PI3K Regulates YAP/TAZ in Mammary Tumorigenesis Through Multiple Signaling Pathways

Author Manuscript Published OnlineFirst on March 15, 2018; DOI: 10.1158/1541-7786.MCR-17-0593 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Research article

PIK3CB positively regulates YAP and TAZ in mammary tumorigenesis

through multiple signaling pathways

Yulei Zhao1, Tess Montminy1,3, Taha Azad1,3, Elizabeth Lightbody1.3, Yawei Hao1, Sandip SenGupta1, Eric Asselin2, Christopher Nicol1, Xiaolong Yang1*

1. Department of Pathology and Molecular Medicine, Queen’s University, Kingston, ON, K7L 3N6, Canada 2. Department of Medical Biology, University of Quebec at Trois-Rivieres, 3353 boul. des Forges, C.P. 500, Trois-Rivieres, Que., G9A5H7, Canada 3. Equal contribution

*Correspondence: Dr. Xiaolong Yang Tel: +1 613-533-6000 x75998; Fax: +1 613-533-2970 E-mail: [email protected] Running title: PI3K regulates YAP and TAZ in mammary tumorigenesis Key words: PIK3CB, PIK3CA, YAP, TAZ, breast cancer Article category: signal transduction The authors declare no potential conflicts of interest.

Downloaded from mcr.aacrjournals.org on October 1, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on March 15, 2018; DOI: 10.1158/1541-7786.MCR-17-0593 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Abstract

Breast cancer (BC) is a leading cause of death in women worldwide. Active mutations of

PI3K catalytic subunit PIK3CA (e.g., H1047R) and amplification of its homolog PIK3CB are observed in a large number of BCs. In recent years, aberrant activation of Transcriptional coactivator with PDZ binding motif (TAZ) and its paralog Yes-associated protein (YAP) have

also been found to be important for BC development and progression. However, whether PI3K

interacts with YAP/TAZ during mammary tumorigenesis is unknown. Through a systematic

gain-of-function screen for kinases involved in mammary tumorigenesis, we identified PIK3CB

as a transformation-inducing kinase in breast cells. We further determined that PIK3CB

positively regulates YAP and TAZ to promote transformation and inhibit mammary cell death in

vitro. PIK3CB co-expression with TAZ, rather than PIK3CB or TAZ alone, in human MCF10A

non-tumorigenic mammary cells is sufficient for tumor formation in mice in vivo. Interestingly,

we also determined that PIK3CA-H1047R enhances YAP and TAZ activity in mammary

tumorigenesis in vitro. Mechanistically, the regulation of YAP/TAZ by both PIK3CA and

PIK3CB occurs through multiple signaling pathways including LATS-dependent and LATS-

independent pathways. Therefore, in this study we determine that PI3K and YAP/TAZ interact to

promote breast cancer cell transformation.

Implications: This study provides the first evidence that the Hippo pathway effectors TAZ and

YAP are critical mediators of PI3K-induced mammary tumorigenesis and synergistically

function together with PI3K in transformation of mammary cells. These findings may provide a

novel rationale for targeting YAP/TAZ alone or in combination with PI3K inhibitors for breast

cancer therapy in the future.

1. Introduction

BC is one of the most frequently diagnosed cancers in women worldwide, accounting for

25% of all cancer cases and 15% of cancer mortalities in women (1). PIK3CA, a catalytic subunit of PI3K, is one of the most frequently mutated genes identified in BCs (2). One of the most common and best-characterized mutations of PIK3CA identified in BC is H1047R in the kinase domain (3), which causes increased catalytic activity. PIK3CB, another major catalytic subunit of PI3K, is also aberrantly activated in BC cells however this is more commonly found to occur secondary to overexpression and/or gene amplification (3). Regardless of the mechanism, both the PIK3CA-H1047R mutation and PIK3CB overexpression result in hyper- activation of PI3K, enabling further exertion of its oncogenic functions (e.g., cell proliferation, anti-apoptosis and angiogenesis) through the PI3K-PDK1-AKT (PI3K-AKT) signaling pathway

(4). In this pathway, the activation of PI3K can phosphorylate PI (3,4) P2 into PI (3,4,5) P3, which then interacts with PDK1 and AKT, recruiting them to the inner leaflet of the cell membrane, where PDK1 phosphorylates and activates AKT. Activated AKT subsequently phosphorylates a variety of downstream genes to cause increased cell proliferation, diminished apoptosis, and other oncogenic functions (4,5). Moreover, the activation of the PI3K-AKT pathway is frequently correlated with resistance to various anti-cancer therapies (6–8). Given this, many studies have been carried out to develop agents inhibiting PI3K-AKT for cancer treatment (3,5,9–12). Unfortunately, the existing drugs targeting the PI3K-AKT pathway often result in the development of drug resistance (13), through unknown mechanisms. More studies are therefore necessary in order to discern the molecular network of PI3K in BC development and progression in order to design more efficient strategies for the treatment of PI3K-involved

BC.

YAP and its paralog TAZ, two well-known transcriptional coactivators and effectors of

the Hippo pathway, are involved in tumorigenesis of BC (14–17). Through interactions with

transcription factors of the TEAD family, YAP and TAZ can induce transformation and

epithelial-mesenchymal transition (EMT) of human immortalized mammary epithelial MCF10A cells (18,19) as well as cellular resistance to chemotherapeutic drugs such as Taxol and

Doxorubicin (16–18,20). YAP/TAZ are negatively regulated by the Hippo signaling pathway. In

this pathway, MST1/2 serine/threonine (S/T) kinases, the mammalian homologs of Drosophila

Hippo, phosphorylate and activate LATS1/2. LATS1/2 subsequently phosphorylate S127/S89 of

YAP/TAZ and prevent them from translocating to the nucleus to activate transcription of downstream genes (19,21,22). Although an increasing number of negative regulators of YAP and

TAZ have been identified (23–31), there are few known positive regulators of YAP and TAZ.

Recent studies have found that PIK3CA can positively regulate YAP in response to mitogen

signals such as EGF treatment (32). Furthermore, coactivation of PIK3CA and YAP has been

shown to promote liver carcinogenesis in mice and in human patients (33). However, the

signaling pathway mediating the regulation of YAP by PIK3CA is not clear. PIK3CB has been

found to be a major target of YAP in cardiomyocyte proliferation and survival (34), but there is

currently no evidence showing PIK3CB can regulate YAP in tumorigenesis. Therefore, the role

of PIK3CA/B in regulation of YAP and its paralog TAZ in mammary tumorigenesis is not yet

known.

