DOCSLIB.ORG

Supplemental Figure 1: the Majority of Genes Identified with 4C-Seq Were Positioned up to 500Kbp from the CKD Associated SNP Locus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplemental Figure 1: the Majority of Genes Identified with 4C-Seq Were Positioned up to 500Kbp from the CKD Associated SNP Locus Supplemental figure 1: The majority of genes identified with 4C-seq were positioned up to 500kbp from the CKD associated SNP locus. Graph shows the distance from the SNP to the TSS of the target genes found with 4C in HRGECs (X-axis), expressed as the number of target genes (frequency on Y- axis) per 100kbp. The majority of target genes was positioned up to 500kbp from the SNP, but occasionally candidate genes were found at locations over 1.5mb from the SNP locus (A). The TSS of the majority of candidate genes found with 4C in HRPTECs was positioned up to 500kbp from the SNP position, but some candidate genes were found at locations over 1.5mbp from the SNP locus (B). Supplemental figure 2: Target genes of DREs colocalizing with CKD-associated SNPs, highlighted in red, are enriched in the mevalonate pathway and the trans, trans-farnesyl diphosphate biosynthesis pathway (adapted from IPA). Supplemental table 1: Primer design for cloning DREs from the rs11959928 region into the STARR-seq reporter plasmid. SNP ID Chromosome Forward primer Reversed primer Location (GRCh37/hg19) chr5 ACATGGCCTATCCCTTTCCT GGATTTCCACCAGATGTTGC 39353419-39354619 chr5 CCAGTGTTAGTGCTGTTGTTGC CCCCATCCTCTGCCACTA 39355029-39356229 chr5 CAGGGTGGGTAGAGACGAGT ACCATCTCTGTGGCTCAGGT 39359279-39360479 chr5 TTGCTAACATTTGTGAGTGCTT TCCTACCTCTACAGGTTGTCACAT 39360189-39361389 chr5 ACCACATAAAGTCAAAGGAAGAA TGTGTCCTGCTGTGAGGAAT 39360529-39361729 chr5 TCAGGCTTTTCCTACCTTGC GCTATGTACTGGCAGCAGCTC 39368449-39369649 chr5 GGCATGCTGGCTGTTAAAGT CTGTTGCATGAGGTGAGTGG 39370239-39371439 rs11959928 chr5 GCACCTGGATAAGCCAGATAA GGCATAATTTTCTATCAGCTTCC 39370869-39372069 chr5 AGCCTGGGTGACAGAGTGAG TGGGAGGTGGAGGACTGTAG 39379474-39380674 chr5 GGGGCAACTACCAATAAGCA CCAATCGACACCTTCTTCGT 39382029-39383229 chr5 GCGTATTTTCTTCCTTGCTTG GCCTGACCCTGCTTAGCTT 39396569-39397769 chr5 AAAATCAATCCGCCATAAGC GGTGCAGCTGTCGCTATGTA 39400609-39401809 chr5 GGCAAAGCTGGGTGTAAGTT GCCCTCTCCACTGTGTCAG 39405129-39406329 chr5 GCTGAACGCTATAGCCCTGT CAGCCTCCTCTCCTGTCAAA 39411679-39412879 chr5 TTTGGGAATCCAGGACTGAG TTCTTGGCACTGGTCTTTCC 39412649-39413849 Supplemental table 2: Comparison of reference allele prevalence (Δ) for each variant