DOCSLIB.ORG

Distribution of Granulicatella Adiacens and Porphyromonas Gingivalis Among Ortho and Non-Orthodontic Patients with Gingivitis in Kufa City /Iraq

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Distribution of Granulicatella Adiacens and Porphyromonas Gingivalis Among Ortho and Non-Orthodontic Patients with Gingivitis in Kufa City /Iraq AL-Qadisiya Medical Journal Vol.13 No.23 2017 Distribution of Granulicatella adiacens and Porphyromonas gingivalis among ortho and non-orthodontic Patients with Gingivitis in Kufa City /Iraq. Manar Hussain Abbas* ,Ahlam Kadhum Al-Yasseen* , Wisam Wahab Alhamadi *Faculty of Education for Girls, University of Kufa/ Iraq * * Faculty of Dentistry, University of Babylon / Iraq. *Corresponding author E-Mail: [email protected] Mobil: 964 780 803 6089 الخﻻصة: هدفت هذه الدراسة إلى التعرف على توزيع غرانوليكاتيﻻ أدياسنس و بورفيروموناس لينغيفيك ودور أسﻻك تقويم اﻷسنان على نمط مقاومة المضادات الحيوية من العزﻻت البكتيرية. تم جمع ما مجموعه 78 عينة مسحة اللثة من المريض مع أسﻻك تقويم اﻷسنان الذين يعانون من التهاب اللثة و 71 عينات تم جمعها من صحية دون أسﻻك تقويم اﻷسنان خﻻل أربعة أشهر من عيادات اﻷسنان الخاصة. اظهرت نتائج العزلة والتعرف على العزﻻت البكتيرية باستخدام اﻻستزراع واﻻختبارات البيوكيميائية التقليدية وكذلك التقنية الجزيئية باستخدام ال S16 الريباسي للكشف عن ال G. أدياسنس والعنصر التسلسلي IS1126 للكشف عن P. لينجيفاليس ان 54 عزلة )٪29.6( كانت تنتمي إلى G أدياسنس و 4 العزﻻت تنتمي إلى P اللثة. لشرح دور أسﻻك تقويم اﻷسنان على العزﻻت البكتيرية تم إجراء تجربة طفرة. وأظهرت النتائج نفس التغيير الذي تم الحصول عليه عند استخدام كل من نيتي واﻷسﻻك الفوﻻذ المقاوم للصدأ على G. أدياسنس و P. اللثة بعد hr-96hr24 من الحضانة. أظهر نمط مقاومة المضادات الحيوية للعزﻻت اﻷصلية والمعالجة مع نيتي والفوﻻذ المقاوم للصدأ زيادة في مقاومة المضادات الحيوية لباسيتراسين، سيفتازيديم، أوجمنتين، واﻻريثروميسين في حين تبقى المضادات الحيوية اﻷخرى حساسة مثل سيفوتاكسيم و أميكاسين لجميع العزﻻت. Abstract This study aimed to investigate the distribution of Granulicatella adiacens and Porphyromonas gingivalis and the role of orthodontic wire on antibiotic resistance pattern of bacterial isolates. A total of 78 gingival swab samples have been collected from patient with orthodontic wires suffering from gingivitis and 71 samples were collected from healthy without orthodontic wire during four months from private dental clinics. The results of isolation and identification of bacterial isolates by using culture and conventional biochemical tests as well as molecular technique using 16S rRNA for detection of G. adiacens and insertion seqence element IS1126 for detection of P. gingivalis showed that 54 (29.6%) isolates were belong to G adiacens and 4 isolates were belong to P gingivalis. To explain the role of orthodontic wires on bacterial isolates a mutation experiment was carried out. The result showed the same change has been obtained when using both NiTi and stainless steel wire on G. adiacens and P. gingivalis after 24hr-96hr of incubation. Antibiotic resistance pattern of both original and treated isolates with NiTi and stainless steel showed increased in antibiotic resistance to bacitracin, ceftazidim, ogmentin, and erythromycin while other antibiotic remain sensitive such as cefotaxim and amikacin for all isolates. Introduction gingivae causing destruction of ligament and periodontal disease refers to gingivitis alveolar bone supporting the teeth resulting and periodontitis is a reversible inflammation in oral malodor and loss of tooth and then induced by dental plaque of the gingiva ( loss the quality of life (Al-Harthi et al., Suvan et al., 2011), while periodontitis is a 2013). There are more than 300 species microbial inflammatory condition of the identified in the oral cavity, only small 180 AL-Qadisiya Medical Journal Vol.13 No.23 2017 group of gram-negative organisms which and 71 samples were collected from patient frequently are the most isolated from infected without orthodontic wires. All samples were periodontal pockets, including Bacteroides collected from the mouth firstly by rolling a forsythus, Actinobacillus sterile cotton swab across the