Posted on Authorea 3 Jun 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159121417.71766615 — This a preprint and has not been peer reviewed. Data may be preliminary. nuneo seatrtsb prgltn L4adPTN Zhu and Zhen IL24 up-regulating potential by has osteoarthritis GNL3 on protein influence binding RNA of expression Increased rti nteptoeei fotorhii tl ed ob lrfid o h oeo N-idn protein RNA-binding of role the So, clarified. be RNA-binding to of needs mechanism of still specific members osteoarthritis the modulating of However, so by pathogenesis cartilage, [8]. osteoarthritis the of of apoptosis in apoptosis pathogenesis chondrocytes protein inhibited two the inhibiting of genes in family, two expression role HSP70 the mRNA a the increased, the plays members gene, ZFP36L1 family (ZFP36L1) protein knocking by (HSP70) 1 RNA-binding After type-like regulated proliferation, 70 36 protein is [7]. chondrocyte protein shock it regulation differentiation, finger heat particular, enzyme zinc chondrocyte In binding-protein proteolytic formation, RNA and revealed. down miRNAs chondrocyte ossification 25 been have endochondral in than have researches hypertrophy, More dietary OA miRNA OA. more chondrocyte and and for addition and one treatments syndrome chondrogenesis more In than target Recently, metabolic of due find [5]. more Both [6]. to occurrence unemployed time OA OA OA. the are over of of of in mechanism increase who development pathogenesis involved molecular and to people the the susceptibility expected on of in the is conducted 44.4% role in been influence that a role the a play reported and play osteoarthritis factors is Canada, habit disabling other It in elderly, many OA affects the aging, work. disability to of to in on by related disease 38th impact listed are a and illness significant disabilities 2010 considered to in a 291 is globally have the osteoarthritis 11th still Among the Although ranked OA can of of [3]. [4]. knee 80% prevalence (DALY) costs, KOA and About The year hip medical of (GBD), life high evidence [2]. age. disease radiographic its issue with of reveals health burden and increased global years public which population disability urgent 65 4.2%˜15.5%, aging of an above was the causes become population osteoarthritis in have main knee increase it the articular symptomatic the by of of diagnosed caused With one destruction disability is people. and progressive It osteoarthritis elderly by [1]. and characterized osteosclerosis middle-aged disorder subchondral in and joint hyperplasia degenerative synovial a cartilage, is (OA) two Osteoarthritis these of of both progression and Introduction the GNL3 1 OA. to between of contributes association contributes development PTN the the IL24 and investigating assess joint, for group. to biomarker expres- the control aimed potential the at the a study osteoarthritis, apoptosis as with This of cells genes compared downstream lesions bone angiogenesis. up-regulated the inducing significantly promoting in by were by Likewise, expression osteoarthritis gene osteoarthritis RNA the of study, PTN down. that progression showed knocked and this the results was IL24 In The to GNL3 (OA). GNL3, cells. when osteoarthritis of HeLa down-regulated level in in was differentiation. level sion transcription PTN transcription chondrocytes regulates global and with Protein which the IL24 correlates GTP-binding analyze GNL3, of and to Nucleolar to of cells used OA regulation. study was stem of genome (RNA-seq) mesenchymal transcriptome ra- mechanism sequencing in marrow the revealing molecular role bone years report key the in 65 we a on expressed above Here play conducted abundantly population (RBPs) been is the proteins have (GNL3) binding of researches 3 RNA 80% more and about treatments. more target affects Recently, find which OA. disorder of joint evidence degenerative diographic a is (OA) Osteoarthritis Abstract 2020 3, June 1 ffiito o available not Affiliation 1 u Xie Jun , 1 ae Bian Yawen , 1 psn Manandhar Upasana , 1 1 ioi Yao Xiaomin , 1 n oZhang Bo and , 1 Posted on Authorea 3 Jun 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159121417.71766615 — This a preprint and has not been peer reviewed. Data may be preliminary. eesree ycln C 3 yls ihuieslpies(oae ntebcbn etr.The vector). backbone the on (located primers Colonies universal were 37. with at shRNA overnight cycles) transformation. drop-in incubated chemical (30 were by and by plates PCR refined BamHI coli Then colony and Escherichia and kanamycin. by into gel containing HindIII brought screened plates agarose by were LB were 1.0% Plasmids onto digested on put (NEB). DNA run were Ligase vector Cells also DNA linearized was T4 HindIII A vector by by dissolved enzyme-digested ligase was kit. 2h˜3h,and pGFP-B-RS column Vector for shRNA. 