Appl Entomol Zool (2011) 46:533–543 DOI 10.1007/s13355-011-0074-6 ORIGINAL RESEARCH PAPER Expressions of the cytochrome P450 monooxygenase gene Cyp4g1 and its homolog in the prothoracic glands of the fruit fly Drosophila melanogaster (Diptera: Drosophilidae) and the silkworm Bombyx mori (Lepidoptera: Bombycidae) Ryusuke Niwa • Takashi Sakudoh • Takeshi Matsuya • Toshiki Namiki • Shinji Kasai • Takashi Tomita • Hiroshi Kataoka Received: 25 July 2011 / Accepted: 30 August 2011 / Published online: 16 September 2011 Ó The Japanese Society of Applied Entomology and Zoology 2011 Abstract Here we describe the expression profiles of the (PTTH), a neuropeptide hormone that stimulates the syn- cytochrome P450 monooxygenase gene Cyp4g1 in the fruit thesis and release of ecdysone. We propose that Cyp4g1 fly, Drosophila melanogaster Meigen, and its homolog in and Cyp4g25 are the candidates that play a role in regu- the silkworm, Bombyx mori L. We identified Cyp4g1 by a lating PG function and control ecdysteroid production and/ microarray analysis to examine the expression levels of 86 or metabolism during insect development. predicted D. melanogaster P450 genes in the ring gland that contains the prothoracic gland (PG), an endocrine Keywords Cytochrome P450 monooxygenase Á organ responsible for synthesizing ecdysteroids. B. mori Prothoracic gland Á Bombyx mori Á Drosophila Cyp4g25 is a closely related homolog of D. melanogaster melanogaster Cyp4g1 and is also expressed in the PG. A developmental expression pattern of Cyp4g25 in the PG is positively correlated with a fluctuation in hemolymph ecdysteroid Introduction titer in the late stage of the final instar. Moreover, the expression of Cyp4g25 in cultured PGs is significantly In arthropods, steroid hormones designated as ecdysteroids, induced by the addition of prothoracicotropic hormone such as ecdysone and its derivative 20-hydroxyecdysone (20E), are essential for precise progression through devel- opment (Thummel 2001; Gilbert et al. 2002; Spindler et al. 2009). Ecdysone is synthesized from dietary cholesterol via R. Niwa (&) a series of hydroxylation and oxidation steps in the pro- Initiative for the Promotion of Young Scientists’ Independent thoracic gland (PG) during postembryonic development Research, Graduate School of Life and Environmental Sciences, (Gilbert et al. 2002). Ecdysone is subsequently converted University of Tsukuba, Seinou-tou B411, Tennoudai 1-1-1, Tsukuba, Ibaraki 305-8572, Japan to 20E by the 20-hydroxylase present in the peripheral e-mail: [email protected] tissues (Gilbert et al. 2002). Recently, molecular genetic studies using the fruit fly T. Sakudoh Drosophila melanogaster Meigen and the silkworm Bom- Division of Radiological Protection and Biology, National Institute of Infectious Diseases, byx mori L. have successfully identified several genes 1-23-1 Toyama, Shinjuku-ku, Tokyo 162-8640, Japan crucial for intermediate steps in ecdysone biosynthesis. The dehydrogenation of cholesterol to 7-hydrocholesterol T. Matsuya Á T. Namiki Á H. Kataoka (7dC), the first step in synthesizing ecdysone, is catalyzed Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, by the Rieske-domain enzyme Neverland (Nvd) (Yoshiy- 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8562, Japan ama et al. 2006; Niwa and Niwa 2011; Yoshiyama- Yanagawa et al. 2011). The conversion of 7dC to 5b-ketodiol S. Kasai Á T. Tomita is commonly referred to as a ‘‘Black Box’’ since no stable Department of Medical Entomology, National Institute of Infectious Diseases, 1-23-1 Toyama, Shinjuku-ku, intermediate has been identified (Gilbert et al. 2002). Tokyo 162-8640, Japan Recent studies have demonstrated that the cytochrome 123 534 Appl Entomol Zool (2011) 46:533–543 P450 monooxygenases, CYP307A1/Spook (Spo) and Microarray analysis CYP307A2/Spookier (Spok), and the short-chain dehy- drogenase/reductase Non-molting glossy/Shroud are We created a customized cDNA microarray, which con- involved in the Black Box reaction (Namiki et al. 2005; tained DNA fragments corresponding to 86 predicted Ono et al. 2006; Niwa et al. 2010). The terminal hydrox- D. melanogaster P450 gene that were chose in our previous ylation steps from 5b-ketodiol to ecdysone in the PG are study (Kasai and Tomita 2003). A DNA fragment corre- catalyzed by three cytochrome P450 monooxygenases: sponding to each of the 86 P450 genes was amplified by CYP306A1/Phantom (Phm), CYP302A1/Disembodied PCR as previously described (Kasai and Tomita 2003). (Dib) and CYP315A1/Shadow (Sad) (Cha´vez et al. 2000; Gene-specific primers used for PCR are listed in Table 1. Warren et al. 2002; Niwa et al. 2004; Warren et al. 2004; The DNA fragments of the 86 P450 genes were approxi- Niwa et al. 2005). The conversion of ecdysone to 20E is