DOCSLIB.ORG

Expressions of the Cytochrome P450 Monooxygenase Gene Cyp4g1 And

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expressions of the Cytochrome P450 Monooxygenase Gene Cyp4g1 And Appl Entomol Zool (2011) 46:533–543 DOI 10.1007/s13355-011-0074-6 ORIGINAL RESEARCH PAPER Expressions of the cytochrome P450 monooxygenase gene Cyp4g1 and its homolog in the prothoracic glands of the fruit fly Drosophila melanogaster (Diptera: Drosophilidae) and the silkworm Bombyx mori (Lepidoptera: Bombycidae) Ryusuke Niwa • Takashi Sakudoh • Takeshi Matsuya • Toshiki Namiki • Shinji Kasai • Takashi Tomita • Hiroshi Kataoka Received: 25 July 2011 / Accepted: 30 August 2011 / Published online: 16 September 2011 Ó The Japanese Society of Applied Entomology and Zoology 2011 Abstract Here we describe the expression profiles of the (PTTH), a neuropeptide hormone that stimulates the syn- cytochrome P450 monooxygenase gene Cyp4g1 in the fruit thesis and release of ecdysone. We propose that Cyp4g1 fly, Drosophila melanogaster Meigen, and its homolog in and Cyp4g25 are the candidates that play a role in regu- the silkworm, Bombyx mori L. We identified Cyp4g1 by a lating PG function and control ecdysteroid production and/ microarray analysis to examine the expression levels of 86 or metabolism during insect development. predicted D. melanogaster P450 genes in the ring gland that contains the prothoracic gland (PG), an endocrine Keywords Cytochrome P450 monooxygenase Á organ responsible for synthesizing ecdysteroids. B. mori Prothoracic gland Á Bombyx mori Á Drosophila Cyp4g25 is a closely related homolog of D. melanogaster melanogaster Cyp4g1 and is also expressed in the PG. A developmental expression pattern of Cyp4g25 in the PG is positively correlated with a fluctuation in hemolymph ecdysteroid Introduction titer in the late stage of the final instar. Moreover, the expression of Cyp4g25 in cultured PGs is significantly In arthropods, steroid hormones designated as ecdysteroids, induced by the addition of prothoracicotropic hormone such as ecdysone and its derivative 20-hydroxyecdysone (20E), are essential for precise progression through devel- opment (Thummel 2001; Gilbert et al. 2002; Spindler et al. 2009). Ecdysone is synthesized from dietary cholesterol via R. Niwa (&) a series of hydroxylation and oxidation steps in the pro- Initiative for the Promotion of Young Scientists’ Independent thoracic gland (PG) during postembryonic development Research, Graduate School of Life and Environmental Sciences, (Gilbert et al. 2002). Ecdysone is subsequently converted University of Tsukuba, Seinou-tou B411, Tennoudai 1-1-1, Tsukuba, Ibaraki 305-8572, Japan to 20E by the 20-hydroxylase present in the peripheral e-mail: [email protected] tissues (Gilbert et al. 2002). Recently, molecular genetic studies using the fruit fly T. Sakudoh Drosophila melanogaster Meigen and the silkworm Bom- Division of Radiological Protection and Biology, National Institute of Infectious Diseases, byx mori L. have successfully identified several genes 1-23-1 Toyama, Shinjuku-ku, Tokyo 162-8640, Japan crucial for intermediate steps in ecdysone biosynthesis. The dehydrogenation of cholesterol to 7-hydrocholesterol T. Matsuya Á T. Namiki Á H. Kataoka (7dC), the first step in synthesizing ecdysone, is catalyzed Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, by the Rieske-domain enzyme Neverland (Nvd) (Yoshiy- 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8562, Japan