Delivered by Publishing Technology to: Yale University IP: 130.132.27.226 on: Tue, 25 Sep 2012 15:00:20 Copyright (c) American Society for Plant Taxonomists. All rights reserved. n h iaaa,toi aa,toi etr North western 1). (Fig. in America two North eastern Japan, in in two China and two in America, (1990) occur Himalayas, Farjon which the follow of We three and 1999). species, al. nine et recognized (Fitschen Far- Fu who 1986; authors 1990; Silba Page 1983; various 1990; Cheng by jon 1966; Gaussen accepted 1936; Flous species 1929; 13 to eight ln Sate 94 oe1992). Cope of 1984; cultivars (Swartley and with alone varieties important named horticulturally 250 salamanders than also more and are They 1993), 2001). (Benkman (Brooks birds (Mladenoff 1993), deer Stearns including and wildlife, provide for Hemlocks resources value. important aesthetic and functions ecological enudrae.Mtuooe l 19)ue ih mor- infer eight phytochemical to used used chromatography (1972) (1995) Taylor and al. characters, et phological Matsumoto undertaken. been etr ot mrc,aeago oreo ubrand lumber of source good a are fiber, America, especially North species, western certain While 1972, persistent drought. tolerate Hirokawa cannot that slow-growing, trees 1961; are shade-tolerant Hemlocks long-lived, (Wang 1990). Honkala Asia and Burns and 1976; America communities North forest lowland in and subalpine of conifer portant oyih 08b h mrcnSceyo ln Taxonomists Plant of Society American the by 2008 Copyright © Botany Systematic iig19;LPg 03) h eann relationships 1997; remaining Bayer The and (LePage 2003a). within species LePage Asian 1999; the Vining of all includes Ameri- North eastern species, two to can the sister that are and region species species, remaining American the (ITS) North western spacer the that transcribed agreed internal ribosomal nuclear ahohr u that but other, each hlgn n igorpyof Biogeography and Phylogeny opeesv hlgntcaayi of analysis phylogenetic comprehensive A pt 5etn pce of species extant 25 to Up Hemlock, 4 SR iiino ln nuty etrfrPatBoiest eerh P 60 abra C 61Australia; 2601 ACT Canberra, 1600, GPO Research, Biodiversity Plant for Center Industry, Plant of Division – CSIRO ahnP Havill P. Nathan lndsqecso h ula iooa T ein nlsso hools n T eune eov ld hticue h w western two the includes that clade a resolve sequences multiple ITS and and sequences chloroplast DNA of chloroplast species, Analysis using region. American inferred ITS were North ribosomal species nuclear nine the all of of sequences accessions cloned multiple among relationships phylogenetic Tsuga, species, awnddntgopwith group not did Taiwan oiin nteclrpatadIStes ugsigta tmyb fhbi rgn ieiodbsdboegahcifrnewith with inference distribution circumpolar biogeographic widespread Likelihood-based initial origin. an hybrid distribution. and intron. of disjunct diversification be current group the may to crown it leading basal events that Eocene extinction suggesting and an trees, vicariance infers subsequent ITS estimates and time chloroplast divergence the in positions ugsigta h aooi ttso hs itntppltossol ereautd h iaaa species, Himalayan The reevaluated. be should populations distinct these of status taxonomic the that suggesting Tsuga Abstract—Hemlock, neta rarcntuto,itra rncie pcr hlgntcincongruence, phylogenetic spacer, transcribed internal reconstruction, area Keywords—ancestral 1 3 Tsuga eateto clg n vltoayBooy aeUiest,NwHvn onciu 62-16U.S.A 06520-8106 Connecticut Haven, New University, Yale Biology, Evolutionary and Ecology of Department h cdm fNtrlSine,10 ejmnFaki aka,Piaepi,Pnslai 90 U.S.A. 19103 Pennsylvania Philadelphia, Parkway, Franklin Benjamin 1900 Sciences, Natural of Academy The 5 rsn drs:DlaIsiueo aua itr,29Da ie od odi,Mie027U.S.A. 04287 Maine Bowdoin, Road, River Dead 219 History, Natural of Institute Delta address: Present .caroliniana, T. sgnrlycniee ob oevlal o its for valuable more be to considered generally is 20) 33:p.478–489 pp. 33(3): (2008), .caroliniana T. Tsuga rsn drs:Dprmn fBooy nvriyo epi,Mmhs ense312U.S.A. 38152 Tennesee Memphis, Memphis, of University Biology, of Department address: present eentwl resolved. well not were Edihr arèe(iaee,i nim- an is (Pinaceae), Carrière (Endlicher) 2 colo ilg n clg,Uiest fMie rn,Mie04953 U.S.A. 04469-5735 Maine Orono, Maine, of University Ecology, and Biology of School .caroliniana T. 1,6 snse.TeohresenNrhAeia species, American North eastern other The nested. is Tsuga Tsuga hitpe .Campbell S. Christopher , and .heterophylla T. .chinensis T. Tsuga Pnca) a ijntdsrbto nNrhAeiaadAi.T xmn h igorpi itr of history biogeographic the examine To Asia. and America North in distribution disjunct a has (Pinaceae), .canadensis T. hlgnn.Aaye fthe of Analyses phylogeneny. aebe ecie,with described, been have slctdi ld that clade a in located is 6 n hools N euneData Sequence DNA Chloroplast and uhrfrcrepnec ([email protected]) correspondence for Author rmmiln hn,and China, mainland from and .mertensiana, T. eentsse to sister not were , .heterophylla T. omnctn dtr atLavin Matt Editor: Communicating Tsuga Tsuga .canadensis T. ihe .Donoghue J. Michael a not has n ld fAinseiswti hc n fteesenNrhAmerican North eastern the of one which within species Asian of clade a and 2 hmsF Vining F. Thomas , Pnca)Ifre rmNcerRbsmlITS Ribosomal Nuclear from Inferred (Pinaceae) in .sieboldii T. 478 otn upssbcueteegnr r huh ob otclosely most be to thought are genera to these related because purposes rooting of Species each of ne osbeisacso yrdzto.W sdthe to used and We phylogenies hybridization. of cpDNA instances and po- possible ITS examine infer to in us discordance the allows tential in which inherited 1996), paternally bipa- (Mogenson is is Pinaceae cpDNA ITS and genus. to the inherited, and of rentally data, history biogeographic sequence the (cpDNA) examine DNA chloroplast and (ITS) of logeny epu oeaieadacutfrpten fdivergence is of species. it patterns between ITS, and for within using account copies Pinaceae and among the examine relationships in to phylogenetic taxa helpful related infer closely accurately among To et Campbell 2004; 2005). coalesce Wang always and al. not Wei In 1999; do 2007). Liston species al. and et a (Gernandt Kan within 2005, copies al. ITS et Campbell addition, al. al. 2003; et et al. Gernandt et Maggini 1999; Wei 1996; other Vining 2001; 1999; al. subre- all Liston et distinctive and in Marrocco Gernandt has 1996; 1998; than al. region longer et ITS1 (Liston is the peats region and 2004). ITS plants, Wang the 1999; and vascular Wei Pinaceae, Liston 2001; al. the and et In Gernandt Gernandt 1999; commonly (e.g. al. taxa, et also Pinaceae Liston plant is the related region closely al. in ITS of et including analyses Ran The phylogenetic 2005; 2007). for al. al. al. used et et et Chaw Gernandt Liston 2005; (e.g. 2006; Donoghue plants and related Bell closely 2003; of of studies groups phylogenetic for other successfully used been have these matK apigDsg n ugopSelection— Outgroup and Design Sampling h betvso hssuywr orcntuttephy- the reconstruct to were study this of objectives The .canadensis, T. rmUln sadddntgopwith group not did Island Ullung from intron, Tsuga Tsuga, Nothotsuga, 1 Tsuga pce n n apeo ahotru Apni 1). (Appendix outgroup each of sample one and species 2,5 rpl with e LePage Ben , ssse oteAinclade. Asian the to sister is 6ito,and intron, 16 sn ula nenltasrbdspacer transcribed internal nuclear using M Abies, Nothotsuga TRASAND ATERIALS and Keteleeria, trnK–matK itrto sister 3 adl .Bayer J. Randall , trnT–F a nconflicting in was dumosa, T. intron, M ETHODS Tsuga Pseudolarix .sieboldii T. eotie –0samples 2–10 obtained We sg chinensis Tsuga trnL–F pN ein,as regions, cpDNA Hr 97 rc tal. et Price 1987; (Hart region, eeicue for included were rmJapan from 4 and , rpl16 from trnK– Delivered by Publishing Technology to: Yale University IP: 130.132.27.226 on: Tue, 25 Sep 2012 15:00:20 Copyright (c) American Society for Plant Taxonomists. All rights reserved. oe oprto,AnAbr ihgn n lge sn MUSCLE using aligned and Michigan) Arbor, (Gene au- 4.2.2 Ann 3100 Sequencher Corporation, using Biosystems Codes edited Applied were an Sequences sequencer. on tomated California) City, Foster Biosystems, h aeecp o nanaigtmeaueo 50 of temperature annealing an for except same the ia xeso t72 at extension final 95 at cycles 40 rT,tnb rL,tnd rL,adtnf(aelte l 91.Ther- 1991). al. et (Taberlet trnLf and for trnLe, conditions primers mocycling the trnLd, of trnLc, combinations trnLb, using sequenced trnTa, and amplified was that bp) CCAGAACCGGACATGAAAGT-3 primers the using sequenced (5Ј and amplified was that bp) 630 ein uha h iraNvd where Nevada Sierra the as such regions mertensiana i Qae,L ol,Clfri) xetfor except extraction California), mini plant Jolla, DNeasy La the (Qiagen, using leaves kit dried or fresh from was tracted region ITS The 2000). with al. genera et outgroup Wang only 1999; with Vining rooted 1990; Farjon 1987; 2008] TCGTCATGAGGAAGAACGAA-3 ATCCCATGAGTCAGGAGAGC-3 and 1999) CGGATGA-3 al. et (Young trnK-11 matK hc N a idypoie yX-.Wn tteCieeAcademy Chinese the Beijing. at Wang Sciences, X.