.org/10.1644/12-MAMM-A-169.1.

Dawkins, M. S. (2000). Animal Minds and Animal Emotions. American Zoologist, 40(6), 883– 888. https://doi.org/10.1093/icb/40.6.883.

Gilmore, M. (2007). Tapir behaviour- An examination of activity patterns, mother young interactions, spatial use, and environmental effects in captivity on two species (Tapirus indicus & Tapirus bairdii).

Hunsaker, D., & Hahn, T. C. (1965). Vocalization of the South American tapir, Tapirus terrestris. Animal Behaviour, 13(1), 69–74. https://doi.org/10.1016/0003-3472(65)90073- 4.

Johnston, R. E. (2003). Chemical communication in rodents: from pheromones to individual recognition. Journal of Mammalogy, 84(4), 1141–1162. https://doi.org/10.1644/BLe-010.

Linklater, W. L., Mayer, K., & Swaisgood, R. R. (2013). Chemical signals of age, sex and identity in black rhinoceros. Animal Behaviour, 85(3), 671-677.

Lynam, A., Traeholt, C., Martyr, D., Holden, J., Kawanishi, K., van Strien, N.J. & Novarino, W. (2008). Tapirus indicus. The IUCN Red List of Threatened Species 2008: e.T21472A9285043.

135

Lynam, A. J., Tantipisanuh, N., Chutipong, W., Ngoprasert, D., Baker, M. C., Cutter, P., … Thunhikorn, S. (2012). Comparative sensitivity to environmental variation and human disturbance of Asian tapirs (Tapirus indicus) and other wild ungulates in Thailand. Integrative Zoology, 7(4), 389–399. https://doi.org/10.1111/1749-4877.12002.

Macedonia, J. M., & Evans, C. S. (1993). Essay on Contemporary Issues in Ethology: Variation among Mammalian Alarm Call Systems and the Problem of Meaning in Animal Signals. Ethology, 93(3), 177–197. https://doi.org/10.1111/j.1439-0310.1993.tb00988.x.

McDonnell, S. M., & Haviland, J. C. S. (1995). Agonistic ethogram of the equid bachelor band. Applied Animal Behaviour Science, 43(3), 147–188. https://doi.org/10.1016/0168- 1591(94)00550-X.

Roberts, S. C., & Gosling, L. M. (2004). Manipulation of olfactory signaling and mate choice for conservation breeding: A case study of harvest mice. Conservation Biology. https://doi.org/10.1111/j.1523-1739.2004.00514.x.

Swaisgood, R. R., Lindburg, D. G., White, a M., Zhang, H., & Zhou, X. (2004). Chemical Communication in Giant Pandas. Giant Pandas, 106–120. https://doi.org/10.1017/S0952836902003187.

Tortato, M. a, Santos, L. G. R. O., Carlos, L., Machado, P., & Hötzel, M. J. (2007). Reproductive behaviour repertoire of semi-captive lowland tapir Tapirus terrestris.

White, A. M., Swaisgood, R. R., & Zhang, H. (2003). Chemical communication in the giant panda (Ailuropoda melanoleuca): the role of age in the signaller and assessor.Journal of Zoology, 259(2), 171–178. https://doi.org/doi:10.1017/S0952836902003187.

136

CHAPTER 4 ANIMAL PHYSIOLOGY

4.1 Reproductive Status of Bats Species in Compartment 15, Ayer Hitam Forest Reserve, Puchong, Selangor

Summary

This study was conducted in order to determine the reproductive status of bats within the five months of sampling period at Comparment 15, Ayer Hitam Forest Reserve, Puchong, Selangor. Mist nets and harp traps were used to capture the bats. The traps and nets were erected at different areas of Compartment 15 to ensure the sampling covered all parts of Compartment 15. The total number of bats captured was 55 of six different species, namely Cynopterus brachyotis, Hipposideros bicolor, Myotis muricola, Rhinolophus sedulus, Rhinolophus trifoliatus and Tylonycteris robustula from three different families which are Pteropodidae, Rhinolophidae and Vespertilionidae. The reproductive status of each species of bats captured varied from Status I to V for males and Status I to IV for females. Most of the bats captured were Cynopterus brachyotis, therefore, the variations of female reproductive status can be observed from this species, especially in July, where all four reproductive statuses of female bats were recorded. However, the patterns of reproductive statuses for all species of bats captured at the study area could not be recorded accurately because of the short sampling period of only five months. This suggests that the study should be done for one year to obtain the complete data of bats’ reproductive statuses and patterns.

Keywords: Megachiroptera; Microchiroptera; Bats; Reproductive Status; Reproductive Patterns; Ayer Hitam Forest Reserve

Introduction Bats are the only mammals that can truly fly. Around the globe, almost 1000 species of bats can be found. Bats can be found around almost every part of the world except in areas that have extreme temperatures, ranging from being too hot to too cold. Most bats find their shelter in caves, buildings and tree cavities. During winter, bats migrate to other areas in order to survive. The most suitable area for bats to survive is in tropical forests including forests in Malaysia such as the Ayer Hitam Forest Reserve, Puchong, Selangor. Therefore, this study was done at Ayer Hitam Forest Reserve. The Ayer Hitam Forest Reserve is located about 20 kilometres away from the main campus of Universiti Putra Malaysia (UPM), Serdang, Selangor (Bawon & Amat Ramsa, 2007). The forest reserve is rich in the tropical diversity of plants and animals. UPM has established an 80-year agreement with the State Government of Selangor to manage the forest that commenced on 7 October 1996 under the management and responsibility of the Faculty of Forestry, UPM for education, research and extension purposes (Mohamed Zakaria, Puan, & Yeap, 2008). There are many examples of research that had been carried out at Ayer Hitam Forest Reserve in plant and animal diversity. Bats play an important role for all terrestrial biotic communities such as controlling insects for crops plantations, reseed deforested forests and pollinators for plants which are food resources for animals; their guano is used as fertilizers and in production of soaps, gasohol and antibiotics (Calisher, Childa, Field, Holmes, & Schountz, 2006). Bats, especially insectivorous bats are important for crop plantations as natural pest controllers by feeding

137

on insects. Therefore, the farmers can use this as an advantage to maintain their crops’ productivity and quality. The role of bats as seed dispersal agents in forests is more significant compared to that of played by birds. According to Medellin and Gaona (1999) in their study on seed dispersal by bats and birds in forests, they found that bats are capable of dispersing a higher number of seeds at night and more species of seeds in a month than what birds can do. However, the population of bats declined because of the myths and fear that caused humans to kill bats. Bats are also threatened by urbanization processes that harm their habitat. According to International Union for Conservation of Nature (IUCN) Red List of Threatened Species (cited in Bats Conservation International, 2016), currently there are 77 endangered and critically endangered species of bats.

A study by Mohd. Azlan, Sharma and Zakaria (2000) at Ayer Hitam Forest Reserve reported 15 species of bats including two species from Megachiroptera which are Cynopterus branchyotis and Balionycteric maculate; and thirteen species from Microchiroptera which are Rhinolopus trifoliantus, Hipposideros cervinus, Hipposideros bicolour, Myotis sp., Myotis muricola, Kerivoula papillosa, Tylonycteris pachypus, Tylonycteris robustula, Rhinolophus sedulus, Pipistrellus javanicus, Kerivoula intermedia, Kerivoula sp. and Scotophilus kuhlii. This study was conducted by focusing the main study area at Compartments 14 and 15. However, no study has yet been conducted on the reproductive status of bats at Ayer Hitam Forest Reserve. Therefore, this research was conducted as a fundamental study on the reproductive status of bats at Ayer Hitam Forest Reserve. The data obtained can be used as a reference for other future studies on bats at Ayer Hitam Forest Reserve. Therefore, the objective of this study is to identify the reproductive status of different species of bats within the time frame, from April 2016 to October 2016.

Materials and Methods

Study area

The study area for this research is at Compartment 15 of Ayer Hitam Forest Reserve with a landmass of 200 hectares. This tropical forest is one of the reserved forests in Malaysia which has been gazetted in Selangor in 1906, with a landmass of 1248 hectares. Ayer Hitam Forest Reserve is surrounded by a developing area that has been undergoing urbanization processes. The forest stands at 15 to 233 m above sea level with the highest peak at Bukit Permatang Kumbang. The primary irrigation sources of this forest are Rasau River at south and Bohol River at north (Bawon & Amat Ramsa, 2007). Bats trapping

The harp traps and mist nets were used to capture the bats in different areas at Ayer Hitam Forest Reserve. Mist nets were erected at four to five different areas per day within three nights per month and were relocated for the next sampling. Harp traps were placed across the flyways during the same period as when mist nets were set. The harp traps have two to four vertical strands with the holding bag at the bottom for the trapped bats to slide into. The mist nets were opened at 1700 and were checked three times, at 2000, 2200 and 0630 hours. It was necessary to check the nets frequently because the bats can chew on the nets to release themselves. The mist nets and harp traps were tagged with different numbers for different sampling site.

Samples collection and identification

Before identification process, the bats were placed in a cloth holding bag. At first, the weight, total length of body including the head, forearm and length of wingspan of the bats

138

were measured and recorded. The different morphological features of the bats such as the pattern of nose leaf, shape of ears and tragus, and the shape of interfemoral membrane also were examined for identification of the species of bats. Then, sex and reproductive status of bats were identified and recorded. For female bats, they have four different reproductive statuses which are Status I, possibility of pregnancy; Status II, lactation; Status III, post lactation; and Status IV, not reproductively active. Meanwhile, male bats have five reproductive statuses which are Status I, minor testes enlargement, no epididymal distention; Status II, testes at or near maximal enlargement, no epididymal distention; Status III, testes regressed, cauda epididymal distented; Status IV, testes not regressed, cauda epididymal distented; and Status V, no testicular or epididymal enlargement (Ibrahim, 2013). The age of the bats, whether they were young or at adult stage, was identified by placing a torch light underneath the wings to visualise the pattern of closure of growth plate in the flight membrane. The bats were considered young when a gap between two bone plates can be found and were considered adults when no gaps between the two bone plates can be found (Haarsma, 2008). Prior to release, the bats were tagged by using nail polish on their claws.

Results From this study, a total of 55 individuals of bats were trapped at Compartment 15 as presented in Table 1. They consists of six different species from three different families and five different genera which are Cynopterus in family of Pteropodidae; Hipposideros and Rhinolophus from family of Rhinolophidae; and Tylonycteris and Myotis from family of Vespertilionidae.

Table 1: The number of bats species in secondary forest of Compartment 15, Ayer Hitam Reserve Forest, Puchong, Selangor

No. of species No. of individuals Megachiroptera 1.Cynopterus brachyotis 35

Microchiroptera 2. Hipposideros bicolor 12 3. Rhinolophus sedulus 2 4. Rhinolophus trifoliatus 1 5. Tylonycteris robustula 4 6. Myotis muricola 1 TOTAL 55

35 individuals captured were Cynopterus brachyotis, 12 were Hipposideros bicolor, four were Tylonycteris robustula, two were Rhinolophus sedulus and only one of each individual representing Rhinolophus trifoliatus and Myotis muricola. Based on 35 Cynopterus brachyotis bats captured including juvenile bats, it shows that the reproductive status of frugivorous bats varies among them for each month of sampling for both female and male. For Hipposideros bicolor and female Tylonycteris robustula, the reproductive status occurs only in one month and does not vary like the reproductive status of Cynopterus brachyotis. The reproductive statuses of the other three species of bats captured were not analysed as only one individual was captured for each species. Based on

139

this study, during the sampling in October, only one male of Cynopterus brachyotis was caught with second stage of reproductive status (testes at near or at maximal enlargement or there is no epididymal distention) (Figure 1). Out of ten individuals, four were juveniles, which are two out of five in April, one out of three in July and one out of two in August. The rest of them are at Stage V (do not have pattern of epididymal enlargement or no testicular reproduction pattern) which are three out of five in April (60 %), two out of three in May (66.67 %) and one out of two in August (50 %). Based on Figure 1, there is no occurance of male Cynopterus brachyotis in Status I, III and IV within the sampling period.

The variation percentage of reproductive Status I of female Cynopterus brachyotis over the five months of sampling is shown in Figure 2. The female Cynopterus brachyotis, with all reproductive statuses including juvenile bats were captured in July. The female bats in Status I (35.71 %) only occurred in July which are five out of fourteen individuals and it is the highest percentage of reproductive status that occurred in that month, as well as for the juvenile which is also at 35.71 %. In April, seven female bats with two different reproductive statuses was recorded; two of them in lactating condition (Status II), the other two in post lactation stage (Status III); three of the female bats are juveniles. In May, the only Cynopterus brachyotis that was captured was a juvenile female, while in August female bats only occurred in lactation stage. In October two females in lactation and post lactation status respectively was found. Based on the results (Figure 2), all reproductive statuses occurred among the captured bats within the sampling period. Each month of sampling shows different percentage of reproductive statuses with different number of female induviduals.

100% 90% 80% 70% I 60% II 50% III IV 40% V Percentage Percentage % 30% VI 20% 10% 0% April May 2016 July 2016 August October 2016 2016 2016 Months of sampling

Figure 1: The percentage of reproductive status of male Cynopterus brachyotis: Status I minor testes enlargement, no epididymal distention; Status II testes at or near maximal enlargement, no epididymal distention; Status III testes regressed, cauda epididymal distented; Status IV testes not regressed, cauda epididymal distented; Status V no testicular or epididymal enlargement and Status VI represents juvenile (n=10).

140

100% 90% 80% 70% I II 60% III 50% IV

40% V Percentage % Percentage 30% 20% 10% 0% April 2016 May 2016 July 2016 August 2016 October 2016 Months of sampling Figure 2: The percentage of reproductive statuses of female Cynopterus brachyotis: Status I possibility of pregnancy; Status II lactation; Status III post lactation, Status IV not reproductively active and Status V represents juvenile (n=25).

141

Hipposideras bicolor was only able to be captured from July to October. No individuals of this species was recorded in April and May. In July, two male juveniles were caught. In August, only one male juvenile was captured. The highest occurence of male bats was in October, and their reproductive status was in Status V, with no testicular or epididymal enlargement detected (Figure 3). From the results, no variation in male reproductive status of Hipposideras bicolor was found within the sampling months. The reproductive status of female Hipposideras bicolor recorded in both August and Sepetember was Status IV which is not reproductively active. In August there is one female in Status IV and in October there are three female in Status IV (Figure 4).

100% 90% 80% I 70% II 60% III 50% IV V

40% VI Percentage % Percentage 30% 20% 10% 0% April 2016 May 2016 July 2016 August 2016 October 2016 Months of sampling

Figure 3: The percentage of reproductive statuses of male Hipposideros bicolor: Status I minor testes enlargement, no epididymal distention; Status II testes at or near maximal enlargement, no epididymal distention; Status III testes regressed, cauda epididymal distented; Status IV testes not regressed, cauda epididymal distented; Status V no testicular or epididymal enlargement and Status VI represents juvenile (n=8).

100% 80% I 60% II III 40% IV V Percentage Percentage % 20% 0% April 2016 May 2016 July 2016 August 2016 October 2016

Months of sampling

Figure 4: The percentage of reproductive status of female Hipposideros bicolor: Status I possibility of pregnancy; Status II lactation; Status III post lactation, Status IV not reproductively active and Status V represents juvenile (n=4).

142

Tylonycteris robustula was captured only in April and from the sampling, only one male was captured which is a juvenile. For the female Tyonycteris robustula, the number of individuals captured was three in two different reproductive statuses. Two of them were in lactating stage (66.67 %) and the other one was not reproductively active (33.33 %) during that month (Figure 5).

100% 90% 80% 70% I 60% II 50% III

40% IV Percentage % 30% V 20% 10% 0% April 2016 May 2016 July 2016 August October 2016 2016 Months of sampling

Figure 5: The percentage of reproductive status of female Tylonycteris robustula: Status I is possibility of pregnancy; Status II is lactation; Status III is post lactation, Status IV is not reproductively active and V represents juvenile (n=3).

From this study, there were only two Rhinolophus sedulus bats that have been captured. One of them was captured in April and the other one was captured in May. The bat that was captured in April was a female in Status IV which is not reproductively active. The other bat was a male in Status V which has no testicular or epididymal enlargement pattern. In April, a male Rhinolophus trifoliatus in Status IV was recorded and there was no female captured during the particular sampling period. This also applies for Myotis muricola which was captured in October. One one Myotis Muricola bat, a male juvenile, was captured.

Discussion Based on the results of reproductive statuses of each species of bats captured, the reproductive statuses that were obtained for Cynopterus brachyotis showed a variety of stages in one month. As for Hipposideros bicolor and Tylonycteris robustula, they only showed one reproductive status per month within the sampling period. The frugivorous bats are polyoestrous, meaning they can have more than one reproductive period per year whereas the insectivorous bats, including bats from families of Rhinolophidae and Vespertilioidae are monoestrous bats which means they have only one reproductive period per year and produce a single litter each time (Yalden & Morris, 1975). In tropical areas where the temperature and day length are relatively constant, there are no breeding seasons but bats can breed throughout the year (Yalden & Morris, 1975). Therefore, juveniles of different ages can be found throughout the whole year and the same applies for the other reproductive statuses of bats (Richarz & Limbrunner, 1993).

143

Conclusions In conclusion, within sampling period, the frugivorous bats showed a variety of reporoductive statuses in one month as they are polyoestrous while the insectivorous bats showed only one reproductive status in one month as they are monoestrous. As a recommendation for futher research, the sampling period should be extended to atleast 12 months to determine the reproductive status of bats per year more accurately. Further studies can be also done in determining the effects of microclimate on the foraging and roosting activities of bats at Ayer Hitam Forest Reserve, Puchong, Selangor.

Acknowledgements

My acknowledgment goes to all the staff of Sultan Idris Shah Forestry Education Centre, Ayer Hitam Forest Reserve for their help throughout the field works. Sincerely thanks to Nazura Natasha binti Abdullah and Fadzillah binti Mahdzir for the cooperation in completing the field works and support.

References

Abd. Ghani, A. N., Bawon, P., Hj. Othman, M. S., Mohd, R., Mohamed, S., Faridah Hanum, I. & Mohamed Zakaria, H. (1999). Direct Uses of Ayer Hitam Forest Reserve, Puchong, Selangor. Pertanika J. Tropical Agricultural Science, 22(2), 203-206

Abrol, D. P. (2011). Pollination Biology: Biodiversity Conservation and Agricultural Production. Retrieve from https://books.google.com.my/books?id=clwm8CSIIdIC&pg=PR5&lpg=PR5&dq=Pollination +Biology:+Biodiversity+Conservation+and+Agricultural+Production

Bats Conservation International (2016). Prevent Extictions. Retrieved from http://www.batcon.org/our-work/regions/critically-endangered-species

Bawon, P. & Amat Ramsa, Y. (2007). Ayer Hitam Forest Reserve. Selangor. Selangor: Universiti Putra Press.

Bogan, M. A. (2013). Potential Effects of Global Change on Bats. Retrieved from http://geochange.er.usgs.gov/sw/impacts/biology/bats/

Belwood, J. J. & Morton, P. A. (1991). The Truth about the Bats People Love to Hate is even Fascinating than Myth. Vampires: The Real Story. 9(1)

Brown, V. A., Torrez, E. B. & McCracken, G. F. (2014). Crop pests eaten by bats in organic pecan orchards. Crops Protection, 67, 66-71.

Calisher, C. H., Childa, J. E., Field, H.E., Holmes, K. V. & Schountz J. (2006). Bats: Important Reservoir Host of Emerging Viruses. Clinical Microbiology Review, 19(3), 531–545.

Charles, M. F. (2001). A Photographic Guide to Mammals of South-East Asia (3rd ed.). Aucland, New Zealand: New Holland Publishers (UK) Ltd.

Crichton, E. G. & Krutzsch, P. H. (2000). Reproductive Biology of Bats. San Diego, California: Academic Press. Available from http://ezproxy.upm.edu.my:2055/science/book/9780121956707

144

DeBlase, A. F. & Martin, R. E. (1976). Manual of Mammalogy with Keys to Families of the World. United States, America: WM. C. Brown Company Publisers.

Defenders of Wildlife (2016). Basics about Bats. Retrieved from http://www.defenders.org/bats/bats

Department of Environment and Primary Industries, DEPI (2014). Victoria State Government: Environment & Wildlife. Victoria: Author

Feldhamer, G. A., Drickamer, L. C., Vessey, S. H., & Merritt, J. F. (2004). Mammalogy (2nd ed.). New York: McGraw Hill Companies.

Haarsma, A. (2008). Manual for Assessment of Reproductive Status, Age and Health in European Vespertilionid Bats. Holland: Electronic Publications.

Hodgkinson, R., Baldin, S. T., Zubaid, A., & Kunz, T. H. (2004). Temporal Variation in the Relative Abundance of Fruit Bats (Megachiroptera: Pteropodidae) in Relation to the Availability of Food in a Lowland Malaysia Rain Forest. Biotropica, 36(4), 522-533. doi: http://dx.doi.org/10.1646/1593

Ibrahim, A. (2013). Reproductive Pattern of Dog-faced Fruit Bat Cynopterus brachyotis muller in Bintulu, Sarawak, Malaysia (Master Thesis), Universiti Putra Malaysia, Malaysia.

Jung, K. & Threlfall, C. G. (2016). Views on Chapter 2 Urbanisation and Its Effects on Bats—A Global Meta-Analysis. In Voigt, C. C. & Kingston, T. (Ed.), Bats in the Anthropocene: Conservation of Bats in a Changing World (pp. 13-33). Doi 10.1007/978-3-319-25220-9_2

Khan, M. M. (2012). Panduan Bergambar Khazanah Mamalia Semenanjung Malaysia. Kuala Lumpur: Tinta Publisher.

Koopman, K. F. (1984). Views on Bats. In Aderson, S. & Jones. Jr. J. K. (Ed.), Orders and Families of Recent Mammals of the World (pp. 145-186). United States, America: John Wiley& Sons, Inc.

Koopman, K. F. (1993). Views on Order Chiroptera. In Wilson, D. E. & Reeders, D. M. (Ed.), Mammal Species of the World: A Taxonomic and Geographic Reference 2nd ed. (pp. 137-241). Washington DC: Smithsonian Institution Press.

Medway, L. (1969). The Wild Mammals of Malaya (Peninsular Malaysia) and Singapore. New York: Oxford University Press.

Medellin, R. A. & Gaona, O. (1999). Seed Dispersal by Bats and Birds in Forest and Disturbed Habitats of Chiapas, Mexico’. Biotropica 31 (3), 478-485.

Montiel, S., Estrada, A. L. & Leon, P. (2011). Reproductive Seasonality of Fruit-eating Bats in Northwestern Yucatan, Mexico. Acta Chiropterologica, 13(1), 139-145. doi: 103161/150811011X578688

145

Mohamed Zakaria, Puan, C. L. & Yeap, C. A. (2008). A Photograpic Guide to Birds of Ayer Hitam Forest Reserve, Selangor. Selangor: Universiti Putra Press

Mohd. Azlan, J., Sharma, R. S. K. & Zakaria M. (2000). Species Diversity and Relative Abundance of Understorey Bats at Air Hitam Forest Reserve, Selangor, Malaysia. Malayan Nature Journal, 54(1), 69-75.

Nor Amira, A. R., Shahrul Anuar, M. S., Fatin Syakirah, M., Quah Evan, S. H. & Muin, M. A., (2015). A Checklist of the bats (Chiroptera) of Bukit Mertajam, Pulau Pinang, Malaysia. Malayan Nature Journal 2015, 67(1), 15-23.

Nowak, R. M. (1994). Walker’s Bats of the World. Baltimore, London: The Johns Hopkins University Press.

Richarz, K. & Limbrunner, A. (1993). The World of Bats: The Flying Goblins of the Night. Germany: THF Publications, Inc.

Rainforest Journal (2012). Ayer Hitam Forest Reserve, Puchong. Retrieve from: https://www.rainforestjournal.com/ayer-hitam-forest-reserve-puchong/

Smeekers, M. J. (2016). The Effect of Rain Noise on Roost Emergence in Neotropical Bats (Bachelor thesis, Van Hall Larenstein University of Applied Sciences, Netherlands). Retrieved from file:///C:/Users/user/Downloads/file_2.140925_001.pdf

Threlfall, C. G, Bradley, L. & Bank, P. B. (2011). Sensitivity of insectivorous bats to urbanization: Implications for suburban. Biological Conservation, 146, 41-52 conservation planning

Tweedie, M. W. F. (1978). Mammals of Malaysia. Singapore: Multiprint Services.

Vaughan, Ryan & Czaplewski (2000). Mammalogy (4th ed.). United State: Thomson Learning, Inc.

Walker, E. P. (1964). Mammals of the World (Vol. 1) Baltimore, Maryland: The Johns Hopkins Press.

Wunds, M. & P. Myers (2005). Mammalia (on-line), Animal Diversity Web. Retrieve from: http://is.muni.cz/e;/1431/podzim2009/JAB01/um/Mammals_vocab_09_Ss.pdf

Yalden, D. W. & Morris, P. A. (1975). The Lives of Bats. Canada: Douglas David & Charles Limited.

146

4.2 Reproductive Pattern of Cynopterus brachyotis from Secondary Forest in Ayer Hitam Forest Reserve, Puchong, Selangor

Summary A study on the reproductive pattern of dog-faced fruit bat, Cynopterus brachyotis was conducted at Ayer Hitam Forest Reserve Puchong, Selangor (AHFR). Bats were captured by using mist nets for a period of five months from November 2016 until March 2017. The reproductive status was determined based on the morphology of the bats. There are five categories of male reproductive status that were successfully recorded within the sampling period. Status I (Minor testes enlargement, no epididymal distention), Status II (Testes at or near maximal enlargement, no epididymal distention), Status III (Testes regressed, cauda epididymal distented), Status IV (Testes not regressed, cauda epididymal distented) and Status V (No testicular or epididymal enlargement) were categorized for the male Cynopterus brachyotis. Meanwhile, there are four categories of female reproductive status that were successfully recorded which is Status I (Possibility pregnant), Status II (Lactating, swollen nipples), Status III ( Post-lactating, bare patches around smaller nipple with regrowth hair) and Status IV (Not reproductively active), respectively. The male bats reproductive status were observed to be synchronised with the female bats so that there will be a successful conception. Male bats were observed to be the most active in February 2017 with the highest percentage of reproductive status is Status II (Testes at or near maximal enlargement, no epididymal distention) was recorded in this month. While, female bats was in Status III (Post-lactating) which they were just finish nursing their young and ready to reactivate back their oestrus cycle by gaining sufficient energy with foraging and lastly mate with those active male bats. Keywords: Cynopterus brachyotis; Reproductive Status; Lactating; Pregnant; Conception Introduction Since there are more than 1000 species of bats, these mammals also have a wide variety of mating habits. Mating for the first time among these mammals begin at approximately 14 months of age. Bats are promiscuous animals; male and female often copulate with many different partners whom they won’t encounter again. Besides that, bats have a variety of reproductive patterns from seasonal monoestry to polystery (Racey, 1982; O’Brien, 1993) as one of the strategies to ensure the survival of young. Hayssen (1993) (as cited in Bumrungsri et al., 2007) stated that the long gestation period for mammals of their size, relatively long periods of lactation and maternal care are the characteristics of the life histories of bats.

Reproductive period is a crucial phase for most living organisms. Bats reproduce at all time of the year and the peak periods are associated with the rainy seasons (Ibrahim, Musa, Mohd Top, & Zakaria, 2013). It is possible for a female to have one, two, or even three litters per time frame. However, only one young will be born at a time. Reproductive patterns vary greatly both among and within species, and the extent to which this variation occurs is under environmental factors (Heideman, 2000; Racey & Entwistle, 2000). Kofron (1997) (as cited in Azema, 2013) found that the reproductive pattern of frugivorous bats Cynopterus brachyotis in an evergreen rainforest of Brunei at a latitude of 4-5ºN is characterized as continuous bimodal polyestry with postpartum oestrus; this is due to the continuous rainfall which corresponds with high food availability. The environmental factors are known to be affecting the timing of reproduction and certain reproductive events in bats. Rainfall, photoperiod and temperature are the environmental factors that affects the reproductive cycles of bats

147

(Heideman, 2000). Several studies found that bats species show strong seasonality and synchrony in their reproductive cycles, such as pregnancies and lactation coinciding with maximum rainfall which promises high food abundance. This also increases the chances for the young to survive after the lactation period of their mother (Azema, 2013).

The dog-faced fruit bat, Cynopterus brachyotis (family Pteropodidae), is a common furgivorous bat in Southeast Asia, and is widely distributed in Malaysia. Previous study by Funakoshi et al. (1997) (as cited in Azema, 2013) found that this bat species inhabits a variety of habitats including primary forest, disturbed forest, mangrove, cultivated areas, orchards, gardens, and urban areas. Their diet includes fruits, flowers, leaves and sometimes insects to obtain additional protein (Lim, 1970; Tan et al., 1998). Kofron (19970 (as cited in Azema, 2013) found that the feeding areas and the composition of their food are largely influenced by the seasonal flowering and fruiting season. The frugivorous bat also acts as an important pollinator and tropical seed dispersal agent in forest succession as they feed on flowers (nectar) and fruits (Azema, 2013). As its dependence on plants and flowers for food relies with environmental factors, the response of C. brachyotis to these factors and the effect on its reproductive cycles are of interest. This study was conducted to investigate the synchronisation of reproductive pattern between the male and female C. brachyotis, and also its relationship with the environmental factors.

Materials and Methods

Study Site This study was carried out from November 2016 to March 2017 in Compartment 15 at Ayer Hitam Forest Reserve Puchong, Selangor. Bat Trapping Cynopterus brachyotis was captured by setting up mist nets (seven nets per night, 3 cm mesh x 14 m x 4 m width) in areas where it was believed that capture success would be maximised such as places that were close to fruiting, flowering trees or water sources. These nets were suspended for four nights at different sites for five months; November 2016 – March 2017. Mist nets were set up at evening and were attended at three different times, at 2000 hours, 0000 hours and 0700 hours.

Sample Collection

Each captured bats were temporarily held in a cloth bags with drawstring closure and identified with their external characteristics by referring to the book, Bats Krau Wildlife Reserve (Kingston, Lim, & Akbar, 2006). Then, each bat was weighed by a spring balance followed by other physical measurement. The forearm and penis length were measured using vernier calipers, while the total head and body length and wingspan were measured by using a ruler. For identification of reproductive status, ten individual bats were required from each sex in order to run the statistical analysis for determination of the bat’s reproductive pattern. The sexes and reproductive status of bats were identified by referring to the guidelines from Azema (2013). Bats were tagged with cutex before releasing them back at the captured point to prevent recording data from the same individuals.

148

Reproductive Categories Captured bat’s reproductive statuses were identified using guides adapted from Azema (2013). Cynopterus brachyotis’s male reproductive status is divided into five categories of statuses: (I) Minor testes enlargement, no epididymal distention (II) Testes at or near maximal enlargement, no epididymal distention (III) Testes regressed, cauda epididymal distended (IV) Testes not regressed, cauda epididymal distented (V) No testicular or epididymal enlargement

Cynopterus brachyotis’s female reproductive status is divided into four categories of statuses.

(I) Possibility of pregnancy (II) Lactation (enlarged nipples surrounded by bare skin, expresses milk when gently massaged) (III) Post- lactation (bare patches around nipple, but milk cannot be expressed) (IV) Not reproductively active (no sign of pregnancy or lactation process)

Results and Discussion

A total of one hundred and twenty five (125) captured individuals of Cynopterus brachyotis consist of 54 adult males and 50 adult females, while 8 males and 13 females of juvenile stage were recorded during the period of study. Fig.1 and Fig. 2 show the male and female bats reproductive percentages with body mass during the five months of study period. Bats body mass can be also used as an indicator of their reproductive status. According to McGuckin and Blackshaw (1991) and Welbergen (2011), it was reported that body mass and testosterone concentration are utmost around the time of the breeding season. The body mass of male and female C. brachyotis fluctuated throughout the study period. The highest male bats’ body mass was recorded in February 2017 (42 ± 7.15 g), after the month of the heaviest rainfall (329.63 mm/month). The highest female bats’ body mass was also recorded in February 2017 (41.6 ± 6.20). The food resources are more abundant during the rainy season than the dry season (Bumrungsri et al., 2007).

Furthermore, the highest percentage (50%) of status II (testes at or near maximal enlargement, no epididymal distention) for male bats was recorded in February 2017 and were concomitant with their highest male body mass (42 ± 7.15 g) which might be influenced by the higher food availability. This clearly shows a strong relationship between the testes size and the body mass. A previous study by Martinez-Coronel Matias, Munguia Perez Alma Alicia and Arenas Rios Edith (2015) focused on the relationship between the amount of subcutaneous fat, testicular morphometry, epididymis and some sperm parameters in frugivorous Leptonysteris yerbabuenae before, during and after mating. The study found that the male body mass increased over time simultaneously with the testes size. The male needs sufficient energy for the courtship, defense and also spermatogenesis which are costly in terms of energy. It is

149

suggested that the male bats have to gain more energy for mating repertoire such as vocalisation, body movement, special flight patterns, roost defense, and urinary tract marking territorial. A study by Wong et al. (2002) (as cited in Azema, 2013), showed that the spermatogenesis of C. brachyotis in fragmented forest occurred throughout the year among the population but peaked during the fruiting season. Besides that, the pattern/timing of male reproduction was continuous from November 2016 to March 2017. As seen in Fig.1, the male bats with Status I and Status II were frequently caught within the five months of study period referring to the male bats that were experiencing the enlargement of testes. The male C. brachyotis with Status I and Status II were observed to be simultaneously increasing in their body mass. Racey and Entwistle (2000) (as cited in Azema, 2013) stated that food supply is a major determining factor for the reproductive timing in male bats and this explains the rise in body mass. Study by Azema (2013) found that the male C. brachyotis with Status II was significantly correlated with their body mass, and this indicates that the maximum testicular size was reached when the body mass was at maximum. Mating activity begins when the testicular size is at maximum and according to the Heideman and Bronson (1992) (as cited in Azema, 2013), the peak of spermatogenesis is associated with the peak of testicular size.

100 45

90 40

80 35 70 30 60 25 50

n=10 20 40

Percentage (%) Percentage 15

30 Body mass (g) mass Body 20 10 10 5 0 0 Nov-16 Dec-16 Jan-17 Feb-17 Mar-17 Months (November 2016- March 2017)

Status I Status II Status III Status IV Status V Male Body Mass (g)

Figure 1: Percentages of reproductive status of male Cynopterus brachyotis: Status I (minor testes enlargement, no epididymal distention); Status II (testes at or near maximal enlargement, no epididymal distention); Status III (testes regressed, cauda epididymal distented); Status IV (testes not regressed, cauda epididymal distented), and Status V (no testicular or epididymal enlargement).

150

100 45

90 40

80 35 70 30 60 25 50

20 n=10

40 (g) mass Body 15 Percentage (%) Percentage 30

20 10

10 5

0 0 Nov-16 Dec-16 Jan-17 Feb-17 Mar-17 Months (November 2016 - March 2017) Status I Status II Status III Female Body Mass (g)

Figure 2: Percentage of reproductive status of female Cynopterus brachyotis: Status I (possibility of pregnancy); Status II (lactation); Status III (post -lactation) and Status IV (not reproductively active).

The highest females body mass was recorded in February 2017 (41.6 ± 6.20 g), which occurred a month after the heaviest rainfall. The fruiting season occurred in January 2017 due to the heaviest rainfall, with fruits already ripened and flowers ready to be visited by the frugivorous. The highest percentage of female reproductive status in February 2017 is Status III (Post-lactation). This means that the mothers just finished nursing their young and were ready to feast, and this explains the rise of their body mass in this particular month. The mothers also gained sufficient energy to reactivate their oestrus cycle to prepare for mating season. Even though the timing of reproduction among male bats were continuous, (the numbers of males with Status I and Status II were frequently caught within five months of study period) the males maintained synchronisation with the females’ receptivity to ensure successful conception as stated by Kofron (1997) (as cited in Azema, 2013). The peak of males with Status II (testes at or near maximal enlargement) was recorded in February 2017 which synchronised with the females who were in Status III, which were ready for mating.

Besides that, a few pregnant females were recorded in November and December 2016. The peak of pregnant females (60%) was recorded in November 2016, and was found to be synchronised with the maximum rainfall (320.24 mm/month). This finding was similar with the previous study by Azema (2013) who discovered that the peak of pregnant C. brachyotis females in Bintulu Sarawak was also recorded in the month of maximum rainfall. Therefore, rainfall is one of the most crucial factors in the reproduction of C. brachyotis.