ama et al. 2006; Niwa and Niwa 2011; Yoshiyama- Yanagawa et al. 2011). The conversion of 7dC to 5b-ketodiol S. Kasai Á T. Tomita is commonly referred to as a ‘‘Black Box’’ since no stable Department of Medical Entomology, National Institute of Infectious Diseases, 1-23-1 Toyama, Shinjuku-ku, intermediate has been identified (Gilbert et al. 2002). Tokyo 162-8640, Japan Recent studies have demonstrated that the cytochrome 123 534 Appl Entomol Zool (2011) 46:533–543 P450 monooxygenases, CYP307A1/Spook (Spo) and Microarray analysis CYP307A2/Spookier (Spok), and the short-chain dehy- drogenase/reductase Non-molting glossy/Shroud are We created a customized cDNA microarray, which con- involved in the Black Box reaction (Namiki et al. 2005; tained DNA fragments corresponding to 86 predicted Ono et al. 2006; Niwa et al. 2010). The terminal hydrox- D. melanogaster P450 gene that were chose in our previous ylation steps from 5b-ketodiol to ecdysone in the PG are study (Kasai and Tomita 2003). A DNA fragment corre- catalyzed by three cytochrome P450 monooxygenases: sponding to each of the 86 P450 genes was amplified by CYP306A1/Phantom (Phm), CYP302A1/Disembodied PCR as previously described (Kasai and Tomita 2003). (Dib) and CYP315A1/Shadow (Sad) (Cha´vez et al. 2000; Gene-specific primers used for PCR are listed in Table 1. Warren et al. 2002; Niwa et al. 2004; Warren et al. 2004; The DNA fragments of the 86 P450 genes were approxi- Niwa et al. 2005). The conversion of ecdysone to 20E is mately 500–600 bp in length (Table 1). PCR products were also mediated by a P450 monooxygenase, CYP314A1/ purified by agarose gel electrophoresis and then subcloned Shade (Shd), in the peripheral tissues (Petryk et al. 2003). to pCR2.1 (Invitrogen). After DNA sequences of each of Shroud and the P450 enzymes described above were the PCR products had been verified, we re-performed PCR identified from embryonic lethal mutants, known as the using pCR2.1 plasmids containing sequence-verified P450 Halloween mutants, that exhibit embryonic ecdysone fragments with the gene-specific primers (Table 1). These deficiency (Cha´vez et al. 2000). The recent discovery of PCR products were spotted onto microarrays. Total RNA these ecdysteroidogenic enzymes greatly advances our from the ring glands and the brain-ventral nerve cord knowledge of ecdysone biosynthesis at the molecular level. complex of the wandering 3rd instar D. melanogaster lar- However, it has not yet been proven whether the enzymes vae were prepared using TRIzol reagent (Invitrogen). identified thus far are sufficient for the conversion of Spotting, cRNA amplification, fluorescent labeling, cholesterol to 20-hydroxyecdysone. Therefore, it is unclear hybridization, detection and analysis were conducted by whether there are still unidentified enzyme(s) that are Bio Matrix Research, Inc., Kashiwa, Japan. One custom- responsible for ecdysone biosynthesis. ized microarray contained 4 spots for each of the P450 Here, we report that another P450 gene, Cyp4g1,is genes. Spot intensities were normalized using a summation highly expressed in the PG in D. melanogaster.Aclo- of total spot intensities in the hybridization experiments. sely related homolog of Cyp4g1 from B. mori, Cyp4g25, is also expressed in the PG, and its expression profile is RNA in situ hybridization positively correlated with a change in ecdysteroid titer in the hemolymph during the late