gingival region actinomycetemcomitans, Campylobacter in lower and upper gum and by using dental spp., Capnocytophoga spp., Fusobacterium floss for sample collection from sub-gingival nucleatum, Porphyromonas gingivalis, region then swabs were cultured on Eikenella corrodens, and Prevotella MacConkey agar and Blood Agar base, intermedia, there are also oral spirochetes incubated an anaerobically at 37ᵒC for 24- 48 and are thus recognized as potential hr. for primary isolation of bacteria. periodontal pathogens (Socransky and Molecular Bacterial Identification: PCR Haffajee, 1992). technique was used for molecular Porphyromonas gingivalis (P. gingivalis) is identification of G. adiacens using 16SrRNA the second intensively studied probable (Yat Woo et al., 2003) and P. gingivalis periodontal pathogen and considered a major using IS1126 (Park et al., 2004). pathogen in chronic periodontitis (Haffajee Extraction of DNA: Boiling method that and Socransky,1994). It produce a number of described by Sambrook and Russell (2001) virulence factors and extracellular proteases, was carried out for DNA extraction. Briefly, such as lipopolysaccharide, capsule, an overnight of brain heart infusion culture gingipain, fimbria and so on, resulting in the (10 ml) of bacterial isolates were centrifuged destruction of periodontal tissues (Hayashi et at 6000 rpm/10 min and the pellet was al., 2012) washed twice with STE buffer and incubated Nutritionally variant streptococci (NVS) with lysozyme for 10 min at room are pleomorphic Gram variable bacteria temperature, then heated to boiling for 5min showing fastidious growth requirements and and incubated in ice bath for 10 min. the is a common cause of infectious endocarditis mixture was centrifuge for 30 min at 15000 in cases that are negative by blood culture. rpm. The supernatant was transferred to new Four bacterial species have been identified Eppendorf tube and mixed with 0.7 v:v of as NVS: Abiotrophia defectiva , isopropanol and incubated in ice bath Granulicatella adiacens , Granulicatella overnight. DNA was recovered by elegans , and Granulicatella balaenopterae.( centrifugation at 10000 rpm/10min and the Hugo et al., 2015). G. adiacens formerly pellet was washed with70% ethanol and described as a member of nutritionally preserved with 100µl of TE buffer (Tris-base variant streptococci (NVS) It is found to and Na2EDTA). account for 85% of the NVS in the human Amplification of target gene: monoplex mouth making it the most common type PCR was used to amplified 16SrRNA using (Ohara-Nemoto et al.,1997). It colonizes the LPW200F-GAGTTGCGAACGGGTGAG- oral cavity, intestinal and genitourinary tracts and LPW200 R- CTTGTTACGACTTC as normal flora (Ruoff, 1991). This research ACC, and amplified IS1126 using PI F- aim to investigate the distribution of G. CCCGGCTTATGACGTGATTTCTCT, and adiacens and P. gingivalis among PI R-CTGTTGCG TTTGTGCCCTTGTGC. periodontitis in gingivitis patient with PCR mixture with final volume of 20µl orthodontic wire. consist of 5µl of master mix (2.5U-iTag Key words: G. adiacens and P. gingivalis, DNA polymerase,2.5mM dNTPs,1X reaction orthodontic wire, PCR technique. buffer and 1X Gel loading buffer), 3µl of Materials and Methods each forward and revers and 6µl of DNA Sample collection: 78 samples of gingival template. A condition of PCR thermocycler swab have been collected from patient with (Biometra, USA) involved 94ᴼC for 2min orthodontic wires that suffering from followed by 30 cycle of 94ᴼC for 2min, 55ᴼC gingivitis whom visited private dental clinics for 1min and 72ᴼC for 2min with final 181 AL-Qadisiya Medical Journal Vol.13 No.23 2017 extension 72ᴼC for 10min. Multiplex PCR 80V. for 1hr. and photographed. ( Yat Woo for amplification of input and output of et al., 2003; Park et al ., 2004) IS1126 using PI and PIRC(1- Antibiotic sensitivity tests: The test was AGAGAAATCACGTCATAAGCCGGG- done for antibiotic resistance detection and 2- pattern of G. adiacens and P. gingivalis to GCACAAGGGCACAAACGCAACAG). six antibiotics belong to five different class PCR mixture and condition was carried out of antibiotic as mentioned in table (1). Disk as explained above. The resulted amplicon diffusion method was used as described by was electrophoresis on 1% agarose gel Kirby et al.