AL-Qadisiya Medical Journal Vol.13 No.23 2017

Distribution of adiacens and Porphyromonas gingivalis among ortho and non-orthodontic Patients with Gingivitis in Kufa City /Iraq. Manar Hussain Abbas* ,Ahlam Kadhum Al-Yasseen* , Wisam Wahab Alhamadi *Faculty of Education for Girls, University of Kufa/ Iraq * * Faculty of Dentistry, University of Babylon / Iraq. *Corresponding author E-Mail: [email protected] Mobil: 964 780 803 6089 الخالصة: هدفت هذه الدراسة إلى التعرف على توزيع غرانوليكاتيال أدياسنس و بورفيروموناس لينغيفيك ودور أسالك تقويم األسنان على نمط مقاومة المضادات الحيوية من العزالت البكتيرية. تم جمع ما مجموعه 78 عينة مسحة اللثة من المريض مع أسالك تقويم األسنان الذين يعانون من التهاب اللثة و 71 عينات تم جمعها من صحية دون أسالك تقويم األسنان خالل أربعة أشهر من عيادات األسنان الخاصة. اظهرت نتائج العزلة والتعرف على العزالت البكتيرية باستخدام االستزراع واالختبارات البيوكيميائية التقليدية وكذلك التقنية الجزيئية باستخدام ال S16 الريباسي للكشف عن ال G. أدياسنس والعنصر التسلسلي IS1126 للكشف عن P. لينجيفاليس ان 54 عزلة )٪29.6( كانت تنتمي إلى G أدياسنس و 4 العزالت تنتمي إلى P اللثة. لشرح دور أسالك تقويم األسنان على العزالت البكتيرية تم إجراء تجربة طفرة. وأظهرت النتائج نفس التغيير الذي تم الحصول عليه عند استخدام كل من نيتي واألسالك الفوالذ المقاوم للصدأ على G. أدياسنس و P. اللثة بعد hr-96hr24 من الحضانة. أظهر نمط مقاومة المضادات الحيوية للعزالت األصلية والمعالجة مع نيتي والفوالذ المقاوم للصدأ زيادة في مقاومة المضادات الحيوية لباسيتراسين، سيفتازيديم، أوجمنتين، واالريثروميسين في حين تبقى المضادات الحيوية األخرى حساسة مثل سيفوتاكسيم و أميكاسين لجميع العزالت. Abstract This study aimed to investigate the distribution of Granulicatella adiacens and Porphyromonas gingivalis and the role of orthodontic wire on antibiotic resistance pattern of bacterial isolates. A total of 78 gingival swab samples have been collected from patient with orthodontic wires suffering from gingivitis and 71 samples were collected from healthy without orthodontic wire during four months from private dental clinics. The results of isolation and identification of bacterial isolates by using culture and conventional biochemical tests as well as molecular technique using 16S rRNA for detection of G. adiacens and insertion seqence element IS1126 for detection of P. gingivalis showed that 54 (29.6%) isolates were belong to G adiacens and 4 isolates were belong to P gingivalis. To explain the role of orthodontic wires on bacterial isolates a mutation experiment was carried out. The result showed the same change has been obtained when using both NiTi and stainless steel wire on G. adiacens and P. gingivalis after 24hr-96hr of incubation. Antibiotic resistance pattern of both original and treated isolates with NiTi and stainless steel showed increased in antibiotic resistance to bacitracin, ceftazidim, ogmentin, and erythromycin while other antibiotic remain sensitive such as cefotaxim and amikacin for all isolates. Introduction gingivae causing destruction of ligament and periodontal disease refers to gingivitis alveolar bone supporting the teeth resulting and periodontitis is a reversible inflammation in oral malodor and loss of tooth and then induced by dental plaque of the gingiva ( loss the quality of life (Al-Harthi et al., Suvan et al., 2011), while periodontitis is a 2013). There are more than 300 species microbial inflammatory condition of the identified in the oral cavity, only small

180

AL-Qadisiya Medical Journal Vol.13 No.23 2017 group of gram-negative organisms which and 71 samples were collected from patient frequently are the most isolated from infected without orthodontic wires. All samples were periodontal pockets, including Bacteroides collected from the mouth firstly by rolling a forsythus, Actinobacillus sterile cotton swab across the gingival region actinomycetemcomitans, Campylobacter in lower and upper gum and by using dental spp., Capnocytophoga spp., Fusobacterium floss for sample collection from sub-gingival nucleatum, Porphyromonas gingivalis, region then swabs were cultured on Eikenella corrodens, and Prevotella MacConkey agar and Blood Agar base, intermedia, there are also oral spirochetes incubated an anaerobically at 37ᵒC for 24- 48 and are thus recognized as potential hr. for primary isolation of . periodontal pathogens (Socransky and Molecular Bacterial Identification: PCR Haffajee, 1992). technique was used for molecular Porphyromonas gingivalis (P. gingivalis) is identification of G. adiacens using 16SrRNA the second intensively studied probable (Yat Woo et al., 2003) and P. gingivalis periodontal pathogen and considered a major using IS1126 (Park et al., 2004). pathogen in chronic periodontitis (Haffajee Extraction of DNA: Boiling method that and Socransky,1994). It produce a number of described by Sambrook and Russell (2001) virulence factors and extracellular proteases, was carried out for DNA extraction. Briefly, such as lipopolysaccharide, capsule, an overnight of brain heart infusion culture gingipain, fimbria and so on, resulting in the (10 ml) of bacterial isolates were centrifuged destruction of periodontal tissues (Hayashi et at 6000 rpm/10 min and the pellet was al., 2012) washed twice with STE buffer and incubated Nutritionally variant streptococci (NVS) with lysozyme for 10 min at room are pleomorphic Gram variable bacteria temperature, then heated to boiling for 5min showing fastidious growth requirements and and incubated in ice bath for 10 min. the is a common cause of infectious endocarditis mixture was centrifuge for 30 min at 15000 in cases that are negative by blood culture. rpm. The supernatant was transferred to new Four bacterial species have been identified Eppendorf tube and mixed with 0.7 v:v of as NVS: defectiva , isopropanol and incubated in ice bath Granulicatella adiacens , Granulicatella overnight. DNA was recovered by elegans , and Granulicatella balaenopterae.( centrifugation at 10000 rpm/10min and the Hugo et al., 2015). G. adiacens formerly pellet was washed with70% ethanol and described as a member of nutritionally preserved with 100µl of TE buffer (Tris-base variant streptococci (NVS) It is found to and Na2EDTA). account for 85% of the NVS in the human Amplification of target gene: monoplex mouth making it the most common type PCR was used to amplified 16SrRNA using (Ohara-Nemoto et al.,1997). It colonizes the LPW200F-GAGTTGCGAACGGGTGAG- oral cavity, intestinal and genitourinary tracts and LPW200 R- CTTGTTACGACTTC as normal flora (Ruoff, 1991). This research ACC, and amplified IS1126 using PI F- aim to investigate the distribution of G. CCCGGCTTATGACGTGATTTCTCT, and adiacens and P. gingivalis among PI R-CTGTTGCG TTTGTGCCCTTGTGC. periodontitis in gingivitis patient with PCR mixture with final volume of 20µl orthodontic wire. consist of 5µl of master mix (2.5U-iTag Key words: G. adiacens and P. gingivalis, DNA polymerase,2.5mM dNTPs,1X reaction orthodontic wire, PCR technique. buffer and 1X Gel loading buffer), 3µl of Materials and Methods each forward and revers and 6µl of DNA Sample collection: 78 samples of gingival template. A condition of PCR thermocycler swab have been collected from patient with (Biometra, USA) involved 94ᴼC for 2min orthodontic wires that suffering from followed by 30 cycle of 94ᴼC for 2min, 55ᴼC gingivitis whom visited private dental clinics for 1min and 72ᴼC for 2min with final