151

Food resources are more abundant during the rainy season than the dry season. Pregnancy, lactation and weaning are the most energetically reproductive stages. Therefore, Racey (1982) (as cited in Azema, 2013) stated that they should coincide with the period of high food availability. In addition, the lactating females (Status II) showed higher captures in December 2016 (60%), suggesting that parturition had occurred. December 2016 was also one of the months with maximum rainfall (322.24 mm/month) within the five months of sampling period, which promises abundance of food. The lactating mothers must forage in order to gain sufficient energy as the milk production, transportation provision and warming the young require a lot of energy.

Conclusion In conclusion, there is a strong relationship between the testes size and the body mass as the males require a lot of energy for their needs in reproduction such as mating repertoire, defense and spermatogenesis. The body mass of female bats also increased when in Status I (Pregnant) due to the weight of the growing fetus. In addition, although the male bats were found to be continuously in their reproduction stage within the study period, they still synchronised with the female bats as shown when the peak of male bats with Status II (testes at or near maximal enlargement) was recorded simultaneously with the peak of Post-lactating females; this indicated that both sexes were ready for the mating season.

Acknowledgements We thank the SISFEC officers and rangers; Mr. Kamarulizwan, Mr. Mohd Naeem, Mr. Noor Hafiz, Mr. Mohd Fakhrullah, Mr. Fazrul Azree, Mr. Fazli Shariff, Puan Siti Zurina and Puan Nor Azlina who helped a lot in this project. Thanks to Ms. Nadia Simon, Ms Nadhirah and Mr. Faris with the fieldwork.

References Azema, I. (2013). Reproductive pattern of dog-faced fruit bat Cynopterus Brachyotis (Muller) in Bintulu, Sarawak Malaysia, 17-39. Bumrungsri, S., Bumrungsri, W., & Racey, P. A. (2007). Reproduction in the hort‐nosed fruit bat in relation to environmental factors. Journal of Zoology, 272(1), 73-81. Heideman, P. D. (2000). Environmental regulation of reproduction. In Reproduction Biology of Bats, ed. Crichton, E. C., &Krutzsch, P. H. New York: Academic Press, pp. 469-499. Ibrahim, A., Musa, N., Mohd Top, M., & Zakaria, M. (2013). Reproductive patterns of Cynopterus brachyotis (dog-faced fruit bat) in Bintulu, Sarawak. Pertanika Journal of Tropical Agricultural Science, 36(S), 47-54. Kingston, T., Lim, B. L., & Akbar, Z. (2006). Bats of Krau wildlife reserve. Penerbit Universiti Kebangsaan Malaysia. Lim, B. L. (1970). Food habits and breeding cycle of the Malaysian fruit – eating bat, Cynopterus brachyotis. Journal of Mammalogy, 51, 174-177. Martínez-Coronel Matías, Munguía-Pérez Alma Alicia, Arenas-Ríos Edith. (2015). Relationship between the amount of subcutaneous fat, testicular morphometry, epidydims and some sperm parameters in Leptonysteris yerbabuenae bat before, during

152

and after mating. Animal and Veterinary Sciences. Special Issue: Space Laboratories: Advances in Bat’s Reproduction, 3(1), 22-27. doi: 10.11648/j.avs.s.2015030101.14. McGuckin, M.A., & Blackshaw, A.W. (1991). Seasonal changes in testicular size, plasma testosterone concentration and body weight in captive flying foxes (Pteropus poliocephalus and Pteropus scapulatus). Journal of Reproduction and Fertility, 92, 339-346. O’Brien, G. M. (1993). Seasonal reproduction in flying foxes, review in the context of other tropical mammals. Reproduction Fertility Development, 5, 499–521. Racey, P. A. (1982). Ecology of bat reproduction. In Kunz, T. H., ed., Ecology of Plenum Press, New York, 57–104. Tan, K. H., Zubaid, A., & Kunz, T. H. (1998). Food habits of Cynopterus brachyotis (Muller) (Chiroptera, Pteropodidae) in Peninsular Malaysia. Journal of Tropical Biology, 14, 299–307. Welbergen, J. A. (2011). Fot female and fat polgynous males: seasonal body mass changes in the grey-headed flying fox. Ocologia, 165, 629-637.

153

4.3 A Review on Polyamine Analogues and Its Cytotoxicity Effect Against Selected Human Cancer Cell Lines

Summary Natural polyamines such as putrescine, spermidine, and spermine are crucial for cell growth and proliferation. However, over accumulation of polyamines can lead to the worst scenario which is the progression of cancer cells. The upregulation of polyamine transport system (PTS) activity leads to an opportunity to develop more specific and effective cancer treatment. Based on this strategy, polyamines are utilized as a vector which inserted with known cytotoxic compound. Perhaps, anticancer drugs that attached to the polyamines are directly targeted the cancer cells without affecting other normal cells and the side effects of the drugs could be reduced or minimized. Therefore the aim of this paper is to review the polyamine analogues which have been synthesized and evaluated as potential anti-cancer agent in various types of cancer cell lines. It is hope that the concept of selective targeting of cancer cells via the polyamine transport system will lead to the development of novel and effective anti-cancer therapies. Keywords: Cancer; Drug Delivery; Polyamine Analogues

Cancer, a Global Burden Disease Cancer is caused by the accumulation of extensive proliferation in targeted normal cell initiated at primary site. The cancer causative agent is known as carcinogen, which exposed from various sources such as chemicals, radiation, physical and behavior. The frequent exposure of these carcinogenic substances might induce the mutational changes in structure or functional DNA in cell nucleus. The cancer formation arises from these four fundamental stages which are tumor initiation, tumor promotion, malignant conversion and tumor progression as explained by Weston and Harris (2003). In brief, the initiation process occurred spontaneously or influenced by carcinogen exposures that resulted in any alteration, substitution, or mutation of genes in specific site of cells. Then, the mutated cells undergo tumor promotion process whereby the reversible proliferation take place and could be encountered by chemopreventive agent (Siddiqui et al., 2015). The permanent changes of genotype and phenotype of cancer cells will develop a tumor. The tumor formation could be classified into two different types either non- cancerous (benign) or cancerous (metastasize). The invasion of cancerous cells to other body parts would implicate severe damages to the affected organ’s morphology and body function as described by National Institute of Health (2015). In Malaysia, the most leading cancer for male is lung cancer while for female is breast cancer reported by National Cancer Registry’s report on 2007 (Zainal & Nor Saleha, 2011). Lung cancer is one of the most critical health issues in Malaysia as it is among the leading cause of death in Malaysia, been reported in NCR. Smoking is a prominent behavioral risk factor that associated with oncogenesis of lung cancer and most of Malaysian males are smokers. Lung cancer consists of three types, non-small cell lung cancer, small cell lung cancer and lung carcinoid tumor. Non-small cell lung cancer (NSCLC) is a dominant type of lung cancer accounts for 85% of cases while small lung cancer cell (SLC) contributes about 15% cases in worldwide (American Cancer Society, 2016). The exposure of carcinogen, mainly tobacco in cigarettes pipes play a major

154

contributor in pathogenesis of lung cancer. The harmful substances contained in cigarettes such as polycyclic aromatic hydrocarbons (PAH) had significantly induced the p53 gene mutation which alters the apoptotic death stimulation (Gupta et al., 2004). The genetic alteration of specific gene in bronchioles would affect the cell division signalling pathway and transform into tumor. Secondly, the diagnosis of the new cases of breast cancer which affected about 1.7 million of women around the world in 2012 had contributed to higher mortality rate (IARC Globocan, 2012). A study on the multistep process in carcinogenesis of breast cancer demonstrated the factors of genetic and environment associated with the cancer progression as conducted by Beckmann, Niederacher, Schnurch, Gusterson and Bender (1997). This study discussed the oncogenesis of breast cancer rely mainly on the accumulation of the genetic alteration such as amplification of oncogenes and mutation of tumor suppressor genes. The pathophysiological process in breast tissue undergo the transformation of normal tissue into hyperplasia, premalignant and in situ carcinoma before it being metastasize into other organ parts as explained in (Beckmann et al., 1997).

Challenges in Current Chemotherapeutic Intervention Cancer intervention nowadays had confront global challenges in lacking specificity of drug action to affected cancer cells and induced systemic toxicity to normal cells. The treatment regimen in killing or inactivating the tumor cells required a series of treatment that must be spent for many years. Conventional chemotherapeutic drug such as cisplatin-containing platinum exerts a positive effect in inducing apoptosis in tumor cell (Florea & Büsselberg, 2011). This drug specifically manufactured to treat various types of cancers such as testicular, ovarian, bladder, esophageal, small or non-small lung carcinoma, breast and others that stated in this study. However, the efficiency of this anticancer drug only retain for some range of time and dosage-dependent toxicity which exhibit major side effects. The patients might experience hearing loss, nephrotoxicity, heart damage and liver toxicity due to elevated lipid peroxidation (Florea & Büsselberg, 2011). The optimization of drug’s bioavailability in targeted tumor cells deemed necessary in order to reduce the prominent side effects. Pembrolizumab is one example of anti-tumor agent specific for treatment of lung cancer especially for non-small cell lung cancer (NSCLC). This agent designed as human monoclonal antibody, IgG4 kappa that acts upon programme death receptor (PD-1) that been actively expressed on T-cell. This synthetic antibody drug will prevent the binding of PD-1 with its ligand, PD-L1 to ensure the apoptotic signal being stimulated as justified by Leighl et al. (2015). This drug also activates the cytotoxic T-cell action in killing tumor cells. This study also investigates the possible side effects from taking the drug among patients of NSCLC such as fatigue, pruritis, decreased appetite, rash and diarrhea (Leighl et al., 2015). The effectiveness of the chemotherapeutic highly depends on the ability of treatment to attack the targeted cancer cells with minimizing the affected healthy cells. A cross-sectional survey had been performed to investigate the side effects reported by patients administered with tamoxifen in San Francisco, California (Lorizio et al., 2012). About 241 women that undergo treatment with tamoxifen to treat breast cancer had experiencing several unwanted symptoms such as hot flashes (more prominent), vaginal dryness, sleep problems, weight gain and depression. This study identified the main metabolites,

155

endoxifen contributed to the side effects occurrence. A direct action of endoxifen to tumor cells may minimize the unwanted effects by modifying its drug delivery system. The issue of lack specificity in cancer treatment had driven the designation of targeted drug delivery system through use of nanotechnology in medicine. Polyamines: Another Miracle Molecule Polyamines were identified in 1678 by Anthony Van Leeuwenhoek when he discovered a crystal in seminal plasma which is now known as spermine phosphatase. After more than three centuries, the structure and synthesis of spermine and its precursors spermidine and putrescine are well known. The polyamines; putrescine (diamine) ,spermidine (triamine) and spermine (tetramine) constitute a group of cell components that have been shown in numerous studies to be essential for the regulation of cell proliferation and cell differentiation (Wallace et al., 2007). Putrescine and spermidine are found in all living species however spermine is less common in prokaryotes .At physiological pH the polyamines are protonated and thus have two to four positive charges depending on the number of amine groups present (Wallace et al., 2007). The structural arrangement and cationic nature of the polyamines is a major determinant for their interaction with a wide variety of cellular components. This allows them to bind to negatively charged molecules such as DNA, RNA and phospholipids (Thomas & Thomas, 2003). The unique feature of polyamines compared to inorganic cations such as Mg2+ or Ca2+ is that they have positive charges at defined distances and there is methylene group between them which can participate in hydrophobic interaction. Thus, polyamines form stronger and more specific interactions than inorganic cations (Tomasi et al, 2010). In general, spermidine and spermine are present in millimolar concentrations, whereas putrescine level is slightly lower (Agostinelli et al, 2010). However, most of polyamines in the cells are bound to nucleic acids and other negatively charged molecules such as phospholipid membranes. Hence, a free and potentially reactive concentration is much lower than total concentration. The most unique characteristic of polyamines is the widely distributed positive charge on its aliphatic backbone. Polyamines neutralise the charges on phosphate group and dock into the major or minor grooves of DNA and induces important conformational changes and their binding has been reported to promote the conversion of the right-handed B-DNA to a left-handed Z-DNA. This conversion plays a role in transcriptional control (Agostinelli et al., 2015) It also appears to be involved in signalling pathways that regulate synthesis of a transcription factors or modulate their binding activity via phosphorylation (Norwotarski et al., 2013). Polyamines play a role in the stabilization of DNA, increasing the melting point of DNA in a concentration dependent manner. Their affinity for DNA means they bind to DNA and aid condensation, therefore enhancing DNA denaturation and protein-DNA interactions (Weiger & Hermann, 2014). The polyamines are also involved in many cellular processes. They participate in signal transduction and regulate the serine/threonine protein casein kinase 2 (CK2), by stimulating its binding to DNA and phosphorylation of a variety of substrates of CK2 . In addition to this, G-proteins have their GTPase activity stimulated by polyamines .The polyamines are also known to interact with ion channels. They gate a potassium ion channel and activate and block AMPA and kainate receptors, as well as activating and inhibiting the NMDA glutamate-mediated response in a concentration-dependent

156

manner. Besides, polyamines also have ability to block AMPA and kainate receptors.These three receptors belong to the class of glutamate activator receptor channels (Soto et al., 2014). However, the most important function of the polyamines is that they are absolutely critical for cell growth (Wallace et al., 2003; Heiger & Hermann, 2014). Polyamine Transport System The polyamine transport system (PTS) plays an important role in regulating the proliferation mechanism of cancer cells and able to become a targeted pathway in inducing apoptotic death of tumor. This statement been supported by a study that explained the main function of PTS in biosynthesis and breakdown of polyamines for cell proliferation. The advantage in targeting this pathway is due to its promiscuous property. Any polyamine-like molecules may have high tendency to be transported intracellular through PTS regularly (Palmer, Ghani, Kaur, Phanstiel, & Wallace, 2009). Multiple enzymes were involved in this pathway to maintain the concentration of polyamine in cancer cells such as ornithine decarboxylase (Palmer & Wallace, 2010). This study had discovered the mechanism for inhibition of cell proliferation through suppressing the PTS when it is up-regulated in polyamine biosynthesis. Generally, the polyamine concentration in cancer cells extremely elevated due to uncontrolled growth and become benign tumor such as in colorectal cancer which elevated up in three to four folds than normal cells (Saunders & Wallace, 2010). Based on the review done by Gamble et al. (2012), the expression of the transmembrane transporter in PTS such as SLC32A and SLC22A16 would contribute significantly for the accumulated level of polyamine concentration through the reuptake of polyamine from the extracellular environment as supported in other studies (Aouida, Poulin, & Ramotar, 2010; Uemura et al., 2008). Native polyamine consists of spermidine, spermine and basic precursor, putrescine. The biosynthesis of these polyamines are regulated by the rate-limiting enzyme in polyamine transport system, ornithine decarboxylase (ODC). A key action in inhibiting the cell growth is by manipulating the action of ODC in this pathway as suggested by Saunders and Wallace (2010). The principle of down-regulating the ODC enzyme action eventually would produce low concentration of putrescine, hence decreased the concentration of other polyamine in cancer cells. Many studies had reported the discovery of antitumor drug, alpha-Difluoromethylornithine (DFMO) acts as inhibitor of ODC enzyme. A study had reported the effectiveness of DFMO drug which decreased the putrescine concentration in prostate cell and affect low growth rate of prostate cancer cells (Casero Jr & Woster, 2009). On the other hand, the updated study then provide a contrast idea that DFMO drug only slowing the growth rate and not effective in killing the cells according to Palmer and Wallace (2010). These findings signified that the cancer cells manage to utilize the extracellular polyamine to be reuptake into polyamine transport system. The lack of specificity in DFMO action in targeted cancer cells resulted in slow growth rate but not in terms of cytotoxicity. This problem had opened a new avenue in research by designing polyamine analogue to maximize the specificity of drug’s action on cancer cells.

157

Polyamine Analogues as Anti-cancer Agent The interruption in biosynthesis of natural polyamine by competing with polyamine analogue is the strategy as anticancer agent. The designated polyamine analogue by substitution of alkylated group in N- terminal of polyamine structure that undergo several modification (Pegg & Casero, 2011). This study showed the evidence in proving the polyamine analogue able to exhibit anti-proliferative effect to cancer cells. The polyamine analogue mimics the native structures which assist for intracellular polyamine uptake through polyamine transport system. The advantages in utilizing polyamine analogue in cancer therapy shown by a study which it is able to down-regulated the ornithine decarboxylase (ODC) enzyme in formation of natural polyamines and manifest cytotoxic effect due to dysfunctional of proliferation mechanism as in native polyamines (Casero Jr & Woster, 2009). The polyamine analogue will possibly compete for the polyamine transporter in PTS with the native polyamine, thus reducing the level of native polyamine in cancer cells. These positive features of polyamine analogue intervention could be exploited into targeted vector in carrying the anticancer agent directly into affected cells. The drug delivery system of the polyamine-drug conjugated increases in specificity to targeted cells and minimizes the local or systemic toxicity due to presence of vector molecules. There are many examples of polyamine-drug conjugated drugs that produce positive effect in cytotoxicity demonstrated in the studies. Firstly, the formation of putrescine- anthracene (Ant-4) analogues that been tested on HL-60, human promylogenous leukemic cells done by Palmer et al. (2009). This anticancer agent had displayed the positive results which down-regulated the putrescine metabolism and act localized in affected cells based on fluorescence color observation. It is also proven that this conjugate successfully produce apoptotic induction in HL-60 cells (Palmer et al., 2009). This anticancer drug exerts their effect in reducing the inhibitory concentration across the time. Another study had investigated the efficacy of polyamine conjugated with F14512 antitumor agent in treatment of acute myeloid leukemia (AML) which was in clinical studies Phase 1 (Kruczynski, Pillon, & Cre, 2013) This study aims in finding the mechanism of apoptotic death induces by this drugs which could be used for supporting the evidence in passing clinical trial. F14512 drug acts as DNA damaging agent that lead to senescence and cell death. Since it is vectored by spermine polyamine, it could produce an accumulated effect in AML cells. This potent conjugated drug had already passed the clinical phase 1 and progressing into phase 2 clinical trial. Another strategy of polyamine analogues is exploitation of PTS as a mean for drug delivery. The idea of this concept derived from the facts that highly proliferating cells, such as tumour cells have upregulated PTS for the uptake of exogenous polyamines compared to normal cells (Kruczynski et al., 2009). More important, there have been a number of studies demonstrating that PTS is not restricted to natural polyamines but can accommodate a wide range of substrates (Phanstiel et al., 2007). In comparison with normal cells, it has also been shown that transformed cells accumulate exogenous polyamines at enhanced rate compared to normal cells. This was shown in normal and Rous sarcoma virus-transformed chick embryo fibroblast (Bacharch et al., 1981). Moreover, it has been demonstrated that a range of human cancer cells including neuroblastoma, melanoma, human lymphocytic leukaemia, colon and lung all have high transport activities (Phanstiel et al., 2007). With this in mind, a strategy was developed to exploit the PTS to selectively deliver polyamine-drug conjugates to cancer cells. Since cancer cells shows high transport activity and high demand for polyamines, the attachment of cytotoxic compound to polyamines should allow specific targeting to cancer cells (Gardner et al., 2004). This can reduce the toxic effect on normal cells which associated with conventional chemotherapy.

158

There are a variety of polyamine-drug conjugates that have been designed to test this hypothesis (Phanstiel et al., 2000: Dalcros et al., 2003: Wang et al., 2003). Cytotoxic drugs such as chlorambucil (Holley et al., 1992), nitroimidazoles (Tian et al., 2009), aziridines (Eiseman et al., 1998), acridines (Delcros et al., 2002), naphthquinonens (Cunha et al., 2006), camptothecin (Dallavelle et al., 2006), protoberberine (Pang et al., 2007) are the examples of compound that been conjugated to polyamine vector. Spermidine-chlorambucil conjugate exerted the cytotoxicity effect 35 times more than chlorambucil alone, and the pre-treatment with DFMO shows seven-fold cytotoxic effect than chlorambucil alone ( Holley et al., 1992). However the therapeutic value was not increased due to neurotoxicity in BALB/c mice (Xie et al., 2010). A series of polyamine- naphthalimide conjugates have been synthesised and evaluated in vitro cytotoxicity. Two of five compounds produced exhibited excellent cell selectivity to cancer cells based on the studies in two cell lines which are human hepatoma BEL-7402 and human normal hepatocytes QSG-7701 (Tian et al., 2009). A research on cell death pathway shown naphthalimide polyamine B induced apoptosis via both mitochondrial and membrane death receptor pathway (Tian et al., 2009). Despite some of the examples of polyamine conjugates with cytotoxic drugs mentioned, polyamine-anthracene conjugates provide a systematic background of structural activity relationship data, which are beneficial in the process of selection of an appropriate drug to a proper polyamine vector (Xie et al., 2010). A series of polyamine conjugates consists of DNA intercalator, anthracene which appended to polyamine side chain with altered tether length of the alkyl groups between the nitrogens. There are three different structures of polyamine anthracene conjugates evaluated: anthracene-9-yl-butanediamine (Ant 4), N1- anthracenylmethyl-4,4-triamine (Ant 44) and N(1)-(9anthracenylmethyl)tetraamines (Ant 444). The polyamine-anthracene conjugates showed dose dependent cytotoxic effects with IC50 values in the range of 5-25 µM after 48h exposure, with decreases in cell number and protein content. The total polyamine content was decreased by all treatments and the decrease was due mainly to induction in spermidine/spermine N1- acetyltransferase, acetylpolyamine oxidase and spermine oxidase activities and inhibition of ornithine decarboxylase, an enzyme in biosynthetic pathway. Thus, the Ant 4, Ant 44 and Ant 444 have the potential to act as a ‘double edged sword’ with the anthracene acting as DNA intercalator and the polyamine moiety interfering in polyamine metabolism (Abdul Ghani, 2012).

Conclusion Overall, the idea of selectively targeting cancer cells via the polyamine transport system shows great promise. In future, it is hope that the concept of selective targeting of cancer cells via the polyamine transport system will lead to the development of novel and effective anti-cancer therapies. References World Health Report (2012). http://www.who.int/whr/2012/en/index.html Parkin D.M, Bray F, Ferlay J, Pisani, P. (2001). Estimating the world cancer burden: Glocoban 2000. Int J Cancer, 94,153-156.

159

Boyle P., Langman, J.S. (2000). ABC of colorectal cancer. Epidemiology. BMJ. 321:805- 808.Croce CM (2008). Oncogenesis and cancer. The New England Journal of Medicine, 358 (5), 502-11. Gerber H.P., Sapra P., Loganzo F., May C. (2016). Combining antibody-drug conjugates and immune-mediated cancer therapy: What to expect? Biochem Pharmacol, 15(102),1-6. Han L., Huang R., Huang S, Jiang C. (2010). Peptide-conjugated PAMAM for targeted doxorubicin delivery to transferrin receptor overexpressed tumors. Mol Pharm, 7(6), 2156- 65. Komarova E.A., Gudkov A.V. (2000). Suppression of p53. Biochemistry, 65, 41-48. Thomas, T. and Thomas, T.J. (2001). Polyamines in cell growth and cell death: molecular mechanisms and therapeutic applications. Cellular and Molecular Life Sciences (CMLS), 58(2), 244-258. Thomas, T., Thomas, T.J. (2003). Polyamine metabolism and cancer. Journal of Cellular and Molecular Medicine, 7(2), 113-126. Liao, C.P., Lasbury, M.E., Wang, S.H., Zhang, C., Durant P.J., Murakami Y., Matsufiji, S., And Lee, C.H. (2009). Pneumocystis mediates overexpression of antizyme inhibitor resulting in increased polyamine levels and apoptosis in alveolar macrophages. J. Biol. Chem., 284, 8174- 8184. Hsu, P., Hung, H., Liao Y., Liu, C., Tsay, G. And Liu, G. (2008). Ornithine decarboxylase attenuates leukaemic chemotherapy drug-induced cell apoptosis and arrest in human promyelocytic HL60 cells. Leukemia Research, 32, 1530-1540. Wallace, H.M. (2007). Targeting polyamine metabolism: A viable therapeutic/preventative solution for cancer? Expert Opinion on Pharmacotherapy, 8(13), 2109-2116. Wallace, H.M. (2007). Health implications of dietary amines: An overview of COST action 922 (2001-2006). Biochemical Society Transactions, 35(2), 293-294. Tomasi S., Renault J., Martins B., Dunieus S., Cerecs V., Leroch M., Uriac P., Delcros J., (2010). Targeting the polyamine transport system with Benzazepine- and Azepine-polyamine conjugates. J. Med. Chem., 53 (21), 7467-7663. Agostinelli E., Marques M.P.M., Calheiros R., Gil F.P., Tempera G., Viceconta N., Battaslia S, Toninello A (2010). Polyamines fundamental characters in chemistry and biology. Amino Acids, 38 (2), 393-403. Agostinelli E., Vianello F., Giuseppe M., Thresia T., T.J. Thomas. (2015). Nanoparticle strategies for cancer therapeutics: Nucleic acids, polyamines, bovine serum amine oxidase and iron oxide nanoparticles (Review). International Journal Of Oncology, 46, 5-16. Shannon L.N., Woster P.M., Casero R.A. (2013). Polyamines and cancer: Implications for chemoprevention and chemotherapy. Expert Rev. Mol. Med. 15(e3). Weiger T.M. & Hermann, A. (2014). Cell proliferation, potassium channels, polyamines and their interactions: a mini review. Amino Acids, 46 (3), 681–688. Soto D., Coombs I.D., Gratacos-Battle E., Farrant M., Cull-Candy S.G. (2014). Molecular Mechanisms Contributing to TARP Regulation of Channel Conductance and Polyamine Block of Calcium-Permeable AMPA Receptors. The Journal of Neuroscience, 34(35), 11673-11683. Wallace, H.M., (2003). Polyamines and their role in human disease - An introduction. Biochemical Society transactions, 31(2), 354-355.

160

Battaglia V., Shields C.D., Murray-Stewart T., Casero R.A (2014). Polyamine catabolism in carcinogenesis: potential targets for chemotherapy and chemoprevention. Amino Acid, 46(3), 511–519. Wei Huang, Jens C Eichkoff, Farideh Mahrein-Gonomi, Hirak S Basu (2015). Expression of spermidine/spermine N1-acetyl transferase (SSAT) in human prostate tissues is related to prostate cancer progression and metastasis. The Prostate, 75(11), 1150-1159. Browley D.R, Labrijin AF, Zwick MB, Burton DR (2007) Antigen selection from an HIV-1 immune antibody library displayed on yeast yields many novel antibodies compared to selection from the same library displayed on phage. Protein Eng Des Sel, 20, 81–90. Cervelli M., Pietropaoli S., Signore F., Amendola R., Mariottini, P. (2014). Polyamines metabolism and breast cancer: state of the art and perspectives. Breast Cancer Res Treat., 148(2), 233-48. Zhu, Yu (2014). Dual Delivery Systems Based On Polyamine Analog Benspm As Prodrug And Gene Delivery Vectors. Wayne State University Dissertations. Silva T.M., Fiuza S.M., Marques M.P.M., Persson L., Oredsson, S.(2014) Increased breast cancer cell toxicity by palladination of the polyamine analogue N1,N11- bis(ethyl)norspermine. Amino Acids, 46 (2), 339–352. Cervelli, M., Bellavia G., Fratini E., Amendola R., Polticelli F., Barba M., Federico R., Signore F.(2010). Spermine oxidase (SMO) activity in breast tumor tissues and biochemical analysis of the anticancer spermine analogues BENSpm and CPENSpm. BMC Cancer, 10, 555. Hakkinen M.R., Hynoven M.T., Auriola S., Casero R.A., Vepsalainen J., Khomutov A.R., Alhonen L., Keinanen T.A. (2010). Metabolism of N-Alkylated Spermine Analogues By Polyamine And Spermine Oxidases. Amino Acids, 38(2), 369–381. Abdul Ghani, R. (2012). An investigation of polyamine anthracene conjugates as paradigm for selective drug delivery to cancer cells via Polyamine transport system. PhD Thesis, University of Aberdeen United Kingdom.

161

4.4 Distribution Pattern of Brucella melitensis in Organs of Bucks Following Experimental Acute Brucellosis

Summary A study was conducted to assess the distribution pattern of Brucella melitensis in male goats following experimental acute brucellosis using direct isolation and PCR detection. Nine goats that were divided into three groups were used in this study. Group 1 and Group 2 were exposed with 50µl of inoculum containing 109 cell/ml of live B. melitensis into each eye and kept for seven days and 14 days, respectively. The other group was exposed to sterile normal saline as negative control group. Swab samples from conjunctiva and prepuce were collected at 3 days interval. At post mortem, tissue samples consisted of conjunctiva, synovial membrane of knee joint, lymph nodes, liver, spleen, testis, prepuce, epididymis, bulbourethral and seminal vesicle glands were collected for isolation and identification. The same tissue samples and swab samples were subjected to DNA extraction for bacterial identification and followed by PCR technique for confirmation. The highest rate of positive culture for swab samples was prepucial swab at day-12 post infection. Highest rate of direct organ culture was demonstrated in synovial membrane with the rate of 50% positivity, while testis and spleen of all groups showed negative culture. For DNA extraction from organs, all treated groups demonstrated positive DNA extraction, with testis as the most consistent organ which showed positive results. Thus, we found that the most significant technique to be used in detecting B.melitensis was bacterial DNA exctraction, since it showed higher yielding capability comparing to direct organ culture technique. Keywords: Brucellosis; Brucella; PCR; culture; bucks Introduction Brucella melitensis is the main causative agent for brucellosis in goats and has been recognised as one of the major causes of reproductive related problems, characterized by abortion, weak birth of offsprings and infertility in male and female animals (Barbier et al., 2011). The disease is endemic in most ASEAN countries which causes huge economy impact to the nation (Zamri-Saad and Kamarudin, 2016). The pathogen is transmitted through ingestion of contaminated particles such as placenta, foetus and vaginal discharges from affected animals (Ko and Splitter, 2003). Thus, vertical transmission has also been reported where the pathogen is conveyed during pregnancy and ingestion of colostrum and milk from infected female (Abdullah et al., 2013). It was reported that sheep experimentally infected by B. melitensis can induce local and systemic dissemination particularly in tonsils, lymph nodes and spleen (Suraud et al., 2008). Simirlarly, Brucella abortus infection in cow showed distribution pattern in uterus, placenta, lymph nodes and other organs (Gao et al., 2015). Brucellosis can be transmitted to human by consuming unpasturized milk and cheese, or direct contact with infected animals and carcass (Ramin and Macpherson, 2010). Thus, it is known that B. melitensis is highly zoonotic and responsible for most cases of human brucellosis (Franco et al., 2007). The clinical presentation for human brucellosis include undulant fever, arthralgia, back pain and in chronic cases, abscess may develop in any organs such as liver, meninges and others (Hartady et al., 2014). In recent years, application of polymerase chain reaction (PCR) technique is a powerful procedure to be used as additional aid in detection of Brucella (OIE, 2009). By combining the bacterial DNA extraction method with PCR, the sensitivity and reproducibility were significantly improved (Boom et al., 1990). Thus, the tool can enhance sensitivity of detection compared to bacterial culture, which is known to be tedious and time consuming (Franco et al., 2007).

162

Therefore, the aim of the present work was to study the dissemination pattern of B. melitensis in male goats using direct culture from organs, bacterial DNA extraction and PCR technique.

Material & Methods Animal Nine healthy, adult male crossbred goats were divided into three groups. The animals were tested with Rose Bengal Plate Test (RBPT) and Complement Fixation Test (CFT) prior to the study for rapid screening test against brucellosis. All groups were kept in different pen and given cut grass (2kg/animal/day) and palm kernel based pellet (300g/goat/day). Drinking water was available ad libitum. Inoculum preparation Isolates of B. melitensis from local outbreaks were subcultured onto Brucella agar and incubated at 37°C for 96 hours. The pure colonies were then prepared into bacterial suspension with a concentration of 109 cell/ml using McFarland Standard. Experimental design Two groups (Groups 1 and 2) were exposed intraconjuctivally to 50µl of the inoculum containing 109 cell/ml of live B. melitensis into each eye. Goats of Group 3 were similarly exposed to 50µl of sterile normal saline into each eye. Swab samples from conjunctiva and prepuce were collected at 3 days interval. At the end of day 7 post-exposure, all goats of Group 1 were culled while goats of Group 2 and 3 were culled on day 14. All swab samples together with tissue samples from post mortem which consisted of conjunctiva, synovial membrane of knee joint, lymph nodes (submandibular, prescapular and supramammary), liver, spleen, testis, prepuce, epididymis, bulbourethral and seminal vesicle glands were collected, grinded using a stomacher before being cultured onto supplemented Brucella agar and incubated at 37°C for 96 hours for isolation of the organism. Brucella melitensis was identified based on its colony morphology and characteristics. The same tissue samples were subjected to DNA extraction following standard manufacturer method (NucleoSpin Tissue DNA Purification Kit, Macherey-Nagel, German) for bacterial identification and followed by PCR technique for confirmation. Polymerase Chain Reaction The forward and reverse primer sequences that were used in the study were P1 (5’- CATGCGCTATGTCTGGTTAC-3’) and P2 (5’-AGTGTTTCGGCTCAGAATAATC-3’) which amplified the 252bp fragment (Al Garadia et al., 2011). The PCR amplification was performed in 34 cycles and the annealing, extension and final extension phase were set at 57.1°C for 2 minutes, 72°C for 2 minutes and 72°C for 5 minutes, respectively. Results In Group 1, higher rate of positive culture was demonstrated in supramammary lymph nodes, prepuce, bulbouretheral gland, seminal vesicle and conjunctiva, followed by submandibular lymph nodes and epipidymis with the rate of 33% and 16%, respectively. On the other hand, in Group 2, synovial membrane showed the highest rate at 50%, followed by prescapular lymph nodes, liver, epididymis, and conjuctiva at 33%. Only 16% of submandibular and supramammary lymph nodes samples were cultured positive. While the sample from Group 3 remained negative (Table 1). For swab sample, 33% of conjunctival samples from Group 1 showed positive culture on day 3 post infection, as well as samples from Group 2 at day 12 and 14 post infection.

163

Prepuce samples from Group 2 was positive at day 12 post infection with 66%, and at day 14 post infection with 33% positivity (Table 2). All organs collected from Group 1 demonstrated positive Brucella DNA extraction. Successful extraction from the testis was the highest at 100%, followed by submandibular lymph nodes at 83%. The prescapular lymph nodes, bulbourethral gland, seminal vesicle and synovial membrane was 66%, supramammary lymph nodes, epididymis, prepuce and conjunctiva showed 50% successful rate and finally liver and spleen demonstrated 33%. Organs collected from Group 2 showed similar positive results with the highest positive extraction were from prescapular lymph nodes, spleen and testis at 100%, followed by synovial membrane at 83%, and 66% positive extraction was demonstrated in supramammary lymph nodes, bulbourethral gland, seminal vesicle and conjunctiva. The extraction rate from submandibular lymph nodes and epipidymis was 50% and the organs with the lowest positive result was liver and prepuce with 33% (Table 3). Polymerase chain reaction confirmation of B. melitensis from samples revealed 252 bp (Fig.1).

Figure 1. PCR on Brucella melitensis produces the expected 252 bp. Lane 1: positive control; Lane 2: bacterial DNA extraction from testis of Group 1; Lane 3: bacterial DNA extraction from testis of Group 2; Lane 4: bacterial DNA extraction from epididymis of Group 2; Lane 5: DNA extraction from testis of Group 3 (negative control).

Discussion Following exposure to B. melitensis through the conjunctiva, the bacteria remained in the conjunctiva until day-12 post infection. Nevertheless, positive isolation was made only twice from the swabs, on day 3 and 12 post infection. This might due to the stimulation of immunity mechanism of host, including a combination of non-specific microbicidal molecules in tear, the efficient activity of conjunctiva-associated lymphoid tissue, and the draining capacity towards other lymphoid structures (Suraud et al., 2008).

164

Furthermore, it was claimed that the presence of B. melitensis in the ocular region can be controlled within one month, and later the pathogen was cleared from the site of inoculation (Suraud et al., 2008). Nevertheless, B. melitensis was still present in other organs, indicating a systemic dissemination of the infection. However, prepuce swabs from Group 2 were positive with B. melitensis starting at day-12 post infection and continuously can be detected at day-14 post infection. The results contradicted a study done by Xavier et al. (2010) who found positive preputial wash of rams experimentally infected by Brucella ovis starting on day-45 post infection. Based on these findings, it showed that as early as 12 days post infection, the pathogen was ready to be spread to other animals and is highly suggestive that B. melitensis infection can be transmitted through coitus. Therefore, prepuce swab samples can be a useful and simple diagnostic tool to isolate the pathogen in acute brucellosis although the excretion of the pathogen is known to be intermittent, which might restrict the efficiency of diagnostics (Saunders et al., 2007; Xavier et al., 2010). However, the presence of B. melitensis in prepucial swab during infection must be studied further to confirm the significance. The gold standard for definitive diagnosis of brucellosis is the isolation of the pathogen (Alton et al., 1988). In this study, we managed to confirm the presence of B. melitensis in organs using direct organ culture. However, the bacterial DNA extraction method followed by PCR used in this study resulted in the highest score compared to the conventional direct organ culture method. As an example, results from direct culture of spleen and testis revealed 0% of isolation on day-7 and 14 post infection, but DNA extraction followed by PCR showed 33% and 100% positive results respectively. In fact, all samples from both infected groups showed positive results following DNA extraction and PCR. The direct organ culture resulted in negative results in five organs; the prescapular lymph nodes, liver, spleen, testis and conjunctiva on day-7 post infection and half of the organ remained negative on day-14 post infeciton.

