Suppression of AP1 Transcription Factor Function in Keratinocyte Suppresses Differentiation

Bingshe Han1, Ellen A. Rorke1, Gautam Adhikary1, Yap Ching Chew1, Wen Xu1, Richard L. Eckert1,2,3* 1 Department of Biochemistry and Molecular Biology, University of Maryland School of Medicine, Baltimore, Maryland, United States of America, 2 Department of Dermatology, University of Maryland School of Medicine, Baltimore, Maryland, United States of America, 3 Department of Obstetrics, Gynecology and Reproductive Sciences, University of Maryland School of Medicine, Baltimore, Maryland, United States of America

Abstract Our previous study shows that inhibiting activator protein one (AP1) transcription factor function in murine epidermis, using dominant-negative c-jun (TAM67), increases cell proliferation and delays differentiation. To understand the mechanism of action, we compare TAM67 impact in mouse epidermis and in cultured normal human keratinocytes. We show that TAM67 localizes in the nucleus where it forms TAM67 homodimers that competitively interact with AP1 transcription factor DNA binding sites to reduce endogenous jun and fos factor binding. Involucrin is a marker of keratinocyte differentiation that is expressed in the suprabasal epidermis and this expression requires AP1 factor interaction at the AP1-5 site in the promoter. TAM67 interacts competitively at this site to reduce involucrin expression. TAM67 also reduces endogenous c-jun, junB and junD mRNA and protein level. Studies with c-jun promoter suggest that this is due to reduced transcription of the c-jun gene. We propose that TAM67 suppresses keratinocyte differentiation by interfering with endogenous AP1 factor binding to regulator elements in differentiation-associated target genes, and by reducing endogenous c-jun factor expression.

Citation: Han B, Rorke EA, Adhikary G, Chew YC, Xu W, et al. (2012) Suppression of AP1 Transcription Factor Function in Keratinocyte Suppresses Differentiation. PLoS ONE 7(5): e36941. doi:10.1371/journal.pone.0036941 Editor: Andrzej T. Slominski, University of Tennessee, United States of America Received March 14, 2012; Accepted April 16, 2012; Published May 23, 2012 Copyright: ß 2012 Han et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was supported by National Institutes of Health (NIH) grant R01 AR046494 awarded to Richard L. Eckert. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: Richard L. Eckert is a PloS ONE Editor Board member, but this does not alter his adherence to all of the PloS ONE policies on sharing data and materials, as detailed online in the guide for authors. The other authors have declared that no competing interests exist. * E-mail: [email protected]

Introduction In melanoma cells, induction of the melanoma differentiation associated genes is increased by AP1 factors and inhibited by Activator protein one (AP1) transcription factors are a family of TAM67 [33], and TAM67 also inhibits differentiation in jun and fos proteins that form jun-jun and jun-fos homo- and monocytic leukemia cells [34]. heterodimers, and these complexes interact with AP1 factor DNA We [35,36] and others [37–43] have used TAM67 to study AP1 binding sites to regulate gene expression [1–4]. The AP1 factor factor function in keratinocytes. These studies show that TAM67 family includes c-jun, junB, junD, c-fos, FosB, Fra-1 and Fra-2. inhibits keratinocyte differentiation [35,36]. Cell culture based These proteins are implicated in control of keratinocyte pro- studies in human primary foreskin keratinocytes show that AP1 liferation [5–7], differentiation [8–10], apoptosis [11,12], and factors are required for expression of markers of terminal transformation [13–16]. The importance of these proteins is differentiation and that inhibition of AP1 factor function with confirmed by in vivo studies [13,17–25]. Analysis of the role of TAM67 suppresses these responses [10,36,44]. We have also these proteins in epidermis is complicated because AP1 proteins recently shown that expression of TAM67 in vivo in suprabasal display context-dependent functions and because multiple family mouse epidermis results in delayed and incomplete epidermal members are expressed. differentiation [35]. An altered form of c-jun, which is truncated to remove the N- However, the molecular mechanism of TAM67 action in these terminal transactivation domain, has been used to study AP1 models is not fully understood. In the present study we examine factor function [26]. Deletion of the c-jun transactivation domain the mechanism of TAM67 action on AP1 factor function in creates a dominant-negative form of the protein (TAM67) that epidermal keratinocytes. These studies indicate that TAM67 inhibits AP1 factor function [26]. TAM67 has been used in homodimer binds to AP1 factor DNA binding sites in human a number of systems. TAM67 expression in lung cancer in mice keratinocytes to inhibit jun and fos factor binding, and also [27,28] and in nasopharyngeal carcinoma inhibits cell growth by reduces the mRNA and protein level of endogenous jun family altering cell cycle protein expression [29]. TAM67 inhibits members. In the case of c-jun this is via inhibition of transcription. growth of MCF-7 breast cancer cells [30], and halts HT-1080 Moreover, TAM67 binding to the AP1-5 binding site of the cell proliferation in G1 phase [31]. TAM67 has also been used to involucrin (hINV) promoter reduces expression of involucrin, study the impact of AP1 factor signaling on cell differentiation. a keratinocyte differentiation marker, in cultured keratinocytes. Inhibition of AP1 factor function in neuroblastoma cells We further show that TAM67 in murine epidermis reduces suppresses nerve growth factor-dependent differentiation [32].

PLoS ONE | www.plosone.org 1 May 2012 | Volume 7 | Issue 5 | e36941 TAM67 Impact on AP1 Signaling involucrin (and loricrin) gene expression and reduces binding of reduction, we monitored mRNA level using quantitative RT- endogenous AP1 factors to AP1 factor binding elements. PCR. The level of c-jun, junB and junD encoding mRNA is reduced in TAM67 expressing cells, indicating that part of the Results reason for loss of these factors is a reduction in mRNA level (Fig. 2B). In contrast, the level of RNA encoding fos family TAM67 is a truncated form of c-jun that lacks the amino members (Fra-1, Fra-2, c-fos) is not altered. We next examined the terminal transactivation domain and is not transcriptionally active ability of TAM67-FLAG to interact with other AP1 factors by [26] (Fig. 1A). In the present study we utilize TAM67 as a tool to testing the ability of TAM67-FLAG to co-precipitate individual study AP1 factor function in normal human keratinocytes. To AP1 factors in keratinocytes. As shown in Fig. 2C, anti-FLAG initiate these studies, we monitored TAM67-FLAG expression. precipitation of TAM67-FLAG co-precipitates Fra-1, Fra-2 and c- Fig. 1B shows that TAM67-FLAG is expressed in keratinocytes fos. In contrast, junB and junD did not co-precipitate, which is and Fig. 1C shows that, as expected of a nuclear transcriptional expected considering that these proteins are reduced in level in regulator, TAM67-FLAG accumulates in the nucleus. TAM67-expressing cells (Fig. 2A). In spite of the reduction in total AP1 factors are key regulators of function in keratinocytes [45– c-jun level (Fig. 2A), sufficient c-jun appears to remain and 47]. To understand the impact of TAM67 on AP1 factor function, interacts with TAM67-FLAG (Fig. 2C). We next monitored the we monitored endogenous AP1 factor level in TAM67-expressing impact on nuclear AP1 factor level. Fig. 2D shows that TAM67 cells. Fig. 2A shows a reduction in c-jun, junB and junD but no expression is associated with reduced nuclear c-jun, junB and change in Fra-1, Fra-2 or c-fos level in TAM67 expressing cells, junD. In contrast, nuclear c-fos, Fra-1 and Fra-2 levels are not suggesting that TAM67 reduces the level of a subset of AP1 affected. factors. To assess the mechanism causing c-jun, junB and junD

Figure 1. TAM67-FLAG expression in keratinocytes. A Comparison of c-jun and TAM67 structure. The numbers are indicated in amino acids. The transactivation, DNA binding and leucine zipper domains are indicated. The TAM67 truncated protein is FLAG epitope tagged as indicated. B/C TAM67-FLAG is expressed in keratinocytes. Normal human keratinocytes were infected with 10 MOI of tAd5-EV or tAd5-TAM67-FLAG with 5 MOI of Ad5-TA. After 24 h the cells were fixed for immunostaining and extracts were prepared for immunoblot with anti-FLAG. Similar results were observed in each of three repeated experiments. doi:10.1371/journal.pone.0036941.g001

