Supplemental Figure 1: the Majority of Genes Identified with 4C-Seq Were Positioned up to 500Kbp from the CKD Associated SNP Locus

Supplemental Figure 1: the Majority of Genes Identified with 4C-Seq Were Positioned up to 500Kbp from the CKD Associated SNP Locus

Supplemental figure 1: The majority of genes identified with 4C-seq were positioned up to 500kbp from the CKD associated SNP locus. Graph shows the distance from the SNP to the TSS of the target genes found with 4C in HRGECs (X-axis), expressed as the number of target genes (frequency on Y- axis) per 100kbp. The majority of target genes was positioned up to 500kbp from the SNP, but occasionally candidate genes were found at locations over 1.5mb from the SNP locus (A). The TSS of the majority of candidate genes found with 4C in HRPTECs was positioned up to 500kbp from the SNP position, but some candidate genes were found at locations over 1.5mbp from the SNP locus (B). Supplemental figure 2: Target genes of DREs colocalizing with CKD-associated SNPs, highlighted in red, are enriched in the mevalonate pathway and the trans, trans-farnesyl diphosphate biosynthesis pathway (adapted from IPA). Supplemental table 1: Primer design for cloning DREs from the rs11959928 region into the STARR-seq reporter plasmid. SNP ID Chromosome Forward primer Reversed primer Location (GRCh37/hg19) chr5 ACATGGCCTATCCCTTTCCT GGATTTCCACCAGATGTTGC 39353419-39354619 chr5 CCAGTGTTAGTGCTGTTGTTGC CCCCATCCTCTGCCACTA 39355029-39356229 chr5 CAGGGTGGGTAGAGACGAGT ACCATCTCTGTGGCTCAGGT 39359279-39360479 chr5 TTGCTAACATTTGTGAGTGCTT TCCTACCTCTACAGGTTGTCACAT 39360189-39361389 chr5 ACCACATAAAGTCAAAGGAAGAA TGTGTCCTGCTGTGAGGAAT 39360529-39361729 chr5 TCAGGCTTTTCCTACCTTGC GCTATGTACTGGCAGCAGCTC 39368449-39369649 chr5 GGCATGCTGGCTGTTAAAGT CTGTTGCATGAGGTGAGTGG 39370239-39371439 rs11959928 chr5 GCACCTGGATAAGCCAGATAA GGCATAATTTTCTATCAGCTTCC 39370869-39372069 chr5 AGCCTGGGTGACAGAGTGAG TGGGAGGTGGAGGACTGTAG 39379474-39380674 chr5 GGGGCAACTACCAATAAGCA CCAATCGACACCTTCTTCGT 39382029-39383229 chr5 GCGTATTTTCTTCCTTGCTTG GCCTGACCCTGCTTAGCTT 39396569-39397769 chr5 AAAATCAATCCGCCATAAGC GGTGCAGCTGTCGCTATGTA 39400609-39401809 chr5 GGCAAAGCTGGGTGTAAGTT GCCCTCTCCACTGTGTCAG 39405129-39406329 chr5 GCTGAACGCTATAGCCCTGT CAGCCTCCTCTCCTGTCAAA 39411679-39412879 chr5 TTTGGGAATCCAGGACTGAG TTCTTGGCACTGGTCTTTCC 39412649-39413849 Supplemental table 2: Comparison of reference allele prevalence (Δ) for each variant in rs11959928 locus in STARR-seq library (input) with reference allele prevalence in transcribed RNA of HRGECs, HRPTECs, and HEK293a after transformation with STARR-seq library. Regions in bold are described in figure 2C. SNP ID Chromosome Location input 1 Input 2 HRGECs 1 HRGECs 2 Δ HRGECs 1 Δ HRGECs 2 chr5 39353722 70.5 54.5 57.4 44.1 -13.1 -10.4 chr5 39354039 97.5 89.7 