Pioneer Transcription Factors in Cell Reprogramming
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Prospective Isolation of NKX2-1–Expressing Human Lung Progenitors Derived from Pluripotent Stem Cells
The Journal of Clinical Investigation RESEARCH ARTICLE Prospective isolation of NKX2-1–expressing human lung progenitors derived from pluripotent stem cells Finn Hawkins,1,2 Philipp Kramer,3 Anjali Jacob,1,2 Ian Driver,4 Dylan C. Thomas,1 Katherine B. McCauley,1,2 Nicholas Skvir,1 Ana M. Crane,3 Anita A. Kurmann,1,5 Anthony N. Hollenberg,5 Sinead Nguyen,1 Brandon G. Wong,6 Ahmad S. Khalil,6,7 Sarah X.L. Huang,3,8 Susan Guttentag,9 Jason R. Rock,4 John M. Shannon,10 Brian R. Davis,3 and Darrell N. Kotton1,2 2 1Center for Regenerative Medicine, and The Pulmonary Center and Department of Medicine, Boston University School of Medicine, Boston, Massachusetts, USA. 3Center for Stem Cell and Regenerative Medicine, Brown Foundation Institute of Molecular Medicine, University of Texas Health Science Center, Houston, Texas, USA. 4Department of Anatomy, UCSF, San Francisco, California, USA. 5Division of Endocrinology, Diabetes and Metabolism, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts, USA. 6Department of Biomedical Engineering and Biological Design Center, Boston University, Boston, Massachusetts, USA. 7Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, Massachusetts, USA. 8Columbia Center for Translational Immunology & Columbia Center for Human Development, Columbia University Medical Center, New York, New York, USA. 9Department of Pediatrics, Monroe Carell Jr. Children’s Hospital, Vanderbilt University, Nashville, Tennessee, USA. 10Division of Pulmonary Biology, Cincinnati Children’s Hospital, Cincinnati, Ohio, USA. It has been postulated that during human fetal development, all cells of the lung epithelium derive from embryonic, endodermal, NK2 homeobox 1–expressing (NKX2-1+) precursor cells. -
UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By
UNIVERSITY OF CALIFORNIA, IRVINE Combinatorial regulation by maternal transcription factors during activation of the endoderm gene regulatory network DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences by Kitt D. Paraiso Dissertation Committee: Professor Ken W.Y. Cho, Chair Associate Professor Olivier Cinquin Professor Thomas Schilling 2018 Chapter 4 © 2017 Elsevier Ltd. © 2018 Kitt D. Paraiso DEDICATION To the incredibly intelligent and talented people, who in one way or another, helped complete this thesis. ii TABLE OF CONTENTS Page LIST OF FIGURES vii LIST OF TABLES ix LIST OF ABBREVIATIONS X ACKNOWLEDGEMENTS xi CURRICULUM VITAE xii ABSTRACT OF THE DISSERTATION xiv CHAPTER 1: Maternal transcription factors during early endoderm formation in 1 Xenopus Transcription factors co-regulate in a cell type-specific manner 2 Otx1 is expressed in a variety of cell lineages 4 Maternal otx1 in the endodermal conteXt 5 Establishment of enhancers by maternal transcription factors 9 Uncovering the endodermal gene regulatory network 12 Zygotic genome activation and temporal control of gene eXpression 14 The role of maternal transcription factors in early development 18 References 19 CHAPTER 2: Assembly of maternal transcription factors initiates the emergence 26 of tissue-specific zygotic cis-regulatory regions Introduction 28 Identification of maternal vegetally-localized transcription factors 31 Vegt and OtX1 combinatorially regulate the endodermal 33 transcriptome iii -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Construction of a Cerna Network Combining Transcription Factors in Eutopic Endometrial Tissue of Tubal Factor Infertility and Endometriosis-Related Infertility