(1969) Inhibition zone diameter stained with 0.5µg/ml of ethidium bromide at was compared with CLSI (2010). Table 1: Commercial Antibiotic Disk Class Subclass Antibiotic Symbol Content Beta-lactam/beta- Non Amoxicillin/Clav AMC 30ug lactamase inhibitor uanic acide combinations Cefotaxime CTX 30ug Cephems(parenteral) Cephalosporin III Ceftazidim CAZ 30ug Macrolides Non Erythromycin E 15 ug Aminoglycosidase Non Amikacin AK 10ug Peptide Non Bacitracin B 10ug Mutation experiment: To evaluate the role Least signifigant differences (LSD) and chi of orthodontic wire as a mutagenic agent to sequare (X2) were used for analysis of our bacterial isolates, two orthodontic wires have results. been chosen. Also four isolates of each G. Results and Discussion adiacens and P. gingivalis has been carried Results that from culturing of 149 gingival out using a method described by Lentino et specimen collected from patient with al.,1993 with some modification that include orthodontic wires of each gender: male (34 using crushing orthodontic wire in which sample) and female (115 samples) their age 0.95 mg/10ml of stainless steel and group range from 17 onward showed that 54 0.45mg/10ml of Nickel Titanium (NiTi) were isolates were belong to G. adiacens and 4 added to BHI broth. The morphology of 990-isolate belong to P. gingivalis while 91 bacterial isolates treated with orthodontic isolates described as un identified bacteria. wires as well as antibiotic resistance pattern The result of gel electrophoresis of amplicon were comparing with control after 24, 48, 72 resulted from amplification of 16S rRNA of and 96 hrs. G. adiacens showed that 54 (36,2%) isolates Statistical analysis were belong to G.adiacens by appearance of 1410 bp band on agarose gel stained with eithidium bromide as showed in figure (1) 182 AL-Qadisiya Medical Journal Vol.13 No.23 2017 12 11 10 9 8 7 6 5 4 3 2 1 L 1410bp 1500 bp 500 bp 100 bp Figure (1): Gel electrophoresis of PCR product of 16S rRNA amplicon of Granulicatella adiacens with 1410 bp. Lane (L) DNA marker (100bp), Lanes (3,6,8,9,10,11,12) positive result to G. adiacens ( 1% agarose, 80 Volt stained with ethidium bromide as showed in for 1hr) figure(2).
Load more

Recommended publications
  • The Oral Microbiome of Healthy Japanese People at the Age of 90
    applied sciences Article The Oral Microbiome of Healthy Japanese People at the Age of 90 Yoshiaki Nomura 1,* , Erika Kakuta 2, Noboru Kaneko 3, Kaname Nohno 3, Akihiro Yoshihara 4 and Nobuhiro Hanada 1 1 Department of Translational Research, Tsurumi University School of Dental Medicine, Kanagawa 230-8501, Japan; [email protected] 2 Department of Oral bacteriology, Tsurumi University School of Dental Medicine, Kanagawa 230-8501, Japan; [email protected] 3 Division of Preventive Dentistry, Faculty of Dentistry and Graduate School of Medical and Dental Science, Niigata University, Niigata 951-8514, Japan; [email protected] (N.K.); [email protected] (K.N.) 4 Division of Oral Science for Health Promotion, Faculty of Dentistry and Graduate School of Medical and Dental Science, Niigata University, Niigata 951-8514, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-45-580-8462 Received: 19 August 2020; Accepted: 15 September 2020; Published: 16 September 2020 Abstract: For a healthy oral cavity, maintaining a healthy microbiome is essential. However, data on healthy microbiomes are not sufficient. To determine the nature of the core microbiome, the oral-microbiome structure was analyzed using pyrosequencing data. Saliva samples were obtained from healthy 90-year-old participants who attended the 20-year follow-up Niigata cohort study. A total of 85 people participated in the health checkups. The study population consisted of 40 male and 45 female participants. Stimulated saliva samples were obtained by chewing paraffin wax for 5 min. The V3–V4 hypervariable regions of the 16S ribosomal RNA (rRNA) gene were amplified by PCR.