in rs11959928 locus in STARR-seq library (input) with reference allele prevalence in transcribed RNA of HRGECs, HRPTECs, and HEK293a after transformation with STARR-seq library. Regions in bold are described in figure 2C. SNP ID Chromosome Location input 1 Input 2 HRGECs 1 HRGECs 2 Δ HRGECs 1 Δ HRGECs 2 chr5 39353722 70.5 54.5 57.4 44.1 -13.1 -10.4 chr5 39354039 97.5 89.7 94.1 98.2 -3.4 8.5 chr5 39355135 19.2 18.4 15.3 15.6 -3.9 -2.8 chr5 39355591 83.4 88.4 84.8 82.4 1.5 -6.0 chr5 39355648 82.0 87.1 83.8 83.6 1.8 -3.6 chr5 39356000 86.3 86.3 83.0 82.5 -3.2 -3.8 chr5 39359597 88.8 84.8 82.0 76.0 -6.8 -8.9 chr5 39359698 77.5 98.9 71.0 76.8 -6.4 -22.0 chr5 39360817 94.1 89.1 94.6 87.4 0.5 -1.7 chr5 39361231 72.8 69.1 100.0 100.0 27.2 30.9 chr5 39361273 74.8 71.2 100.0 100.0 25.2 28.8 chr5 39361303 36.5 31.8 17.8 3.2 -18.7 -28.6 chr5 39361359 70.2 64.8 100.0 99.1 29.8 34.3 chr5 39361382 91.2 91.5 91.4 91.1 0.2 -0.5 chr5 39361387 89.6 90.7 88.9 90.0 -0.7 -0.7 chr5 39361556 89.4 94.0 81.1 80.0 -8.3 -14.0 chr5 39361573 48.9 45.2 100.0 99.6 51.1 54.3 chr5 39368773 95.3 69.7 92.9 96.7 -2.4 27.0 chr5 39368977 82.6 95.5 88.2 86.4 5.5 -9.1 chr5 39369030 78.6 96.1 84.8 84.4 6.3 -11.7 rs11959928 chr5 39369103 87.2 95.5 79.4 83.9 -7.7 -11.5 chr5 39369492 94.9 90.7 95.7 92.8 0.8 2.1 chr5 39370386 98.7 94.3 94.9 96.9 -3.7 2.6 chr5 39370397 83.7 75.8 78.6 74.3 -5.1 -1.5 chr5 39370442 99.2 97.6 95.0 98.0 -4.1 0.4 chr5 39371493 44.5 45.2 44.1 41.6 -0.4 -3.7 chr5 39382261 58.8 56.3 57.0 55.9 -1.8 -0.4 chr5 39397132 74.0 71.8 73.3 71.8 -0.7 0.0 chr5 39397662 80.5 78.1 84.8 82.2 4.2 4.1 chr5 39400701 81.1 87.1 87.5 81.7 6.3 -5.4 chr5 39401049 82.7 70.4 80.9 77.7 -1.8 7.3 chr5 39401384 79.9 83.3 84.0 81.1 4.1 -2.2 chr5 39401620 64.1 52.3 60.0 62.6 -4.1 10.3 chr5 39405736 58.7 62.2 59.6 59.3 0.9 -2.8 chr5 39406098 66.4 66.8 64.3 65.1 -2.1 -1.7 chr5 39412248 74.4 83.6 77.7 71.5 3.3 -12.1 chr5 39412480 97.5 100.0 95.3 96.4 -2.2 -3.6 chr5 39412568 23.8 15.6 9.9 13.6 -13.9 -2.0 chr5 39412681 9.9 8.9 7.5 7.2 -2.4 -1.7 chr5 39412798 15.4 10.0 14.0 19.8 -1.4 9.8 SNP ID Chromosome Location input 1 Input 2 HRPTECs 1 HRPTECs 2 Δ HRPTECs 1 Δ HRPTECs 2 chr5 39353722 70.5 54.5 65.2 54.7 -5.3 0.1 chr5 39354039 97.5 89.7 83.1 88.0 -14.4 -1.7 chr5 39355135 19.2 18.4 14.8 16.6 -4.4 -1.8 chr5 39355591 83.4 88.4 82.6 83.9 -0.8 -4.4 chr5 39355648 82.0 87.1 81.6 81.3 -0.4 -5.8 chr5 39356000 86.3 86.3 82.8 82.4 -3.4 -3.9 chr5 39359597 88.8 84.8 74.1 68.9 -14.7 -15.9 chr5 39359698 77.5 98.9 71.3 80.5 -6.2 -18.4 chr5 39360817 94.1 89.1 100.0 75.8 5.9 -13.3 rs11959928 chr5 39361231 72.8 69.1 100.0 100.0 27.2 30.9 chr5 39361273 74.8 71.2 100.0 100.0 25.2 28.8 chr5 39361303 36.5 31.8 8.3 23.2 -28.1 -8.6 chr5 39361359 70.2 64.8 100.0 100.0 29.8 35.2 chr5 39361382 91.2 91.5 100.0 79.4 8.8 -12.2 chr5 39361387 89.6 90.7 100.0 76.2 10.4 -14.5 chr5 39361556 89.4 94.0 96.0 91.1 6.6 -2.9 chr5 39361573 48.9 45.2 100.0 100.0 51.1 54.8 chr5 39368773 95.3 69.7 80.1 100.0 -15.2 30.3 chr5 39368977 82.6 95.5 59.6 83.9 -23.1 -11.5 chr5 39369030 78.6 96.1 64.8 69.8 -13.8 -26.3 rs11959928 chr5 39369103 87.2 95.5 99.0 63.5 11.8 -32.0 chr5 39369492 94.9 90.7 100.0 73.3 5.1 -17.4 chr5 39370386 98.7 94.3 84.0 83.0 -14.7 -11.3 chr5 39370397 83.7 75.8 63.5 86.0 -20.1 10.2 chr5 39370442 99.2 97.6 84.2 75.9 -14.9 -21.6 chr5 39371493 44.5 45.2 44.7 42.4 0.2 -2.8 chr5 39382261 58.8 56.3 51.3 55.5 -7.5 -0.9 chr5 39397132 74.0 71.8 82.7 72.1 8.7 0.3 chr5 39397662 80.5 78.1 81.5 84.3 1.0 6.2 chr5 39400701 81.1 87.1 73.9 84.4 -7.3 -2.8 chr5 39401049 82.7 70.4 88.2 84.4 5.6 14.0 chr5 39401384 79.9 83.3 90.5 77.7 10.7 -5.6 chr5 39401620 64.1 52.3 60.4 52.8 -3.7 0.5 chr5 39405736 58.7 62.2 57.3 61.7 -1.4 -0.5 chr5 39406098 66.4 66.8 62.9 67.5 -3.5 0.7 chr5 39412248 74.4 83.6 70.3 90.4 -4.1 6.8 chr5 39412480 97.5 100.0 71.8 99.4 -25.7 -0.6 chr5 39412568 23.8 15.6 21.9 9.4 -1.9 -6.2 chr5 39412681 9.9 8.9 18.1 1.3 8.2 -7.6 chr5 39412798 15.4 10.0 22.7 3.5 7.3 -6.5 SNP ID Chromosome Location input 1 Input 2 HEK293a 1 HEK293a 2 Δ HEK293a 1 Δ HEK293a 2 chr5 39353722 70.5 54.5 62.8 58.9 -7.7 4.3 chr5 39354039 97.5 89.7 93.1 95.9 -4.4 6.2 chr5 39355135 19.2 18.4 16.3 15.9 -2.9 -2.5 chr5 39355591 83.4 88.4 83.5 83.3 0.1 -5.1 chr5 39355648 82.0 87.1 83.2 83.3 1.1 -3.8 chr5 39356000 86.3 86.3 82.9 82.0 -3.4 -4.3 chr5 39359597 88.8 84.8 79.3 92.3 -9.5 7.5 chr5 39359698 77.5 98.9 76.6 79.1 -0.9 -19.7 chr5 39360817 94.1 89.1 100.0 90.7 5.9 1.5 chr5 39361231 72.8 69.1 100.0 100.0 27.2 30.9 chr5 39361273 74.8 71.2 100.0 100.0 25.2 28.8 chr5 39361303 36.5 31.8 9.1 19.8 -27.4 -12.1 chr5 39361359 70.2 64.8 100.0 100.0 29.8 35.2 chr5 39361382 91.2 91.5 76.1 83.3 -15.1 -8.2 chr5 39361387 89.6 90.7 71.2 82.2 -18.4 -8.5 chr5 39361556 89.4 94.0 81.4 59.8 -8.0 -34.2 chr5 39361573 48.9 45.2 98.9 100.0 49.9 54.8 chr5 39368773 95.3 69.7 90.6 90.4 -4.8 20.7 chr5 39368977 82.6 95.5 77.7 88.4 -4.9 -7.0 chr5 39369030 78.6 96.1 78.6 90.5 0.0 -5.5 rs11959928 chr5 39369103 87.2 95.5 82.5 86.2 -4.7 -9.3 chr5 39369492 94.9 90.7 