stage of the last larval Synthesis of DIG-labeled RNA probes and RNA in situ instar. Furthermore, we show that in cultured PGs, the hybridizations were performed as previously described expression of Cyp4g25 is significantly induced by the (Lehmann and Tautz 1994). To synthesize sense and addition of the prothoracicotropic hormone (PTTH), antisense RNA probes for Cyp4g1 and Cyp310a1, EST which is a crucial neuropeptide that stimulates the syn- cDNA clones of the Berkeley Drosophila genome project thesis and release of ecdysone (Gilbert et al. 2002). GH05567 and LD44491, respectively (Stapleton et al. These results suggest that Cyp4g1 and Cyp4g25 play a 2002), were used as templates. To generate a template for role in regulating the PG function during insect synthesizing sense and antisense Cyp12e1 RNA probes, the development. ORF region of Cyp12e1 was amplified by PCR with primers (50-ATGTTGTCAACGCAGTGGAACGCAAAT AAA-30 and 50-AAACCCGATCTTAAAGTTTCTTACCA Materials and methods ACCG-30) using wild-type genomic DNA as template and subcloned into pBluescript. Insects Quantitative reverse-transcription PCR (qRT-PCR) Silkworms, B. mori (KINSYU 9 SHOWA F1 hybrid), were reared on an artificial diet (Silkmate, Nihon-Nosan- Single-stranded cDNA synthesis was performed as previ- Kogyo, Japan) at 25°C under a 16 h light/8 h dark cycle. ously described (Niwa et al. 2004). qRT-PCR was per- The first days corresponding to the developmental stages of formed using a real-time thermal Smart Cycler System the 4th to 5th larval ecdysis, wandering and pupation were (Cepheid) with the SYBR Premix ExTaq (TaKaRa). Spe- designated as V0, W0 and P0, respectively. D. melano- cific primers used in this study were the following: gaster flies were reared on standard agar-cornmeal medium Cyp4g1-forward (50-CGGTCCTGGGATTCAGTCCTAT at 25°C under a 12 h light/12 h dark cycle. Oregon R was G-30), Cyp4g1-reverse (50-CATCACCGAACCAGGGCTT used as the wild-type fly. GAAG-30), Cyp4g25-forward (50-TCGTCGGTGGATCTG 123 Appl Entomol Zool (2011) 46:533–543 535 Table 1 Primers used to amplify DNA fragments corresponding to the 86 validated and predicted D. melanogaster P450 genes that were spotted on our customized microarray Name Forward (50 [ 30) Reverse (50 [ 30) Length Cyp4c3 TGAATGTGGATCACGACGAG CTCTGGTGGAGCTTGTACT 573 Cyp4d1 ATGTTTCTGGTCATCGG GCAGATCGTGTCCATGGT 564 Cyp4d1alt ATGTGGCTCCTACTATCG GCAAATGGCGTCCAGAGC 537 Cyp4d2 TGGATTCTCCACCAGTTGG GTTGTTAACCAGCGTTTCACG 571 Cyp4d8 AGCATCTGGTGAAGCATCC AGTGGACATCAGCAGGACGT 581 Cyp4d14 GATATGCAGTTCCGACTGA GTCGTGCATGTTCTTCACG 570 Cyp4d20 AAGGGTCAACTCTACGAGT AGAGCCATCTGCGACTTGCT 560 Cyp4d21 AAAGCTCACCTCTACCGAT GTCCAGCAAAGTCATCTTAGC 567 Cyp4e1 TCCACTGTTCTTGGTGACC CTTGCACAACGGAGGAACTT 578 Cyp4e2 ACCACTGCTGCTGGTTGCA TGCACAATGGAAGAGCTG 576 Cyp4e3 GCCACTGATCACATTGGTG GGACAATGGAGGAGTCAC 575 Cyp4g1 TAGTTCAGGAGACGCTGCAA AGGATGTCAACCGTGGTCT
Load more

Recommended publications
  • Ultraspiracle Promotes the Nuclear Localization of Ecdysteroid Receptor in Mammalian Cells