    [Show full text]
  • Prosthetic Joint Infection Caused by Granulicatella Adiacens
    Quénard et al. BMC Musculoskeletal Disorders (2017) 18:276 DOI 10.1186/s12891-017-1630-1 CASEREPORT Open Access Prosthetic joint infection caused by Granulicatella adiacens: a case series and review of literature Fanny Quénard1, Piseth Seng1,2,3* , Jean-Christophe Lagier3, Florence Fenollar3 and Andreas Stein1,2,3 Abstract Background: Bone and joint infection involving Granulicatella adiacens is rare, and mainly involved in cases of bacteremia and infectious endocarditis. Here we report three cases of prosthetic joint infection involving G. adiacens that were successfully treated with surgery and prolonged antimicrobial treatment. We also review the two cases of prosthetic joint infection involving G. adiacens that are reported in the literature. Case presentation: Not all five cases of prosthetic joint infection caused by G. adiacens were associated with bacteremia or infectious endocarditis. Dental care before the onset of infection was observed in two cases. The median time delay between arthroplasty implantation and the onset of infection was of 4 years (ranging between 2 and 10 years). One of our cases was identified with 16srRNA gene sequencing, one case with MALDI-TOF mass spectrometry, and one case with both techniques. Two literature cases were diagnosed by 16srRNA gene sequencing. All five cases were cured after surgery including a two-stage prosthesis exchange in three cases, a one- stage prosthesis exchange in one case, and debridement, antibiotics, irrigation, and retention of the prosthesis in one case, and prolonged antimicrobial treatment. Conclusion: Prosthetic joint infection involving G. adiacens is probably often dismissed due to difficult culture or misdiagnosis, in particular in the cases of polymicrobial infection.
    [Show full text]
  • Granulicatella Adiacens Bacteria Isolation from Perodontitical
    Sys Rev Pharm 2020; 11(4): 396 400 A multifaceted review journal in the field of pharmacy E-ISSN 0976-2779 P-ISSN 0975-8453 Granulicatella Adiacens Bacteria Isolation from Perodontitical Patients with Polymerase Chain Reaction Techniques Harun Achmad1, Sri Oktawati2,Andi Mardiana Adam2,Burhanuddin Pasiga3, Rizalinda Sjahril4, Aulia Azizah5, Bayu Indra Sukmana6, Huldani7, Heri Siswanto8 , Ingrid Neormansyah8 1Lecturer of Pedodontics Department, Dentistry Faculty, Hasanuddin University, Makassar, Indonesia 2Lecturer of Periodontology Department, Dentistry Faculty, Hasanuddin University, Makassar, Indonesia 3Lecturer of Dental Public Health Department, Dentistry Faculty, Hasanuddin University, Makassar, Indonesia 4 Lecturer of Microbiology Department, Medical Faculty, Hasanuddin University, Makassar, Indonesia 5Department of Preventive and Public Health Dentistry, Faculty of Dentistry, Lambung Mangkurat University, Banjarmasin, Indonesia. 6Department of Dental Radiology, Faculty of Dentistry, Lambung Mangkurat University, Banjarmasin, Indonesia. 7Department of Physiology, Faculty of Medicine, Lambung Mangkurat University, Banjarmasin, Indonesia. 8 Resident of Periodontology Department, Dentistry Faculty, Hasanuddin University, Makassar, Indonesia Correspondence Author E-mail: [email protected] Article History: Submitted: 10.01.2020 Revised: 12.03.2020 Accepted: 24.04.2020 ABSTRACT Background: Periodontitis is an inflammatory disease of dental support the NCBI Gene Bank using BLAST analysis. tissue caused by certain groups of microorganisms,
    [Show full text]
  • Bacterial Diversity and Functional Analysis of Severe Early Childhood