181

AL-Qadisiya Medical Journal Vol.13 No.23 2017 extension 72ᴼC for 10min. Multiplex PCR 80V. for 1hr. and photographed. ( Yat Woo for amplification of input and output of et al., 2003; Park et al ., 2004) IS1126 using PI and PIRC(1- Antibiotic sensitivity tests: The test was AGAGAAATCACGTCATAAGCCGGG- done for antibiotic resistance detection and 2- pattern of G. adiacens and P. gingivalis to GCACAAGGGCACAAACGCAACAG). six antibiotics belong to five different class PCR mixture and condition was carried out of antibiotic as mentioned in table (1). Disk as explained above. The resulted amplicon diffusion method was used as described by was electrophoresis on 1% agarose gel Kirby et al.(1969) Inhibition zone diameter stained with 0.5µg/ml of ethidium bromide at was compared with CLSI (2010).

Table 1: Commercial Antibiotic Disk Class Subclass Antibiotic Symbol Content Beta-lactam/beta- Non Amoxicillin/Clav AMC 30ug lactamase inhibitor uanic acide combinations Cefotaxime CTX 30ug Cephems(parenteral) Cephalosporin III Ceftazidim CAZ 30ug Macrolides Non Erythromycin E 15 ug Aminoglycosidase Non Amikacin AK 10ug Peptide Non Bacitracin B 10ug

Mutation experiment: To evaluate the role Least signifigant differences (LSD) and chi of orthodontic wire as a mutagenic agent to sequare (X2) were used for analysis of our bacterial isolates, two orthodontic wires have results. been chosen. Also four isolates of each G. Results and Discussion adiacens and P. gingivalis has been carried Results that from culturing of 149 gingival out using a method described by Lentino et specimen collected from patient with al.,1993 with some modification that include orthodontic wires of each gender: male (34 using crushing orthodontic wire in which sample) and female (115 samples) their age 0.95 mg/10ml of stainless steel and group range from 17 onward showed that 54 0.45mg/10ml of Nickel Titanium (NiTi) were isolates were belong to G. adiacens and 4 added to BHI broth. The morphology of 990-isolate belong to P. gingivalis while 91 bacterial isolates treated with orthodontic isolates described as un identified bacteria. wires as well as antibiotic resistance pattern The result of gel electrophoresis of amplicon were comparing with control after 24, 48, 72 resulted from amplification of 16S rRNA of and 96 hrs. G. adiacens showed that 54 (36,2%) isolates Statistical analysis were belong to G.adiacens by appearance of 1410 bp band on agarose gel stained with eithidium bromide as showed in figure (1)

182

AL-Qadisiya Medical Journal Vol.13 No.23 2017

12 11 10 9 8 7 6 5 4 3 2 1 L

1410bp 1500 bp 500 bp 100 bp

Figure (1): Gel electrophoresis of PCR product of 16S rRNA amplicon of Granulicatella adiacens with 1410 bp. Lane (L) DNA marker (100bp), Lanes (3,6,8,9,10,11,12) positive result to G. adiacens ( 1% agarose, 80 Volt stained with ethidium bromide as showed in for 1hr) figure(2). Multiplex PCR for amplification of While 4 (2,6%) isolates were belong to IS1126-based PCR using PI1RC and PI2RC P.gingivalis by appearing of amplicon with primers showed no amplicon has been molecular weight 690 bp on agarose gel appeared on agarose gel electrophoresis.

7 6 5 4 3 2 1 L

1500 bp 690bp 500 bp

Figure (2): Gel electrophoresis of PCR product of IS1126 (PI) of Porphyromonas gingivalis (amplicon with 690 bp). Lane (L) DNA marker (100-bp ladder), Lanes (2,5,6,7) positive result to Porphyromonas gingivalis (1gm agarose, 80 Volt for 1hr). Molecular genetic methods have been widely Most recent DNA studies have reported used to investigate the bacterial diversity in increased rates of detection of G. adiacens in various environments, including the human periodontitis (Belstrom et al., 2014), and so oral cavity microbiological diagnosis have in endodontic infections (Hsiao et al., 2012) not only been used to detect uncultivated Shimoyama et al., (2011) used multiplex bacteria only but also to identify cultivable PCR as a rapid and highly sensitive bacterial species with superior specificity identification method which is 16S rRNA when compared with traditional culture- PCR for G. adiacens by using primers set based methods (Song, 2005). method for bacterial identification in roughly 4 h (Ohara-Nemoto et al., 1997).

183

AL-Qadisiya Medical Journal Vol.13 No.23 2017

The genome of P. gingivalis have multiple specific pathogen in a subgingival sample copies of IS1126, a number strains of P. will remain undetected. (Van Assche et al., gingivalis were analysed by Southern blot 2009). analysis by using IS1126 as a probe of About one-half of the more than 700 therefor the value of this element has been different species of bacteria were detected in used as a rapid epidemiological tool for the humans oral cavity remain to be identification of specific strain of P. cultivated and are known only by using of gingivalis (Maley and Roberts, 1994). 16S rRNA gene sequences (Kazor et al., Bactria that associated with periodontitis 2003). This approach has been used to detect and gingivitis are not detectable when using uncultivated bacteria directly in samples standard culture techniques only and are from subjects with periodontal disease in an extremely difficult to identify (Iwai . 2009). attempt to establish correlations with etiology Another potential source of error in the of disease (Kumar et al., 2003). culturing procedure for anaerobic bacteria The result showed a high distribution of belong to the processing of samples acute gingivitis in age group 17-27 among including transport media (Syed and upper and lower gums compared with other Loesche,1972). Therefor polymerase chain type of gingivitis and other age group where reaction (PCR) method was used for DNA their percentage were 32 and 28 in both detection of oral bacteria (Toyofuku et al., lower and upper gum respectively as 2011) showed in Table (2) Also astatical analysis The development of quantitative real-time showed a significant differences between PCR has enabled the sensitive and accurate lower and upper gum in acute stage in age determination of the cell number of group (17-22) years in compartion with individual species in subgingival plaque chronic at p < 0.05 samples, (von Wintzingerode et al., 1997). Results showed widely distribution of The efficiency of PCR assays in detecting bacterial isolates among chronic and acute microorganisms depends on collection of gingivitis in which G.adiacens may sample, PCR methodology, validation, and represented a main causes of acute gingivitis the interpretation of each PCR analysis in upper gum (18.5%) followed by (Fenollar et al., 2006). Suggests that P.gingivalis (0%). The same results were approximately 415 species are likely to be obtained in lower gum where G.adiacens present when using PCR and sequence incidence in a high percentage (11.1%). analysis 16S rRNA from bacteria in While in state of chronic gingivitis in upper subgingival plaque (Paster et al., 2001). The gum G.adiacens was (11.1%) whereas in agreement between culture and PCR method lower gum G.adiacens was (9.25%). While in detecting the absence of P.gingivalis, in state of non-orthodontic patient, when PCR was performed with the bacterial G.adiacens appear with high dominance suspension obtained after cultivating of compared with P.gingivalis where the plaque samples supposed that there were no percentage of isolation were (20.3%) and viable bacteria as well as PCR will detect not (25%) respectively in upper gum while in only viable but also moribund and dead cells lower gum G. adiacens was the most (Van Assche et al., 2009). common as showed in Table (3). Also a Detection limit could be explained the statical analysis showed a significant to to discrepancy between PCR-based and culture G.adiacens in lower gum of non-orthodontic based studies for PCR the detection limit is patient. typically 25–100 cells while for culturing 103–104 bacteria are required before Granulicatellas occur relatively among other detection the sensitivity of bacterial culturing dental infections (Belstrom et al., 2014), it is is theraby low especially for non-selective known as nutritionally variant streptococci media and therefore low numbers of a (NVS) due to their requirement for pyridoxal