    Ultraspiracle promotes the nuclear localization of ecdysteroid receptor in mammalian cells By: Claudia Nieva, Tomasz Gwoóźdź, Joanna Dutko-Gwóźdź, Jörg Wiedenmann, Margarethe Spindler-Barth, Elżbieta Wieczorek, Jurek Dobrucki, Danuta Duś, Vince Henrich, Andrzej Ożyhar and Klaus-Dieter Spindler Nieva C, Gwozdz T, Dutko-Gwozdz J, Wiedenmann J, Spindler-Barth M, Wieczorek E, Dobrucki J, Dus D, Henrich V, Ozyhar A, Spindler KD. (2005) Ultraspiracle promotes the nuclear localization of ecdysteroid receptor in mammalian cells. Biol. Chem. 386:463-470. Made available courtesy of Walter de Gruyter: http://www.[publisherURL].com ***Reprinted with permission. No further reproduction is authorized without written permission from Walter de Gruyter. This version of the document is not the version of record. Figures and/or pictures may be missing from this format of the document.*** Abstract: The heterodimer consisting of ecdysteroid receptor (EcR) and ultraspiracle (USP), both of which are members of the nuclear receptor superfamily, is considered to be the functional ecdysteroid receptor. Here we analyzed the subcellular distribution of EcR and USP fused to fluorescent proteins. The experiments were carried out in mammalian COS-7, CHO-K1 and HeLa cells to facilitate investigation of the subcellular trafficking of EcR and USP in the absence of endogenous expression of these two receptors. The distribution of USP tagged with a yellow fluorescent protein (YFP-USP) was almost exclusively nuclear in all cell types analyzed. The nuclear localization remained constant for at least 1 day after the first visible signs of expression. In contrast, the intracellular distribution of EcR tagged with a yellow fluorescent protein (YFP-EcR) varied and was dependent on time and cell type, although YFP-EcR alone was also able to partially translocate into the nuclear compartment.
    [Show full text]
  • Cooperative Control of Ecdysone Biosynthesis in Drosophila by Transcription Factors Séance, Ouija Board, and Molting Defective
    | INVESTIGATION Cooperative Control of Ecdysone Biosynthesis in Drosophila by Transcription Factors Séance, Ouija Board, and Molting Defective Outa Uryu,*,1,2 Qiuxiang Ou,†,1 Tatsuya Komura-Kawa,‡ Takumi Kamiyama,‡ Masatoshi Iga,§,3 Monika Syrzycka,** Keiko Hirota,* Hiroshi Kataoka,§ Barry M. Honda,** Kirst King-Jones,†,4 and Ryusuke Niwa*,††,4 *Faculty of Life and Environmental Sciences and ‡Graduate School of Life and Environmental Sciences, University of Tsukuba, 305-8572, Ibaraki, Japan, †Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9, Canada, §Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Kashiwa, Chiba 277-8562, Japan, **Department of Molecular Biology and Biochemistry, Simon Fraser University, Burnaby, British Columbia V5A 1S6, Canada, and ††Precursory Research for Embryonic Science and Technology, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012, Japan ORCID IDs: 0000-0002-2961-2057 (Q.O.); 0000-0002-6583-7157 (T.K.-K.); 0000-0002-9089-8015 (K.K.-J.); 0000-0002-1716-455X (R.N.) ABSTRACT Ecdysteroids are steroid hormones that control many aspects of development and physiology. During larval development, ecdysone is synthesized in an endocrine organ called the prothoracic gland through a series of ecdysteroidogenic enzymes encoded by the Halloween genes. The expression of the Halloween genes is highly restricted and dynamic, indicating that their spatiotemporal regulation is mediated by their tight transcriptional control. In this study, we report that three zinc finger-associated domain (ZAD)-C2 H2 zinc finger transcription factors—Séance (Séan), Ouija board (Ouib), and Molting defective (Mld)—cooperatively control ecdysone biosynthesis in the fruit fly Drosophila melanogaster. Séan and Ouib act in cooperation with Mld to positively regulate the transcription of neverland and spookier, respectively, two Halloween genes.