mately 500–600 bp in length (Table 1). PCR products were also mediated by a P450 monooxygenase, CYP314A1/ purified by agarose gel electrophoresis and then subcloned Shade (Shd), in the peripheral tissues (Petryk et al. 2003). to pCR2.1 (Invitrogen). After DNA sequences of each of Shroud and the P450 enzymes described above were the PCR products had been verified, we re-performed PCR identified from embryonic lethal mutants, known as the using pCR2.1 plasmids containing sequence-verified P450 Halloween mutants, that exhibit embryonic ecdysone fragments with the gene-specific primers (Table 1). These deficiency (Cha´vez et al. 2000). The recent discovery of PCR products were spotted onto microarrays. Total RNA these ecdysteroidogenic enzymes greatly advances our from the ring glands and the brain-ventral nerve cord knowledge of ecdysone biosynthesis at the molecular level. complex of the wandering 3rd instar D. melanogaster lar- However, it has not yet been proven whether the enzymes vae were prepared using TRIzol reagent (Invitrogen). identified thus far are sufficient for the conversion of Spotting, cRNA amplification, fluorescent labeling, cholesterol to 20-hydroxyecdysone. Therefore, it is unclear hybridization, detection and analysis were conducted by whether there are still unidentified enzyme(s) that are Bio Matrix Research, Inc., Kashiwa, Japan. One custom- responsible for ecdysone biosynthesis. ized microarray contained 4 spots for each of the P450 Here, we report that another P450 gene, Cyp4g1,is genes. Spot intensities were normalized using a summation highly expressed in the PG in D. melanogaster.Aclo- of total spot intensities in the hybridization experiments. sely related homolog of Cyp4g1 from B. mori, Cyp4g25, is also expressed in the PG, and its expression profile is RNA in situ hybridization positively correlated with a change in ecdysteroid titer in the hemolymph during the late stage of the last larval Synthesis of DIG-labeled RNA probes and RNA in situ instar. Furthermore, we show that in cultured PGs, the hybridizations were performed as previously described expression of Cyp4g25 is significantly induced by the (Lehmann and Tautz 1994). To synthesize sense and addition of the prothoracicotropic hormone (PTTH), antisense RNA probes for Cyp4g1 and Cyp310a1, EST which is a crucial neuropeptide that stimulates the syn- cDNA clones of the Berkeley Drosophila genome project thesis and release of ecdysone (Gilbert et al. 2002). GH05567 and LD44491, respectively (Stapleton et al. These results suggest that Cyp4g1 and Cyp4g25 play a 2002), were used as templates. To generate a template for role in regulating the PG function during insect synthesizing sense and antisense Cyp12e1 RNA probes, the development. ORF region of Cyp12e1 was amplified by PCR with primers (50-ATGTTGTCAACGCAGTGGAACGCAAAT AAA-30 and 50-AAACCCGATCTTAAAGTTTCTTACCA Materials and methods ACCG-30) using wild-type genomic DNA as template and subcloned into pBluescript. Insects Quantitative reverse-transcription PCR (qRT-PCR) Silkworms, B. mori (KINSYU 9 SHOWA F1 hybrid), were reared on an artificial diet (Silkmate, Nihon-Nosan- Single-stranded cDNA synthesis was performed as previ- Kogyo, Japan) at 25°C under a 16 h light/8 h dark cycle. ously described (Niwa et al. 2004). qRT-PCR was per- The first days corresponding to the developmental stages of formed using a real-time thermal Smart Cycler System the 4th to 5th larval ecdysis, wandering and pupation were (Cepheid) with the SYBR Premix ExTaq (TaKaRa). Spe- designated as V0, W0 and P0, respectively. D. melano- cific primers used in this study were the following: gaster flies were reared on standard agar-cornmeal medium Cyp4g1-forward (50-CGGTCCTGGGATTCAGTCCTAT at 25°C under a 12 h light/12 h dark cycle. Oregon R was G-30), Cyp4g1-reverse (50-CATCACCGAACCAGGGCTT used as the wild-type fly. GAAG-30), Cyp4g25-forward (50-TCGTCGGTGGATCTG 123 Appl Entomol Zool (2011) 46:533–543 535 Table 1 Primers used to amplify DNA fragments corresponding to the 86 validated and predicted D. melanogaster P450 genes that were spotted on our customized microarray Name Forward (50 [ 30) Reverse (50 [ 30) Length Cyp4c3 TGAATGTGGATCACGACGAG CTCTGGTGGAGCTTGTACT 573 Cyp4d1 ATGTTTCTGGTCATCGG GCAGATCGTGTCCATGGT 564 Cyp4d1alt ATGTGGCTCCTACTATCG GCAAATGGCGTCCAGAGC 537 Cyp4d2 TGGATTCTCCACCAGTTGG GTTGTTAACCAGCGTTTCACG 571 Cyp4d8 AGCATCTGGTGAAGCATCC AGTGGACATCAGCAGGACGT 581 Cyp4d14 GATATGCAGTTCCGACTGA GTCGTGCATGTTCTTCACG 570 Cyp4d20 AAGGGTCAACTCTACGAGT AGAGCCATCTGCGACTTGCT 560 Cyp4d21 AAAGCTCACCTCTACCGAT GTCCAGCAAAGTCATCTTAGC 567 Cyp4e1 TCCACTGTTCTTGGTGACC CTTGCACAACGGAGGAACTT 578 Cyp4e2 ACCACTGCTGCTGGTTGCA TGCACAATGGAAGAGCTG 576 Cyp4e3 GCCACTGATCACATTGGTG GGACAATGGAGGAGTCAC 575 Cyp4g1 TAGTTCAGGAGACGCTGCAA AGGATGTCAACCGTGGTCT