94.1 98.2 -3.4 8.5 chr5 39355135 19.2 18.4 15.3 15.6 -3.9 -2.8 chr5 39355591 83.4 88.4 84.8 82.4 1.5 -6.0 chr5 39355648 82.0 87.1 83.8 83.6 1.8 -3.6 chr5 39356000 86.3 86.3 83.0 82.5 -3.2 -3.8 chr5 39359597 88.8 84.8 82.0 76.0 -6.8 -8.9 chr5 39359698 77.5 98.9 71.0 76.8 -6.4 -22.0 chr5 39360817 94.1 89.1 94.6 87.4 0.5 -1.7 chr5 39361231 72.8 69.1 100.0 100.0 27.2 30.9 chr5 39361273 74.8 71.2 100.0 100.0 25.2 28.8 chr5 39361303 36.5 31.8 17.8 3.2 -18.7 -28.6 chr5 39361359 70.2 64.8 100.0 99.1 29.8 34.3 chr5 39361382 91.2 91.5 91.4 91.1 0.2 -0.5 chr5 39361387 89.6 90.7 88.9 90.0 -0.7 -0.7 chr5 39361556 89.4 94.0 81.1 80.0 -8.3 -14.0 chr5 39361573 48.9 45.2 100.0 99.6 51.1 54.3 chr5 39368773 95.3 69.7 92.9 96.7 -2.4 27.0 chr5 39368977 82.6 95.5 88.2 86.4 5.5 -9.1 chr5 39369030 78.6 96.1 84.8 84.4 6.3 -11.7 rs11959928 chr5 39369103 87.2 95.5 79.4 83.9 -7.7 -11.5 chr5 39369492 94.9 90.7 95.7 92.8 0.8 2.1 chr5 39370386 98.7 94.3 94.9 96.9 -3.7 2.6 chr5 39370397 83.7 75.8 78.6 74.3 -5.1 -1.5 chr5 39370442 99.2 97.6 95.0 98.0 -4.1 0.4 chr5 39371493 44.5 45.2 44.1 41.6 -0.4 -3.7 chr5 39382261 58.8 56.3 57.0 55.9 -1.8 -0.4 chr5 39397132 74.0 71.8 73.3 71.8 -0.7 0.0 chr5 39397662 80.5 78.1 84.8 82.2 4.2 4.1 chr5 39400701 81.1 87.1 87.5 81.7 6.3 -5.4 chr5 39401049 82.7 70.4 80.9 77.7 -1.8 7.3 chr5 39401384 79.9 83.3 84.0 81.1 4.1 -2.2 chr5 39401620 64.1 52.3 60.0 62.6 -4.1 10.3 chr5 39405736 58.7 62.2 59.6 59.3 0.9 -2.8 chr5 39406098 66.4 66.8 64.3 65.1 -2.1 -1.7 chr5 39412248 74.4 83.6 77.7 71.5 3.3 -12.1 chr5 39412480 97.5 100.0 95.3 96.4 -2.2 -3.6 chr5 39412568 23.8 15.6 9.9 13.6 -13.9 -2.0 chr5 39412681 9.9 8.9 7.5 7.2 -2.4 -1.7 chr5 39412798 15.4 10.0 14.0 19.8 -1.4 9.8 SNP ID Chromosome Location input 1 Input 2 HRPTECs 1 HRPTECs 2 Δ HRPTECs 1 Δ HRPTECs 2 chr5 39353722 70.5 54.5 65.2 54.7 -5.3 0.1 chr5 39354039 97.5 89.7 83.1 88.0 -14.4 -1.7 chr5 39355135 19.2 18.4 14.8 16.6 -4.4 -1.8 chr5 39355591 83.4 88.4 82.6 83.9 -0.8 -4.4 chr5 39355648 82.0 87.1 81.6 81.3 -0.4 -5.8 chr5 39356000 86.3 86.3 82.8 82.4 -3.4 -3.9 chr5 39359597 88.8 84.8 74.1 68.9 -14.7 -15.9 chr5 39359698 77.5 98.9 71.3 80.5 -6.2 -18.4 chr5 39360817 94.1 89.1 100.0 75.8 5.9 -13.3 rs11959928 chr5 39361231 72.8 69.1 100.0 100.0 27.2 30.9 chr5 39361273 74.8 71.2 100.0 100.0 25.2 28.8 chr5 39361303 36.5 31.8 8.3 23.2 -28.1 -8.6 chr5 39361359 70.2 64.8 100.0 100.0 29.8 35.2 chr5 39361382 91.2 91.5 100.0 79.4 8.8 -12.2 chr5 39361387 89.6 90.7 100.0 76.2 10.4 -14.5 chr5 39361556 89.4 94.0 96.0 91.1 6.6 -2.9 chr5 39361573 48.9 45.2 100.0 100.0 51.1 54.8 chr5 39368773 95.3 69.7 80.1 100.0 -15.2 30.3 chr5 39368977 82.6 95.5 59.6 83.9 -23.1 -11.5 chr5 39369030 78.6 96.1 64.8 69.8 -13.8 -26.3 rs11959928 chr5 39369103 87.2 95.5 99.0 63.5 11.8 -32.0 chr5 39369492 94.9 90.7 100.0 73.3 5.1 -17.4 chr5 39370386 98.7 94.3 