    [Show full text]
  • CYP18A1, a Key Enzyme of Drosophila Steroid Hormone Inactivation, Is Essential for Metamorphosis
    Developmental Biology 349 (2011) 35–45 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/developmentalbiology CYP18A1, a key enzyme of Drosophila steroid hormone inactivation, is essential for metamorphosis Emilie Guittard a, Catherine Blais a, Annick Maria a, Jean-Philippe Parvy a, Shivani Pasricha b, Christopher Lumb b, René Lafont c, Phillip J. Daborn b, Chantal Dauphin-Villemant a,⁎ a Equipe Biogenèse des Signaux hormonaux, Laboratoire Biologie du Développement, UMR7622 CNRS, UPMC, 7 Quai St Bernard, F-75005 Paris, France b Department of Genetics, Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Victoria, 3010, Australia c Laboratoire BIOSIPE, ER3, UPMC, 7 Quai St Bernard, F-75005 Paris, France article info abstract Article history: Ecdysteroids are steroid hormones, which coordinate major developmental transitions in insects. Both the Received for publication 18 June 2010 rises and falls in circulating levels of active hormones are important for coordinating molting and Revised 28 September 2010 metamorphosis, making both ecdysteroid biosynthesis and inactivation of physiological relevance. We Accepted 28 September 2010 demonstrate that Drosophila melanogaster Cyp18a1 encodes a cytochrome P450 enzyme (CYP) with 26- Available online 7 October 2010 hydroxylase activity, a prominent step in ecdysteroid catabolism. A clear ortholog of Cyp18a1 exists in most Keywords: insects and crustaceans. When Cyp18a1 is transfected in Drosophila S2 cells, extensive conversion of 20- Cytochrome P450 enzyme hydroxyecdysone (20E) into 20-hydroxyecdysonoic acid is observed. This is a multi-step process, which Drosophila melanogaster involves the formation of 20,26-dihydroxyecdysone as an intermediate. In Drosophila larvae, Cyp18a1 is Growth expressed in many target tissues of 20E.
    [Show full text]
  • Molecular and Biochemical Characterization of Two P450 Enzymes in the Ecdysteroidogenic Pathway of Drosophila Melanogaster
    Molecular and biochemical characterization of two P450 enzymes in the ecdysteroidogenic pathway of Drosophila melanogaster James T. Warren*†, Anna Petryk†‡, Guillermo Marque´ s§¶, Michael Jarcho¶, Jean-Philippe Parvyʈ, Chantal Dauphin-Villemantʈ, Michael B. O’Connor§¶, and Lawrence I. Gilbert*,** *Department of Biology, University of North Carolina, Chapel Hill, NC 27599-3280; ‡Department of Pediatrics, University of Minnesota, 516 Delaware Street Southeast, Minneapolis, MN 55455; §Department of Genetics, Cell Biology, and Development and ¶Howard Hughes Medical Institute, University of Minnesota, 321 Church Street Southeast, Minneapolis, MN 55455; and ʈUniversite´P. et M. Curie, Laboratoire Endocrinologie Mole´culaire et E´ volution, Baˆtiment 5A, 5e`meE´ tage, Case 29, 7 Quai St. Bernard, 75252 Paris Cedex 05, France Communicated by William S. Bowers, University of Arizona, Tucson, AZ, June 24, 2002 (received for review May 12, 2002) Five different enzymatic activities, catalyzed by both microsomal enzymes (i.e., CYP302A1; ref. 6). Mutations in dib result in a and mitochondrial cytochrome P450 monooxygenases (CYPs), are number of striking embryonic phenotypes, including disruptions strongly implicated in the biosynthesis of ecdysone (E) from cho- in head involution, dorsal closure, gut morphogenesis, and a lesterol. However, none of these enzymes have been characterized failure to produce embryonic cuticle. These developmental completely. The present data show that the wild-type genes of two disruptions are accompanied by, or are a result of, low titers of members of the Halloween family of embryonic lethals, disem- ecdysteroids, as is the severe reduction in the epidermal expres- bodied (dib) and shadow (sad), code for mitochondrial cyto- sion of the 20E inducible gene IMP-E1.