Construction of a ceRNA network combining transcription factors in eutopic endometrial tissue of tubal factor infertility and endometriosis-related infertility Junzui Li ( [email protected] ) Xiamen University https://orcid.org/0000-0002-6640-8215 Lulu Ren Xiamen University Medical College Cui Yang Xiamen University Medical College Rongfeng Wu Xiamen University Medical College Zhixiong Huang Xiamen University School of Life Sciences Qionghua Chen Xiamen University Medical College Research article Keywords: TFI, endometriosis-related infertility, DEGs, ceRNA network, TFs Posted Date: December 19th, 2019 DOI: https://doi.org/10.21203/rs.2.19312/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/27 Abstract Purpose Although tubal factor infertility (TFI) and endometriosis-related infertility all can result in female infertility, the pathogenesis of TFI and endometriosis-related infertility were different. The pathophysiologic mechanisms of TFI and endometriosis-related infertility have not been investigated thoroughly. Thus, the aim of the study is to identify the potential crucial genes, pathways, transcription factors (TFs) and long non-coding RNAs (lncRNAs) associated with TFI and endometriosis-related infertility, and further analyze the molecular mechanism implicated in genes. Methods 3 patients with TFI and 3 patients with endometriosis-related infertility were recruited, and microarray hybridization of the eutopic endometrial tissue during the window of implantation (WOI) was performed to examine the expression of mRNAs and lncRNAs. First, differentially expressed genes (DEGs) and differentially expressed lncRNAs (DELs) were screened out based on P < 0.05 and fold change (FC) ≧ 2. Second, gene ontology, pathway and TFs enrichment analyses and PPI network construction of DEGs were performed. -
Functional Characterisation of MYT1L, a Brain-Specific Transcriptional Regulator
This electronic thesis or dissertation has been downloaded from the King’s Research Portal at https://kclpure.kcl.ac.uk/portal/ Functional characterisation of MYT1L, a brain-specific transcriptional regulator Kepa, Agnieszka Maria Awarding institution: King's College London The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without proper acknowledgement. END USER LICENCE AGREEMENT Unless another licence is stated on the immediately following page this work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International licence. https://creativecommons.org/licenses/by-nc-nd/4.0/ You are free to copy, distribute and transmit the work Under the following conditions: Attribution: You must attribute the work in the manner specified by the author (but not in any way that suggests that they endorse you or your use of the work). Non Commercial: You may not use this work for commercial purposes. No Derivative Works - You may not alter, transform, or build upon this work. Any of these conditions can be waived if you receive permission from the author. Your fair dealings and other rights are in no way affected by the above. Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 04. Oct. 2021 Functional characterisation of MYT1L, a brain-specific transcriptional regulator Agnieszka Kępa 2014 A thesis submitted to King’s College London for the degree of Doctor of Philosophy MRC Social, Genetic and Developmental Psychiatry Centre, Institute of Psychiatry ABSTRACT Abnormalities in brain development and maladaptive plasticity are thought to underlay a range of neurodevelopmental and neurological disabilities and disorders, such as autism spectrum disorders, schizophrenia and learning disability. -
Early-Onset Obesity and Paternal 2Pter Deletion Encompassing the ACP1, TMEM18,Andmyt1l Genes