Therefore, the bacterial DNA extraction together with PCR method is a better technique to detect and confirm the presence of B. melitensis in the organs because of its higher sensitivity and specificity. Nonetheless, bacterial isolation remain essential although the limitations of direct culture may interfere with the outcome (Manterola et al., 2003). This study showed B. melitensis can be disseminated to all parts of the body as early as day- 7 post infection. This is in agreement with Xavier et al., (2010) who concluded that Brucella can be in any part of the body systems. The Brucella was disseminated through the draining lymph nodes and survived for a long period of time (Suraud et al., 2008). Starting from the site of inoculation (conjunctiva), to the most caudal part (prepuce), all organs taken for bacterial identification showed the presence of B. melitensis. Based on these results, the synovial membrane displayed as the best tissue sample to be used for direct organ culture since it gave more yielding percentage (Pandit, 2011). As expected, the testis gave the highest percentage of B. melitensis detection by PCR since in male, the most common predilection site is the testis (Fensterbank, 1987). Thus, the localization of the pathogen in the organ will lead to severe orchitis and infertility at later stage (Shaqinah et al., 2014) which corresponds with the common clinical signs in affected male animals. Spleen too gave high percentage since this reticuloendothelia-rich organ is prone to Brucella localization (Mense et al., 2004). The use of PCR-based assays on all samples reflected the fast and sensitive test to improve the restrictions of conventional bacterial isolation (Bricker, 2002). Most importantly, PCR assay with specific amplification of the target sequence at species level, which had been used in this study enhanced the identification of the pathogen.

165

Conclusion From this study, it can be concluded that in acute brucellosis, the predilection site for B. melitensis in male goats is the testis because it was the only organ which demonstrated the highest percentage of bacterial DNA extraction, and the infected host was detected to shed the pathogen through prepuce at day-12 post infection. Therefore, it is highly likely that infected males can become carriers and transmit the disease to other animals as early as day-12 post infection even though the host itself does not demonstrate any symptom or clinical signs. Acknowledgements The authors wish to thank all staff of Histopathology Laboratory and Post-Mortem Unit, Faculty of Veterinary Medicine, Universiti Putra Malaysia. The work was supported by the FRGS research grant from the Ministry of Higher Education Malaysia.

References

Abdullah, F.F.J., Adamu, L, Hazirah, N., Abdinasir, Y.O., Rozaihan, M., Wahid, A.H., Zamri-Saad, M., Omar, A.R. and Saharee, A.A. (2013). Clinical and reproductive pathological changes associated with Brucella melitensis and its lipopolysaccharides in female mice via oral inoculation. Journal of Animal and Veterinary Sciences, 8(3), 104-111.

Al-Garadia, M.A., Khairani-Bejo, S., Zunita, Z. and Omar, A.R. (2011). Detection of Brucella melitensis in blood samples collected from goats. Journal of Animal and Veterinary Advances, 10(11), 1437-1444.

Alton, G.G., Jones, L.M., Angus, R.D. and Verger, J.M. (1988). Techniques for the Brucellosis Laboratory. Paris, INRA.

Barbier, T., Nicolas, C. and Letesson, J.J. (2011). Brucella adaptation and survival at the crossroad of metabolism and virulence. Federation of European Biochemical Societies Letters, 585, 2929–2934.

Boom, R., Sol, C.J. and Salimans, M.M. (1990). Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology, 28, 495–503.

Fensterbank, R. (1987). Some aspects of experimental bovine brucellosis. Annales De Recherches Veterinaires, 18, 421-428.

Franco, M.P., Mulder, M., Gilman, R.H. and Smits, H.L. (2007). Human brucellosis. Lancet Infection Disease, 7, 775–786.

Gao, X., Kuang, Y., Ma, L., Lu, Y. and Wu, Q. (2015). The relationships between Brucella melitensis predilection sites, bacterial loads in vivo, and the agglutinating antibody response in experimentally infected sheep. Turkish Journal of Veterinary and Animal Sciences, 39, 271- 278.

Hartady, T., Zamri-Saad, M., Siti-Khairani, B. and Mohd-Shahrom, S. (2014). Clinical human brucellosis in Malaysia: a case report. Asian Pacific Journal of Tropical Disease, 4(2),150-153.

166

Ko, J. and Splitter, G.A. (2003). Molecular host pathogen interaction in brucellosis: Current understanding and future approaches to vaccine development for mice and humans. American Society for Microbiology, 16(1), 65-78.

Manterola, L., Tejero-Garces, A., Ficapal, A., Shopayeva, G., Blasco, J.M., Marín, C.M. and López-Gońi, I. (2003). Evaluation of a PCR test for the diagnosis of Brucella ovis infection in semen samples from rams. Veterinary Microbiology, 92, 65–72.

Mense, M.G., Richard, H., Borschel, R.H., Wilhelmsen, C.L., Louise Pitt, M.L. and Hoover, D.L. (2004). Pathologic changes associated with brucellosis experimentally induced by aerosol exposure in rhesus macaques (Macaca mulatta). American Journal of Animal and Veterinary Science, 65, 644-652.

OIE (2009) Caprine and Ovine Brucellosis (Excluding Brucella ovis). Manual of Diagnostic Tests and Vaccines for Terrestrial Animals, http://www.oie.int/fileadmin/Home/eng/Health_standards/tahm/2.07.02_caprine_Ovine_ bruc.pdf (Accessed 10-09-17). Pandit, D. (2011). Brucella arthritis- an update. Indian Journal of Rheumatology, 6(1), 75-79. Ramin, B. and Macpherson, P. (2010). Human brucellosis. Biomedic Journal, 341, c4545. Saunders, V.F., Reddacliff, L.A., Berg, T. and Hornitzky, M. (2007). Multiplex PCR for the detection of Brucella ovis, Actinobacillus seminis and Histophilus somni in ram semen. Australian Veterinary Journal, 85, 72–77. Shaqinah, N.N., Mazlina, M., Zamri-Saad, M., Hazilawati, H. Jasni, S. (2014). Histopathology and immunohistochemistry assessments of acute experimental infection by Brucella melitensis in bucks. Open Journal of Pathology, 4, 54-63. Suraud, V., Jacques, I., Olivier, M. and Guilloteau, L.A. (2008). Acute infection by conjunctival route with Brucella melitensis induces IgG+ cells and IFN-Ɣ producing cells in peripheral and mucosal lymph nodes in sheep. Microbes and Infection, 10, 1370-1378. Xavier, M.N., Paixão, T.A., den Hartigh, A.B., Tsolis, R.M. and Santos, R.L. (2010). Pathogenesis of Brucella spp. The Open Veterinary Science Journal, 4, 109-118. Zamri-Saad, M. And Kamarudin, M.I. (2016). Control of animal brucellosis: The Malaysian experience. Asian Pasific Journal of Tropical Medicine, 9(12), 1136-1140.

167

Ani. Sub Pre Sup Liv Spl Epi Tes Prep Bul Sem Syn Con group LN LN LN

G1 16% 0% 33% 0% 0% 16% 0% 33% 33% 33% 33% 0%

G2 16% 33% 16% 33% 0% 33% 0% 0% 0% 0% 50% 33%

G3 0% 0% 0% 0% 0% 0% 0% 0% 0% 0% 0% 0%

Table 1: The results of direct organ culture. The rate of isolation from each organ of each group presented as percentage. G1: Group 1 (7 days of infection); G2: Group 2 (14 days of infection); G3: Group 3 (negative control); LN: Lymph nodes; Sub: Submandibular; Pre: Prescapular; Sup: Supramammary; Liv: Liver; Spl: Spleen; Epi: Epididymis; Tes: Testis; Prep: Prepuce; Bul: Bulbourethral gland; Sem: Seminal vesicle; Syn: Synovial membrane; Con: Conjunctiva.

168

Day PI/ 0 0 3 3 6 6 9 9 12 12 14 14

Animal C P C P C P C P C P C P group

G1 0 0 33 0 0 0 N N NA NA N NA % % % % % % A A A

G2 0 0 0% 0 0 0 0 0 33 66 33 33 % % % % % % % % % % %

G3 0 0 0% 0 0 0 0 0 0% 0% 0 0% % % % % % % % %

Table 2: The results of Brucella culture from swab samples, presented in percentage. G1: Group 1 (7 days infection); G2: Group 2 (14 days infection); G3: Group 3 (negative uninfected control); PI: Post infection; C: conjunctival swab P: prepuce swab; NA: not available. Ani Sub Pre Sup Liv Spl Epi Tes Prep Bul Sem Syn Con group LN LN LN

G1 83% 66% 50% 33% 33% 50% 100% 50% 66% 66% 66% 50%

G2 50% 100% 66% 33% 100% 50% 100% 33% 66% 66% 83% 66%

G3 0% 0% 0% 0% 0% 0% 0% 0% 0% 0% 0% 0%

Table 3: The results of Brucella DNA extraction. The rate of extraction from each organ of each group presented as percentage. G1: Group 1 (7 days of infection); G2: Group 2 (14 days of infection); G3: Group 3 (negative control); LN: Lymph nodes; Sub: Submandibular; Pre: Prescapular; Sup: Supramammary; Liv: Liver; Spl: Spleen; Epi: Epididymis; Tes: Testis; Prep: Prepuce; Bul: Bulbourethral gland; Sem: Seminal vesicle; Syn: Synovial membrane; Con: Conjunctiva.

169

4.5 Effect of Minerals on β-galactosidase activity of Lactobacillus fermentum Isolated from Raw Cow Milk

Summary

Lactobacillus strains have been associated with alleviation of lactose intolerance by producing an enzyme, β-galactosidase. However, the effect of minerals (manganese, magnesium, sodium, potassium and calcium) on β-galactosidase activity of lactobacilli is yet to be elucidated. Three isolates were obtained from local raw cow milk and identified as L. fermentum FD111, L. fermentum FD211 and L. fermentum FD212 using 16S rRNA sequencing. Results showed that the β-galactosidase activity of all strains was increased significantly (P<0.05) when grown in medium supplemented with manganese compared to the control (without minerals) and other minerals. Highest β-galactosidase activity was showed by L. fermentum FD211 (663.84 Miller units) with addition of manganese ions. Molecular docking results also demonstrated that lactose was bounded to β-galactosidase of L. fermentum FD211 with the free energy of binding amounted -3.18 kcal/mol in presence of manganese. Therefore, this indicates a potential way for more effective alleviation of lactose intolerance in the presence of both L. fermentum FD211 and manganese.

Keywords: Lactobacillus; β-galactosidase; Minerals; Lactose Intolerance

Introduction

Lactic acid bacteria (LAB) comprise a wide range of bacterial genera which produce lactic acid as the main fermentation product of their carbohydrate metabolism. They have a long history of applications in food industry as starter cultures of fermented foods. In addition, LAB is used to improve food flavor, texture and safety by producing enzymes, aroma compounds, antimicrobial peptides and metabolites (Nyugen et al., 2011). Among the LAB, Lactobacillus is one of the most important genera which consists of more than 80 species (Sieladie, Zambou, Kaktcham, Cresci & Fonteh, 2011). They are a group of rod-shaped, non- sporulating, gram-positive and catalase negative bacteria. They are commonly found in association with many animals, plants and foodstuffs such as raw milk and dairy products (Tham, Peh, Bhat & Liong, 2012). Lactobacillus (L.) is generally recognized as safe (GRAS) and has been widely used as a probiotic agent due to its health-promoting effects on the host. One of the proven beneficial effects of Lactobacillus upon consumption is amelioration of lactose intolerance. Lactose intolerance or maldigestion is an inability to digest lactose due to β-galactosidase (also known as lactase) deficiency and leads to lactose intolerance symptoms. These symptoms are abdominal pain, nausea, diarrhea, flatulence and/or bloating (Deng, Misselwitz, Dai & Fox, 2015). It is an arising health care concern as 75% of the world’s population are lactose maldigesters (Savaiano et al., 2013). Lactobacillus showed a promising effect in alleviation of lactose intolerance with the help of β- galactosidase found naturally in it. β-galactosidase can act as a hydrolase to degrade lactose into glucose and galactose which increase its absorption in the small intestine. Moreover, minerals are found to act as cofactors for enzyme to increase the bacterial metabolizability include β-galactosidase (Juajun et al., 2011; Juers, Matthews & Huber, 2012; Liu, Zhao, Deng, Huang & Liu, 2015). For instance, an increase in the β-galactosidase activity and stability of L. acidophilus R22 were reported in medium supplemented with magnesium (Nguyen et al., 2007). Liu et al. (2011) showed that

170

addition of sodium and potassium also enhanced the β-galactosidase activity of L. fermentum K4. These indicate that β-galactosidase activity of different strains might show different specific requirement of minerals. Thus, the aim of this study was to evaluate effect of minerals (manganese, magnesium, sodium, potassium and calcium) on β-galactosidase activity of L. fermentum in medium containing lactose.

Materials and Methods

Isolation of Cultures

Raw cow milks were purchased from the local industrial outlets in Perak, Malaysia. Aliquots of the milk samples were cultured in sterile Lactobacillus Selection Agar (LBS) (ChemSoln, India) at 37°C for 48 h. After incubation, single colonies were cultured in de Mann, Rogosa, and Sharpe (MRS) medium (Himedia, Mumbai, India) at 37°C for 24 h. The cultures were then subjected to microscopic examination on their morphology, gram staining and catalase test. Rod shaped, gram-positive and catalase negative cultures were selected for sequence analyses.

Identification of Lactobacillus strains

The genomic DNA of each bacterial strain was extracted using TNArex Purification Kit (Biovalence, Selangor, Malaysia) according to manufacturer’s protocol. The bacterial strains were then identified using sequence analysis of the amplified chromosomal 16S rRNA. Two universal primers were selected: 5’- AGAGTTTGATCMTGGCTCAG -3’ (27F) and 5’- TACGGYTACCTTGTTACGACTT -3’ (1492R), which gave an expected amplification product of 1500bp.

Culture Conditions

The isolated bacterial strains were propagated three times in sterile MRS broth (Himedia) using 10% (v/v) inoculum and incubated at 37°C for 24 h prior to use. To study the enzyme activity upon the addition of minerals, the sterile MRS broth was supplemented with 1% (v/v) of lactose (HmbG Chemicals, Hamburg, Germany) and 10mM of either MgCl2.H2O (ChemSoln, India), KCl (ChemSoln, India), MnCl2.4H2O (Bendosen Laboratory Chemicals, Bendosen, Norway), NaCl (ChemSoln, India) or CaCl2 solution (GENE Chem, Quebec, Canada). The sterile MRS broth without supplementation of mineral was used as a control.

Determination of β-galactosidase activity

β-galactosidase activity of each strain was determined according to the method of Vinderola and Reinhermer (2003). The bacterial cultures were harvested by centrifugation (12000 xg, 5 min, 5°C), washed twice in 60 mM phosphate buffer (pH 7.0) and resuspended in the same buffer. Absorbance of the cell suspension at 560 nm was adjusted to approximately 1.0 with the same buffer. One milliliter of the cell suspension was permeabilized with 50 μl of toluene/acetone (1:9; v/v) solution, vortexed for 7 min and immediately assayed for β- galactosidase activity. Then, 100 μl of the permeabilized cell suspension was added with 900 μl of phosphate buffer and 200 μl of o-nitrophenyl-β-D-galactopyranoside (ONPG) (HmBG) (4 mg/ml). The mixture was placed in a water

171

bath at 37°C for 15 min. After that, 0.5 ml of 1 M Na2CO3 was added to stop the reaction. Absorbance was measured at both 560 nm and 420 nm. β-galactosidase activity was calculated (in Miller units) as follows: A420 – 1.75 × A2560 Miller units = 1000 × 15 min × 1 ml × A1560 where A1560 was the absorbance just before assay and A2560 was the absorbance of the reaction mixture. A420 was the absorbance of yellow o-nitrophenol.

Molecular docking

The β-galactosidase sequence of isolated L. fermentum was elucidated and then subjected to Swiss Model (www.swissmodel.expasy.org) for protein structure modelling. β-galactosidase from E. coli with the PDB ID 3BGA was selected based on the sequence identity as the template in modelling building for L. fermentum β-galactosidase. The top model was selected based on the global model quality estimation scoring. Structure validation was conducted using Ramachandran plot. Ramachadran plot is generated by calculating the psi and phi angle of the alanine residue in the peptide chain. Subsequently, molecular docking was conducted using the built β-galactosidase model and lactose (the substrate of the enzyme) in the presence of manganese. Autodock 4.2 (Morris et al., 2009) was used to determine the binding affinity of ligand molecule to β-galactosidase. Lactose was chosen as the binding ligand because it is the natural substrate of β-galactosidase. Grid spacing was set as 0.375 Ǻ and the grid points of X, Y and Z axis were set as 40 x 40 x 40 Ǻ. Conformational searching was done using Lamarckian genetic algorithm (Morris et al., 2009). Ten simulations were performed for each docking process and the free energy of binding was analyzed. Lactose molecule in the most populated cluster with the lowest binding energy was chosen.

Statistical Analysis

Data analysis was carried out using SPSS software window ver. 20.0 (SPSS, Chicago, IL). One-way analysis of variance (ANOVA) was used to determine significant differences between means at a significance level of α = 0.05. Tukey’s test was used to perform multiple comparisons between means. All data were presented as the mean ± standard error of means. All analyses were performed in triplicate.

Results and Discussion

Isolation and identification of Lactobacillus strains

Three isolates were obtained from local raw cow milk and were selected based on their gram-positive, catalase negative reaction and rod-shaped morphology. They were identified as L. fermentum FD111, L. fermentum FD211 and L. fermentum FD212 using 16S rRNA sequencing (data not shown).

Determination of β-galactosidase activity

β-galactosidase deficiency is the general cause of lactose intolerance that affects approximately 75% of the world’s population. Undigested lactose due to insufficient β- galactosidase amount is fermented by colonic microbiota, causes excessive production of gases that subsequently leads to lactose intolerance symptoms (Brown-Esters, Mc

172

Namara & Savaiano, 2012). Thus, β-galactosidase of Lactobacillus strains that carry GRAS status has gained great interest as potential solutions to alleviate lactose intolerance. It was reported that metal ions play a crucial role in biological function of β-galactosidase such as maintaining the structural stability or involving in the catalytic processes (Carević et al., 2017). Some metal ions can cause enhancement of the enzyme activity while some can have inhibitory effects. Therefore, in vitro test was conducted in this study to determine the effect of several mono or divalent metal ions on β-galactosidase activity of the isolated L. fermentum. For the control, the β-galactosidase activity was ranged from 2.70 to 142.87 Miller units (Table 1). However, there was no significant change in β-galactosidase activity of all strains upon addition of minerals (Mg2+, K+, Na+, Ca2+) compared to the control, except manganese. The presence of manganese significantly enhanced (P<0.05) β-galactosidase activity of all L. fermentum strains. Meanwhile, L. fermentum FD211 (663.84 Miller units) showed highest β-galactosidase activity upon the addition of manganese. Ibrahim et al. (2010) found that addition of Mn2+ increased β-galactosidase activity (P<0.01) of L. reuteri CF2-7F and MF14C by 18% and 39%, respectively, compared to their controls. Kim and Rajagopal (2000) also reported that divalent ion Mn2+ activated β-galactosidase activity of L. crispatus whereas monovalent ions such as K+ and Na+ showed no effect on the enzyme activity. Carević et al. (2017) also showed that monovalent ions K+ and Na+ gave negligible effect on β-galactosidase activity of L. acidophilus while Mg2+ ion slightly activated the enzyme activity whereas Ca2+ ion showed inhibitory effect on the activity. However, Nguyen et al. (2012) reported that addition of monovalent ions K+ and Na+ activated the β- galactosidase activity of L. bulgaricus. This suggests that the addition of different minerals might give different effects on the β-galactosidase activity of different Lactobacillus species.

Table 1: Effect of minerals on β-galactosidase activity of L. fermentum.

β-galactosidase activity (Miller units) Strains Control Mg2+ K+ Mn2+ Na+ Ca2+ L. 347.59 10.44± 10.45± 3.65±0 11.74± 12.72± fermentum ±78.35b 1.48b,B 5.31b,B .88b,B 5.39b,B 2.95b,B FD111 ,A L. 131.37 137.11 663.84 142.19 fermentum 142.87± ± 73.67± ±30.61a ±84.10a ±11.53a FD211 14.48a,B 29.41a, 19.13a,B ,B ,A ,B B L. 172.51 5.59± 2.01 2.90± 5.96± 10.04± fermentum ±45.63c 0.62b,B ±0.50b,B 1.51b,B 2.77b,B 2.71b,B FD212 ,A

Results are expressed as means ± standard deviation of means; values are means of duplicates from three separate runs (n=3). abc Means in the same column with different lowercase superscripts are significantly different (P<0.05). AB Means in the same row with different uppercase superscripts are significantly different (P<0.05).

173

Molecular Docking

As highest β-galactosidase activity was showed by L. fermentum FD211 (663.84 Miller units) with addition of manganese, the protein structure model was built based on the β- galactosidase of L. fermentum. From the Ramachadran plot (Table 2), steric clashes of the model were identified. Our built model has only 1.5% of the residues fall into a disallowed region where these eight residues were found in the presence with unusual psi and phi angles. However, these eight residues were not resided at the binding site. Thus, in general this model is acceptable. In term of its secondary structure topology, the built model for β- galactosidase of L. fermentum consists of 30.7% of beta strand and 19.9% of helices and others such as loop/coils are about 49.4% (Figure 1). The model was then used to conduct molecular docking. Molecular docking result showed that lactose was bounded to β- galactosidase with the free energy of binding amounted -3.18 kcal/mol in the presence of manganese. In addition, several hydrogen bonds were formed between Tyr93, Asp209, Glu534, Trp565 and Asp602 with lactose (Figure 2). Formation of hydrogen bonding might contribute to a higher binding affinity of lactose with β-galactosidase in the presence of manganese and subsequently enhanced the β-galactosidase activity.

Table 2: Distribution of amino acids residues in Ramachandran plot.

Regions of distribution of amino No. of residues Percentage (%) acids residues In favoured region 468 85.4 Additional allowed regions 61 11.1 Generously allowed regions 11 2.0 Disallowed regions 8 1.5 Total 548 100

174

Figure 1: Built model of β-galactosidase. (A) 3D model of β-galactosidase in secondary structure representation. (B) Secondary structure topology is constructed using PDBsum.

B

175

Figure 2. Molecular docking result on lactose against beta galactosidase with the presence of manganese ion. Hydrogen bonding is represented in green dotted line. Conclusion

The results demonstrated that addition of manganese was able to increase the β- galactosidase activity of L. fermentum. It was due to increased binding affinity of lactose to the enzyme through formation of hydrogen bonding. This indicates a potential way for more effective alleviation of lactose intolerance in the presence of both L. fermentum FD211 and manganese. Further studies should be conducted to evaluate the optimal concentration of metal ions required to obtain maximum enzyme activity of L. fermentum.

Acknowledgements

This study was supported by the UTAR Research Fund (IPSR/RMC/UTARRF/2014-C1/L14) provided by Universiti Tunku Abdul Rahman, Perak, Malaysia.

176

References

Brown-Esters, O., Mc Namara, P. & Savaiano, D. (2012). Dietary and biological factors influencing lactose intolerance. International Dairy Journal, 22, 98-103.

Carević, M. B., Vukašinović-Sekulić, M. S., Banjanac, K. M., Milivojević, A. D., Ćorović, M. M. & Bezbradica, D. I. (2017). Characterization of β-galactosidase from Lactobacillus acidophilus: stability and kinetic study. Advanced Technologies, 6, 5-13.

Deng, Y., Misselwitz, B., Dai, N. & Fox, M. (2015). Lactose intolerance in adults: biological mechanism and dietary management. Nutrients, 7, 8020-8035.

Ibrahim, S. A., Alazzeh, A. Y., Awaisheh, S. S., Song, D., Shahbazi, A. & AbuGhazaleh, A. A. (2010). Enhancement of α- and β-galactosidase activity in Lactobacillus reuteri by different metal ions. Biological Trace Element Research, 136, 106-116.

Juajun, O., Nguyen, T. H., Maischberger, T., Iqbal, S., Haltrich, D. & Yamabhai, M. (2011). Cloning, purification, and characterization of β-galactosidase from Bacillus licheniformis DSM 13. Applied Microbiology and Biotechnology, 89, 645-654 . Juers, D. H., Matthews, B. W. & Huber, R. E. (2012). LacZ b-galactosidase: Structure and function of an enzyme of historical and molecular biological importance. Protein Science, 21, 1792-1807.

Kim, J. W. & Rajagopal, S. N. (2000). Isolation and characterization of beta-galactosidase from Lactobacillus crispatus. Folia Microbiologica, 45, 29-34.

Liu, G. X., Kong, J., Lu, W. W., Kong, W. T., Tian, H., Tian, X. Y. & Huo, G. C. (2011). β- galactosidase with transgalactosylation activity from Lactobacillus fermentum K4. Journal of Dairy Science, 94, 5811-5820.

Liu, Z., Zhao, C., Deng, Y., Huang, Y. & Liu, B. (2015) Characterization of a thermostable recombinant b-galactosidase from a thermophilic anaerobic bacterial consortium YTY-70. Biotechnology & Biotechnological Equipment, 29, 547-554.

Morris, G. M., Huey, R., Lindstrom, W., Sanner, M. F., Belew, R. K., Goodsell, D. S. & Olson, A. J. (2009). AutoDock4 and AutoDockTools4: automated docking with selective receptor flexibility. Journal of Computational Chemistry, 30, 2785–2791.

Nguyen, T. H., Splechtna, B., Krasteva, S., Kneifel, W., Kulbe, K. D., Divne, C. & Haltrich, D. (2007). Characterization and molecular cloning of a heterodimeric β-galactosidase from the probiotic strain Lactobacillus acidophilus R22. FEMS Microbiology Letters, 269, 136-144.

Nguyen, T. T., Nguyen, H. A., Arreola, S. L., Mlynek, G., Djinović-Carugo, K., Mathiesen, G., Nguyen, T. H. & Haltrich, D. (2012). Homodimeric β-galactosidase from Lactobacillus delbrueckii subsp. Bulgaricus DSM 20081: expression in Lactobacillus plantarum and biochemical characterization. Journal of Agricultural and Food Chemistry, 60, 1713-1721.

Nguyen, T. T., Nguyen, T. H., Maischberger, T., Schmelzer, P., Mathiesen, G., Eijsink, V. G. H., Haltrich, D. & Peterbauer, C. K. (2011). Quantitative transcript analysis of the inducible expression system pSIP: comparison of the overexpression of Lactobacillus spp. Β- galactosidases in Lactobacillus plantarum. Microbial Cell Factories, 10, 46.

Savaiano, D. A., Ritter, A. J., Klaenhammer, T. R., James, G.M., Longcore, A.T., Chandler, J. R.,

177

Walker, W. A. & Foyt, H. L. (2013). Improving lactose digestion and symptoms of lactose intolerance with a novel galacto-oligosaccharide (RP-G28): a randomized, double-blind clinical trial. Nutrition Journal, 12, 160.

Sieladie, D. V., Zambou, N. F., Kaktcham, P. M., Cresci, A. & Fonteh, F. (2011). Probiotic properties of lactobacilli strains isolated from raw cow milk in the western highlands of Cameroon. Innovative Romanian Food Biotechnology, 9, 12-28.

Tham, C. S. C., Peh, K. K., Bhat, R. & Liong, M. T. (2012). Probiotic properties of bifidobacteria and lactobacilli isolated from local dairy products. Annals of Microbiology, 62, 1079-1087.

Vinderola, C. G. & Reinheimer, J. A. (2003). Lactic acid starter and probiotic bacteria: a comparative “in vitro” study of probiotic characteristics and biological barrier resistance. Food Research International, 36, 895-904.

178

4.6 Extremely Low Electromagnetic Field (1.0 mT, 50 Hz) Exposure Effects Osteoblasts Growth on Nanobiocomposite Bone Scaffold

Summary

Electromagnetic field is an effective application in bone healing treatment that promotes osteoblast growth. However, evidence of EL-EMF stimulation as therapeutic medicine is still limited. The purpose of this study is to observe bone tissue formation in vivo and cells growth when exposed to different EL-EMF intensities. Bone scaffold was developed from a mixture of 40% alginate and 60% nano-cockle shell powder. Bone scaffold was prepared in 10x3x5 mm3 cylindrical implant and seeded with osteoblast prior to subcutaneous implantation on the right and left dorsum of Wistar rats. A total of 18 Wistar were randomly divided into three groups consisting of control (NC) that was not exposed to EL-EMF and treatment groups exposed to EL-EMF at 0.5 mT (T1) and 1.0 mT (T2) for an hour daily for duration of two weeks. After treatment, the scaffolds were harvested from the rats for microscopic observation, biochemical analysis and osteoblast counts. H&E staining showed osteoblast infiltration and blood vessels formation were found to be higher T2. Masson’s Trichrome staining showed the presence of collagen in NC, T1 and T2. Von Kossa staining revealed the accumulation of calcium that was found to be higher in T2. ALP analysis was found significantly higher in T1 (p<0.05) as compared to NC and T2. Osteoblast counts revealed a significant increase (p<0.001) in T2 as compare to NC and T1. In conclusion, findings from this study indicate the possible use of EL-EMF as a therapeutic alternative that could accelerate bone healing process.

Keywords: Extremely Low Electromagnetic Field (EL-EMF); Bone Scaffold; Osteoblast Cell

Introduction

Electromagnetic field (EMF) was used as a physical stimulation tools in bone healing treatment (Basset et al., 1974). Ironically, low EMF exposures facilitate the production of bone matrix quality, growth factor secretion, osteoblast proliferation and differentiation (Ciombor & Aaron 2005; Lohmann et al., 2000). According to Fitzsimmons et al. (1992) and Ryaby et al. (1994), the secretion of growth factors such as IGF-2 and BMP-2 are stimulated when treated with low EMF. Growth factors serve as intermediate molecules that bind to osteoblasts receptor for cell proliferation and differentiation. Stimulation of EMF interfere the permeability of plasma membrane and increase the entry of Ca2+ influx to activate calmodulin activity for DNA production (Brighton et al., 2001; Crocker et al., 1988).

In addition, the techniques from bone tissue engineering were introduced to speed up the healing process through applications of life sciences and engineering. Bone scaffold has been designed for regenerating new cells and tissues (Williams, 2004). Application of bone tissue engineering can reduce the complications such as infection, bleeding, nerves damage and defects during surgical procedure (Mountziaris & Mikos, 2008). Natural and synthetic polymers have been selected to create an ideal scaffold based on suitability and cell types (Polo-Corrales et al., 2014).

Alginate and cockle shell have been chosen for bone scaffold formation that produces a good morphological structure to facilitate osteoblast growth and attachment (Hemabarathy et al., 2014). Alginate is extracted from brown algae and consists of two

179

basic monomers which are β-D guluronic acid and α-L mannuronic acid (Smidsrod & Skjak- Bræk, 1990). Alginate is an inexpensive material that often used in medical treatment such as wound healing due to low toxicity (Lee & Mooney 2012). Cockle shell from Anadara Granulosa sp. contained 98-99% of calcium carbonate; inorganic materials which are essential for cells growth and readily exist in three different form namely calcite, vaterite and aroganite. Aroganite is a suitable compound to synthesis hydroxyapatite (HA) crystals by calcination process (Bakar et al., 2011; Hemabarathy et al., 2014).

However, the evidence of EMF effectiveness for the treatment of large bone defects is still limited. Thus, the objective of this study is to observe the cells growth and bone tissue formation in vivo when exposed at different EL-EMF intensities. Hence, the combination of EL-EMF and bone tissue engineering are applied to compare and observe the cells growth and bone tissue formation, ALP activity and calcium deposition on nanobiocomposite bone scaffold.

Materials and methods

Electromagnetic Field

A solenoid was used to generate extremely low electromagnetic field. The solenoid consists of rigid PVC tube (8 inch in diameter, 15 mm thickness, Malayan Industrial Plastics Sdn. Bhd) and silicon insulated copper wire (Model: 60245 IEC 03 (YG) sheath thickness 0.78mm, diameter 4.0). The coil was attached with adjustable wire supply and EL-EMF generated was directly monitored with a Teslameter (TM-191, China) throughout the experiment. Teslameter was used to maintain the consistency between the centre and the ends of the solenoid. The rats from T1 and T2 were exposed to EL-EMF at 5.0 mT and 1.0 mT respectively for one hour dialy for a fortnight. At the end of the experiment, the rats were sacrificed and the scaffolds were harvested from left and right dorsum of Wistar rats.

Animals Study

Eighteen male Wistar rats (8 weeks old) were used in this study and had an average weight between 200-220g. The rats were received from animal house, Faculty of Medicine, Universiti Kebangsaan Malaysia. Procedures & practices of the animal was approved with approval number FSK/2016/HEMABARATHY/23 NOV./802-JAN.-2017-AUG.-2017.

Osteoblast Cell Culture

Osteoblast were differentiated from sheep mesenchymal stem cells (MSC) and received from the Centre of Tissue Engineering, Universiti Kebangsaan Malaysia Medical Centre (PPUKM). Osteoblast from single vial were culture in T-75 flask contained Dulbecco’s Modified Eagle Medium (DMEM: E15-810 PAA), 10% fetus bovine serum (FBS: Sigma F4135), 1% penisilin/streptomycin (PAA P11-010) and incubated at 37°C with 5% carbon dioxide. The culture medium was changed every 2-3 days and the cells were subcultured at 70-80% confluency.

Bone Scaffod Development

Bone scaffold was developed based on studies by Hemabarathy et al. (2014). The bone scaffold was made up of 40% alginate solution and 60% nanocockle shell powder and

180

dissolved in deionized water using a magnetic stirrer. The mixture was poured into customized mold and freezed at -20°C for 24 hours. The bone scaffold was then freeze- dryed using freeze dryer (Lyolab 3000) at -50°C for 24 hours and removed from customized mold. Bone scaffold was immersed in 1% calcium chloride (CaCl2) for 20 minutes and rinsed in deionized water before stored in freezer at -20°C for 24 hours. Finally, bone scaffold was freeze-dryed at -50°C for 24 hours and prepared in 10x3x5 mm3 cylindrical implant.

Bone Scaffold Implantation

Osteoblast cells were seeded on nanobiocomposite bone scaffold at 100000 cel/100 µL density and kept overnight at 37°C with 5% carbon dioxide. Animals were injected with general anesthesia of 0.2 ml/kg of 50 mg/ml ketamine, 20 mg/ml xylazil and 50 mg/ml zoletil prior to having the dorsal furs shaved and cleaned for surgical procedure. The cell seeded scaffolds were then inserted through a small incision to the left and right dorsum of the animals. Post implantation, the opened skins were sutured and treated with antiseptic. After 2 weeks treatment, bone scaffolds were harvested for histology, biochemical analysis and osteoblast counts.

Biochemical Analysis

Harvested bone scaffolds were placed in 1 mL phosphate buffer solution (PBS) and crushed using homogenizer. Lysate cell produced was centrifuged at 12000 rpm, 4 °C for 10 minutes and kept in -20 °C. ALP activity level was perfomed based on study by Tampieri et al. (2005). 100 µl lysate cells were incubated in 0.5 ml alkaline buffer solution and 0.5 ml p- nitrophenol phosphate (40 mg pNPP and 10 ml distilled water) at 37°C for 1 hour. After incubation, the level of p-nitrophenol was determined using microplate reader at 405 nm. ALP activity level was determined using equation formed by the standard graph in mg/ml.

Histology

Ten percent formalin was used to preserve the harvested scaffold sample structure. The samples were processed using automated tissue processors and followed by a standard tissue processing protocol. The slides obtained from each sample were stained with Hematoxylin dan Eosin (H&E), Von Kossa (VK) and Masson’s Trichrome (MT). In addition, the scaffold samples for scanning electron microscopy (SEM) analysis were dehydrated in 70%, 80%, 85%, 90% and 100% for 10 minutes respectively prior to be soaked in hexamethyldisilazine (Sigma-Aldrich, USA) solution for 30 minutes and observed under scanning electron microscope (SU5000, HITACHI).