    [Show full text]
  • The Ecdysteroidome of Drosophila: Influence of Diet and Development Oksana Lavrynenko1,*,¶, Jonathan Rodenfels1,‡,¶, Maria Carvalho1,§, Natalie A
    © 2015. Published by The Company of Biologists Ltd | Development (2015) 142, 3758-3768 doi:10.1242/dev.124982 RESEARCH ARTICLE The ecdysteroidome of Drosophila: influence of diet and development Oksana Lavrynenko1,*,¶, Jonathan Rodenfels1,‡,¶, Maria Carvalho1,§, Natalie A. Dye1, Rene Lafont2, Suzanne Eaton1,** and Andrej Shevchenko1,** ABSTRACT metabolism and fertility (reviewed by Lafont et al., 2012). Ecdysteroids are the hormones regulating development, physiology Ecdysteroids comprise a large structurally diverse family of and fertility in arthropods, which synthesize them exclusively from polyhydroxylated sterols (reviewed by Lafont and Koolman, dietary sterols. But how dietary sterol diversity influences the 2009). In Drosophila, ecdysteroid levels peak just before the ecdysteroid profile, how animals ensure the production of desired critical developmental transitions: mid-embryogenesis, the two hormones and whether there are functional differences between larval molts, pupariation and the intra-pupal molt (Kozlova and different ecdysteroids produced in vivo remains unknown. This is Thummel, 2000). In larvae, ecdysteroids are synthesized from because currently there is no analytical technology for unbiased, sterols in the prothoracic gland as pro-hormones and are further comprehensive and quantitative assessment of the full complement activated by C-20 hydroxylation in the intestine and fat body (Petryk of endogenous ecdysteroids. We developed a new LC-MS/MS et al., 2003). Controlling the production, activation and removal method to screen the entire chemical space of ecdysteroid-related of these hormones is crucial for coupling growth and nutrition structures and to quantify known and newly discovered hormones to developmental timing, but the mechanisms involved are and their catabolites. We quantified the ecdysteroidome in Drosophila incompletely understood.
    [Show full text]
  • Properties of Ecdysteroid Receptors from Diverse Insect Species in a Heterologous Cell Culture System – a Basis for Screening Novel Insecticidal Candidates
    Properties of ecdysteroid receptors from diverse insect species in a heterologous cell culture system – a basis for screening novel insecticidal candidates Joshua M. Beatty, Guy Smagghe, Takehiko Ogura, Yoshiaki Nakagawa, Margarethe Spindler-Barth, Vincent C. Henrich Beatty, JM, G Smagghe, T Ogura, Y Nakagawa, M Spindler-Barth, and V C Henrich (2009) Properties of ecdysteroid receptors from diverse insect species: A basis for identifying novel insecticides. FEBS J, 276, 3087- 3098. DOI: 10.1111/j.1742-4658.2009.07026.x Made available courtesy of Wiley-Blackwell: http://www3.interscience.wiley.com ***The definitive version is available at www3.interscience.wiley.com ***Reprinted with permission. No further reproduction is authorized without written permission from Wiley-Blackwell. This version of the document is not the version of record. Figures and/or pictures may be missing from this format of the document.*** Abstract: Insect development is driven by the action of ecdysteroids on morphogenetic processes. The classic ecdysteroid receptor is a protein heterodimer composed of two nuclear receptors, the ecdysone receptor (EcR) and Ultraspiracle (USP), the insect ortholog of retinoid X receptor. The functional properties of EcR and USP vary among insect species, and provide a basis for identifying novel and species-specific insecticidal candidates that disrupt this receptor’s normal activity. A heterologous mammalian cell culture assay was used to assess the transcriptional activity of the heterodimeric ecdysteroid receptor from species representing two major insect orders: the fruit fly, Drosophila melanogaster (Diptera), and the Colorado potato beetle, Leptinotarsa decemlineata (Coleoptera). Several nonsteroidal agonists evoked a strong response with the L. decemlineata heterodimer that was consistent with biochemical and in vivo evidence, whereas the D.