PLoS ONE | www.plosone.org 2 May 2012 | Volume 7 | Issue 5 | e36941 TAM67 Impact on AP1 Signaling

Figure 2. Impact of TAM67-FLAG on AP1 factors. Keratinocytes were infected with empty (EV) or TAM67-FLAG encoding adenovirus and after 24 h cells were harvested and extracts prepared. A Total extracts were electrophoresed for immunoblot detection of the indicated proteins. B TAM67-FLAG suppresses jun factor mRNA level. At 24 h post-infection with EV or TAM67-FLAG encoding virus, mRNA was prepared for detection by quantitative PCR. The bars are mean 6 SD and the asterisks indicate a significant reduction (p,0.005, n = 3). C Total extract (200 mg) was immunoprecipitated with anti-FLAG and the immunoprecipitate was electrophoresed for immunoblot to detect the indicated jun and fos proteins. D Nuclear extract was prepared and the level of each indicated protein was measured by immunoblot. Similar results were observed in three experiments. doi:10.1371/journal.pone.0036941.g002

TAM67-FLAG Impact on c-jun Gene Expression same promoter in which the key AP1 factor binding sites are As shown above, c-jun, junB and junD protein and mRNA mutated, 21780/+731(AP1m) [48], displays basal activity and is levels are reduced in TAM67-expressing cells. To gain insight not regulated by TAM67. Fig. 3C shows the structure of the regarding the mechanism, we used c-jun as a model. We examined promoter constructs. These findings suggest that c-jun level is the impact of TAM67 on c-jun mRNA level and promoter activity reduced by a transcriptional mechanism that requires AP1 factor in a side-by-side comparison. Fig. 3A shows that TAM67 reduces binding sites in the c-jun promoter upstream regulatory region. c-jun encoding mRNA by more than 50%. To gain insight into the mechanism, we monitored the impact of TAM67 on activity of a c- TAM67-FLAG Inhibits AP1 Factor Binding to AP1 jun promoter construct in which nucleotides 21780/+731 is Consensus DNA Binding Element linked to luciferase (Fig. 3B). Our studies show that TAM67 Gel mobility shift and supershift analysis, using a consensus reduces promoter activity by 50% in keratinocytes. In contrast, the AP1 binding probe, was performed to investigate the effect of

PLoS ONE | www.plosone.org 3 May 2012 | Volume 7 | Issue 5 | e36941 TAM67 Impact on AP1 Signaling

resis. Fig. 4C shows the presence of a TAM67 dimer, in DSS- treated extracts, migrating at 54 kDa. There are also higher molecular weight forms (brackets) which most likely represent TAM67 crosslinking to endogenous AP1 factors. However, the major band appears as a TAM67 homodimer. These findings suggest that TAM67 homodimers interact with AP1 binding sites to inhibit binding of endogenous AP1 factors. It also suggests that a TAM67 homodimer may be the major AP1 site interacting species in these cells.

TAM67-FLAG Inhibits hINV Gene Expression We next investigated the impact of TAM67 on AP1-regulated gene expression using involucrin (hINV) as an AP1 responsive gene [10]. Involucrin is a keratinocyte differentiation marker and is known to be increased by AP1 transcription factor signaling [25,47,49–51]. Control and TAM67-FLAG expressing keratino- cytes were harvested and the level of hINV protein and mRNA was measured. Fig. 5A shows a TAM67-dependent reduction in hINV protein and mRNA. To assess the mechanism, we monitored the impact on hINV promoter activity. Three promoter constructs were used and keratinocytes were treated with TPA, a strong inducer of AP1-dependent hINV promoter activity [47,49]. The hINV basal promoter, which encodes 41 nucleotides upstream of the transcription start site [47] and no AP1 sites, is not regulated by TAM67 or TPA (Fig. 5B). In contrast, pINV-241, which encodes the proximal regulatory region, and pINV-2473, which encodes both the proximal and distal regulatory regions [23,47], are responsive to TPA and basal and TPA-stimulated promoter activity is inhibited by TAM67. The proximal and distal Figure 3. TAM67 suppresses c-jun promoter activity. A TAM67 reduces c-jun mRNA. Keratinocytes were infected with empty (EV) or regulatory regions encode regulatory elements required for TAM67-FLAG encoding adenovirus (10 MOI) and after 24 h mRNA was promoter activity in cultured keratinocytes [47] and involucrin prepared and c-jun mRNA level was measured by quantitative PCR. B expression in vivo [47,49]. These experiments indicate that TAM67 TAM67 suppresses c-jun promoter activity. Keratinocytes were trans- inhibits differentiation-associated AP1-dependent transcriptional fected with 1 mg of the indicated c-jun promoter luciferase reporter events in keratinocytes. construct and 1 mg of pcDNA3 (EV) or pcDNA3-TAM67-FLAG (TAM67- FLAG). After 24 h the cells were harvested and assayed for luciferase activity. The values in both plots are mean + SD and the asterisks TAM67-FLAG Binds to the AP1-5 Site of hINV Gene indicate a significant reduction (p,0.005, n = 3). C Map of c-jun Promoter promoter region. The promoter constructs encode nucleotides 21780 AP1 factors regulate transcription of hINV via binding to the to +731 with the transcription start site at +1. c-jun(21780/+731) is the proximal and distal AP1 sites in the hINV promoter [25,47,49– wild-type intact promoter and c-jun(21780/+731)-AP1m is a construct in which the critical AP1 sites are eliminated by mutation [48]. LUC 51]. In particularly, the AP1-5 site in the distal promoter is indicates the luciferase gene. The numbers are given in nucleotides. absolutely required for involucrin gene expression in vivo [22–25]. doi:10.1371/journal.pone.0036941.g003 We therefore examined the impact of TAM67 on AP1 factor interaction at the AP1-5 site. Fig. 6 shows gel mobility shift TAM67-FLAG on AP1 factor interaction with DNA. Fig. 4A analysis of AP1 factor binding to the hINV promoter AP1-5 site. shows a gel shift using 32P-labeled AP1 consensus binding site Fig. 6A shows that the presence of TAM67-FLAG markedly oligonucleotide and human foreskin keratinocyte nuclear extract. increases the intensity of the gel shifted band (compare lanes 2 and Shifted bands appear at increased intensity and free probe appears 3) and that incubation with anti-FLAG produces a strong at reduced intensity in nuclear extracts prepared from TAM67- supershifted band only in cells expressing TAM67-FLAG (com- FLAG expressing cells (lanes 3, 5 and 9). This is caused by an pare lanes 4 and 5). Moreover, the binding is competed by increase in total cellular AP1 site binding capacity due to the incubation with a 50-fold molar excess of radioinert AP1-5 presence of TAM67. As expected, addition of anti-FLAG results in oligonucleotide (see lanes 6 and 7), but a 50-fold excess of AP1- appearance of a supershifted band only in extracts from TAM67- 5 m does not compete (lane 8). We next examined the impact of TAM67 on endogenous AP1 factor interaction with AP1-5. As FLAG expressing cells (lane 5, asterisk). We next incubated shown in Fig. 6B, supershifted bands (asterisks) are observed nuclear extract from control and TAM67-expressing cells with when extracts are incubated with anti-c-jun, junB, junD, Fra-1, anti-c-jun, junB, junD, Fra-1, Fra-2, c-fos or fosB. Supershifted Fra-2 and c-fos, and this interaction is reduced in the presence of bands are observed for each AP1 factor. The most obvious TAM67-FLAG. Fos-B was not detected. The low signal intensity supershifts were observed for c-jun, junD, Fra-1, Fra-2 and c-fos of the shifted bands is consistent with previous reports [47]. (Fig. 4B). The amount of supershifted DNA is reduced in To further assess the in vivo impact of TAM67 we used TAM67-expressing cells, demonstrating that TAM67 competes for chromatin immunoprecipitation. Nuclear extracts from TAM67- endogenous AP1 factor binding to the AP1c element (Fig. 4B). FLAG positive and negative keratinocytes were prepared for ChIP We also examined the ability of TAM67 to form dimers. Nuclear analysis using a primer set that targets the AP1-5 binding site extract from TAM67-FLAG expressing cells was crosslinked with (22218/22005) and a second primer set that targets a region of disuccinimidyl suberate (DSS) prior to denaturing gel electropho- the promoter lacking an AP1 factor binding site (21040/2919).