94.8 97.8 -0.1 7.1 chr5 39370386 98.7 94.3 98.9 85.8 0.2 -8.4 rs11959928 chr5 39370397 83.7 75.8 74.7 85.7 -8.9 10.0 chr5 39370442 99.2 97.6 99.1 93.6 -0.1 -3.9 chr5 39371493 44.5 45.2 42.0 45.5 -2.4 0.3 chr5 39382261 58.8 56.3 58.1 56.5 -0.7 0.2 chr5 39397132 74.0 71.8 73.6 77.1 -0.4 5.3 chr5 39397662 80.5 78.1 80.6 81.5 0.1 3.4 chr5 39400701 81.1 87.1 71.2 83.0 -9.9 -4.1 chr5 39401049 82.7 70.4 83.3 81.8 0.6 11.4 chr5 39401384 79.9 83.3 81.2 80.7 1.4 -2.7 chr5 39401620 64.1 52.3 68.1 68.0 4.0 15.7 chr5 39405736 58.7 62.2 57.3 58.1 -1.4 -4.1 chr5 39406098 66.4 66.8 64.2 62.8 -2.2 -4.0 chr5 39412248 74.4 83.6 79.7 80.7 5.3 -2.9 chr5 39412480 97.5 100.0 97.8 94.9 0.3 -5.1 chr5 39412568 23.8 15.6 6.3 8.8 -17.5 -6.7 chr5 39412681 9.9 8.9 0.9 4.6 -9.1 -4.3 chr5 39412798 15.4 10.0 10.3 9.7 -5.1 -0.3 Supplemental table 3: Datasets used for selection of active DNA regulatory elements.
Load more

Recommended publications
  • Targeted Genes and Methodology Details for Neuromuscular Genetic Panels
    Targeted Genes and Methodology Details for Neuromuscular Genetic Panels Reference transcripts based on build GRCh37 (hg19) interrogated by Neuromuscular Genetic Panels Next-generation sequencing (NGS) and/or Sanger sequencing is performed Motor Neuron Disease Panel to test for the presence of a mutation in these genes. Gene GenBank Accession Number Regions of homology, high GC-rich content, and repetitive sequences may ALS2 NM_020919 not provide accurate sequence. Therefore, all reported alterations detected ANG NM_001145 by NGS are confirmed by an independent reference method based on laboratory developed criteria. However, this does not rule out the possibility CHMP2B NM_014043 of a false-negative result in these regions. ERBB4 NM_005235 Sanger sequencing is used to confirm alterations detected by NGS when FIG4 NM_014845 appropriate.(Unpublished Mayo method) FUS NM_004960 HNRNPA1 NM_031157 OPTN NM_021980 PFN1 NM_005022 SETX NM_015046 SIGMAR1 NM_005866 SOD1 NM_000454 SQSTM1 NM_003900 TARDBP NM_007375 UBQLN2 NM_013444 VAPB NM_004738 VCP NM_007126 ©2018 Mayo Foundation for Medical Education and Research Page 1 of 14 MC4091-83rev1018 Muscular Dystrophy Panel Muscular Dystrophy Panel Gene GenBank Accession Number Gene GenBank Accession Number ACTA1 NM_001100 LMNA NM_170707 ANO5 NM_213599 LPIN1 NM_145693 B3GALNT2 NM_152490 MATR3 NM_199189 B4GAT1 NM_006876 MYH2 NM_017534 BAG3 NM_004281 MYH7 NM_000257 BIN1 NM_139343 MYOT NM_006790 BVES NM_007073 NEB NM_004543 CAPN3 NM_000070 PLEC NM_000445 CAV3 NM_033337 POMGNT1 NM_017739 CAVIN1 NM_012232 POMGNT2