    [Show full text]
  • The Drosophila Orphan Nuclear Receptor DHR38 Mediates an Atypical Ecdysteroid Signaling Pathway
    Cell, Vol. 113, 731–742, June 13, 2003, Copyright 2003 by Cell Press The Drosophila Orphan Nuclear Receptor DHR38 Mediates an Atypical Ecdysteroid Signaling Pathway Keith D. Baker,1,6 Lisa M. Shewchuk,2 that seem to be common to all NGFI-B subfamily mem- Tatiana Kozlova,3 Makoto Makishima,1,7 bers. Taken together, these data reveal the existence Annie Hassell,2 Bruce Wisely,2 of a separate structural class of nuclear receptors that Justin A. Caravella,2 Millard H. Lambert,2 is conserved from fly to humans. Jeffrey L. Reinking,4 Henry Krause,5 Carl S. Thummel,3 Timothy M. Willson,2 Introduction and David J. Mangelsdorf1,* 1Howard Hughes Medical Institute and Ecdysteroids are arthropod-specific hormones that Department of Pharmacology function as the major inducing signals responsible for University of Texas Southwestern Medical Center postembryonic developmental progression in insects. 5323 Harry Hines Boulevard In Drosophila, the ring gland releases two major ecdy- Dallas, Texas 75390 steroids, ␣-ecdysone and 20-deoxymakisterone A, 2 Discovery Research which are thought to be largely inactive (Gilbert et al., GlaxoSmithKline 1997; Riddiford, 1996). The conversion of ␣-ecdysone 5 Moore Drive to 20-hydroxyecdysone (20E) in the peripheral tissues Research Triangle Park, North Carolina 27709 is thought to elicit most of the effects of ecdysteroid 3 Howard Hughes Medical Institute and pulses, with the remaining metabolites having no known Department of Human Genetics function (Gilbert et al., 2002). The receptor for 20E is University of Utah a transcription factor comprised of a nuclear receptor 50 North 2030 East, Room 5100 heterodimer of the ecdysone receptor (EcR, NR1H1) and Salt Lake City, Utah 84112 Ultraspiracle (USP, NR2B4) (Koelle, 1992; Thomas et al., 4 Ontario Cancer Institute and 1993; Yao et al., 1993).
    [Show full text]
  • Role of Endocrine System in the Regulation of Female Insect Reproduction
    biology Review Role of Endocrine System in the Regulation of Female Insect Reproduction Muhammad Zaryab Khalid 1,2 , Sajjad Ahmad 1, Patrick Maada Ngegba 1,3 and Guohua Zhong 1,* 1 Key Laboratory of Natural Pesticide and Chemical Biology, Ministry of Education, South China Agricultural University, Guangzhou 510642, China; [email protected] (M.Z.K.); [email protected] (S.A.); [email protected] (P.M.N.) 2 Termite Management Laboratory, Department of Entomology, University of Agriculture Faisalabad, Faisalabad 38000, Pakistan 3 Sierra Leone Agricultural Research Institute, Tower Hill, Freetown P.M.B 1313, Sierra Leone * Correspondence: [email protected] Simple Summary: The abundance of insects indicates that they are one of the most adaptable forms of life on earth. Genetic, physiological, and biochemical plasticity and the extensive reproductive capacity of insects are some of the main reasons for such domination. The endocrine system has been known to regulate different stages of physiological and developmental processes such as metabolism, metamorphosis, growth, molting, and reproduction. However, in this review, we focus on those aspects of the endocrine system that regulate female insect reproduction. The proper understanding of the endocrine system will help us to better understand the insect reproductive system as well as to develop new strategies to control the insect pest population. The juvenile hormone analogs and molting hormone analogs have been widely used to control the insect pests. Such insect growth regulators are usually more specific and cause little harm to the beneficial organisms. Therefore, a proper understanding of these signaling pathways as well as their interaction with each other and other signaling pathways is very crucial.