PLoS ONE | www.plosone.org 4 May 2012 | Volume 7 | Issue 5 | e36941 TAM67 Impact on AP1 Signaling

Figure 4. TAM67-FLAG inhibits AP1 factor binding to AP1 consensus DNA binding element. Keratinocytes were infected with 10 MOI tAd5-EV or tAd5-TAM67-FLAG and after 24 h nuclear extracts were prepared. A AP1 factors interact with AP1 consensus DNA element. Nuclear extracts were incubated with AP1c-P32 without or with a 50-fold molar excess of Sp1c or AP1c oligonucleotides, or anti-FLAG antibody and electrophoresed on a 6% acrylamide non-denaturing gel. FP indicates free probe and NE is nuclear extract. The arrow indicates the major shifted band and asterisks indicate migration of supershifted complexes. AP1c and Sp1c encode consensus AP1 and Sp1 binding elements. B TAM67-FLAG

PLoS ONE | www.plosone.org 5 May 2012 | Volume 7 | Issue 5 | e36941 TAM67 Impact on AP1 Signaling

reduces AP1 factor binding to DNA. Nuclear extracts were incubated with AP1c-P32 in the absence or presence of c-jun, junB, junD, Fra-1, Fra-2, c-fos, or fosB antibodies, and electrophoresed on a 6% acrylamide non-denaturing gel. Arrows indicate shifted band and asterisks supershifted bands. FP indicates free probe. C TAM67-FLAG forms homodimers and heterodimers. Nuclear extracts were treated with or without DSS crosslinker prior to electrophoresis on a denaturing 8% polyacrylamide gel and TAM67-FLAG was detected by anti-FLAG immunoblot. Identical results were observed in three repeated independent experiments. doi:10.1371/journal.pone.0036941.g004

TAM67-FLAG and associated chromatin was precipitated with anti-FLAG. Fig. 6C shows that TAM67-FLAG is substantially enriched at the AP1-5 binding site (nucleotides 22218/22055) as compared to the control DNA segment that lacks an AP1 binding site (nucleotides 21040/2919), suggesting TAM67 interaction at the hINV promoter AP1-5 site in vivo.

TAM67 Impact on AP1 Factors in vivo We previously described TAM67-rTA mice in which TAM67- FLAG expression can be induced in the suprabasal epidermis by addition of doxycycline to the drinking water [35]. Expression of TAM67 in this tissue would be expected to reduce expression of AP1 factor-regulated genes. To assess this, we compared expression of two AP1-factor regulated genes, involucrin and loricrin [10,52,53]. TAM67-rTA mice were treated for three days with doxycycline and total epidermal extracts were prepared to detect involucrin and loricrin. Consistent with the finding that involucrin expression is reduced in TAM67-expressing cultured keratinocytes, we find that involucrin level is reduced in TAM67 expressing mouse epidermis (Fig. 7A). We also show that loricrin protein level is reduced. Loricrin expression is also AP1 factor signaling dependent [52]. We next examined the impact of TAM67 on endogenous AP1 factor DNA binding in mouse epidermis nuclear extracts. Fig. 7B shows an increase in the quantity of shifted AP1c-P32 probe in extract prepared from TAM67-expressing epidermis. This binding is specifically reduced by addition of excess radioinert AP1c, but is not competed by Sp1 consensus sequence. Moreover, TAM67- FLAG binding to AP1c-P32 is confirmed by anti-FLAG supershift (Fig. 7B). We also examined the impact of TAM67 on endogenous AP1 factor binding to DNA. The supershift analysis in Fig. 7C shows that TAM67 binding to the AP1 consensus element reduces c-jun, junB and junD interaction, with a strong reduction observed for junD. In contrast, Fra-2 and c-fos interaction is not altered by TAM67 and interaction of Fra-1 and FosB is below the limits of detection.

Discussion We recently expressed dominant-negative c-jun in murine epidermis and observed significant changes in epidermal pheno- type [35]. These changes included increased cell proliferation, delayed differentiation and reduced tumor formation [35]. We presume that TAM67 is impacting AP1 target genes in this tissue and so in the present study we examine the TAM67 mechanism of action in more detail. We studied the role of dominant-negative c- Figure 5. TAM67-FLAG inhibits hINV gene expression. A TAM67 jun (TAM67) in human epidermal keratinocytes and in an in vivo reduces hINV protein and mRNA level. Keratinocytes were infected with murine keratinocyte model of differentiation. indicated MOI of tAd5-EV or tAd5-TAM67-FLAG and after 48 h extracts were prepared to detect hINV protein by immunoblot and mRNA by In cultured human keratinocytes TAM67-FLAG was detected quantitative PCR. The values are mean 6 SD and the asterisks indicate in punctate foci in the center of the nucleus. Expression of TAM67 a significant reduction using student’s t-test, n = 3 (p,0.001). B TAM67 produced profound changes in AP1 transcription factor function. suppresses AP1 factor-dependent promoter activity. Keratinocytes were The first change we observed was a reduction in c-jun, junB and transfected with the indicated hINV reporter constructs in the presence junD protein and mRNA level. The decrease in mRNA encoding of empty pcDNA3 vector or pcDNA3-TAM67-FLAG and treated 24 h with or without 50 ng/ml TPA prior to preparation of extracts and assay the jun factors could be due to a reduction in mRNA stability or to of luciferase activity. The values are mean 6 SEM and the asterisks a reduction in transcription. Further study with the c-jun promoter indicate a significant reduction using student’s t-test, n = 3 (p,0.001). upstream regulatory region revealed a TAM67-dependent re- doi:10.1371/journal.pone.0036941.g005 duction in promoter activity. This reduction required the presence

PLoS ONE | www.plosone.org 6 May 2012 | Volume 7 | Issue 5 | e36941 TAM67 Impact on AP1 Signaling

Figure 6. TAM67 binds to the AP1-5 site of hINV gene promoter. Keratinocytes were infected with 10 MOI tAd5-EV or tAd5-TAM67-FLAG and after 24 h nuclear extracts were prepared for gel shift. A TAM67 interaction with hINV promoter AP1-5 site. Nuclear extracts were incubated with AP1-5-P32 with or without a 50-fold molar excess of AP1-5 or AP1-5 m oligonucleotide, or anti-FLAG antibody, and electrophoresed on a 6% acrylamide non-denaturing gel. FP indicates free probe and NE is nuclear extract. The arrow indicates the major shifted bands and asterisks indicate supershifted bands. AP1-5 is an oligonucleotide encoding the AP1-5 site of hINV promoter. AP1-5 m is an AP1-5 mutant that does not bind AP1 transcription factors [47]. B TAM67 inhibits AP1 factor interaction with AP1-5. Nuclear extracts were incubated with AP1-5-P32 in the absence or presence of c-jun, junB, junD, Fra-1, Fra-2, c-fos, or fosB specific antibodies, and electrophoresed on a 6% acrylamide non-denaturing gel. Arrows indicate major shifted band and asterisks indicate supershifted bands. FP is free probe. C ChIP analysis reveals TAM67 presence at the hINV upstream regulatory region AP1-5 site in vivo. Nuclear extracts were prepared for ChIP analysis and incubated with anti-IgG or anti-FLAG and the precipitated DNA was analyzed for AP1-5 site encoding sequences. The values are mean 6 SD (n = 3, p,0.001) and the asterisk indicates a significant increase compared to all other groups. Nucleotides 22218/22055 encodes the AP1-5 site and nucleotides 21040/2919 is a region of the hINV upstream regulatory region that lacks an AP1 site. doi:10.1371/journal.pone.0036941.g006 of AP1 transcription factor binding sites within the c-jun promoter. is due to reduced expression of these proteins. Surprisingly, c-jun, These findings are consistent with previous reports indicating that which is markedly reduced in level, does co-precipitate with AP1 factor auto-regulate via a feedback loop [48,54–57]. Our TAM67. Perhaps c-jun homodimer formation is favored and findings suggest that TAM67 binds to these elements, displacing TAM67, which retains the leucine zipper domain required for other AP1 factors, and thereby suppresses c-jun transcription. In dimerization [26], may seek out and interact with residual c-jun in contrast, it is interesting that level of the fos family members (Fra- the cells. 1, Fra-2 and c-fos) is not altered by TAM67. The loss of jun factors An interesting finding is that the population of jun family is also reflected in co-precipitation experiments. Fra-1, Fra-2 and transcription factors is highly depleted in TAM67-positive c-fos co-precipitate with TAM67-FLAG, but junB and junD do keratinocytes. This feature has not been previously appreciated. not. Presumably, the reduction in junB and junD co-precipitation Since AP1 factor signaling requires jun family members as