-Q. of by provided kindly was DNA which eune rmohrseisi h iaeefo eBn,adnew the and (1) were preliminary GenBank, regions using cpDNA from The designed Pinaceae quences. were the primers using in sequencing designed species internal were other primers from amplification sequences new necessary, When tions. (5 ITS-NothoFor1 GACTAGGG-3 primers additional CTTGTGTGCCTCGGTCTTC-3 the for failed so ITS-5c respectively, and the ITS-2d and with primers amplification (5Ј the 5c Posi- (5Ј-CGCAACGCCTTCGAGAGAAC-3 using primers. ITS-2d amplification sequenced primers colonies internal the were using 27 clones PCR sample, by each tive inserts For for Clon- California). screened TA Carlsbad, were TOPO the (Invitrogen, using Kit cloned were ing products Amplification 72 min. and 5 min, for 1 for 95 54°C at min, min 1 5 were conditions al. cycling et using (CGATGTCGTGAGAAGTTCACTG), (White designed ITS-TsuFor1 was ITS-4 which primer primer new the the with and (PCR) 1990), reaction chain polymerase the eunigwspromduigteBgy emntrkt(Applied kit Terminator BigDye the using performed was Sequencing F N mlfcto n Sequencing and Amplification DNA h nieISrgo (ITS1 region ITS entire The he pN ein eeapiidadsqecdi ohdirec- both in sequenced and amplified were regions cpDNA Three -CGTAAAGACTTTCTTCCACGAGA-3 IG .Mpsoigterne fextant of ranges the showing Map 1. . oigrgo c.14 p htwr mlfe sn h primers the using amplified were that bp) 1240 (ca. region coding -GTTGATCGGAAAGGGCTTGC-3 and o i,56 min, 1 for °C Ј eedsge sn rlmnr sequences. preliminary using designed were Ј) ,adsqecdwt primers with sequenced and ), .heterophylla T. Nothotsuga o i.Cniin o the for Conditions min. 5 for °C Tsuga matK Tsuga T2 a 70b)wsapiidusing amplified was bp) 1730 ca. –5.8SITS2; o . i ihafnletnina 72 at extension final a with min 1.5 for °C a problematic. was eas lgmn fIS rmteother the from ITS1 of alignment because r hw ssmarcfrgahclsmlct although simplicity graphical for sympatric as shown are o i,ad72 and min, 1 for °C and n T-he1(5 ITS-ThRev1 and Ј) Tue1(5 matK-TsuRev1 eune rmVnn 19) Thermo- (1999). Vining from sequences AILE L:PYOEYADBOEGAH FTSUGA OF BIOGEOGRAPHY AND PHYLOGENY AL.: ET HAVILL ;()te3 the (2) Ј); ;ad()the (3) and Ј); rpl16 ,floe y4 ylsa 95 at cycles 40 by followed °C, .longibracteata N. — Ј ee5mna 95 at min 5 were and ) trnK Ј oa eoi N a ex- was DNA genomic Total .hererophylla T. Vnn 99.Sequencing 1999). (Vining ) Keteleeria Ј Ј and ) nrnadaprino the of portion a and intron Tsuga n fthe of end Ј-GAACCAAAATTTC- trnT–F matK trnT–F o . i iha with min 1.5 for °C °C. matK Ј-CATGGAGGACG pce ae nLtl 17) ioaa(92 96,adFro 19) h itiuin of distributions The (1990). Farjon and 1976), (1972; Hirokawa (1971), Little on based species and Tue (5Ј rpl16-TsuRev and Tue2(5 -TsuRev2 sntpeet h sad fUln n awnaeidctdwt stars. with indicated are Taiwan and Ullung of islands The present. not is ein(a 1460 (ca. region ,floe by followed °C, rpl16 Tuo1(5 -TsuFor1 .heterophylla, T. ecin were reactions Nothotsuga rpl16-TsuFor n ITS- and Ј) nrn(ca. intron Tsuga for °C for se- °C Ј Ј Ј - - - - nomtv eas hycnb sdt osri h g fthe remaining of the age of the pollen whereas constrain ceae, to used of Pollen be stem. can they because (Szafer informative these of subset a only 2003b). characters include shoot LePage typically and 1949; cone, deposits leaf, fossil of the suite a while requires to species fossils extant of these eation assigning However, within positions 2003b). phylogenetic (LePage America North ern 90 rta 97 oadSili17;OesadBae1983). Blake and Campo-Duplan Owens longibracteata (van 1972; Sziklai suga fringe and equatorial Ho puffy 1957; a Erdtman 1950; to reduced sacs lateral the known Bayesian sampled 400 the of analysis divergence replicate of trees. rate by deviations estimated standard a and were Means with times 2003). 2002) (Sanderson software 1.71 (Sanderson the re- r8s using cross-validation was likelihood using lengths estimated penalized a parameter branch smoothing of used among enforcement rate we het- constant without rate jected, a and examine Because to with clock. used scores molecular estimate was likelihood to test used using ratio were erogeneity set likelihood data A cpDNA times. the divergence of analysis Bayesian from hypotheses. ing taxonomic conflicting cpDNA test the to using sets performed data were ITS PAUP* and in chains. implemented Markov as the 3.7 replicates of stabilization Modeltest assess by to genera- versus implemented used scores were as log-likelihood time of AIC tion Plots 1998). using Crandall and determined (Posada and was region calculate cpDNA generations ITS each to for used 10,000,000 for model trees fitting 400 best of of The total probabilities. runs a heated posterior for concurrent generations incrementally 50,000 two every four sampled and priors, chains, default Markov using 2003) the Huelsenbeck with replicates bootstrap conditions. 1,000 search data. using heuristic missing estimated same as treated was were support Gaps branches, characters. Clade tree-bisection- all zero-length of addition, collapsing weighting equal swapping, sequence and branch random (TBR) with reconnection searches heuristic 2003). ing each (Swofford of 4.10b10 composition PAUP* base with the determined pseudogenes, was of sequence presence ITS 2001). the al. for et (Gernandt check content To GC de- decreased been and rate have substitution creased matrices data S3450). all number and (study 1) depos- TreeBASE been Appendix in have posited (see study GenBank this in in generated ited sequences All 2004). (Edgar 3.6 Tsuga iegnetmswr airtduigfsi vdne h earliest The evidence. fossil using calibrated were times Divergence result- lengths branch and topology Estimation—The Time Divergence 1,000 with bootstrap RELL the using tests (S-H) Shimodaira-Hasegawa and (Ronquist 3.1 MrBayes with conducted were analyses Bayesian us- PAUP* with conducted were analyses (MP) parsimony Maximum Analyses Phylogenetic Tsuga olni nw rmerirtms aigteercrsmore records these making times, earlier from known is pollen .mertensiana T. eaosl r rmEcn eoisi uoeadwest- and Europe in deposits Eocene from are megafossils .mertensiana T. olni iact ihsalsc htaevral in variable are that sacs small with bisaccate is pollen eeal cusa ihreeain n nsome in and elevations higher at occurs generally — vdnefrISpedgnsicue in- includes pseudogenes ITS for Evidence a w aea as si otohrPina- other most in as sacs, lateral two has Tsuga sntawy eibebcuedelin- because reliable always not is Tsuga pce smnscaewith monosaccate is species Nothot- Tsuga 479 T. Delivered by Publishing Technology to: Yale University IP: 130.132.27.226 on: Tue, 25 Sep 2012 15:00:20 Copyright (c) American Society for Plant Taxonomists. All rights reserved. eetcmo netrof ancestor common of recent distribution past Liu the 1985; incorporate (Tiffney To Tsuga glaciations 2003b). LePage and 2000; climate Basinger drier and and Qua- the cooler during to disappeared due but ternary Pleistocene, the through Cretaceous the rnhlaigt h otrcn omnacso of ancestor common recent most the to leading branch and Macrofossils 2.5. AReA that in indicate us- implemented records likelihood algorithm pollen maximum genetic under for 0.002 data the and the dispersal ing from for 0.0003 estimated of were Rates set. extinction data using cpDNA the framework from likelihood rived a in node each methods. estimated for Carlo Probabili- then and Monte press). are in branch areas al. geographic each et among along Moore movements geo- 2005; ancestral among al. of connection et extinction, ties (Ree of and time probability dispersal over the areas lineage of graphic model of independent rates an data, and phylogeny, pack- incorporates fossil software method the times, This by 2008). divergence Smith superseded and been Ree since lagrange; has age software AReA the (note, using 2.5 inference AReA likelihood model-based with the reconstructed for mya 90 of age an fixing of by ancestor estimates common age the calibrated we to record, similar types, to saccate similar which pollen, morphologically bisaccate of considered contained association he The deposits These that convincing. 1963). (Macko but less Poland surface, in was the species of on monosaccate record spines oldest extant of other lack with pos- be the fossils may and it grain that with the observed pollen fossil (1973) associate Sivak to 1957). sible (Ueno fringe reduced a uasct lgcn u oteTra tat l rbblte r inde- are probabilities migration. Middle All of the the Strait. direction Turgai by from the the of separation EUR to pendent to and due due EAS Oligocene Cretaceous between to Jurassic and late be- Seaway, the probabilities Interior in dispersal Western WNA reduced and (2001). include ENA Scotese model by tween this summarized Mesozoic of as the features history during Some probabilities paleogeographic Connection on press). implemented based (in and are al. (2001) paleogeologic et Manchester Moore and and by paleoclimatic Tiffney on by synthesized based probabilities The factors are EUR). connections Cenozoic and intracontinental EAS the between the throughout and and WNA, and EAS), ENA land and (between Bering the WNA EUR), and for (between ENA functions bridge (between dispersal bridges among land includes Atlantic top) probabilities North 4, the connection (Fig. areas of Hemisphere model Northern paleogeographic The 2003b). caroliniana T. as such species extant other However, fringe. duced 480 tp ihaflydvlpdfig n a and fringe developed fully a with folia-type eune.TeIS einvre rm1342 Nothotsuga from varied region per ITS1 individuals The two sequenced. or one across clones of 15 clones Four long. nucleotides eonzdtotpso fossil of types of two analysis recognized phylogenetic thorough extant a of and absence fossil the in unclear is tionships At- extant certain with 1957). pollen and monosaccate Ueno fossil fringe, Tsuga 1950; associate the to Campo-Duplan made of been (van have size tempts structure the surface size, Monosaccate of overall 1950). aspects in Campo-Duplan species among (van differs shape and size Ccnetfralcoe nordt e a 84(..