    [Show full text]
  • Constitutive Activation of RAS/MAPK Pathway Cooperates with Trisomy 21 and Is Therapeutically Exploitable in Down Syndrome B-Cell Leukemia
    Author Manuscript Published OnlineFirst on March 27, 2020; DOI: 10.1158/1078-0432.CCR-19-3519 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Constitutive activation of RAS/MAPK pathway cooperates with trisomy 21 and is therapeutically exploitable in Down syndrome B-cell Leukemia Anouchka P. Laurent1,2, Aurélie Siret1, Cathy Ignacimouttou1, Kunjal Panchal3, M’Boyba K. Diop4, Silvia Jenny5, Yi-Chien Tsai5, Damien Ross-Weil1, Zakia Aid1, Naïs Prade6, Stéphanie Lagarde6, Damien Plassard7, Gaelle Pierron8, Estelle Daudigeos-Dubus4, Yann Lecluse4, Nathalie Droin1, Beat Bornhauser5, Laurence C. Cheung3,9, John D. Crispino10, Muriel Gaudry1, Olivier A. Bernard1, Elizabeth Macintyre11, Carole Barin Bonnigal12, Rishi S. Kotecha3,9,13, Birgit Geoerger4, Paola Ballerini14, Jean-Pierre Bourquin5, Eric Delabesse6, Thomas Mercher1,15 and Sébastien Malinge1,3 1INSERM U1170, Gustave Roussy Institute, Université Paris Saclay, Villejuif, France 2Université Paris Diderot, Paris, France 3Telethon Kids Cancer Centre, Telethon Kids Institute, University of Western Australia, Perth, Australia 4Gustave Roussy Institute Cancer Campus, Department of Pediatric and Adolescent Oncology, INSERM U1015, Equipe Labellisée Ligue Nationale contre le Cancer, Université Paris-Saclay, Villejuif, France 5Department of Pediatric Oncology, Children’s Research Centre, University Children’s Hospital Zurich, Zurich, Switzerland 6Centre of Research on Cancer of Toulouse (CRCT), CHU Toulouse, Université Toulouse III, Toulouse, France 7IGBMC, Plateforme GenomEast, UMR7104 CNRS, Ilkirch, France 8Service de Génétique, Institut Curie, Paris, France 9School of Pharmacy and Biomedical Sciences, Curtin University, Bentley, Australia 10Division of Hematology/Oncology, Northwestern University, Chicago, USA 11Hematology, Université de Paris, Institut Necker-Enfants Malades and Assistance Publique – Hopitaux de Paris, Paris, France 12Centre Hospitalier Universitaire de Tours, Tours, France 1 Downloaded from clincancerres.aacrjournals.org on September 30, 2021.
    [Show full text]
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions
    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function
    Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human.