PLoS ONE | www.plosone.org 7 May 2012 | Volume 7 | Issue 5 | e36941 TAM67 Impact on AP1 Signaling

Figure 7. Impact of TAM67 on AP1 factors in vivo. TAM67-rTA mice were treated with (+) or without (2) 2 mg/ml doxycycline in drinking water for 3 days. A Murine epidermis was collected free of the dermis by high temperature separation as previously described [35]. Total extract was prepared for immunoblot to detect the indicated proteins. TAM67-FLAG was detected with anti-FLAG. B Interaction of TAM67 with AP1 site consensus element. Nuclear extracts were prepared from epidermis and incubated with AP1c-P32 and other probes as indicated. FP indicates free probe, NE indicates nuclear extract. Similar results were observed in each of three experiments. C Impact of TAM67 on interaction of endogenous AP1 factors with AP1 site element. Nuclear extracts were prepared from TAM67-negative and TAM67-expressing epidermis and incubated with the AP1c- P32 and antibodies as indicated. The complexes were then separated on a non-denaturing 6% polyacrylamide gel. FP indicates free probe and NE is nuclear extract. Note the reduction in jun factor binding in the presence of TAM67-FLAG (left panel). We did not observe a significant reduction in fos factor interaction in the presence of TAM67 (right panel). doi:10.1371/journal.pone.0036941.g007 dimerization partners for jun and fos, the absence of jun factors is and that TAM67, at the level we achieve in these experiments, expected to severely limit AP1 factor signaling. An equally substantially reduces interaction of endogenous AP1 factors with interesting feature is that expression of fos family members is not DNA binding sites. Previous studies suggest that TAM67 forms reduced. This suggests that fos family proteins are not regulated by transcriptionally inactive heterodimers with jun and fos family an AP1 factor-dependent feedback loop in this system. members [26]. These factors bind to the promoter of target genes, Second, we examined the impact of TAM67 on AP1 factor but are not able to activate transcription. This mechanism, called interaction with DNA. DNA gel shift experiments indicate that transcriptional quenching, leads to reduced target gene expression TAM67-FLAG interacts with the AP1 consensus DNA sequence, [26]. Our findings also suggest an additional mechanism. Protein-

PLoS ONE | www.plosone.org 8 May 2012 | Volume 7 | Issue 5 | e36941 TAM67 Impact on AP1 Signaling protein crosslinking and gel shift experiments strongly suggest that this cascade leads to AP1 factor interaction with specific DNA TAM67-FLAG homodimers are preferentially formed in these binding elements on the hINV promoter to drive expression [23– cells, and we suspect that this homodimer is a major AP1 factor 25]. A key DNA binding site that is required for involucrin complex that interacts with DNA. This would suggest that a major expression, both in cultured keratinocytes and in vivo, is the AP1- mechanism whereby TAM67 inhibits AP1 target gene expression 5 DNA binding site located in the distal regulatory region of the in keratinocytes is TAM67 homodimer interaction with DNA to hINV gene promoter [36,47,50]. We show that TAM67 reduces block endogenous AP1 factor access to these sites. It is also clear, hINV mRNA and protein level in cultured keratinocytes. as reported previously [26], that TAM67 forms heterodimers with Moreover, hINV promoter activity is also reduced, suggesting jun and fos proteins, to form inactive complexes that quench that TAM67 is inhibiting AP1 factor-dependent transcription. activity of the complex. Thus, two mechanisms are possible: We confirmed TAM67 interaction with AP1-5 transcription a blocking action wherein the TAM67 homodimer binds to DNA factor binding site in the hINV promoter by gel mobility shift to block endogenous AP1 factor interaction with AP1 sites, and and chromatin IP. These findings confirm the important role of a quenching action wherein TAM67 inhibits the transactivation the AP1-5 binding site in driving hINV gene expression [22–25]. potential of endogenous AP1 factors by forming inhibitory The fact that this is associated with reduced binding of AP1 TAM67:jun and TAM67:fos heterodimers (Fig. 8). Our studies factor at this site, as measured by gel mobility supershift assay, favor the blocking mechanism involving TAM67 homodimers. suggests that TAM67 is displacing these factors by competition. In addition, we examined the impact of TAM67 on an We also examined the impact of TAM67 expression on important AP1 transcription factor-regulated target, involucrin. involucrin protein level in TAM67-expressing murine epidermis. Involucrin is a marker of suprabasal differentiation in epidermis We compared control mice (lacking TAM67 expression) and that is regulated by a MAP kinase cascade [36,47]. Activation of TAM67-expressing mice. These studies reveal a substantial re- duction in murine involucrin protein in TAM67-expressing epidermis. This is associated with a 2 to 3-fold increase in transcription factor binding to the AP1 site in extracts prepared from TAM67-expressing epidermis. This increase is directly associated with increased TAM67 level, suggesting that TAM67 is a major factor interacting with the AP1 binding elements in the epidermis of these mice. TAM67 appears to readily compete jun family factors off from this site, but appears less efficient at competing fos family factors. We suspect that this is due preferred interaction with jun factors and to the somewhat lower level of TAM67 expression in mouse epidermis as compared to cultured keratinocytes. In summary, we describe several findings regarding the mechanism of TAM67 action in keratinocytes and in TAM67- expressing murine epidermis. First, our findings suggest that AP1 transcription factors regulate c-jun, junB, junD mRNA and protein level. Moreover, we show that TAM67 inhibits activity of the c-jun promoter, suggesting a transcriptional mechanism of regulation. Second, we show that blocking AP1 factor access to the hINV gene promoter AP1 factor binding site inhibits transcription, both in cultured human cells and in vivo in mouse epidermis. Third, this inhibition appears to be mediated by a ‘‘blocking’’ mechanism where a TAM67 homodimer interacts with the AP1 response element to suppress transcription by preventing endog- enous jun and fos factor binding to the element (Fig. 8). Crosslinking experiments suggest the presence of TAM67 homodimers as the major species present in keratinocytes. We suspect that the balance of TAM67 homodimers versus TAM67 heterodimerzation with endogenous jun and fos factors is depend upon the concentration of TAM67 expressed. At higher concen- Figure 8. Mechanism of TAM67 action in keratinocytes. A Wild- trations we would expect TAM67 homodimers to be the major type regulation involves the binding of fos:jun heterodimers (and species and that these factors will block endogenous AP1 factor jun:jun hetero and homodimers, not shown) to AP1 response element interaction with DNA. An alternate mechanism, quenching, where to drive differentiation-associated gene expression. Blocking occurs TAM67 forms heterodimers with fos and jun proteins to produce when the concentration of TAM67 present in the cells is high enough that TAM67 homodimers comprise the major complex bound to DNA a transcriptionally inactivate complex at AP1 DNA binding sites, is and this complex blocks interaction of endogenous AP1 factors with the also likely. Crosslinking and co-immunoprecipitation experiments element. Quenching occurs when TAM67 complexes with endogenous suggest some formation of TAM67 heterodimers with endogenous jun and fos factors and this complex, which is transcriptionally inactive, AP1 factors. An additional mechanism, called squelching (not binds to DNA. We propose that blocking is a major mechanism of shown), is also possible [26,58,59]. In this mechanism an inhibitor TAM67 action in our system, but that quenching is also important. B protein interacts with endogenous factors involved in transcription TAM67 interaction at the promoter elements leads to blocking and quenching to reduce AP1 factor interaction and activity at AP1 binding regulation that are not bound to DNA [26,58,59]. Although this sites. This leads to reduced expression of jun factors and ultimately may also be a mechanism of TAM67 inhibition, wherein TAM67 reduced target gene (involucrin, loricrin) expression. sequesters co-activator proteins away from the AP1 binding sites, doi:10.1371/journal.pone.0036941.g008 we suspect that the major mechanisms whereby TAM67