= (s.d. 58.4 was set data 57.1 our of range in Mean narrow clones the content. and all GC 0.004), low for correspondingly content a GC not is there restii, of clones some data the align to or required insertions were set. Forty-four ITS1, deletion. in bp all 37 (indels), a deletions to due long bp 1325 as of to 23 referred clone (hereinafter including not clones, RAaayi noprtdtete oooyadbac egh de- lengths branch and topology tree the incorporated analysis AReA Biogeography Historical h lge T aasto 1 lndsqecsws1785 was sequences cloned 116 of set data ITS aligned The hl hr per ob ihrsbttto aein rate substitution higher a be to appears there While nErp,fsiswr lcdaogtebac edn otemost the to leading branch the along placed were fossils Europe, in pce,btwehrteeascain niaepyoeei rela- phylogenetic indicate associations these whether but species, ae nmlil oslrcrs(umrzdb LePage by (summarized records fossil multiple on based lnsadfo 1351 from and clones Tsuga Tsuga .ciess .chinensis T. chinensis, T. Nothotsuga olni rmlt rtcos(a 0ma deposits mya) 90 (ca. Cretaceous late from is pollen oln o xml,TosnadPlg(1953) Pflug and Thomson example, For pollen. .canadensis T. atrso ipra n iainewere vicariance and dispersal of —Patterns .mertensiana T. Tsuga Tsuga R .chinensis T. and ESULTS a rsn hogotErp from Europe throughout present was .canadensis T. Tsuga. olnfo h loee a Pliocene: the from pollen and .longibracteata N. .chinensis T. .mertensiana T. – 91idctsta there that indicates –59.1 and .diversifolia T. 34b among bp 1364 Tia),wihwas which (Taiwan)), tp ihare- a with canadensis-type n nthe on and canadensis, T. Tia) and (Taiwan), ae ntedaee of diameter the on based Tsuga .sieboldii T. 30b among bp –1350 .canadensis T. n w mono- two and , rmTaiwan from ae nthis on Based . ao were taxon n ieto five and Tsuga YTMTCBOTANY SYSTEMATIC lohave also .for- T. Tsuga diversi- pollen and rmmiln hn ntecDAte,btisedwas instead but tree, cpDNA the to in sister China mainland from omaclade. a form sieboldii h pN aast( .7 n infcn ifrnefor difference ( significant set a data and 0.07) ITS = the (P set data using cpDNA difference the significant marginally a in resulted positions dumosa hetero- T. dumosa, T. caroliniana, of clones T. phylla, the canadensis, resolved T. 2) bracteata, G (Fig. + tree majority I 75% consensus + Bayesian rule GTR The a reten- substitution. utilized nucleotide and analysis of 0.592 model Bayesian of 0.894. index of consistency with index steps, trees tion 1191 parsimonious of equally 38 length 15,977 in and a resulted (5.5%), ITS analy- 9 of MP (30.2%), sis respectively. sites, 428 informative and parsimony sites, (18.5%) variable (31.2%) content 64 GC its and taxon consis- this was for tree 59.1%. clones the was sequence other in the position this with its remove because was tent set there to data however, the reason copy; from compelling functional a no be otherwise not may this that uecnesste Fg )ecp hti h Ptree MP the in that except majority 3) 50% (Fig. Bayesian caroliniana tree the to consensus identical rule was tree consensus GTR unlinked +I+Gmodelsforeachofthethreeregions.TheMPstrict separate with substitution nucleotide of model taxa informative. single not in therefore found were and majority the because analyses netic in bp) in 83 and (68 deletions ( long nucleotides hntoeta eentmnpyei rne0.014 (range of monophyletic exception not the with were that 0.007 those (range than divergence exhib- sequence monophyletic pairwise were of lower sequences exception ited cloned the which with for clade a Taxa indi- form an not from did sequences vidual taxon, per included were individual and Taiwan, from of clade a of four of exception the with as to referred (hereinafter from Clones een eune ihuuulylwG otn.Te3 bp 37 04 The clone content. in GC deletion low unusually with sequences no were inidxo .1.Tetesdfee nyb h placement the by only reten- differed a trees and of The 0.890, 0.914. of a of index index with consistency tion a trees steps, parsimonious MP 427 equally of respectively. length four and sites in (5.5%), resulted informative 38 analysis (4.9%), parsimony 61 (5.9%) and sites, 90 variable (11.4%) 175 and in tion dataset in entire repeat poly-AT the align to (matK required were indels Forty-eight ein nqet n rtotx nldda5b insertion in bp insertion 5 bp a 15 a included taxa two or anda5bpdeletionin one to unique region, h pN n T re ifrdi h lcmn of placement the in differed trees ITS and cpDNA The sg chinensis Tsuga and (16.6%), 27 (39.6%), 561 contained ITS2 and 5.8S, ITS1, matK, 3456 was sequences 37 of set data cpDNA aligned The Keteleeria. .caroliniana T. =8, - et with tests S-H . and .diversifolia T. Uln) n h three the and (Ullung), and rpl16, h - etwssgiiatydifferent significantly was test S-H The dumosa. T. rpl16 a o eovda itrto sister as resolved not was .mertensiana T. neswr o oe scaatr nphyloge- in characters as coded not were Indels .diversifolia T. .sieboldii T. aeinaayi tlzdaheterogeneous a utilized analysis Bayesian . 11, = p .forrestii. T. Tia)ddntgopwith group not did (Taiwan) matK oeotyidl,ali the in all indels, Noteworthy rpl16. 0.03). = 52 from –85.23 trnT–F 9b eeinin deletion bp 69 a , .chinensis T. trnT–F .sieboldii T. .diversifolia T. .dumosa T. 1246, = rmJapan, from .sieboldii T. and smnpyei o ahspecies. each for monophyletic as .diversifolia T. otie 1 90) 8(10.0%), 68 (9.0%), 113 contained .dumosa T. hncoe rmmr hnone than more from clones When 9 nldn oyAada and poly-A a including 29) = .sieboldii T. .chinensis T. .diversifolia T. and rpl16 Uln)(.0)(al 1). (Table (0.007) (Ullung) osrie otedifferent the to constrained .forrestii T. Uln) omdaclade a formed (Ullung)) and .ciess .chinensis T. chinensis, T. n 1 pdeletion bp 112 a and , 680, = lnsta eepart were that clones Nothotsuga .sieboldii T. rmUln Island Ullung from .diversifolia T. Tia)suggests (Taiwan) ape i not did samples trnT–F 7b inser- bp 17 a , Vlm 33 [Volume .chinensis T. .dumosa T. w long two , (Ullung), .longi- N. 1530). = –0.023), –0.013) trnT–F + T. T. T. . Delivered by Publishing Technology to: Yale University IP: 130.132.27.226 on: Tue, 25 Sep 2012 15:00:20 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 2008] AILE L:PYOEYADBOEGAH FTSUGA OF BIOGEOGRAPHY AND PHYLOGENY AL.: ET HAVILL 481 Delivered by Publishing Technology to: Yale University IP: 130.132.27.226 on: Tue, 25 Sep 2012 15:00:20 Copyright (c) American Society for Plant Taxonomists. All rights reserved. ← to sister was instead but tree, cpDNA with group not did chinensis ( set chinensis data cpDNA the using chinensis T. chinensis T. caroliniana T. canadensis T. longibracteata N. 482 .sieboldii T. sieboldii T. mertensiana T. heterophylla T. forrestii T. dumosa T. diversifolia T. r eo h rnhs ebru oce n ln ubr olwteseisnms(e pedx1). Appendix (see names species the follow numbers clone and voucher Herbarium branches. the below are some related closely and in 2004), reported been also in has species clones ITS of cence forrestii T. uigteMoeeadetnto fteErpa re left trees European the caroliniana of T. extinction and of Miocene the ancestor during the from split The lung). with ( tree cpDNA the the from different sieboldii significantly was with position tree the that found hs pce sdsusdi oedti below. detail more in discussed is species these of phyly of by non-monophyly supported sieboldii for is evidence possibility strong This delimitation. taxonomic pce.Ti itiuinwsmitie ni h diver- the until maintained of was gence remaining distribution the to This leading EAS species. and EUR, ENA, in distribution to within divergence leading second The lin- EAS. the and Tsuga, from EUR, lineage ENA, WNA in the when eage separated Eocene late event the vicariance until a areas history of Hemisphere range biogeographic Northern ancestral four of the standard that and reveal 0.0021 2) 4) (Fig. (Table (± Estimates times 0.0067 years. divergence million of per of rate site per mean substitutions a deviation) in resulted trees ( set data ITS ( the set using data significant cpDNA was the using difference nificant mertensiana siana F T T Variation ITS nlsswt 8 sn h ape aeincpDNA Bayesian sampled the using r8s with Analysis the of placement the of tests S-H IG ABLE .Bysa 5 aoiyrl osnu reof tree consensus rule majority 75% Bayesian 2. . and Tsuga Taxon ae oteOioee eutdi ieg nENA in lineage a in resulted Oligocene, the to dated .Ma ariesqec iegne(iuatoprmtr ihsadr eito o T1 .S n T2coe ihnec taxon. each within clones ITS2 and 5.5S, ITS1, for deviation standard with two-parameter) (Kimura divergence sequence pairwise Mean 1. pN eune n nywa upr o mono- for support weak only and sequences cpDNA Uln)sse to sister (Ullung) (Ullung) rmmiln hn.Likewise, China. mainland from Tia)i h nerdpsto esssse to sister versus position inferred the in (Taiwan) .diversifolia T. .caroliniana T. (Taiwan) and , Pinus Picea .dvrioi .sieboldii T. + diversifolia T. .heterophylla T. .canadensis T. itrt l eann pce,ddntfn sig- a find not did species, remaining all to sister T eune a ede npr,t incorrect to part, in due, be may sequences ITS p nENA. in .0)adISdt es( sets data ITS and 0.001) < .sieboldii T. T lnsof clones —ITS Cmbl ta.20) ako olsec of coalescence of Lack 2005). al. et (Campbell Grad ta.2001), al. et (Gernandt .sieboldii T. pN eune.Tetxnm of taxonomy The sequences. cpDNA from o individuals No. D .sieboldii T. n ieg ihawidespread a with lineage a and .sieboldii T. ontcaec.Alc fcoales- of lack A coalesce. not do ssse pce esswith versus species sister as ISCUSSION .caroliniana T. p 2 1 2 1 1 2 2 1 2 1 2 3 .dvrioi .sieboldii T. + diversifolia T. rmJpni ihrteISor ITS the either in Japan from .2 ewe re with trees between 0.02) = ug chinensis Tusga Tsuga Uln)i h inferred the in (Ullung) Uln)lnaei EAS in lineage (Ullung) rmJpnuigboth using Japan from .diversifolia. T. Larix p ot with root, Tsuga o lnsprindividual per clones No. 0.001). < .chinensis T. .sieboldii T. nEAadEUR and ENA in p 0.001). < WiadWang and (Wei , opie all comprised p ,5 2 5, 5, Tsuga .diversifolia T. 1 4 11, ,6 3, 7 7, ,3 9, 6 4, 7 4, 10 .1,but 0.41), = 8 4 6 5 YTMTCBOTANY SYSTEMATIC .merten- T. - tests S-H (Ullung) T lndsqecs otro rbblte r itdaoeadM otta values bootstrap MP and above listed are probabilities Posterior sequences. cloned ITS and (Ul- T. T. T. T. T. , .1 (0.008) 0.014 (0.005) 0.007 .2 (0.011) 0.023 (0.006) 0.008 .1 (0.004) 0.010 (0.010) 0.015 .0 (0.003) 0.007 (0.011) 0.019 (0.004) 0.008 (0.009) 0.025 (0.005) 0.011 (0.006) 0.016 ftedee oe norISadcDAtopologies. cpDNA and ITS our most in between nodes congruence deeper in strong the by relationships of indicated phylogentic as deeper genus, infers the reliably ITS that of taxa related these closely among of lationships influence the explore fully to genes factors. required nuclear low-copy be interspecific from Increased would data therein). additional references and and sampling (2005) Campbell al. numerous and (1999) et on Liston loci and Gernandt DNA of (see ribosomal in because chromosomes nuclear possibly regions of Pinaceae, ITS the separation in the homogenizing retarded evolu- with is concerted plants, credited most that effective is likely high which seems to tion, also lead the that It in traits sizes. history regions population life nuclear to for due common Pinaceae be may (incomplete sorting) polymorphisms lineage ancestral of retention that cated ex- could 2002), in al. coalescence of et and lack and Bentz variation 1997; high is the al. plain et which Wang Hybridization, 1972; diverged recently (Taylor others. between occur preva- than to more likely species be more should some occurred, has in it recombination lent if PCR 2002), why al. reason et obvious (Cronn any there is nor set, tdwt sadclnzto n slto rmother from isolation associ- species. and bottleneck colonization a island of with ated because perhaps divergence, quence from verged age l 20) n u pN aa(i.3 hwthat show 3) (Fig. (1999), data Vining cpDNA our 1995). and al. Tsuga (2000), et al. et Matsumoto Wang 1990; Frankis segregation (e.g. but Farjon accepted 1999), widely al. more 1989; et is Fu genus monotypic (e.g. a valid into be as to some described by ered originally was China, longibracteata southeastern of tive ess74)sgetn t s sa ugopwswell was outgroup an as use its founded. suggesting 7.4%) most two versus the between divergence distant the twice approximately hnwt h te ugop.Tepretsqec diver- sequence percent The between outgroups. gence other the with than hlgn n Taxonomy and Phylogeny re- phylogenetic resolving in utility limited has ITS While data our in present be to appear not do pseudogenes ITS Bouill ITS1 .forrestii T. hrsamr eetcmo netrwith ancestor common recent more a shares Tsuga é n osut(05 n yige l 20)indi- (2007) al. et Syring and (2005) Bousquet and Ceg13) h atrdsgaini consid- is designation latter The 1932). (Cheng .diversifolia T. pce cDA .