In this study, we performed a systematic gain-of-function screening of kinases involved

in mammary tumorigenesis. PIK3CB was identified as a kinase of interest. We further

determined that PIK3CB positively regulates YAP and TAZ to promote mammary tumorigenesis

both in vitro and in vivo. Similarly, PIK3CA-H1047R was found to positively regulate YAP and

TAZ in mammary tumorigenesis. This study implicates YAP/TAZ in PI3K-related BC and provides a new rationale for targeting YAP/TAZ for BC treatment.

2. Materials and Methods

2.1 Cell culture

HEK293, SK-BR3, MCF10A were purchased from ATCC about 10 years ago. Passages

10-20 for HEK293, SK-BR3 and passages 105-115 for MCF10A were used in our experiment;

HEK293A, HEK293A-LATS1/2-knockout (LATS-KO), HEK293A-MST1/2-KO (MST-KO) were generously provided by Dr. Kunliang Guan, passages 20-30 were used for our experiment;

HCT116, HCT116-AKT-KO cells were gifts from Dr. Bert Vogelstein; MMTV-NIC cells were provided by Dr. Christopher Nicol. No authentication and Mycoplasma tests have been performed for all cell lines. HEK293, HEK293A, HEK293A-LATS1/2-knockout (LATS-KO),

HEK293A-MST1/2-KO (MST-KO) and HEK293T cells were cultured in Dulbecco’s Modiﬁed

Eagle complete medium (DMEM) (Sigma-Aldrich) supplemented with 10 % heat-inactivated fetal bovine serum (FBS) (Sigma-Aldrich) and 1% penicillin/streptomycin (P/S). Sub-cultivation was performed every 3 days at the ratio of 1:10. SK-BR3 and HCT116, HCT116-AKT-KO cells were maintained in McCoy’s 5A Modified Media (Sigma-Aldrich) with 10% FBS and 1% P/S added. Cells were passed every 3 days at the ratio of 1:3-1:10. MMTV-NIC and MCF10A

(human immortalized mammary epithelial cells) were cultured in DMEM/Nutrient Mixture F12

Ham (Sigma-Aldrich) supplemented with 5% horse serum (HS) (Invitrogen), 200 µg/mL human epidermal growth factor (hEGF), 5 mg/mL hydrocortisone, 2 mg/mL insulin, 200 mM L-

Glutamine, 1mg/mL cholera toxin, and 1% P/S. Cells were maintained in a 37 0C incubator with

5% CO2. Cells were normally sub-cultivated every 4 days with ratio of 1:10. All cell lines were cultured less than 2 months for experiments.

2.2 Plasmids construction and site-direct mutagenesis

PIK3CB cDNA was amplified from a human kinase open reading frame (ORF) library

(KOL, Addgene kit # 1000000014) with a FLAG tag in the forward primer and cloned into

BamHI/MluI site of the WPI vector (containing hygromycin B resistant gene) or BamHI/NotI

site of the pcDNA3 vector. PIK3CB-D937A was generated through site-directed mutagenesis.

Primers used are as follows: PIK3CB forward primer: 5’-

GAAGATCTACCATGGACTACAAAGACGATGACGACAAG

ATGTGCTTCAGTTTCATAATG-3’ (BglII cut site is underlined, FLAG tag is in italics);

reverse primer: GTAATCATGCGGCCGCCGACGCGT TTAAGGTCCGTAGTCTTT

CCGAAC (NotI cut site is underlined, MluI cut site is in italics; PIK3CB-D937A forward primer:

CAGCTCTTCCACATTGCCTTTGGACATATTCTT; reverse primer:

AAGAATATGTCCAAAGGCAATGTGGAAGAGCTG (mutation site is underlined).

PIK3CA-H1047R-pBabe plasmid was a gift from Dr. Leda Raptis. PIK3CA was amplified from

Myr-PIK3CA-pLNCX plasmid (gift from Dr. Raptis) using PCR and cloned into pcDNA3 at

BamHI and NotI sites. PIK3CA-D933A was generated through site-directed mutagenesis and

cloned into pcDNA3 vector. Myr-AKT1, Myr-ATK2 and AKT2-KD (kinase dead) plasmids

were provided by Dr. Eric Asselin; PDK1-WT, PDK1-KD (K110N), PDK1-ΔPH (PH domain

deletion) plasmids were generous gifts from Drs. Paolo Armando Gagliardi and Luca Primo

(35,36) .

2.3 Modification and production of kinase overexpressing library (KOL)

The human kinase ORF library was purchased from Addgene (Kit #1000000014), which contains 558 human kinase ORFs in the pDONR-223 Gateway® Entry vector in six 96-well plates with each well containing one kinase in bacteria. To further modify the library, 1 µL from

each well of kinase was mixed together to make a pool of whole human kinase ORFs before

being spread onto 10×150 mm spectinomycin-containing (50 µg/mL, Sigma) LB plates.

Bacterial colonies were directly scraped off the LB plates to avoid over-representation of certain

kinases during liquid culture, then subjected to Midiprep (Qiagen) for plasmid extraction. The

kinase cDNAs from the ORF library were subsequently transferred from entry vector (pDONR-

223) into V5-tagged expression vector pLX304 through Gateway LR ligations (Invitrogen)

according to the manufacturer’s protocol. Plasmids were then electroporated into competent cells

(Lucigen) and grown on 10×150 mm LB plates with ampicillin (100 µg/mL). KOL plasmids

were collected by Midiprep. The newly established KOL was further validated by amplifications

of several kinase ORFs in the library by PCR (data not shown).

2.4 Virus production, infection and establishment of MCF10A stable cell lines

Retroviral and lentiviral production, titration and infection of overexpressing constructs

were as described (22). To knock down YAP and TAZ in MCF10A-WPI and MCF10A-

PIK3CB-WPI cells, sgRNAs targeting YAP and TAZ were cloned in lentiCRISPRv2.0 (a gift from Dr. Feng Zhang, Addgene plasmid #52961) and were used for producing lentivirus to infect

the cells. MCF10A-PIK3CA-H1047R was established through retroviral infection.

Overexpression of TAZ in MCF10A-PIK3CB and MCF10A-PIK3CA-H1047R was established

by infecting MCF10A-PIK3CB and MCF10A-PIK3CA-H1047R with TAZ-WPI lentivirus. For

the establishment of MCF10A cells stably expressing KOL, MCF10A cells were infected with

KOL lentivirus at a multiplicity of infection (MOI) of 0.3 with a 100-fold coverage (100 cells

infected with virus expressing each kinase). Infected cells were selected with blasticidin (10

µg/mL) for five days.

2.5 RNA extraction and quantitative reverse transcriptase PCR (qRT-PCR)

RNA extraction and qRT-PCR were as described (22). mRNA expression levels of experimental cells were normalized to control cell lines. Results are represented as fold change.