    www.nature.com/scientificreports OPEN Bacterial diversity and functional analysis of severe early childhood caries and recurrence in India Balakrishnan Kalpana1,3, Puniethaa Prabhu3, Ashaq Hussain Bhat3, Arunsaikiran Senthilkumar3, Raj Pranap Arun1, Sharath Asokan4, Sachin S. Gunthe2 & Rama S. Verma1,5* Dental caries is the most prevalent oral disease afecting nearly 70% of children in India and elsewhere. Micro-ecological niche based acidifcation due to dysbiosis in oral microbiome are crucial for caries onset and progression. Here we report the tooth bacteriome diversity compared in Indian children with caries free (CF), severe early childhood caries (SC) and recurrent caries (RC). High quality V3–V4 amplicon sequencing revealed that SC exhibited high bacterial diversity with unique combination and interrelationship. Gracillibacteria_GN02 and TM7 were unique in CF and SC respectively, while Bacteroidetes, Fusobacteria were signifcantly high in RC. Interestingly, we found Streptococcus oralis subsp. tigurinus clade 071 in all groups with signifcant abundance in SC and RC. Positive correlation between low and high abundant bacteria as well as with TCS, PTS and ABC transporters were seen from co-occurrence network analysis. This could lead to persistence of SC niche resulting in RC. Comparative in vitro assessment of bioflm formation showed that the standard culture of S. oralis and its phylogenetically similar clinical isolates showed profound bioflm formation and augmented the growth and enhanced bioflm formation in S. mutans in both dual and multispecies cultures. Interaction among more than 700 species of microbiota under diferent micro-ecological niches of the human oral cavity1,2 acts as a primary defense against various pathogens. Tis has been observed to play a signifcant role in child’s oral and general health.
    [Show full text]
  • Atypica, and Granulicatella Adiacens in Biofilm of Complete Dentures
    [Downloaded free from http://www.j-ips.org on Thursday, November 1, 2018, IP: 183.82.145.117] Original Article Relative presence of Streptococcus mutans, Veillonella atypica, and Granulicatella adiacens in biofilm of complete dentures Binoy Mathews Nedumgottil Department of Prosthodontics and Implantology, Mahe Institute of Dental Sciences and Hospital, Puducherry, India Abstract Aims and Objective: Oral biofilms in denture wearers are populated with a large number of bacteria, a few of which have been associated with medical conditions such as sepsis and infective endocarditis (IE). The present study was designed to investigate the relative presence of pathogenic bacteria in biofilms of denture wearers specifically those that are associated with IE. Methods: Biofilm samples from 88 denture wearers were collected and processed to extract total genomic DNA. Eight of these samples were subjected to 16S rRNA gene sequencing analysis to first identify the general bacterial occurrence pattern. This was followed by species-specific quantitative polymerase chain reaction (qPCR) on entire batch of 88 samples to quantify the relative copy numbers of IE-associated pathogens. Results: 16S rRNA gene analysis of eight biofilm samples identified bacteria from Firmicutes, Actinobacteria, Proteobacteria, Bacteroidetes, and Fusobacteria species. Interestingly, Streptococcus mutans, Veillonella atypica, and Granulicatella adiacens from Firmicutes, all known to be associated with early-onset sepsis and IE was present in five of eight biofilm samples. The other three samples carried bacteria from genus Proteobacteria with Neisseria flava and Neisseria mucosa, which are known to be commensals, as dominant species. Species-specific qPCR of S. mutans V. atypica, and G. adiacens on 88 biofilm DNA samples identified the presence of S.