Osteoblast Counts

Cells counts were performed through histological slides observation which were stained with H&E. Histological slides were observed under light microscope (Zeiss, Germany) at x40 magnification. Five slides from each samples were taken (a, …,e) and five areas on each slides were randomly chosen (a1, …,a5).Osteoblast counts were then performed based on the equation below:

181

a= (a1+a2+a3+a4+a5)/5 (1)

A=(a+b+c+d+e)/5 (2)

Average osteoblast count =(A+B+C+D+E)/5 (3)

(a: average number of cells in five calculated area per slide, A: average number of cells from each sample)

Statistical analysis

One way ANOVA has been used to analyze data and results expressed as mean + standard error of mean. Post-hoc test is performed using Turkey’s multiple comparison test and significant value at p<0.05.

Results

Comparison and observation of cells growth and bone tissue formation on nanobiocomposite bone scaffold

Figure 1 shows osteoblast number on nanobiocomposite bone scaffold. The results found that osteoblast counts in EL-EMF treated groups (T1 and T2) were significantly higher (p<0.001) by 50% as compared to NC (11 + 0.84). Meanwhile, osteoblast counts in T2 (41 + 1.42) was significantly higher (p<0.001) by 50% as compared to T1 (20 + 1.64). Microscopic examination revealed a significant difference between control and EL-EMF treated groups as shown in Figures 2, 3 and 6. Figure 2 shows H&E staining of nanobiocomposite bone scaffold at x40 magnification. The results showed presence of blood vessels and osteoblast infiltrations in T1 scaffolds that were observed to be higher than NC but lower compared to scaffolds from T2. In addition, EL-EMF treated group in T2 showed neutrophils and osteoblasts infiltration on nanobiocomposite bone scaffold and more intact blood vessel structure than NC and T1. Figure 3 shows Masson’s Trichrome staining on nanobiocomposite bone scaffold at x40 magnification. The results showed no deposition of bone matrix and little formation of collagen fibers in NC.

Meanwhile, EL-EMF treated group in T1 showed little deposition of bone matrix and collagen fibers as compared to NC. While scaffolds from T2 group showed more deposition of bone matrix and collagen fibers as compared to NC and T1. Figure 4 (A1-A3) shows the presence of cells and structures that involved in bone tissue formation under scanning electron microscopy. Collagen was observed as long rod fibers while osteoblast was noted as irregular shaped cells. Osteocyte was also observed in image A1 as single flatten cell with long finger like projections.

182

) 45 2 b,c 40 35 30 25 a Control 20 15 0.5 mT EMF 10 1.0 mT EMF

5 Osteoblasts (cm Counts 0 Control 0.5 mT EMF 1.0 mT EMF Groups

Figure 1: Osteoblast counts, ap < 0.001vscontrol, bp < 0.001vs 0.5 mT EMF and cp < 0.001vs control. Data are presented as mean + standard error of mean.

Control (NC) 0.5 mT EMF (T1) 1.0 mT EMF (T2)

BV BV OS

OS OS BV BV RBC BV BV N

Figure 2: Histological image of H&E stained nanobiocomposite scaffolds at x40 magnification. BV: blood vessel, N: neutrophil, OS: osteoblast cell, RBC: erythrocyte

183

Control (NC) 0.5 mT EMF (T1) 1.0 mT EMF (T2) Os

C

Os C

Figure 3: Histological image of Masson’s Trichrome stained nanobiocomposite scaffolds at x40 magnification. C: collagen, Os: osteoid.

A1 A2 A3

Osteocyte Osteoblast Collagen fiber fi

8.8mm/1.00k 9.0mm/6.00k 6.8mm/4.99k Figure 4: Micrograph image on nanobiocomposite scaffold under Scanning Electron Microscopy.

184

0.012 ) a 0.01

0.008 b 0.006 Control 0.5 mT EMF 0.004 1.0 mT EMF 0.002

Alkaline Alkaline Phosphatase Activity (mg/ml 0 Control 0.5 mT EMF 1.0 mT EMF Groups

Figure 5: Alkaline Phosphatase activity, ap < 0.001 vs control dan bp < 0.001 vs 0.5 mT EMF. Data are presented as mean + standard error of mean.

Control (NC) 0.5 mT EMF (T1) 1.0 mT EMF (T2)

Figure 6: Histology image of von Kossa stained nanobiocomposite scaffolds at x40 magnification showing deposition of calcium (black) and osteoid tissue formation (brown)

Determination of alkaline phosphatase activity on nanobiocomposite bone scaffold

Figure 5 shows an alkaline phosphatase (ALP) activity level on nanobiocomposite bone scaffold in three different groups. ALP activity in EL-EMF treated group (T1 and T2) was found to be higher than NC. ALP activity in T1 (0.008915 + 0.001566 mg/ml) was significantly higher (p<0.05) as compared to NC (0.003147 + 0.001605 mg/ml) and T2 (0.005262 + 0.001611 mg/ml). However, there was no significant difference (p=0.288) between T2 and NC.

185

Histological observation of calcium deposition on nanobiocomposite bone scaffold

Figure 6 shows the calcium deposition on nanobiocomposite bone scaffold. No calcium depositions were noted in scaffolds from NC while scaffold from T1 showed early osteoid deposition indicated by brown depositions while scaffold from T2 showed osteoid deposition with surface mineralization (black) indicating a maturation process.

Discussion

The aim of this study was to investigate the cells growth and bone tissue formation in vivo when exposed at different EL-EMF intensities. Electromagnetic field (EMF) is a beneficial tool in bone healing treatment and has ability to stimulate the cells growth and proliferation. Based on studies conducted by Liu et al. (2013) and Ross et al. (2015), bone marrow stem cells proliferation and differentiation were increased when treated with low EMF. EMF ability as a physical stimulation tool can be observed from this study. The finding showed osteoblast number was increased by 50% when treated with EL-EMF as compared to control. This study revealed that osteoblast proliferation and differentiation will increase when treated with EL-EMF.

Furthermore, bone recovery process is also dependent on blood vessel formation (Colnot et al., 2004; Hausman et al., 2001). Blood vessel is an important structure to keep cells alive by providing essential nutrients for cell growth. Oxygen and nutrition exchange will reduce when the capacity of functional blood vessel decrease (Lu et al., 2008). EMF abilities in stimulating the formation of blood vessel in this study can be observed through H&E staining. The finding showed blood vessel formation was increased when treated with EL- EMF as compared to control. Erythrocytes or red blood cells can also be seen in the blood vessels and this finding revealed the requirement of oxygen and nutrients are essential for cells growth. This study is clearly demonstrated that blood vessels capacity will increase and develop when exposed with EL-EMF.

In addition, inflammation is a spontaneous reaction to eliminate infections and germs. At the early stages of inflammation, neutrophils and leukocytes will dominate the affected area (Varani et al., 2002). The finding from this study showed the infiltration of neutrophils on nanobiocomposite bone scaffold was observed in 1.0 mT EL-EMF exposed group. Indicating exposure to EL-EMF has potential to recruit inflammatory cells and provides a conducive environment for new tissue formation (Hart, 2002). The strength of bone structure is also important to support the movement and body weight. Collagen is a main component in bone structure. The function of collagen is to resist and absorp the mechanical pressure (Taichman, 2005). EMF abilities in stimulating the formation of collagen fibers can be observed through Masson’s Trichrome staining as well as through SEM observations. The finding showed the accumulation of collagen fibres were increased when treated with EL- EMF as compare to unexposed control group.

During proliferation phase, ALP enzyme will be synthesized by active osteoblast. ALP enzymes are important in bone mineralization activity (Magnusson et al. 1999; Piattelli et al., 1996). Based on studies by Lee et al. (1993), ALP enzyme and calcium deposition were increased when treated with low EMF. EMF ability in stimulating the secretion of ALP enzymes can be observed from this study. The finding showed ALP enzymes were increased when treated with EL-EMF as compared to control.

186

On the other hand, the activity of ALP enzymes in T2 was decreased by 37% as compared to T1. This finding was supported the previous study by Golub & Boesze-Battaglia (2007) which stated that ALP expression is up regulated during proliferation phase and down regulated during differentiation phase. Thus, this study revealed that stimulation with EL- EMF will influence the cells growth on nanobiocomposite bone scaffold.

In normal physiological condition, bones play a vital role for calcium storage with 99% of the body’s calcium content being stored in bone (Polo-Corrales et al., 2014). Generally, calcium ions strored are regulate and monitor the calcium concentration in systemic blood circulation. Apart from homeostasis, calcium also serves as a marker for bone tissue formation. EMF abilities in stimulating the calcium deposition can be observed through Von Kossa staining. This finding demonstrated that the calcium deposition will increase when treated with EL-EMF. Early stage matrix mineralization was also more prominent with higher calcium deposition noted in T2 group comparatively which supports the findings from ALP activity indicating a faster maturation phase with 1.0mT EL-EMF exposure. Thus this study is able to support the possible application of EL-EMF as a physical stimulation tools in order to stimulate bone tissue formation in-vivo and accelerate the healing process over normal physiological response.

Conclusion

The results from this study show that the combination techniques form bone tissue engineering and EL-EMF stimulation can be applied to treat and accelerate the process of bone healing. Bone scaffold is an ideal medium to stimulate bone tissue formation. Therefore, the application of bone tissue engineering and EL-EMF stimulation can promotes the process of bone recovery, hence, providing an affordable and cost effective treatment method for bone tissue healing.

Acknowledgement

Appreciation is given to the Program of Biomedical Science, Faculty of Health Science, Universiti Kebangsaan Malaysia, for supporting this study and research project was funded by Research University Grant (GGPM-2014-038).

References

Bakar, Z. A., Hussein, B. F., & Mustapha, N. M. (2011). Cockle Shell-Based Biocomposite Scaffold for Bone Tissue Engineering In Regenerative Medicine and Tissue Engineering - Cells and Biomaterials. InTech, Rejica, Croatia. 365-390.

Bassett, C. A., Pawluk, R. J., & Pilla, A. A. (1974). Augmentation of bone repair by inductively coupled electromagnetic fields. Science, 184(4136), 575-577.

Brighton, C. T., Wang, W., Seldes, R., Zhang, G., & Pollack, S. R. (2001). Signal transduction in electrically stimulated bone cells. Journal Bone Joint Surgery, 83-a(10), 1514-1523.

Ciombor, D. M., & Aaron, R. K. (2005). The role of electrical stimulation in bone repair. Foot Ankle Clinical, 10(4), 579-593, vii. doi: 10.1016/j.fcl.2005.06.006

Colnot, C., Lu, C., Hu, D., & Helms, J. A. (2004). Distinguishing the contributions of the perichondrium, cartilage, and vascular endothelium to skeletal development. Developmental Biology, 269(1), 55-69. doi: 10.1016/j.ydbio.2004.01.011

187

Crocker, G., Dawson, R. A., Barton, C. H., & MacNeil, S. (1988). An extracellular role for calmodulin-like activity in cell proliferation. Biochemical Journal, 253(3), 877-884.

Fitzsimmons, R. J., Strong, D. D., Mohan, S., & Baylink, D. J. (1992). Low-amplitude, low- frequency electric field-stimulated bone cell proliferation may in part be mediated by increased IGF-II release. Journal Cell Physiology, 150(1), 84-89. doi: 10.1002/jcp.1041500112.

Golub, E. E., & Boesze-Battaglia, K. (2007). The role of alkaline phosphatase in mineralization. Current Opinion in Orthopaedics, 18(5), 444-448.

Hart, J. (2002). Inflammation. 1: Its role in the healing of acute wounds. Journal Wound Care, 11(6), 205-209. doi: 10.12968/jowc.2002.11.6.26411.

Hausman, M. R., Schaffler, M. B., & Majeska, R. J. (2001). Prevention of fracture healing in rats by an inhibitor of angiogenesis. Bone, 29(6), 560-564.

Hemabarathy, B., Md. Zuki, A.B., Perimal, E.K., Md. Yusof, L. & Muhajir, H. (2014). Development and characterization of novel porous 3d alginate-cockle shell powder nanobiocomposite bone scaffold. BioMed Research International, 6723, 11.

Hemabarathy, B., Md. Zuki, A.B.Z., Perimal, E.K., Yusof, L.Q. & Hamid, M. (2014). Mineral and physiochemical evaluation of cockle shell (AnadaraGranosa) and other selected molluscan shell as potential biomaterials. Sains Malaysiana, 43(7), 1023-1029

Lee, K. Y., & Mooney, D. J. (2012). Alginate: Properties and biomedical applications. Progress in Polymer Science, 37(1), 106-126.

Lee, R. C., Gowrishankar, T. R., Basch, R. M., Patel, P. K., & Golan, D. E. (1993). Cell shape- dependent rectification of surface receptor transport in a sinusoidal electric field. Biophysical Journal, 64(1), 44-57. doi: 10.1016/s0006-3495(93)81339-0

Liu, C., Yu, J., Yang, Y., Tang, X., Zhao, D., Zhao, W., & Wu, H. (2013). Effect of 1 mT sinusoidal electromagnetic fields on proliferation and osteogenic differentiation of rat bone marrow mesenchymal stromal cells. Bioelectromagnetics, 34(6), 453-464.

Lohmann, C. H., Schwartz, Z., Liu, Y., Guerkov, H., Dean, D. D., Simon, B., & Boyan, B. D. (2000). Pulsed electromagnetic field stimulation of MG63 osteoblast-like cells affects differentiation and local factor production. Journal of Orthopaedics Research, 18(4), 637- 646. doi: 10.1002/jor.1100180417

Lu, C., Hansen, E., Sapozhnikova, A., Hu, D., Miclau, T., & Marcucio, R. S. (2008). Effect of age on vascularization during fracture repair. Journalof Orthopaedics Research, 26(10), 1384- 1389. doi: 10.1002/jor.20667

Magnusson, P., Larsson, L., Magnusson, M., Davie, M. W., & Sharp, C. A. (1999). Isoforms of bone alkaline phosphatase: characterization and origin in human trabecular and cortical bone. Journal of Bone Mineral Research, 14(11), 1926-1933. doi: 10.1359/jbmr.1999.14.11.1926

188

Mountziaris, P. M., & Mikos, A. G. (2008). Modulation of the Inflammatory Response for Enhanced Bone Tissue Regeneration. Tissue Engineering Part B Review, 14(2), 179-186. doi: 10.1089/ten.teb.2008.0038

Piattelli, A., Scarano, A., Corigliano, M., & Piattelli, M. (1996). Effects of alkaline phosphatase on bone healing around plasma-sprayed titanium implants: a pilot study in rabbits. Biomaterials, 17(14), 1443-1449.

Polo-Corrales, L., Latorre-Esteves, M., & Ramirez-Vick, J. E. (2014). Scaffold Design for Bone Regeneration. Journal of Nanoscience and Nanotechnology, 14(1), 15-56.

Ross, C. L., Siriwardane, M., Almeida-Porada, G., Porada, C. D., Brink, P., Christ, G. J., & Harrison, B. S. (2015). The effect of low-frequency electromagnetic field on human bone marrow stem/progenitor cell differentiation. Stem Cell Research, 15(1), 96-108.

Ryaby, J. T., Fitzsimmons, R. J., Khin, N. A., Culley, P. L., Magee, F. P., Weinstein, A. M., & Baylink, D. J. (1994). The role of insulin-like growth factor II in magnetic field regulation of bone formation. Bioelectrochemistry and Bioenergetics, 35(1), 87-91.

Smidsrod, O., & Skjak-Braek, G. (1990). Alginate as immobilization matrix for cells. Trends Biotechnology, 8(3), 71-78.

Taichman, R. S. (2005). Blood and bone: two tissues whose fates are intertwined to create the hematopoietic stem-cell niche. Blood, 105(7), 2631-2639. doi: 10.1182/blood-2004-06- 2480.

Tampieri, A., Sandri, M., Landi, E., Celotti, G., Roveri, N., Mattioli-Belmonte, M., . . . Biagini, G. (2005). HA/alginate hybrid composites prepared through bio-inspired nucleation. Acta Biomaterialia, 1(3), 343-351. doi: 10.1016/j.actbio.2005.01.001

Varani, K., Gessi, S., Merighi, S., Iannotta, V., Cattabriga, E., Spisani, S., . . . Borea, P. A. (2002). Effect of low frequency electromagnetic fields on A2A adenosine receptors in human neutrophils. British Journal of Pharmacology, 136(1), 57-66. doi: 10.1038/sj.bjp.0704695.

Williams, D. (2004). Benefit and risk in tissue engineering. Materials Today, 7(5), 24-29.

189

4.7 Design and evaluation of PCR primer and protocol for progesterone receptor in ovaries tissue of female goats. Summary Beyond the well-documented effects of progesterone hormones on female reproductive functions, there is still lack of information on their receptors in goat’s tissue. Luteal progesterone secretion regulates numerous aspects of female reproductive activity via its receptor, however, the signaling mechanism and the ability of nutrition to regulate this receptor expression in the ovaries are not well understood, particularly in goats. The study of interrelationship between luteal progesterone secretion and progesterone receptor expression were unable to be determine because the specific primer sets for those purposed are unestablished. Therefore in this study, we report the design and evaluation of PCR primers and program for amplification of progesterone receptor. Their specificity and efficiency were tested thoroughly with ovary samples from four healthy female goats. The outcome of the research will improved knowledge on the physiological mechanism/pathway of hypothalamic-pituitary-ovarian axis and the acts of its receptor thus help to better understand the relationship between nutritional status and reproductive performance, particularly in small ruminants. Keywords: Progesterone Receptor; PCR primer; Goat; Ovary; Reproduction Introduction Progesterone hormones are produce mainly by the ovary and act at difference tissue level. Progesterone can act on the hypothalamus-pituitary axis, to regulate gonadotropin secretion (Mahesh and Muldoon, 1987; Muldoon and Mahesh, 1987) and mating behavior (Dudley, 1980) the mammary gland, to stimulate its development (Kurita et al., 2001) and the uterus (Kurita et al., 2001), progesterone also influences numerous aspects of uterine physiology, including the differentiation of the endometrium and the development of the placenta (Spencer 2004). Given the diverse roles of progesterone in to regulate all these importance physiological, considerable research has been develop to fully understand the mechanism which progesterone mediate its actions. Previous studies have identified progesterone play its role via classical receptor-mediated pathway by binding to the nuclear progesterone receptor (PR) (O'Malley, 2005). Despite the fact that receptors important in mediating the physiological functions, it was demonstrated that receptor expression can be control and alter under certain conditions. Recently, the role of progesterone receptors in reproductive functions has drawn researcher’s attention due to debate concerning the effect of nutrition on the expression level of the receptors. There has been considerable uncertainty as to how hormones receptors is associated with nutrition. Previous researchers found that nutrition could alter the ovarian functions, thus change responsiveness of responsible receptors such as progesterone receptor (Moguilewsky and Raynaud, 1979; Sosa et al., 2004). It is important to explore the effect of nutritional on expression of progesterone receptor in the ovary, however, a specific primer set for the expression of progesterone receptor in caprine ovary cell are unestablished. Therefore in this study, we report the design and evaluation of PCR primers and program for amplification of progesterone receptor.

190

Materials and Methods Primer design

Few sequences of progesterone receptors for goat and other species including sheep, swine and cattle was selected from the NCBI GenBank (Table 1). Multiple sequences was aligned using clustalw2 to find a conserve region between the species. Then, gene-specific primer pairs was designed using the Primer3 software.

Table 1: A few selected accession number for PR gene primers of different species from NCBI database. Gene Species Accession number Progesterone receptor (PR) Goat (Capra hircus) 1. XM005689 375.2 2. XM013976 238.1 Sheep (Ovis aries) 1. Z66555.1 2. EU184862. 1 Cattle (Bos taurus) 1. AY656812. 1 2. AJ557823.1 Swine (Sus scrofa) 1. NM001166 488.1 2. AY555732. 1 Water buffalo (Bubalus 1. FJ917400.1 bubalis) 2. EU662279. 1

Tissue extraction and quality determination of total RNA Corpus luteum from four of healthy mixed-Boer female goats with an average initial body condition score of 2 to 3 and age between 2 to 3 years old were used in this study. Total RNA was extracted from each individual samples using Rneasy mini kits (Qiagen). The bands of 28 sRNA and 18 sRNA reflected the high quality of extracted total RNA and the purity and concentration of total RNA was checked using NanoVue™ Plus Spectrophotometer. Isolated RNA samples were free from the protein contamination as the OD 260/OD 280 values were more than 1.8. The concentrations of the RNA samples were in the range of 100–1500 ng/μl.

RNA reverse transcription For each sample, 1 µg of total RNA were reverse transcribed into complementary DNA (cDNA) to a final volume of 20ul using Transcriptor First Strand cDNA Synthesis Kit (Roche) product commercial protocol as following: Master mix containing: 2.5 µM of Anchored- oligo(dT) Primer, 4 µl Transcriptor Reverse Transcriptase Reaction Buffer (5x), 20 U Protector RNase Inhibitor, 1mM Deoxynucleotide Mix and 10 U Transcriptor Reverse Transcriptase. cDNA synthesis will be carried out by first incubating the

191

mixture total RNA with Anchored-oligo(dT)18 Primer at 65 ºC for 10 min and 55 ºC for 30 min after adding remaining component. The reverse transcriptase was inactivate by heating at 85 ºC for 5 min.

Evaluation of specific PR primer pair and PCR condition The amplification of primer set designed were tested using cDNA template from corpus luteum sample using MasterCycler Gradient (Eppendorf). The integrity of the templates and the PCR condition were confirmed by examining two housekeeping gene, GAPDH and B- actin as internal standard in the samples. The condition for PCR were optimized with regard to Taq DNA polymerase (Promega, USA), PCR water, primers, MgCl2 concentrations, and various annealing temperatures. Amplification products were then separated on a 2% high- resolution gel electrophoresis. Results To optimize the primers, different concentrations of PCR and temperatures (between 50 °C to 70 °C) were tested for each primer sets. The modified reaction reagents and amplification program were describe in Table 2 and Table 3 respectively. Amplified PCR products from primer for PR gene together with housekeeping gene showed a single band and the expected molecular size of 154 bp for GADPH, 200 bp for B-actin and 177bp for leptin receptor (Figure. 1). Table 4 shows the selected primer sequences for progesterone receptor and housekeeping gene (B-actin and GADPH) used in this study.

Table 2: Optimized reaction condition for PCR assay Component Volume Concentration 5x GoTaq Flexi buffer 4.0 µl 1x MgCl2 Solution 3.2 µl 4mm PCR nucleotide Mix 0.5 µl 0.25mm Forward primer 2.0 µl 1µm Reverse primer 2.0 µl 1µm GoTaq Dna polymerase 0.5 µl 1.25 unit Template DNA 1.0 µl 200 ng Nuclease free water 6.8 µl Final reaction volume 20 µl

Table 3: Optimized cycling program for PCR assay amplification Step Temperature Time No. of cycles Initial 95 °C 5 minutes 1 cycle denaturation Denaturation 94 °C 15 seconds Annealing 60 °C 30 seconds 40 cycles Extension 72 °C 45 seconds Final extension 72 °C 30 seconds 1 cycle Soak 4 °C indefinite 1 cycle

192

M 1 2 3 1 Figure 1: Representative sample for specific PCR products from primer tested on Corpus luteum tissue sample visualized by agarose gel electrophoresis.1 Lane M: DNA ladder (50- 1000bp), Lane 1: B-actin (200 bp), Lane 2: GADPH (154 bp) and Lane 3: PR (297 bp).

Table 4:. Primer sequences of PR, B-actin, GADPH and resulting fragment size Target Primer sequence (5′→3′) Fragment Accession no./ gene size (bp) Reference PR F: CCTGAGAGACGGGTAAAACAT 297 XM013976238.1 R: GTCCCCAAACAGAGAAAGTAGG B-actin F: ACCACTGGCATTGTCATGGACTCT 200 AF481159/ R: TCCTTGATGTCACGGACGATTTCC Celestino et al.(2010) GADPH F: TGTTTGTGATGGGCGTGAACCA 154 AJ431207/ R: ATGGCGTGGACAGTGGTCATAA Celestino et al. (2010) F: forward primer; R: reverse primer

Discussion The need to understand the physiological mechanism of progesterone signaling with the acts of its receptor require an RT-PCR technique to determine the expression level of progesterone receptor. Designing a good pair of primers is a critical factor to obtain a good outcome. In this study, several primer pairs were designed according to several guidelines (Dieffenbach et al., 1995); 1) ranged of melting temperatures (Tm ) values between 55–60°C, 2) the primer GC content were restricted to 40–65% and 3) avoid self-complementarity and hair-pin structure. Characteristic of each primer pair were determine using in silico analysis. Primer that does not satisfied all the necessary parameter were rejected and only four shortlisted primer pairs were selected for optimization.

However, even with in silico analysis, specific primers can still be a difficult to obtain. We need to go through several primer pairs by in vitro analysis as in silico analysis is a predictions that do not take into account the chemical reactions/limitations that can occur in the PCR tube and as such cannot truly approximate experimental events (Henriques et al.,

193

2012). Results from gel visualization shows that PR primer pair was successfully and consistently amplify from corpus luteum tissue sample. Specific PR primer genes was successfully designed and optimized at PCR amplification program as follows: enzyme activation step (95 °C for 5 min) followed by 40 cycles of denaturation, annealing and extension (94 °C for 15 s, 60 °C for 30 s and 72 °C for 45 s).

Conclusion The best primer pair specific for progesterone receptor gene for goat’s ovarian tissue was designed. Additional and modifications of original specifications were made to obtain functional and specific primer pairs. Primer pair of progesterone receptor designed from this study will facilitate future study to determine expression of progesterone receptor gene and assess their regulation in ovarian function. Acknowledgements This work was supported by a Fundamental Research Grant (01-01-15-1716FR) Scheme from the Ministry of Higher Education Malaysia and Putra Grant (GP-IPS/2016/9493100) from Universiti Putra Malaysia. References Dudley, C. A., Cooper, K. J., Moss, R. L. (1980). Progesterone-induced mating behavior in rats on the day following spontaneous heat. Physiology Behavior, 25, 759-762.

Dieffenbach, C. W., Lowe, T. M. J., & Dveksler, G. S. (1995). General Concepts for PCR Primer Design. In: PCR Primer, A Laboratory Manual, Dieffenbach CW, Dveksler GS Ed., Cold Spring Harbor Laboratory Press, New York, 133-155.

Henriques, A., Cereija, T., Machado, A., & Cerca, N. (2012). In silico vs in vitro analysis of primer specificity for the detection of Gardnerella vaginalis, Atopobium vaginae and Lactobacillus spp. BMC Research Notes, 5(1), 637.

Kurita, T., Wang, Y. Z., Donjacour, A. A., Zhao, C., Lydon, J. P., O'Malley, B. W., Isaacs, J. T., Dahiya, R. & Cunha, G. R. (2001). Paracrine regulation of apoptosis by steroid hormones in the male and female reproductive system. Cell Death Differentiation, 8, 192-200.

Kurita, T. Lee, K. Saunders, P. T., Cooke, P. S., Taylor, J. A., Lubahn, D. B., Zhao, C., Makela, S., Gustafsson, J. A., Dahiya, R., & Cunha, G. R. (2001). Regulation of progesterone receptors and decidualization in uterine stroma of the estrogen receptor-alpha knockout mouse. Biology Reproduction, 64, 272-283.

O'Malley, B. W. (2005). A life-long search for the molecular pathways of steroid hormone action. Molecular Endocrinology, 19, 1402-1411.

Moguilewsky, M., & Raynaud, J. P. (1979). The relevance of hypothalamic and hyphophyseal progestin receptor regulation in the induction and inhibition of sexual behavior in the female rat. Endocrinology, 105(2), 516-522.

194

Mahesh, V. B., & Muldoon, T. G. (1987). Integration of the effects of estradiol and progesterone in the modulation of gonadotropin secretion. Journal Steroid Biochemical, 27, 665-675.

Muldoon, T. G. & Mahesh, V. B. (1987). Receptor-weighted mechanistic approach to analysis of the actions of estrogen and progesterone on gonadotropin secretion. Advances in Experimental Medicine and Biology, 219, 47-64.

Spencer, T. E., Johnson, G. A., Burghardt, R. C., & Bazer, F. W. (2004). Progesterone and placental hormone actions on the uterus: insights from domestic animals. Biology Reproduction, 71, 2-10.

Sosa, C., Lozano, J. M., Viñoles, C., Acuña, S., Abecia, J. A., Forcada, F., & Meikle, A. (2004). Effect of plane of nutrition on endometrial sex steroid receptor expression in ewes. Animal Reproduction Science, 84(3), 337-348.

195

4.8 Evaluation of Magnetized Water (MW) on the Growth Performance and Survival of Hybrid Red Tilapia Oreochromis spp.

Summary Magnetic water (MW) is one of the applications of magnetic fields (SMFs). In recent years, MW has widely increased in aquatic environment. In this study, 60 days experiment was conducted to assess the effect of variable MWs treated with different SMFs intensities (0.2, 0.3, and 0.4Tesla) compare to the control group (non-treated water) on promoting the growth performance and survival of hybrid red tilapia (Oreochromis spp) fingerlings. There was significant difference (P<0.05) in the weight gain WG (g), percentage (%) WG, percentage (%) specific growth rate ( % SGR) and Percentage (%) survival SR among treatment groups of fish reared in magnetic water compare to the control. The best values WG (12.11g), % WG (434.55%) and % SGR (2.79%) were recorded in treatment 0.4T. While the lowest survival (93.3%) observed in the control which is significantly different (P<0.05) from other treatments. Moreover, the FCR, FER, and the PER were enhanced significantly (P<0.05) in the all magnetic groups compare to the non-treated water and the best values (1.09, 0.92, and 0.22, respectively) were recorded in group (0.4T). The data showed that magnetic water have the potential to exert beneficial effects on growth and survival in tilapia. Keywords: Magnetized Water; Red Tilapia; Growth Performance; Food Efficiency; Oreochromis Spp. Introduction Aquaculture refers to the farming of aquatic animals and plants in freshwater, brackish and marine water. It is among the most rising food sectors worldwide to provide the growing request for food sources, mainly protein. To meet the demands and favorites of consumers, different types of freshwater fish, such as tilapia, carp, and catfish have been cultured in many parts of the world (FAO, 2014). However, the most important limiting factor in fish culture is water quality; poor water quality may contribute to decreased growth, poor feed conversion efficiency and fish death (Jamabo et al., 2015). Water is crucial for all living creature as it hydrates cells (Gholizadeh & Arabshahi, 2008). All organisms are frequently exposed to the magnetic fields in their environment (Esitken & Turan, 2004). Magnetic fields have direct and/or indirect effects. Sakurai and Miyakoshi (2008), have confirmed that cell cycle is affected by the exposure to high-strength magnetic fields, either by promoting or reducing cellular growth. Organisms differ in their sensitivity to magnetic fields. Magnetic treatment can be influenced by many factors such as, type and strength of magnetic field and the duration of exposure (Tang et al., 2015). Magnetic fields can influence the ion-permeable channels of membrane mediated transport (Dhawi et al., 2009). As organisms are exposed to a strong field, the biomolecules movement orientate with the field. Metal-ion containing proteins and enzymes show paramagnetism (Schenck, 1996). Such ions are pivotal actors in enzyme activity and in biological processes and consequently the growing of the organism (Lin et al., 1992).

196

Application of magnetic fields (MFs) are more frequent in the fields like environmental management, industrial procedures, in addition to therapeutic and diagnostic medicine (Yadollahpour & Rezaee, 2014). One of these applications is for magnetic water, encouraging potentials for health benefits, industry and environment. Magnetic water is a product of passing water through magnetic fields or placing magnet in water to improve water properties and quality (Yacout et al., 2015). Treatment of water by magnetic fields to restructure the water molecules can be an ideal way for water purification (Ambashta & Sillanpää, 2010). Food supplements are utilized to promote the functioning of various types of fish. These feed supplements contain a varied array of chemical and non-chemical substances (Zaki et al., 2012). Aquaculture studies are mainly focused on enhancing feed and its additives to improve growth and not on enhancing water quality. The technique of magnetic fields has several benefits if compared to conventional chemical techniques, since it promotes growth rates, reduces mortality of juveniles, and increases immunity and yield (Rosen, 2010). It is eco-friendly is refer to this technique because it is neither introducing chemicals into the environment nor causes side effects (Aliverdi et al., 2015). Tang et al. (2015) observed enhanced growth speed of sea cucumber juvenile when exposed to 0.5T Electromagnetic Fields (EMFs) for 1 h/day, concluded that the strength of magnetic treatment should exceed 0.3T and the duration should be more than 0.5 h. Nofouzi et al. (2015) showed the effect of Extremely Low-Frequency Electromagnetic Field (ELF- EMF) on day 30 and 60, rainbow trout treated with 5 and 50µT 1h daily had significantly higher weight than fish in control group. At 0.1, 0.5, 5 and 50µT groups showed significantly higher length than fish in control group. Applying ELF-EMF for more than 0.5µT may have useful impacts, by influencing the growth performance of fish. However, study by Li et al. (2014) concluded that exposing larvae Nile tilapia for 30 days to ELF-EMF may reduce the growth and activity of digestive enzymes. Gilani et al. (2016) showed that magnetized water increased the feed intake and body weight gain of broiler chicks significantly. Lack of information on the cause and bio effect mechanisms of direct and indirect exposures to magnetic fields. Thus, there is a need to conduct research to understand the effect of the magnetic fields and magnetic water on the biological response of fish. The aim of this study was to compare effect of different magnetized water on the growth performance and survival of the hybrid red tilapia Oreochromis spp fingerlings. Materials and Methods This experiment was conducted in Aquaculture Experimental Station, Universiti Putra Malaysia (UPM), Puchong, Selangor, between September to October 2015. Preparation of magnetized water Tap water was kept in 2-ton tanks for 3 days with aeration to dechlorinate the water. Rare earth and anisotropic permanent magnets with different intensities (0.2, 0.3, 0.4T) were used to treat the water. In each aquarium, (72 X 36 X 37 cm) filled with 80 L water, individual pre-conditioned biofilters were used, and all were provided with the magnetic fields source except for the control. A gauss meter (Model MM2; AlphaLab, Salt Lake City, Utah, USA) was used to measure the intensity of magnetic fields.

197

Water quality parameters In all aquariums, mild exposure to air and individual pre-conditioned biofilters have been utilized. Nevertheless, every 2 days one third of water was exchanged, it is totally exchanged once a week. The amounts of ammonia and nitrite have been checked once a week before changing water by (HACH model DR/2400 portable spectrophotometer). The dissolved oxygen, pH and temperature have been also gauged once a week by a digital device (YSI multiparameter model 556 MPS). Fish and Experiment Design Hybrid red tilapia fingerlings have been provided by a local supplier. The fishes have been acclimatized in a 2000 L fiberglass tank and have been fed with a commercial tilapia diet for seven days. The fish weighted 0.01g, individual fish have been randomly chosen, total of 20 fish (with initial mean body weight 2.8g) were placed in the aquarium. The aquaria have been randomly designated one of the four treatments to have three replicates for every treatment. The fish have been further acclimated for another 10 days. After acclimatization, all fishes have been weighed separately and measured again. Fish have been fed with commercial tilapia diet (34% crud protein) which constitutes about 4% of their body weight twice a day for 8 weeks. Growth Performance Variables The growth in body weight has been recorded as the variation between average final weight and average initial weight by means of a digital scale. Morphological alterations have been inspected in weeks 2,4,6,8 of the experiment. Fish have been assessed following one-day fasting. Fish mortalities for all groups has been documented to decide percentage of survival. In the current experiment, growth variables have been examined including growth performance indicators and the calculations of each variable were according to Yue & Zhou (2008), as shown below: WG (g)= Final weight (FW) (g) – Initial weight (IW) (g). Percentage (%) WG = FW − IW / IW × 100. DWG (g/day) = Total WG (g) / period of the experiment (day). SGR (%/day) = [(LN(FW)−LN(IW)] / period of the experiment) × 100. FCR = dry feed consumed (g)/ (WG (g)+ weight of died fish). FER =WG (g)/ dry feed consumed (g). PER = WG (g)/ protein intake (g). Survival (%) = (total remaining fish − initial amount of fish) × 100.

Statistical Analysis Data was subjected to general linear model multivariate to determine significant difference at p = 0.05 with Duncan’s post-hoc test applied for identifying variations among treatments. All statistical analysis was using IBM’s SPSS 23 was exploited to perform the statistical analysis of the study.

198

Results Water quality The amounts of ammonia and nitrite are less that 0.5 mg/l. The dissolved oxygen and pH between 4.8–5.5 ppm and 6.4–7.7 respectively. Water temperature of the experiment ranged between 27–29°C. Growth Performance Variables Fig. 1 shows that fish cultured in magnetized water have higher weight than fish in control group. Significant was observed in third and fourth groups with magnetic field intensities of 0.3 and 0.4 T compare to the control group.