2.6 Antibodies, protein extraction, western blotting (WB) and co- immunoprecipitation (co-IP)

Protein extraction and western blotting were as described (22). Antibodies targeting

YAP and CYR61 are from Santa Cruz (SC), 1:1000; antibodies against p-YAP-S127, S6K, pS6K, AKT1, AKT2, pAKT, PIK3CA, PIK3CB, LATS1, cleaved-PARP, MST1 and MST2 are from Cell Signaling (CS), 1:1000; LATS2 antibody used is from Bethyl Laboratories (1:2500);

TAZ antibody is from BD Biosciences (1:1000); FLAG and HA antibodies are from Sigma

(1:1000). For co-IP, HEK293 cells with different transfections were grown to 85% confluency and were lysed in NP40 lysis buffer (50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% NP40, 10% glycerol, dH2O) with complete EDTA-free protease inhibitor (Roche) added. Lysates were incubated overnight with protein A or G agarose beads (Roche). Immunoprecipitates were subsequently analyzed by western blot.

2.7 Cell proliferation and anoikis assays

For cell proliferation assay, a triplicate of 1×103 MCF10A-WPI, TAZ, PIK3CA,

PIK3CB, PIK3CA-TAZ and PIK3CB-TAZ cells were seeded into each well of 24-well plates.

Cell numbers were counted on days 1, 3, 4, 5, and 6 after plating. Data are shown as mean ±S.D. and experiments were repeated at least three times.

For anoikis cell death analysis, triplicates of 2x105 cells were plated into ultra-low attachment flask (Corning) and culture for 60 hours. 1/10 of the floating cells were taken for trypan blue cell viability assay. The remaining cells were lysed and used for western blot to check expression of apoptotic marker cleaved-PARP.

2.8 Soft agar assay

MCF10A cells stably overexpressing KOL (1×105 cells / 100 mm plate) or WPI control,

TAZ-WPI, PIK3CB-V5, PIK3CB-V5-WPI, PIK3CB-TAZ-WPI, PIK3CA-H1047R or PIK3CA-

H1047R-TAZ-WPI (2×104 cells/well of 6-well plate) were plated in complete media containing

0.4% agarose overtop of a 0.8% agarose layer. Medium was refreshed every three days. At around 20-30 days, colonies were visible. For screening purposes, single colonies were picked with a P-10 tip and transferred into single wells of 96-well plate for further cell growth. These cells were passed to bigger plates when they were confluent. For soft agar assays with other cell lines, colonies were stained with crystal violet (0.005% crystal violet in 20% methanol). Pictures of these stained colonies were further captured under white light using the Bio-Rad Gel Doc

System (Bio-Rad) and quantified using Quantity one software. Counted colonies were averaged and summarized in data bars. Data was statistically analyzed with unpaired student t test, where

“*” indicates P value is less than 0.05. The experiments were repeated at least twice.

2.9 Luciferase assay

Triplicates of either HEK293, HEK293A-related cells, HCT116-related cells (5×105 cells/well of 12-well plate) or SK-BR3 (6×104 cells/well of 12-well plate) were transfected with

CYR61-luc (0.1 µg), super TEAD binding site (STBS)-luc (0.1 µg) alone or together with other plasmids (0.4 µg) using Polyjet (SignaGen). In addition, 10 ng of Renilla luciferase vector (pRL-

TK) was cotransfected in each sample as an internal transfection control. Approximately 40 hours post transfection, luciferase activity was measured with the Dual Luciferase Reporter

Assay System (Promega) and Turner Biosystems 20/20 luminometer. Fold change values were calculated by normalizing experimental samples to controls transfected with reporter plasmids alone.

3.0 In vivo tumorigenesis assay

A xenograft mouse model was used to evaluate the tumor formation of a variety of

transformed MCF10A cells; MCF10A/TAZ, MCF10A/PIK3CA, MCF10A/PIK3CB,

MCF10A/PIK3CA+TAZ and MCF10A/PIK3CB+TAZ. A total of 4×106 cells suspended in 200

µL of cold PBS and GFR phenol-red free Matrigel (1:1 dilution) were injected subcutaneously

(s.c.) into the flanks of twelve-week old Rag2-/-;Il2rg-/- mice (n=3/group). General health of

these animals and palpable tumor volume was assessed twice a week. Six weeks post injection,

mice were sacrificed and tumors were harvested. Tumors were fixed in formaldehyde, paraffin-

embedded and sectioned for hematoxylin and eosin (H&E) staining and immunohistochemical

(IHC) analysis. All procedures were approved by the Queen’s Animal Care Committee in

accordance with Canadian Council on Animal Care guidelines.

3.1 Immunohistochemistry analysis

Formalin-fixed paraffin-embedded (FFPE) tumor tissues were sectioned at the thickness

of 3-4 m and were stained by the Discovery XT Automated IHC/ISH research slide staining

system (Ventana Medical Systems, Inc.). For pathology analysis, sections were stained with

H&E. For IHC, antigens were retrieved with EDTA (pH=8) solution, blocked by 1% Bovine

Serum Albumin (BSA, Fraction V), and incubated with mouse monoclonal anti-TAZ antibody

(1:2500 dilution, BD Biosciences) or rabbit monoclonal anti-PIK3CB (1:100 dilution, Abcam) antibody. As a control for specificity, one slide was processed with the same IHC conditions without a primary antibody. IHC signals were developed by using biotinylated HRP-conjugated anti-mouse or anti-rabbit secondary antibody, respectively, followed by catalyzing 3,3’-

diaminobenzidine (DAB) substrate-chromogen into a visible precipitate. Slides were scanned

and the images were uploaded to Spectrum system for picture capture and analysis.

3.2 Statistics analysis

Statistical significance was determined using an unpaired student’s t-test. A p value less

than or equal to 0.05 is considered as significant. “*” indicates p value is < 0.05.

3. Results

3.1 PIK3CB is identified in a kinase gain-of-function screen in mammary tumorigenesis

To screen for kinases causing transformation in mammary cells, we established a

heterogeneous population of non-tumorigenic MCF10A mammary cells infected with a kinase

overexpression (KOL) library. After antibiotic selection, surviving cells were subjected to soft

agar assay to assess cellular transformation. Thirty days after culture, colonies representing

transformed clones became visible. Single colonies were isolated and expanded. Protein lysates

were collected from each clonal cell line of interest and the identity of the transformation-

inducing kinase was determined by immunoprecipitation using a V5 antibody and mass

spectrometry (MS).