European Journal of Human Genetics (2014) 22, 471–479 & 2014 Macmillan Publishers Limited All rights reserved 1018-4813/14 www.nature.com/ejhg ARTICLE Early-onset obesity and paternal 2pter deletion encompassing the ACP1, TMEM18,andMYT1L genes Martine Doco-Fenzy*,1, Camille Leroy1, Anouck Schneider2, Florence Petit3, Marie-Ange Delrue4, Joris Andrieux3, Laurence Perrin-Sabourin5, Emilie Landais1, Azzedine Aboura5, Jacques Puechberty2,6, Manon Girard6, Magali Tournaire6, Elodie Sanchez2, Caroline Rooryck4,Agne`s Ameil7, Michel Goossens8, Philippe Jonveaux9, Genevie`ve Lefort2,6, Laurence Taine4, Dorothe´e Cailley4, Dominique Gaillard1, Bruno Leheup10, Pierre Sarda2 and David Genevie`ve2 Obesity is a common but highly, clinically, and genetically heterogeneous disease. Deletion of the terminal region of the short arm of chromosome 2 is rare and has been reported in about 13 patients in the literature often associated with a Prader–Willi-like phenotype. We report on five unrelated patients with 2p25 deletion of paternal origin presenting with early- onset obesity, hyperphagia, intellectual deficiency, and behavioural difficulties. Among these patients, three had de novo pure 2pter deletions, one presented with a paternal derivative der(2)t(2;15)(p25.3;q26) with deletion in the 2pter region and the last patient presented with an interstitial 2p25 deletion. The size of the deletions was characterized by SNP array or array-CGH and was confirmed by fluorescence in situ hybridization (FISH) studies. Four patients shared a 2p25.3 deletion with a minimal critical region estimated at 1.97 Mb and encompassing seven genes, namely SH3HYL1, ACP1, TMEMI8, SNTG2, TPO, PXDN, and MYT1L genes. The fifth patient had a smaller interstitial deletion encompassing the TPO, PXDN, and MYT1L genes. -
A Sox2 Distal Enhancer Cluster Regulates Embryonic Stem Cell Differentiation Potential
Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press A Sox2 distal enhancer cluster regulates embryonic stem cell differentiation potential Harry Y. Zhou,1,3 Yulia Katsman,1,3 Navroop K. Dhaliwal,1 Scott Davidson,1 Neil N. Macpherson,1 Moorthy Sakthidevi,1 Felicia Collura,1 and Jennifer A. Mitchell1,2 1Department of Cell and Systems Biology, University of Toronto, Toronto, Ontario M5S 3G5, Canada; 2Center for the Analysis of Genome Evolution and Function, University of Toronto, Toronto, Ontario M5S 3G5, Canada The Sox2 transcription factor must be robustly transcribed in embryonic stem (ES) cells to maintain pluripotency. Two gene-proximal enhancers, Sox2 regulatory region 1 (SRR1) and SRR2, display activity in reporter assays, but deleting SRR1 has no effect on pluripotency. We identified and functionally validated the sequences required for Sox2 transcription based on a computational model that predicted transcriptional enhancer elements within 130 kb of Sox2. Our reporter assays revealed three novel enhancers—SRR18, SRR107, and SRR111—that, through the formation of chromatin loops, form a chromatin complex with the Sox2 promoter in ES cells. Using the CRISPR/ Cas9 system and F1 ES cells (Mus musculus129 3 Mus castaneus), we generated heterozygous deletions of each enhancer region, revealing that only the distal cluster containing SRR107 and SRR111, located >100 kb downstream from Sox2, is required for cis-regulation of Sox2 in ES cells. Furthermore, homozygous deletion of this distal Sox2 control region (SCR) caused significant reduction in Sox2 mRNA and protein levels, loss of ES cell colony morphology, genome-wide changes in gene expression, and impaired neuroectodermal formation upon spontaneous differentiation to embryoid bodies. -
Pancreas-Specific Deletion of Mouse Gata4 and Gata6 Causes Pancreatic Agenesis
Pancreas-specific deletion of mouse Gata4 and Gata6 causes pancreatic agenesis Shouhong Xuan, … , Raymond J. Macdonald, Lori Sussel J Clin Invest. 2012;122(10):3516-3528. https://doi.org/10.1172/JCI63352. Research Article Pancreatic agenesis is a human disorder caused by defects in pancreas development. To date, only a few genes have been linked to pancreatic agenesis in humans, with mutations in pancreatic and duodenal homeobox 1 (PDX1) and pancreas-specific transcription factor 1a (PTF1A) reported in only 5 families with described cases. Recently, mutations in GATA6 have been identified in a large percentage of human cases, and aG ATA4 mutant allele has been implicated in a single case. In the mouse, Gata4 and Gata6 are expressed in several