16 a b 14 c bc 12 10 8 Initial Wieght

6 Weight Weight (g) 4 a a a a Final Wieght 2 0 0 0.2T 0.3T 0.4T Treatment

Figure 1: Final fish body weight of hybrid red tilapia fingerlings culture in water exposed to different magnetic fields (MFs). Values are means ± S.E. with the same superscripts in the same column have no significance differences at p = 0.05 The highest values for weight gain and daily growth rate for the treatment (0.4 T) were (12.05 g and 0.2 g/d) respectively, as effect of the magnetized water clearly showing enhancing growth of fish declined in treated water unlike the WG and DWG in control group (9.94 g and 0.16 g/d) respectively. The results % WG and SGR %/d confirmed the positive impact of magnetic water, as there are significant differences between fish reared in magnetically treated water and non-treated water. Gradually increment was observed with increase of the MFs intensity with the best in group 0.4T. In addition, the survival during the experimental period was significantly higher in all groups, except the control (Table 1).

199

Table 1. Effect of MW on weight gain WG(g), daily weight gain DWG (g/d), weight gain (%), specific growth rate SGR (%/d), and survival (SR%) of red hybrid tilapia

SMFs WG (g) DWG WG (%) SGR SR (%) (T) (g/d) (%/d)

0 9.94±0 0.17±0.0c 335.81 2.63 ± 93.3 .11c ±5.89c 0.02c ±1.67b 0.2 10.41± 0.19±0.0c 367.31 2.75 ± 98.3 0.29b b ±14.73bc 0.05bc ±1.67a 0.3 11.05± 0.20±0.0b 415.00 2.93 ± 100 0.09b ±25.39ab 0.08b ±0.00a 0.4 12.05± 0.22±0.0a 434.55 2.99± 98.3 0.28a ±24.77a 0.08a ±1.67a Values are means ± S.E. with the same superscripts in the same column have no significant differences at p>0.05

The effects of magnetized water on food intake g/fish (FI), feed conversion ratio (FCR), food efficiency ratio (FER), and protein efficiency ratio (PER) are presented in Table 2. Significant differences in FI, FCR, FER, and PER were observed between the different treatments in comparison to the control (P<0.05). FCR was significantly enhanced in 0.2, 0.3, and 0.4T groups if compared to control group. Similarly, FER and PER were also enhanced, with the best values recorded in group of fish cultured in water treated with 0.4T static magnetic fields. Table 2. Effect of MW on food intake g/fish (FI), feed conversion ratio (FCR), food efficiency ratio (FER), and protein efficiency ratio (PER) of red hybrid tilapia

SMFs(T) FI (g/fish) FCR FER PER

0 12.68±0.36ab 1.23±0.00b 0.81±0.00b 0.17 ± 0.00b 0.2 11.95±0.18b 1.13±0.00a 0.89±0.00a 0.19 ± 0.00a 0.3 12.32±0.36ab 1.11±0.02a 0.90±0.02a 0.20 ± 0.00a 0.4 13.26±0.29a 1.09±0.04a 0.92±0.03a 0.22± 0.00a

Values are means ± S.E. with the same superscripts in the same column have no significant differences at p>0.05.

200

Discussion Janac et al. (2012) indicated that the biological response of organism to MFs are influencing by the characteristics of applied MFs (type, intensity, duration of exposure and frequency). In the current study, the magnetized water in treatment groups, particularly in 0.3 and 0.4T, have enhanced the growth parameters, like weight gain, specific growth rate, and survival of red hybrid tilapia. These findings are in agreement with the findings by Nofouzi et al. (2015) and Tang et al. (2015), on rainbow trout fish and sea cucumber respectively. While, Gilani et al. (2016) observed enhanced growth performance of broiler chicks that consumed magnetic water (0.65T) during starter stage (21 days). However, Li et al. (2014) found that ELF-MF may also inhibit the growth of Nile tilapia larvae. Some studies have related the alteration in animal’s body weight to changes in their metabolism or eating habit (Hashish et al., 2008). In the present study, no significant variations were recorded in feed consumed and eating habit between all groups (12.68,11.95, 12.32, and 13.26) g/fish, indicating that the improvement in the growth performance in fish reared in magnetic water most likely occur due to metabolic changes. These results showed enhanced values of FCR, EFR, and PER which were significantly different (p<0.05) in all MW treatments unlike the control group. Studies performed on fish and other animals have reached inconsistent results. Seemingly, several factors determine how MFs affect animal performance. These include the type of MFs, frequency, intensity, timing and length of exposure. However, EMF penetrates the animal body and acts on all organs, altering the cell membrane potential and distribution of dipoles and ions. These alterations influence all processes in animal body (Nofouzi et al., 2015). According to Tyari et al. (2014), treatment of water by magnetic fields may alter the physical and chemical characteristics of water. For instance, it increases the solubility of minerals which consequently increases nutrients transferring throughout body resulted in, enhanced organism performance. Enhanced performance by the magnetic fields may be attributed to its effect on the angle between hydrogen and oxygen atoms in water molecular and reducing it to 103°. This decrease the number of the water molecules in water clusters to (6-7) molecules and these small clusters can easily penetrate the cell membrane (Yan et al., 2009). Conclusion It can be concluded that magnetic water has positive effect on the growth performance, survival, and efficiency of food conversion of hybrid red tilapia. Based on the findings of this study, SMFs treatment using is recommended for the enhancement of growth performance in hybrid red tilapia fingerlings. Acknowledgments Authors would like to thank the staffs in Aquaculture Experimental Station, Universiti Putra Malaysia (UPM), Puchong, Selangor for their assistance during the study period.

201

References

Aliverdi, A., Parsa, M and Hammami, H. (2015). Increased soyabean-rhizobium symbiosis by magnetically treated water. Biological Agriculture & Horticulture, 31 (3), 167–176.

Ambashta,R.D and Sillanpää, M. (2010). Water purification using magnetic assistance: A review. Journal of Hazardous Materials, 180, 38–49.

Dhawi, F., Al-Khayri, J.M., Hassan, E. (2009). Static magnetic field influence on elements composition in date palm (Phoenix dactylifera L.). Res. J. Agric. Biol. Sci., 5 (2),161–166.

Esitken, A., Turan, M. (2004). Alternating magnetic field effects on yield and plant nutrient element composition of strawberry (Fragaria xananassa cv. Camarosa). Soil Plant Sci., 54, 135–139.

FAO (Food and Agricultural Organization), (2014). The state of world fisheries and aquaculture 2014: Opportunities and challenges. www.fao.org/3/ai3720e. pdf. Accessed 11 May 2015.

Gholizadeh, M. and Arabshahi, H. (2008). The effect of magnetic water on growth and quality improvement of poultry. Middle-East Journal of Scientific Research, 3, 140-144.

Gilani A., Kermanshahi, Golian A., Gholizadeh M., Mohammadpour A.A. (2016). Evaluation of Magnetized Drinking Water on Carcass Yield and Performance of Broiler Chickens. Iranian Journal of Animal Science Research, 8(1), 86-95.

Hashish, A.H., El-Missiry, M.A., Abdelkader, H.I., Abou-Saleh, R.H. (2008). Assessment of biological changes of continuous whole body exposure to static magnetic field and extremely low frequency electromagnetic fields in mice. Ecotox Environ Safe, 71, 895–902.

Janac, B., Selakovic, V., Raus, S., Radenovic, L., Zrnic, M., Prolic, Z. (2012). Temporal patterns of extremely low frequency magnetic field-induced motor behavior changes in Mongolian gerbils of different age. Int. J. Radiat Biol., 88(4), 359–366.

Li, M.H., Yang, H.H., Zhao, J.E., Shi, H.J., Fang, L.L., Li, M.R., Sun, Y.L., Zhang, X.B., Jiang, D.N., Zhou, L.Y., Wang, D.S. (2014). Efficient and heritable gene targeting in tilapia by CRISPR/Cas9. Genetics, 197(2), 591–599.

Nofouzi, K., Sheikhzadeh, N., Jassur, D.M.Z., Helan,J.A. (2015). Influence of extremely low frequency electromagnetic fields on growth performance, innate immune response, biochemical parameters and disease resistance in rainbow trout, Oncorhynchus mykiss. Fish Physiol Biochem., 41,721–731.

Rosen, A.D. (2010). Studies on the effect of static magnetic fields on biological systems. Piers Online, 6 (2), 133–136.

Sakurai, T., Miyakoshi, J. (2008). Biological effects of strong static magnetic fields on insulin secreting cells. The 3rd International Workshop on Materials Analysis and Processing Magnetic Fields, May 14–16, Tokyo, Japan. Journal of Physics: Conference Series 156, p. 012014.

202

Schenck, J.F. (1996). The role of magnetic susceptibility in magnetic resonance imaging magnetic field compatibility of the first and second kinds. Med. Phys., 23, 815–850.

Tang, J., Zhao, W.,Chi,J., Liua,G.,Yu,X., Bian,L. (2015). Effects of magnetic treatment on growth and immune and digestive enzyme activity in the juvenile sea cucumber Apostichopus japonicus (Selenka). Aquaculture, 435, 437–441.

Tyari, E., Jamshidi, A.R., and Neisy, A. (2014). Magnetic Water and its Benefit in Cattle Breeding, Pisciculture and Poultry Advances in Environmental Biology, 8(4), 1031-1036.

Yacout, M.H., Hassan, A.A., Khalel, M.S., Shwerab, A.M., Abdel-Gawad, EI. (2015). Effect of Magnetic Water on the Performance of Lactating Goats. J. Dairy Vet. Anim. Res., 2(5), 2-14.

Yadollahpour, A. and Rezaee, Z. (2014). Electroporation as a New Cancer Treatment Technique: A Review on the Mechanisms of Action. Biomedical & Pharmacology Journal, 7(1), 53-62.

Yan, M., T.W., Yeung T. (2009). Chemistry of magnetic water. International Chemistry Olympiad. IChO’2009, UK; 2009.

Yue, Y.R., and Zhou, Q.C. (2008). Effect of replacing soybean meal with cottonseed meal on growth, feed utilization, and hematological indexes for juvenile hybrid tilapia, Oreochromis niloticus X O. aureus. Aquaculture, 284, 185–189.

203

4.9 LCMS/MS Detection of Faecal Progestogens in Female Malayan Tapir

Summary

Progesterone monitoring through faecal samples of wildlife animals, such as tapirs seems to be an important as a tool to monitor reproductive status of these animals due to its extinction. However, in literatures, there are still lacks of information regarding this matter might be due to low amount of progestogens found in faecal tapir. Therefore, the aim of the study was to detect progestogens (progesterone and pregnanediol) in the fresh faecal samples through three different methods of faecal extractions. In this study, faecal samples of female Malayan tapir were collected from Sungai Dusun Wildlife Reserve (n = 3) and Zoo Taiping (n = 2). Fecal samples were extracted based on established non-invasive hormonal faecal extraction protocols in wildlife (Methods A to D). Each method provides differences in the step of extraction and the solvents used. Simultaneous detection of faecal progestogens was carried out using a multiple reaction monitoring (MRM) approach in the Liquid Chromatography Tandem Mass Spectrometry (LCMS/MS). Results showed that the faecal extraction from Method B employed 80% methanol showed highest peak intensity for progesterone ions; while high variation of peak intensity for pregnanediol ion based on LCMS/MS analysis. The possible reason for vary peak intensity on pregnanediol ion due to several factors such as polarity of the solvents, purification steps and involvement of heat in extraction process.

Keywords: Malayan tapir; non-invasive; LCMS/MS; faecal extraction;progestogen

Introduction

Malayan tapir or scientifically known as Tapirus indicus has been listed as an Endangered category in the International Union for Conservation of Nature (IUCN) Red List of Threatened Species (Traeholt et al., 2016). In general, the population of tapirs decreased every years due to rapid deforestation, habitat loss, road kills and over-hunting (Mace and Balmford, 2000; Novarino, 2005; Traeholt et al., 2016). Therefore, due to recent circumstances, it is important to study their reproductive physiology through hormone monitoring (Pukazenthi et al., 2013), perhaps it would help to sustain or improved the population. In addition, it is also important to generate knowledge of wildlife management, thus could implement new approaches of improve current managements. The improvise includes controlling diet, space, daily monitoring, stress control, and isolation from male during pregnancy (Hodges et al., 2010; Holt et al., 2014). These are needed to successfully facilitate their reproductive performance and indirectly protect the animals from extinction.

Reproductive hormone monitoring through faecal progestogens metabolites (i.e. progesterone, pregnanolone, pregnane and pregnanediol) were able to predict pregnancy status in some wildlife animals such as in rhinoceros, felids and elephants (Brown et al., 1994; Wasser et al., 1996; Schwarzenberger et al., 1996; Brown et al., 2001). However, little scientific data have been published for reproductive hormones of Malayan tapir. According to Pukazenthi et al. (2013), the faecal of tapirs excreted a low

204

amount of progestogens in feces and did not show potentials to measure progesterone for pregnancy diagnosis. Thus, it is important to include more hormonal databases, with concerns should be on the methodological aspect of hormonal analysis such as in determination of progestogens hormone metabolites in fecal samlpes using Liquid Chromatography Tandem Mass Spectrometry (LCMS/MS) in different extraction protocols. Technique such as LCMS/MS has been established to monitor faecal steroid hormones of captive or wild animals (Schwarzenberger et al., 1996; Brown et al., 2001) and primates (Weltring et al., 2012).

Therefore, the aim of the study was to use three different faecal extraction methods and detect the extracted progestogens (i.e. progesterone and pregnanediol) using a multiple reaction monitoring (MRM) approach in the Liquid Chromatography Tandem Mass Spectrometry (LCMS/MS). Results from this study will be adopted in an establishment of simultaneous detection of metabolites from faecal sample of Malayan tapir.

Materials and method

Animals and samplings

Faecal samples were collected from five female Malayan tapirs at Sungai Dusun Wildlife Reserve, Selangor (n = 3) and Zoo Taiping, Perak (n = 2). Fresh faecal samples were collected in the morning between 0800 and 1000 prior to daily feeding. Faecal samples were homogenized and undigested material (i.e. plant parts, seeds and insects) were removed. Faecal samples were placed into labelled 50 mL falcon tube. Samples were extracted immediately at field for Method C (Shutt et al., 2012). Meanwhile, as for Method A (Brown et al., 2001) and Method B (Schwarzenberger et al., 1996), samples were transported in ice box to laboratory in Universiti Putra Malaysia, Serdang, Malaysia before faecal extraction.

Approval of animal ethics and permit

The project was approved by Institutional Animal Care and Use Committee (IACUC) of Universiti Putra Malaysia with reference number of UPM/IACUC/AUP-R033/2016 and the permission to collect faecal samples was approved by Jabatan Perlindungan Hidupan Liar dan Taman Negara (PERHILITAN) with permit number of NRE 600-2/2/21 JLD 4 (34), B- 00441-6-16.

Extraction of faecal samples

Fresh faecal samples were extracted using faecal extraction method by A) Brown et al. (2001), B) Schwarzenberger et al. (1996) and C) Shutt et al. (2012) with modification.

A. Briefly, 1.0 g of fresh faecal samples was suspended in 5 ml of 90% ethanol and vortexed. Samples were boiled in water bath (90°C) for 20 minutes and centrifuged at 1500 rpm for 20 minutes. The extracts were poured into the new labelled tube. Then,

205

another 5 ml of 90% ethanol were added to the remaining faecal pellets and centrifuged again for 15 minutes. The extracts were combined in a new labelled tube and dried using rotary savant evaporator. The dried extracts were reconstituted in 2 ml of methanol and briefly vortexed. The methanol extracts were stored at -20° C until further analysis.

B. Briefly, 1.0 g of fresh faecal samples were placed in 10 ml of 80% methanol and vortexed for one minute. Samples were homogenized overnight to make sure hormone metabolites were fully extracted. Then, samples were centrifuged at 1500 rpm for 15 minutes. Supernatants were recovered and stored at -20° C until analysis. C. D. Briefly, 1 g of fresh faecal samples were placed in 10 ml of 90% ethanol and shake for 3 minutes and supernatant was recovered and stored at -20° C until further analysis.

LCMS/MS measurement

The extract was separated at 50 °C on a reversed phase C18 column (Gemini C18; 150 mm × 2 mm, 3 μm, Phenomenex Torrance, CA, USA) covered by a guard cartridge of the same material (Security Guard; 4 mm × 2 mm, 5 μm, Phenomenex Torrance, CA, USA). The composition of eluent A and eluent B was water and methanol respectively, both contained 0.1% ammonium formate. The gradient was 30% A (0 to 4 min), 45% A (4 to 4.10 min), linear increase to 60% A (4.10 to 6 min). A 10 μL of extract was injected. Flow rate was 0.5 ml/min. The MS equipment was (Agilent mass spectrometer with ESI interface). The sample cone voltage and the collision energy were set individually for each compound. Steroids were detected in positive ion mode with multiple reaction monitoring (MRM) of the two most abundant product ions per analyte. During MS/MS, the precursor ions of each metabolite were fragmented into different product ions. The product ion mass for progesterone was 109 m/z, mean while pregnanediol was 179 m/z. This information can be used to distinguish both progestogen metabolites. MRM parameters have been optimised for progesterone and pregnanediol according to method by Weltring et al. (2012) as shown in Table 1.

Table 1: Targeted faecal progestogen metabolites using multiple reaction monitoring (MRM) parameters (Weltring et al., 2012) Precursor Product Collision Progestogen ions ion Polarity energy (Ev) (m/z) (1/2) Progesterone 315 97/109 25/25 Positive Pregnanediol 285 175/189 18/18 Positive Note: m/z (mass per charge), Ev (Electron volt)

206

Results and Discussion

Results from this study showed that faecal progestogens metabolites (i.e. progesterone and pregnanediol) can be detected through LCMS/MS but the peak intensity were different all animals and extraction methods. Based on Figures 1 and 2, the highest peak intensity for progesterone was observed in Method B from Animal 1, 2 and 5 (Figure 1). In this method, 80% methanol was used to extract progestogen metabolites. Polarities of the solvent plays important role in extraction (Palme et al., 2013). Since the steroid metabolites such as progestogens are polar compound, using more polar solvents (i.e. methanol and ethanol) were recommended (Palme et al., 1997; Palme et al., 2013). In this case, methanol is more polar than ethanol, therefore the peak intensity was higher. Extraction protocols with more than 80% methanol and ethanol were commonly used due to ability of solvents to extracts high percentage of unconjugated steroid metabolites (Hodges et al., 2010). In addition, both methanol and ethanol have been used to extract progestogen metabolites from faecal samples of animals such as rhinoceros and felids (Brown et al., 1994; Schwarzenberger et al., 1996; Brown et al., 2001). This eventually help to improve breeding strategies through hormone monitoring in these species. Besides, there is also no involvement of boiling and evaporation process in Method B as this would reduce the variation between samples since fewer steps are involved (Palme et al., 2013). As for Method C, homogenization of faecal samples using centrifuge might help to improve the detection of progestogens metabolites. However, limitation exist as high technology machine such as vortex and centrifuge are mostly unavailable in field (Shutt et al., 2012). Thus, future study should investigate correlation between extraction in laboratory and field study. This would be important as immediate extraction in field study might help to ensure progestogens are not degraded during transfer process to laboratory.

Meanwhile, there are more variation in terms of peak intensity for pregnanediol, with the highest peak intensity can be observed in Method A of Animal 5 (Figure 2). The variation existed might be due to application of heat and temperature in extraction process in Method A. According to Palme et al. (2013), application of heat in extraction process could lead to variation in relative abundance of ions since parameters such as time and temperature need to be well-executed. Although some studies have reported that the use of heat in extraction enhances the extraction process, careful handling is needed to ensure the hormone of interest was not loss during extraction (Brown et al., 1994; Brown et al., 2001; Rangel- Negrin 2011; Palme et al., 2013). Thus far, there is less study on the effect of heat and extraction protocols, in which progestogens metabolites might be destroyed when evaporated to dryness. Future study should investigate the effect of heat towards faecal extracts as it could be important for further validation on extraction methods.

207

382

312

247

141 130 136 116 109 91 90 69 70 75 57 53

1 2 3 4 5 Figure 1: Peak intensity of progesterone ions (m/z=315) in each faecal samples. Animal (1- 3: from Sungai Dusun Wildlife Reserve 4-5: from Zoo Taiping); extraction methods (A, B, C). Note: blue (Method A), red (Method B) and green (Method C).

1548

637

340 277 315 216 149 112 15 36 57 21 60 33 24

1 2 3 4 5 Figure 2: Peak intensity of pregnanediol ions (m/z=285) in each faecal sample. Animal (1-3: from Sungai Dusun Wildlife Reserve 4-5: from Zoo Taiping); extraction methods (A, B, C). Note: blue (Method A), red (Method B) and green (Method C).

Progestogens such as progesterone and pregnanediol are important in diagnosing pregnancy in animals (Brown et al., 1994; Pukazenthi et al., 2013). Elevated faecal progestogen concentration during gestation can be used as indicator to pregnancy. It

208

has been successfully done in animals such as rhinoceros, horses, felids and primates (Schwarzenberger et al., 1996; Brown et al., 2001; Asa et al., 2001; Weltring et al., 2012). In this study, faecal progestogens such as progesterone and pregnanediol were detected in all samples. Animal 2 was pregnant during our study and other animals (Animals 1, 3, 4, and 5) were not pregnant. Results from LCMS/MS could not validate the pregnancy status in Malayan tapir as peak intensity for progesterone and pregnanediol in Figures 1 and 2 does not reflect the actual hormone concentration. Although, it is possible for all extraction method to extract both progesterone and pregnanediol in faecal samples of Malayan tapir, but the information is still limited. The qualitative aspect of LCMS/MS in this study limited the findings regarding the exact concentration in pregnant and non-pregnant animals. Future study should include the measurement of progestogen metabolites using specific reference standards for each detected progestogen metabolites. In addition, to improve the detection of progestogens metabolites in faecal samples of Malayan tapir, purification of faecal extracts prior to LCMS/MS are needed in this study. The presence of unwanted matrix can cause an ion suppression or enhancement, thus could affecting the determination of progestogens in faecal samples (Van Eleckhaut et al., 2009). Since Malayan tapir consumed a lot of plant fibres, purification was required to remove interferences, so that matrix effect and ionization problem can be reduced (Murtagh et al., 2013). Although such detail was not considered in this study, for future research, cleaning method or purification of hormones of interest using solid phase extraction (SPE) need to be considered prior to LCMS/MS.

Conclusion The non-invasive approach by using faecal samples provide alternative to blood collection from animals. LCMS/MS allows detection of targeted progestogen metabolites (i.e. progesterone and pregnanediol) from faecal samples. Results from this study suggested that different extraction methods affect the outcomes of LCMS/MS detection. Limitation exist from this study as it is only included the qualitative aspect of LCMS/MS, it is not yet conclusive to recommend the best faecal extraction method for Malayan Tapir. Thus, future work will be carried out to investigate the effect of different extraction methods towards the steroid hormones recovery from each method of extraction. Reference standards to the respective hormones will be used to quantify the concentration of extracted hormones. Thus, allow the establishment of baseline values using LCMS/MS to determine pregnancy status in Malayan tapir.

Acknowledgements We would like to acknowledge Jabatan Perlindungan Hidupan Liar dan Taman Negara (PERHILITAN) for our great collaboration. Special thanks to the all staffs at Zoo Taiping and Sungai Dusun Wildlife Reserves. We also want to acknowledge Universiti Putra Malaysia (UPM) for financial supports (GP-IPS/2016/9504500) and Malaysian Nature Society-Young Environmental Research Grant (YERG16-21) and make this research more valuable.

209

References Asa, C. S., Bauman, J. E., Houston, E. W., Fischer, M. T., Read, B., Brownfield, C. M., & Roser, J. F. (2001). Patterns of excretion of fecal oestradiol and progesterone and urinary chorionic gonadotropin in Grevy’s zebras (Equus grevyi): ovulatory cycles and pregnancy. Zoo Biology, 20(3), 185-195. Brown, J. L., Bellem, A. C., Fouraker, M., Wildt, D. E., & Roth, T. L. (2001). Comparative analysis of gonadal and adrenal activity in the black and white rhinoceros in North America by noninvasive endocrine monitoring. Zoo Biology, 20(6), 463-486. Brown, J. L., Citino, S. B., Shaw, J., & Miller, C. (1994). Endocrine profiles during the estrous cycle and pregnancy in the Baird's tapir (Tapirus bairdii). Zoo Biology, 13(2), 107-117. Holt, W. V., Brown, J. L., & Comizzoli, P. (2014). Reproductive science as an essential component of conservation biology. In Reproductive Sciences in Animal Conservation (pp. 3- 14). Springer, New York, NY. Murtagh, R., Behringer, V., & Deschner, T. (2013). LC-MS as a method for non-invasive measurement of steroid hormones and their metabolites in urine and faeces of animals. Wien Tierärztl Monat–Vet Med Austria, 100, 247-254. Novarino, W., & Grant, R. S. (2005). Population monitoring and study of daily activities of Malayan tapir (Tapirus indicus). Report to Rufford Small Grant (for Nature Conservation) in association with the Whitley Laing Foundation. Palme, R., Möstl, E., Brem, G., Schellander, K., & Bamberg, E. (1997). Faecal Metabolites of Infused 14C‐Progesterone in Domestic Livestock. Reproduction in Domestic Animals, 32(4), 199-206 Palme, R., Touma, C., Arias, N., Dominchin, M. F., & Lepschy, M. (2013). Steroid extraction: get the best out of faecal samples. Wien Tierarztl Monatsschr, 100 (9-10), 238-46. Pukazhenthi, B., Quse, V., Hoyer, M., van Engeldorp Gastelaars, H., Sanjur, O., & Brown, J. L. (2013). A review of the reproductive biology and breeding management of tapirs. Integrative Zoology, 8(1), 18-34. Rangel-Negrín, A., Flores-Escobar, E., Chavira, R., Canales-Espinosa, D., & Dias, P. A. D. (2014). Physiological and analytical validations of fecal steroid hormone measures in black howler monkeys. Primates, 55(4), 459-465. Schwarzenberger, F., Möstl, E., Palme, R., & Bamberg, E. (1996). Faecal steroid analysis for non-invasive monitoring of reproductive status in farm, wild and zoo animals. Animal Reproduction Science, 42(1), 515-526. Shutt, K., Setchell, J. M., & Heistermann, M. (2012). Non-invasive monitoring of physiological stress in the Western lowland gorilla (Gorilla gorilla gorilla): validation of a fecal glucocorticoid assay and methods for practical application in the field. General and Comparative Endocrinology, 179(2), 167-177.

210

Traeholt, C., Novarino, W., bin Saaban, S., Shwe, N.M., Lynam, A., Zainuddin, Z., Simpson, B. & bin Mohd, S. (2016). Tapirus indicus. The IUCN Red List of Threatened Species 2016. Retrieved on 10 February 2018. Van Eleckhaut, A., Lanckmans, K., Sarre, S., Smolders, I., & Michotte, Y. (2009). Validation of bioanalytical LC–MS/MS assays: evaluation of matrix effects. Journal of Chromatography B, 877 (23), 2198-2207. Wasser, S. K., Papageorge, S., Foley, C., & Brown, J. L. (1996). Excretory fate of estradiol and progesterone in the African elephant (Loxodonta africana) and patterns of fecal steroid concentrations throughout the estrous cycle. General and Comparative Endocrinology, 102 (2), 255-262. Weltring, A., Schaebs, F. S., Perry, S. E., & Deschner, T. (2012). Simultaneous measurement of endogenous steroid hormones and their metabolites with LC–MS/MS in faeces of a New World primate species, Cebus capucinus. Physiology & behavior, 105 (2), 510-521.

211

CHAPTER 5

PLANT PHYSIOLOGY

5.1 Impact Of Potassium Fertilization On The Growth And Secondary Metabolites Of Orthosiphon stamineus (Misai Kucing)

Summary

A randomized complete block design 4 × 3 experiment was designed and conducted for three months to investigate the relationships between plant growth, leaf gas exchange, total chlorophyll and secondary metabolites (total phenolics) of Orthosiphon stamineus under four levels of potassium fertilization i.e. 0 kg /ha (control), 90 kg /ha, 180 kg /ha and 270 kg /ha. Generally, it was found that the growth of O. stamineus was influenced by potassium fertilization rate. The plant leaf numbers and leaf area was enhanced as potassium levels increased from 0 to 270 kg K/ha. The leaf gas exchange characteristics such as net photosynthesis, stomatal conductance and transpiration rate and water use efficiency (WUE) were up-regulated under high rate of potassium fertilization. The net photosynthesis, stomatal conductance and transpiration rate was enhanced with high potassium fertilization. In the present study, it was found that plant that was fertilized with high levels of potassium would have high efficiency in water usage by having high water use efficiency. The production of plant phenolics was influenced by potassium fertilization. Total phenolics were 38, 65 and 86% lowered in 180, 90 and 0 kg/ha respectively compared to 270 kg/ha that record 1.86 mg/g GAE. The current study showed that the high application of potassium can enhance growth and production of secondary metabolites in O. stamineus seedlings.

Keywords: Potassium Fertilization; Herbs; Growth; Secondary Metabolites

Introduction

Malaysia is one of the countries that rich in plant diversity, including herbal plants. From about 10,000 species of higher plants and 2000 species of lower plants available in Peninsular Malaysia, approximately 16% are identified to be useful in medicines (Krishnaiah et al., 2011). The goodness of the herbal plants has been used hundred years ago. It can be used for the purpose of health, beauty and medicine. Most of the herbal products nowadays come in forms of in capsule, drink, food and liquid extract. The usage of herbal product is increased due to enhanced awareness of the dangerous of using synthetic drugs for medicinal purposes (Aziz et al., 2010). Malaysia is well positioned to promote the growth and competitiveness of herbal industries and rich in bio-diversity (Paul et al., 2014). There are certain circumstances that we must overcome to promote the usage of our herbal industry product such as lack industrial infrastructure, low sustainability of production and less of information on the benefits of Malaysian herbs to the consumer.

Cultivation factors such as soil type, compost, mulching and fertilization also can affect the plant secondary metabolites and antioxidant activity of plant. While Liaqat et al. (2012) found that the total phenolics in blackberries decreased as potassium (K) levels decreased. It is also well known that K also can enhance growth of plant by regulating photosynthesis. K is known to regulate photosynthesis by controlling the stomata opening and closing thus influences the plant stomata conductance. Usually increase in K would increase stomata conductance that enhanced photosynthesis and increase plant growth (Pal and Ghosh,

212

2010). This indicate that the used of fertilizer especially K can influence the growth and biometabolites of the plants.

The demands for the herbs plant is getting increase however the production of these plants is still insufficient to fulfill the demands of local industrial due to low qualities of planting materials. The usage of potassium fertilizer would produce plants with high qualities and uniform in size that can be used for mass production for factory line. Currently, there were lacks of research done on impact of potassium on local Malaysian herbs especially on O. stamineus. Previous research have been conducted, however there were no proper documentation about the recommended potassium application to have high growth and secondary metabolites of these plants. This information would be useful for the herbal propagators in Malaysia. With that the research has been conducted to observe the best rate of potassium would to achieve the optimum growth and high production of secondary metabolites for O. stamineus. This comes with three main objectives i.e. 1) to investigate the effect of potassium fertilization on the growth and secondary metabolites of O. stamineus, 2) To determine the best potassium rate for the best growth and secondary metabolites of O. stamineus, and 3) To characterize the growth and secondary metabolites of O. stamineus relationship with potassium fertilization.

Materials and Methods Location and Planting Materials

The planting site for this project was done at the Ladang E, Taman Pertanian Universiti, Universiti Putra Malaysia. While the laboratory analysis was done at the Physiology Plant Laboratory, Department of Biology, Faculty of Science, Universiti Putra Malaysia and Physiology Laboratory, Department of Crop Science, Faculty of Agriculture, Universiti Putra Malaysia. Orthosiphon stamineus was planted by using stem cutting method. The stem cutting methods was conducted at Taman Herba, Taman Pertanian Universiti, Universiti Putra Malaysia. The stems were propagated in trays containing peat moss about two weeks (Fig. 3.1). Rooting hormone (Seradix) was used to enhance rooting by dipping the end of the cutting into the powder. After a month, the rooted cuttings were transferred into polybags (16 x 30 cm). The total plants used were 96 plants.

Planting Medium

A mixture of 3 parts top soil: 1 part of sand ratio was used as a planting media (v/v). All polybags contained this mixture were arranged at Ladang Taman Pertanian Universiti, Universiti Putra Malaysia.

Experimental Design And Treatment

The experiment used in the study was Randomized Complete Block Design (RCBD). Four potassium treatments (0, 90, 180, and 270 kg/ha) with three replication were used and each treatment consisted of eight plants. Nitrogen and phosphorus were applied using urea and trisodium phosphate (TSP) respectively at fixed rate at 180 kg/ha.

213

Leaf Gas Exchange Measurement

The measurement was obtained from a closed infra-red gas analyzer LICOR 6400 Portable Photosynthesis System. The instrument was warmed for 30 minutes and calibrated with the ZERO IRGA mode. The measurements used optimal conditions set of 400 μmol mol−1 CO2 30 °C cuvette temperature, 60% relative humidity with air flow rate set at 500 cm3 min−1, and modified cuvette condition of 800 μmol m−2 s−1 photosynthetically photon flux density (PPFD). The measurements of gas exchange were carried out between 9:00 a.m and 11:00 a.m. using fully expanded young leaves numbered three and four from plant apex to record net photosynthesis rate. The operation was automatic and the data were stored in the LI- 6400 console and analyzed by “Photosyn Assistant”.

Total Phenolic Quantification

The method of extraction and quantification for total phenolics and flavonoids contents followed after Ibrahim et al. (2012). An amount of ground dried tissue samples (0.1 g) was extracted with 80% ethanol (10 mL) on an orbital shaker for 120 minutes at 50 °C. The mixture was subsequently filtered (Whatman™ No.1), and the filtrate was used for the quantification of total phenolics. Folin-Ciocalteu reagent (diluted 10-fold) was used to determine the total phenolics content of the leaf samples. The sample extract (200 μL) was mixed with Folin-Ciocalteau reagent (1.5 mL) and allowed to stand at 22 °C for 5 min before adding NaNO3 solution (1.5 mL, 60 g L−1). After two hours at 22 °C, absorbance was measured at 725 nm. The results were expressed as mg g−1 gallic acid equivalent (mg GAE g−1 dry sample).

Data Analysis

All the data taken were analyzed using Analysis of Variance (ANOVA) at p=0.05. The differences between treatments were analyzed for means separation by Duncan Multiple Range Test (DMRT) at p=0.05. Both methods were carried out using SPSS Window version 22.

Result and Discussion

Total leaf area

Total leaf area of plants was influenced by potassium fertilization (p≤ 0.05; Figure 1). It was observed potassium influenced the total leaf area in two and three months after treatment. Generally as potassium level increase from 0>90>180>270 kg/ha, the leaf area was increased. Increase supply of potassium would usually enhance the turgor pressure of the plant. The increase in turgor pressure usually resulted leaf to expand and grew bigger. Potassium help to improves performance by increasing leaf area, this allows the crop to intercept more radiation giving proportional increases in sugar yield (Sahib, 2009), thus justify why leaf area was increased with high potassium fertilization.

214

450 a 400 a 350 Treatment 300 b (kg/ha) 250 0 c 200 a 90 150 b 180 Total leaf Totalleaf area(cm²) 100 270 a 50 0 0 1 2 3 Month

Figure 1: The impact of potassium fertilization on total leaf area of Orthosipon stamineus during three months of planting. N=6. Means with same letter are not significant different (p≤ 0.05) according to (DMRT).

Number of Leaves Number of leaves followed the same trends with specific leaf area. It was found that number of leaves was influenced by potassium fertilization (p≤ 0.05). Figure 2 showed significant differences were observed in two and three month after treatment. The leaves number was increased as the potassium level was enhanced from 0>90>180>270 kg/ha. This was observed in two and three month after treatment. This indicates that application of potassium can stimulate vegetative growth of Orthosipon stamineus especially the enhancement of the leaves number.

200 a 180 b 160 c Treatment 140 (kg/ha) a 120 c 0 b 100 90 c 80 180 60

Number Number ofleaves a 270 40 20 0 0 1 2 3 Month

Figure 2: The impact of potassium fertilization on number of leaves of Orthosipon stamineus during three months of planting. N=6. Means with same letter are not significant different (p≤ 0.05) according to DMRT.

215

Net Photosynthesis Rate Figure 3 showed that potassium fertilization significantly influenced the net photosynthesis rate. As the level potassium fertilization enhanced from 0>270 kg/ha the net photosynthesis rate was also enhanced. The increase in photosynthesis rate with increase in potassium fertilization might be due to the role of potassium in photosynthesis enzyme activation. The optimum potassium concentration resulted in the maximum net photosynthetic rate which could be associated with the highest chlorophyll content (Xu et al., 2011).