Among the kinases detected by MS, PIK3CB was identified as the transformation-

inducing kinase in two different clonal cell lines. PIK3CB is a catalytic subunit belonging to

PI3K family class IA (3). Given that the mechanisms underlying PIK3CB-induced mammary tumorigenesis are largely unknown, we chose to further evaluate the function of this kinase in our cell lines.

To confirm the results of our screen, we first subjected cells from the two PIK3CB-

overexpressing colonies (MCF10A-PIK3CB-V5-C-1/C-2) to soft agar assay alongside a control cell line. After 20 days of culture, colonies of MCF10A-PIK3CB-C-1/C-2 cells were visible

(Fig. 1A-B). Thus, PIK3CB indeed enhances anchorage-independent growth of MCF10A cells.

3.2 PIK3CB positively regulates YAP and TAZ

We have previously found that overexpression of the Hippo transducers YAP and TAZ is also sufficient for MCF10A cellular transformation. Indeed, YAP/TAZ overexpression in

MCF10A results in similar tumorigenic phenotypes to PIK3CB overexpression in MCF10A cells

(18,37). Thus, we next investigated whether PIK3CB might promote mammary tumorigenesis

through modulation of YAP and TAZ function.

As previously described YAP and TAZ are translocated to nucleus after activation.

Therefore, we first investigated whether PIK3CB overexpression might affect translocation of

YAP/TAZ into the nucleus. Wild-type MCF10A (MCF10A-WT) and MCF10A-PIK3CB-C-1

cells were fixed and the subcellular locations of YAP/TAZ were examined through indirect

fluorescence staining. PIK3CB dramatically increased YAP/TAZ nuclear localization (Fig. 1C,

S-Fig. 1A-B, S-Fig. 2A-B), suggesting that YAP and TAZ may be activated after PIK3CB

overexpression.

To further test this hypothesis, we evaluated YAP/TAZ transcriptional co-activation

using promoter reporter assays. First, a promoter reporter containing 14 TEAD DNA-binding sequences (STBS) upstream of a luciferase gene (STBS-luc) was used (38). PIK3CB was

cotransfected with STBS-luc into HEK293A. Notably, PIK3CB significantly increased STBS-

luc luciferase activity (Fig. 1D). We also examined the effect of PIK3CB on the promoter of

CYR61—a YAP/TAZ target gene that we have previously characterized (17). Consistent with

what was observed using STBS-luc, PIK3CB activates the CYR61 promoter (Fig. 1E). Similar

results were obtained in a BC cell line, SK-BR3 (Fig. 1F). Finally, we also determined that

PIK3CA active mutant (PIK3CA-H1047R) enhances CYR61 promoter activity (Fig. 1G).

Therefore, both PIK3CA and PIK3CB positive regulate YAP/TAZ.

To confirm that PIK3CA/B modulates YAP/TAZ function, we tested whether loss of

PIK3CA/B reduces YAP/TAZ activity. We treated MCF7 BC cells with a PI3K inhibitor,

GDC0941, and assessed YAP S127 phosphorylation (YAP-pS127; LATS phosphorylation site).

Interestingly, the PI3K inhibitor abolished the phosphorylation of two known PI3K downstream

targets, AKT and S6K, and increased YAP-S127 phosphorylation (Fig. 2A). Likewise, genetic

knockout of both PIK3CA and PIK3CB using CRISPR-Cas9 in HEK293A cells also increased

phosphorylation of YAP at S127 (Fig. 2B). Furthermore, PI3K inhibitor treatment suppressed

PIK3CB-induced nuclear-translocation of YAP/TAZ in MCF10A-PIK3CB cells (Fig. 2C, S-Fig.

1-B, S-Fig. 2A-B). Thus, inhibition of PIK3CA/B regulates YAP phosphorylation status and

YAP/TAZ subcellular localization, suggesting that the activation of PIK3CA/B decreases LATS- induced inhibitory phosphorylation of YAP/TAZ.

In order to further examine the relationship between PI3K and YAP/TAZ, we evaluated

YAP/TAZ status in cells with endogenous activation of PI3K. Previous studies have shown that

PI3K is activated in cells with HER2 overexpression (39). Therefore, we used cells isolated from

tumors formed in an MMTV-driven HER2-overexpresion BC mouse model (MMTV-NIC). In

this model, overexpression of HER2 increased AKT phosphorylation/activation (Fig. 2D) and

caused YAP/TAZ to be localized in the nucleus in a PI3K-dependent manner (Fig. 2E, S-Fig.

1C, S-Fig. 2C-D).

3.3 PIK3CB activates YAP/TAZ through their kinase activities

PI3K kinase activity is critical for its functions in the PI3K-AKT pathway. To examine if

regulation of YAP/TAZ by PI3K depends on its kinase activity, we generated MCF10A cell lines stably overexpressing wild-type PIKCB (PIK3CB-WT) and a kinase-dead construct of PIK3CB

(PIK3CB-D937A). As shown in Fig. 3A, overexpression of PIK3CB-WT, but not PIK3CB-

D937A, reduced pS127-YAP and upregulated CYR61 expression (Fig. 3A-B). Similarly,

PIK3CB-D937A and kinase-dead PIK3CA (PIK3CA-D933A) could not activate the CYR61

promoter in HEK293 (Fig. 3C). Therefore, PIK3CA/B regulate YAP and TAZ through their

kinase activity.

3.4 PIK3CB activates TAZ/YAP through PDK1 and AKT

As previously described, PI3K signals through PDK1 and AKT to regulate tumorigenesis

(5). Therefore, we examined whether PIK3CB regulates YAP and TAZ through PDK1 and AKT.

PDK1 inhibition dramatically reduced PIK3CA/PIK3CB-induced activation of the CYR61-luc construct (Fig. 4A-B). Unfortunately, we failed to establish stable HEK293 or HEK293A cell

lines with PDK1 CRISPR knockout, possibly due to the essential functions of PDK1 in

HEK293A/HEK293 cells. Nonetheless, we further examined how PDK1 regulates YAP/TAZ

using MCF10A cell lines stably overexpressing wild type (MCF10A-PDK1-WT), membrane

binding domain deletion (MCF10A-PDK1-ΔPH) or kinase-dead PDK1 (MCF10A-PDK1-KD)

(Fig. 4C). Immunofluorescent staining indicates that YAP nucleus localization is dramatically

increased in PDK1 and PDK1-ΔPH overexpressing MCF10A cells but decreased in MCF10A-

PDK1-KD (Fig. 4D-E), suggesting that PDK1 regulates YAP and TAZ through its kinase

activity. Consistent with this, PDK1-KD showed reduced CYR61-luc reporter activity compared

to the wild type and PDK1-ΔPH constructs (S-Fig. 3A). Therefore, PDK1 kinase activity plays an essential role in the regulation of YAP/TAZ.