84.0 83.0 -14.7 -11.3 chr5 39370397 83.7 75.8 63.5 86.0 -20.1 10.2 chr5 39370442 99.2 97.6 84.2 75.9 -14.9 -21.6 chr5 39371493 44.5 45.2 44.7 42.4 0.2 -2.8 chr5 39382261 58.8 56.3 51.3 55.5 -7.5 -0.9 chr5 39397132 74.0 71.8 82.7 72.1 8.7 0.3 chr5 39397662 80.5 78.1 81.5 84.3 1.0 6.2 chr5 39400701 81.1 87.1 73.9 84.4 -7.3 -2.8 chr5 39401049 82.7 70.4 88.2 84.4 5.6 14.0 chr5 39401384 79.9 83.3 90.5 77.7 10.7 -5.6 chr5 39401620 64.1 52.3 60.4 52.8 -3.7 0.5 chr5 39405736 58.7 62.2 57.3 61.7 -1.4 -0.5 chr5 39406098 66.4 66.8 62.9 67.5 -3.5 0.7 chr5 39412248 74.4 83.6 70.3 90.4 -4.1 6.8 chr5 39412480 97.5 100.0 71.8 99.4 -25.7 -0.6 chr5 39412568 23.8 15.6 21.9 9.4 -1.9 -6.2 chr5 39412681 9.9 8.9 18.1 1.3 8.2 -7.6 chr5 39412798 15.4 10.0 22.7 3.5 7.3 -6.5 SNP ID Chromosome Location input 1 Input 2 HEK293a 1 HEK293a 2 Δ HEK293a 1 Δ HEK293a 2 chr5 39353722 70.5 54.5 62.8 58.9 -7.7 4.3 chr5 39354039 97.5 89.7 93.1 95.9 -4.4 6.2 chr5 39355135 19.2 18.4 16.3 15.9 -2.9 -2.5 chr5 39355591 83.4 88.4 83.5 83.3 0.1 -5.1 chr5 39355648 82.0 87.1 83.2 83.3 1.1 -3.8 chr5 39356000 86.3 86.3 82.9 82.0 -3.4 -4.3 chr5 39359597 88.8 84.8 79.3 92.3 -9.5 7.5 chr5 39359698 77.5 98.9 76.6 79.1 -0.9 -19.7 chr5 39360817 94.1 89.1 100.0 90.7 5.9 1.5 chr5 39361231 72.8 69.1 100.0 100.0 27.2 30.9 chr5 39361273 74.8 71.2 100.0 100.0 25.2 28.8 chr5 39361303 36.5 31.8 9.1 19.8 -27.4 -12.1 chr5 39361359 70.2 64.8 100.0 100.0 29.8 35.2 chr5 39361382 91.2 91.5 76.1 83.3 -15.1 -8.2 chr5 39361387 89.6 90.7 71.2 82.2 -18.4 -8.5 chr5 39361556 89.4 94.0 81.4 59.8 -8.0 -34.2 chr5 39361573 48.9 45.2 98.9 100.0 49.9 54.8 chr5 39368773 95.3 69.7 90.6 90.4 -4.8 20.7 chr5 39368977 82.6 95.5 77.7 88.4 -4.9 -7.0 chr5 39369030 78.6 96.1 78.6 90.5 0.0 -5.5 rs11959928 chr5 39369103 87.2 95.5 82.5 86.2 -4.7 -9.3 chr5 39369492 94.9 90.7 94.8 97.8 -0.1 7.1 chr5 39370386 98.7 94.3 98.9 85.8 0.2 -8.4 rs11959928 chr5 39370397 83.7 75.8 74.7 85.7 -8.9 10.0 chr5 39370442 99.2 97.6 99.1 93.6 -0.1 -3.9 chr5 39371493 44.5 45.2 42.0 45.5 -2.4 0.3 chr5 39382261 58.8 56.3 58.1 56.5 -0.7 0.2 chr5 39397132 74.0 71.8 73.6 77.1 -0.4 5.3 chr5 39397662 80.5 78.1 80.6 81.5 0.1 3.4 chr5 39400701 81.1 87.1 71.2 83.0 -9.9 -4.1 chr5 39401049 82.7 70.4 83.3 81.8 0.6 11.4 chr5 39401384 79.9 83.3 81.2 80.7 1.4 -2.7 chr5 39401620 64.1 52.3 68.1 68.0 4.0 15.7 chr5 39405736 58.7 62.2 57.3 58.1 -1.4 -4.1 chr5 39406098 66.4 66.8 64.2 62.8 -2.2 -4.0 chr5 39412248 74.4 83.6 79.7 80.7 5.3 -2.9 chr5 39412480 97.5 100.0 97.8 94.9 0.3 -5.1 chr5 39412568 23.8 15.6 6.3 8.8 -17.5 -6.7 chr5 39412681 9.9 8.9 0.9 4.6 -9.1 -4.3 chr5 39412798 15.4 10.0 10.3 9.7 -5.1 -0.3 Supplemental table 3: Datasets used for selection of active DNA regulatory elements.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    32 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us