37 Qiagen become at to BamHI annealed were and strands antisense and Sense software. Online by designed sequence or Silence website 2.1 sigma from osteoarthritis downloaded of were progression clones genes. downstream ShRNA the osteoarthritis two of to these methods of progression contribute and both the PTN on Materials to acting and 2 by contribute osteoarthritis IL24 osteoarthritis may of of While, development PTN progression the and the promotes 24]. joint GNL3 aggravates [19, directly, the mainly angiogenesis at IL24 promoting apoptosis that by cells speculated bone was [26]. inducing it activity by studies, phosphatase osteoblast, alkaline previous the of of on formation addition, facilitating colony specificity Based In total and OA, the [25]. formation promote of and angiogenesis colony can damage promoting which pathogenesis positive structural by chemotaxis, phosphatase the cell to osteoarthritis alkaline bone contribute of in original development that promotes essential the receptors PTN aggravate pain is the angiogenesis can local in Angiogenesis PTN in participates So, increase directly pain. and PTN 24]. cells that to [23, suggested inflammatory leads is hypoxia of repair invasion and it ischemia bone while of to [22], promotes state contributes death the that and tissue in factor and epiphysis growth Bone cell secretory a a bone [21]. playing fibroblast- is extensive embryos by mineralization, PTN human dickkopf-1 inducing osteogenic of [20]. of development induces in osteoarthritis skeletal also production participates of the and the progression and arthritis, reduces the spinal IL24 [19], aggravating determined of that in p38 is pathogenesis role reported pathway the It is apoptotic in It [18]. cells classical synovial cells diseases. the like of tumor in variety of in a role incidence apoptosis in important the apoptosis induces an with and plays correlated angiogenesis, IL24 were and that which proliferation cell of inhibits some profile gene. IL24 gene, transcription PTN the GNL3 and in gene the the changes IL24 down obtain evident to including knocking showed group osteoarthritis, after results gene control The genes the regulates High-throughput GNL3. specific and GNL3 Hela. by group of shRNA how regulated experimental by profiles investigate the gene for expression GNL3 to gene performed the utilized were down protein (RNA-seq) knocked been RNA-binding successfully sequencing We has RNA of cells. analysis role osteoarthritis. Hela of of transcriptome the treatment in pathogenesis the unbiased transcription explored for the study, we target new the in this study a involved to provide this In can related is which in closely osteoarthritis, GNL3 So, of is that pathogenesis GNL3 the protein. speculated that in GNL3 RNA-binding proved was results an it These susceptibility as Chinese Therefore, osteoarthritis [17]. osteoarthritis Han the chromosome osteoarthritis. and acting 3p21 in 3p21, of polymorphisms to chromosome osteoarthritis pathogenesis regulatory at mapped cis-acting signal clinical and been that association the had gene OA found in locus the levels study GNL3 patients to Further GNL3 contributed osteoarthritis between [16]. GNL3 of verified on relationship fluid differentiation. been expressed and the also chondrocytes abundantly tissue has Furthermore, with synovial population is in correlates cell It increased [15]. and stem significantly experiment biosynthesis, cells, be [12-14]. important to stem ribosome integrity an found mesenchymal inhibition, plays telomere were marrow which differentiation and protein bone regulation, stability RNA-binding in Protein cycle genome an GTP-binding cell Nucleolar maintenance, is proliferation, ( factor, characteristic GNL3 cell nucleostem [9-11]. in as apoptosis known role RNA and of also stages proliferation different Nucleostemin), cell affect 3, can of and process regulation target post-transcriptional and new in provide metabolism, role can key which a play OA, proteins of RNA-binding pathogenesis the with association OA. in for research treatments this in studied was GNL3 GTCCTGGTCTTGAACAAGATT : 2 Posted on Authorea 3 Jun 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159121417.71766615 — This a preprint and has not been peer reviewed. Data may be preliminary. eeas icre.Te,cenraswr lge oteGc3 eoeb oht 2]alwn 4 allowing [28] tophat2 by genome were GRch38 bases the low-quality to and 16nt aligned than adaptors were less Then reads reads short clean off. The Then, cast 0.0.13). first (Version discarded. FASTX-Toolkit were using also bases reads were sequencing 2-N raw than from more removed covering Alignment reads and Raw Ten Clean X Data HiSeq sequencing. Raw Illumina high-throughput RNA-Seq to for 2.6 applied sequencing and paired-end instructions nt manufacturer’s 150 the to for following and system roped prepared quantified were digested were refined, DNAs were amplified, libraries was the The bps cDNA tailing, 200-500 strand A to single and -80. ,the then corresponding sequencing at repair and products before stored end and ligation fragmented, of UDG, Refined and step heat-labile refined with the (Vazyme). were After Adapters mRNAs cDNA. RNA Polyadenylated VAHTS strand double (Vazyme). into Kit translated The Prep USA). Library (BioRad, electrophoresis. mRNA-seq gel Plus 1 The agarose DNase Smartspec sample, 1.5% rejudged using each RQ1 by were For (A260/A280) (Ambion). with RNA determined nm refined further TRIZOL preformed the nm/280 was of with then 260 RNA quantity of at and extracted and integrity quality absorbance treatments RNA The the DNA. phenol-chloroform measuring before remove by two to powder USA) with WI, fine Madison, refined into (Promega, further triturated was were RNA cells HeLa The sequencing standardized and then extraction CA). was Diego, RNA transcript (San each 2.5 software of Prism compression GraphPad The The using on by 2- China). 