184

AL-Qadisiya Medical Journal Vol.13 No.23 2017 or other additional agents to be incorporated because of the pleomorphic nature and into standard media for accurate laboratory variable Gram-staining characteristics of the isolation (Ruoff, 1991). Pyridoxal is required organism (Ruoff, 1991). limitation of for coenzymatic transformation of L-alanine nutrient can cause morphological to D-alanine, which is necessary for pleomorphism may be as a result to bacterial production of peptidoglycan (Ruoff, 1991). growth unbalanced related to the limitation Accurate identification of it can be difficult of nutrient (Frehel et al., 1988).

Table (2): Distribution of gingivitis types in ortho and non-orthodontic patient according to the age group with location of samples. Age group Orthodontic patient with gingivitis Non Total Type of gingivitis orthodontic Lower gum Upper gum patient with Acute Chronic Acute Chronic gingivitis 17-22 32 3 28 4 71 138 (91.4%) (100%) (93.3%) (100%) (92.2%) (92.6%) 23-28 3 0 3 0 3 5 (7.89%) (0%) (7.89%) (0%) (3.89%) (3.35%) 29-35 3 0 2 0 3 6 (7.89%) (0%) (6.06%) (0%) (3.89%) (4.02%) Total 38 3 33 4 71 149 (25.5%) (2.01%) (22.1%) (2.68%) (47.6%) (100%) CalculatedX 2.15 1.97 2 TableX2 0.71 P < 0.05

Table (3) Distribution of bacterial isolates in ortho and non-orthodontic patient according to the type of gingivitis with location of samples. Study group Location G.adiacens P.gingivalis Unidentified Total bacteria Non orthodontic Upper 11 1 6 33 (20.3%) (25%) (21.4%) (22.1%) lower 16 3 7 38 (29.6%) (75%) (25%) (25.5%) Orthodontic Upper 10 0 4 30 (Acute) (18.5%) (0%) (14.2%) (20.1%) Lower 6 0 3 22 (11.1%) (0%) (10.7%) (14.7%) Orthodontic Upper 6 0 6 16 (Chronic) (11.1%) (0%) (21.4%) (10.7%) Lower 5 0 2 10 (9.25%) (0%) (7.14%) (6.71%) Total 54 4 28 149 (36.2%) (2.68%) (18.7%) (100%) Calculated X2 2.11 Table X2 0.71 P < 0.05

During our study a correlation has been ability of S. aureus colonies to hemolyzed found between S. aureus and G. adiacens in erythrocyte resulting high amount of which G. adiacens was occur around S. pyridoxal an important substance that aureus colonies when culturing on blood required for the growth of G. adiacens agar base (unpublished data) this due to (Versalovic et al., 2011). While other studies

185

AL-Qadisiya Medical Journal Vol.13 No.23 2017 showed that G. adiacens unable to grow colonized subgingival plaque may due to when culturing in trypticase soy agar with their ability to tolerance anaerobic condition 5% of sheep blood because of their and neutral pH (Takahashi and Schachtele. fastidious growth requirements (Frenkel & 1990) Hirsch, 1961). Many studies demonstrated Variations in P. gingivalis virulence occur that other organisms such as staphylococci, because of the phenotypic expression which streptococci (excepting Streptococcus induced by both host and environmental pyogenes ), Enterobacteriaceae, and yeasts factors while the variation within the same may support the growth of G. adiacens by strain could also be due of recombinations supplement of pyridoxal or L-cysteine and genetic rearrangements (Holt et.al., (Frenkel & Hirsch, 1961). Deficient forms of 1999). Previous studies have tried to the cell wall developed as a result of characterize more virulent types of P. antibiotics exposure so the appearance of gingivalis by the expression of various Gram morphology appearance of cell-wall genetic rearrangements virulence factors e.g. deficiency in G. adiacens remained the same biochemical activity, colony morphotypes, after repeated sub culturing (Bottone et production of enzyme, antibiotic al.,1995). susceptibility, fimbriae, capsule formation P. gingivalis is considered the major antigenic properties, and their ability of pathogen among anaerobic Gram-negative adherence to various host cells (epithelial bacteria that cause periodontitis (Nishihara cells, neutrophils, hemagglutination, and Koseki, 2004). Which produce fibroblasts) (Holt et al., 1999). porphyrin pigments when grow on blood G. adiacens was detected in high level agar (dark brown/black pigments) (Bachrach especially in the oral cavity of adult (Sato et et.al., 2011) Our results showed that P. al., 1999; Aas et al., 2005). It is associated gingivalis have the ability to produce black with up to 2.3% of streptococcal bacteremia colonies when grow on blood agar base due and up to 5% of streptococcal endocarditis to aggregation of hemin on its cell wall as a and it was found more common than A. result from using iron transport system defective and much more common than G. (Ogrendik et al., 2005). This properties elegans as an etiologic agent of bacterial represented an important feature that endocarditis and in some cases of infectious recognized an opportunistic isolates from un crystalline keratopathies and corneal ulcers virulent isolates when grow on heme-limited following penetrating keratoplasty and it was medium (McKee et al., 1986) suggested that Co-infection with S. aureus or P. gingivalis does not produce siderophores other streptococcal species may contribute to to sequester and transport iron but its the growth of G. adiacens in vivo gingipains mediate the uptake of iron from (Christensen and Facklam, 2001). It form hemoglobin, heme proteins, and ferritin important part of biofilm in dental plaque due unlike other gram-negative (Sroka et al., to their ability to co-aggregate and grow of 2001). The source of metabolic energy of P. G. elegans and A. actinomycetemcomitans gingivalis obtained by fermenting amino with F. nucleatum to form th “bridge acids and this property is very important organism”. Granulicatella spp. have benefits which enable it to survive in deep for such this partnership for example, if periodontal pockets where sugars are Granulicatella spp. lack β-lactamase similar extremely scarce (Kolenbrander et al., 2011). to some streptococci in mouth. (Kuriyama et Is found in close proximity and interacts with al., 2002). the juxtaposing gingival tissue when P. gingivalis was detected in patients with considering its location in multispecies periodontitis and in healthy subjects subgingival biofilm communities therefor it (Frandsen et al.,2001). Lamont et al., (2013) represent as a late colonizer (Zijnge et al., identified P. gingivalis (Pg) as bacteria that 2011). The ability of P. gingivalis to form biofilm and cause gingivitis and