    [Show full text]
  • Identification and Antimicrobial Susceptibility of Granulicatella
    Sys Rev Pharm 2020; 11(4): 324 331 A multifaceted review journal in the field of pharmacy E-ISSN 0976-2779 P-ISSN 0975-8453 Identification and Antimicrobial Susceptibility of Granulicatella adiacens Isolated from Periodontal Pocket *1Harun Achmad, 2Andi Mardiana Adam, 2Surijana Mappangara, 2Sri Oktawati, 3Rizalinda Sjahril, 1Marhamah F. Singgih, 2Ingrid Neormansyah, 2Heri Siswanto *1Pediatric Dentistry Department, Faculty of Dentistry, Hasanuddin University, Makassar, Indonesia 2Periodontology Department, Faculty of Dentistry, Hasanuddin University, Makassar, Indonesia 3Microbiology Department, Medical Faculty, Hasanuddin University, Makassar, Indonesia Correspondence Author E-mail: [email protected] Article History: Submitted: 23.01.2020 Revised: 20.03.2020 Accepted: 09.04.2020 ABSTRACT Background: Periodontal diseases often occur in developing and Granulicatella adiacens. Those samples were tested on seven types of developed countries, affecting 20 – 50% of the world population. antibiotic which is ofloxacin, ceftriaxone, azithromycin, vancomycin, Periodontitis may also complicate systemic health and have a risk to tetracycline, levofloxacin, and clindamycin. Sensitive isolates were cause endocarditis infection. Granulicatella adiacens, part found on 90% of ofloxacin and levofloxacin group, 85% of ofnutritionally variant streptococci (NVS), was proven to cause many azithromycin group, 50% of vancomycin group, and less than 50% for diseases, especially endocarditis infection. GA was a part of three other groups. High resistance
    [Show full text]
  • Identification of Clinically Relevant Streptococcus and Enterococcus
    pathogens Article Identification of Clinically Relevant Streptococcus and Enterococcus Species Based on Biochemical Methods and 16S rRNA, sodA, tuf, rpoB, and recA Gene Sequencing Maja Kosecka-Strojek 1,* , Mariola Wolska 1, Dorota Zabicka˙ 2 , Ewa Sadowy 3 and Jacek Mi˛edzobrodzki 1 1 Department of Microbiology, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, 30-387 Krakow, Poland; [email protected] (M.W.); [email protected] (J.M.) 2 Department of Molecular Microbiology, National Medicines Institute, 00-725 Warsaw, Poland; [email protected] 3 Department of Epidemiology and Clinical Microbiology, National Medicines Institute, 00-725 Warsaw, Poland; [email protected] * Correspondence: [email protected]; Tel.: +48-12-664-6365 Received: 13 October 2020; Accepted: 9 November 2020; Published: 11 November 2020 Abstract: Streptococci and enterococci are significant opportunistic pathogens in epidemiology and infectious medicine. High genetic and taxonomic similarities and several reclassifications within genera are the most challenging in species identification. The aim of this study was to identify Streptococcus and Enterococcus species using genetic and phenotypic methods and to determine the most discriminatory identification method. Thirty strains recovered from clinical samples representing 15 streptococcal species, five enterococcal species, and four nonstreptococcal species were subjected to bacterial identification by the Vitek® 2 system and Sanger-based sequencing methods targeting the 16S rRNA, sodA, tuf, rpoB, and recA genes. Phenotypic methods allowed the identification of 10 streptococcal strains, five enterococcal strains, and four nonstreptococcal strains (Leuconostoc, Granulicatella, and Globicatella genera). The combination of sequencing methods allowed the identification of 21 streptococcal strains, five enterococcal strains, and four nonstreptococcal strains.
    [Show full text]
  • Infective Endocarditis: Identification of Catalase-Negative, Gram-Positive Cocci from Blood Cultures by Partial 16S Rrna Gene Analysis and by Vitek 2 Examination
    116 The Open Microbiology Journal, 2010, 4, 116-122 Open Access Infective Endocarditis: Identification of Catalase-Negative, Gram-Positive Cocci from Blood Cultures by Partial 16S rRNA Gene Analysis and by Vitek 2 Examination Rawaa Jalil Abdul-Redha1, Michael Kemp1, Jette M. Bangsborg2, Magnus Arpi2 and Jens Jørgen Christensen1,* 1Department of Bacteriology, Mycology and Parasitology, Statens Serum Institut; Department of Clinical Microbiology, 2Herlev University Hospital, *Present address, Slagelse Hospital; Copenhagen, Denmark Abstract: Streptococci, enterococci and Streptococcus-like bacteria are frequent etiologic agents of infective endocarditis and correct species identification can be a laboratory challenge. Viridans streptococci (VS) not seldomly cause contamina- tion of blood cultures. Vitek 2 and partial sequencing of the 16S rRNA gene were applied in order to compare the results of both methods. Strains originated from two groups of patients: 149 strains from patients with infective endocarditis and 181 strains as- sessed as blood culture contaminants. Of the 330 strains, based on partial 16S rRNA gene sequencing results, 251 (76%) were VS strains, 10 (3%) were pyogenic streptococcal strains, 54 (16%) were E. faecalis strains and 15 (5%) strains be- longed to a group of miscellaneous catalase-negative, Gram-positive cocci. Among VS strains, respectively, 220 (87,6%) and 31 (12,3%) obtained agreeing and non-agreeing identifications with the two methods with respect to allocation to the same VS group. Non-agreeing species identification mostly occurred among strains in the contaminant group, while for endocarditis strains notably fewer disagreeing results were observed. Only 67 of 150 strains in the mitis group strains obtained identical species identifications by the two methods.