Next, we explored signaling downstream of PDK1 through AKT. AKT knockout in

HCT116 colon cancer cells reduced PI3KCA/B-induced activation of the CYR61-luc reporter

(Fig. 5A-B). Interestingly, AKT knockout in this cell line decreased but did not abolish

activation of the reporter by PIK3CA/B suggesting either AKT knockout is incomplete in this model or that AKT is not the sole factor downstream of PI3K that regulates YAP/TAZ.

We further examined whether the upstream kinases of the Hippo pathway (MST and

LATS) are essential for PIK3CA/B-induced activation of YAP/TAZ. We cotransfected PIK3CA-

H1047R or PIK3CB with CYR61-luc into HEK293A-WT, HEK293A-MST knockout (MST-KO) or HEK293A-LATS knockout (LATS-KO) cell lines (Fig. 5C-D). As shown in Fig. 5E,

PIK3CA/B-induced CYR61 promoter activity in HEK293A-MST-KO cells was similar to that in

HEK293A-WT cells (Fig. 5E), suggesting that PI3K activates YAP/TAZ activity independent of

MST. Surprisingly, PIK3CA/B-induced activation of CYR61 promoter activity was enhanced

rather than abolished in LATS-KO cells (Fig. 5E), suggesting that PI3K may also activate

YAP/TAZ through other proteins in the absence of LATS.

To further elucidate the signaling between PDK1, AKT, MST and LATS, we

cotransfected AKT1 and PDK1 alongside CYR61-luc into HEK293A-WT, LATS-KO and MST-

KO cells. Interestingly, AKT showed no activation of the reporter in HEK293A-WT cells and

only marginal activation in MST-KO cells, but did show dramatic activation in LATS-KO cells

(Fig. 5F). Indeed, cotransfection of AKT1 with YAP increased YAP levels in LATS-KO cells

but not in WT cells (Fig. 5G). This suggests that LATS suppresses the function of AKT in

YAP/TAZ regulation. However, PDK1 showed similar activation of the reporter in both WT and

MST-KO cells (Fig. 5F), suggesting that MST does not mediate PDK1 activation of YAP/TAZ.

Like AKT, PDK1 induced dramatic activation of YAP/TAZ reporter in LATS-KO cells (Fig.

5F), which is consistent with the result of PI3K-induced activation of YAP/TAZ reporter in

LATS-KO cells (Fig. 5E), suggesting there exists a PI3K-PDK1-AKT-dependent signal

activating YAP/TAZ, which is antagonized by LATS.

The observation that PDK1 but not AKT activated the reporter in WT cells indicates

there are likely other components in addition to AKT mediating the effect of PDK1 on

YAP/TAZ. Since PDK1 affects subcellular localization of YAP/TAZ (Fig. 4D-E), we

investigated whether there is any interaction between PDK1 and LATS (independent of AKT) in

YAP/TAZ regulation. LATS and YAP were cotransfected with different PDK1 constructs and

binding between these proteins was assessed by co-IP. Although differences in PDK1 constructs

did not affect binding between LATS and YAP, we noted that YAP-S127 phosphorylation by

LATS is decreased in PDK1-expressing cells (S-Fig. 3B-D). Thus PDK1 can activate YAP

through LATS.

Given that AKT also seems to be involved in PI3K-PDK1-YAP/TAZ signaling (Fig. 5A-

B) and activates YAP/TAZ in LATS-KO cells (Fig. 5F), we tested whether AKT and LATS

interact. LATS1 or LATS2 expression were not affected by co-expression of AKT1, AKT2 or

AKT2-kinase dead (KD) constructs in HEK293 (S-Fig. 4A). Moreover, we did not observe any

differences in LATS1 or LATS2 phosphorylation phospho-tag resolving gel (S-Fig. 4B). Thus, it

is unlikely that AKT directly interacts with LATS to affect the activation of YAP/TAZ.

The interactions between PI3K, PDK1, AKT, LATS, YAP/TAZ may be further

complicated by feedback pathways. Indeed, it has been shown that overexpression of YAP/TAZ

upregulates LATS activity, which in turn suppresses YAP/TAZ function (40). Thus, it is possible

that in LATS WT cell lines, the increased YAP expression by AKT1 triggers the activation of

LATS, which in turn inhibits YAP activation, such that YAP activity appears unaltered.

However, in LATS-KO cells, this feedback loop is disrupted such that YAP expression levels are not suppressed by LATS, leading to activation of YAP by AKT1. To test this hypothesis, we

transfected YAP5SA—a YAP construct with all five LATS phosphorylation sites mutated—

alongside AKT1 into LATS-WT cells As expected, AKT1 increased YAP5SA expression in

these cells (Fig. 5H). These results are consistent with a model in which AKT1 can activate

YAP by increasing YAP expression levels, and that activated YAP can trigger LATS expression,

which in turn inhibits YAP function. This signaling may also explain why AKT1 dramatically increases CYR61-luc activity in LATS-KO cells but not in WT cells.

We next set out to determine whether AKT1 kinase regulates the expression of YAP

through phosphorylation. We chose to use YAP5SA to test for phosphorylation by AKT to avoid

confounding signals due to basal phosphorylation of YAP by LATS (S-Fig. 5A). Interestingly,

no YAP phosphorylation was detected with AKT1 coexpression in HEK293, suggesting the

regulation of YAP by AKT1 is not due to phosphorylation (S-Fig. 5A). Moreover, we did not

observe any direct binding between AKT1 and YAP/YAP5SA (S-Fig. 5B-C) or AKT1 and

TAZ/TAZ4SA (S-Fig. 5C-D) indicating that AKT1 regulates YAP/TAZ indirectly. Thus, further studies will be required to understand the precise mechanisms of AKT1-induced YAP

upregulation.

3.5 YAP and TAZ mediate PIK3CB-induced mammary tumorigenesis

To further confirm that YAP and TAZ play essential roles in mediating PIK3CB

functions, we knocked out YAP and TAZ in MCF10A-PIK3CB-WPI cells to generate MCF10A-

PIK3CB-WPI-sgYAP/TAZ (S-Fig. 6A). Significantly, YAP/TAZ double knockdown

dramatically decreased PIK3CB-induced anchorage-independent growth of MCF10A cells (Fig.

6A-B). Similar results were obtained using MCF10A-PIK3CA-H1047R cells (S-Fig. 6B-D).