186

AL-Qadisiya Medical Journal Vol.13 No.23 2017

periodontitis. P. gingivalis present in high individuals (Missailidis et al., 2004; Zhao et level in advanced forms of periodontitis and al., 2007). Also P. gingivalis was detected in play important role in the pathogenesis of it 77.3% of samples from early periodontal (Scher et al., 2012; Abusleme et al., 2013). It patient using culture method (Kamma et al., was detected in deep periodontal pockets of 2004). There is a strong evidence for a adults (van Winkelhoff et al., 2002), and significant association between rheumatoid correlated with periodontal pocket depth arthritis and periodontitis. P. gingivalis (Grossi et al., 1995). As well as there were which is the major etiologic factor in low numbers of P. gingivalis is present when periodontitis and gingivitis facilitates the found in healthy cases. (Marsh, 2003). Riep development and progression of collagen et al. (2009) reported that P. gingivalis induced arthritis (Adamowicz et al., 2014). could also be frequently isolated from Mutation experiment healthy controls this in contrast to other To explain the role of orthodontic wire on studies where Haffajee and Socransky 1994 bacteria isolates a mutation experiment has showed that P. gingivalis is uncommon or been carried out. Four isolates of each G. found in low numbers in healthy individuals adiacens, and P.gingivalis were randomly and those with gingivitis, while it is more selected. frequently detected in those with more Results of 24 hr of incubation of G. destructive forms of disease. Samples from adiacens in BHI broth containing stainless 3.2% of children and adolescents without steel and NiTi wire showed no change in the periodontitis showed a positive reaction to P. colonies appearance comparing with control gingivalis-specific primers (Tamura et al., group (figure3A), While a greenish 2005), studies reported a high correlation discoloration of the colonies was obtained between rate of detection of P. gingivalis after 48 h of incubation of G. adiacens with and the age ( Ooshima et al., 2003). while NiTi wire (figure 3B). Wheres after 72 hr of another study noted that P. gingivalis may be incubation no discoloration of the colonies difficult to transmit or require a longer period was observed (figure3C). Finally, after 96 hr of time for colonization (Umeda et al., 2004). of incubation of G.adiacens in both of NiTi P. gingivalis has been detected at a high level and stainless steel wire containing broth (50.25– 89.4 %) in periodontitis patients but appear the same of control when culturing on also at a low level (23.1–36.8 %) in healthy BHI agar (figure 3D).

S N C S N C S N C S N C

A B C D

Figure (3): Morphological characteristic of treated Granulicatella adiacens grow on brain heart infusion agar. A- 24 hours incubation period; B- 48 hours incubation period C-72 hours incubation period D-96 hours of incubation period. N= treated with Nikle-titanium wire, S= treated with stainless steel wire, C=control.

187

AL-Qadisiya Medical Journal Vol.13 No.23 2017

On the other hand the result of 24 hr of purpose of the treatment (Chung and Font, incubation of P. gingivalis on BHI broth 2004). Orthodontic fixed appliance therapy is containing NiTi and stainless steel wire the commonest mode of treatment and the showed no change in the appearance of most commonly used orthodontic materials colonies when culturing on BHI agar in are brackets, tubes, band material, ligating comparing with control (figure 4A), while materials and arch-wires. These materials the result of 48 hr of incubation of P. facilitate the microbial adhesion and greatly gingivalis cause greenish discoloration of inhibit oral hygiene and provide new colonies of control and stainless steel wire retentive areas for plaque and debris which in containing broth after culturing on BHT agar turn predisposes the wearer to increased (figure 4B). After 72 and 96 hr no change in microbial burden and possibility of the color of the colonies has been occurred as subsequent infection (Magno et al., 2008). shown in figure (4 C and D) respectively. Many appliances are available either fixed or removable in accordance with the main

S N C S N C S N C S N C

A B C D

Figure(4): morphological characteristic of treated Porphyromonas gingivalis grow on brain heart infusion agar A- 24 hr of orthodontic appliance and the increase of it incubation period B-48 hr of incubation was significantly related with the period C-72 hr of incubation period D-96 development of gingivitis in orthodontic hr of incubation period. N= treated with treatment (Huang and Xiao. 2010; Wang et Nikle-titanium wire, S= treated with al., 2011). Peros, et al. (2011) reported new stainless steel wire, C=control. data on the duration of salivary microbial The result of this study indicate an increasing changes induced by the placement of fixed in the level of pathogenic bacteria when orthodontic appliances they noted the success comparing healthy and gingival case (Table of antimicrobial preventive measures for 3). While P. gingivalis obtained from healthy orthodontic patients with proper timing, Such only this due to mistaken in collection of measures should be applied between sixth samples because we discarded the suspected and twelfth weeks of orthodontic therapy colonies during our work and a mistake in which is the time where St. mutans and primary diagnosis of P. gingivalis which lead Lactobacillus spp. increase in the saliva in to loss of bacteria during cultivation. which their increase significantly in 6 months Multiplication of decaying bacteria increased after the insertion of fixed orthodontic significantly in the presence of fixed appliances. According to Topaloglu-Ak, et appliances in the mouth for one to two years al. (2011) the negative effect of microbial (Chany et al., 1999). flora can occur at long-term utilization of Percentage of P. gingivalis appliances of orthodontic and so increase the increased significantly after wearing risk of carious lesions.