    [Show full text]
  • Ecdysteroids) in Mammals
    1 REVIEW Effects and applications of arthropod steroid hormones (ecdysteroids) in mammals Laurence Dinan and Rene´ Lafont1 Department of Biological Sciences, University of Exeter, Exeter, Devon EX4 4PS, UK 1Laboratoire Prote´ines: Biochimie Structurale et Fonctionnelle, Universite´ Pierre et Marie Curie, 7 Quai St. Bernard, F-75252 Paris 05, France (Requests for offprints should be addressed to L Dinan who is now at 30 Hederman Close, Silverton, Nr. Exeter, Devon EX5 4HW, UK; Email: [email protected]) Abstract Zooecdysteroids (arthropod steroid hormones) regulate the metabolism and pharmacological effects of ecdysteroids in development of arthropods and probably many other mammalian systems and to draw attention to their potential invertebrates. Phytoecdysteroids are analogues occurring in applications, particularly in gene-switch technology, where a wide range of plant species, where they contribute to the ecdysteroid analogues (steroidal and non-steroidal) can be deterrence of phytophagous invertebrates. The purpose of used as effective and potent elicitors. this short review is to summarise findings on the occurrence, Journal of Endocrinology (2006) 191, 1–8 Introduction suggesting that ecdysteroids may have significantly positive pharmacological properties. This is consistent with the use of Ecdysteroids are the steroid hormones of arthropods, where several ecdysteroid-containing plant species in traditional they regulate moulting, metamorphosis, reproduction and medicines. The ready availability of large amounts of 20E diapause (Koolman 1989). They probably fulfil similar roles in from certain plant sources has led to a boom in recent years in many other invertebrate phyla, but these have not been so its inclusion in many commercial anabolic preparations for extensively investigated (Lafont 1997).
    [Show full text]
  • Nuclear Receptors: Emerging Drug Targets for Parasitic Diseases
    The Journal of Clinical Investigation REVIEW SERIES: NUCLEAR RECEPTORS Series Editor: Mitchell A. Lazar Nuclear receptors: emerging drug targets for parasitic diseases Zhu Wang,1 Nathaniel E. Schaffer,1 Steven A. Kliewer,1,2 and David J. Mangelsdorf1,3 1Department of Pharmacology, 2Department of Molecular Biology, and 3Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, Dallas, Texas, USA. Parasitic worms infect billions of people worldwide. Current treatments rely on a small group of drugs that have been used for decades. A shortcoming of these drugs is their inability to target the intractable infectious stage of the parasite. As well- known therapeutic targets in mammals, nuclear receptors have begun to be studied in parasitic worms, where they are widely distributed and play key roles in governing metabolic and developmental transcriptional networks. One such nuclear receptor is DAF-12, which is required for normal nematode development, including the all-important infectious stage. Here we review the emerging literature that implicates DAF-12 and potentially other nuclear receptors as novel anthelmintic targets. Introduction ple genes within the same pathway, nuclear receptors have become One of the most prevalent classes of parasitic organisms is the attractive targets for the development of orally available small-mol- helminth (parasitic worms), which collectively infect more than ecule drugs (4). Importantly, nuclear receptors have been identi- 1 billion people worldwide and cause a range of maladies includ- fied in all categories of helminths (see ref. 5 for a systematic review ing malnutrition, growth and mental retardation, disfigurement of nuclear receptors found in helminths). We propose that targeting and physical disabilities, and death (1).
    [Show full text]