Conversely, TAZ overexpression in MCF10A-PIK3CA-H1047R and MCF10A-PIK3CB cells

(S-Fig. 6E) increased both PIK3CA- and PIK3CB-induced anchorage-independent growth of

MCF10A cells (Fig. 6C-D). Likewise, MCF10A with TAZ and PI3K coexpression significantly

increased cell proliferation compared to MCF10A expressing either construct alone (Fig. 6E-F).

Moreover, TAZ coexpression with PIK3CA or PIK3CB significantly decreased cell death as

demonstrated by trypan blue assay and cleaved-PARP (c-PARP) expression when these cells

were cultured in ultra-low attachment flask, suggesting coexpression of TAZ and PI3K decreases

anoikis (Fig. 6G-H). Finally, we tested whether coexpression of TAZ and PI3K was sufficient

for tumorigenesis in vivo. Notably, MCF10A-PIK3CB-TAZ cells formed tumors after 6 weeks in

immunocompromised mice (Fig. 7A). These tumors had strong expression of both TAZ and

PIK3CB and resembled a high-grade poorly differentiated mammary carcinoma in pathological

appearance.

Collectively, these results show that TAZ and PI3K synergistically increase malignant

cell phenotypes and that YAP and TAZ are functional components mediating PI3K-induced

mammary tumorigenesis.

4. Discussion

YAP and TAZ are negatively regulated by LATS in the Hippo pathway (19,21,22).

Mounting evidence suggests that YAP and TAZ can be also negatively regulated by other

proteins, such as AMOT (41), α-catenin (24) and Cdk1 (30,31). To date, a limited number of

positive regulators of YAP and TAZ have been identified. In this study, we identified novel

positive regulation of YAP and TAZ by kinase PIK3CB and its homolog PIK3CA. Moreover, we

found that the activation of YAP and TAZ by PIK3CA and PIK3CB occurs through PI3K-

PDK1-AKT signaling, in which AKT positively regulates the expression level of YAP to affect

its activation status (Fig. 7B). This regulation was also affected by the negative feedback regulation between YAP/TAZ and LATS. In LATS-KO cells, which have no negative feedback,

PI3Ks, PDK1 and AKT1 dramatically increased YAP/TAZ activity (Fig. 5E-F). Interestingly,

we found that the regulation of YAP by AKT does not occur through direct phosphorylation (S-

Fig. 5A). No direct interaction between AKT1 and YAP/TAZ was found (S-Fig. 5B-D), suggesting an indirect regulation of YAP by AKT. Therefore, more studies are required to

discern the exact mechanism by which AKT regulates YAP expression levels.

We also found that PDK1 inhibition abolished PI3K-induced YAP/TAZ activation (Fig.

4A), indicating that PDK1 is the major downstream player in PI3K regulation of YAP/TAZ.

However, unlike AKT1, both PI3Ks and PDK1 activated YAP/TAZ activity in HEK293A-WT

cells, which have intact LATS-YAP/TAZ negative feedback regulation (Fig. 5E-F). Therefore,

PDK1 may negatively regulate LATS to affect the negative feedback regulation. This notion was

supported through co-IP experiments, in which PDK1 coexpression decreased LATS

phosphorylation of YAP without affecting the interaction of LATS and YAP (S-Fig. 3B-D). In previous studies, it has been shown that PKCs, downstream targets of PDK1, can regulate LATS

to affect YAP activity (42,43). Thus, we hypothesize that LATS may be negatively regulated by

PDK1 indirectly and therefore involved in PI3K-YAP/TAZ regulation (Fig. 7B). One study

suggests that the subcellular location of PDK1 but not its kinase activity mediates PIK3CA

activation of YAP in response to mitogen treatment (32). In this study, the cytoplasm-localized

PDK1 may serve as a scaffold protein to form a complex with Sav, MST and LATS. In this

complex, LATS can be activated by MST and therefore triggers the inhibition of downstream

YAP and TAZ (32). Our study, however, indicates that PDK1-KD but not PDK1-ΔPH, which

loses the membrane binding motif to mimic the cytoplasm-localized PDK1, decreased the

activity of YAP/TAZ (Fig. 4C-E, S-Fig. 3). This suggests that PDK1 kinase activity rather than subcellular location of PDK1 plays an essential role mediating the regulation of YAP/TAZ by

PI3Ks in our condition of mammary tumorigenesis. While future work will be necessary to

reconcile the differences in signaling between our study and others, we suspect that these observations may be due to cell line-specific or context-specific signaling.

As PI3K catalytic subunits, PIK3CA and PIK3CB share common properties and play essential roles in PI3K activation. The PI3K-AKT signaling pathway is a major pathway downstream of activated HER2, which is involved in 20% of BC (44). Significantly, PIK3CA-

H1047R has been found involved in HER2 targeted therapy (6). Moreover, both PIK3CA and

PIK3CB are involved in BC development and progression. About 30% of BCs have active mutations of PIK3CA, and these tend to be luminal-typed BCs (45). Amplification of PIK3CB is identified in around 5% of BC patients and is correlated with the Luminal B subtype (46). Both active mutation and amplification of PI3K isoforms result in highly active functions of the kinase. In this study, we found that PI3K can positively regulate YAP and TAZ (Fig. 1-2, S-Fig.

1-2). Moreover, coactivation of TAZ can dramatically enhance the oncogenic functions of

PIK3CA or PIK3CB both in vitro and in vivo (Fig.6C-H, Fig. 7A), while knock down of YAP and TAZ dramatically decreased PI3K-induced anchorage-independent growth (Fig. 6A-B, S-

Fig. 6A-D). Surprisingly, although both PIK3CA and PIK3CB activate YAP/TAZ and function similarly in cells, co-overexpression of TAZ with PIK3CB instead of PIK3CA causes tumor formation in mice in vivo (Fig. 7A). The reason for this difference is unknown. It has previously been suggested that loss of PTEN tumor suppressor-induced tumor formation in vivo depends on

PIK3CB instead of PIK3CA (47). Therefore, it is possible that PIK3B may have higher oncogenic activity than PIK3CA due to stronger activation of YAP/TAZ in vivo.

Finally, we analyzed human tumor databases and found a significant co-occurrence of

PIK3CA/B and YAP/TAZ mRNA expression in BC (S-Table 1). It is therefore highly possible that activated PI3K positively regulates YAP and TAZ to result in tumorigenesis, either through

an overexpression of PIK3CB or an active mutation of PIK3CA. Our data suggests that the

resistance or relapse of cancers in patients treated with specific PI3K inhibitors may be due to the

activation of YAP/TAZ through other complimentary pathways when PI3K is inhibited.