%vru .% T:13.6 ITS: 1.3%; versus 2.6% (cpDNA: species . .longibracteata N. sg sieboldii Tsuga .0 (0.005) 0.006 (0.007) 0.006 .0 (0.002) 0.001 (0.005) 0.004 .0 (0.004) 0.005 (0.006) 0.007 .0 (0.004) 0.003 (0.005) 0.004 (0.003) 0.002 (0.005) 0.010 (0.000) 0.000 (0.003) 0.002 5.8S u osntcnanhg se- high contain not does but , ohtualongibracteata —Nothotsuga Uln)i lorcnl di- recently also is (Ullung) n nearest and .1 (0.008) 0.010 (0.003) 0.004 .2 (0.015) 0.024 (0.005) 0.008 .1 (0.011) 0.012 (0.022) 0.028 .0 (0.006) 0.009 (0.016) 0.014 (0.007) 0.010 (0.015) 0.021 (0.005) 0.006 (0.007) 0.014 ITS2 Tsuga Tsuga ti loclear also is it , Tsuga Vlm 33 [Volume .chinensis T. Nothotsuga .1 (0.007) 0.013 (0.004) 0.007 .2 (0.010) 0.021 (0.005) 0.008 .1 (0.004) 0.010 (0.011) 0.015 .0 (0.003) 0.007 (0.010) 0.017 (0.004) 0.008 (0.008) 0.023 (0.005) 0.010 (0.006) 0.014 pce is species Combined species na- a , Tsuga T. Delivered by Publishing Technology to: Yale University IP: 130.132.27.226 on: Tue, 25 Sep 2012 15:00:20 Copyright (c) American Society for Plant Taxonomists. All rights reserved. rnhs ebru oce ubr olwteseisnms(e pedx1). Appendix (see names species the follow numbers voucher Herbarium branches. 2008] F IG .Bysa 0 aoiyrl osnu reof tree consensus rule majority 50% Bayesian 3. . AILE L:PYOEYADBOEGAH FTSUGA OF BIOGEOGRAPHY AND PHYLOGENY AL.: ET HAVILL Tsuga pN.Pseirpoaiiisaelse bv n Pbosrpvle r eo the below are values bootstrap MP and above listed are probabilities Posterior cpDNA. 483 Delivered by Publishing Technology to: Yale University IP: 130.132.27.226 on: Tue, 25 Sep 2012 15:00:20 Copyright (c) American Society for Plant Taxonomists. All rights reserved. PbosrpadBysa otro rbblte nalphy- all in probabilities posterior Bayesian and bootstrap MP aentbe xmndi eal hl h itrrelation- sister the While detail. of our in ship species examined to other been although, the not of 1998), have mechanisms al. pollination other the et the knowledge, (Owens of pollen typical monosaccate of be mechanism to pollination pollen considered The Owens long 1998). 1983; a Blake al. and which (Owens ad- et from ovule pollen the bracts reach the and to help grows scales tube that cone sur- spines the minute the to has and here pollen pendulous, its are of cones face the because germinates. inverted it the not where on ovule sacs the buoyant into contrast, up the In float and to erect, it being as cause cone down pollen the faces micropyle of The result pollen droplet. a where pollination funnel a a on into out lands splayed is area micropylar our the To 2005). al. of larix, et mechanisms Fernando pollination 1998; al. knowledge, et Owens 1983; Blake remaining the to than u ooact oln nadto,tepliainmecha- pollination the of addition, nism In pollen. monosaccate sus on nalohrPnca except Pinaceae other all in found dolarix olnto,as on in found also pollination, Keteleeria, sn 0mafxdaefrtems eetcmo netrof ancestor common recent most the for age suga fixed calibrated mya and 90 data a cpDNA using using likelihood penalized by estimated tion) ai evs lofudin found also leaves, matic Tsuga remaining while the Pinaceae, in derived the be of to appear members traits other these with traits ancestral remaining al. of et Flora Matsumoto 1991; 1993; 1995). Committee Vidakovic Editorial 1990; America place- Farjon North the 1986; (1988)), (Silba Page ognized and (1972) Sziklai of ment and Ho see genus (but the of Farjon use 1948; While genus Jackson monotypic and the and Dallimore 1990) 1879; (Engelmann tion Node 484 both in traits of relationship and sister-group inferred The cies. L K J I H G F E D C B90A T emgthv expected have might We mertensiana Tsuga ABLE and .heterophylla T. .heterophylla T. and pce.Frexample, For species. esspnuosse oe;()bscaepollen, bisaccate (3) cones; seed pendulous versus , 2. Tsuga .mertensiana T. .mertensiana T. .mertensiana T. .mertensiana T. Keteleeria esshpsoai evs 2 rc edcnsat cones seed erect (2) leaves; hypostomatic versus Tsuga Tsuga .heterophylla T. Nd ) oedsgain r niae nFg 4. Fig. in indicated are designations Node B). (Node iegnetms(iloso er tnaddevia- standard ± years of (millions times divergence pce eas tsae eea apparently several shares it because species mle ihrraqiiino h ancestral the of reacquisition either implies aentbe ecie.In described. been not have n h ieg edn oteremaining the to leading lineage the and a ensgeae oamntpcsec- monotypic a to segregated been has Tsuga and noisonscini eeal rec- generally is section own its into smr iia to similar more is rcnegn oso hs risin traits these of loss convergent or Hesperopeuce Abies a ople rp t vlsare ovules its drop, pollen no has .heterophylla T. .mertensiana T. .mertensiana T. pce Dye14;Oesand Owens 1945; (Doyle species ohtua Abies Nothotsuga, , Hesperopeuce Cedrus Larix sntwdl accepted widely not is , enae±sadr deviation standard ± age Mean and Keteleeria, Tsuga ohtua Pseudo- Nothotsuga, a upre by supported was a:()amphisto- (1) has: ob itrt the to sister be to Abies Pseudotsuga, 7.6±17.74 ± 171.26 .heterophylla T. Lmo 1890). (Lemmon 48 6.84 ± 14.82 7.06 ± 16.79 7.63 ± 19.76 8.08 ± 23.03 8.18 ± 24.73 8.46 ± 31.43 7.84 ± 34.62 8.02 ± 42.26 .4±3.12 ± 4.84 4.78 ± 8.76 .mertensiana T. , .mertensiana T. pce with species Cedrus and Tsuga YTMTCBOTANY SYSTEMATIC and Cedrus Nothot- and , Pseu- spe- ver- is var. hemlock. Island sta- taxonomic Ullung the of evaluate tus further to in needed variation 1998). specific is Stuessy intra morphology and and (Sun inter of Korea sister analysis from mainland Detailed Ul- diverged or have on Japan to in species thought species plant are endemic which 30 (Kim Island, than lung mya more from 2.7 are formed approximately There that Japan 1985). began of that Sea the eruptions in volcanic island to small related a closely more is be Ullung to it show results our sieboldii chinensis. species, separate inser- by bp not 15 but the as well the as in tion result, This China. mainland from Tsuga tfo h anadppltos u eut show results Our separating populations. ensis characters distinct mainland diagnostic the a of from as lack 1999), it it a al. treating of et favor because Fu not variety did 1994; (1990) Keng Farjon and although Li (e.g. accepted commonly var. sana ieadsaeo h ede n oe.I sntknown to not attempt of not samples is did the We It assign units. evolu- discrete cones. to ecologically and correspond or tionarily variants needles the morphological the by these mostly of whether discriminated shape been and have Cheng 1999), size (e.g. al. status et species-level Fu 1983; given sometimes are which this explain to help result. may regions incorrect nuclear additional from or Data hybridization the of historical could placement from node this resulted with have associated discrepancies this apparent compare The that tests remaining S-H forcing 3), versus 2, relationship (Figs. analyses logenetic sa ld,afnigta scnitn ihtecpct of capacity the with consistent is caroliniana, that T. the finding in nested a is clade, it Asian Rather America. North eastern from species .chinensis, T. that either suggest of results subspecies cpDNA a be may it dumosa that suggested been has it between mediate the in included discernable individuals no two tree. is ITS the there differentiate and to analysis, pattern cpDNA the in tutions chinensis Tsuga aebe sa eas t aenlyihrtdcDAis cpDNA inherited paternally its because of Asian been hybridization, parent of have result paternal the the were trees then ITS and of cpDNA 1997; placement the al. conflicting in the et If Sang 2006). (e.g. al. groups et Edwards plant other histori- in for hybridization evidence cal as presented been nuclear has and phylogenies cpDNA DNA between discordance Such trees. ITS and eea aite of varieties Several Tsuga Tsuga sg caroliniana Tsuga sg dumosa Tsuga forrestii Tsuga formosana Hyt 98 n ae twscagdto changed was it later and 1908) (Hayata tchekiangensis Tia)i o itrt rnse within nested or to sister not is (Taiwan) pce Bnze l 2002). al. et (Bentz species eg isn11;Km18;Le19;Le20) but 2001), Lee 1993; Lee 1988; Kim 1918; Wilson (e.g. Fro 90 or 1990) (Farjon nUln sadhsbe ossetyasge to assigned consistently been has Island Ullung on rmTia a rgnlydsrbdas described originally was Taiwan from trnT–F .chinensis T. Tsuga n sntcoeyrltdto related closely not is and u not but L n eg15) h atrdsgainis designation latter The 1954). Keng and (Li niiul ayb nyoet he substi- three to one only by vary individuals per ndfeetpstosi h cpDNA the in positions different in appears a opooia hrcesta r inter- are that characters morphological has a infcn o T,btntfrcpDNA. for not but ITS, for significant was .dumosa T. .formosana T. einsae by shared region Tsuga , sntsse