188

AL-Qadisiya Medical Journal Vol.13 No.23 2017

Exposure of bacterial isolates to NiTi wire metabolize metals from alloys or microbial results in changing the color of culture media byproducts with the metabolic processes may this may due to the fact that NiTi alloys alter the conditions of the microenvironment compose of 55% nickel and 45% titanium (ie, decreasing the pH and therfore (Roach, 2007) which lead to effect on contributing to the initiation of the corrosion chemical properties of media as well as the process) (Palaghias,1985). metabolic activities of bacterial isolates. Aerobic, facultative and anaerobic bacteria NiTi archwires were considered better than favouring the corrosion process Aerobic stainless steel alloys due to their elasticity of bacteria utilize the simple sugar then enter 20% higher than stainless steel alloys into glycolysis and TCA cycle releasing (Chaturvedi, 2010), but also has a carbon dioxide (Gerhard, 1985) The disadvantage which include a decrease in facultative bacteria enter into the mechanical properties due to corrosion fermentative pathway utilizing the simple processes (Cai et al., 2010). NiTi archwires sugars and produce organic alcohols, acids were covered with Teflon based materials, and CO2, Organic acids formation cause composite resins, hydrogenated carbon or reduction of pH thereby it favoring corrosion. zirconium dioxide, which restricted corrosion facultative in the anaerobic zone utilize the and restrict the release of Ni by 80% without lactate as carbon source and reduce sulphate alter the mechanical properties of the to sulphide then sulphide combines with iron archwires (Ohgoe et al., 2007; Elayyan et al., to form ferrous sulphide. The sulphide 2008), this phenomena may also play role in produced by sulfide reducing bacteria (SRB) altering the color of culture media. Clinical enters into the interface of the anaerobic and oral manifestations in orthodontic patients facultative zones where it gets oxidized by such as gingival hyperplasia and periodontitis sulphate oxidizing bacteria to sulphate, might be associated with an inflammatory sulphuric acid is also formed which cause response elicited by the corrosion of reduction of the pH and cause tooth orthodontic appliances and then subsequent decalcification and corrosion of metallic release of nickel. (Genelhu et al., 2005.) implants because of its corrosive nature. Low Eliades et al. (2000) reported alteration in pH provide favorable environment for the composition of surface NiTi archwires aerobic microbes such as iron oxidizing after intra-oral exposure for 1–6 months due bacteria (Maruthamuthu et.al., 2005) MnO2, to the occurrence of amorphous precipitates FeO, Fe2O3 These metal ions combine with and microcrystalline particles in the bacterial end-products along with the proteinaceous biofilm. chloride ion in the electrolyte of saliva to Stainless steel arch wires have been used as form more corrosive products like ferric orthodontic wires with a wide range of chloride (FeCl3), manganese chloride applications in both the fixed and removable (MnCl2), etc. This leads leaching of metal appliances (Brantley et al., 2002). Studies on with subsequent release of chromium and it showed that the smoothness of their surface nickel into the body and then decalcification is responsible for the decrease in count of of teeth (Christopher et al., 2004). Streptoccocus colony on it where the Antibiotic sensitivity test adhesion ability in the coated and non- Antibiotic resistance patteren was detected coated group was increased by the extended for both origin isolates and mutated isolates incubation time and was the highest after to explain the effect of orthodontic wire on three hours of incubation (Yu et al., 2011). increasing or decreasing of antibiotic So the extended incubation time increased resistance manner of isolates. the adhesion of cariogenic Mutans The result of antibiotic resistance pattern streptococci (Amini et.al., and D’Anto` et after 24hr incubation of origin isolates of al., 2012). The action of microbial G.adiacens showed a variation in antibiotic colonization is twofold either take up and resistance pattern to tested antibiotics

189

AL-Qadisiya Medical Journal Vol.13 No.23 2017

(table-4), while after exposure of these pattern was observed after 48,72 and 96 hr. isolates to NiTi and stainless steel wire a of incubation with each wires. variation in antibiotic resistance among same Also, the same results were obtained when isolate was observed in which isolate that incubation of P. gingivalis with each wires sensitive to some antibiotics became in comparison with original isolates also after resistance to it and visversa as shown in table 24, 48, 72 and 96 hr. of incubation (Table5). (4). An increased in antibiotic resistance

Table (4). Antibiotic resistance pattern of Granulicatella adiacens (origin and mutated isolates) to certain antibiotic after different incubation period Incub cefotaxime Bacitracin ceftazidim Augmentn erthromycin amikacin ation

Perio d

C N $ C N $ C N $ C N $ C N $ C N $

24hr 27 29 24 5. 3. 9. 14 12 10 12. 5. 11. 12 6. 6. 19 21. 22. .8 .3 8 5 3 .3 .8 .8 8 8 8 .3 5 8 8 3 48hr 24 28 14 0 3. 2. 13 16 5. 3 5 6.3 2. 2. 5. 16 17. 18 .8 .8 .8 3 3 .5 .3 5 5 5 5 .8 5 72hr 17 29 25 10 0 0 5 14 12 5.8 3. 4 4. 0 2. 16 14. 15. .8 .5 .3 3 5 3 .8 3 3 96hr 21 23 25 0 0 2. 7 18 15 0 0 0 0 0 5 17 21. 20. .5 3 .3 3 5 6.7Sign $ 3.3 Sign N, $ 3.5Sign $ 5.5 Sign N, $ 2.2 Sign N 1.8 Sign N LSD 48 hr 72 hr 48 hr 96 hr 72 , 96 hr 72hr

N=Nikle-titanium wire, $=stainless steel wire, C=control, R=Resistant, S= senstive Table(5). Antibiotic resistance pattern of Porphyromonas gingivalis (origin and mutated isolates) to certain antibiotic after different incubation period Incu cefotaxime Bacitracin ceftazidim Augmentn erthromycin amikacin batio n

Perio d

C N $ C N $ C N $ C N $ C N $ C N $

24hr 36. 22. 26.5 9. 4 10 14 12 10 15 11 14 20 13 15. 16. 22 27. 5 8 5 .3 .3 .5 .5 .3 .5 5 3 .3 8 48hr 28. 31. 36 1. 0 0 13 13 14 0 0 2 4. 0 2.5 16. 16 16. 8 3 8 .8 5 5 .5 3 72hr 27. 18. 26.8 0 0 2 15 8. 14 2 2. 2.8 2 3. 5.3 15. 15 15 5 5 .8 8 5 3 3 .3 96hr 15. 16 20.5 0 0 2. 0 10 12 0 0 0 0 0 0 17. 17 18. 5 5 5 .3 5 2.4 Sign $ 1.3 Sign $ 1.1 Sign $ 3.2 Sign N, $ 5.6 Sign N, $ 4.4 Sign $ LSD 48 hr 24 hr 48 hr 48 , 96 hr 96 hr 72hr N=Nikle-titanium wire, $=stainless steel wire, C=control, R=Resistant, S= senstive