Therefore, in addition to developing specific inhibitors targeting PIK3CB or PI3K signaling, our

study highlights the potential for TAZ and YAP to be targeted therapeutically for the treatment

of PI3K-involved BCs, HER2-positive BCs and other cancers that are resistant to PI3K inhibitor

treatments. The activation status of TAZ and YAP may also be good biomarkers for clinical

prognosis of these types of BCs.

5. Conclusions

In conclusion, our study provides the first evidence that PIK3CB functions as a novel

regulator of YAP and TAZ in BC development. Moreover, we clarified the signaling pathways

that mediate PI3KCA/CB regulation of YAP/TAZ. Most significantly, we found TAZ enhances

PI3K functions in mammary tumorigenesis both in vitro and in vivo, and knockdown of

YAP/TAZ dramatically blocked PI3K-induced mammary tumorigenesis. Amplification of

PIK3CB is found in luminal B subtype of BC and mutations of PIK3CA (e.g., PIK3CA-

H1047R) mostly exist in luminal types of BC. In addition, it is well known that PIK3CA

mutations (e.g., PIK3CA-H1047R) play an important role in resistances of the targeted therapy for HER2 positive BC due to the well-studied mechanism that HER2 functions through PI3K-

AKT pathway. Therefore, our studies suggest that YAP/TAZ are critical mediators of HER2- and PI3K-induced tumorigenesis and can be used as biomarkers and therapeutic targets for the

prognosis and treatment of HER2-positive and luminal subtypes of BC in the future.

Acknowledgement

We would like to thank Dr. Kunliang Guan for providing the HEK293A-LATS1/2-knockout (LATS-KO) and HEK293A-MST1/2-KO (MST-KO) cell lines; Dr. Fernando D. Camargo from Harvard University for providing the STBS-luc plasmid; Dr. Jian Chen for performing the MS detection and analysis; Drs. Paolo Armando Gagliardi and Luca Primo for the PDK1 constructs (PDK1-WT, PDK1-KD, PDK1-ΔPH); Dr. Leda Raptis for the PIK3CA-H1047R plasmid. We also thank Ellen van Rensburg for manuscript proof-reading and Lee Boudreau for performing IHC. This work was supported by grants from the Canadian Institute of Health Research (CIHR) and Canadian Breast Cancer Foundation (CBCF; X.Yang), Breast Cancer Action Kingston and Kingston General Hospital Foundation (C.J. Nicol), and Canadian Breast Cancer Foundation, Ontario Chapter #369649 (C.J. Nicol). Y. Zhao was supported by Ontario Trillium Scholarship (OTS, Canada), CIHR/Terry Fox Foundation Training Program in Transdisciplinary Cancer Research and Chinese Government Award for Outstanding Self-financed Students Abroad (2014). T. Montminy was funded by CIHR/Terry Fox Foundation Training Program in Transdisciplinary Cancer Research and the Huang Leadership Development Scholarship. T. Azad is supported by a Vanier Canada Graduate Scholarship. E. Lightbody is supported by Queen’s University Terry Fox Research Institute Transdisciplinary Training Program in Cancer Research Fellowship, and the Dr. Robert John Wilson Graduate Fellowship.

Conflict of interest

The authors declare no conflict of interest.

References

1. Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin. 2015;65:87–108. 2. Nik-Zainal S, Davies H, Staaf J, Ramakrishna M, Glodzik D, Zou X, et al. Landscape of somatic mutations in 560 breast cancer whole-genome sequences. Nature. 2016;534:47– 54. 3. Thorpe LM, Yuzugullu H, Zhao JJ. PI3K in cancer: divergent roles of isoforms, modes of activation and therapeutic targeting. Nat Rev Cancer. 2014;15:7–24. 4. Martini M, Santis MC De, Braccini L, Gulluni F, Hirsch E. PI3K/AKT signaling pathway and cancer: an updated review. Ann Med. 2014;46:372–83. 5. Fresno Vara JA, Casado E, de Castro J, Cejas P, Belda-Iniesta C, González-Barón M. PI3K/Akt signalling pathway and cancer. Cancer Treat Rev. 2004;30:193–204. 6. Berns K, Horlings HM, Hennessy BT, Madiredjo M, Hijmans EM, Beelen K, et al. A functional genetic approach identifies the PI3K pathway as a major determinant of trastuzumab resistance in breast cancer. Cancer Cell. 2007;12:395–402. 7. Burris HA. Overcoming acquired resistance to anticancer therapy: Focus on the PI3K/AKT/mTOR pathway. Cancer Chemother Pharmacol. 2013;71:829–42. 8. Huw L-Y, O’Brien C, Pandita A, Mohan S, Spoerke JM, Lu S, et al. Acquired PIK3CA amplification causes resistance to selective phosphoinositide 3-kinase inhibitors in breast cancer. Oncogenesis. 2013;2:e83. 9. Kim D, Dan HC, Park S, Yang L, Liu Q, Kaneko S, et al. AKT/PKB signaling mechanisms in cancer and chemoresistance. Front Biosci. 2005;10:975–87. 10. Yu H-G, Ai Y-W, Yu L-L, Zhou X-D, Liu J, Li J-H, et al. Phosphoinositide 3-kinase/Akt pathway plays an important role in chemoresistance of gastric cancer cells against etoposide and doxorubicin induced cell death. Int J Cancer. 2008;122:433–43. 11. Lee JJ, Loh K, Yap Y. PI3K/Akt/mTOR inhibitors in breast cancer. Cancer Biol Med. 2015;12:342–54. 12. Akinleye A, Avvaru P, Furqan M, Song Y, Liu D. Phosphatidylinositol 3-kinase (PI3K) inhibitors as cancer therapeutics. J Hematol Oncol. 2013;6:88. 13. Leroy C, Amante RJ, Bentires-Alj M. Anticipating mechanisms of resistance to PI3K inhibition in breast cancer: a challenge in the era of precision medicine. Biochem Soc Trans. 2014;42:733–41. 14. Wang X, Su L, Ou Q. Yes-associated protein promotes tumour development in luminal epithelial derived breast cancer. Eur J Cancer. 2012;48:1227–34. 15. Chan SW, Lim CJ, Guo K, Ng CP, Lee I, Hunziker W, et al. A role for TAZ in migration, invasion, and tumorigenesis of breast cancer cells. Cancer Res. 2008;68:2592–8. 16. Bartucci M, Dattilo R, Moriconi C, Pagliuca A, Mottolese M, Federici G, et al. TAZ is required for metastatic activity and chemoresistance of breast cancer stem cells. Oncogene. 2014;34:681–90. 17. Lai D, Ho KC, Hao Y, Yang X. Taxol resistance in breast cancer cells is mediated by the