PLoS ONE | www.plosone.org 9 May 2012 | Volume 7 | Issue 5 | e36941 TAM67 Impact on AP1 Signaling suppresses gene expression in keratinocytes are AP1 site blocking disc confocal microscope. No signaling was detected in the absence and quenching (Fig. 8A) leading to suppression of jun factor and of primary antibody. target gene (hINV, loricrin) expression (Fig. 8B). Our results suggest that these mechanisms are active both in cultures Antibodies keratinocytes and in TAM67-expressing murine epidermis. Rabbit polyclonal antibodies including anti-c-jun (sc-1694, diluted 1:1000), anti-jun D (sc-746, diluted 1:500), anti-Fra-1 Materials and Methods (sc-6056, diluted 1:1000) and anti-Fra-2 (sc-6046, diluted 1:1000), and mouse anti-junB (sc-8051, diluted 1:300) and goat Cell Culture and Virus Infection anti-fosB (sc-482, diluted 1:300) were obtained from Santa Cruz Primary cultures of human newborn foreskin keratinocytes were Biotechnology (Santa Cruz, CA). Rabbit polyclonal anti-c-fos cultured in keratinocyte serum-free medium (KSFM) supplemen- (ab7963, diluted 1:500) was from Abcam (Cambridge, UK). ted with epidermal growth factor and bovine pituitary extract Monoclonal anti-FLAG M2-Peroxidase (A8952, diluted 1:3000) (10724, Gibco, Invitrogen, Carlsbad, CA). These are obtained as and monoclonal anti-b-Actin (A1978, diluted 1:3000) were discarded tissue samples and their use was reviewed and approved purchased from Sigma (St. Louis, MO). Rabbit anti-human in writing by the University of Maryland Human Subjects involucrin (hINV) serum (diluted 1:2000) was produced in our Institutional Review Board. For virus infection, cells were plated laboratory [62]. Donkey anti-rabbit (NA934, diluted 1:3000) at 40% confluence (0.5 million cells per 21 cm2 dish) and infected and sheep anti-mouse HRP-conjugated secondary antibody with 0, 2 or 10 MOI of tAd5-EV or tAd5-TAM67-FLAG in the (NA931, diluted 1:3000) were from GE Healthcare (GE presence of 5 MOI of Ad5-TA virus in KSFM containing 6 mg/ml Healthcare, Piscataway, NJ). Donkey anti-goat HRP-conjugated polybrene (H9268, Sigma, St. Louis, MO). After 6 h the cells were secondary antibody (sc-2033, diluted 1:3000) was from Santa washed and shifted to fresh virus-free medium. Cruz Biotechnology (Santa Cruz, CA). Rabbit anti-loricrin (PRB-145P, diluted 1:1000) was obtained from Covance Immunological Methods and Antibodies (Princeton, NJ). For immunoblot, keratinocytes were washed twice with phosphate-buffered saline (PBS), drained, and 0.5 ml of lysis Nuclear Extract Preparation 6 buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM Keratinocytes (5610 cells) were harvested with trypsin-EDTA, collected by centrifugation at 5006g and washed several times Na2EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium with PBS. Nuclear pellet and cytoplasmic fractions were prepared pyrophosphate, 1 mM b-glycerophosphate, 1 mM Na3VO4 and 1 mg/ml leupeptin) supplemented with protease inhibitors was using Nuclear and Cytoplasmic Extraction Kit (78833, Pierce 2 Biotechnology, Rockford IL) and stored at 280uC. For protein added to each 21 cm (60 mm) dish. After 5 min on ice, the cells 6 were collected by scraping, and pelleted and sonicated. After crosslinking, the pellet (nuclear fraction, 5610 cell equivalents) centrifugation at 4uC and 15,0006g for 10 min, protein aliquots was suspended in 100 ml of PBS (pH 8.0) containing 1 mM containing 30 mg of protein were separated on denaturing and disuccinimidyl suberate (DSS, 21555, Pierce, Rockford, IL) and reducing Laemmli [60] 8% polyacrylamide gels and transferred to incubated for 10 min at room temperature. Tris-HCl (1 M, pH 7) nitrocellulose. The membrane was blocked in PBS containing 5% was added to a final concentration of 10 mM to stop the reaction, and the protein samples were used for gel electrophoresis and milk powder and 0.1% Tween 20, and incubated at 4uC overnight immunoblot. with primary antibody and for 1 h at 25uC with horseradish To prepare nuclear extract from mouse epidermis, skin was peroxidase-conjugated secondary antibody. Antibody binding was removed and placed on ice and the epidermis was removed by visualized using chemiluminescence detection reagent [61]. scraping with a razor blade. Nuclear extract was prepared from For anti-FLAG immunoprecipitation, keratinocytes were in- the epidermal tissue using the nuclear and cytoplasmic extraction fected with 10 MOI of tAd5-EV or tAd5-TAM67-FLAG with 10 kit (78833, Pierce Biotechnology, Rockford, IL) and stored at MOI of Ad5-TA. At 24 h, 200 mg of total cell extract was diluted 280uC. to final volume of 500 ml in lysis buffer and pre-cleared by addition of 25 ml of protein A/G-agarose for 1 h at 4 C. The samples were u Chromatin Immunoprecipitation Assay (ChIP) then incubated with 20 ml of anti-FLAG M2 affinity gel (Sigma, ChIP assay was performed as described [63] with minor A2220) overnight, and the antibody complex was washed three modification. Keratinocytes (56105 cells) from a 35 mm dish were times with lysis buffer and boiled in 40 ml of Laemmli sample crosslinked with 1.42% formaldehyde at room temperature for buffer for electrophoresis. 15 min followed by quenching with 125 mM glycine and then washed with ice cold PBS containing histone deacetylase Immunofluorescence inhibitors. The cells were then lysed in 150 ml of lysis buffer Keratinocytes, growing on coverslips, were rinsed with PBS and (50 mM Tris-HCl, pH 8, 10 mM EDTA, 1% SDS, 1 mM PMSF, fixed with 1:1 acetone:methanol for 10 min at 220uC. Cells were 20 mM sodium butyrate, and protease inhibitors). Samples were washed three times in PBS for 5 min, and the coverslips were chilled on ice and DNA was sheared using a Branson Sonifier blocked in 3% bovine serum albumin in PBS for 1 h at room (three 30-sec pulses on ice at 40% amplitude with 30 seconds temperature and then incubated with monoclonal anti-FLAG M2 between pulses to produce fragments of 1,000 bp). Four hundred antibody (F3165, Sigma, diluted 1:1000) for 1 h at room microliters of RIPA buffer containing protease inhibitors and temperature. Coverslips were washed three times in PBS for histone deacetylase inhibitors was added followed by a centrifuga- 5 min each and incubated with Alexa Fluor 488-conjugated goat tion of 12,0006g for 10 min. Aliquots of supernatant containing anti-mouse IgG (A11029, Invitrogen, Eugene, OR, diluted 1:1000) sheared chromatin were used for immunoprecipitation. Mouse for 45 min at room temperature. Cells were further co-stained monoclonal anti-FLAG (2 mg, F3165, Sigma, St. Louis, MO) was with 2 mg/ml Hoechst 33258 (H3569, Invitrogen) for 5 min, added to Dynabeads Protein A and incubated for 2 h at 4uC with rinsed in PBS and place in mounting medium (M1289, Sigma). rotation at 40 rpm. Sheared chromatin was added and mixture Fluorescence was visualized using an Olympus OX81 spinning- was incubated at 4uC overnight with rotation. The chromatin-