    [Show full text]
  • Role of Non-Motile Microtubule-Associated Proteins in Virus Trafficking
    BioMol Concepts 2016; 7(5-6): 283–292 Review Débora M. Portilho, Roger Persson and Nathalie Arhel* Role of non-motile microtubule-associated proteins in virus trafficking DOI 10.1515/bmc-2016-0018 continuously switching between phases of growth and Received June 21, 2016; accepted November 4, 2016 shrinkage, referred to as dynamic instability (1). MTs are involved in a wide range of cellular functions, including Abstract: Viruses are entirely dependent on their ability cell morphology, division, motility, and organelle posi- to infect a host cell in order to replicate. To reach their site tioning, as well as in disease, such as neurodegenerative of replication as rapidly and efficiently as possible follow- disease, infection and immunity. Once the MT filaments ing cell entry, many have evolved elaborate mechanisms are formed by nucleation at the centrosome and elon- to hijack the cellular transport machinery to propel them- gated from the subunit pool, their stability and mechani- selves across the cytoplasm. Long-range movements have cal properties are often controlled by a set of proteins that been shown to involve motor proteins along microtubules bind along the polymer. These so-called microtubule- (MTs) and direct interactions between viral proteins and associated proteins (MAPs, not to be confused with mito- dynein and/or kinesin motors have been well described. gen-activated proteins) are essential for the regulation of Although less well-characterized, it is also becoming MT dynamics. increasingly clear that non-motile microtubule-associated Several types of MAPs have been identified in eukary- proteins (MAPs), including structural MAPs of the MAP1 otes, including MT motors, MT plus-end and minus-end and MAP2 families, and microtubule plus-end tracking tracking proteins (+ TIPs, − TIPs), centrosome-associated proteins (+ TIPs), can also promote viral trafficking in proteins and structural MAPs.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • A Curated Gene List for Reporting Results of Newborn Genomic Sequencing
    © American College of Medical Genetics and Genomics ORIGINAL RESEARCH ARTICLE A curated gene list for reporting results of newborn genomic sequencing Ozge Ceyhan-Birsoy, PhD1,2,3, Kalotina Machini, PhD1,2,3, Matthew S. Lebo, PhD1,2,3, Tim W. Yu, MD3,4,5, Pankaj B. Agrawal, MD, MMSC3,4,6, Richard B. Parad, MD, MPH3,7, Ingrid A. Holm, MD, MPH3,4, Amy McGuire, PhD8, Robert C. Green, MD, MPH3,9,10, Alan H. Beggs, PhD3,4, Heidi L. Rehm, PhD1,2,3,10; for the BabySeq Project Purpose: Genomic sequencing (GS) for newborns may enable detec- of newborn GS (nGS), and used our curated list for the first 15 new- tion of conditions for which early knowledge can improve health out- borns sequenced in this project. comes. One of the major challenges hindering its broader application Results: Here, we present our curated list for 1,514 gene–disease is the time it takes to assess the clinical relevance of detected variants associations. Overall, 954 genes met our criteria for return in nGS. and the genes they impact so that disease risk is reported appropri- This reference list eliminated manual assessment for 41% of rare vari- ately. ants identified in 15 newborns. Methods: To facilitate rapid interpretation of GS results in new- Conclusion: Our list provides a resource that can assist in guiding borns, we curated a catalog of genes with putative pediatric relevance the interpretive scope of clinical GS for newborns and potentially for their validity based on the ClinGen clinical validity classification other populations. framework criteria, age of onset, penetrance, and mode of inheri- tance through systematic evaluation of published evidence.