to sister not is robusta .chinensis T. .chinensis T. .canadensis, T. Tia) uprsissgeaina a as segregation its supports (Taiwan), otdet ogbac attraction. long-branch to due root .chinensis T. and , .mertensiana T. .forrestii T. ahrta savreyof variety a as than rather , .dumosa T. oblongisquamata .chinensis T. ovreisi u analysis. our in varieties to rmmiln hn (e.g. China mainland from .chinensis T. oitrre ihAsian with interbreed to .canadensis, T. F ta.19) Our 1999). al. et (Fu a ense within nested be may ol presumably would .dumosa T. Fro 90,and 1990), (Farjon ob itrt all to sister be to and , and .diversifolia T. Vlm 33 [Volume .chinensis T. .chinensis T. .forrestii T. . .dumosa T. h other the .formo- T. patens .chin- T. Tsuga T. T. T. ), . , Delivered by Publishing Technology to: Yale University IP: 130.132.27.226 on: Tue, 25 Sep 2012 15:00:20 Copyright (c) American Society for Plant Taxonomists. All rights reserved. oe hsi ossetwt h urn itiuinof distribution current the with consistent dumosa is This rope. of parent maternal dumosa the that T. is possibility One America. North and species Asian other the taining fEuropean of rgno t uaiemtra aeti escer h ITS The clear. less is parent that maternal indicates topology putative geographic its The 3). of (Fig. origin clade Asian entirely an within nested 2008] ie r eie rmtecDAdt e.Dvrec ie eeclbae ihafxdaeo 0mafrtesltof split the divergence for and mya topology 90 tree of age The fixed tree. a the with of calibrated tips America were the times North on Divergence eastern shown set. (EUR), is data Europe species cpDNA (EAS), extant the of Asia from distribution eastern derived Geographic areas: are (WNA). geographic times America four North among western connection and of (ENA), probability the detailing model paleogeographic F IG .Etmtso neta agsfor ranges ancestral of Estimates 4. . stewsenms sa pce n lss oEu- to closest and species Asian western-most the as a ebro ieg htoiiae nEu- in originated that lineage a of member a was Tsuga osl o RAaayi r niae ntete,a r h eutn pia siae facsrlrneinheritance. range ancestral of estimates optimal resulting the are as tree, the on indicated are analysis AReA for fossils .dumosa T. AILE L:PYOEYADBOEGAH FTSUGA OF BIOGEOGRAPHY AND PHYLOGENY AL.: ET HAVILL ssse otecaecon- clade the to sister is .caroliniana T. Tsuga rmmdlbsdlklho neec sn h otaeAe.Tegah ttetpso the show top the at graphs The AReA. software the using inference likelihood model-based from rmeastern from T. sa hl sinetof assignment While Euro- Asia. and Eu- Asian that of that populations possibility and pean the east preclude migrated populations not ropean does region and Plain Oligocene of rian late lack the the Miocene, during early populations Asian east from oe lhuhLPg 20b ugse htEuropean that suggested of (2003b) populations LePage Although rope. Tsuga Tsuga eepoal egahclyisolated geographically probably were Tsuga ucsflyhbiie neastern in hybridized successfully Tsuga osl oetn aashould taxa extant to fossils osl rmteWs Sibe- West the from fossils Tsuga and Placement Nothotsuga. 485 Delivered by Publishing Technology to: Yale University IP: 130.132.27.226 on: Tue, 25 Sep 2012 15:00:20 Copyright (c) American Society for Plant Taxonomists. All rights reserved. n ut 97 hn n aaa20) thsbe sug- been has It 2003). Zavada and that gested Shang sur- 1997; extant and of Dutta morphology pollen and gross monosaccate to in structure similar face is and (1958) Couper as records son. on identified relies pollen ages fossil early of unreasonably in like- method results calibration penalized also Another that using data). mya unpubl. Havill, 310 (N. of lihood age early unreasonably an atnadDta19;SagadZvd 03,although 2003), Zavada and Shang 1997; Dutta and Batten of ancestor common recent late the node. from the pollen constrain monosaccate re- should and the Cretaceous whether bisaccate clear both immediately of not cord therefore is It species. heterophylla T. in pollen the of placement inferred the Tsuga above, al. discussed Willyard As et 2005; 2007). Wang al. Sanderson et 1976; and late Magallon Miller the 2003a; (e.g. LePage between Tertiary 2000; early genera the Pinaceae and extant Jurassic re- place of studies dating Most divergence molecular studies. related the our other evaluate with context to in sults important is it fossils, the by Japan as far as west migrated Pliocene. it can that we and reports Miocene few the these on that conclude Based only 1957). 1954, of of (Miki Pliocene Oligocene) the Japan the and 1979), possibly Rayushkina (and 1958; (Karavaev Miocene Russia the (Kunzmann 2005), Germany Mai of Miocene and early the from only reports a 98 swl sfo h icn fCia(age al. et (Wang China of Miocene the from as 2006). Lakhan- well 1935; as Brown 1958) Mai (e.g. pal America and North Kunzmann western 1942; and 2005) Kirchheimer in (e.g. Miocene through Europe Oligocene Vietnam, central the and from for known Laos, origin are China, fossils of southern but in area only the found have about currently may distrib- ranges say widely modern to all their fossil therefore were little the and they past of that the in examination show uted taxa However, these Asia. of in record that origin suggest an might which had Asia, eastern in found sively eue sgoa lmt eaecoe n re uigthe during drier Tertiary. and late cooler greatly became became climate global distributions as their reduced that America, and North Asia in and representatives Europe, with Cenozoic the of most that concluded the (2003b) LePage of distribution current 2005). the al. et within (Yi Yun- are species in that deposits in Pliocene China, from deposits nan, and Pleistocene 2003b), (LePage through Europe the Oligocene resemble with from to consistent said described is Fossils scenario record. this fossil caution, with treated be 486 huht h loee(eaeadBsne 95 LePage 1995; Jurassic Basinger late and the (LePage Eu- from Pliocene 2003a). Asia, the American in to North known though are western fossils and but rope, China, southeast in only suga-Tsuga fthe If of placement phylogenetic in uncertainty the Given eea ftecoetetn eaie of relatives extant closest the of Several Biogeography Historical h oslrcr of record fossil The Cerebropollenites Pseudolarix oti u td mle ecusto fbisaccate of reacquisition implies study our in root Tsuga .mertensiana T. ld yWn ta.(00,i urnl found currently is (2000), al. et Wang by clade Cerebropollenites n h ieg edn oteremaining the to leading lineage the and rw oei osrie o9 y,temost the mya, 90 to constrained is node crown hc a on ob itrt the to sister be to found was which , Nothotsuga a is ecie as described first was Nothotsuga rtecnegn oso asi both in sacs of loss convergent the or Nothotsuga srltdt ancestral to related is — Cerebropollenites a ieydsrbtdduring distributed widely was Tsuga ae ntefsi record, fossil the on Based Tsuga spo,wt unequivocal with poor, is a iepedduring widespread was and tm rw,o other or crown, stem, .dumosa T. sg.Keteleeria Tsuga. Tsugaepollenites Tsuga Tsuga Cue)Nils- (Couper) Tsuga sassigned is Tsuga aebeen have YTMTCBOTANY SYSTEMATIC r exclu- are Nothot- (Batten Tsuga Tsuga Tsuga (e.g. by is cd gi.Fr c) hghk hyk n ooauOaoo(Osaka Okamoto Motoharu and (Beijing Shiyake Yu Shigehiko Guoyue Sci), For. Arboretum), Agric. (Arnold Acad. Tredici Del Peter Arboretum), nteercrs h basal the records, these on Ni- 1996; the al. If the 2003). et during chols Herngreen Asia 1994; east (Srivastava was and Cretaceous that Europe, early America, pteridophytes North in and present gymnosperms zone climatic by circumpolar cool dominated and wet the in formation tinct dino- the of of those presence delineate The as 2000). al. such et fossils, (Martill Cerebropollenites period other time this date to to saurs, used presence its been and 1996), has (Pederson Koppelhus the and mya) Batten around 1980; Jurassic 197 Lund and early (ca. the in boundary record Hettengian-Sinemurian fossil it. the to in linked appears been not have megafossils eut na g f11mafrtems eetcommon recent most the for mya 171 of of age ancestor an in results un- Havill, (N. mya Tsuga 370 data). approximately of publ. age recent most unlikely the the and of mya ancestor 62 approximately common of age an signed uasc(eaeadBsne 95 eae20a.This basal 2003a). a in LePage results 1995; also Basinger method and for (LePage record Jurassic oldest the with consistent is o nern h itr of valuable arti- history is by This the DIVA taxa. inferring in terminal for be possible to only them is considering which ficially incorpo- data, direct fossil allows of also ration ranges AReA widespread events. of speciation maintenance through allow specia- that additional scenarios incorporates tion AReA likelihood- using the contrast, inference In explain based species. to extant needed of events pattern extinction distribution and num- dispersal the minimizing of by ber works and events vicariance occurs history. by speciation only biogeographic that 1996) explore assumes (Ronquist to analysis Dispersal-vicariance used DIVA commonly software is the which analysis using dispersal-vicariance 1997) using (Ronquist those with contrast ence fossil resembling phylla of cones proliferation and the seeds, with pollen, agrees that Eocene the during nul aa ne htteacso ftelreyAsian largely the of ancestor the includes that that clade at infer America data) North unpubl. and Asia past. east the to in times connected various because been include to has area important it an is Europe such, As tinct. indicates ntemto fanalysis. of method results the Our on 2004). Smith and as for viewed (Donoghue been pattern has common this inferred and a clades, been plant have temperate America other North for to an Asia yield from to Movements likely ancestral more widespread Corridor. be of may retention Beringian ranges, the allowing the not to through by Asia DIVA, possibly from dispersal America, by of explained North presence be must the America case, North this In Asia. A osriigthe Constraining u eut sn ieiodbsdboegahcinfer- biogeographic likelihood-based using results Our h eut fDV eosrcinfor reconstruction DIVA of results The CKNOWLEDGMENTS Tsuga and , speiul suggested. previously as