endoderm-derived tissues, including the pancreas. To analyze the functions of GATA4 and/or GATA6 during mouse pancreatic development, we generated pancreas- specific deletions of Gata4 and Gata6. Surprisingly, loss of either Gata4 or Gata6 in the pancreas resulted in only mild pancreatic defects, which resolved postnatally. However, simultaneous deletion of both Gata4 and Gata6 in the pancreas caused severe pancreatic agenesis due to disruption of pancreatic progenitor cell proliferation, defects in branching morphogenesis, and a subsequent failure to induce the differentiation of progenitor cells expressing carboxypeptidase A1 (CPA1) and neurogenin 3 (NEUROG3). These studies address the conserved and nonconserved mechanisms underlying GATA4 and GATA6 function during pancreas development and provide a new mouse model to characterize the underlying developmental defects associated with pancreatic agenesis. Find the latest version: https://jci.me/63352/pdf Research article Related Commentary, page 3469 Pancreas-specific deletion of mouse Gata4 and Gata6 causes pancreatic agenesis Shouhong Xuan,1 Matthew J. -
Myt1l Safeguards Neuronal Identity by Actively Repressing Many Non-Neuronal Fates Moritz Mall1, Michael S
LETTER doi:10.1038/nature21722 Myt1l safeguards neuronal identity by actively repressing many non-neuronal fates Moritz Mall1, Michael S. Kareta1†, Soham Chanda1,2, Henrik Ahlenius3, Nicholas Perotti1, Bo Zhou1,2, Sarah D. Grieder1, Xuecai Ge4†, Sienna Drake3, Cheen Euong Ang1, Brandon M. Walker1, Thomas Vierbuchen1†, Daniel R. Fuentes1, Philip Brennecke5†, Kazuhiro R. Nitta6†, Arttu Jolma6, Lars M. Steinmetz5,7, Jussi Taipale6,8, Thomas C. Südhof2 & Marius Wernig1 Normal differentiation and induced reprogramming require human Myt1l (Extended Data Fig. 1). Chromatin immunoprecipita- the activation of target cell programs and silencing of donor cell tion followed by DNA sequencing (ChIP–seq) of endogenous Myt1l programs1,2. In reprogramming, the same factors are often used to in fetal neurons (embryonic day (E) 13.5) and ectopic Myt1l in mouse reprogram many different donor cell types3. As most developmental embryonic fibroblasts (MEFs) two days after induction identified 3,325 repressors, such as RE1-silencing transcription factor (REST) and high-confidence Myt1l peaks that overlapped remarkably well between Groucho (also known as TLE), are considered lineage-specific neurons and MEFs (Fig. 1a, Extended Data Fig. 2, Supplementary repressors4,5, it remains unclear how identical combinations of Table 1). Thus, similar to the pioneer factor Ascl1, Myt1l can access transcription factors can silence so many different donor programs. the majority of its cognate DNA binding sites even in a distantly related Distinct lineage repressors would have to be induced in different cell type. However, unlike Ascl1 targets8, the chromatin at Myt1l donor cell types. Here, by studying the reprogramming of mouse fibroblasts to neurons, we found that the pan neuron-specific a Myt1l Myt1l b Myt1l Ascl1 Random Myt1l 6 Ascl1 + Brn2 endogenous transcription factor Myt1-like (Myt1l) exerts its pro-neuronal Closed 0.030 function by direct repression of many different somatic lineage k programs except the neuronal program. -
Mechanism of Nucleosome Targeting by Pioneer Transcription Factors
University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2019 Mechanism Of Nucleosome Targeting By Pioneer Transcription Factors Meilin Mary Fernandez Garcia University of Pennsylvania Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Biochemistry Commons, and the Biophysics Commons Recommended Citation Fernandez Garcia, Meilin Mary, "Mechanism Of Nucleosome Targeting By Pioneer Transcription Factors" (2019). Publicly Accessible Penn Dissertations. 