190

AL-Qadisiya Medical Journal Vol.13 No.23 2017

Antimicrobial drug susceptibility patterns, Abramson J.; Riistama S.; Larsson G.; In vitro do not correlate well with clinical Jasaitis A.; Svensson-Ek M.; Laakkonen response to treatment and there is poorly L.; Puustinen A.; Iwata S. and Wikstrom respond to antimicrobial treatment from NVS M. (2000). The Structure of the Ubiquinol infections with significant rates of Oxidase from Escherichia coli and Its microbiological failure and relapse rates after Ubiquinone Binding Site. J. N. S. B.; 7: 910- treatment have been showed for NVS 917. infections than with streptococci and related Abusleme L.; Dupuy A. K.; Dutzan N.; genera (Adam et al., 2015). G. adiacens has Silva N.; Burleson J. A. and Strausbaug L. been recorded to be resistant to , D. (2013).The subgingiva lmicrobiome in and resistance to extended-spectrum health and periodontitis and its relationship cephalosporins and newer fluoroquinolones with community biomass and inflammation. (Tuohy et al., 2000).in contrast to Ruoff. I.S.M.E. J.; 7: 1016–1025. (1991) that showed that NVS were Adam E. L.; Siciliano R. F.; Gualandro D. moderately susceptible to , M.; Calderaro D.; Issa V. S.; Rossi F.; , chloramphenicol, erythromycin, Caramelli B.; Mansur A. J. and Strabelli rifampin, and vancomycin and variably T. M. (2015). Case series of infective susceptible to cephalosporins . The endocarditis caused by Granulicatella emergence of macrolide resistanc of G. species. Int. J. Infect. Dis.; 31:56-8. adiacens that cause endocarditis is Adamowicz K.; Maresz K.; Benedyk M.; associated with high mortality (Bouvet and Hellvard A.; Mydel P. and Potempa J. Acar, 1984). Woo et al., 2003 reported that (2014). Intratracheal inoculation of three out of nine isolates of NVS were porphyromonas gingivalis induces resistant to erythromycin, clarithromycin and inflammatory changes in the joints of DBA/1 azithromycin while Cargill et al., (2012) mice. Ann. Rheu. Dis.; 73(1): A70–A71. reported that isolates was susceptible to AlHarthi L. S.; Cullinan M. P.; Leichter J. clindamycin, rifampin, and vancomycin, and W. and Thomson W. M. (2013). The impact it was resistant to penicillin, cefotaxime, of periodontitis on oral health-related quality ceftriaxone, and meropenem. of life: are view of the evidence from positive responses have been reported observational studies. Aust.Dent.J.58, 274 - with amoxicillin/clavulanic acid in the 277. periodontitis treatment (Van Winkelhoff et Amini F.; Rakhshan V.; Pousti M.; al., 2005). The fact that 12 % of the bacteria Rahimi H.; Shariati M. and were resistant or intermediate resistant to Aghamohamadi B. (2012). Variations in amoxicillin but 100 % were sensitive to surface roughness of seven orthodontic amoxicillin/clavulanic acid indicates archwires: a sem-profilometry study. Korean resistance of P.gingivalis to β-lactam J. Orthod.; 42(3):129-37. antibiotics which due to β-lactamase Bachrach G.; Faerman M.; Ginesinm O.; production (Blandino et al., 2007). Eini A. and Sol A. (2011). Oral Microbes in ACKNOWLEDGMENT Health and Disease. In: Rosenberg E, The author like to thank Collage of Gophna U (eds.). Beneficial microorganisms Dentistry /University of Kufa and University in multicellular life forms. Berlin: Springer of Babylon for providing facility and support Heidelberg; Pp. 189-201. to finish this study. Belstrom D.; Fiehn N. E.; Nielsen C. H.; Kirkby N.; Twetman S. and Klepac-Ceraj References V. (2014). Differences in bacterial saliva Aas J. A.; Paster B. J.; Stokes L. N.; Olsen profile between periodontitis patients and a I. and Dewhirst F. E. (2005). Defining the control cohort. J. Clin. Periodontol.; normal bacterial flora of the oral cavity. J. 41(2):104–12. Clin. Microbiol.; 43:5721–32.

191

AL-Qadisiya Medical Journal Vol.13 No.23 2017

Blandino G.; Milazzo I.; Fazio D.; Puglisi Chung C. H. and Font B. (2004). Skeletal S.; Pisano M. and Speciale A. (2007). and dental changes in the sagittal, vertical, Antimicrobial susceptibility and beta- and transverse dimensions after rapid palatal lactamase production of anaerobic and expansion. Am. J. Orthod. Dentofacial aerobic bacteria isolated from pus specimens Orthop.; 126(5):569-75. from orofacial infections. J. Chemother.; CLSI, editor (2010). Clinical and 19:495-9. Laboratory Standards Insitute. Performance Bottone E. J.; Thomas C. A.; Lindquist D. Standards for Antimicrobial Susceptebility and Janda J. M. (1995). Difficulties Testing: Twentieth Informational encountered in identification of a Supplement M100-S20. CLSI, Wayne, PA, nutritionally deficient streptococcus on the USA. basis of its failure to revert to streptococcal D’Anto` V.; Rongo R.; Ametrano G.; morphology. J. Clin. Microbiol.; 33: 1022- Spagnuolo G. and Manzo P. (2012). 1024. Evaluation of surface roughness of Bouvet A. and Acar J. F. (1984). New orthodontic wires by means of atomic force bacteriological aspects of infective microscopy. Angle Orthod.; 82(5):922-8. endocarditis. Eur. Heart. J.; 5 (Suppl. C): 45- Elayyan F.; Silikas N. and Bearn D. 48. (2008). Ex vivo surface and mechanical Brantley W. A.; Iijima M. and Grentzer T. properties of coated orthodontic archwires, H. (2002). Temperature modulated DSC Eur. J. Orthod.; 30(6):661–667. study of phase transformations in nickel– Eliades T.; Eliades G.; Athanasiou A. E. titanium orthodontic wires. Thermochim. and Bradley T. G. (2000). Surface Acta.; 392-393, 329-337. characterization of retrieved NiTi orthodontic Cai F .; Yang Q.; Huang X. and Wei R. archwires. Eur. J. Orthod.; 22:317–326. (2010). Microstructure and corrosion Fenollar F.; Roux V.; Stein A.; Drancourt behavior of CrN and CrSiCN coatings. J. M. and Raoult D. (2006). Usefulness of 16S Mat. Eng. Perform; 19(5): 721–727. rDNA PCR and sequencing in bone and joint Caporaso J. G.; Lauber C. L.; Walters W. infections.An experience on525 A.; Berg-Lyons D. and Lozupone C. A. samples.J.Clin.Microbiol.;44:1018-1028. (2011). Global patterns of 16S rRNA Frandsen E.V.; Poulsen K.; Curtis M. A. diversity at a depth of millions of sequences and Kilian M. (2001). Evidence of per sample. Proc. Natl. Acad. Sci. USA.; 108 recombinationin Porphyromonas gingivalis (1):4516-4522. and random distribution of putative virulence Cargill J. S.; Scott K. S.; Gascoyne-Binzi markers.Infect. Immun.; 69:4479–4485. D. and Sandoe J. A. (2012). Granulicatella Frehel C.; Hellio R.; Cremieux A. C.; infection: diagnosis and management. J. Contrepois A.; Bouvet A. (1988). Med. Microbiol.; 61:755-61. Nutritionally variant streptococci develop Chany H. S.; Walsh L. J. and Freer T. J. ultrastructural abnormalities during (1999). The effect of orthodontic treatment experimental endocarditis. Microb. Pathog.; on salivary flow PH, buffer capacity and 4: 247-255. levels of Streptococcus mutans and Frenkel A. and Hirsch W. (1961). Lactobacilli. Aust. Orthod. J.; 15: 229-234. Spontaneous development of L forms of Chaturvedi T. P. and Upadhayay S. N. streptococci requiring secretions of other (2010). An overview of orthodontic material bacteria or sulphydryl compounds for normal degradation in oral cavity. Indian J. Dent. growth. Nat.; 191: 728–730. Res.; 21(2):275–284. Genelhu M. C.; Marigo M.; Alves-Oliveira Christensen J. J. and Facklam R. R. L. F.; Malaquias L. C. and Gomez R. S. (2001). Granulicatella and Abiotrophia (2005). Characterization of nickel-induced species from human clinical specimens. J. allergic contact stomatitis associated with Clin. Microbiol.; 39:3520–3523.