    [Show full text]
  • Nutritionally Variant Streptococci)
    Microbiol. Immunol., 44(12), 981-985, 2000 Serological Properties of Abiotrophia and Granulicatella Species (Nutritionally Variant Streptococci) Katsuhiro Kitada, Yasuko Okada, Taisei Kanamoto*, and Masakazu Inoue* Department of Preventive Dentistry, Kagoshima University Dental School, Kagoshima, Kagoshima 890-8544, Japan Received May 11, 2000; in revised form, August 15, 2000. Accepted September 9, 2000 Abstract: Serological variations were examined among 12 type or reference strains and 91 oral isolates of vitamin B6-dependent Abiotrophia and Granulicatella spp. Rabbits were immunized with whole cells of 12 selected strains and 10 typing antisera were obtained, which were unreactive with the Lancefield group A to G antigen preparations. The reactivity of the antisera and autoclaved cell surface antigen extracts was tested by double diffusion in agar gel and a capillary precipitin test. These typing antisera categorized all Abiotrophia defectiva strains, all except one Granulicatella elegans strain, three-quarters of the Granulicatella adiacens, and half of the Granulicatella paraadiacens into 8 serotypes and 2 subserotypes. The Granulicatella balaenopterae type strain was unserotypable. All A. defectiva strains were serotype I, some of which were divided into subserotype I-1 and/or I-5. The G. adiacens strains generally belonged to serotype II or III, and the G. paraadiacens strains to serotype IV, V or VI. All G. adiacens or G. paraadiacens serotype II strains were also subserotype 1-5. The G. elegans strains were serotype VII or VIII. These Abiotrophia and Gran- ulicatella serotypes were undetectable among 33 strains of the other 11 species including the bacteriolytic enzyme-producing but vitamin B6-independent strains of Streptococcus, Enterococcus, Dolosigranulum and Aerococcus.
    [Show full text]
  • Granulicatella Adiacens, an Unusual Causative Agent in Chronic Dacryocystitis
    Faculty & Staff Scholarship 2015 Granulicatella adiacens, an unusual causative agent in chronic dacryocystitis Cristy A. Ku Blake Forcina Paul R. LaSala John Nguyen Follow this and additional works at: https://researchrepository.wvu.edu/faculty_publications Ku et al. Journal of Ophthalmic Inflammation and Infection (2015) 5:12 DOI 10.1186/s12348-015-0043-2 BRIEF REPORT Open Access Granulicatella adiacens, an unusual causative agent in chronic dacryocystitis Cristy A Ku1, Blake Forcina2, Paul Rocco LaSala3 and John Nguyen2* Abstract Background: Granulicatella adiacens, a recent taxonomic addition, is a commensal organism of the oral, gastrointestinal, and urogenital tracts and is rarely encountered in the orbit and eye. Findings: We present a 46-year-old Caucasian woman with chronic dacryocystitis who underwent an external dacryocystorhinostomy and was found to have G. adiacens. Conclusions: This is an unusual causative organism isolated in the nasolacrimal system and, to our knowledge, the first reported case of chronic dacryocystitis associated with G. adiacens. Keywords: Granulicatella adiacens; Chronic; Dacryocystitis; Dacryocystorhinostomy; Nasolacrimal duct obstruction Findings pressure was 15 mmHg in each eye. Pooling of clear Introduction tears was noted on a normal-appearing right lower lid Acquired nasolacrimal duct obstruction (NLDO), a com- without an enlarged, erythematous, or tender lacrimal mon cause of epiphora and dacryocystitis, is typically sac. Nasolacrimal dilation and irrigation revealed complete managed with dacryocystorhinostomy (DCR). Even in reflux of clear saline, and the remainder of the ocular cases without signs of infection, positive bacterial cultures exam was unremarkable. are often obtained from the lacrimal sac [1]. Gram- The patient underwent an uneventful external dacryo- positive bacteria - Staphylococcus epidermidis, Staphylo- cystorhinostomy with placement of Crawford stent.