Tsuga ugs htsc neecsmgtdpn heavily depend might inferences such that suggest .canadensis T. Pseudolarix Cerebropollenites Cerebropollenites a xesv nErp,btltrwn ex- went later but Europe, in extensive was ntefsi eodhsas enue to used been also has record fossil the in eaegaeu oSsnBnz(..National (U.S. Bentz Susan to grateful are We . Tsuga .caroliniana T. Tsuga Pseudolarix and tmi osrie o17mabased mya 197 to constrained is stem rmti ie(eae2003b). (LePage time this from tmt 0ma sw eothere, report we as mya, 90 to stem Tsuga Nothotsuga Tsuga a o ecoeyrltdto related closely be not may ayolrlPoic,adis- a Province, Palynofloral Tsuga a rsn nyi eastern in only present was and eas h oslevidence fossil the because rw iegnei as- is divergence crown .caroliniana T. .mertensiana T. Nothotsuga Tbe2 i.4 which 4) Fig. 2; (Table u fAsia” of “out rw diversification crown Pseudolarix Cerebropollenites Tsuga Vlm 33 [Volume sassigned is N Havill, (N. , neastern in ntelate the in .hetero- T. pattern. first Delivered by Publishing Technology to: Yale University IP: 130.132.27.226 on: Tue, 25 Sep 2012 15:00:20 Copyright (c) American Society for Plant Taxonomists. All rights reserved. da,R .20.MSL:mlil euneainetwt ihac- high with alignment sequence multiple MUSCLE: 2004. C. R. Edgar, the in mechanisms pollination in lines Developmental 1945. C. tem- J. of Doyle, assembly the in Patterns 2004. Smith. A. S. and J. M. Donoghue, almr,W n .B ako.1948. Jackson. B. A. and W. Dallimore, rn,R,M ern,T aekr,C rvr n .F edl 2002. Wendel. F. J. and Grover, C. Haselkorn, T. Cedroni, M. a R., grains: Cronn, pollen and microspores Mesozoic British 1958. A. R. Couper, oe .A 92 ioht gmoprs fNwYr State. York New of (gymnosperms) Pinophyta 1992. A. E. Cope, 1983. C. W. Cheng, new A 1932. W. Cheng, 2005. Chen. H. S. and Hu, H. S. Chang, C. C. Walters, W. and T. M., Major, S. S. Chaw, C. Vining, F. T. Cox, M. Wright, A. W. S., C. Campbell, 1990. Honkala. H. B. and M. R. Oregon, Idaho, Burns, from seeds and fruits, leaves, Miocene 1935. W. R. Brown, ros .T 01 fet ftermvlo vrtr elc from hemlock overstory of removal the of Effects 2001. T. R. Brooks, at polymorphisms shared Trans-species 2005. Bousquet. J. 2002. and M. Townsend. Bouillé, M. A. and Pooler, R. M. Riedel, H. G. cross- L. of E., conservation S. the Bentz, and conifers, Logging, 1993. of W. C. biogeography Benkman, and Phylogeny 2005. Donoghue. J. M. and D. C. Bell, of significance Biostratigraphic 1996. Koppelhus. B. E. and J. D. Batten, gymnosper- of exine of Ultrastructure 1997. Dutta. J. R. and J. D. Batten, Forest and 3008. Agricultural publication Maine Station is Experiment Science Deland This National CSC). Arboretum the to and Arnold (NSF-0629713 Studies, Foundation Biospheric the for Service, Institute Yale Forest the Award, USDA was research the re- This by drafts. anonymous earlier supported three on and comments Service), valuable (Yale), provided Caccone Forest viewers and Adalgisa (USDA dating and with Stearns Montgomery advice Stephen W. Smith Michael and Stephen Ewha guidance analyses. samples. Sciences, provided biogeographic obtaining (Yale) Life in Moore of Brian help (Dept. and for Lee Korea) Sook Seoul, Nam University, and Gar- Botanical of Edinburgh), (Royal (Institute Macmillan den Peng Libby Ching-I Taipei), Sciences), Sinica, of Academia (Insti- Botany, Academy Qin Chinese Hai-Ning Botany, and of Wang tute Xiao-Quan History), Natural of Museum 2008] uayadhg throughput. high and curacy Society Dublin Coniferales. Sciences Biological B. Society Royal The Of Hemisphere. actions Northern the around forests perate odn dadArnold. Edward London: Ginkgoaceae. C-eitdrcmiaini mlfcto rdcsderived products cotton. amplification polyploid from in recombination PCR-mediated study. Paläophytologie stratigraphic and systematic tt uemBulletin Museum State House. Series Botanical China, of Society Science 1–3. the 7: of Laboratory Biological the Evolution and chloroplast netics from inferred (Cycadales) gene, cycads of phylogeny A transcribed ture. in internal (ITS1) DNA ribosomal 1 Nuclear spacer 2005. Arsenault. P. M. Wash- 654, Handbook Agricultural D.C. Service ington, Forest USDA conifers. Washington. and clg n Management salamanders. and redback Ecology eastern on forests hemlock-dominated trees. conifer in the diversity in netic species distant among Picea loci gene nuclear orthologous ( of Arboriculture hemlock pollinations Asian of and controlled American North in eastern self-compatibility and Hybridization South bills. the to reference special valerians. American with (Dipsacales) Valerianaceae Publisher City: Lake Salt McGregor. C. D. Pp. Europe. in northwest in 795–806 miospores Jurassic and Triassic uppermost Palynology and relationships. in Palaeobotany botanical deposits of for Cretaceous view implications basal and and Europe Jurassic Northwest from grains pollen mous oeua hlgntc n Evolution and Phylogenetics Molecular osrainBiology Conservation Pnca) mlctosfrteln-emmitnneo ge- of maintenance long-term the for implications (Pinaceae): trnK nrn n ula DAISregion. ITS rDNA nuclear and intron, ayooy rnilsadapplications and principles Palynology: h cetfcPoednso h oa ulnScey Royal Society. Dublin Royal the of Proceedings Scientific The 4 43–62. 24: yv Sinica Sylva 0:75–179. 103: 8 200–205. 28: ora fPaleontology of Journal Picea Tsuga 7 214–234. 37: raim,Dvriy .Evolution &. Diversity, Organisms, L 483. ITERATURE hoeia n ple Genetics Applied and Theoretical mrcnJunlo Botany of Journal American Pnca) eunedvrec n struc- and divergence sequence (Pinaceae): 4:197–204. 149: :473–479. 7: rmsuhetr China. southwestern from o.1 ejn:CiaFrsr Publishing Forestry China Beijing: 1. vol. AILE L:PYOEYADBOEGAH FTSUGA OF BIOGEOGRAPHY AND PHYLOGENY AL.: ET HAVILL uli cd Research Acids Nucleic C 9 25–54. 99: adoko oiea including Coniferae of handbook A ivc fNrhAmerica North of Silvics ITED aaotgahc beln B- Abteilung Palaeontographica :572–587. 9: Press. ’s 5 165–185. 35: species. Tsuga) 5:1633–1644. 359: d.J aoisand Jasonius J. eds. hlspia Trans- Philosophical oeua Phyloge- Molecular 2 63–73. 92: 2 1792–1797. 32: otiuin of Contributions 0:482–489. 104: :147–159. 5: e York New Journal o.1: vol. Forest matK Re- rta,G 1957. G. Erdtman, ajn .1990. A. Farjon, 117 Pp. Abietinae. 1879. G. Engelmann, of phylogeny Molecular 2006. Soltis. S. P. and Soltis, E. D. E., C. Edwards, ase,H 96 e ynsemsatelse osls accl VIII. Fascicule fossiles. et actuelles gymnospermes Les 1966. H. Gaussen, 11 Pp. Pinaceae. 1999. Mill. R. R. and Li, N. L., Fu, Pinaceae. in inter-relationships Generic 1989. P. M. Frankis, R 1936. F. Flous, lr fNrhAeiaEioilCmite 1993. Committee. Editorial America North of Flora and Growth Gattung 2005. Die 1929. Owens. J. N. Fitschen, J. and Lazzaro, D. M. D., D. Fernando, ennt .S n .Lso.19.Itra rncie pcrregion spacer transcribed Internal 1999. Liston. A. and S. D. Gernandt, ennt .S,A itn n .Pnr.20.Pyoeeisof Phylogenetics 2003. Pinero. D. and Liston, A. S., D. Gernandt, Pi D. and Liston, A. S., D. Gernandt, at .A 97 ldsi nlsso oies rlmnr results. preliminary conifers: of analysis cladistic A 1987. A. J. Hart, uzan .adD .Mi 05 i oiee e Mastixiodeen-Flora der Koniferen Die 2005. Mai. H. D. Ka- and bei L. Kunzmann, Wiesa von Alttertiärflora 1, der Kenntnis part Zur Korea, 1942. F. island, Kirchheimer, volcanic Ulreung of Petrology 1985. K. Y. Ulreung-do, on Kim, vegetation forest of phytosociology The 1988. J.-W. Kim, o .adO zka.17.O h olnmrhlg of morphology pollen the On 1972. Sziklai. O. and R. Ho, 1972. Y. Hirokawa, 1996. Smirnova. B. S. and Rovnina, V. L. Kedves, M. W., F. Formosa. G. from Herngreen, conifers New 1908. B. Hayata, ahna,R .15.TeRjd lr fws eta Oregon. central west of flora Rujada The 1958. N. R. Lakhanpal, 1958. N. M. Karavaev, evolu- Structural 2007. Wang. X.-Q. and Ding, X. Wang, S.-S. X.-Z., Kan, 1976. Y. Hirokawa, e,Y .2001. N. Y. Lee, 1993. B. T. Lee, eae .A 03.Teeouin igorpyadploclg of paleoecology and biogeography evolution, The 2003a. A. B. LePage, 1890. G. J. Lemmon, d .Wto.Cmrde nvriyPress. University Cambridge: Watson. S. ed. S:eiec o yrdzto nPesoeerefugia? Pleistocene in hybridization Botany for evidence USA: Conradina int ayooyII palynology to tion ers suoai,Ktlei,Ntosg,Tua ahy,Pseu- Larix, Cathaya, dotsuga, Tsuga, Nothotsuga, Keteleeria, Pseudolarix, Cedrus, oa oaia adn Edinburgh Garden, Botanical Royal Toulouse rvu uLbrtieFrsird Toulouse de Forestier Laboratoire du Travaux St. Raven. H. Press. P. Garden and Botanical Wu Missouri Z.-Y. Louis: eds. Fagaceae, through Cycadaceae 4, Press. University Oxford ot fMexico of north ice Gesellschaft gischen tubes. pollen 149–162. conifer of development vlto in evolution Evolution complexes. species pine of studies tematic Botany T of ITS uscin ebodsadNloieifre rmcDAse- cpDNA from inferred Nelsoniae quences. and Cembroides subsections auaitsd ocu eto Biologique Section Moscou, de Naturalistes ihiugdrNadelbl der Mioz (Sachen, sichtigung Kamenz bei Wiesa von (Sachsen). menz Geologists Economic and geology. Korea. o.Sl aeCt:Publisher City: Lake Salt gor. applications, 1157 and Pp. principles review. nology: a provinces: palynofloral Cretaceous a fteAnl roeu.Anl Arboretum Arnold Arboretum. Arnold the of nal odto ntetrioyo h U.S.S.R. the of territory the on condition Paläophytologie implications. phylogenetic its and Evolution Pinaceae and in Phylogenetics ITS Molecular nrDNA of tion species. Asia East of sociology lg fEs Asia East of ology iyo aionaPbiain nGooia Sciences Geological in Publications California of sity .W aemn armno aionaSaeBado Forestry. of Board State California 1887 Sacramento: years Waterman. the W. for R. forestry of board state California Pinus 1 193–207. 31: 6 711–723. 86: Phytocoenologia Grana :1–136. 5: ora fteJpns soito fMnrlgss Petrologists Mineralogists, of Association Japanese the of Journal ytmtcBotany Systematic 1 449–467. 21: n te cu it Lmaee rmtesoutheastern the from (Lamiaceae) mints scrub other and lutae lr fKorea of flora Illustrated iind genre du évision eu:Kyohak. Seoul: Korea. of Flora uscinCmrie:ipiain o oeua sys- molecular for implications Cembroides: subsection iaee rwnsaddsrpin ftegenera the of descriptions and drawings Pinaceae: Larix olnadsoemrhlg/ln aooy nintroduc- an taxonomy: morphology/plant spore and Pollen 2 31–40. 