1. performed t-test using Shanghai, Table level was Bioscience, in RT-qPCR mRNA (DBI GAPDH presented Mix and to Master is procedures RT-PCR primers standard Green of by SYBR effects Bestar information done the with was assessing S1000 synthesis for Bio-Rad cDNA gene the were control knockdown. a assays GNL3 as All of utilized was nm. dehydrogenase) 570 (glyceraldehyde-3-phosphate at GAPDH expression lysates gene cell of of Assessment density number 4 relative 2.4 optical The for the 5- incubation well. measuring each After 5-dimethylthiazol-2-yl)-2, times. by to added (3-(4, 5 well. assessed was performed each MTT was sulfoxide in dimethyl to cells transfection, mL cultured added surviving after 100 and was and of hours removed mL) siRNA was 96 20 or medium and the mg/mL, vector hours, 72, (5 corresponding solution 48, with bromide) transfected 24, before diphenyl-tetrazolium *10 At hours hours, (1 10 10 for medium. cells for starvation of normal serum-starved with aliquot and (Invitrogen) An FBS FBS 2% 2% performed. containing were serum, experiments low in the maintained were cells All assay harvested MTT 2000 were Lipofectamine 2.3 cells Transfected using CO 48h. operated protocol. after 5% was manufacturer’s 100 analysis cells with the (FBS), RT-qPCR HeLa to 37 serum for according of at bovine USA) transfection cultured CA, fetal Plasmid Carlsbad, were 10% penicillin. (Invitrogen, cells with U/mL HeLa (DMEM) 100 medium and China). mycin, Eagle’s (China Hubei, modified CCTCC Wuhan, from Dulbecco’s Collection, obtained in Culture were (CCTCC@GDC0009) Type HeLa for lines, Center cell specimen. Carcinoma) (Cervical per CC Master 10G Human RT-PCR is transfections Green information and SYBR sequencing culture of Bestar Cell standard depth with by 2.2 The S1000 done China). Bio-Rad was Shanghai, the synthesis Bioscience, on CDNA (DBI performed sequencing. Mix was Sanger RT-PCR by checked and was procedures shRNA of sequence interference μ ftettlRAwsuiie o N-e irr rprto yVHSStranded VAHTS by preparation library RNA-seq for utilized was RNA total the of g ΔΔ Tmto 2] oprsn eeoeae ihtepie Student’s paired the with operated were Comparisons [27]. method CT 3 3 el/el a eddi 6wl lt with plate 96-well a in seeded was cells/well) μ /Lstrepto- g/mL 2 Posted on Authorea 3 Jun 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159121417.71766615 — This a preprint and has not been peer reviewed. Data may be preliminary. h N3epeso nteeprmna ru erae infiaty(iue2 n ) hc indicated which B), GNL3, and down 2A knocking (Figure after significantly successful. study, decreased was end this group modeling with In experimental paired the the and obtained. that in platform con- were expression sequencing successfully data Ten GNL3 transcriptome been X the have quality HiSeq samples Illunima high using of and constructed sequencing sequencing, was high-throughput library and The libraries structed. cDNA cell experiment, C). HeLa this and in 1B In enhanced genes (Figure was GNL3-regulated group apoptosis control of cell the apoptosis analysis while and with RNA-seq assay inhibited compared MTT was reproduction when by reproduction group The detected cell were GNL3-knockdown 1A). that groups the (Figure control showed in the results successful and The expression was experimental fluorescence respectively. transfection the (GFP) kit, in cell protein cells experiments fluorescent the of cytological green that apoptosis apoptosis, the and revealed and transfection, reproduction transfection of cell hours shRNA on 48 after GNL3 After knockdown out. of carried effect were the verify cells to HeLa order in In proliferation cell promotes GNL3 Information. 3.1 Supporting necrosis the steroid-induced in by arthritis, was caused rheumatoid form surgery Results consent gout, replacement informed by joint The caused with patients necrosis. lesions selected alcohol-induced joint was and excluded group criteria fracture control diagnostic neck were the association’s criteria femoral rheumatology And inclusion American following scale. the The WOMAC to experiments according (S531). and all regulations. diagnosed and IEC and was collection, guidelines (2019) Osteoarthritis relevant sample number with used: to accordance prior Huazhong protocol participant in of Uni- under each performed Committee Huazhong College from were Ethics obtained Medicine Hospital, Medical was Tongji Union the consent Technology by Wuhan informed Written approved who and at was patients Science fracture study 20 of neck This in Technology. University biopsies femoral and set-matched by Science and caused of OA versity with surgery patients replacement 20 joint from had collected were samples head Femoral verification term. Clinical were each identified 2.10 procedure were of controlling pathways enrichment FDR KEGG Benjamini-Hochberg the and and define test terms to Hypergeometric (GO) utilized in Ontology [31]. Gene server performed DEGs, 2.0 were KOBAS of 15 using GAPDH. categories amplifications for functional of PCR out 95@C that pick sample, against at To standardized each denaturing were For of analysis genes enrichment cycles the min. Functional all 40 1 2.9 of (Yeasen). min, levels for Kit 10 expression Reagents 60@C for RNA PCR RNA at The 95@C Green q-RT-PCR. extension at triplicate. SYBR for and denaturing the utilized annealing of