3624. https://repository.upenn.edu/edissertations/3624 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/3624 For more information, please contact [email protected]. Mechanism Of Nucleosome Targeting By Pioneer Transcription Factors Abstract Transcription factors (TFs) forage the genome to instruct cell plasticity, identity, and differentiation. These developmental processes are elicited through TF engagement with chromatin. Yet, how and which TFs can engage with chromatin and thus, nucleosomes, remains largely unexplored. Pioneer TFs are TF that display a high affinity for nucleosomes. Extensive genetic and biochemical studies on the pioneer TF FOXA, a driver of fibroblast to hepatocyte reprogramming, revealed its nucleosome binding ability and chromatin targeting lead to chromatin accessibility and subsequent cooperative binding of TFs. Similarly, a number of reprogramming TFs have been suggested to have pioneering activity due to their ability to target compact chromatin and increase accessibility and enhancer formation in vivo. But whether these factors directly interact with nucleosomes remains to be assessed. Here we test the nucleosome binding ability of the cell reprogramming TFs, Oct4, Sox2, Klf4 and cMyc, that are required for the generation of induced pluripotent stem cells. In addition, we also test neuronal and macrophage reprogramming TFs. -
Mouse Myt1l Knockout Project (CRISPR/Cas9)
https://www.alphaknockout.com Mouse Myt1l Knockout Project (CRISPR/Cas9) Objective: To create a Myt1l knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Myt1l gene (NCBI Reference Sequence: NM_001093775 ; Ensembl: ENSMUSG00000061911 ) is located on Mouse chromosome 12. 25 exons are identified, with the ATG start codon in exon 6 and the TGA stop codon in exon 25 (Transcript: ENSMUST00000049784). Exon 9 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 9 starts from about 4.3% of the coding region. Exon 9 covers 10.17% of the coding region. The size of effective KO region: ~362 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 9 25 Legends Exon of mouse Myt1l Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 9 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of Exon 9 is aligned with itself to determine if there are tandem repeats. -
KRAS Drives Immune Evasion in a Genetic Model of Pancreatic Cancer
ARTICLE https://doi.org/10.1038/s41467-021-21736-w OPEN KRAS drives immune evasion in a genetic model of pancreatic cancer Irene Ischenko1, Stephen D’Amico1, Manisha Rao2, Jinyu Li2, Michael J. Hayman1, Scott Powers 2, ✉ ✉ Oleksi Petrenko 1,3 & Nancy C. Reich 1,3 Immune evasion is a hallmark of KRAS-driven cancers, but the underlying causes remain unresolved. Here, we use a mouse model of pancreatic ductal adenocarcinoma to inactivate 1234567890():,; KRAS by CRISPR-mediated genome editing. We demonstrate that at an advanced tumor stage, dependence on KRAS for tumor growth is reduced and is manifested in the sup- pression of antitumor immunity. KRAS-deficient cells retain the ability to form tumors in immunodeficient mice. However, they fail to evade the host immune system in syngeneic wild-type mice, triggering strong antitumor response. We uncover changes both in tumor cells and host immune cells attributable to oncogenic KRAS expression. We identify BRAF and MYC as key mediators of KRAS-driven tumor immune suppression and show that loss of BRAF effectively blocks tumor growth in mice. Applying our results to human PDAC we show that lowering KRAS activity is likewise associated with a more vigorous immune environment. 1 Department of Molecular Genetics and Microbiology, Stony Brook University, Stony Brook, NY, USA. 2 Department of Pathology, Stony Brook University, ✉ Stony Brook, NY, USA. 3These authors jointly supervised this work: Oleksi Petrenko, Nancy C. Reich. email: [email protected]; [email protected] NATURE COMMUNICATIONS | (2021) 12:1482 | https://doi.org/10.1038/s41467-021-21736-w | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-021-21736-w RAS is frequently associated with some of the deadliest and characterization of KRASG12D p53KO mouse cell lines forms of cancer.