6.00

)

1 -

s a 2 - 5.00

4.00 b 3.00 b

2.00 c 1.00

0.00 Photosynthesis Photosynthesis rate (µmol/m 0 90 180 270 Potassium (kg/ha)

Figure 3: The impact of potassium fertilization on net photosynthesis rate of Orthosipon stamineus during three months of planting. N=6. Means with same letter are not significant different (p≤ 0.05) according to DMRT.

Water Use Efficiency Water use efficiency was calculated by dividing the photosynthesis rate with transpiration rate. The data showed the efficiency of plant using the water. Figure 4 showed that potassium level have influenced the water use efficiency of Orthosipon stamineus. It showed that application of 270 kg/ha potassium has produced plant with the highest water use efficiency. There were no significant differences were observed between 0, 90 and 180 kg/ha. This suggests high application of potassium fertilization can enhance Orthosipon stamineus plant water use efficiency. This showed that plants fertilized with high potassium can survive under limited water condition.

216

2.50 a

/mol 2 2.00 ab

mmol CO mmol 1.50 b b

O) O)

2

H 1 - 1.00

0.50

0.00 Water use efficiency Water efficiency use ( 0 90 180 270 Potassium (kg/ha)

Figure 4: The impact of potassium fertilization on water use efficiency of Orthosipon stamineus during three months of planting. N=6. Means with same letter are not significant different (p≤ 0.05) according to DMRT. Total phenolics

Figure 5 showed that potassium fertilization significantly influenced the total phenolic. As the level potassium fertilization enhanced from 0>270 kg/ha the total phenolic was also enhanced. Plant received 270 kg/ha of potassium was observed to have the highest total phenolic content (1.86) followed by 180, 90 and 0 kg/ha (1.15, 0.64 and 0.21 respectively). Accumulation of total phenolics and flavonoids in O. stamineus were influenced by potassium levels (p≤ 0.05). As the plant receives high potassium levels (0>270 kg/ha) the production of total phenolics was enhanced. The increase in the production of total phenolics with increasing potassium levels in the study might be due to enhancement of total non-structural carbohydrate (TNC) (Norhaiza et al., 2009) and this might due to potassium’s role of stimulating photosynthesis activity and increasing the translocation of carbohydrate to plant parts (Ghasemzadeh et al., 2010). The increase in translocation indirectly enhanced the biosynthesis of total phenolics of O. staminues treated with high potassium fertilizer. The present findings was also in agreement with (Wei et al., 1990) that found the increase in total phenolics and flavonoids in Chrysanthemum morifolium leaves was due to increase in production of TNC under high K application. This implies that an increasing potassium supply can enhance production of TNC and simultaneously increase the production of plant secondary metabolites in O. stamineus seedlings

217

2.00 a 1.80 1.60 1.40 b 1.20 1.00

0.80 c 0.60 0.40 d

0.20 Total phenolics (mg GAE/g Totalphenolics (mg GAE/g dry) 0.00 0 90 180 270 Potassium (kg/ha) Figure 5: The impact of potassium fertilization on total phenolic of Orthosipon stamineus during three months of planting. N=6. Means with same letter are not significant different (p≤ 0.05) according to DMRT.

Conclusion

The current study showed that the high application of potassium can enhance growth and production of secondary metabolites in O. stamineus seedlings.

REFERENCES

Aziz R., Yaakob H., Khairul A.R., Samsulbahrin J., Abdul H.M., (2010) Herbal and Industry Potential In Malaysia: Issues and Market. Institute of Bioproduct Development. Universiti Teknologi Malaysia.

Ibrahim, M. H., Jaafar, H. Z., Karimi, E., & Ghasemzadeh, A. (2012). Primary, secondary metabolites, photosynthetic capacity and antioxidant activity of the Malaysian herb kacip fatimah (Labisia pumila benth) exposed to potassium fertilization under greenhouse conditions. International Journal of Molecular Sciences, 13(11), 15321-15342. Krishnaiah, D., Sarbatly, R., & Nithyanandam, R. (2011). A review of the antioxidant potential of medicinal plant species. Food and bioproducts processing, 89(3), 217-233.

Pal, P., & Ghosh, P. (2010). Effect of different sources and levels of potassium on growth, flowering and yield of African marigold (Tagetes erecta) cv.“Siracole”. Indian J.Natural Products Res, 1(3), 371-375.

Paul, K. C., Hamzah, A., Samah, B. A., Ismail, I. A., & D’Silva, J. L. (2014). Technology Implementation Barrier of Rural Malay Herbal Entrepreneurship in Malaysia. Journal of Applied Sciences, 14(1), 72-76

Sahib, H.B., Aisha, A.F., Yam, M.F., Asmawi, M.Z., Ismail, Z., Salhimi, S.M., Othman, N.H., Majid, M.A.S.,(2009) Anti-angiogenic and antioxidant properties of Orthosiphon stamineus Benth. methanolic leaves extract. International Journal of Pharmacology, 5 (2), 162-167.

218

5.2 Carbon Assimilation, Leaf Gas Exchange And Quality Of Ipomea aquatica As Affected By Nitrogen Rates

Summary

The study was conducted to investigate the impact of the nitrogen fertilization on the growth, leaf gas exchange and bio-metabolite accumulation in Ipomea aquatica. The nitrogen source used was from the NPK green fertilizer (15:15:15). In the study, there were four treatments with different rates of nitrogen being applied on Ipomea aquatica, such as 0 (control), 30, 60 and 90 N kg/ha. Complete Randomize Design (CRD) with 11 replications was used in this study. Generally, as the nitrogen rate increases from 0 to 90 N kg/ha, the growth and development of Ipomea aquatica was enhanced. This was shown by the increased in plant height, basal diameter, leaf and branch number, fresh and dry weight, and chlorophyll content where all the growth parameters recorded the highest measurement at 90 kg N/ha and the lowest at 0 kg N/ha. As for the leaf gas exchange, the positive effect of nitrogen fertilization on kangkung was shown by the increased in photosynthesis rate, stomatal conductance and transpiration rate, where the highest measurement recorded at 90 kg N/ha, while the lowest at 0 kg N/ha. However, the water use efficiency (WUE) decreased as the nitrogen rates increased where at 0 kg N/ha the WUE was the highest. On the other hand, it was found that at lower rates of nitrogen fertilization (30 kg N/ha) produced the highest production of secondary metabolites, where the total phenolics and flavonoids production were enhanced compared to other nitrogen treatments. Keywords: Carbon Assimilation; Leaf Gas Exchange; Nitrogen; Stomatal Conductance; Ipomea Aquatica

Introduction In Malaysia, agriculture sector has contributed about 8.5% to Gross Domestic Products (GDP). About 39% of the contributions originated from the production of food crops, fruits and vegetables. It is estimated that there are about 44, 000 hectares of the total area in Malaysia was used for vegetable cultivation. According to Jabatan Pertanian Semenanjung Malaysia in 2011, kangkung is one out of ten types of vegetables that consumed the highest area for vegetable production. This plant is among the most consumed vegetable in Asia. This is because of its low price compared to other types of vegetable. Kangkung or its scientific name, Ipomea aquatica, is a widely known leafy vegetable especially in Asian country. The plant also commonly known with different local names, such as water spinach, swamp cabbage, or water convolvulus. From its scientific classification, kangkung has been classified under a family of Convolvulaceae (Nashrin et al., 2002). This species of family can nicely grow at almost anywhere at the higher or even the lower land. Ipomea aquatica is one of the species that is cultivated on the higher land. Besides easy to be grown, kangkung often be the favorable plant to be cultivated because it does not take long time to mature and harvest. It can easily adapt towards it’s grow environment and usually unsusceptible to disease. Almost all parts of kangkung plant are edible (Susila et al., 2012).

Nitrogen is one of the macro-nutrients that is very crucial especially for a plant to have a proper growth and development such as that required in constructing the matter of the plant cell and tissue (Mokhele, 2011). The amount of nitrogen in the soil could be insufficient for the plant to grow. Therefore, the source of nitrogen for plant especially in agriculture field often be found in the form of a fertilizer. Both organic and inorganic nitrogen fertilizer are widely used in agriculture especially in cultivating green crops to keep the source of nutrients for plant being supply (Liu et al., 2014).

219

Previously, there were studies that have been conducted on how the rate of nitrogen fertilizer affect the morphological growth and yield of this plant. However, there were no study about the production of secondary metabolites and leaf gas exchange properties under different nitrogen rates. So, it is pertinent to conduct the research to answer the remaining question. This research will provide the important information for vegetable growers that involved in kangkung cultivation.

Materials and Methods

Planting materials

The seeds of I. aquatica were used and directly sown 1 inch into the black soil that has been prepared in a seedling tray as shown in Figure 3.2. These seeds were allowed to germinate for two weeks. The soil medium for the continuing of planting I. aquatica was obtained from Ladang 2, UPM with a mixture of topsoil, organic matter and sand with the ratio of 3:2:1 (v/v). The soil medium were strained to remove the sizeable rocks. After all the seeds has been germinated, all the plants then were transplanted into the polybags where each of the polybags had only one plant

Experimental design

The polybags were arranged according to Completely Randomized Design (CRD) with eleven replications. There were four nitrogen rates were applied (0, 30, 60 and 90 N Kg/ha) with overall 44 of I. aquatica plants were used.

Leaf gas exchange measurement

The leaf gas exchange measurement was obtained after week 4 the treatment was given. This is because the sample was not sufficient to obtain the result every week from week one until the fourth week. The result then was obtained by using the Portable Photosynthesis System machine (LICOR 6400). The machine firstly warm up for at least 30 minutes before the data collected. Next, it will be calibrated with Zero IRGA mode. The optimal condition was set to 400 µmol mol-1 carbon dioxide (CO2), 30 oC cuvette temperature, 60% relative humidity with air flow rate set at 500 cm3 min-1, and 800 µmolm-2s-1 of cuvette condition of photosynthetic photon flux density (PPFD). The time for the measurement were done at the morning of a day. The measurement of photosynthesis rate were taken from the first leaves starting from the plant apex. The data then were recorded and stored in a console of the system and analyse with Photosyn Assistant Software. The photosynthesis, transpiration and water use efficiency data was recorded during the measurement.

Measurements of total phenolics and flavonoids

A fixed amount of ground tissue samples (0.1 g) was extracted with 80% ethanol (10 mL) on an orbital shaker for 120 min at 50 °C. The mixture was subsequently filtered (Whatman™ No.1), and the filtrate was used for the quantification of total phenolics and total flavonoids. Folin–Ciocalteu reagent (diluted 10-fold) was used to determine total phenolics content of the leaf samples. The sample extract at 200µL was mixed with Folin– Ciocalteau reagent (1.5 mL) and allowed to stand at 22 °C for 5 min before adding NaNO3 solution (1.5 mL, 60 g L−1). After two hours at 22 °C, absorbance was measured

220

at 725 nm. The results were expressed as mg g−1gallic acid equivalent (mg GAE g−1dry sample). For total flavonoids determination, samples (1 mL) were mixed with NaNO3 (0.3 mL) in a test tube covered with aluminium foil, and left for 5 min. Then 10% AlCl3 (0.3 mL) was added followed by addition of 1 M NaOH (2 mL). The absorbance was measured at 510 nm using a spectrophotometer with rutin as a standard (results expressed as mg/g rutin dry sample).

Results and Discussion

Total biomass of plant

The effect of four different nitrogen treatments had significantly influenced on the total plant dry weight of I. aquatica plant (Figure 1). The graph pattern shows increased trends with higher nitrogen fertilization rates. It was observed that the highest total biomass of I. aquatica was obtained from 90 kg N/ha, followed by 60 kg N/ha and 30 N kg N/ha that recorded at 3.7g and 3.26g respectively. The lowest total biomass was recorded in control treatment 0 kg N/ha with of 3.13g. There were no significant different occurred in between 0 and 30 N kg/ha treatment (p ≥ 0.05). It was observed that the increased in dry weight of shoot across the treatments of N. The highest dry weight of shoot and root both observed at 90 kg N/ha with value of 2.34g and 1.94g respectively. While the lowest dry weight of shoot and root was observed at 0 kg N/ha and 30 kg N/ha (1.74g and 1.35g, respectively).

Figure 1: The impact of different nitrogen rates on the total biomass of Ipomea aquatica after 6 weeks of planting. Mean with the same letter indicates that all of the groups were not significantly different according to Duncan multiple range test (p ≥ 0.05) N=11.

221

Total Chlorophyll Content

Figure 2 showed the impact of nitrogen fertilization on total chlorophyll content (TCC) of I. aquatica in 4 weeks of treatments. There were significant differences was observed for TCC in every week of measurement content was obtained from 60 N kg/ha in week 3 (mean=39.35). The chlorophyll content increased after week 1 and reached its maximum WAT content at week 3 as shown in Figure 4.12. The decreased in chlorophyll content was observed started after week 3 until week 4 with the lowest chlorophyll content recorded in every week at 0 N kg/ha. According to Bojović and Marković (2009), there is a linear relationship between the rates of nitrogen and the chlorophyll content in plants. The deficiency symptom of nitrogen in plant are usually shown by reduction in chlorophyll content in plant, the chlorophyll content usually happen to be at the shoot, root, leaves and seed of the plant. The plant that has been treated under high N level will resulted in higher chlorophyll content where this might be due to the immediate absorbance of nitrogen in plant (Sarkar et al., 2014). Since N is important for the structural element of chlorophyll and protein molecules, low N level will affect the formation of chloroplasts and the accumulation of chlorophyll in the plant.

45 a 40 a a a a a a 35 ab b Treatment ab a b 30 0 kg/ha b c 25 c b 30 kg/ha 20 60 kg/ha 15 90 kg/ha 10 Content Chlorophyll 5

0 0 1 2 3 4 Weeks

Figure 2: The impact of different nitrogen rates on the chlorophyll content of Ipomea aquatica after 6 weeks of planting. Mean with the same letter indicates that all of the groups were not significantly different according to Duncan multiple range test (p ≥ 0.05) N=4.

Photosynthesis Rate

The photosynthesis rate of I. aquatica was affected by four different nitrogen treatments. It is clearly observed that from the graph pattern, as the nitrogen rate fertilization become higher, the rate of photosynthesis also higher (Figure 3). Treatment that affect photosynthesis rate the most was 90 kg/ha nitrogen, follow by 60 and 30 kg/ha, with the means of 3.91, 3.42, and 2.69 mol/m2/s respectively. The least photosynthesis rate affected was the plant which applied with no treatment (2.31 mol/m2/s).

222

There were no significant different observed between 0 and 30 kg/ha of nitrogen fertilization rate (p≥0.05). The imposition of nitrogen rates also found to increase photosynthetic activity per unit leaf area. The result was also in agreement with Boussadia et al. (2009), where low nitrogen content inhibit the photosynthesis rate in olive plants. The nitrogen and photosynthesis activity is linked together because of the Calvin Cycle protein which represent the nitrogen in leaf. At lower N level, the rate of photosynthesis was low. This might be due to the greater resistance and low biochemical of chloroplast. According to Makino et al. (1992), the increase in rate of nitrogen leads to a greater N allocation to Rubisco. Rubisco is the primary CO2 for enzyme fixation where the amount of this enzyme can drastically affect the photosynthesis rate. Besides, high N is needed in Rubisco protein due to the low rate of catalysis in Rubisco (Makino, 2010). So, it can be concluded that, enhanced application of nitrogen would enhance rubisco production that enhanced the net photosynthesis of Ipomea aquatica that was observed in the present study.

4.50 a

/s) 4.00 2 b 3.50 3.00 c c 2.50 2.00

1.50

1.00 0.50 Photosynthesis Rate(umol/m 0.00 0 kg/ha 30 kg/ha 60 kg/ha 90 kg/ha Treatments

Figure 3: The impact of different nitrogen rates on the photosynthesis rate of Ipomea aquatica after 6 weeks of planting. Mean with the same letter indicates that all of the groups were not significantly different according to Duncan multiple range test (p ≥ 0.05) N=6.

Total Phenolics

Total plant phenolics contents was influenced with nitrogen fertilization at 4 WAT (P<0,05; Figure 4). As levels of nitrogen enhanced the nitrogen content was enhanced by 2.94 %, 1.38 % and 0.83 % respectively in 30,60 and 90 kg N/ha compared to the control (0 kg N/ha). The highest measurement of total phenolics in kangkung was observed under 30 kg/ha of nitrogen treatment at 2.94 mg/g GAE and lowest in 90 kg/ha that recorded at 0.83 mg/g GAE. Another result obtained by Stewart et al. (2001) on tomato leaf, also prove that the phenolic content increased as the plant faced deficiency in nitrogen level. According to Nori et al. (2012), the TPC was reduced as the nitrogen rate of fertilization increased.The result obtained in this study suggested that at 30 kg N/ha is the best rate for the production of phenolics in Ipomea aquatica since the TPC observed to be at the highest.

223

According to William et al. (2012), when a plant undergoes N deficiency, the process of distributing carbon-based secondary compounds will increase, thus, decreasing the synthesis of nitrogen-based secondary compounds. Besides, Ibrahim et al. (2011) stated that the increased in TPC under low N level also might be due to the improving of total carbohydrate structural production.

3.50 a

3.00

2.50

2.00

Weight) b 1.50 bc c 1.00

Dry GAE/g (Mg Phenolics Total 0.50

0.00 0 kg/ha 30 kg/ha 60 kg/ha 90 kg/ha Treatments

Figure 4: The impact of different nitrogen rates on the total phenolics of Ipomea aquatica after 6 weeks of planting. Mean with the same letter indicates that all of the groups were not significantly different according to Duncan multiple range test (p ≥ 0.05) N=6.

Conclusion It was found that as the nitrogen rates increased, it also positively influenced the growth, leaf gas exchange and also the total phenolics and flavonoids of. High application of N on I. aquatica had enhanced most of the growth parameters being studied including the plant height, stem diameter and number, leaves number, fresh and the dry weight and chlorophyll content. Similar results were obtained in the leaf gas exchange parameters where the rate of photosynthesis and transpiration and stomatal conductance increased as the nitrogen rate reaching 90 kg/ha. While as for WUE, it was observed to be decreased as nitrogen rates increased from 0>90 kg N/ha. Both total phenolics and flavonoids reached optimum content at 30 N kg/ha.

224

References Bojoviæ, B., & Markoviæ, A. (2009). Correlation Between Nitrogen and Chlorophyll Content In Wheat (Triticum aestivum L.). Kragujevac Journal of Science, 3, 69-74.

Boussadia, K., Steppe, K., Labeke, M.-C., Lemeur, R., & Braham, M. (2015). Effects of Nitrogen Deficiency on Leaf Chlorophyll Fluorescence Parameters in Two Olive Tree Cultivars ;MEski' and 'Koroneiki'. Journal of Plant Nutrition, 2230-2246.

Ibrahim, M., Jaafar, H., Rahmant , A., & Rahman, Z. (2011). Effects of Nitrogen fertilization on synthesis of primary and secondary metabolites in three varieties of kacip Fatimah (Labisia pumila blume). International Journal of Molecular Sciences,12(8), 5238-5254.

Jabatan Pertanian Malaysia (2010). Statistical Book of Agriculture. Li, J., Zhu, Z., & Gerend´as, J. (2008). Effects of nitrogen and sulfur on total phenolics and antioxidant activity in two genotypes of leaf mustard. Journal of Plant Nutrition, 31, 1642- 1655.

Makino, A. (2011 ). Photosynthesis, Grain Yield, and Nitrogen Utilization in Rice and Wheat. Plant Physiology, 155, 125-129.

Makino, A., Sakashita, H., Hidema, J., Mae, T., Ojima, K., & Osmond, B. (1992). Distinctive responses of ribulose-1,5-bisphosphate carboxylase and carbonic anhydrase in wheat leaves to nitrogen nutrition and their possible relationships to CO2 transfer resistance. Plant Physiology, 100, 1737-1743.

Nashrin, S., Farooque, A., Siddiqua, M., Rahman, M., & Khanam, M. (2002). Effect of nitrogen and spacing on the growth and yield of gimakalmi, Ipomea reptans poi . Journal of Biological Sciences, 170-174.

Nori, M., Bayat, F., & Esmaeili, A. (2012). Changes of vegetative growth indices and yield of garlic (Allium sativum L.) in different sources and levels of nitrogen fertilizer. International Journal of Agriculture and Crop Sciences, 1394-1400.

Sarkar, R., Jana, J., & Datta, S. (2014). Effect of cutting frequencies and nitrogen levels yield and quality of water spinach (Ipomoea reptans Poir.). Journal of Applied and Natural Science, 545-551.

Susila, A., Prasetyo, T., & Palada, M. (2008). Optimum Fertilizer rate for kangkong (Ipomoea reptans L.) Production in Ultisols Nanggung.

225

5.3 Morphological, physicochemical and functional properties of cattail (Typha angustifolia L.) starch

Summary Typha angustifolia L. known as a narrow-leaved cattail is an emergent aquatic plants inhabiting in lakes, ponds and slightly brackish marshes. Typha angustifolia rhizome and pollen are edible with starch content of 66.02% and 7.02% respectively, and widely used in food formulation in the form of starch flour. Though it has been traditionally consumed by rural communities, studies on T. angustifolia starch properties and structural characteristics are still limited. Thus, the aims of the present study are to investigate the morphological, physicochemical and functional characteristics of starch extracted from T. angustifolia rhizome and pollen. Morphologically, starch granules of rhizome and pollen were oval and round in shape with centric hilum, and possessed size range of 1.77-10.0 µm and 0.4-4.0 µm respectively. Rhizome starch contained lower amylose (13.51%) compared to pollen starch (36.47%). The higher amylose content in pollen resulted in high gelatinization enthalpy (18.66 Jg-1) compared to rhizome (3.85 Jg-1). Chemical composition showed that protein and phosphorus content in pollen (15.70% and 0.1% respectively) was higher compared to rhizome protein and phosphorus content (4.86% and 0.09% respectively), whereas lipid content was comparable ranging from 3.0 to 4.2%. X-ray diffraction analysis indicated that rhizome and pollen starches are of B-type starch with peaks displayed at 17°, 20° and 24° 2θ. Rhizome’s starch developed higher paste viscosity (8.03 mPas) compared to pollen starch (3.2 mPas). The findings obtained from this present assessment may be used as a guideline on the usage of cattail rhizome and pollen starches in food formulation.

Keywords: Typha angustifolia; Pollen; Rhizome; Starch Morphology; Functional Properties

Introduction

Typha angustifolia L. known as narrow-leaved cattail or bulrush is a perennial aquatic macrophytes with an erect rhizomatous and emerged leaves bearing a separated male (above) and female (below) flowers. Several parts of T. angustifolia are edible, including young shoot which are eaten as vegetables, whereas rhizome and ripe pollen are dried and ground into powder as soup thickener and additive to flour in making biscuit, bread, cakes, pies and porridge (Shukla et al., 2013). Furthermore cattail pollens are usually consumed as confectionery (mixed with honey) and also for colouring rice yellow by local communities of Gran Chaco, South America (Arenas & Scarpa, 2003). Kurzawska et al. (2014) reported that total starch and amylose content of T. latifolia is 70% and 32% respectively with predominantly round shaped starch granules (9-15 µm), whereas approximately 6.7% starch yielded from fresh T. latifolia pollen with ellipsoid granules (Iwata, Funagama, & Hara, 1989). Typha latifolia rhizomes was observed with A- and B- type crystalline (Kurzawska et al., 2014) while its pollen displayed A- type crystalline (Iwata et al., 1989). Starch is the major storage components in plants, have distinct and special properties, which is widely used as functional component in food formulations. The growing demand for the starches in the food industry has created interest in alternative newer starch sources (Gani, Massodi, & Wani, 2013) from under-utilised plants that produce starch.

226

Although starch flours from rhizome and pollen of cattails has been consumed by native people around North American, Bosnians, Sahara, Herzegovina, Germans and Chinese (Kurzawska et al., 2014), its starch characteristic and functionality are not well studied. Thus the objective of this present research was to determine the morphological, physicochemical and functional properties of starches isolated from T. angustifolia’s pollen and rhizome.

Materials and Methods Isolation of native starch One (1) kg rhizome and 50 g pollen of T. angustifolia were collected at saline marshes of Pantai Sri Tujuh, Tumpat, Kelantan, followed by cleaned and labelled. The male flower spike of cattail were placed into zip lock plastic bag and the flower spikes were shaken to dislodge the yellowish pollens. Native starches of rhizome and pollen were isolated following the method of Kurzawska et al. (2014).

Morphological properties Approximately 0.2 mg starch powder was stained with 0.25% Lugol’s solution and observed under compound light microscope (DM 750, Leica Microsystem, Wetzlar, Germany) equipped with polarized filter and analyser. Images of starch granules with birefringence were captured. Detailed structure of starch granules were examined with scanning electron microscope Jeol JSM-6400 (Jeol Ltd., Tokyo, Japan).

Physicochemical properties Total starch and amylose were determined using the Megazyme assay kit (Megazyme International Ireland Ltd., Bray, Ireland). Protein, Lipid and phosphorus content were determined according to the official method of AOAC International (2005).

Functional properties The degree of crystallinity of starches were quantitatively estimated and analyzed through 2θ of 5°-45° using X-ray diffractograms (Xpert Pro MPD, Philips, Netherlands). Thermal properties of starches were obtained using differential scanning calorimeter, DSC (Model- 823e, Mettler-Toledo, Switzerland) from 25 to 120°C at the rate of 10°C/min. Rheological properties of starches suspended in distilled water were determined using Rotational rheometer (C-DG26.7/QC, RheolabQC, Anton Par Ltd, Germany), following the method by Chrungoo and Devi (2015).

Statistical analysis Mean, standard deviation and range were computed for triplicated determination. Data for morphological, physicochemical and thermal properties were statistically analysed using SPSS 16.0 Statistical Software Program. Means were compared using independent sample T-Test and Levene’s Test was performed for equality of variances. Principal component analysis (PCA) XLSTAT software version 2013.5 (Addinsoft, New York, USA) was performed to obtain the similarities or differences of physiochemical properties of Typha starches compared to other plants’ starches.

227

Results and Discussion Morphological properties Starch granules isolated from cattail pollen and rhizome were viewed under polarized light and SEM (Figure 1). The starch granules of both pollen and rhizome were smooth in structure. Pollen starch granules had round and oval starch while rhizome starch granules were predominantly ellipsoidal. Both starch granules were compound starch and displayed distinct Maltese cross centred at the hilum. Cattail rhizome had significantly larger (p<0.05) starch granules with mean size of 4.69 µm (range 1.77-10.0 µm) compared to pollen with mean size of 2.09 µm (range 0.4-4.0 µm). Both starch granules were under the category of small starch granules (<10 µm) in the same group of starches from rice, cow cockle, taro, amaranth, pigweed and quinoa. Small starch granules are easily digested and had advantages as a fat substitute, filler for thinner degradable plastic film, dusting and laundry- stiffening agents and also stabilizer in baking powder (Jane, Shen, Wang, & Maningat, 1992).

Figure 1: Starches from of pollen and rhizome of Typha angustifolia. (a) Cattail inflorescence, (b) starch granules of pollen under polarized filter, (c) starch granules of pollen under SEM, (d) cattail rhizome, (e) starch granules from cattail rhizome under polarized filter and (f) starch granules of rhizome under SEM.

228

Physicochemical properties Cattail rhizome had significantly higher (p<0.05) total starch (66.02%) compared to pollen (7.02%), whereas high (p<0.05) amylose was observed in pollen (36.47%) compared to its rhizome starch (13.51%) (Table 1). Based on amylose classification (waxy, <15%; regular, 20-35%; and high amylose starch, >40%) reported by Tester, Karkalas, and Qi (2004), cattail rhizome starch was categorised as waxy starch while pollen cattails as regular starch. In food formulation pollen with regular starch will produce firmer dough due to linear structure of amylose which increase the gel strength, whereas waxy starch of cattail rhizome resulted in stickier and softer textures (Cruz, Abraao, Lemos, & Nunes, 2013). Minor component of starches such as protein, lipids and phosphorus influenced the starch functional properties. Cattail pollen starch showed higher (p<0.05) value of protein (15.70%), whereas cattail rhizome showed comparable protein (4.86%) with taro (5.61%) and water chestnut (3.12%). Generally, 3 g or less protein are accumulated in single starch granule, where higher protein would cause effect like easier to foam, browning and mealy flavour formation (Mishra & Rai, 2006). Both starches of cattail pollen and rhizome showed high lipid content (3.23% and 3.87% respectively) which was slightly lower than wheat starch (4.1%). Copeland, Blazek, Salman, and Tang (1999) reported that lipid in cereal starches occurred on surface and internal granules, which are linked freely with hydroxyl groups and also bound with amylose forming amylose inclusion complexes. This explained that higher lipid tend to increase the amylose content. Morisson (1998) also reported that smaller granules as cattails starch possessed high lipid due to greater surface to volume ratio. Excessive lipid contents can cause lipid oxidation which later produce undesirable off flavours. Phosphorus content of <0.1% in cattail starches were comparable with others commercial, e.g. potato, rice, maize, cassava and wheat and aquatic macrophytes, e.g., water caltrop starches.

229

Table 1: Physicochemical properties of Typha angustifolia starches and previous studies of aquatic macrophytes and commercial starches No Species Total Amylose Protein Lipid Phosphorus starch (%) (%) (%) (%) (%) 1 T. 7.02±0. 36.47±0. 15.70±0. 3.23±0 0.10±0.01 angustifoli 10 84 24 .21 a pollen 2 T. 66.02± 13.51±0. 4.86±0.8 3.87±0 0.09±0.10 angustifoli 2.91 19 9 .28 a rhizome Aquatic macrophyte starch 3 Colocasia 99.7 23.35 5.61 0.22 0.41 esculenta (Taro) 4 Eleocharis 91.85 41 3.12 1.04 0.19 dulcis (Water chestnut) 5 Nelumbo 20 30.61 0.16 0.07 nd nucifera rhizome (Lotus) 6 N. nucifera 55.7 40.2 0.45 nd nd seed 7 Cyperus 89.81 16.18 0.53 0.42 nd esculentus (Tiger nut) 8 T. 98.18 47.1 0.11 nd 0.07 bispinosa (Water caltrop) Commercial starch 9 Oryza 89.8 0.6 7.6 0.3 0.02 sativa (Rice) 10 Triticum 75.4 21 0.4 4.1 0.06 aestivum (Wheat) 11 Zea mays 89.27 25.6 0.35 0.7 0.02 (Maize) 12 Manihot 90.99 16.27 0.1 0.1 0.01 esculenta (Cassava) 13 Solanum 89.44 24.95 0.05 0.05 0.08 tuberosum (Potato) Data are expressed as mean values of n=3 determination ± standard deviation for present study. No. 1-2: Present study, No. 3: Himeda et al. (2012), No.4: Rujirapisit (2005), No.5-6: Man et al. (2012) and, Geng, Zongdao, & Yimin (2007), No. 7: Jing, Yan, Ouyang, Xiang, & Ren (2012), No. 8: Tulyathan, Boondee, & Mahawanich (2004). No 9-10: Gibson, Solah, & McCleary (1997) and No.11-13: Mishra & Rai (2006). Nd: not defined.

230

Based on ordination with PCA (Figure 2), the two, F1 and F2 for the starch accounted for 85.50% of total variance. All the variables examined were well segregated on the F1 and F2 in four groups. Cattail rhizome starch was grouped with water chestnut, taro and tiger nut and most of the commercial starches except rice in Group 1. This is due to the high total starch content ranged from 66.02% to 99.7%. Seed and rhizome of lotus starches in Group 2 represented higher amylose content, whereas the cattail pollen starch in Group 3 (negative F1 and F2) due to low amylose and total starch contents. Rice was solely grouped in Group 4 due to high total starch and low amylose content.

Figure 2: Biplot of total starch, amylose and protein content of native starch of T. angustifolia (■), previous studies of aquatic macrophytes starches (●) and commercial starches (▲).

Functional properties Functional properties of starches were investigated when the starch undergoes gelatinization and retrogradation during heating process. The present results (Figure 3) indicated that pollen and rhizome starches are under the category of B-type starch with peaks displayed at 17°, 20° and 24° 2θ. Zobel (1988) reported that B-type crystallinity was mainly for starches in rhizomes and tubers, consisted longer branches of amylopectin chains in loosely structure which resulted in low crystallinity index. Lower relative crystallinity of pollen starch (2.52%) compared to rhizome starch (6.40%) resulted in higher (p<0.05) gelatinization enthalpy of pollen starch (18.66 Jg-1) as closely ordered structure (less water) needed more energy to cleave the structures (Table 2). Furthermore cattail rhizome starch was observed to require higher temperature (96.02°C) in order to alter all the granules to be in paste solution compared to rhizome starch. When native starch is heated, granules started to swell and leaching of amylose caused viscosity of the solution to increase. On the other hand, melting of helices within the starch amylopectin started to interact with amylose chains which can reduced the paste viscosity (Copeland et al., 1999). These explained low viscosity of cattail pollen starch (8-8.1 mPas) as high amount of amylopectin that yielded the viscosity and produced slimy paste.

231

Figure 3: X-ray diffraction patterns of T. angustifolia pollen and rhizome starches obtained by laser diffraction. Table 2: Functional properties of Typha angustifolia starches Species/ X-ray Thermal Viscosity (mPas)/shear stress (Pa) functional diffraction properties propertie Relative Tp ΔHgel 1st 2nd 3rd s crystallini (°C) (Jg-1) rotation rotation rotation ty (%) T. 2.52 74.62± 18.66 3.2/4.93 3.0/4.68 2.9/4.45 angustifoli 0.01 ±0.01 a (pollen) T. 6.40 96.02± 3.85± 8.0/12.3 8.1/12.5 8.0/12.8 angustifoli 0.01 0.01 7 3 9 a (rhizome) Data are expressed as mean values of n=3 determination ± standard deviation for present study. Tp: peak temperature, ΔHgel: gelatinization enthalpy.

Conclusion Both starches isolated from pollen and rhizome cattail give promising potential to be used in food formulation. Although low starch was observed in cattail pollen, its high amylose promotes beneficial in human health which can reduced insulin level and blood glucose. High amount of starch minor components (protein and lipid) indicated that the starch extracted were less pure which will resulted in unfavorable effects. Thus isolation method of these starches need to be improved in order to obtain the purest starch. In addition higher amylose content of cattail pollen resulted in higher gelatinization enthalpy and lower viscosity and vice versa. These functional properties of cattail native starch are important in order for the starch to be altered chemically and physically according to the preferred products.

232

Acknowledgments This research was funded and supported by Japan Society for the Promotion of Science (JSPS), Core-to-Core Program Research and Education Network on Coastal Ecosystems in Southeast Asia (CCore-RENSEA) and Industry Grant, Country Garden Pacific View under research of Seagrass Transplanting and Rehabilitation (Assisted Recovery).

References AOAC (2005). Official Methods of Analysis, Vol. 4 (18th Ed.). Arlington, VA: Association of Official Analytical Chemists. Arenas, P., & Scarpa, G. F. (2003). The consumption of Typha domingensis Pers. (Typhaceae) pollen among the ethnic groups of the Gran Chaco, South America. Economic Botany, 57(2), 181-188. Chrungoo, N. K., & Devi, A. G. (2015). Morphological and rheological properties of starches separated from cultivars of rice (Oryza sativa L.) from North East India. American Journal of Plant Sciences, 6(12), 2019-2031. Copeland, L., Blazek, J., Salman, H., & Tang, M. C. (2009). Form and functionality of starch. Food hydrocolloids, 23(6), 1527-1534. Cruz, B. R., Abraao, A.S., Lemos, A. M., & Nunes, F. M. (2013). Chemical composition and functional properties of native chestnut starch (Castanea sativa Mill). Carbohydrate Polymer, 94, 594-602. Gani, A., Masoodi, F. A., & Wani, S. M. (2013). Characterization of lotus stem (Nelumbo nucifera) starches purified from three lakes of India. Journal of Aquatic Food Product Technology, 22(6), 605-618. Geng, Z., Zongdao, C., & Yimin, W. (2007). Physicochemical properties of lotus (Nelumbo nucifera Gaertn.) and kudzu (Pueraria hirsute Matsum.) starches. International Journal of Food Science & Technology, 42(12), 1449-1455. Gibson, T. S., Solah, V. A., & McCleary, B. V. (1997). A procedure to measure amylose in cereal starches and flours with concanavalin A. Journal of Cereal Science, 25(2): 111-119. Himeda, M., Njintang, N., Nguimbou, R., Gaiani, C., Scher, J., Facho, B., & Mbofung, C. (2012). Physicochemical, rheological and thermal properties of taro (Colocassia esculenta) starch harvested at different maturity stages. International Journal of Biosciences, 2(3), 14-27. Iwata, T., Funaguma, T., & Hara, A. (1989). Starch granules and phoshorylases from pollens. Japanese Journal of Pharmacognosy, 35(1), 21-29. Jane, J. L., Shen, L., Wang, L., & Maningat, C. C. (1992). Preparation and properties of small- particle corn starch. Cereal Chemistry, 69(3), 280-283. Jing, S., Yan, X., Ouyang, W., Xiang, H., & Ren, Z. (2012). Study on properties of Cyperus esculentus starch grown in Xinjiang, China. Starch‐Stärke, 64(8), 581-589. Kurzawska, A., Górecka, D., Błaszczak, W., Szwengiel, A., Paukszta, D., & Lewandowicz, G. (2014). The molecular and supermolecular structure of common cattail (Typha latifolia) starch. Starch‐Stärke, 66(9-10), 849-856.