was using PCR was compose s, System Real-time conditions preparation PCR presented (Vazyme). PCR RealTime library Transcriptase is The StepOne Reverse RNA-seq primers M-MLV the of from utilizing with information cDNA polymerase remaining performed The into reverse-transcription RNA DEGs. transcribed quantitative Total reverse the data, was of RNA-seq 4. some the Table for of performed in validity was the (q-RT-PCR) elucidate reaction chain to work, DEGs this of In A validation (DEGs). q-PCR genes transcription expressed Reverse differentially the 2.8 out screen to used rate was discovery [30] false edgeR package Bioconductor R analysis calculation The (DEG) FPKM [29]. and Genes mapped) counting Expressed fragments number Differentially million reads 2.7 per gene transcript for of utilized kilobase were per reads (fragments mapped Uniquely mismatches. < .5adfl change fold and 0.05 > or 2 < . eesta h u-ffciei o dniyn DEGs. identifying for criteria cut-off the as set were 0.5 4 Posted on Authorea 3 Jun 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159121417.71766615 — This a preprint and has not been peer reviewed. Data may be preliminary. seatrts o h xrsino L4adPNgnswr prgltdwt OA. with up-regulated of were pathogenesis genes chondrocytes the PTN with in Discussion and correlates respectively 4 IL24 and angiogenesis of cells promotes expression and the PTN D). stem and IL24 So, and mesenchymal control 4C GNL3, apoptosis marrow osteoarthritis. (Figure of 20 induces bone group level and control IL24 in expression the osteoarthritis the differentiation. expressed with with that compared abundantly showed up-regulated patients is significantly results 20 were GNL3 The specimens from B). in and specimens gene 4A head PTN patients (Figure OA femoral collected the results, were in samples the gene down-regulated verify IL24 PTN was of further PTN and To expression and IL24 the IL24 GNL3, verify of of expression to level the performed Expression that was showed down. Q-RT-PCR results knocked D). The was F). and GNL3 and 3C when 3E (Figure (Figure including gene genes PTN many PTN and a of expression in and the role affected gene significantly important knockdown IL24 an GNL3 angiogenesis. that plays found and GNL3 was immunodeficiency. inflammation that it rep- Interestingly, primary as speculated the ten such was and in top activities it concentrated proliferation biological KEGG, the are cell and of selected. 3, functions GO were series transcription, gene Figure on KEGG down-regulated apoptotic, analysis the of the enrichment differentially pathways In transduction, GNL3, Through and the of B). signal knockdown GO of and of after of analysis 3A 3 aspects subset enrichment Figure (Figure processes taxonomic in performed biological a shown the was As DEGs, in KEGG these enriched and of events GO resentative role on biological genes the expressed reveal to order In (Figure genes sets in GNL3-regulated data DEGs both of partial in clustering of transcription Functional GNL3 GNL3-mediated patterns that the expression indicated of the is consistency of it high 0.5,FDR 2E). analysis group, a differentially [?] showed control Heatmap was or samples the gene 2 RNA-seq and transcription. a [?] group gene whether FC experimental regulated determine were the extensively expression to between difference used comparison The significant were the ob- for samples. (FDR) Through were criteria more rate (DEG) evaluation or discovery two The genes between false expression expressed expressed. and differential differentially the (FC) and analyze change to compared fold selected were was between samples edgeR transcriptome Software sampling. above, correlation of tained. of detections the expression correctness the on differential genes the on the analysis most determine Based Then research, to clustering this 2D). 2C) inter-sample In (Figure (Figure used First, conducted 20 gene. was fragments (DEG). was a value [?] million samples analyzed from FPKM FPKM per were lengths of transcript samples base samples, level of between million different expression kilobase per an among the reads per at ensure of expression fragments were number to (expected gene the used FPKM in represents was mapped) differences reads expression. experiment of gene the this batch represent in compare this to data to only data the downstream, order The that the indicated In 70%. on which than results. analysis reference 90% higher experimental data above the usually the the all and of is were contamination for reliability data experiment no As of this is part reliable. was of there this was reads groups if of clean four sequencing, that proportion set, reads the transcriptome the of was in In appropriately, proportion version rate and selected genome. genome tolerance number is the the reference certain genome indicates in the a mapped located Total and After be sapiens, 3). (Table [28]. can Homo genome 2 line, reference TopHat the were cell software to was HeLa sample matched selected sequencing from We per this were in of GRCh38. reads experiment Per possibility was this clean Clean polluted in and of the samples data that generated The means the were which these, sample 95%, Among than per more sequences. reads all contaminating little. conducted were raw and were groups results adaptors 2, four sequencing of table these the removal