PLoS ONE | www.plosone.org 10 May 2012 | Volume 7 | Issue 5 | e36941 TAM67 Impact on AP1 Signaling antibody complex was washed twice with RIPA buffer and 40 ml nase 59-TCCACTGGCGTCTTCACC-39/59-GGCAGAGAT- of Chelex 100 slurry (10% wt/vol) was added to the washed beads GATGACCCTTT-39; c-fos 59- prior to boiling for 10 min. The samples were then treated with TGTCTGTGGCTTCCCTTGATCTGA-39/59-TGGAT- proteinase K for 30 min at 55uC and boiled for 10 min. GATGCTGGGAACAGGAAGT-39; Fra-1 59- Enrichment of TAM67-FLAG-associated DNA sequences in CTGTGCTTGAACCTGAGGCA-39/59-GGTGAAAGGAGT- immunoprecipitated samples and input samples were detected TAGGGAGGGT-39 [64]; Fra-2 59-CCCTGCACACCCC- by quantitative RT-PCR using sequence specific primers and CATCGTG-39/59-TGATTGGTCCCCGCTGCTACTGCTT- LightCycler 480 SYBR Green I Master mix. ChIP primers 39 [65]; c-jun 59-GTACCTGATGAACCTGATGC-39/59- included hINV promoter AP1-5 (nucleotides 22218/22055) GGTCACAGCACATGCCACTT-39 [66]; junB 59-GTCACC- forward: 59-TCAGCTGTATCCACTGCCCTCTTT-39 and re- GAGGAGCAGGAGG-39/59-TCTTGTGCAGATCGTC- verse: 59-TCACACCGGTCTTATGGGTTAGCA-39 primers, CAGG-39 [66]; junD 59-AAGACCCTCAAGAGTCAGAA- and hINV promoter control (nucleotides 21040/2919) forward: CACG-39/59-TGTTGACGTGGCTGAGGACTTTCT-39; and 59-CCTCTCAGGGAGAGATTGACATGA-39 and reverse: 59- involucrin 59-CCTCAGCCTTACTGTGAG-39/59-GGGAGG- CAACAGTGCACCAGCACACTTGAA-39 primers [23]. CAGTGGAGTTGG-39.

Gel Mobility Shift Assays hINV and c-jun Promoter Activity Cells were washed with PBS for preparation of nuclear extract Human involucrin hINV reporter plasmids, encoding various using NE-PER Nuclear and Cytoplasmic Extraction Reagent lengths of hINV promoter upstream regulatory region fused to the (78833, Pierce Biotechnology, Rockford, IL). Binding of luciferase reporter gene have been described [36,47]. We used transcription factors to double-stranded AP1 consensus (AP1c) hINV promoter constructs, pINV-2473, pINV-241, and pINV-41, oligonucleotide 59-CGCTTGATGAGTCAGCCGGAA-39 which include nucleotides 22473/27, 2241/27 and 241/27, (E320A, Promega, Madison, WI, AP1 site in bold) or hINV respectively, of the hINV promoter linked to the luciferase AP1-5 probe which encodes the AP1-5 binding site in upstream reporter gene [47]. TAM67 expression plasmid was pcDNA3- regulatory region of human involucrin promoter, 59- TAM67-FLAG. 12-O-Tetradecanoylphorbol-13-acetate (TPA) CTTAAGGCTCTTATTATGCCGTGAGTCAGAGGGCGG- was obtained from Sigma (St. Louis, MO). For experiments, GAGGCAGATCT-39 (AP1 site in bold, Sp1 site underlined) 26105 cells were seeded into 35 mm dishes 24 h before trans- [50], was monitored by gel mobility shift assay. Three fection. For transfection, 6 ml of Fugene-6 reagent (11 814 443 00, micrograms of nuclear extract was incubated for 30 min at Roche, Indianapolis, IN) was mixed with 94 ml of KSFM, and room temperature in a volume of 20 ml containing 20 mM incubated at 25uC for 10 min. This mixture was then added to HEPES, pH 7.5, 10% glycerol, 50 mM KCl, 2 mM MgCl2, 1 mg of hINV plasmid and 1 mg of TAM67-FLAG expression 0.5 mM EDTA, 0.5 mM DTT, 1 mg/ml poly(dI:dC), 0.1 mg/ml plasmid and incubated at 25uC for 20 min followed by direct bovine serum albumin, and 40,000 cpm radioactive double- addition to cultures containing 2 ml of KSFM. The final DNA stranded AP1c-P32 or AP1-5-P32 oligonucleotide. For competi- concentration in all groups was maintained constant by addition of tion studies, a fixed molar excess of non-radioactive competitor empty expression vector. At 24 h after transfection, 2 ml of fresh oligonucleotide was added to the DNA binding reaction. These medium was added containing 0 or 50 ng/ml TPA. After an competitors included Sp1 consensus oligonucleotide (Sp1c) 59- additional 24 h, the cells were washed with PBS and scraped into ATTCGATCGGGGCGGGGCGAGC-39 (E323, Promega, Ma- 200 ml of cell lysis buffer, and luciferase activity was assayed dison, WI, Sp1 site underlined), AP1c and AP1-5 m/Sp1 m, 59- immediately. All assays were performed in triplicate, and each CTTAAGGCTCTTATTATGCCGTGAGCCAGAGTCA AG- experiment was repeated a minimum of three times. Luciferase GAGGCAGATCT-39 (AP1 site in bold, Sp1 site underlined, activity was normalized per microgram of protein. Promoter mutant nucleotides shaded) [50]. For gel mobility supershift activity experiments were also performed in keratinocytes using c- assay, 2 mg of antibody specific for FLAG (F3165, Sigma, St. jun promoter luciferase reporter constructs c-jun(21780/+731) Louis, MO) or c-jun (sc-456), junB (sc-466), junD (sc-746), Fra1 and c-jun(21780/+731)-AP1 m which encode nucleotides (sc-6056), Fra-2 (sc-6046), c-fos (sc-2536) and fosB (sc-486) was 21780/+731 of the human c-jun promoter and upstream added to the reaction mixture and incubated 1 h at 25uC. The regulatory region [48]. The latter construct is identical except 32P-labeled probe was then added and the incubation was that the AP1 sites in the c-jun upstream regulatory region are continued for an additional 30 min at 25uC. Protein-DNA mutated [48]. complexes were resolved in 6% polyacrylamide gels under nondenaturing conditions [8,61]. TAM67-rTA Transgenic Mice The TAM67-rTA mice are maintained in the genetic Quantitative RT-PCR background as previously described [35]. These mice harbor Total RNA was extracted using Illustra RNAspin Mini Isolation a transgene that encodes TAM67-FLAG linked to a tetracycline- kit (25-0500-70, GE Healthcare) according to instructions. One inducible promoter. Epidermis-specific TAM67-FLAG expres- microgram of total RNA was reverse-transcribed to cDNA using sion is induced by addition of 2 mg/ml doxycycline in drinking Superscript III reverse transcriptase (18080-093, Invitrogen Inc.) water and expression is maximal within two day [35]. A FLAG and random primers (10814270001, Roche, Indianapolis, IN). epitope is included at the carboxyl terminus of TAM67 so that Gene expression was measured by quantitative PCR using Roche expression can be easily monitored. For the experiments LightCycler 480 System and SYBR Green reagents (LightCycler outlined in the present study we utilize 20 wk old female mice 480 SYBR Green I Master, 04 707 516 001, Roche). RNA level from TAM67-44 strain [35]. Epidermal extracts were prepared was normalized to glyceraldehyde-3-phosphate dehydrogenase for gel mobility shift or immunoblot after a three day treatment (GAPDH) mRNA level. Relative mRNA level was analyzed by the with doxycycline. Mice were maintained in the University of comparative CT method. The primers, designed to detect the Maryland School of Medicine animal facility in compliance with indicated genes in mRNA isolated from human keratinocytes, NIH regulations with laboratory chow and water accessible ad include (forward/reverse) glyceraldehyde-3-phosphate dehydroge- libitum. The study was approved by the University of Maryland

PLoS ONE | www.plosone.org 11 May 2012 | Volume 7 | Issue 5 | e36941 TAM67 Impact on AP1 Signaling

School of Medicine Institutional Animal Care and Use Author Contributions Committee. Conceived and designed the experiments: BH EAR GA YCC RLE. Performed the experiments: BH EAR GA YCC WX. Analyzed the data: Acknowledgments BH EAR GA YCC RLE. Contributed reagents/materials/analysis tools: BH EAR GA YCC RLE. Wrote the paper: BH RLE. We thank Dr. Wayne V. Vedeckis, Department of Biochemistry and Molecular Biology, Louisiana State Medical Center, for providing the c-jun promoter constructs.