12: 7:67–135. 272: ta fteJpns lr:a nrdcint ln soci- plant to introduction an flora: Japanese the of Atlas o.2 trdpye n ynsem.NwYork: New Gymnosperms. and Pteridophytes 2: vol. and oebaeso California. of bearers Cone ta fteJpns lr I nitouto oplant to introduction an II: flora Japanese the of Atlas oy:Gakken. Tokyo: . Planta sg longibracteata Tsuga 1 1–11. 41: e ok oadPress. Ronald York: New . and isen olzSinii Books. Scientific Koeltz Königstein: Picea. oy:Gakken. Tokyo: . 6 259–281. 16: 2 418–446. 32: 0 128–135. 80: Pseudotsuga sg.Mtelne e etce Dendrolo- Deutschen der Mitteilungen Tsuga. ä 8 657–673. 28: tter. sg.Taaxd aoaor oete de Forestier Laboratoire du Travaux Tsuga. Press. ’s r.20.Vraini h nrDNA the in Variation 2001. ñero. d.J asnu n .C McGre- C. D. and Jansonius J. eds. 5 527–548. 45: eu:Hyangmunsa. Seoul: . aaotgahc beln B- Abteilung Palaeontographica 2 in –128 (Pinaceae). 4 765–777. 44: )utrbsnee Ber besonderer unter än) hn,frtfudi fossil a in found first Cheng, eulPatReproduction Plant Sexual hr inilrpr fthe of report biennial Third Chronicle Gardener’s 6 i Russian). (in 73–76. 63: oeua hlgntc and Phylogenetics Molecular oayo California of Botany 8,637 481–486, 2: ultnd aSoci la de Bulletin 2in –52 3 269–307. 63: lr fNrhAmerica North of Flora mrcnJunlof Journal American 5 1–66. 35: lr fChina of Flora 8 oGovernor to –88, Picea 18in –1188 oe rmthe from Notes and –661. Systematic 3 194. 43: Univer- ét Abies, o.2, vol. Tsuga Pinus Paly- Jour- ück- 487 vol. des 18: Delivered by Publishing Technology to: Yale University IP: 130.132.27.226 on: Tue, 25 Sep 2012 15:00:20 Copyright (c) American Society for Plant Taxonomists. All rights reserved. asmt,M,T haa n .Nsia 1995. Nishida. M. and Ohsawa, T. M., Matsumoto, ii .15.Teocrec ftermisof remains the of occurrence The 1954. S. Miki, of specimen new A 2000. Loydell. K. D. and Batten, J. D. M., D. Martill, of sequence Nucleotide 1996. Maggini. F. and Gelati, T. 1998. M. R., Dominicis. Marrocco, De I. R. and Gelati, T. M. Marrocco, R. F., Maggini, times: divergence Angiosperm 2005. Sanderson. J. M. and A. S. Magallon, wn,J .adM .Bae 93 olnmrhlg n development and morphology Pollen 1983. Blake. D. M. and N. J. of Owens, palynofloras Cretaceous in changes Biodiversity 2003. J. Incorporating D. Donoghue. Nichols, J. M. and Ree, H. R. Smith, A. S. R., B. Moore, oesn .L 96 h osadwy fctpam neiac in inheritance cytoplasmc of whys and hows The 1996. L. H. Mogenson, and regeneration hemlock Eastern 1993. Stearns. F. and J. D. Mladenoff, Pinaceae. the in evolution Early remains. 1976. N. its C. to Miller, reference special with Japan, of Pinaceae 1957. S. Miki, (Silesia) Opole near Cretaceous Upper from Sporomorphs 1963. S. Macko, 567 Pp. Pinaceae. 1994. Formosanarum. Keng. Gymnospermum H. and Icones H.-L. Li, 1954. Keng. H. of and analysis H.-L. phylogenetic Li, A 1997. Bayer. J. R. and A. B. genus LePage, the of history Evolutionary 1995. Basinger. F. J. and A. B. LePage, 488 i,Y .adL .Bsne.20.Fossil 2000. Basinger. F. L. and S. Y. Liu, 1971. L. E. Little, Inter- 2007. Willyard. A. and Syring, V. J. Parker-Defeniks, M. A., Liston, 1999. Alvarez-Buylla. R. E. and Pinero, D. Robinson, A. W. A., Liston, 1996. Alvarez-Buylla. R. E. and Oliphant, M. J. Robinson, A. W. A., Liston, eae .A 03.Anwseisof species new A 2003b. A. B. LePage, vation. eeSioaagop okio Japan. 417–428. Mio- 108: Hokkaido, middle group, the from Shimokawa leaves conifer cene permineralized of species new a cf. dinosaur thyreophoran the in DNA ribosomal of pinea region Pinus 5.8S and spacers transcribed internal the Evolution pteridophytes. nuclear and and of atics gymnosperms spacers in internal DNA the of ribosomal sequences nucleotide and Lengths constraints. time and positions, 1653–1670. codon 59: genes, of effect The atr saadwsenNrhAmerica. North ences western and Asia eastern approach. likelihood a tion inference: biogeographic in data fossil edplants. seed re-examination a region: simulation. Lakes model Great and northern the in browsing deer Palynology and D, Series University, City Osaka Polytechnics, of Biology Institute the of Journal Japan. 976–981. in 30: beds Pliocene from subg.) S Wroclaw, de Clays. Lettres London the from and 829–847. Taiwania [Abstract]. approach Botany integrative an (Pinaceae): 910–950. 156: Pseudolarix oeeo xlHiegIln,Cnd,ada seseto the of Society assessment Linnean genus. an the the of and of history Canada, biogeographical Island, and evolution Heiberg Axel of Eocene ,e.Foao awnEioilCmite api pc Publishing Epoch Taipei: Committee. Company. Editorial Taiwan of Flora ed. 1, h aainHg Arctic. High Canadian the Miscella- Agriculture of 1146. Publication Department neous U.S. Washington: hardwoods. in study phylogenetic case intraspecific a enhances inference: analysis phylogenetic specific Evolution and sequences. region spacer transcribed internal of Phylogenetics plants. seed ology non-flowering transcribed of internal sequences DNA region ribosomal spacer nuclear the in variation Length h orhitrainlcnfrcneec.At Horticulturae Acta conference. conifer international representatives. fourth extant the and fossil on based Pinaceae the 3926–3937. I press). (In 1 823–833. 21: 1 109–120. 21: 4Splmn) 210. 84(Supplement): :221–272. 8: Palaeontology :25–84. 5: odn(Pinaceae). Gordon L. mrcnJunlo Botany of Journal American ta fUie ttstes o.1 oiesadimportant and conifers 1: vol. trees, States United of Atlas 1 95–109. 11: N Sequence DNA 1 101–117. 21: Pinus 1:199–205. 213: i B éria 3 549–559. 43: 4:257–296. 141: Pnca)bsdo ula iooa DNA ribosomal nuclear on based (Pinaceae) osrainBiology Conservation 0:1–136. 106: nentoa ora fPatSciences Plant of Journal International iu abrin.MlclrEcology Molecular lambertiana. Pinus :175–177. 6: rvu el Soci la de Travaux Scelidosaurus nentoa ora fPatSciences Plant of Journal International Tsuga rceig fteJpnAcademy Japan the of Proceedings Cathaya 3 383–404. 83: Pnca)fo h middle the from (Pinaceae) 8 in –581 Taiwania ora fAinErhSci- Earth Asian of Journal ora fPatResearch Plant of Journal :889–900. 7: ihsf isepreser- tissue soft with Pnca)ple from pollen (Pinaceae) oeua Phylogenetics Molecular eiwo Palaeobotany of Review sg shimokawaensis Tsuga ét mrcnJunlof Journal American lr fTaiwan of Flora e cecse des et Sciences des and oaia Journal Botanical ytmtcBi- Systematic ln System- Plant rceig of Proceedings Paleotsuga YTMTCBOTANY SYSTEMATIC 1:29–52. 615: Evolution Evolu- Tsuga 161: vol. 16: (n. , 3 in families 319–331 Pp. conifer Pinaceae. 1990. the N. C. Page, in genera maintained and New conifers. 1988. in N. Pollination 1998. C. Runions. Page, J. C. and Takaso, T. N., J. Owens, rc,R . .Osntjoih n .M oesen 97 Relationships 1987. Lowenstein. M. J. and Olsenstojkovich, J. A., DNA R. of Price, model the testing Modeltest: plant-bearing 1998. Crandall. the A. K. of and D. Palynology Posada, 1980. Lund. J. J. and R. K. Pederson, cts,C .2001. R. C. Scotese, e,R .adS .Sih 08 aiu ieiodifrneo geo- of inference likelihood Maximum 2008. Smith. A. like- S. A and 2005. H. Donoghue. R. J. Ree, M. and Webb, O. C. Moore, R. B. H., R. Ree, 1979. S. G. Rayushkina, and phylogeny Molecular 2006. Wang. Q. X. and Wei, X. X. H., H. Ran, zfr .14.Suiso h genus the on Studies 1949. W. Szafer, Coniferae. Encyclopaedia 1986. of J. ultrastructure Silba, The 2003. Zavada. S. M. and Y. Shang, phy- DNA Chloroplast 1997. Stuessy. F. T. and Crawford, J. D. T., Sang, oqit .19.Dseslvcrac nlss e praht the to approach new a analysis: Dispersal-vicariance 1997. F. Ronquist, by available manual and program Computer 1.1. DIVA 1996. F. Ronquist, alr .17.Terltosi n rgnof origin and relationship The 1972. R. Taylor, prim- Universal 1991. Bouvet. J. and Pautou, G. Gielly, G. L., P. Taberlet, Wide- 2007. Liston. A. and Cronn, R. Businsky, parsimony R. Farrell, using K. analysis J., Syring, phylogenetic PAUP*: 2003. L. D. Swofford, 1984. C. J. Swartley, evo- the on observations Preliminary 1998. Stuessy. F. T. and B.-Y. Sun, Con- Phytogeoprovinces, Cretaceous of Evolution 1994. de K. pollen S. de Srivastava, grains les sur nouvelles Observations 1973. J. Sivak, evolution molecular of rates absolute inferring r8s: 2003. J. M. Sanderson, evolution molecular of rates absolute Estimating 2002. J. M. Sanderson, phyloge- Bayesian 3: MrBayes 2003. Huelsenbeck. P. J. and F. Ronquist, Edinburgh Pinaceae. and Podocarpaceae Science Plant in Trends Botany of Journal Canadian in mechanism pollination the of substitution. east Sund, Scoresby formation, Stewart Greenland. Kap Hettengian to Rhaetian Verlag. Springer York: plants, ceae). laAa ak I Russian]. [In Nauka Alma-Ata: Altai. rpi ag vlto ydsesl oa xicin n cladogen- and extinction, local esis. dispersal, by evolution range graphic on range geographic trees. of evolution phylogenetic the inferring for framework lihood Evolution haplotypes. cytoplasmic using studies cal of biogeography comparison. immunological an Botany Pinaceae: tematic of genera the among rope. Asia. of Cretaceous and Jurassic the from Project. PALEOMAP Texas: ton, of biogeography and evolution, reticulate logeny, uniiaino itrclbiogeography. historical of quantification (ftp.sysbot.uu.se). University Uppsala from FTP anonymous olne Spores et Pollen 203. r o mlfcto ftrenncdn ein fchloroplast of regions non-coding three of DNA. amplification for ers 23–51. 3: of Biology species Systematic in Strobus. nonmomophyly genealogical spread Associates. Sinauer Sunderland: 10. beta 4.0 v. methods), other (*and Press. Press. University Cambridge: 181–202 Ono. Pp. Korea. Island, Ullung in of angiosperms endemic of lution 224. Climates. and tinents clock. molecular a of England) absence (Oxford, the matics in times divergence and approach. likelihood Evolution penalized and a Biology times: divergence and 1572–1574. 19: models. mixed under inference netic vlto n pcaino sadplants, island of speciation and Evolution ytmtcBiology Systematic cdmePlnied cecse e ete,S Lettres, des et Sciences de Polonaise l’Academie de Bulletin mrcnJunlo Botany of Journal American ln oeua Biology Molecular Plant o.1 trdpye n ynsem,e.K uizi New Kubitzki. K. ed. gymnosperms, and pteridophytes 1: vol. 1 405–419. 