    [Show full text]
  • Post-Operative Endophthalmitis Caused by the Nutritionally Variant Streptococcus Granulicatella Adiacens
    perim Ex en l & ta a l ic O p in l h t C h f Journal of Clinical & Experimental a o l m l a o n l r o Todokoro, J Clin Exp Ophthalmol 2016, 7:3 g u y o J Ophthalmology 10.4172/2155-9570.1000557 ISSN: 2155-9570 DOI: Case Report Open Access Post-Operative Endophthalmitis Caused by the Nutritionally Variant Streptococcus Granulicatella adiacens Daisuke Todokoro1*, Kiyofumi Mochizuki2, Kiyofumi Ohkusu3, Ryuichi Hosoya4, Nobumichi Takahashi2, and Shoji Kishi1,5 1Department of Ophthalmology, Gunma University School of Medicine, Japan 2Department of Ophthalmology, Gifu University School of Medicine, Japan 3Department of Microbiology, Tokyo Medical University, Japan 4Department of Clinical Laboratory, Gunma University School of Medicine, Japan 5Maebashi Central Eye Clinic, Japan *Corresponding author: Daisuke Todokoro, Department of Ophthalmology, Gunma University School of Medicine, 3-39-15 Showa-machi, Maebashi, Gunma, Japan, Tel: +81-27-220-8338; Fax: +81-27-233-3841; E-mail: [email protected] Received date: Apr 27, 2016; Accepted date: May 25, 2016; Published date: May 30, 2016 Copyright: © 2016 Todokoro D, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract Objective: Bacterial endophthalmitis is among the most serious ocular infections. Nutritionally variant streptococci (NVS) are bacteria that are difficult to culture with standard media because of fastidious growth requirements. The cases of post-operative endophthalmitis caused by Granulicatella adiacens, one of the NVS were reported.
    [Show full text]
  • Case Report Granulicatella Adiacens and Abiotrophia Defectiva Native
    Hindawi Case Reports in Infectious Diseases Volume 2019, Article ID 5038563, 8 pages https://doi.org/10.1155/2019/5038563 Case Report Granulicatella adiacens and Abiotrophia defectiva Native Vertebral Osteomyelitis: Three Cases and Literature Review of Clinical Characteristics and Treatment Approach Cinzia Puzzolante ,1 Gianluca Cuomo ,1 Marianna Meschiari,1 Andrea Bedini,1 Aurora Bonazza,1 Claudia Venturelli ,2 Mario Sarti,3 and Cristina Mussini1,4 1Azienda Ospedaliero-Universitaria di Modena, Infectious Disease Clinic, Modena, Italy 2Clinical Microbiology, Azienda Ospedaliero-Universitaria di Modena, Modena, Italy 3Clinical Microbiology, Ospedale Civile di Baggiovara, Modena, Italy 4University of Modena and Reggio Emilia, Azienda Ospedaliero-Universitaria di Modena, Infectious Disease Clinic, Modena, Italy Correspondence should be addressed to Cinzia Puzzolante; [email protected] Received 8 January 2019; Accepted 16 April 2019; Published 6 May 2019 Academic Editor: Antonella Marangoni Copyright © 2019 Cinzia Puzzolante et al. 'is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Granulicatella adiacens and Abiotrophia defectiva are an increasingly recognized cause of osteoarticular infections. We describe two cases of G. adiacens and one case of A. defectiva native vertebral osteomyelitis (NVO) and review all published cases. Nine cases of G. adiacens NVO and two cases of A. defectiva NVO were previously described. Patients were usually middle-aged men, and classical risk factors for NVO were present in half of the cases. Concomitant bacteremia was reported in 78.6% of cases, and concurrent infective endocarditis occurred in 36.4% of this sub-group of patients.
    [Show full text]