References 1. Angel P, Szabowski A, Schorpp-Kistner M (2001) Function and regulation of 26. Brown PH, Chen TK, Birrer MJ (1994) Mechanism of action of a dominant- AP-1 subunits in skin physiology and pathology. Oncogene 20: 2413–2423. negative mutant of c-Jun. Oncogene 9: 791–799. 2. Karin M, Liu Z, Zandi E (1997) AP-1 function and regulation. Curr Opin Cell 27. Shimizu Y, Kinoshita I, Kikuchi J, Yamazaki K, Nishimura M, et al. (2008) Biol 9: 240–246. Growth inhibition of non-small cell lung cancer cells by AP-1 blockade using 3. Shaulian E, Karin M (2002) AP-1 as a regulator of cell life and death. Nat Cell a cJun dominant-negative mutant. Br J Cancer 98: 915–922. Biol 4: E131–E136. 28. Tichelaar JW, Yan Y, Tan Q, Wang Y, Estensen RD, et al. (2010) A dominant- 4. Shaulian E, Karin M (2001) AP-1 in cell proliferation and survival. Oncogene negative c-jun mutant inhibits lung carcinogenesis in mice. Cancer Prev Res 20: 2390–2400. (Phila) 3: 1148–1156. 5. Mizuno H, Cho YY, Ma WY, Bode AM, Dong Z (2006) Effects of MAP kinase 29. Jin X, Song X, Li L, Wang Z, Tao Y, et al. (2007) Blockade of AP-1 activity by inhibitors on epidermal growth factor-induced neoplastic transformation of dominant-negative TAM67 can abrogate the oncogenic phenotype in latent human keratinocytes. Mol Carcinog 45: 1–9. membrane protein 1-positive human nasopharyngeal carcinoma. Mol Carcinog 6. Shi B, Isseroff RR (2005) Epidermal growth factor (EGF)-mediated DNA- 46: 901–911. binding activity of AP-1 is attenuated in senescent human epidermal 30. Liu Y, Lu C, Shen Q, Munoz-Medellin D, Kim H, et al. (2004) AP-1 blockade keratinocytes. Exp Dermatol 14: 519–527. in breast cancer cells causes cell cycle arrest by suppressing G1 cyclin expression 7. Takahashi H, Ibe M, Nakamura S, Ishida-Yamamoto A, Hashimoto Y, et al. and reducing cyclin-dependent kinase activity. Oncogene 23: 8238–8246. (2002) Extracellular regulated kinase and c-Jun N-terminal kinase are activated 31. Hennigan RF, Stambrook PJ (2001) Dominant negative c-jun inhibits activation in psoriatic involved epidermis. J Dermatol Sci 30: 94–99. of the cyclin D1 and cyclin E kinase complexes. Mol Biol Cell 12: 2352–2363. 8. Adhikary G, Crish J, Lass J, Eckert RL (2004) Regulation of involucrin 32. Feng Z, Li L, Ng PY, Porter AG (2002) Neuronal differentiation and protection expression in normal human corneal epithelial cells: a role for activator protein from nitric oxide-induced apoptosis require c-Jun-dependent expression of one. Invest Ophthalmol Vis Sci 45: 1080–1087. NCAM140. Mol Cell Biol 22: 5357–5366. 9. Eckert RL, Efimova T, Balasubramanian S, Crish JF, Bone F, et al. (2003) p38 33. Madireddi MT, Dent P, Fisher PB (2000) AP-1 and C/EBP transcription factors Mitogen-Activated Protein Kinases on the Body Surface - A Function for contribute to mda-7 gene promoter activity during human melanoma p38delta. J Invest Dermatol 120: 823–828. differentiation. J Cell Physiol 185: 36–46. 10. Eckert RL, Crish JF, Efimova T, Dashti SR, Deucher A, et al. (2004) Regulation 34. Grant S, Freemerman AJ, Birrer MJ, Martin HA, Turner AJ, et al. (1996) Effect of involucrin gene expression. J Invest Dermatol 123: 13–22. of 1-beta-D-arabinofuranosylcytosine on apoptosis and differentiation in human 11. Efimova T, Broome AM, Eckert RL (2004) Protein kinase Cdelta regulates monocytic leukemia cells (U937) expressing a c-Jun dominant-negative mutant keratinocyte death and survival by regulating activity and subcellular localization protein (TAM67). Cell Growth Differ 7: 603–613. of a p38delta-extracellular signal-regulated kinase 1/2 complex. Mol Cell Biol 35. Rorke EA, Adhikary G, Jans R, Crish JF, Eckert RL (2010) AP1 factor 24: 8167–8183. inactivation in the suprabasal epidermis causes increased epidermal hyperpro- 12. Raj D, Brash DE, Grossman D (2006) Keratinocyte apoptosis in epidermal liferation and hyperkeratosis but reduced carcinogen-dependent tumor forma- development and disease. J Invest Dermatol 126: 243–257. tion. Oncogene 29: 5873–5882. 13. Saez E, Rutberg SE, Mueller E, Oppenheim H, Smoluk J, et al. (1995) c-fos is 36. Efimova T, LaCelle P, Welter JF, Eckert RL (1998) Regulation of human required for malignant progression of skin tumors. Cell 82: 721–732. involucrin promoter activity by a protein kinase C, Ras, MEKK1, MEK3, p38/ 14. Kahn CR, Young E, Lee IH, Rhim JS (1993) Human corneal epithelial primary RK, AP1 signal transduction pathway. J Biol Chem 273: 24387–24395. cultures and cell lines with extended life span: in vitro model for ocular studies. 37. Cooper SJ, MacGowan J, Ranger-Moore J, Young MR, Colburn NH, et al. Invest Ophthalmol Vis Sci 34: 3429–3441. (2003) Expression of dominant negative c-jun inhibits ultraviolet B-induced 15. She QB, Chen N, Bode AM, Flavell RA, Dong Z (2002) Deficiency of c-Jun- squamous cell carcinoma number and size in an SKH-1 hairless mouse model. NH(2)-terminal kinase-1 in mice enhances skin tumor development by 12-O- Mol Cancer Res 1: 848–854. tetradecanoylphorbol-13-acetate. Cancer Res 62: 1343–1348. 38. Dong Z, Crawford HC, Lavrovsky V, Taub D, Watts R, et al. (1997) A 16. Rutberg SE, Adams TL, Glick A, Bonovich MT, Vinson C, et al. (2000) dominant negative mutant of jun blocking 12-O-tetradecanoylphorbol-13- Activator protein 1 transcription factors are fundamental to v-rasHa-induced acetate-induced invasion in mouse keratinocytes. Mol Carcinog 19: 204–212. changes in gene expression in neoplastic keratinocytes. Cancer Res 60: 6332–6338. 39. Li JJ, Rhim JS, Schlegel R, Vousden KH, Colburn NH (1998) Expression of 17. Florin L, Knebel J, Zigrino P, Vonderstrass B, Mauch C, et al. (2006) Delayed dominant negative Jun inhibits elevated AP-1 and NF-kappaB transactivation wound healing and epidermal hyperproliferation in mice lacking JunB in the and suppresses anchorage independent growth of HPV immortalized human skin. J Invest Dermatol 126: 902–911. keratinocytes. Oncogene 16: 2711–2721. 18. Passegue E, Jochum W, Behrens A, Ricci R, Wagner EF (2002) JunB can 40. Shen Q, Zhang Y, Uray IP, Hill JL, Kim HT, et al. (2006) The AP-1 substitute for Jun in mouse development and cell proliferation. Nat Genet 30: transcription factor regulates postnatal mammary gland development. Dev Biol 158–166. 295: 589–603. 19. Schreiber M, Wang ZQ, Jochum W, Fetka I, Elliott C, et al. (2000) Placental 41. Thompson EJ, MacGowan J, Young MR, Colburn N, Bowden GT (2002) A vascularisation requires the AP-1 component fra1. Development 127: dominant negative c-jun specifically blocks okadaic acid-induced skin tumor 4937–4948. promotion. Cancer Res 62: 3044–3047. 20. Fleischmann A, Hafezi F, Elliott C, Reme CE, Ruther U, et al. (2000) Fra-1 42. Young MR, Farrell L, Lambert P, Awasthi P, Colburn NH (2002) Protection replaces c-Fos-dependent functions in mice. Genes Dev 14: 2695–2700. against human papillomavirus type 16-E7 oncogene-induced tumorigenesis by 21. Zenz R, Eferl R, Kenner L, Florin L, Hummerich L, et al. (2005) Psoriasis-like in vivo expression of dominant-negative c-jun. Mol Carcinog 34: 72–77. skin disease and arthritis caused by inducible epidermal deletion of Jun proteins. 43. Young MR, Li JJ, Rincon M, Flavell RA, Sathyanarayana BK, et al. (1999) Nature 437: 369–375. Transgenic mice demonstrate AP-1 (activator protein-1) transactivation is 22. Crish JF, Howard JM, Zaim TM, Murthy S, Eckert RL (1993) Tissue-specific required for tumor promotion. Proc Natl Acad Sci U S A 96: 9827–9832. and differentiation-appropriate expression of the human involucrin gene in 44. Efimova T, Eckert RL (2000) Regulation of human involucrin promoter activity transgenic mice: an abnormal epidermal phenotype. Differentiation 53: by novel protein kinase C isoforms. J Biol Chem 275: 1601–1607. 191–200. 45. Eckert RL, Welter JF (1996) Transcription factor regulation of epidermal 23. Crish JF, Zaim TM, Eckert RL (1998) The distal regulatory region of the human keratinocyte gene expression. Mol Biol Rep 23: 59–70. involucrin promoter is required for expression in epidermis. J Biol Chem 273: 46. Eckert RL, Crish JF, Banks EB, Welter JF (1997) The epidermis: genes on - 30460–30465. genes off. J Invest Dermatol 109: 501–509. 24. Crish JF, Bone F, Banks EB, Eckert RL (2002) The human involucrin gene 47. Welter JF, Crish JF, Agarwal C, Eckert RL (1995) Fos-related antigen (Fra-1), contains spatially distinct regulatory elements that regulate expression during junB, and junD activate human involucrin promoter transcription by binding to early versus late epidermal differentiation. Oncogene 21: 738–747. proximal and distal AP1 sites to mediate phorbol ester effects on promoter 25. Crish JF, Gopalakrishnan R, Bone F, Gilliam AC, Eckert RL (2006) The distal activity. J Biol Chem 270: 12614–12622. and proximal regulatory regions of the involucrin gene promoter have distinct 48. Wei P, Inamdar N, Vedeckis WV (1998) Transrepression of c-jun gene functions and are required for in vivo involucrin expression. J Invest Dermatol expression by the glucocorticoid receptor requires both AP-1 sites in the c-jun 126: 305–314. promoter. Mol Endocrinol 12: 1322–1333.