    [Show full text]
  • Full Disclosure Forms
    Expanding genotype/phenotype of neuromuscular diseases by comprehensive target capture/NGS Xia Tian, PhD* ABSTRACT * Wen-Chen Liang, MD Objective: To establish and evaluate the effectiveness of a comprehensive next-generation * Yanming Feng, PhD sequencing (NGS) approach to simultaneously analyze all genes known to be responsible for Jing Wang, MD the most clinically and genetically heterogeneous neuromuscular diseases (NMDs) involving spi- Victor Wei Zhang, PhD nal motoneurons, neuromuscular junctions, nerves, and muscles. Chih-Hung Chou, MS Methods: All coding exons and at least 20 bp of flanking intronic sequences of 236 genes causing Hsien-Da Huang, PhD NMDs were enriched by using SeqCap EZ solution-based capture and enrichment method fol- Ching Wan Lam, PhD lowed by massively parallel sequencing on Illumina HiSeq2000. Ya-Yun Hsu, PhD ; 3 Thy-Sheng Lin, MD Results: The target gene capture/deep sequencing provides an average coverage of 1,000 per Wan-Tzu Chen, MS nucleotide. Thirty-five unrelated NMD families (38 patients) with clinical and/or muscle pathologic Lee-Jun Wong, PhD diagnoses but without identified causative genetic defects were analyzed. Deleterious mutations Yuh-Jyh Jong, MD were found in 29 families (83%). Definitive causative mutations were identified in 21 families (60%) and likely diagnoses were established in 8 families (23%). Six families were left without diagnosis due to uncertainty in phenotype/genotype correlation and/or unidentified causative Correspondence to genes. Using this comprehensive panel, we not only identified mutations in expected genes but Dr. Wong: also expanded phenotype/genotype among different subcategories of NMDs. [email protected] or Dr. Jong: Conclusions: Target gene capture/deep sequencing approach can greatly improve the genetic [email protected] diagnosis of NMDs.
    [Show full text]
  • A Master Autoantigen-Ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A Master Autoantigen-ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases Julia Y. Wang1*, Michael W. Roehrl1, Victor B. Roehrl1, and Michael H. Roehrl2* 1 Curandis, New York, USA 2 Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, USA * Correspondence: [email protected] or [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Chronic and debilitating autoimmune sequelae pose a grave concern for the post-COVID-19 pandemic era. Based on our discovery that the glycosaminoglycan dermatan sulfate (DS) displays peculiar affinity to apoptotic cells and autoantigens (autoAgs) and that DS-autoAg complexes cooperatively stimulate autoreactive B1 cell responses, we compiled a database of 751 candidate autoAgs from six human cell types. At least 657 of these have been found to be affected by SARS-CoV-2 infection based on currently available multi-omic COVID data, and at least 400 are confirmed targets of autoantibodies in a wide array of autoimmune diseases and cancer.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Inappropriate Expression of the Translation Elongation Factor 1A Disrupts Genome Stability and Metabolism Daniel J
    © 2016. Published by The Company of Biologists Ltd | Journal of Cell Science (2016) 129, 4455-4465 doi:10.1242/jcs.192831 RESEARCH ARTICLE Inappropriate expression of the translation elongation factor 1A disrupts genome stability and metabolism Daniel J. Tarrant1, Mariarita Stirpe2, Michelle Rowe1, Mark J. Howard1, Tobias von der Haar1,* and Campbell W. Gourlay1,* ABSTRACT Thornton et al., 2003). However, despite its importance, the The translation elongation factor eEF1A is one of the most abundant mechanisms by which eEF1A participates in roles beyond proteins found within cells, and its role within protein synthesis is translation remain largely uncharacterised. Saccharomyces cerevisiae well documented. Levels of eEF1A are tightly controlled, with The yeast possesses two identical TEF1 TEF2 inappropriate expression linked to oncogenesis. However, the eEF1A-encoding genes and (Schirmaier and mechanisms by which increased eEF1A expression alters cell Philippsen, 1984). In contrast, eEF1A exists as two variant tissue- behaviour are unknown. Our analyses in yeast suggest that specific isoforms, eEF1A1 and eEF1A2, in all vertebrates. The first elevation of eEF1A levels leads to stabilisation of the spindle pole isoform, eEF1A1 is expressed in all tissues during development but body and changes in nuclear organisation. Elevation of the eEF1A2 is no longer detectable in the muscles and heart tissue of adults (Lee isoform also leads to altered nuclear morphology in cultured human et al., 1992; Chambers et al., 1998). Instead high-level expression of cells, suggesting a conserved role in maintaining genome stability. eEF1A2 is switched on in these tissues, as well as in motor neurons Gene expression and metabolomic analyses reveal that the level of of the medulla (Newbery et al., 2007).
    [Show full text]