41: 5 377–395. 45: eiwo aaooayadPalynology and Palaeobotany of Review iifrais(xod England) (Oxford, Bioinformatics 2 91–97. 12: ta ferhhistory earth of Atlas 5 397–457. 15: otad rgn Timber Oregon: Portland, hemlocks. cultivated The Picea h lgcn lr rmMgdhradtesouthern the and Mugodzhar from flora Oligocene The Evolution 9 101–109. 19: eiwo aaooayadPalynology and Palaeobotany of Review :479–485. 3: Pnca) mlctosfrphylogeographi- for implications (Pinaceae): 7 4–14. 57: 9 301–302. 19: 1 3041–3048. 61: 6 163–181. 56: 9 2299–2311. 59: 7 1105–1109. 17: oe rmteRylBtnclGarden, Botanical Royal the from Notes sg heterophylla Tsuga 4 1120–1136. 84: Tsuga o.1 aegorpy Arling- Paleogeography. 1, vol. , htlgaMemoirs Phytologia h aiisadgnr fvascular of genera and families The iifrais(xod England) (Oxford, Bioinformatics ar nteTrir nEu- in Tertiary the in Carr. oeua hlgntc and Phylogenetics Molecular d.T .Susy n M. and Stuessy, F. T. eds. ytmtcBiology Systematic Grana 4 817–818. 14: sg heterophylla Tsuga 2 102–107. 42: 1 1–69. 31: and Paeonia Pinus Cerebropollenites .mertensiana. T. Vlm 33 [Volume :1–127. 8: subgenus (Paeonia- Molecular Bioinfor- 2 197– 82: 6 195 46: Tsuga. i B érie Sys- and – Delivered by Publishing Technology to: Yale University IP: 130.132.27.226 on: Tue, 25 Sep 2012 15:00:20 Copyright (c) American Society for Plant Taxonomists. All rights reserved. ag .F,Q .Xag .K egsn .Zsana,J ag and Yang, J. Zastawniak, E. Ferguson, K. D. Xiang, P. Q. F., divergence Y. and Wang, Phylogeny 2000. Sang. T. and Tank, C. D. Q., X. Wang, 1961. W. B. C. D. Wang, and Hamilton, H. C. VanStockum, R. R. Perlin, H. M. C., Wang, 1999. F. T. Vining, 1991. M. Vidakovic, ife,B .18.Prpcie nteoii ftefoitcsimilarity floristic the of origin the on Perspectives 1985. H. B. Tiffney, ht,T . .Bus .Le n .Tyo.19.Apiiainaddirect and Amplification 1990. Taylor. J. intragenomic and Lee, Marked S. Bruns, 2003. T. J., Hong. T. Y. White, D. and Wang, Q. X. X., X. in radiation Wei, and Recolonization 2004. Wang. Q. X. and X. X. Wei, phylog la sur Recherches 1950. M. Campo-Duplan, van genus of Relationships 1957. and J. geological Ueno, of use The 2001. Manchester. R. S. and H. B. Tiffney, 2008] hmo,P .adH fu.15.Ple n prndsmitteleu- des Sporen und Pollen 1953. Pflug. H. and W. P. Thomson, on,N . .E tie,adC .dPmhls 99 h evolution The 1999. dePamphilis. W. C. and Steiner, E. age Pliocene K. the D., of N. woods Conifer Young, 2005. Jiang. M. X. and Li, Korea. S. C. M., of T. Yi, vegetation The 1918. H. E. 2007. Wilson, Cronn. R. and Liston, A. Gernandt, S. D. Syring, J. A., Willyard, A PPENDIX icn lr fCiaadispyoegahccneto with connection phytogeographic its and America. China North of of flora species new Miocene A 2006. Li. S. C. genomes. three from Evolution and evidence Pinaceae: in times Cambridge: University. 5. Harvard Publication Foundation Cabot Moors Maria vegetation. 1335. in and polymorphisms DNA Chloroplast 1997. Wagner. Maine. of University Orono: Hrvatske. Zavod Toulouse de estier odAbrtm rodArboretum America. Arnold North Arboretum. eastern nold and Asia eastern between 1–138. eeoeet n egahcldfeetaino rN T in ITS nrDNA of potaninii differentiation Larix geographical and heterogeneity paralogues. DNA Ecology ribosomal lecular nuclear from evidence (Pinaceae): pollen. de grains leurs d’après Abiétines D, Series University, City Osaka Polytechnics, of Biology Institute the of Journal Sciences hy- tertiary. Plant phylogeographic Hemisphere Northern plant the in evaluating potheses in evidence paleontological sg mertensiana Tsuga shnTertiärs. ropäischen pretations. eunigo uglrbsmlRAgnsfrpyoeeis Pp. phylogenetics. for genes RNA in 315–322 ribosomal fungal of sequencing une euea vltoaytasto series. Garden transition Botanical souri evolutionary se- an gene refute plastid quences Scrophulariaceae/Orobanchaceae: in parasitism of China. Yunnan, from Society Asiatic Royal the of Branch Pinus. muta- for moderate radiations lution a recent and infers rate divergence tion molecular of Academic calibration Diego: Fossil San White. T. and Sninsky, J. Press. Gelfand, D. Innis, sg aoiin.Cnda ora fFrs Research Forest of Journal Canadian caroliniana. Tsuga 4 90–101. 24: .Vuhrseies oaiy ebru oce;botani- voucher; herbarium locality; specimens: Voucher 1. :191–196. 8: d.M. eds. applications, and methods to guide a protocols: PCR mrcnJunlo Botany of Journal American 7 773–781. 17: 6:S3–S17. 162: h oet fCiawt uvyo rsln n desert and grassland of survey a with China of forests The oeua hlgntc fPinaceae of phylogenetics Molecular (Pinaceae). 3 3115–3123. 13: oies opooyadvariation and morphology Conifers: Taxon oeI.Vlm V ril I. Article IV. Volume II. Tome ae npyohmcladmrhlgclinter- morphological and phytochemical on based aaotgahc beln B-Pal Abteilung Palaeontographica ora fItgaiePatBiology Plant Integrative of Journal 6 876–893. 86: 5 165–171. 55: ora fMlclrEvolution Molecular of Journal AILE L:PYOEYADBOEGAH FTSUGA OF BIOGEOGRAPHY AND PHYLOGENY AL.: ET HAVILL Keteleeria :1–17. 9: 6 73–94. 66: Tsuga 9 149–157. 59: Pnca)i h Shanwang the in (Pinaceae) rmple morphology. pollen from rvu uLbrtieFor- Laboratoire du Travaux oeua ilg n Evo- and Biology Molecular rnatoso h Korea the of Transactions nentoa ora of Journal International hD dissertation. Ph.D. . arb Graficki Zagreb: . naso h Mis- the of Annals oeua Biology Molecular ora fteAr- the of Journal sg canadensis Tsuga äophytologie 7 623–635. 57: 7 264–270. 47: 7 1329– 27: é i des nie Larix Mo- 94: hn,Yunnan; China, sg sieboldii Tsuga (YU); mertensiana Tsuga chigi; S,Connecticut; USA, e,Uln Island; Ullung rea, nw idsource; wild known 00225101 169 Wangchu; hn,Sichuan; China, Yunnan; China, F947 aa,Yamanashi; Japan, EF395497. idsource; wild A; Nlo)Rehder (Nelson) (YU); hn,Sichuan; China, Eichler: Don) (D. nw idsource; wild known Taichung; A;A 243-2000-B; AA (A); nttt fBtn,CieeAaeyo cecs ejn P)o tthe at or (OSA). (PE) History Beijing Natural Sciences, of of the Museum Academy at Osaka deposited Chinese were Dupli- Botany, vouchers of Arboretum. (YU) Institute National Herbarium University U.S. Yale = of RBGE=Royal cates USNA Edinburgh, Arboretum, Garden, AA=Arnold Botanic abbreviations: garden Botanical lina; gent Diels hn,Hunan; China, Page: Nagano; SA69969; USNA 2 3 1 1 1 3 3 4 4 1 2 1 4 2 3 3 3 2 3 2 4 A22-94-C; AA ail03-07 Havill a adnacsin(fapial) n eBn ceso numbers accession GenBank and applicable), (if ( accession garden cal XQ2001-Ke 1 EF395423, EF395464-EF395470. EF395453-EF395456. F957E356.Kra lugIsland; EF395605, Ullung Korea, EF395557-EF395565. EF395411, EF395444, EF395443, EF395400, EF395435, EF395396, Hualien; Taiwan, EF395488-EF395492. EF395439, EF395580, EF395392, EF395579, EF395578, EF395571, EF395379, EF395424, F948 hn,Hubei; China, EF395428. matK, be veitchii Abies 1 EF395589, E;RB 19790172; RGBE (E); S,Washington; USA, : 00163576 hn,Shaanxi; China, : 1 1 00225105 EF395602, EF395599, 2 rpl16, ail04-36 Havill A;A 65-96-B; AA (A); 4 4 aMla 170 MacMillan 3 2 (PE); 3 4 3 4 4 2 3 2 2 F956E353.Cnd,BiihColumbia; British Canada, EF395526-EF395531. (YU); 2 F948E350;Jpn Iwate; Japan, EF395498-EF395502; EF395433. ail04-85 Havill EF395415, 3 EF395437, EF395516-EF395525. EF395448, EF395471-EF395478. 4 F959E351.Cia Sichuan; China, EF395509-EF395515. EF395390, 00225104 EF395429, EF395389, EF395388, EF395381, EF395416. F949E358.Cia Hubei; China, EF395479-EF395484. 1 2 1 EF395593, 3 EF395399, EF395598, A;A 15803-J; AA (A); trnT–L, A;A1007-80-B, A (A); ..Bnz002 Bentz S.E. Carrière 1 ail02-34 Havill ail04-25 Havill 2 2 EF395570, 1 Lindley EF395412, EF395409, EF395573, hn,Zhejiang; China, : ail04-72 Havill Bnad Carrière (Bongard) 00225099 sg canadensis Tsuga 00163580 00249724 (YU); 1 u ZC-002 Luo sg caroliniana Tsuga EF395583, A;A693-77-A, A (A); sg diversifolia Tsuga 3 4 4 4 EF395452, 3 4 3 3 F955E350.Npl Singalia; Nepal, EF395505-EF395508. 3 F952E355.Jpn Osaka; Japan, EF395542-EF395552. ITS). eeeraevelyniana Keteleeria F947 hn ainlTe edC. un- Co., Seed Tree National China EF395427. F945E358.Cia Shaanxi; China, EF395485-EF395487. F946 hn,Sichuan; China, EF395426. Sichuan; China, EF395425. EF395418. aa,Osaka; Japan, : 3 2 aa,Gifu; Japan, : EF395436, EF395403, 2 ail02-09 Havill (YU); E;RG 19924259; RBGE (E); EF395408, 1 1 ail03-03 Havill EF395587, 2 EF395591, 1 3 2 EF395380, 3 00163581 EF395584, EF395449, Tsuga EF395383, EF395446, A;A 100-94-CQ; AA (A); N) SA70161, USNA (NA); ail04-46 Havill (YU); (YU); A;A 19447-O; AA (A); (A); (YU); 2 1 (PE); sg heterophylla Tsuga sg chinensis Tsuga EF395393, 1 EF395575, 1 4 EF395603, EF395585, EF395566-EF395568. oecaueflosFro (1990). Farjon follows nomenclature ohtualongibracteata Nothotsuga 4 3 1 1 1 EF395503-EF395504. EF395440. EF395604, EF395595, EF395594, 1 3 2 1 S,Washington; USA, : 1 EF395574, L)Carrière (L.) EF395445, EF395397, ail02-50 Havill 3 EF395572, 2 EF395600, A;A 17569-A; AA (A); eg17352 Peng 3 EF395417. 4 2 00225098 EF395401, 4 S,NrhCaro- North USA, Engelmann: (YU); EF395420, F953E355.Jpn To- Japan, EF395553-EF395556. EF395394, ail04-40 Havill Mxmwc)Masters (Maximowicz) F956E354.Unknown EF395536-EF395541. (YU); ail04-33 Havill (YU); 00225106 3 2 F940 hn,Shaanxi; China, EF395430. 2 EF395385, 00225102 EF395413, 2 1 sg forrestii Tsuga EF395395, 1 Masters EF395577, 2 EF395597, 2 2 1 EF395414, 1 1 2 3 EF395405, EF395404, 2 1 2 1 EF395592, EF395588, EF395576, EF395384, 4 EF395434, Face)Pizlin Pritzel (Franchet) ..Bnz001 Bentz S.E. suoai amabilis Pseudolarix EF395382, EF395581, EF395410, EF395596, S,Pennsylvania; USA, : 4 A;A 187-94-A; AA (A); EF395532-EF395535. 3 EF395457-EF395463. 3 (HAST); ail04-23 Havill F948 Bhutan, EF395438. F941 Taiwan, EF395431. ail04-56 Havill 04-55 Havill (YU), Rfnsu)Sar- (Rafinesque) A;A1251-83-A; A (A); (YU); (YU); A;A 1837-77- AA (A); 3 China; : 3 F942 Un- EF395422. sg dumosa Tsuga F940 Ko- EF395450. 00225103 ail03-03a Havill ail04-34 Havill 3 2 1 1 2 3 EF395432, 1 3 3 4 2 1 3 2 3 2 2 3 2 1 EF395387, EF395590, EF395582, EF395407, MacMillan EF395451, EF395569, EF395442. EF395441. EF395493- EF395402, EF395601, EF395447. EF395398, EF395421, EF395391, EF395386, EF395419, EF395406, EF395586, 00225100 Downie: Japan, : uex Hu (NA); Wang (YU); (YU); (YU); 489 (A);