233

Man, J., Cai, J., Cai, C., Xu, B., Huai, H., & Wei, C. (2012). Comparison of physicochemical properties of starches from seed and rhizome of lotus. Carbohydrate Polymers, 88(2), 676- 683. Mishra, S, & Rai, T. (2006). Morphological and functional properties of corn, potato and tapioca starches. Food Hydrocolloids, 20, 557-566. Morrison, W. R., & Laignelet, B. (1983). An improved colorimetric procedure for determining apparent and total amylose in cereal and other starches. Journal of Cereal Science, 1(1), 9-20. Rujirapisit, P. (2005). Chemical composition and some physicochemical properties of Chinese water chestnut (Eleocharis dulcis Trin.) flour and starch. In National Science and Technology Development Agency (Eds.), Proceeding of Starch Update 2005: The 3rd Conference on Starch Technology, Bangkok, Thailand: Genencor International Inc. Retrieved from http://vlib.stkc.go.th/handle/023333700/735 Shukla, R., Srivastava, S., Dwivedi, P. K., Sarkar, S., Gupta, S., & Mishra, A. (2013). Preliminary pharmacognostical and phytochemical investigations on the various part of Typha angustifolia. International Journal of Biological & Pharmaceutical Research, 4(1), 19-22. Tester, R. F., Karkalas, J., & Qi, X. (2004) Starch-composition, fine structure and architecture. Journal of Cereal Science, 39, 151-165. Tulyathan, V., Boondee, K., & Mahawanich, T. (2005). Characteristics of starch from water chestnut (Trapa bispinosa Roxb.). Journal of Food Biochemistry, 29(4), 337-348. Zobel, H. F. (1988). Molecules to granules: a comprehensive starch review. Starch‐Stärke, 40(2), 44-50.

234

5.4 Morphological changes and nutrients enrichment on Halophila ovalis (R.Br.) Hooker f. and Halophila beccarii Aschers. (Hydrocharitaceae) under laboratory condition

Summary Culturing seagrass under confine system for long period caused the depletion of important nutrients vital for plant growth. Two fast-growing seagrass species, Halophila ovalis and H. beccarii were cultured for four weeks in a state of nutrient depression, before selected treatments were applied (i) 20 grams of solid fertilizer, e.g., T1: N:P:K (15:15:15) granules and T2: organic tablet for lotus fertilizer and (ii) 1 gram of soluble fertilizer, e.g., T3: sodium nitrite (NaNO2) and T4: ammonium chloride (NH4Cl) per tank (120 cm x 45 cm x 45 cm). Observations were recorded by measuring morphometric changes after eight weeks of T1- T4 treatments. Changes on selected available nutrients in the water were also recorded and data were analyzed by using one-way ANOVA. Both plant species showed varied morphology responses with different treatments applied, and their morphology showed a significant improvement under treatments T2 and T4, i.e., H. ovalis produced longer leaf length (24.23±1.52 mm and 17.58±074 mm), wider leaf width (11.39±0.88 mm and 8.18±0.83 mm), longer petiole length (25.34±2.54 mm and 22.60±2.12 mm) and higher number of paired cross veins (16.40±1.12 no. and 11.81±0.87). Similarly, H. beccarii produced longer leaf length (7.52±0.98 mm and 8.58±0.72 mm), wider leaf width (1.97±0.31mm and 2.07±0.23 mm), longer petiole length (9.96±1.29 mm and 11.43±0.78 mm) and a higher number of leaf per shoot (6.60±0.73 and 5.60±0.50) respectively. The study showed nutrients such ammonia and phosphate availability in water column were correlated with seagrass growth and were expressed through morphological response.

Keywords: Seagrass; Culture; Morphology; Selected Nutrient

Introduction

Seagrasses cultured u n d e r laboratory conditions for long period with limited nutrient cycles, t e n d t o develop an oligotrophic (low nutrient) conditions especially the essential elements for plant growth, e.g., nitrogen (N) and phosphate (P), will a f f e c t seagrass growth development (Romero, Lee, Perez, Mateo & Alcoverro, 2006). The plant's responses to nutrient enrichment were observable through their morphology changes (Rohani, Dmitry, & Schneider, 2011), e.g., plant developed narrowed leaves in stressful condition (low nutrient) and vice versa (Phillips, 1980). Those nutrients deployment can be either done through sediments or water column enrichment (Nielsen, Koch, Jensen, & Madden, 2006). The available nutrients fluctuation for plant, e.g., + - - 3- ammonia (NH4 ), nitrate (NO3 ) and nitrite (NO2 ), and phosphate (PO4 ) c a n b e measured from the water column (Lee, Park, & Kim, 2007). The plants under genus Halophila were known for fast growth rate especially for Halophila ovalis (Vermaat et al., 1995), thus sustaining them for long period of time under enclosed ecosystem required nutrient supplements for ensuring their sustainability. Thus, the objective of this study was to evaluate the responses of Malaysian seagrasses, H. ovalis and H. beccarii to the different nutrient enrichment under enclosed system or laboratory conditions.

235

Material and Methods

Halophila ovalis and H. beccarii were collected from Punang-Sari-Lawas river estuary, Sarawak, East Malaysia. The plants from each species were cultured in four plastic trays and placed in separate aquarium tanks (Figure 1a). For both plant species, three ramets of similar-sized consisting 3-4 shoots with intact leaves were grown in washed coarse sand (70% sand grain >0.50 mm) as substrate. Selected morphometric parameters (Figures 1b and 1c), were recorded after eight weeks. The plants were subjected to four (TX) nutrient treatments (i) solid fertilizer e.g., T1: 20 g of N:P:K (15:15:15) granule –growing inducer K&G®; T2: 20 g of organic tablet for lotus (Highland Rim Pond Plant Fertilizer Tabs 10-26- 10 contain, organics, seaweed extract, plants extract, humates, mycorrhizae, humus, copper Free and safe for fish and aquatic life) and soluble fertilizer, e.g., T3: 1 g of sodium nitrite (NaNO2) and T4: 1 g of ammonium chloride (NH4Cl). The plants in control tank (T5) received no fertilizer enrichment.

Water filter (a)

Fixed 20 cm 25 psu (fixed water salinity) water level Air 45 cm pump

45 cm

Tray 1 Tray 2 Tray 3 Tray 4 4-6 cm thick of substrate 120 cm

(b) (c) CV LW LW NS

L LL PL L PL 2 3 2 4 1 1 3 1 cm 2 cm

Figure 1: (a) Aquarium tank setup used for growing seagrass species, Halophila ovalis and H. beccarii, and selected morphology measured, i.e., (LL) leaf length, (LW) leaf width, (PL) petiole length, (CV) no. of paired cross veins and (NS) no. of leaf per shoot only for H. beccarii for data analysis, (b) H. ovalis and (c) H. beccarii.

The morphometric changes after eight weeks observation.

The morphological changes on the leaf dimension and meristic characteristics were recorded. New shoots (a shoot in H. ovalis consists of paired leaves while a shoot in H. beccarii consists of an erect stem with rosette leaves) or shoot density per 10 cm2 was counted and recorded. The obtained data were analyzed by using ANOVA to investigate the effects of the nutrient treatments on morphometric changes. Fluctuations of nutrient in water, e.g., ammonia, nitrate, nitrite and phosphate were monitored every two weeks using Hach Kit (DR/2400 Portable Spectrophotometer).

236

The other water parameters; i.e., the salinity of 25, light availability 66.66-83.33 mol/m2/sec (11.00 am – 2.00 pm) and water clarity 1-10 NTU were maintained throughout the experimental period. Changes on morphological variability and nutrient fluctuation in water were then analyzed using BV-STEP procedure using PRIMER 5 statistical software (Clarke and Warwick, 1998).

Results and Discussion

Survival and morphometric changes

Both plants species showed no mortality after eight weeks. The plants continue to grow and propagated new shoots (Figure 2). For solid fertilizer treatments, H. ovalis produced denser shoot density in T2 (organic tablet, 13.60±5.60 per 10 cm2) compared to plants grown under treatment T1 (N:P:K, 15:15:15 granule). Halophila beccarii p r o d u c e d significantly higher shoot density under both T2 (15.00±2.89 per 10 cm2) and T1 (16.87±5.93 per 10 cm2) (Figure 3a). For soluble fertilizer treatments, H. ovalis under treatment T4 (ammonium chloride, NH4Cl) was shown to produce a significantly higher (p<0.05) shoot density (14.33±3.88 per 10 cm2) than under treatment T3 (sodium nitrite, NaNO2, 8.00±2.88 per 10 cm2). In contrast, there were no significant differences (p>0.05) in shoot density of H. beccarii u nder treatments T4 and T3 (Figure 3b).

Figure 2: The plant growth and development after eight weeks in laboratory (a) H. ovalis and (b) H. beccarii.

237

(a) (b)

25 25 a 16.87 T1 T3 T2 15.72a 17.20a T4 T5 a T5 2 20 13.60 2 20 a 15.00a 14.33

15 15 8.14b 8.00b

10 10

c c 4.20 4.20 b 3.60b 3.60

Mean no. of 10 cm per Mean shoot 5 no. of 10 cm per Mean shoot 5

0 0 Halophila ovalis Halophila beccarii Halophila ovalis Halophila beccarii Solid fertilizers Soluble fertilizers Figure 3: Shoot density for both plant species after enrichment with (a) solid fertilizer and (b) soluble nutrient fertilizer. All values are mean±s.d. Means with the same alphabet at the same pattern bar are not significantly different (DNMRT, p>0.05).

Both plants species morphological responses and changes are presented in Figures 4 and 5. Under solid fertilizer treatments, H. ovalis under T2 possessed significantly longer leaf length (24.23±1.52 mm), wider leaf width (11.39±0.88 mm), longer petiole length (25.34±2.54 mm) and a higher number of paired cross veins (16.40±1.12) (Figure 4a). Similar responses were also recorded in H. beccarii, where the plant possessed wider leaf width (1.97±0.31 mm), longer petiole length (9.96±1.29 mm) and a higher number of leaf per shoot (6.60±0.73) (Figure 4b).

Treatments using soluble fertilizer, e.g., under T4 significantly improved the plant morphological growth in both H. ovalis and H. beccarii. The plants produced longer leaf length (17.58±0.74 mm and 8.58±0.72 mm), wider leaf width (8.18±0.83 mm and 2.07±0.23 mm) and longer petiole length (22.60±2.12 mm and 11.43±0.78 mm), a higher number of paired cross veins (11.81±0.87) and number of leaf per shoot (5.60±0.50) respectively (Figure 5), compared to H. ovalis (LL 10.18±0.78 mm, LW 4.77±0.38 mm, PL 9.89±1.39 mm and CV 7.71±0.91) and H. beccarii (LL 5.56±0.51 mm, LW 1.48±0.28 mm, PL 788±0.75 mm and NS 4.65±0.61) under treatment T5.

(a) (b)

30 30 14 14 a 25.34 Leaf length (mm) a 24.23 Leaf length (mm) Leaf width (mm) a 12 9.96 12 25 Leaf width (mm) 25 Petiole length (mm) Petiole length (mm) Leaf per shoot (no.) Paired cross veins (no.) 10 b b 10 8.27 7.85 20 20 a a 7.52 16.40 a 6.88 a 8 6.60 8 b 15 15 5.80 b a 5.56 11.39 c b b b 6 4.66 6 10.24 10.15 9.89 b b 9.01 b 9.71 10 9.00 10 4 4

Mean length / width (mm) width / length Mean

Mean length / width (mm) width / length Mean

b a (no.) shoot per leaf of no. Mean 4.59 b 1.97 4.77 b b 5 5 1.60 1.48

Mean no. of paired cross veins (no.) veins cross paired of no. Mean 2 2

0 0 0 0 N:P:K (T1) Organic tablet (T2) Control (T5) N:P:K (T1) Organic tablet (T2) Control (T5)

Halophila ovalis Halophila beccarii

Figure 4: Morphological responses to solid fertilizer enrichment in (a) H. ovalis and (b) H. beccarii. All values are (mean±s.d.). Means with the same alphabet for the same pattern bar are not significantly different (DNMRT, p>0.05).

238

(b) (a)

30 30 14 14 Leaf length (mm) Leaf length (mm) 11.43a Leaf width (mm) Leaf width (mm) 22.60a 12 12 25 Petiole length (mm) 25 Petiole length (mm) Paired cross veins (no.) Leaf per shoot (no.)

10 8.58a 10 7.85b 20 17.58a 20 7.69b

b 8 b 8 14.42 14.03b 6.42 15 15 a 5.60 c 11.81a 5.56 b c 6 6 10.83 c 9.89 b 4.66b 10.15 9.71c 4.33 10 8.18a 10 6.52b 4 4

Mean Mean length / (mm)width

Mean Mean length / (mm)width c a 4.77 b 2.07 1.54 Mean no. of leaf per shoot (no.) 5 5 2 1.48b 2

Mean Mean no. of paired cross veins (no.)

0 0 0 0 Sodium nitrite (T3) Ammonium chloride (T4) Control (T5) Sodium nitrite (T3) Ammonium chloride (T4) Control (T5) Halophila ovalis Halophila beccarii Figure 5: Morphological responses to soluble solid fertilizer enrichment in (a) H. ovalis and (b) H. beccarii. All values are (mean±s.d.). Means with the same alphabet for the same pattern bar are not significantly different (DNMRT, p>0.05).

Nutrient correlation with morphometric changes The relationships between the available nutrients in the water and the morphology changes were explained by Multivariate nonparametric procedure BV-STEP in PRIMER- E. As a guideline, the correlations are given as Spearman rank correlation by (p) values, i.e., perfect (+1), no correlation (0) and negative (-1) correlations. The correlations were determined from the strength of (p) value evaluated and assigned as < 0.33 as weak, 0.34 to 0.66 as medium and >0.67 as strong correlations. Therefore, from BY-STEP procedure, under treatment T2 H. ovalis morphology responses showed weak correlation (p=0.031) with the nitrite fluctuation (Figure 6a). In contrast, H. beccarii showed a strong correlation (p=0.725) with phosphate fluctuation (Figure 6b). Although, in both culture water column showed only low nutrient fluctuation, the significant in morphology improvement in plant species could not be fully explained. The morphology changes must have related to other factor as seagrasses were known to able utilize nutrient in organic matter such urea and amino acid which (T2) organic tablet contains (Vonk, Middleburg, Stapel, & Bouma, 2008).

Whereas in treatment T4, H. ovalis morphology changes showed weak correlation (p=0.261) with the ammonia (Figure 6c). Halophila beccarii showed a weak positive correlation (p=0.307) with the combination of phosphate, ammonia and nitrite (Figure 6d). The difficulties to correlated nutrients in seagrasses are also observed by others (e.g., Worm and Reusch, 2000). In seagrass nitrate need to be reduced to nitrite before being absorbed and assimilated into their tissues. Reduction from nitrate to nitrite need reductase enzyme and which requires energy (Ferrario-Mery et al., 1997). Theoretically, sodium nitrite provides direct source of nitrite to seagrass plants.

239

(a) 5 (b) 5 Nitrite (NO - N) Phosphate (PO 3-) 2 4

4 4

3 3

2 2

1 1

Applicationoffertilizer

Applicationoffertilizer

Meannutrient content in (mg/L) water 0 0

(c) (d) 5 5 3- Phosphate (PO4 ) Ammonia (NH4- N) Ammonia (NH4- N) 4 4 Nitrite (NO3-N)

3 3

2 2

1 1

Meannutrient content in (mg/L) water 0 0

Mean nutrients content in water (mg/L) water in content nutrients Mean

Weeks Weeks Figure 6: The best nutrient combinations responsible and morphology responses under T2 and T4 enrichments for H. ovalis (a & c) and H. beccarii (b & d).

In a study by Lee and Dunton (1999), the morphology responses showed seagrasses were more favorable to nitrogen form of ammonia (NH4+) compared to nitrate-nitrite. In the natural habitat, increased in the nitrogen source will enhance the plant vegetative production and improve their morphology appearance (Kenworthy & Fosenca, 1992). As the seagrass was often observed growing under a low nutrient environment at natural habitat, they develop an ability to absorb the nutrients from the water column efficiently by leaves surface (Vonk et al., 2008). According to James and Dennison (1997), the combination of phosphate and nitrogen had a greater effect on plants morphology improvement compared to the nitrogen alone.

The nutrient availability in water is suitable to observe as an indicator on plants responsive, as seagrass exhibit effective ability to absorb nutrients from water column (Lee & Dunton, 1999). The nutrients effect from water column could be studied under laboratory, as seagrass morphological response to sediment nutrient availability is well documented, but less is known for effect of in situ water column nutrient availability on seagrass morphology (Lee et al., 2007). Beside the salinity range evaluation on seagrass, H. beccarii by Fakhrulddin, Japar Sidik, and Muta Harah (2013), this study on both H. ovalis and H. beccarii behavior responses to nutrient enrichment are important observation in propagation studies for long period of time under enclosed s y s t e m t h a t required nutrient supplements for ensuring their sustainability.

240

Conclusion

Halophila ovalis showed favorable growth and responses to organic tablet and ammonium chloride and observable through their morphometric improvement. In contrast, H. beccarii showed only favorable growth responses to ammonium chloride enrichment. From the experiment conducted, nutrients such as ammonia and phosphate mainly responsible for plants morphology improvement. However, a combination of other elements should be considered as it may be involved in plant behavior as shown by solid organic tablets fertilizer, e.g., humus, urea, amino acid, dissolved organic matter (DOM), types of nutrient delivery and favorable molecule size for absorption.

Acknowledgements This study was funded by the MOSTI, under the ScienceFund Priority Areas’ program entitled “Indoor and outdoor culture of tropical spoongrass, Halophila ovalis R. Brown. This study is also under and supported by Japan Society for the Promotion of Science (JSPS), Core-to-Core Program Research and Education Network on Coastal Ecosystems in Southeast Asia (CCore-RENSEA).

References

Clarke, K. R., & Warwick, R. M. (1998). Quantifying structural redundancy in ecological communities. Oecologia, 113, 278–289.

Fakhrulddin, I. M., Japar Sidik, B., & Muta Harah, Z. (2013). Halophila beccarii Aschers (Hydrocharitaceae) responses to different salinity gradient. Journal Fisheries & Aquatic Science, 8(3), 462-471.

Ferrario-Mery, S., Murchie, E., Hirel, B., Galtier, N., Quick, W. P., & Foyer, C. H. (1997). Manipulation of the pathways of sucrose biosynthesis and nitrogen assimilation in transformed p l a n t s to i m p r o v e d photosynthesis and productivity. In C. H. Foyer & W. P. Quick (Ed.), A molecular approach to p rimary metabolism in higher plants (pp. 125-153). London: Taylor & Francis.

Kenworthy, W. J., & Fonseca, M. S. (1992). The use of fertilizer to enhance growth of transplanted seagrasses Zostera marina L. and Halodule wrightii Aschers. Journal Experimental Marine Biology Ecology, 163, 141-161.

Lee, K.-S., & Dunton, K. H. (1999). Inorganic nitrogen acquisition in the seagrass Thalassia testudinum: development of a whole–plant nitrogen budget. Limnology Oceanography, 44, 1204-1215.

Lee, K.-S., Park, S. R., & Kim, T. K. (2007). Effect of irradiance, temperature and nutrients on growth dynamics of seagrasses: A review. Journal Experimental Marine Biology Ecology, 350, 144-175.

Nielsen, O. L., Koch, M. S., Jensen, H. S., & Madden, C. J. (2006). Thalassia testudinum phosphate uptake kinetics at low in situ concentrations using a 33P radioisotope technique. Limnology Oceanography, 51, 208-217.

Phillips, R. C. 1980. Phenology and taxonomy of seagrass. In R. C. Phillip & C. P., Macroy (Ed.), Handbook of Seagrass Biology: An Ecosystem Perspective (pp. 29-40). New York: Garland STPM Press.

241

Rohani, A-R., Dmitry, L. & Schneider, M. J., (2011). Heavy metal impact on growth and leaf asymmetry of seagrass, Halophila ovalis. Journal Environment Chemistry Ecotoxicity, 3(6), 149-159.

Romero, J., Lee K. S., Perez, M., Mateo, M. A., & Alcoverro, T. (2006). Nutrient dynamics in seagrass ecosystems. In A. W. D. Larkum, R. J. Orth, & C. M. Duarte (Ed.), Seagrasses: Biology, Ecology, and Conservation (pp.227-254). Dordrecht, Springer.

Vermaat, J. E., Agawin, N. S. R., Duarte, C. M., Fortes, M. D., Marba, N., & Uri, J. S. (1995). Meadow maintenance, growth, and productivity of a mixed Philippine seagrass bed. Journal Marine Ecology Progress Series, 124, 215-225.

Vonk, J. A., Middleburg, J. J., Stapel, J. & Bouma, T. J. ( 2008). Dissolved organic nitrogen uptake by seagrass. Limnology Oceanography, 53, 542-548.

Worm, B. & Reusch, T. V. H. (2000). Do nutrient availability and plant density limit seagrass colonization the Baltic Sea? Journal Marine Ecology Progress Series, 200, 159-166.

242

5.5 Lasiodiplodia theobromae, L. pseudotheobromae and Pseudofusicoccum adansoniae causing fruit rot disease of commercial fruits

Summary

Lasiodiplodia and Pseudofusicoccum species are among the important plant pathogens causing fruit rot, which is a threatening disease for some fruits. Information regarding fruit rot disease on commercial fruits in Malaysia is still inadequate; therefore, this study was conducted to examine the host range of Lasiodiplodia theobromae, Lasiodiplodia pseudotheobromae and Pseudofusicoccum adansoniae as the pathogens of fruit rot disease in mangoes towards selected commercial fruits. In this study, seven different fruit types namely banana, pear, apple, guava, mandarins, musk lime and sapodilla were chosen. All isolates of L. theobromae A1718, L. pseudotheobromae R1757 and P. adansoniae B1474 used in this study were originally isolated from fruit rot-infected mangoes. All tested isolates produced the symptoms of fruit rot disease in all fruits host except pear. This finding confirmed that L. theobromae, L. pseudotheobromae and P. adansoniae are also pathogenic to apple, guava, musk lime, mandarin and sapodilla with different disease severity. These results provide useful information that can be used to help in developing monitoring policies for the related fruits.

Keywords: Lasiodiplodia spp.; Pseudofusicoccum spp.; Fruit Rot Disease; Fruit

Introduction

Various vegetables and fruits crops grown in Malaysia are susceptible to one or more diseases. Fruits are generally exposed to various kinds of fungal disease that may attack during pre- and post-harvest phase. Necrotic and rotting are the common symptoms observed in either at the field or in markets, which reduce fruit production and marketability. Fruit crops such as banana (Musa acuminata), apple (Malus sp.), guava (Psidium guava Linn.), mandarin (Citrus reticulata Blanco), musk lime (Citrus microcarpa) and sapodilla (Manilkara zapota) are among the common fruits available in market of Peninsular Malaysia. Besides, their marketable value and use are significant and thus prone to be infected by a wide range of fungi causing fruit rot disease.

Generally, a plant becomes diseased due to susceptibility of host plant and disturbances brought by pathogens or environmental factors that result in changes of appearance, physiological process and decrease in yield compared to normal and healthy plants (Agrios, 2005). Between these three factors, diseases caused by pathogenic agents such as fungi, bacteria, viruses, viroid and nematodes are classified as infectious. Furthermore, they are more severe since the causal agent is an organism or non-organisms capable of reproducing and spreading from one susceptible host to another with or without the aid of vector. In addition, some of the pathogenic agents contribute to the pre- and post-harvest diseases on crops where both stages have their own significant impact on crop loss (Isaac et al., 2015).

Pre-harvest diseases are spoilages developed prior the process of harvesting, whereas post- harvest diseases are deterioration that occurred on crops during harvesting until consumption that includes handling, packaging, storing, transporting and marketing, leading them to be completely unmarketable. Although pre-harvest diseases on fruits are not widely known to give severe loss as post-harvest, wrong practices in handling can cause the diseases to seriously affect the quality of post-harvest and host range.

243

Besides, a good quality of fruit comparatively depends on certain practices carried out during pre-harvest fruits production (Isaac et al., 2015), while poor post-harvest handling can result in host range disease infection. Therefore, this study was conducted to examine the host range of L. theobromae, L. pseudotheobromae and P. adansoniae as the pathogens of fruit rot disease in mangoes towards selected commercial fruits.

Materials and Methods Three isolates used in this study known as A1718 (L. theobromae), R1757 (L. pseudotheobromae) and B1474 (P. adansoniae) were obtained from Mycology Laboratory, Department of Biology, Faculty of Science, Universiti Putra Malaysia. The species identification of all isolates were confirmed based on internal transcribe spacer (ITS) and beta tubulin (BT2) sequence analysis to cause fruit rot disease on mango fruit (Munirah, 2017). These isolates were revived from the stock culture and were cultured on potatoes dextrose agar (PDA). The culture plates were incubated for 5 days with 12 h photoperiod at 27±1°C.

There were seven different fruit types namely banana, pear, apple, guava, mandarins, musk lime and sapodilla were chosen due to their availability and marketability in the local market with some of them have been included as the commonly used fruits in Malaysian cuisine. Fruits with good quality, healthy and clean from any disease symptoms were obtained from Pasar Borong Selangor (2°59'6'' N, 101°40'15'' E). Species name and variety/cultivar/clone for each fruit are stated in Table 1.

Table 1: List of fruit used in host range test

No. Fruit Species Variety/Cultivar (clone) 1. Banana Musa acuminata Berangan 2. Pear Pyrus communis Green Anjou 3. Apple Malus sp. Red Delicious 4. Guava Psidium guava Linn. Seedless guava variety (Clone GU 15) 5. Mandarin Citrus reticulata Limau madu Blanco 6. Musk lime Citrus microcarpa LK1 7. Sapodilla Manokara sapota syn Subang (C63) Achras zapota Linn

All fruits obtained were surface sterilised with 10% Chlorox® and rinsed for two times with sterilised distilled water. The fruits were inoculated using non-wounded method by directly placing 5 mm diameter of colonised-mycelia plug on the mango surface following the method of Kouame et al. (2010) and Marques et al. (2013) with slight modifications for each type of fruit. The mycelia plug was taken from the edge of 5-days old fungal culture while the control fruits were inoculated using non-colonised PDA plug. All the inoculated fruits were incubated in covered containers at the same conditions of 27 ± 1°C in dark. All treatments were repeated twice in four replicates. After four days of inoculation, the fungal colonies from lesion were re-subcultured onto PDA and incubated for seven days. The isolated fungal were tentatively identified.

244

The test was conducted in a completely randomised design with four replicates per treatment (isolate) and one mango per replicate was arranged in this experiment. To compare the variation and significant of the disease severity index (DSI) distribution among isolates, the data were analysed using the Friedman Test of the non-parametric technique by the SPSS programme.

Results and Discussion

The commercial fruits (banana, pear, apple, guava, mandarin, musk lime and sapodilla) were selected because they are commonly available in Malaysian market and mostly used/consumed in Malaysian daily life and culture. Even though some of them were imported from other countries, probability for cross infection to occur with mango plants is high and can lead to a huge loss for fruit growers and sellers. Therefore, in this study, three isolates representing the most virulent fungal isolates for mango plant were inoculated into other fruits. Findings demonstrated that all three isolates were able to cause fruit rot symptoms in all types of fruits tested except for pear with variation in severity and disease progression.

Considered as plurivorous plant pathogen especially on woody plants of fruits, this study clearly presented that L. theobromae and related species often have the capacity to infect a wide diversity of hosts (Pillay et al., 2013). These include Acacia, Citrus, Gmelina, Coffea and Rosa species besides physic nut, papaya, cashew and grapevine for L. pseudotheobromae (Netto et al., 2016). Meanwhile for L. theobromae and P. adansoniae, there are various other hosts of economic importance that were reported to be associated with these fungi such as sugar beet, grapevine, walnut, maize, citrus, avocado, banana, barbados cherry, cashew, coconut palm, custard apple, guava, muskmelon, papaya, passion fruit, soursop and watermelon (Marques et al., 2013; Ismail et al., 2012).

Among all fruits tested, guava was observed as the most susceptible to all three isolates species especially for L. pseudotheobromae species by displaying disease symptoms starting from day one of inoculation followed by severe rot on day four of inoculation (Table 2). Apart from that, apple and sapodilla that produce higher DSI showed increasing disease progression towards the end of the day after inoculation. The faster and violent symptom development produced by these species had shown their aggressiveness and fast colonising nature (Muhammad Shahbaz et al., 2009; Rodríguez-Gálvez et al., 2015) of L. pseudotheobroame, L. theobromae and P. adansoniae toward the tested fruits although similar non wounded method was applied. This concludes that there are higher possibilities for the tested fruits to be infected by these fungi species in the absence of any wounds.

245

Table 2: Disease severity index of L. theobromae A1718, L. pseudotheobromae R1757 and P. adansoniae B1474 produced the symptom of necrotic on different types of fruits at dai 1-4.

Types of fruit / Disease severity index (DSI) on different dai (%) Isolates number 1 2 3 4 Banana (M. acuminata) L. theobromae A1718 0 0 0 0 L. pseudotheobromae R1757 0 15 25 35 P. adansoniae B1474 0 10 15 25

Pear (P. communis) L. theobromae A1718 0 0 0 0 L. pseudotheobromae R1757 0 0 0 0 P. adansoniae B1474 0 0 0 0

Apple (Malus sp.) L. theobromae A1718 0 20 55 80 L. pseudotheobromae R1757 0 15 35 80 P. adansoniae B1474 0 20 55 85

Guava (P. guava Linn) L. theobromae A1718 10 35 62.5 81.25 L. pseudotheobromae R1757 20 35 80 100 P. adansoniae B1474 25 40 56.25 81.25

Mandarin (C.reticulata Blanco) L. theobromae A1718 0 25 25 25 L. pseudotheobromae R1757 0 25 25 25 P. adansoniae B1474 0 25 25 25

Musk lime (C. microcarpa) L. theobromae A1718 0 20 35 40 L. pseudotheobromae R1757 0 20 25 25 P. adansoniae B1474 0 25 25 25

Sapodilla (M. sapota syn Achras zapota Linn) L. theobromae A1718 0 30 55 70 L. pseudotheobromae R1757 0 25 55 95 P. adansoniae B1474 0 20 40 70

Generally, all inoculated hosts showed fruit rot symptoms. However, characteristics and progression of the disease symptom were different according to the host. Banana (M. acuminata) has started to show the symptom after two days of inoculation that started with tiny black spots around the mycelia plug, which were then merged and enlarged. Later, the black rots with brown edges were formed in irregular shape and increased in size after inoculation proceeds.

246

At day 4, rot symptom was observed to be watery while the tissues around the rot becoming soft with the sign of fungal mycelia growth on the particular area. Among three isolates tested in banana, L. pseudotheobromae R1757 was shown severe with DSI 35% compared to isolate P. adansoniae B1474 (DSI 25%; Table 2). Furthermore, isolate L. theobromae A1718 did not produce any measureable external necrotic lesion; however, the fruit became hardened and maintained unripen.

Similar to banana, 15 wax-free apples (Malus sp.) showed fruit rot symptoms after inoculated with three different fungal isolates throughout four days of inoculation. The rot symptoms produced are smaller red-brown in the early day of inoculation, which were then enlarged and covered with mycelia growth. Adjacent tissues surrounding the dark red- brown rot also became soften and decolourised from apple-red to yellowish brown. Among the three species of P. adansoniae, B1474 with DSI 85% was considered highly pathogenic to apple due to the high DSI recorded (Table 2).

Among other fruits tested, guava (P. guava Linn) was shown to have faster fruit rot disease progression after inoculated with these three species because the symptoms of fruit rot disease were already visible at day 1 and achieved highest of DSI (100%) in isolate L. pseudotheobromae R1757 on day 4 (Table 2). This has demonstrated the capability of guava as the susceptible host for L. theobromae, L. pseudotheobromae and P. adansoniae. The symptom of fruit rot in guava began with circular rot formation near the mycelia plug. Later, the light-brown rot was irregularly enlarged, watery with the presence of mycelial growth.

Based on the observation on mandarin (C. reticulata) host throughout four days of inoculation, similar symptoms features were detected on every replicates of mandarin fruit after inoculated with L. theobromae A1718, L. pseudotheobromae R1757 and P. adansoniae B1474. The symptoms showed circular black necrotic lesion with sunken effect surrounding the mycelial plug, which started on day 2. All mandarin replicates tested with isolates undergone ripening process while the control (absence of mycelial plug) maintained in green colour at day 4 after inoculation. However, the disease progression for mandarins had undergone stagnation with less than 25% necrotic lesions observed throughout inoculation days (Table 2). The DSI for all isolates was observed to be 25% throughout four days of inoculation.

Generally, all musk lime (C. microcarpa) hosts tested produced dry circular necrotic lesion with sunken effect surrounding the inoculation area. However, there were slight differences in symptom characteristics among these three isolates species where the replicates inoculated with L. theobromae A1718 had produced darker brown of necrotic lesion with the absence of mycelia growth on adjacent inoculated area (DSI 40%). On the other hand, the fruits inoculated with L. pseudotheobromae R1757 and P. adansoniae B1474 scored with DSI (25%) had produced light colour of necrotic lesion with mycelia of isolates covering the lesion rot (Table 2). Apart from that, disease severity progression has appeared high in isolate L. theobromae A1718 as inoculation day increases with observed stagnation in the other two isolates.

The sapodilla (M. sapota) inoculated with L. theobromae A1718, L. pseudotheobromae R1757 and P. adansoniae B1474 produced similar symptom. Based on outer surface, there were watery and patch of mycelial growth produced on all over the host surface.

247

The severity was measured through the surface area of soften and rotten tissues of sapodilla. On day 4, sapodillas were dissected to further observe the inner tissues. The sapodilla inoculated with L. pseudotheobromae R1757 showed severe disease symptom (DSI 95%, Table 2) with larger and deep area of inner tissue infected.

Among all seven commercial fruits tested, only pear (variety of Green Anjou) did not produce any disease symptom after inoculated with L. theobromae, L. pseudotheobromae and P. adansoniae until day four after inoculation. This result revealed that even though the members of Botryosphaeriaceae have been known to infect a wide range of hosts, some plant species (host) with different variety have developed the resistance mechanisms in either host and non-host resistance resulted from plant immune response (Gill et al., 2015). This capability could cause the specific variety to be able to defence themselves from specific fungal attack. For example, previous study done by Zhou et al. (2015) suggests that pear with variety of Pyrus pyrifolia Nakai ‘Huangjin is able to produce sunken lesion after inoculated with N. parvum.

Conclusion

In overall, Lasiodiplodia and the related species of Botryosphaeriaceae isolated from fruit rot disease of mango were able to produce fruit rot symptom in banana, mandarin, musk lime, sapodilla, apple and guava. This indicates that the host of this pathogen is not restricted to mango fruit only, but also a range of unrelated hosts with particular variety. Therefore, based on the analyses, it can be suggested that intercropping of host with high possibility of being infected with mango pathogen should be avoided since the pathogen may easily spread the disease throughout the farm. As well as preventing, the direct contact of infected fruits with susceptible ones after harvest may also decrease cross- contamination.

Acknowledgements This study was partially supported by the Research University Grant Scheme (RUGS), Universiti Putra Malaysia (UPM) to Nur Ain Izzati M.Z. Munirah Mohd Sattar received scholarship from the UPM Graduate Research Fund (GRF).

References

Agrios, G. N. (2005). Plant Pathology. Fifth Edition, Elsevier Academic Press, London, UK.

Gill, U. S., Lee, S., & Mysore, K. S. (2015). Host versus nonhost resistance: Distinct wars with similar arsenals. Phytopathology, 105, 580-587.

Isaac, K. A., Amaglo, H., Kodzo Kumah, E., & Ofori, H. (2015). Preharvest and postharvest factors affecting the quality and shelf life of harvested tomatoes: A mini review. International Journal of Agronomy, 1-6.

Ismail, A. M., Cirvilleri, G., Polizzi, G., Crous, P. W., Groenewald, J. Z., & Lombard, L. (2012). Lasiodiplodia species associated with dieback disease of mango (Mangifera indica) in Egypt. Australasian Plant Pathology, 41(6), 649–660.

Kouame, K. G., Abo, K., Dick, E., Bomisso, E. L., Kone, D., Ake, S., & Yatty, J. (2010). Artificial wounds implication for the development of mango (Mangifera indica L. anacardiaceae) fruit disease caused by Colletotrichum, 4, 1621–1628.