in on the control shown by quality retained As data, experimental 2). the of (Table reliability the ensure To 5 < 0.05. Posted on Authorea 3 Jun 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159121417.71766615 — This a preprint and has not been peer reviewed. Data may be preliminary. h xrsinlvlo T eei Aptet a eryse ob ee ie ihrta htin that and than migration higher growth, times cell seven in be role to important seen an plays nearly angiogenesis, that was promoting polypeptide patients for secretory OA spinal responsible a in is of is gene PTN development PTN PTN as group. the of Similarly, control promotes synovial level [43]. in and It arthritis expression production response [42]. (MCP1) rheumatoid the pathways inflammatory 1 and signaling protein the arthritis chromosome extracellular aggravates inhibitory joint metaphase and tumor-specific which induces intracellular joint of IL24 cells, through the range that mononuclear at apoptosis wide observed response a induces been nearly with inflammatory also it was cytokine has the and patients immune-regulating aggravates OA 41], an in mainly [40, gene is it effects IL24 IL24 that of osteoarthritis. insisting level in expression group site the The control as groups. than shown control are higher the results twice and The groups q-RT-PCR. OA for the the selected osteoarthritis, were between of groups pathogenesis control the promoting the in genes, in and GNL3 mean role patients downstream of important OA role of an of the play expression prove tissues PTN further the local and To affected IL24 osteoarthritis. GNL3 transcription. of protein development RNA the affecting was RNA-binding by up-regulation that PTN, and gene confirmed IL24 is PTN including it where work, results this of experiments. In sets of appropriate sets two eight our selected in only significant. upregulated of we is not development PTN the heat-map, that with Notably the obviously associated draw is closely molecules. To It been adhesion have researches. gene, cell previous PTN and in and pathway osteoarthritis gene IL24 signality pathway, genes, B down-regulated p53-Akt pathway, two NF-kappa p53 the genes pathway, cancer, signality down-regulated Jak-STAT in as of misregulation immunodeficiency. such functions pathways primary transcription in and the proliferation comprised that cell were showed into transcription, DEGs clustered results The apoptotic, were transduction, the genes expression, signal interestingly in these differential mainly and showed of were functions genes databases, The of KEGG number expression. and large gene GO a regulated knock-down, extensively GNL3 gene levels highly that GNL3 expression results indicating during for 38]. the quantifying that observed [36, measured making precise was replicates [38] was very It concentrations biological magnitude at known and controlled of of technical mapped RNA both is orders spike-in million large for RNA-seq five and 16 a reproducible spanning (q-PCR) analyzed over limit, [39]. PCR that range levels reads upper quantitative study expression a sequence using quantification a detect and mouse in revealed no can [38], measured million it also has was cerevisiae 40 So RNA-seq range RNA-seq Saccharomyces 9,000-fold obtained. in than [35]. sequences 37]. reads greater of butterfly [36, A number fritillary regions range. the Glanville dynamic not with transcriptional of is associated of RNA- is transcriptome RNA-seq sequence 454-based which the all, example, the For sequence of in sequences. to First changes genome used existing advantages. to was several corresponding seq and has transcripts information. experimental detecting transcriptome RNA-seq complete the to obtain methods, limited on to cells hybridization performed Hela in traditional was down studies knocked Unlike (RNA-seq) was gene some sequencing GNL3 genes after we RNA and groups downstream control high-throughput Therefore, protein, of experiment, [34]. expression RNA-binding this and osteoarthritis an In osteoarthritis. transcription of of as the loci molecular incidence GNL3 affects gene the specific GNL3 susceptibility on affecting the thus protein the studies GNL3 RNA-binding [16], with of previous that interacts mechanism population the few speculated GNL3 potential Han that the that been cell Chinese showed of confirmed have possibilities in studies and have multiple There previous role rats considered We OA. Although important OA clarified. in an in 13]. been plays increased not [12, has nucleostemin, gene aspects mechanism GNL3 as other and known of regulation also expression cycle of osteoarthritis. 3), been transcription cell of Protein yet the targets proliferation, affecting not GTP-binding therapeutic by has new (Nucleolar osteoarthritis provided mechanism of GNL3 has specific pathogenesis study the osteoarthritis. the this of 33], affected So pathogenesis [32, indirectly the genes. in OA GNL3 downstream GNL3 that of protein found RNA-binding Although onset of is the disorder. role It joint the to investigated and related study bone This degenerative closely a clarified. are is obesity osteoarthritis that and known aging is it studies, previous Throu ± tnaddvaino he ee.I niae htteei infiatdffrnei eeexpression gene in difference significant a is there that indicates It genes. three of deviation standard 6 Posted on Authorea 3 Jun 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159121417.71766615 — This a preprint and has not been peer reviewed. Data may be preliminary. 