192

AL-Qadisiya Medical Journal Vol.13 No.23 2017 fixed orthodontic appliances. Am. J. Orthod. dilution and disk diffusion methods. p. 1253– Dentofac. Orthop.; 128(3):378-81. 73. Gerhard G. (1985). Bacterial Metabolism, Kadowaki T.; Nakayama K.; Okamoto K.; Springer-Verlag, New York; pp. 1–306. Abe N.; Baba A.; Shi Y.; Ratnayake D. B. Grossi S. G.; Genco R. J.; Machtei E. E.; and Yamamoto K. ( 2000). Porphyromonas Ho A. W.; Koch G.; Dunford R.; Zambon gingivalis proteinases as virulence J. J. and Hausmann E. (1995). Assessment determinants in progression of periodontal of risk for periodontal disease. II. Risk diseases. J. Biochem.; 128: 153-159. indicators for alveolar bone loss. J. Kamma J.J.; Nakou M.; Gmür R. and Periodontol.; 66(1):23-9. Baehni P. C. (2004). Microbiological profile Haffajee A.D. and Socransky S.S. (1994). of early onset/aggressive periodontitis Microbial etiological agents of destructive patients. Oral Microbiol. Immunol.; 19(5): periodontal diseases. Periodontol, 2000.; 314-21. 5:78–111. Kazor C. E.; Mitchell P. M.; Lee A. M.; Harley J. P. (2005). Laboratory exercises in Stokes L. N.; Loesche W. J.; Dewhirst F. microbiology, 6th ed. McGraw Hill, New E. and Paster B. J. (2003). Diversity of York, NY. Hasan, R. J. et al. Structure– bacterial populations on the tongue dorsa of function analysis of decay accelerating patients with halitosis and healthy patients. J. factor: identification of residues important Clin. Microbiol.; 41:558–563. for binding of the Escherichia coli Dr Kolenbrander P. E.; Palmer R. J.; adhesin and complement regulation. Infect. Periasamy S. and Jakubovics N. S. (2011). Immun. 70:4485–4493. Oral multispecies biofilm development and Hayashi F.; Okada M.; Oda Y.; Kojima T. the key role of cell cell distance. Nat. Rev. and Kozai K. (2012). Prevalence of Microbiol.; 8: 471-480. Porphyromonas gingivalis fimA genotypes Kumar P. S.; Griffen A. L.; Barton J. A.; in Japanese children. J. Oral Sci.; 54(1):77- Paster B. J.; Moeschberger M. L. and Leys 83. E. J. (2003). New bacterial species Holt S. C.; Kesavalu L.; Walker S. and associated with chronic periodontitis. J. Dent. Genco C. A. (1999). Virulence factors of Res.; 82: 338–344. Porphyromonas gingivalis. Periodontol 2000 Kuriyama T.; Karasawa T.; Nakagawa 20, 168-238. K.; Nakamura S. and Yamamoto E. Hsiao W. W.; Li K. L.; Liu Z.; Jones C.; (2002). Antimicrobial susceptibility of major Fraser-Liggett C. M. and Fouad A. F. pathogens of orofacial odontogenic (2012). Microbial transformation from infections to 11 beta-lactam antibiotics. Oral normal oral microbiota to acute endodontic Microbiol. Immunol.; 17(5):285-9. infections. BMC Genomics; 13:345. Lamont R. J.; Hajishengallis G. M. and Huang X. and Xiao S. (2010). The impact Jenkinson H. F. (2013). Oral Microbiology of fixed orthodontic appliance on gum and Immunology. Washington, D.C., USA: conditions and bacteria of gingival crevicular ASM Press. fluid. China Clin. Prac. Med. 4(1):26-27. Lentino J.R.; Patel J.A. and Pachucki Hugo Lee M. H.; Lawlor M. and Lee A.J. C.T. (1993). Synergy of levofloxacine ( (2015). Abiotrophia defectiva associated Loflaxacine) and oxacillin against quinolone endophthalmitis confirmed with 16s resistant Staphylococcus aureus measured by ribosomal RNA sequencing. J. Glaucoma 24: Time- Kill method. Antmicrob. Agent. and 87-88. Chemother. 37: 339-341. Iwai T. (2009). Periodontal bacteremia and Macfaddin J. F. (2000). Biochemical test for various vascular diseases. J. Periodontal. identification of medical Bacteria. 3rd ed. The Res.; 44: 689-94. Williams and Wilkins. Baltimore USA. Pp: Jorgensen N.; James H. and Turnidge J. 214-289. D. (2015). Susceptibility test methods:

193

AL-Qadisiya Medical Journal Vol.13 No.23 2017

Magno A. F.; C. Enoki; I. Y. Ito; M. A. New Diamond and Frontier Carbon Matsumoto; G. Faria and P. Nelson-Filho Technology; 17(6):281– 288. (2008). In Vivo Evaluation of the Ooshima T.; Nishiyama N.; Hou B.; Contamination of Super Slick Elastomeric Tamura K.; Amano A.; Kusumoto A. and Rings by Strep tococci mutans in Kimura S. (2003). Occurrence of Orthodontic Patients. Am. J. Orthod. periodontal bacteria in healthy children: a 2- Dentofacial Ortho.; 133(4):S104-S109. year longitudinal study. Community Dent. Maley J. and Roberts S. J. (1994). Oral Epidemiol.; 31: 417-425. Characterisation of IS1126 from Palaghias G. (1985). Oral corrosion and Porphyromonas gingivalis W83: a new corrosion inhibition processes. Swed Dent. member of the IS4 family of insertion J.; 30(suppl):39–65. sequence elements. F.E.M.S. Microbiol. Park O. J.; Man Min K.; Jin Choe S.; Kyu Lett.; 123:219–224. Choi B. and Kyun Kim K. (2004). Use of Marsh P. D. (2003). Plaque as a biofilm: Insertion Sequence Element IS1126 in a pharmacological principles of drug delivery Genotyping and Transmission Study of and action in the sub- and supragingival Porphyromonas gingivalis. J. Clin. environment. Oral Dis.; 9:16-22. Microbial.; 42 (2): p 535-541. Maruthamuthu S.; Mohanan S.; Rajasekar A.; Muthukumar N.; Paster B. J.; Boches S. K.; Galvin J. L.; Ponmarippan S.; Subramanian P. and Ericson R. E.; Lau C. N.; Levanos V. A.; Palaniswamy N. (2005). Indian J. Chem. Sahasrabudhe A. and Dewhirst F. E. Technol., (in press). (2001). Bacterial diversity in human McKee A. S.; McDermid A. S.; Baskerville subgingival plaque. J. Bacteriol.; 183: 3770– A.; Dowsett A. B.; Ellwood D. C. and 3783. Marsh P.D. (1986). Effect of hemin on the Peros K.; Mestrovic S.; Anic-Milosevic S. physiology and virulence of Bacteroides and Slaj M. (2011). Salivary microbial and gingivalis W50. Infect. Immun.; 52: 349-355. non-microbial parameters in children with Missailidis C. G.; Umeda J. E.; Ota- fixed orthodontic appliances. Angle Orthod.; Tsuzuki C.; Anzai D. and Mayer M. P. 81:901-6. (2004). Distribution of fimA genotypes of Riep B.; Edesi-Neuss L.; Claessen F.; Porphyromonas gingivalis in subjects with Skarabis H.; Ehmke B.; Flemmig T. F.; various periodontal conditions. Oral Bernimoulin J. P.; Gobel U. B. and Moter Microbiol. Immunol.; 19: 224–229. A. (2009). Are putative periodontal Nishihara, T. and Koseki, T. (2004). pathogens reliable diagnostic markers? J. Microbial etiology of periodontitis. Clin. Microbiol.; 47:1705–1711. Periodontol 2000, 36: 14–26. Roach M. (2007). Base metal alloys used for Ogrendik M.; Kokino S.; Ozdemir F.; dental restorations and implants. Dent. Clin. Bird P. S. and Hamlet S. (2005). Serum North. Am.; 51: 603–627. Antibodies to Oral Anaerobic Bacteria in Ruoff K. L. (1991). Nutritionally variant Patients with Rheumatoid Arthritis". Med. streptococci. Clin. Microbiol. Rev. 4, 184– Gen. Med.; 7(2): 2. 190. Ohara-Nemoto Y.; Tajika S.; Sasaki M. Sato S.; Kanamoto T. and Inoue M. and Kaneko M. (1997) Identification of (1999). Abiotrophia elegans strains comprise Abiotrophia adiacens and Abiotrophia 8% of the nutritionally variant streptococci defectiva by 16S rRNA gene PCR and isolated from the human mouse. J. Clin. restriction fragment length polymorphism Microbiol.; 37: 2553-2556, 0095-1137. analysis. J. Clin. Microbiol.; 35:2458-2463. Scher J. U.; Ubeda C.; Equinda M.; Ohgoe Y.; Hirakuri K. K.; Ozeki K. and Khanin R.; Buischi Y. and Viale A. (2012). Fukui Y. (2007).Investigation of diamond- Periodontal disease and the oral microbiota like carbon coating for orthodontic archwire.