PLoS ONE | www.plosone.org 12 May 2012 | Volume 7 | Issue 5 | e36941 TAM67 Impact on AP1 Signaling

49. Adhikary G, Crish JF, Bone F, Gopalakrishnan R, Lass J, et al. (2005) An 59. Thompson EJ, Gupta A, Stratton MS, Bowden GT (2002) Mechanism of action involucrin promoter AP1 transcription factor binding site is required for of a dominant negative c-jun mutant in inhibiting activator protein-1 activation. expression of involucrin in the corneal epithelium in vivo. Invest Ophthalmol Mol Carcinog 35: 157–162. Vis Sci 46: 1219–1227. 60. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the 50. Banks EB, Crish JF, Welter JF, Eckert RL (1998) Characterization of human head of the bacteriophage T4. Nature 227: 680–685. involucrin promoter distal regulatory region transcriptional activator elements- 61. Adhikary G, Crish JF, Gopalakrishnan R, Bone F, Eckert RL (2005) Involucrin a role for Sp1 and AP1 binding sites. Biochem J 331 (Pt 1): 61–68. expression in the corneal epithelium: an essential role for Sp1 transcription 51. Balasubramanian S, Eckert RL (2007) Curcumin suppresses AP1 transcription factors. Invest Ophthalmol Vis Sci 46: 3109–3120. factor-dependent differentiation and activates apoptosis in human epidermal 62. Robinson NA, LaCelle PT, Eckert RL (1996) Involucrin is a covalently keratinocytes. J Biol Chem 282: 6707–6715. crosslinked constituent of highly purified epidermal corneocytes: evidence for 52. Jang SI, Steinert PM (2002) Loricrin expression in cultured human keratinocytes a common pattern of involucrin crosslinking in vivo and in vitro. J Invest is controlled by a complex interplay between transcription factors of the Sp1, Dermatol 107: 101–107. CREB, AP1, and AP2 families. J Biol Chem 277: 42268–42279. 63. Chew YC, Adhikary G, Wilson GM, Reece EA, Eckert RL (2011) PKCdelta 53. Yoneda K, Hohl D, McBride OW, Wang M, Cehrs KU, et al. (1992) The suppresses keratinocyte proliferation by increasing p21CIP1 level by a KLF4- human loricrin gene. J Biol Chem 267: 18060–18066. dependent mechanism. J Biol Chem 286: 28771–28782. 54. Angel P, Hattori K, Smeal T, Karin M (1988) The jun proto-oncogene is 64. Ramos-Nino ME, Blumen SR, Pass H, Mossman BT (2007) Fra-1 governs cell positively autoregulated by its product, Jun/AP-1. Cell 55: 875–885. migration via modulation of CD44 expression in human mesotheliomas. Mol 55. Devary Y, Gottlieb RA, Lau LF, Karin M (1991) Rapid and preferential activation of the c-jun gene during the mammalian UV response. Mol Cell Biol Cancer 6: 81. 11: 2804–2811. 65. Diegmann J, Junker K, Gerstmayer B, Bosio A, Hindermann W, et al. (2005) 56. Stein B, Angel P, van Dam H, Ponta H, Herrlich P, et al. (1992) Ultraviolet- Identification of CD70 as a diagnostic biomarker for clear cell renal cell radiation induced c-jun gene transcription: two AP-1 like binding sites mediate carcinoma by gene expression profiling, real-time RT-PCR and immunohisto- the response. Photochem Photobiol 55: 409–415. chemistry. Eur J Cancer 41: 1794–1801. 57. Berger I, Shaul Y (1994) The human junD gene is positively and selectively 66. Kamioka N, Akahane T, Kohno Y, Kuroki T, Iijima M, et al. (2010) Protein autoregulated. DNA Cell Biol 13: 249–255. kinase C delta and eta differently regulate the expression of loricrin and Jun 58. Brown PH, Kim SH, Wise SC, Sabichi AL, Birrer MJ (1996) Dominant- family proteins in human keratinocytes. Biochem Biophys Res Commun 394: negative mutants of cJun inhibit AP-1 activity through multiple mechanisms and 106–111. with different potencies. Cell Growth Differ 7: 1013–1021.

PLoS ONE | www.plosone.org 13 May 2012 | Volume 7 | Issue 5 | e36941