1]L eg .Ln .Pn,J .Hu .Le .Y i,R .Tsai, Y. R. Tsai, Lin, Y. Y. R. Yasumoto, S. H. Lee, Zhu, S. Q. Hsu, [13] K. J. Zhang, Peng, Y. G. Ye, Y. Lin, Chen, 110 Luo, T. J. X. Meng, Wen, Wei, L. S. Y. [12] Xie, Hou, J. T. Li, Cui, Z. J. Wang, R. J. [11] Ling, H. Zhong, W. Chun, Wang, 26-34. S. F. Wang, J. Richter, Chun, Q. D. H. [10] J. Dai, C. Moor, K. Choi, de Zhu, S. H. Z. W. C. Qin, Kim, [9] A. E. Tang, H. T. Son, Liu, O. F. Y. Qu, [8] X. Tian, B. Wu, C. [7] Arthritis National W. Hirsch, Wolfe, R. F. Gabriel, Kremers, S. M. Deyo, H. A. Katz, R. N. Choi, J. H. Jordan, Arnold, M. M. J. L. Hunder, Helmick, G. G. Data, G. C. Felson, Hochberg, T. C. D. M. Lawrence, C. R. [2] Waddell, D. Mandelbaum, B. [1] interest. of conflict References commercial 5 or financial no declare authors The (ABL-7702069). ABLife China by interest of supported Foundation of partially Science Conflict was Natural study National by This provided 81802722). work and this (81501888 for genes funding PTN acknowledge cell and gratefully We IL24 of gene. of STAT3 regulation levels with and expression interaction the GNL3, PTN PTN Acknowledgement through down of of reduced knocking expression are signaling the after pathway reducing JAK-STAT that apoptotic thereby the believe MAPK ALK, anti- in we of of induces the Therefore, function level which the [52]. in expression (ALK) inhibit gene step the can kinase inhibitor activated, STAT3 Of important lymphoma was [51]. Activator STAT3 an anaplastic proliferation And when Binding is Transducer that [50]. activation shown Signal increased pathway been with IL24 GNL3 has interaction patients, gene It OA its downstream of [49]. through (STAT3) specimens pathway 3 genes. the JAK-STAT Transcription downstream in the two and these in affects cells of that GNL3 HeLa than both higher in on times observed acting seven by results about osteoarthritis the changes expressed developed from histopathological also of earliest Hence, was behavior the GNL3 group. the of the promotes [48]. control one and arthritis influences [46], is non-communicable cells also Angiogenesis chronic progenitor PTN [47]. in endothelial microenvironment of angiogenesis, angiogenic migration promoting and of proliferation directly formation the to promoting by addition cells In other 45]. [44, angiogenesis 6 .Brouz,F uii .A Scire, A. C. Furini, March, F. L. Bortoluzzi, Woolf, A. Marshall, A. [6] A. Buchbinder, D. Flanagan, R. M. Vos, W. Guillemin, Sanmartin, T. C. F. Hennessy, Osborne, 2017 D. Williams, Garner, R. S. R. Cicuttini, Sharif, Bridgett, B. F. L. [5] Fransen, Wang, Jones, M. L. G. Ackerman, Bao, Laslett, Dis I. G. Liu, L. Rheum Nolte, H. F. Ann L. S. Wang, J. Hoy, Hill, L. Xiong, D. S. L. C. Smith, Zhuang, C. Y. E. G. Qiu, Cross, Z. D. M. Song, W. [4] T. Duan, Lin, L. W. B. X. Cheng, Liang, G. S. 2010129. Z. L. Zhang, Liu, W. Q. X. Y. Huang, D. [3] 11415-20. , , rhii Rheum Arthritis 25 249-258. , 2014 , 2008 73 1323-1330. , , 58 Orthopedics n e Cytol Rev Int 26-35. , o elBiol Cell Mol uomu Rev Autoimmun 2005 2001 , 28 2006 7 , 203 s207-14. , Gene 2018 , 567-608. , 26 2019 a Commun Nat , 9279-90. , 17 , 1097-1104. , n o Med Mol J Int 687 rcNt cdSiUSA S U Sci Acad Natl Proc 125-134. , anRsManag Res Pain 2019 , 2014 seatrtsCartilage Osteoarthritis 10 77. , Gene , 34 2018 2019 13-23. , , 2013 , 2018 697 , , , Posted on Authorea 3 Jun 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159121417.71766615 — This a preprint and has not been peer reviewed. Data may be preliminary. 2]I .Mcoad .C i,C .S,Y .Wn,C .Ta,C .Tang, R. H. Shakesheff, M. C. K. Howdle, Tsai, M. H. S. Clarke, C. M. Wang, N. Roach, H. I. H. Y. Partridge, A. Su, K. M. Tare, Oreffo, S. C. O. R. Yang, N. Liu, X. Lelovas, P. C. [26] P. S. Lamprou, M. MacDonald, Khaldi, J. ,DOI:10.3390/ijms19072012. L. Vasiliadis, I. F. E. Vasiliadis, [25] Grivas, Papadimitriou, E. B. E. Dangas, Dontas, T. S. A. Kouvaras, Chronopoulos, I. I. E. Papaioannou, Grivas, Kaspiris, B. A. T. Gilbert, [24] Khaldi, R. L. Papadimitriou, S. Heroult, E. Morgan, Courty, M. F. J. Mikelis, E. Liote, C. Garces, Kaspiris, A. Aya-ay, A. J. [23] Bian, H. Kim, K. Papadimitriou, H. E. [22] Giannoudis, Deleuran, V. B. P. Hvid, Liang, Panagiotopoulos, M. E. D. Kaspiris, Jurik, 1816-1823. Liu, A. G. Lamprou, X. A. M. Wu, Schiottz-Christensen, Shan, [21] L. B. B. Yang, Wang, Andersen, X. N. Y. Du, Y. M. Immunol Zhou, Liu, Exp Kragstrup, M. L. W. Zhang, Li, T. C. Z. Sun, [20] G. Feng, Zhao, M. L. Wang, Ma, M. X. [19] Wu, Loughlin, Y. J. Chen, Reynard, N. F. Oncotarget L. Dang, Liu, Raine, X. V. B. Duan, E. [18] N. Clubbs, Wang, F. T. X. Nabil, C. Gong, D. M. Gee, Davey, F. L. F. Ma, Elsebaie, E. [17] W. A. N. Cheng, M. Nagaty, H. Strein, M. Liu, C. M. B. Zakaria, Beckmann, [16] M. Hentze, M. Z. W. B. Louka, M. L. Horos, Krijgsveld, M. J. R. [15] Steinmetz, Eichelbaum, M. K. L. Preiss, Fischer, T. B. Humphreys, Castello, A. [14] 2]C rpel .A ilas .Pre,A otzv,G wn .J a ae,S .Slbr,B J. B. Salzberg, L. S. Baren, van J. M. Kwan, G. Mortazavi, A. Salzberg, Pertea, L. G. Pachter, S. Williams, L. Kelley, A. Wold, R. B. Pimentel, Trapnell, H. C. Trapnell, [29] C. Pertea, G. Kim, D. Schmittgen, [28] D. T. Livak, J. K. [27] .B a er,K hpa,P eoks .E lir .A als .Adn .Cr,M oet,A. Doherty, Loughlin, M. J. Carr, Spector, A. D. Arden, T. N. Valdes, Wallis, M. A. A. G. Ralston, Ollier, Uitterlinden, H. E. G. S. W. A. 815-823. P. Willkinson, Stykarsdottir, Deloukas, Arden, J. F. P. U. M. E. Birrell, Mitchell, Stefansson, Chapman, F. J. Dixon, S. K. Wheeler, K. K. McCaskie, Koller, Salter, M. Meurs, Sherburn, Watkins, C. D. van B. K. N. Rai, Walker, B. E. Keen, Zhai, A. K. J. R. Metspalu, P. G. Swift, Yadav, Joseph, A. D. Metrustry, Rivadeneira, K. Meulenbelt, J. F. S. I. Gordon, V. Reed, Ioannidis, A. Shin, Mangino, R. Doherty, Y. M. S. M. Paling, S. Carluke, E. Potter, Bos, I. O’Neill, Battley, C. Bumpstead, D. K. Ingvarsson, S. S. P. Blackburn, S. Hunt, T. Aslam, H. Day-Williams, E. Beazley, Houwing-Duistermaat, Kloppenburg, N. C. G. S. Ricketts, J. M. A. Elliott, M. Ratnayake, J. Rayner, S. Kerkhof, M. Hoffman, Raine, W. K. J. V. A. N. E. H. Evangelou, Thorleifsson, Southam, G. E. L. Jonnson, Slagboom, Esko, Panoutsopoulou, H. K. T. Jonsdottir, Boraska, Zeggini, E. I. V. arc, Lopes, C. C. O. M. arc, McBeth, C. J. Wei, O. McCabe, L. [34] S. Li, P. Y. O’Neill, C. W. Gao, T. G. [33] Kong, L. Mandl, Dong, A. S. Wu, L. J. [32] Ding, Y. Huang, J. Mao, Res Smyth, X. K. Xie, G. C. McCarthy, [31] J. D. Robinson, D. M. [30] 2011 , oeMnrRes Miner Bone J 39 2017 2017 W316-322. , , seatrtsCartilage Osteoarthritis 8 a Biotechnol Nat , 40791-40803. , 189 342-351. , 2003 2010 Methods on oeSpine Bone Joint , 18 , 47-57. , 28 2019 2001 511-515. , etPatRsCi Rheumatol Clin Res Pract Best Cytokine , 27 , 25 Bioinformatics 359-364. , 8 2013 402-408. , 2016 , 80 , 78 407-413. , 7-15 , M e Genet Med BMC 2010 c Rep Sci Cell no Rep Oncol , 26 2012 eoeBiol Genome Bone Gene 2018 139-140. , 2018 , 149 2009 2016 , 2016 , 2014 8 32 1393-406. , Lancet 9610 , Injury , 312-326. , , 45 2013 , 587 , 35 n o Sci Mol J Int 15 280-288. , uli Acids Nucleic 2012 3122-3130. , 27-32. , 2014 , 53. , 14 , R36. , , 380 Clin 45 , , Posted on Authorea 3 Jun 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159121417.71766615 — This a preprint and has not been peer reviewed. Data may be preliminary. al .qR-C rmr o eeepeso qualification. expression gene for Nakagawa, primers K. q-RT-PCR Janne, 1. A. Deuel, T. P. Table F. Zhu, Nishio, T. K. Y. Vega, Okamoto, Liu, A. I. Takezawa, Y. Z. J. Park, K. Yu, Chang, J. Zhou, [52] D. Y. M. L. Zhang, Liu, Lee, Yan, W. Y. T. J. Perez-Pinera, J. Zhang, C. Ma, P. Kim, Y. Chen, Q. [51] C. Yu, H. Xu, J. Guan, X. W. Kim, Wu, W. Gan, Y. Wang, Z. X. J. W. Zhang, Kang, [50] Li, C. L. Yang, C. Zhou, Yuan, Zhong, X. Y. Y. X. He, Liu, Huang, F. Zhu, Q. X. Zhou, D. Yang, Li, Chen, Y. D. L. Tang, Zhang, Zhang, L. W. Ma, Wei, L. Wachsmann- J. Huo, S. Jin, K. Sierra-Honigmann, Wang, R. J. M. [49] Schett, Qin, G. M. McInnes, Springer, Chen, B. L. H. I. M. Song, [48] Lee, L. J. Wang, R. L. Shah, Yeghiazarians, Zeng, K. Y. P. Z. Real, Hogiu, Sharifi, M. G. W. B. Lao, [47] D. Block, I. C. V. Wong, Tsirmoula, Physiol L. Cell S. M. Heiss, Theochari, C. K. [46] Boudouris, Koutsioumpa, P. Vourtsis, M. D. Lampropoulou, Sfaelou, 190. E. E. Lamprou, Mikelis, M. C. Theodoropoulou, Papadimitriou, Deleuran, E. B. Iversen, [45] Papadimitriou, L. E. Koutsioumpa, Hokland, M. M. Mikelis, Jorgensen, C. A. [44] Holm, C. Gopalkrishnan, Otkjaer, V. A. K. R. Dent, 2008 Rich, Kragstrup, P. Valerie, W. D. K. T. Randolph, Netto, A. [43] Choo, G. T. H. Senzer, Merritt, Su, J. Z. Fisher, N. Z. Hood, B. Lebedeva, Wart P. Cunningham, V. van I. C. J. Sauane, Grimm, M. Zhang, A. [42] E. Y. Ekmekcioglu, Su, S. Parker, Ramesh, D. K. Chada, R. Mhashilkar, Nemunaitis, S. Coffee, A. K. J. Zhang, Parker, Tong, K. Y. Mhashilkar, Nemunaitis, Senzer, W. J. N. A. Tong, Coffee, A. K. [41] Merritt, Hood, A. J. Richards, J. Wold, D. Chada, Vukelja, B. S. S. Schaeffer, Cunningham, L. C. McCue, C. K. [40] Williams, Snyder, A. S. M. B. Varhol, Gerstein, Mortazavi, M. R. A. Raha, [39] McDonald, D. H. Shou, E. C. Pugh, Waern, H. T. K. Ranade, Wang, Krzywinski, 1344-1349. S. Z. M. Nagalakshmi, S. Hirst, U. Lee, [38] M. C. Fejes, L. C. A. A. Bruce, Taylor, Marra, Bainbridge, J. F. M. M. D. S. Jones, Grimmond, Brown, Perkins, Morin, M. K. C. S. R. M. McKernan, A. Faulkner, [37] J. J. Robertson, K. G. Marden, J. Manning, Gardiner, H. A. M. B. J. Bethel, J. B. Hanski, Peckham, G. Kolle, I. Wani, G. Crawford, Forrest, S. L. R. Steptoe, D. A. Frilander, Cloonan, J. N. M. Fescemyer, [36] W. H. Wheat, W. Ecol C. Mol Vera, C. J. [35] , 41 2008 o Ther Mol 16-23 , 2008 acrRes Cancer , 17 Biotechniques N3FradAGAGGTGTTGGATGCCAGAG Forward (5’-3’) Sequence GNL3 CGGAGTCAACGGATTTGGTCGTAT Primer Forward GAPDH Gene , reislrTrm acBiol Vasc Thromb Arterioscler 215 1636-1647. , 2005 o ytBiol Syst Mol 366-373. , 2004 , 11 nlJMed J Engl N ees TGAACACCACTGTTGGCAAT Reverse AGCCTTCTCCATGGTGGTGAAGAC Reverse , 2008 160-172. , 64 2988-2993. , 2017 , 45 81-94. , , 13 2011 965. , n Oncol J Int , 2006 365 eetPtAtcne rgDiscov Drug Anticancer Pat Recent 9 2205-2219. , , 26 o Ther Mol 2018 1273-1280. , a Methods Nat , ilChem Biol J lnCne Res Cancer Clin a Methods Nat 53 2005 u yoieNetw Cytokine Eur 47-58. , 2008 , 11 2007 149-159. , , 2008 5 2011 613-619. , Science , 2007 , 282 5 , 2009 621-628. , 17 28683-28690. , , 2008 2140-2148. , 2 , 175-186. , 20 Cytokine , 180- , 320 J , Posted on Authorea 3 Jun 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159121417.71766615 — This a preprint and has not been peer reviewed. Data may be preliminary. apesCr shGnl3 cells. HeLa of Rep1 apoptosis cell in promoted P-value knockdown cells. GNL3 HeLa that revealed 0.0107.