194

AL-Qadisiya Medical Journal Vol.13 No.23 2017 in new-onset rheumatoid arthritis. Toyofuku T.; Inoue Y.; Kurihara N.; ArthitisRheum.; 64: 3083-3094. Kudo T.; Jibiki M.; Sugano N.; Umeda M. Seaver L. C. and Imlay J. A. (2001). Alkyl and Izumi Y. (2011). Differential detection hydroperoxide reductase is the primary rate of periodontopathic bacteria in scavenger of endogenous hydrogen peroxide atherosclerosis. Surg. Today.; 41:1395-400. in Escherichia coli. J. Bacteriol.; 183(24): Tuohy M. J.; Procop G. W. and 7173-7181. Washington J. A. (2000). Antimicrobial Shimoyama Y.; Sasaki M.; Ohara-Nemoto susceptibility of Abiotrophia adiacens and Y.; Nemoto T. K.; Ishikawa T. and Abiotrophia defectiva. Diagn. Microbiol. Kimura S. (2011).Rapid identification of Infect. Dis.; 38:189-91. Abiotrophia/Granulicatella species using by Umeda M.; Miwa Z.; Takeuchi Y.; 16S rRNA PCR and RFLP. Int. Oral Health Ishizuka M.; Huang Y.; Noguchi K.; Sci. 206-208 Tanaka M.; Takagi Y. and Ishikawa I. Socransky S. S. and Haffajee A. D. (1992). (2004). The distribution of periodontopathic The bacterial etiology of destructive bacteria among Japanese children and their periodontal disease: current concepts. J. parents. J. Periodontal. Res.; 39: 398-404. Periodontol.63:322-331. Van Assche N.; Van Essche M.; Pauwels Song Y. (2005). PCR-based diagnostics for M.; Teughels W. and Quirynen M. (2009) . anaerobic infections. Anaerobe; 11: 79–91. Do periodontopathogens disappear after Sroka A.; Sztukowska M.; Potempa J.; fullmouth tooth extraction? J. Clin. Travis J. and Genco C. A. (2001). Periodontol.; 36(12): 1043-1047. Degradation of host heme proteins by lysine- van Winkelhoff A. J.; Loos B. G.; van der and arginine specific cysteine proteinases Reijden W. A.; van der Velden U. (2002). (gingipains) of Porphyromonas gingivalis. J. Porphyromonas gingivalis, Bacteroides Bacteriol.; 183(19):5609–5616. forsythus and other putative periodontal Suvan J; D’Aiuto F; Moles DR; Petrie A pathogens in subjects with and without and Donos N (2011). Association between periodontal destruction. J. Clin. Periodontol.; overweight/obesity and periodontitis in 29(11):1023-8. adults. A systematic review. Obes. Rev. Van Winkelhoff A. J.; Herrera D.; Oteo A. 12(5):e381-404. and Sanz M. (2005). Antimicrobial profiles Syed S. A. and Loesche W. J. (1972). of periodontal pathogens isolated from Survival of human dental plaque flora in periodontitis patients in The Netherlands and various transport media. Appl. Microbiol.; Spain. J. Clin. Periodontol.; 32:893-8. 24(4): 638-644. Versalovic J.; Carroll K. C.; Funke G.; Takahashi N. and Schachtele C. F. (1990). Jorgensen J.H.; Landry M. L. and Effect of pH on growth and proteolytic Warnock D. W. (2011). Manual of clinical activity of Porphyromonas gingivalis and microbiology. 10th ed. Washington, D.C.; Bacteroides intermedius. J. Dent. Res. 69(6): ASM Press: 365-76. 1244- 1248. von Wintzingerode F.; Gobel U. B. and Tamura K.; Nakano K.; Nomura R.; Stackebrandt E. (1997). Determination of Miyake S.; Nakagawa I.; Amano A. and microbial diversity in environmental Ooshima T. (2005). Distribution of samples: pitfalls of PCR-based rRNA Porphyromonas gingivalis fimA genotypes in analysis. F.E.M.S. Microbiol. Rev.; 21: 213– Japanese children and adolescents. J. 229. Periodontol.; 76: 674-679. Wang J.; Zhang Y. and Xiao S. (2011). The Topaloglu-Ak A.; Ertugrul F.; Eden E.; changes of the bacterial ecology and ALP Ates M. and Bulut H. (2011). Effect of activity in gingival crevicular fluid during orthodontic appliances on oral microbiota - 6 orthodontic treatment. Stomatol.; 31(9):531- month follow-up. J. Clin. Pediatr. Dent.; 535. 35:433-6.

195

AL-Qadisiya Medical Journal Vol.13 No.23 2017

Weisburg W. G.; Barns S. M.; Pelletier D. Zhao L.; Wu Y. F.; Meng S.; Yang H.; A. and Lane D. J. (1991). 16S ribosomal OuYang Y. L. and Zhou X. D. (2007). DNA amplification for phylogenetic study. J. Prevalence of fimA genotypes of Bacteriol. 173:697– 703. Porphyromonas gingivalis and periodontal Woo P. C.; Fung A. M.; Lau S. K. (2003). health status in Chinese adults. J; Granulicatella adiacens and Abiotrophia Periodontal. Res.; 42: 511-517. defective bacteraemia characterized by 16S Zijnge V.; van Leeuwen M. B.; Degener J. rRNA gene sequencing. J. Med. Microbiol.; E.; Abbas F.; Thurnhee T.; Gmur R. and 52:137-40. Harmsen H. J. (2011). Oral biofilm Yu J. H.; Wu L. C.; Hsu J.T.; Chang Y. architecture on natural teeth. PLoS ONE 5: Y.; Huang H. H. and Huang H. L. (2011). 9321. Surface roughness and topography of four commonly used types of orthodontic arch wire. J. Med. Biol. Eng.; 31(5): 367-70.

196