248

Marques, M. W., Lima, N. B., Antônio, M., & Jr, D. M. (2013). Species of Lasiodiplodia associated with mango in Brazil. Fungal Diversity, 61, 181-193.

Munirah, M. S (2017). Characterization, pathogenicity and hodt range analyses of Lasiodiplodia and related species isolated from fruit rot of mango. Msc. Thesis. Universiti Putra Malaysia.

Muhammad Shahbaz, Zafar, I., Ahmad, S., & Muhammad, A. A. (2009). Association of Lasiodiplodia theobromae with different decline disorders in Mango (Mangifera indica L.). Pakistan Journal of Botany, 41(1), 359-368.

Netto, M. S. B., Lima, W. G., Correia, K. C., da Silva, C. F. B., Thon, M., Martins, R. B., Miller, R. N. G., Michereff, S. J., & Câmara, M. P. S. (2016). Analysis of phylogeny, distribution, and pathogenicity of Botryosphaeriaceae species associated with gummosis of Anacardium in Brazil, with a new species of Lasiodiplodia. Fungal Biology, http://dx.doi.org/10.1016/j.funbio.2016.07.006.

Pillay, K., Slippers, B., Wingfield, M.J., & Gryzenhout, M. (2013). Diversity and distribution of co-infecting Botryosphaeriaceae from Eucalyptus grandis and Syzygium cordatum in South Africa. South African Journal of Botany, 84, 38e43.

Rodríguez-Gálvez, E., Maldonado, E., & Alves, A. (2015). Identification and pathogenicity of Lasiodiplodia theobromae causing dieback of table grapes in Peru. European Journal of Plant Pathology, 141, 477.

Zhou, Y., Gong, G., Cui, Y., Zhang, D.X., & Chang, X.L. (2015). Identification of Botryosphaeriaceae species causing kiwifruit rot in Sichuan Province, China. Plant Disease, 99, 699-708.

249

5.6 Screening of potential antagonistic Trichoderma species from soil against Fusarium oxysporum f. sp. lycopersici

Summary

Chemical pesticides are commonly used for managing Fusarium wilt disease of tomato caused by Fusarium oxysporum f. sp. lycopersici. However, the use of chemicals can lead to ecological instabilities. To find an eco-friendly method to cure infected-tomato wilt, this study focuses on screening the potential of antagonistic Trichoderma isolates against Fusarium oxysporum f. sp. lycopersici under in vitro condition. Previously, Trichoderma species have been used as antagonists against different plant pathogens. One-hundred and eighty-four isolates of Trichoderma used in this study were originally isolated from soil. These isolates were obtained from the Mycology Laboratory, Faculty of Science, University Putra Malaysia. Among 184 Trichoderma isolates tested, six isolates showed a very high antagonistic activity based on percentage inhibition of radial growth (PIRG) values against the tested pathogens, which are Trichoderma asperellum isolates B1902 (81.23%), C1667 (80.27%), C1669 (79.41%), B2230 (78.35%) and T2007 (78.11%) as well as T. harzianum isolate C1675 (78.45%). On the other hand, 116 Trichoderma isolates showed high antagonistic activity (PIRG 61-75%), 56 isolates demonstrated moderate antagonistic activity (PIRG 51-60%) and six isolates gave low antagonistic activity (PIRG <50%). This preliminary result is valuable and promising enough for further studies on the efficacy of Trichoderma species as a biocontrol agent of wilt disease in tomato under in vivo and field conditions.

Keywords: Trichoderma spp.; Fusarium oxysporum; Biocontrol; Tomato

Introduction

Tomato (Solanum lycopersicum L.) is an important vegetable crop grown in most regions across Malaysia. The reasons for the popularity of tomato include its highly nutritious content, variety of use and a significant source of vitamin A and C. In terms of its contribution to human’s nutrient needs, it ranks on top of the list. However, numerous plant diseases hampering plant growth and crop yield can affect this vegetable. In the management of tomato plant, pathogenic fungi are the greatest concern, particularly in the wilt caused by the Fusarium species (Jones et al., 1991).

Fusarium oxysporum f. sp. lycopersici, which is responsible for the wilting of tomato, is considered one of the most economically significant plant diseases worldwide (Alabouvette et al., 1993). Fusarium wilt is a nature soil-borne. Applying fungicides as a disease control is not advisable since they are ecologically unfriendly. In addition, fungicides and any other chemicals are among the potential health risks to the applicator as well as to those consuming the chemically treated products. Another downside of chemical use is that it does not only affect targeted organism, but also many other beneficial organisms. Chemical toxic remains in the soil and is a serious source of environmental contamination (Larkin et al., 1996). However, there are possibilities of using the genus Trichoderma for biologically control soil-borne pathogens (Minuto et al., 1995; Paulitz et al., 1987). The genus Trichoderma is one of the most frequently isolated soil fungi that can be widely found in various environments such as agricultural, prairie, forest, and salt marsh and desert soils in all climatic zones.

250

These general saprophytes exhibit high interaction in root, soil and foliar environments apart from having minimal nutritional requirements. They can profusely sporulate and have been reported to constitute up to 3% of total fungal propagules in forest soils (Harman et al., 2004; Klein & Eveleigh, 1998; Pinto et al., 2006). Several isolates of Trichoderma have been developed as biocontrol agents against fungal plant pathogens (Howell, 2003; Harman, 2006; De Souza et al., 2008; Suhaida & Nur Ain Izzati, 2013; Nur Ain Izzati et al., 2016). The objective of this study is to screen the potential antagonistic Trichoderma isolates against Fusarium oxysporum f. sp. lycopersici under in vitro condition.

Materials and Methods

The antagonist Trichoderma isolates and Fusarium oxysporum f. sp. lycopersici (B713T) were obtained from the Fungal Culture Collection of Mycology Laboratory, Department of Biology, Faculty of Science, UPM. Species identification was verified based on internal transcribed spacers sequence analysis (Sharifah Maryam, unpublished). Dual culture was used to determine the impact of Trichoderma isolates on pathogen following a standard method of Dennis & Webster (1971).

All isolates were subcultured on potatoes dextrose agar (PDA) and incubated under standard condition for four days. A mycelia plug taken from the edge of 4-day-old PDA culture was placed at the periphery of the 9 mm PDA plates, whereas another similar-sized agar disc of Fusarium oxysporum f. sp. lycopersici (B713T) was put at the periphery on the opposite end of the same PDA plate. As a control, Fusarium oxysporum f. sp. lycopersici (B713T) mycelia plug was similarly placed but without Trichoderma isolate on the opposite end. The experiments were carried out in four replicates.

The dual cultures and control plates were incubated for four days. The evaluation on the Isolates was conducted employing Percentage Inhibition in Radial Growth (PIRG) of F. oxysporum f. sp. lycopersici based on the following formula (Gigole et al., 2011) with slight modifications. PIRG = R1 – R2 x 100 R1 Where: R1 = Radial growth of F. oxysporum f. sp. lycopersici without the antagonist (control) R2 = Radial growth of F. oxysporum f. sp. lycopersici with the presence of the antagonist (treatment)

PIRG was computed followed by the analysis of all data employing SPSS programme version 17.0. The descriptive assessment for antagonistic activity was converted as shown below (Soytong, 1988): ++++ = very high antagonistic activity (>75 PIRG) +++ = high antagonistic activity (61-75 PIRG) ++ = moderate antagonistic activity (51-60 PIRG) + = low antagonistic activity (<50 PIRG) - = no antagonistic activity

251

Results and Discussion

Antagonistic results of Trichoderma isolates against Fusarium oxysporum f. sp. lycopersici in dual culture of PDA revealed that 184 Trichoderma isolates grew toward the pathogen’s hyphae and inhibited its growth. Trichoderma species were tested for mycelial inhibition of Fusarium oxysporum f. sp. lycopersici (B713T) and recorded after five days of incubation. In this study, Trichoderma isolates showed various inhibitory effects with the highest PIRG obtained by Trichoderma isolate B1902 by 81.23% followed by C1667, C1669, B2230, T2007 and C1675 showing their rates as 80.27%, 79.41%, 78.35%, 78.11% and 78.45%, respectively (Table 1 and Figure 1).

Table 1: Percentage of inhibition growth rate (PIRG) and antagonistic activity of Trichoderma isolates

Trichoderma ISOLATES no. Mean *Antagonistic species value of activity PIRG (%) T. asperellum B1902, C1667, C1669, 78.11 - ++++ B2230, T2007 81.23 B1898, B139s, B158s, 61.34 - +++ B1581, B1584, N2087, 75.02 C1917, T1996, T1989, T2002, T2008, T2015, T2056, B1894, B1898, B2097, B2106, B2219, N327s, B142s, B131s, B99s, B98s, T64s, B302s, B134s, B95s, B10s, A217s, B28s T2051, T2055, B2218, 57.54 - ++ B2221, B2223, B2226, 60.01 B2228, B2234, B30s, B170s, B29s, B16s, B22s, A190s, T66s, A223s B20s, C1934 48.12 - + 50.01 T. harizianum C1675 78.45 ++++ T2061, T2026, T2050, 61.53 - +++ B1949, N2088, B1961, 74.73 C1620, N2084, N2085, N2087, C1672, C1916, C1941, C1947, S1980, T1990, T1993, T1995, T1997, T1998, T2000, T2001, T2004, T2006, T2012, T2013, T2014, T2017, T2019, T2020,

252

T2021, T2022, T2024, T2029, T2030, T2032, T2033, T2034, T2035, T2039, T2042, T2047, T2048, T2059, T2062, T2063, T2064, T2069, T2078, T2079, B1952, B1880, B2238, B25s, B94s, B83s, T69s, C264s, B158s, N317s, B166s, B155s, C259s, B161s, T78s, T73s C1599, B1586, T2057, 52.43 - ++ C1931, T1988, T1992, 59.89 T1994, T1999, T2003, T2018, T2027, T2028, T2058, T2066, T2068, T2074, T2077, B1903, B2222, C267s, B141s, B130s, B159s, B112s, B144s, B8s, B136s, B165s T1991, T2011, A204s 41.32 - + 49.94 T. hamatum T2005, T2023, T63s 63.45 - +++ 68.52 T2025, T2072 57.32 - ++ 95.26 S1972 49.36 + T. C1665, C1928, C1948, 61.16 - +++ koningiopsis T2065, B1904, B129s, 66.54 B296s , C269s, B138s, B156s B1895, T2037, B1901, 53.41 - ++ A237s , B19s, B128s, A221s 59.89 T. rodmanii M1891 68.36 +++ T. spirale T2081 66.35 +++ T2049 55.32 ++ T. virens C1601, T2052, T2073, B79s, 61.62 - +++ B101s, B108s 66.21 C1613 59.97 ++ T. viride T2040 53.42 ++ *Antagonistic activity: ++++, very high antagonistic activity (>75% PIRG); +++, high antagonistic activity (61-75% PIRG); ++, moderate antagonistic activity (51-60% PIRG); +, low antagonistic activity (<50% PIRG).

253

Figure 1: Dual culture of Trichoderma isolate and pathogen. A) T. asperellum B1902 showed the highest antagonistic activity (81.23%), B) T. asperellum B20s the lowest antagonistic activity with PIRG 41%, C) control plate with no Trichoderma isolate.

There has been much interest in Trichoderma spp. as promising biocontrol agents due to their ability to lower the prevalence of disease brought about by plant pathogenic fungi especially common soil-borne pathogens (Howell, 2003; Nur Ain Izzati & Faridah, 2008). In this present study, out of 184 isolates of Trichoderma spp., six isolates showed promising antagonistic capabilities. All Trichoderma strains showed growth inhibition of F. oxysporum f. sp. lycopersici particularly in the zones between the colonies of the pathogen and Trichoderma strains. These inhibition zones could be caused by the effect of diffusible inhibitory substances generated by the Trichoderma strains, which suppressed the growth of F. oxysporum f. sp. lycopersici. The existence and size of the inhibition zones have been considered to prove the presence of antibiotics produced by the Trichoderma strains (Jackson et al., 1991; Crawford et al., 1993). Their rapid rate of growth gives antagonists a significant edge in competing for space and nutrients with the pathogen (Benítez et al., 2004). These isolates were found to outgrow and sporulate on the pathogen colonies. In the interaction zone, the F. oxysporum f. sp. lycopersici mycelia were identified as an abnormal morphology and lysing indicating strong mycoparasitism activity (Howell, 2003).

These results are in agreement with the findings of many other researchers mentioning T. asperellum isolates as the versatile biocontrol agents (Marcello et al., 2010; de los Santos- Villalobos et al., 2013). It is well known that Trichoderma spp. has shown a great promise as biocontrol agents of pathogenic fungi in many crops, particularly to Fusarium spp. and Rhizoctonia spp. (Rojo et al., 2007; Harman, 2000; Howell, 2003; Nur Ain Izzati & Faridah, 2008). The role played by the cell wall degrading enzymes in hyphal degradation of Pythium ultimum var. ultimum by T. harzianum has been well-documented (Elad et al., 1983). Moreover, Elad et al. (1983) presented that the hyphal penetration by Trichoderma spp. is mediated by enzyme activity especially chitinase, and β-1, 3-glucanase.

Conclusion

In conclusion, the application of Trichoderma species under in vitro condition had decreased the development of F. oxysporum f. sp. lycopersici. On the top of that, Trichoderma species could be further investigate for large-scale field trials to manage Fusarium wilt disease on tomato plant and stimulate Trichoderma to enhance growth and quality of tomato plants under in vivo condition.

254

Acknowledgements

Zainap. H received scholarship from the Ministry of Education of Libya. The authors thank Mrs. Nor Hidayah Hussain for technical assistance.

References

Alabouvette, C, Lemanceau, P. and Steinberg, C. (1993). Recent advances in the biological control of fusarium wilts. Pesticide Science, 37, 365–373.

Benitez, T., M. A. Rincon, M. C. Limon and C. A. Codon (2004). Biocontrol mechanisms of Trichoderma strains. International Microbiology, 7, 249-260.

Crawford, D. L., Lynch, J. M., Whipps, J. M. and Osley M. A., (1993). Isolation and characterization of actinomycete antagonists of a fungal root pathogen. Applied Environmental Microbiology, 59, 3899-3909.

De los Santos-Villalobos, S., Guzmàn-Ortiz, D. A., Gomez-Lim, M. A., Délano-Frier, J. P., de- Folter, S., Sànchez-Garía, P. and Peña-Cabriales, J. J. (2013). Potential use of Trichoderma asperellum (Samuels, Liechfeldt et Nirenberg) T8a as a biological control agent against anthracnose in mango (Mangifera indica L.). Biological Control, 64, 37-44.

De Souza, J. T., Bailey, B. A., Pomella, A. W. V., Erbe, E. F., Murphy, C. A., Bae, H. and Hebbar, P. K. (2008). Colonization of cacao seedlings by Trichoderma stromaticum, a mycoparasite of the witches’ broom pathogen, and its influence on plant growth and resistance. Biological Control, 46, 36-45.

Dennis, C. and Webster J. (1971). Antagonistic properties of species groups of Trichoderma. I. Production of non-volatile antibiotics. Transactions of the British Mycological Society,57, 25-39.

Elad, Y. and Chet, I. (1983) Improved selective media for isolation of Trichoderma spp. or Fusarium spp. Phytoparasitica, 11, 55.

Gaigole, A. H., G. N. Wagh, and A. C. Khadse, (2011). Antifungal activity of Trichoderma species against soil borne pathogen. Asia Journal Biotechnological Research, 4, 461-465 .

Harman, G. E., Lorito, M. and Lynch, J. M. (2004). Uses of Trichoderma spp. to alleviate or remediate soil and water pollution. In Advances in Applied Microbiology, 56, 313-321.

Howell, C. R. (2003). Mechanisms employed by Trichoderma species in the biological control of plant diseases: The history and evolution of current concepts. Plant Disease, 87, 4-10.

Jackson, A. M., Whips, J. M. and Lynch, J. M. (1991). In vitro screening for identification of potential biocontrol agent of Allium white rot. Mycological Research, 95, 430-434.

Jones, J. B., Jones, J. P., Stall, R. E. and Zitter, T. A. (1991). Compendium of Tomato Diseases. American Phytopathological Society, St. Paul, MN.

Larkin, R. P., Hopkins, D. L. and Martin, F. N. (1996). Suppression of Fusarium wilt of watermelon by nonpathogenic Fusarium oxysporum and other microorganisms recovered from a disease-suppressive soil. Phytopathology, 86, 812-819.

255

Marcello, C. M., Steindorff, A. S., Silva, S. P., Silva, R. N., Bataus, L. A. M. and Ulhoa, C. J. (2010). Expression analysis of the exo- β-1, 3-glucanase from the mycoparasitic fungus Trichoderma asperellum. Microbiological Research, 165, 75-81.

Minuto, A., Migheli, Q. and Garabaldi, A. (1995). Evaluation of antagonistic strains of Fusarium spp. in the biological and integrated control of Fusarium wilt of cyclamen. Crop Protection, 14, 221-226.

Nur Ain Izzati, M. Z. and Faridah, A. (2008). Disease suppression of Ganoderma-infected oil palm seedling treated with Trichoderma harzianum. Plant Protection Science, 44, 101-107.

Nur Ain Izzati, M. Z., Farah Aqila, H., Nor Azizah, K., Nur Syuhada, Z. and Suhaida, S. (2016). Characterization and pathogenicity of Fusarium proliferatum and Fusarium verticillioides, causal agents of Fusarium ear rot of corn. Turkish Journal of Biology, 41(1), 220-230.

Paulitz, T. C., Park, C. S. and Baker, R. (1987). Biological control of Fusarium wilt of cucumber with nonpathogenic isolates of Fusarium oxysporum. Canadian Journal of Microbiology, 33, 349-353.

Pinto, P. M., Alonso, J. A. P., Fernandez, V. P. and Casero, J. J. D. (2006). Fungi isolated from diseased nursery seedlings in Spain. New Forests, 31(1), 41-56.

Rojo, F. G., M. M. Reynoso, M. F. Sofia, N. Chulze and A. M. Torres (2007). Biological control by Trichoderma species of Fusarium solani causing peanut brown root rot under field conditions. Crop Protection, 26, 549-555.

Soytong K, (1988). Identification of species of Chaetomium in the Philippines and screening for their Biocontrol properties against seed Born Fungi of rice. Ph.D. Thesis Dept. Plant Pathology, ULPB, College, Laguna, Philippines.

Suhaida, S. and Nur Ain Izzati, M. Z. (2013). The efficacy of Trichoderma harzianum T73s as a biocontrol agent of Fusarium Ear Rot disease of maize. International Journal of Agriculture and Biology, 15, 1175-1180.

256

5.7 Spatial distribution of Bacterial Heart Rot (BHR) disease of pineapple

Summary

Bacterial heart rot (BHR) disease caused by Erwinia chrysanthemi is considered as the most damaging disease of pineapple in Malaysia. For the time being, there are no exact solutions for this problem. Because of that, epidemiology study was carried up to understand the spread and management strategies for BHR disease. Two plots were prepared in MARDI Kluang, Johor with 200 plants in each plot. The spread of the disease was observed by inoculation of the pathogen in only one plant in each plot (Plot A: edge and Plot B: Middle). The disease was mapped at weekly interval for up to 12 weeks by visual observation of the symptom. Between these two plots, the rate of disease incidence (DI) was lower in the plot where pineapple plant at the middle of plot was inoculated (2.0%) compared to plot where pineapple plant in the edge was inoculated (6.0%). Spatial analysis in both plots showed that BHR were found aggregated especially in Plot A. The study also found that the percentage of DI in Plot A increased from week 1 to 12. However, for Plot B, percentage of DI was found stagnant from week 3 to 12. The aggregation pattern of disease spreading is believed caused by environmental condition such as wind or humidity and less affected by the insects. The location of initial inoculum source was found to be the determining factor for development and distribution of BHR in both plots. Because of that, eliminating the initial inoculum source or early detection of infected plant is believed as the best management strategy in controlling the spread of BHR in the field.

Keywords: Bacterial Heart Rot; Pineapple; Spatial Distribution

Introduction

Ananas comosus var comosus or well known as pineapple is the most economically important plant in the family of Bromeliaceae which is belongs to the order Bromeliales (Bartholomew et al., 2003). It is originated from South America and discovered by Europeans in 1493. There are approximately 30 cultivars grown commercially in tropical and subtropical countries around the world. Pineapple is the third most important commercial tropical fruit crops in the world (Karnataka, 2007).

Pineapple industry mainly in Malaysia was threatened by pests and diseases tribulation. Various infections of diseases which are caused by bacterial infection reported by Malaysian Pineapple Industry Board (MPIB) and one of them are Bacterial heart rot (BHR). Bacterial heart rot of pineapple was first reported in Malaysia in year 1957, which is caused by Erwinia chrysanthemi (Toth et al., 2011; Lim, 1985; Johnston, 1957). BHR was reported severely affected the pineapple production and regarded as one of the most devastating diseases of the pineapple (Kogeethavani et al., 2005). E. chrysanthemi is gram negative and non-sporing bacteria which have few peritrichous flagella (Lim, 1974) and can cause systemic rot that moves from leaves to heart or vice versa when infected plants (Kaneshiro et al., 2008). This pathogen also can survive in soil and can cause water soaking and rot of pineapple hearts and leaves (Perombelon et al., 1980; Rohrbach et al., 2003).

For the time being, there are no exact solutions for this problem. Conventional techniques used in the control of this phytopathology have serious limitations due to the emergence of resistant strains and the undesirable effect on environment caused by the chemical treatments (Abdenbi et al., 2010). Because of that, epidemiology study was carried up to understand the spread, epidemiology and management strategies for BHR disease.

257

Materials and methods

Two plots were prepared in MARDI Kluang, Johor with 200 plants in each plot. Each plot were tested by inoculation of the pathogen in one plant (Plot A: edge and Plot B: Middle) as shown in layout illustration (Figure 1 and 2). The distribution of disease incidence was evaluated visually for up to 12 weeks.

Figure 1: Layout illustration for Plot A (Disease inoculation at edge of plot)

Figure 2: Layout illustration for Plot B (Disease inoculation at middle of plot)

Results and Discussion

Between these two plots, the rate of disease incidence was lower in the plot where pineapple plant at the middle of plot was inoculated (2.0%) compared to plot where pineapple plant in the edge was inoculated (6.0%). This study found that the infected plant which is inoculated in the edge of the plot was easily spread due to the wind dispersal. Rohrbach and Johnson (2003) also reported that the wind and soil splash are among the mode of disease inoculum dissemination in field. Spatial analysis in both plots showed that BHR were found aggregated especially in Plot A as shown in spatial distribution pattern or maps (Figure 3 and 4).

258

Figure 3: Spatial distribution pattern in Plot A (Observation in week 1, 4, 8 and 12 after inoculation of disease).

Figure 4: Spatial distribution pattern in Plot B (Observation in week 1, 4, 8 and 12 after inoculation of disease).

259

Study also found that, percentage of DI in Plot A show increasing from week 1 to 12 due to the inoculated plant become source of disease inoculum. Rohrbach and Schmitt (2003) also reported that the primary inoculum of E. chrysanthemi is come from infected fruits or plants. However, for Plot B, percentage of DI in was found stagnant from week 3 to 12 as show in the Graph 1. Lower percentage of DI in both plot (A and B) is might be due to hot and dry condition (April 2015 and above) and less numbers of insects (ant, mealybug and others). It also supported by the previously study that the spread and infection by the bacteria was more severe during the raining season because of the water will increase disease development and allows bacterial cells to move easily through injured plant tissue (Sahilah et al., 2008).

Graph 1: Percentage of Disease Incidence (DI) in Plot A and Plot B.

Conclusion

Distribution of disease and vector was identified. Study found that, infection of disease in the edge is more severe rather than in the middle of the plot. The location of initial inoculum source also believed as the determinant factor for development and distribution of BHR in both plots. Because of that, eliminating the initial inoculum source or early detection of infected plant is believed as the best management strategy in controlling the spreading BHR in the field. Hence, it also will reduce the use of pesticide in the field.

Acknowledgements

The authors would like to express their sincere gratitude to Malaysian Agriculture Research and Development Institute (MARDI) for providing the financial support of this research work. They also would like to thanks all staff of Crop and Soil Science Research Centre, MARDI Kluang for the support provided.

260

References

Abdenbi E.K., Fatima Zahra E.H., Mohammed E.M., Mohammed B., and Mohammed E.H (2010). Isolation and identification of an actinomycete strain with a biocontrol effect on the phytopathogenic Erwinia chrysanthemi 3937VIII responsible for soft rot disease. Ann Microbiol., 60, 263–268.

Bartholomew, D.P., Paull, R.E., Rohrbach, K.G. (2003). The Pineapple: Botany, Production and Uses. Bartholomes, D.P., Paull, R.E., Rohrbach, K.G. (eds), CABI Publishing, Wallingford, UK. pp 1-301.

Johnston, A. (1957). Bacterial heart rot of the pineapple. Malay. Agric. J. 40, 2-8.

Kogeethavani, R., Uyub, A.M, Latiffah, Z. (2015). Molecular characterization and pathogenicity of Erwinia spp. associated with pineapple [Ananas comosus (L.) Merr.] and papaya (Carica papaya L.). Journal of Plant Protection Research 55 (4),???

Kaneshiro, W. S., Burger, M., Vine, B. G., de Silva, A. S., and Alvarez, A. M. (2008). Characterization of Erwinia chrysanthemi from a bacterial heart rot of pineapple outbreak in Hawaii. Plant Disease, 2, 1444-1450.

Karnataka, J., (2007). Prospects of Using Plant Extracts in Management of Pineapple Heart Rot. Agric. Sci., 20 (1), 180-182.

Lim, W.H. (1974). The etiology of fruit collapse and bacterial heart rot of pineapple. MARDI Res. Bull. 2, 2, l I - 16.

Lim, W.H. (1985). Diseases and disorders of pineapples in Peninsular Malaysia. MARDI Report 97.

Perombelon, M. C. M., and Kelman, A. (1980). Ecology of the soft rot Erwinias. Annu. Rev. Phytopathol. 18, 361-387.

Rohrbach, K. G., and Johnson, M. W. (2003). Pests, diseases and weeds. Pages 203-251 in: The Pineapple: Botany, Production and Uses. D. P. Bartholomew, R. E. Paull, and K. G. Rohrbach, eds. CABI Publishing, Wallingford, UK.

Rohrbach, K.G. and Schmitt, D. (2003). Diseases of pineapple. CABI Publishing, Wallingford, UK.

Sahilah, A. M., Rozeita, L., Umi Kalsum, M. S. and Son, R. (2008). Typing of Erwinia chrysanthemi isolated from josapine pineapple in Malaysia using antimicrobial susceptibility, plasmid profiles, ERIC-PCR and RFLP analysis. International Food Research Journal, 15(3), 273-280.

Toth I. K., van der Wolf J. M., Saddler G., Lojkowska E., He´ lias V., Pirhonen M., Tsror (Lahkim) L. and Elphinstone J. G (2011). Dickeya species: an emerging problem for potato production in Europe. Plant Pathology, 60, 385–399.

261

5.8 Influence Of Lead On Seed Germination And Plant Growth Of Acacia auriculiformis Species

Summary

Lead (Pb) has emerged as a powerful pollutant in all soil compartments. Its interaction with plants is one of the major menaces for agriculture practices. This study was conducted to determine the impact of Pb on seed germination and plant growth in Acacia auriculiformis species for the purpose of phytoremediation. Series of Pb concentration were tested on A. auriculiformis seed and plant. Evaluation on seed will be based on several germination parameters. While plant will be assessed on growth performance, and some physiological parameters. Study reveals that Pb toxicity has no effect on A. auriculiformis seeds germination and plant growth up to 1.5 and 2 g/l respectively. Acacia auriculiformis seeds germination and growth in high level of Pb make it a very resistant species which probably can be used as Pb hyperaccumulator agent in areas or sites contaminated with this metal.

Keywords: Lead pollution; Seed germination; Plant growth; Proline; Phytoremediation Introduction

Heavy metals toxicity has interfered into the environment causing a serious menace for human beings, animals and plants (Azevedo and Lea, 2005). One of the most persistent heavy metal in the environment is lead (Pb), it comes mostly from paints, cable covering, fertilizers and pesticides. The issue of Pb in a contaminated agricultural soil has been a question of great interest in a wide range of fields (Srinivasan et al., 2014). Environmental engineering faces a big challenge to purify the polluted soils from Pb. Ex situ decontamination using physico-chemical techniques is labour intensive, expensive, and affects the soil’s biological properties (Raymond et al., 2011). The use of plants to decontaminate soils, known as phytoremediation could therefore offer an environment- friendly solution to soil remediation and potentially cost-effective (Illié et al., 2015). Unfortunately, the high concentration of Pb intervenes in the inhibition of various plant physiological process and development; seed germination and plant growth (Yusuf et al., 2011) which disturb the effectiveness of phytoremediation. Acacia auriculiformis is a fast-growing and valuable tree species; it belongs to the Fabaceae family, which known as a heavy-metals hyperaccumulator species family (Ricardo et al., 2012). Its economic impact is predominantly positive and it is one of the most favored trees in degraded sites (Ishiguri et al., 2004). In the purpose to use this plant as a phytoremediation species, the effect of Pb on the germination and plant growth in A. auriculiformis has to be investigated. Hence, the aim of this study is to emphasize the seed germination pattern and plant growth in different Pb concentrations by using A. auriculiformis to contribute a basis for phytoremediation to reduce the risks associated with Pb contamination. Materials and methods

Acacia auriculiformis seeds were surface sterilized following Costa and Sharma (2016). Seeds was exposed to filter paper moistened with series of Pb concentration between 0 to 4 g/l in petri dishes. Seeds was scored as germinated when the breakage of seed coat is visible. The number of seeds germinated will be noted until the maximum germination of the control group (distilled water). The starting and finishing dates of germination will also be recorded. Different germination parameters such as Germination Percentage (Li, 2008), Vigor Index (VI) (Moradi et al., 2008), Mean Germination Time (Kandil et al., 2012) were measured. Radicle length and Tolerance Index was also recorded to investigate the tolerance of seed after germination.

262

The germinated seeds were planted in plastic polybags containing soil (mixture of top soil and sand) watered with distilled water (for control) or with different Pb concentrations (0 to 4 g/l) for the first watering for each treatment under ambient conditions (Srinivas et al., 2013). Normal watering was carried out every day with the same volume of water. Growth performance was monitored for 90 days. Other than physical growth parameters, biochemical parameters such as net photosynthesis (Roger et al., 1975), total chlorophylls (Monni et al. 2001), proline (Magne and Larher, 1992), and relative water content (Matin et al., 1989) were determined. The data obtain was tested using the software program SPSS.

Results and Discussion

The results show that increasing the concentration of Pb led to a reduction in germination percentage and Vigor Index over control. For the germination percentage and germination index, the difference was not significant up to 1.5 g/l (P ≤ 0.05). The increase in Pb concentration led to the increase in the Mean Germination Time of A. auriculiformis. The longest MGT was observed in 3.5g/l of Pb concentration (14.33 days respectively). The shortest MGT was observed in the control with 4.1 days. Several reports have shown that the presence of Pb influences the osmotic balance of seeds, and the entry of metal to the seed may cause a damage to the embryo, which could be a reason for the germination delay (Rehman et al., 2009). Furthermore, the toxicity of ions can also effect the viability of embryo which effect the germination (Houle et al., 2001). The application of different Pb concentrations led to a reduction in the radicle length and tolerance index compared to the control (P ≤ 0.05) (Figure 1). The highest reduction (about 8%) was observed at lead concentration of 3.5 g/l. Moreover, the Pb concentration of 0.5 g/l showed no change compared to the control. Lead have a significant impact on the meristematic cells and some cotyledons and endosperms enzymes, and that’s because when Pb effects the enzymatic reaction the active meristematic cells become soluble and the supplements will not reach the radicle which reduce its growth (Khan, 2013). It has been shown that Pb toxicity enhances protein and carbohydrate contents which cause a delay in the radicle emergence, affecting the oxidizing ability of the radicle, the activity of peroxidases and polyphenol oxidases, and overall lowering of carbohydrate-metabolizing enzymes–α-amylases, β-amylases, acid phosphatases and acid invertases, and altering genomic DNA profile (Singh et al., 2011).

263

Lead concentrations above 2 g/l caused a significant reduction in different growth parameters of A. auriculiformis including the height, root length, basal diameter, and leaves number (Figure 2). Exposure of A. auriculiformis seedlings to Pb concentration of 3 and 4 g/l resulted in a decrease of the net photosynthesis and the total chlorophylls (69.46 and 83.21% respectively). However, there seems to be no important difference among the relative water content transpired by the plant (p > 0.05). At 1 and 2 g/l of Pb concentration, proline content increased significantly by 100% and 27% respectively compared to the control (p < 0.05). While at the Pb treatment of 3 and 4 g/l, proline content decreased significantly by 56.86% and 92.15% respectively compared to the control. Proline accumulates heavily in several plants under heavy metal stress, providing the plants protection against damage by ROS. Although the mechanism of accumulation of proline in plants is suspected to be due to a decrease in the activity of the electron transport system leading to accumulation of NaDH and H+(Meenakshi et al., 2007).

Lead interferes with several metabolic processes, causing toxicity to the plants as exhibited by reduced root and shoots growth and phytomass, chlorosis, photosynthetic impairing, stunting and finally plant death (Roy et al. 2005). Surprisingly, the noticeable finding of this study, which has never been reported is the great resistance of A. auriculiformis to the extreme high concentration of Pb; it was clearly remarkable that there were no significant differences in the germination and the growth of A. auriculiformis up to 1.5g/l and 2g/l respectively. Conclusion

In the present investigation, it is concluded that increasing the concentration of lead to high levels plays a negative effect on the germination and the growth in Acacia auriculiformis. Furthermore, based on the obtained results Acacia auriculiformis is a very tolerant species which can germinate and grow in a high level of lead (up to 1.5g/l). With the fast growing character of this species it probably can be used for phytoremediation or reforestation of soils in which the presence of this heavy metal was reported.

264

References

Illié Zoran. S, Natasa Mirecki, Radmila Trajkovic, Nikolaos Kapoulas, Lidija Milenkovic and Ljubomir Sunic. (2015). Effect of Pb on germination of different seed and his translocation in bean seed tissues during sprouting. Fresenius Environmental Bulletin, 24(2), 670–75.

Ishiguri F, Yokota S, Yoshizawa N, Ona T. (2004). Radial variation of cell morphology in three Acacia species. in T Ona, ed. Improvement of forest resources for recyclable forest products. Springer-Verlag, Tokyo, Japan. Pg 74 – 76.

Nagajyoti. P.C, Dinakar. N, Prasad. T.N.V.K.V, Suresh. C and Damodharam. T. (2008). Heavy Metal Toxicity: Industrial Effluent Effect on Groundnut (Arachis Hypogaea L.) Seedlings. Journal of Applied Science Research, 4(1), 110–21.

Taylor D, Maddock B.G, Mance G. (1985). The acute toxicity of nine ‘grey list’ metals (arsenic, boron, chromium, copper, lead, nickel, tin, vanadium and zinc) to two marine fish species: Dab (Limanda limanda) and grey mullet (Chelon labrosus). Aquatic Toxicology, 7, 135-144.

Roger W. Carlson, F.A. Bazzaz, G.L. Rolfe. (1975). The effect of heavy metals on plants: II. Net photosynthesis and transpiration of whole corn and sunflower plants treated with Pb, Cd, Ni, and Tl. Environmental Research, 10, 113-120.

Raymond A. Wuana and Felix E. Okieimen. (2011). Heavy Metals in Contaminated Soils: A Review of Sources, Chemistry, Risks and Best Available Strategies for Remediation. International Scholarly Research Network. Article ID 402647.

Monni S, Uhlig C, Junttila O, Hansen E, and Hynynen J. 2001.Chemical composition and ecophysiological responses of Empetrum nigrum to above ground element application. Environmental Pollution, 112, 417–426.

Weiqiang Li, Mohammad A. Khan, Shinjiro Yamaguchi, and Yuji Kamiya. (2005). Effects of Heavy Metals on Seed Germination and Early Seedling Growth of Arabidopsis thaliana. Plant Growth Regulation,46(1), 45–50.

Yusuf, M., Q. Fariduddin, S. Hayat, and A. Ahmad. (2011). Nickel: An Overview of Uptake, Essentiality and Toxicity in Plants. Bulletin of Environmental Contamination and Toxicology, 86(1), 1–17.

Srinivasan Malar, Rajendiran Manikandan aPaulo J.C. Favas, Shivendra Vikram Sahi, Perumal Venkatachalam (2014). Effect of Lead on Phytotoxicity, Growth, Biochemical Alterations and Its Role on Genomic Template Stability in Sesbania Grandiflora: A Potential Plant for PhytoremediationEcotoxicology and Environmental Safety, 108, 249–57.

265

266