*P of cytometer and reproduction Flow 0.000268 cell respectively (C) inhibited are knockdown sets Rep2 GNL3 and that revealed assay tRNA. (B)MTT and rRNA mainly the 1. are and Figure genome locations mapped reference Multiple Total the with in in Reads reads locations legends reads. of Multiple Figure with mapped proportion Total reads reads: the Total in of mapped and analysis.b) Total number reads genome subsequent c) the of reference for genome. reads: proportion the used the multiple in Total to are d) mapped located which been uniquely reads, shCtrl reads. have reads clean that of in reads number of reads proportion the of and pairs number of the number mapped: the reads: Total a) mapped Multiple Total mapped Uniquely Total mapped Total reads Total genome Unique reference tag: the Unique to Sample e) compared reads. were raw data in reads. sequencing were used clean reads Effective original reads was of Clean 3. the raw sequences proportion of Table effective reads, and from proportion of reads Clean sequences the number non-repeat original Per: Clean: the of Clean of c) number and d) tag, bases, number calling. low-quality the analysis. base and subsequent reads, by sequence for converted Raw adaptor and the Raw: sequencing from b) removed by obtained number. data Sample image ID: Sample a) sequences effective quality High 2. Table N3pooe elvaiiy A F ursec xrsinatrtaseto o 8hours. 48 for transfection after expression fluorescence GFP (A) viability. cell promotes GNL3 eePie eune(5’-3’) Sequence Primer Gene L4FradTCTCATCGTGTCACAACTG Forward GAGAATGGCAGTGGAGTG Forward IL24 PTN htl7087 42819.6 30932962(41.29%) 28316498(38.74%) 95.96% Tag Unique 74920851 95.30% Per Clean 78078976 73102684 76707134 Clean shCtrl shGnl3 Raw SampleID ees ATCCAGGTCAGAAGAATGTC Reverse GCTTGGAGATGGTGACAG Reverse 192 32% 836 (2.78%) 1853760 70622804 (97.22%) 64926867 (94.56%) 66780627 (3.24%) 2149322 (96.76%) 64232872 (91.84%) 66382194 72284154 10 < .0 ***P 0.10, < .1cmae otecnrlgroups. control the to compared 0.01 Posted on Authorea 3 Jun 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159121417.71766615 — This a preprint and has not been peer reviewed. Data may be preliminary. hno qa otehrzna oriaeo hspit E etmpsosteheacial clustered hierarchically GNL3 the and shows on control map point for Heat values each less (E) expression For is transcript value point. the FPKM genes. this comparing whose of of samples. from genes The knockdown coordinate proportion resulted of horizontal the matrix sample. proportion the correlation and represents the Pearson number to right in number the equal the genes the represents or detected represents on coordinate than left all vertical coordinate the blue its of vertical on curve, in values the coordinate the labeled FPKM vertical and are the of genes, value, down-regulated of distribution FPKM Identification whereas of Cumulative the (C) red, (D) represents 4.604E-10. in coordinate is labeled map. horizontal Methods. P-value and are heat analysis. Materials genes the q-RT-PCR in Up-regulated in GNL3 explained of been genes. result has regulated The that GNL3 (B) as calculated 0.00441. were is values P-value FPKM data. sequencing RNA 2. Figure N-e nlsso N3rgltdgnsi eacls A N3epeso unie by quantified expression GNL3 (A) cells. HeLa in genes GNL3-regulated of analysis RNA-seq 11 Posted on Authorea 3 Jun 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159121417.71766615 — This a preprint and has not been peer reviewed. Data may be preliminary. hw ersino T xrsinatrGL ncdw.()qR-C fI2 eei eacells. HeLa plot in IGV-sashimi gene IL24 (D) of q-RT-PCR line. (E) cells. horizontal HeLa the knockdown. The in GNL3 by gene knockdown. after sequences PTN GNL3 expression of intron after q-RT-PCR PTN expression and (F) down- of IL24 boxes GNL3 repression of by of a repression pathways denoted shows a KEGG are representative shows ten sequences plot top IGV-sashimi exon The (C) (B) genes. genes. regulated down-regulated GNL3 of processes 3. Figure ucinlcutrn fGL-euae ee.()Tetptnrpeettv Obiological GO representative ten top The (A) genes. GNL3-regulated of clustering Functional 12 Posted on Authorea 3 Jun 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159121417.71766615 — This a preprint and has not been peer reviewed. Data may be preliminary. scnrl D -TPRo N3 L4adPNgn n2 ainswt seatrtsad2 control 0.0073.*P 20 and and 0.0230 osteoarthritis 0.0010, with respectively patients are patients 20 sets OA in PTN in gene and Blot PTN from IL24 Western removed and < GNL3, (C) specimen IL24 in head GNL3, cartilage. P-value femoral The of articular samples. (B) q-RT-PCR of (D) joints. degeneration hip controls shows the vs osteoarthritis of narrowing with shows patient OA the with patient a of pelvis 4. Figure .1cmae otecnrlgroups. control the to compared 0.01 xrsinlvlo N3 L4adPNgn nteO ains()Terdorp fthe of radiograph The (A) patients OA the in gene PTN and IL24 GNL3, of level Expression 13 < .0 ***P 0.10, Posted on Authorea 3 Jun 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159121417.71766615 — This a preprint and has not been peer reviewed. Data may be preliminary. 14