hippo pathway component TAZ and its downstream transcriptional targets Cyr61 and CTGF. Cancer Res. 2011;71:2728–38. 18. Overholtzer M, Zhang J, Smolen GA, Muir B, Li W, Sgroi DC, et al. Transforming properties of YAP, a candidate oncogene on the chromosome 11q22 amplicon. Proc Natl Acad Sci U S A. 2006;103:12405–10. 19. Lei Q-Y, Zhang H, Zhao B, Zha Z-Y, Bai F, Pei X-H, et al. TAZ promotes cell proliferation and epithelial-mesenchymal transition and is inhibited by the hippo pathway. Mol Cell Biol. 2008;28:2426–36. 20. Cordenonsi M, Zanconato F, Azzolin L, Forcato M, Rosato A, Frasson C, et al. The Hippo transducer TAZ confers cancer stem cell-related traits on breast cancer cells. Cell. 2011;147:759–72. 21. Zhao B, Wei X, Li W, Udan RS, Yang Q, Kim J, et al. Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. Genes Dev. 2007;21:2747–61. 22. Hao Y, Chun A, Cheung K, Rashidi B, Yang X. Tumor suppressor LATS1 is a negative regulator of oncogene YAP. J Biol Chem. 2008;283:5496–509. 23. Yu F, Guan K. The Hippo pathway: regulators and regulations. Genes Dev. 2013;27:355– 71. 24. Schlegelmilch K, Mohseni M, Kirak O, Pruszak J, Rodriguez JR, Zhou D, et al. Yap1 acts downstream of α-catenin to control epidermal proliferation. Cell. 2011;144:782–95. 25. Yu F-X, Zhao B, Guan K-L. Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer. Cell. 2015;163:811–28. 26. Heidary Arash E, Song KM, Song S, Shiban A, Attisano L. Arhgef7 promotes activation of the Hippo pathway core kinase Lats. EMBO J. 2014;33:2997–3011. 27. Das Thakur M, Feng Y, Jagannathan R, Seppa MJ, Skeath JB, Longmore GD. Ajuba LIM proteins are negative regulators of the Hippo signaling pathway. Curr Biol. 2010;20:657– 62. 28. Lucas EP, Khanal I, Gaspar P, Fletcher GC, Polesello C, Tapon N, et al. The Hippo pathway polarizes the actin cytoskeleton during collective migration of Drosophila border cells. J Cell Biol. 2013;201:875–85. 29. Zhang N, Bai H, David KK, Dong J, Zheng Y, Cai J, et al. The Merlin/NF2 tumor suppressor functions through the YAP oncoprotein to regulate tissue homeostasis in mammals. Dev Cell. 2010;19:27–38. 30. Zhao Y, Yang X. Regulation of sensitivity of tumor cells to antitubulin drugs by Cdk1- TAZ signalling. Oncotarget. 2015;6:21906–17. 31. Zhao Y, Khanal P, Savage P, She Y, Cyr TD, Yang X. YAP-Induced Resistance of Cancer Cells to Antitubulin Drugs Is Modulated by a Hippo-Independent Pathway. Cancer Res. 2014;74:4493–503. 32. Fan R, Kim N-G, Gumbiner BM. Regulation of Hippo pathway by mitogenic growth factors via phosphoinositide 3-kinase and phosphoinositide-dependent kinase-1. Proc Natl Acad Sci U S A. 2013;110:2569–74.

33. Li X, Tao J, Cigliano A, Sini M, Calderaro J, Azoulay D, et al. Co-activation of PIK3CA and Yap promotes development of hepatocellular and cholangiocellular tumors in mouse and human liver. Oncotarget. 2015;6:10102–15. 34. Lin Z, Zhou P, von Gise A, Gu F, Ma Q, Chen J, et al. Pi3kcb links Hippo-YAP and PI3K-AKT signaling pathways to promote cardiomyocyte proliferation and survival. Circ Res. 2015;116:35–45. 35. Armando Gagliardi P, di Blasio L, Orso F, Seano G, Sessa R, Taverna D, et al. 3- Phosphoinositide-Dependent Kinase 1 Controls Breast Tumor Growth in a Kinase- Dependent but Akt-Independent Manner. Neoplasia. 2012;14:719–IN19. 36. Gagliardi PA, di Blasio L, Puliafito A, Seano G, Sessa R, Chianale F, et al. PDK1- mediated activation of MRCKα regulates directional cell migration and lamellipodia retraction. J Cell Biol. 2014;206. 37. Yang N, Morrison CD, Liu P, Miecznikowski J, Bshara W, Han S, et al. TAZ induces growth factor-independent proliferation through activation of EGFR ligand amphiregulin. Cell cycle. 2012;11:2922–30. 38. Mohseni M, Sun J, Lau A, Curtis S, Goldsmith J, Fox VL, et al. A genetic screen identifies an LKB1-MARK signalling axis controlling the Hippo-YAP pathway. Nat Cell Biol. 2014;16:108–17. 39. Moasser MM. The oncogene HER2: its signaling and transforming functions and its role in human cancer pathogenesis. Oncogene. 2007;26:6469–87. 40. Moroishi T, Park HW, Qin B, Chen Q, Meng Z, Plouffe SW, et al. A YAP/TAZ-induced feedback mechanism regulates Hippo pathway homeostasis. Genes Dev. 2015;29:1271– 84. 41. Chan SW, Lim CJ, Chong YF, Pobbati A V, Huang C, Hong W. Hippo pathway- independent restriction of TAZ and YAP by angiomotin. J Biol Chem. 2011;286:7018–26. 42. Wang Y, Justilien V, Brennan KI, Jamieson L, Murray NR, Fields AP. PKCι regulates nuclear YAP1 localization and ovarian cancer tumorigenesis. Oncogene. 2017;36:534–45. 43. Gong R, Hong AW, Plouffe SW, Zhao B, Liu G, Yu F-X, et al. Opposing roles of conventional and novel PKC isoforms in Hippo-YAP pathway regulation. Cell Res. 2015;25:985–8. 44. Rexer BN, Chanthaphaychith S, Dahlman K, Arteaga CL. Direct inhibition of PI3K in combination with dual HER2 inhibitors is required for optimal antitumor activity in HER2+ breast cancer cells. Breast cancer Res. 2014;16:R9. 45. Mukohara T. PI3K mutations in breast cancer: prognostic and therapeutic implications. Breast Cancer Targets Ther. 2015;7:111. 46. Crowder RJ, Phommaly C, Tao Y, Hoog J, Luo J, Perou CM, et al. PIK3CA and PIK3CB inhibition produce synthetic lethality when combined with estrogen deprivation in estrogen receptor-positive breast cancer. Cancer Res. 2009;69:3955–62. 47. Wee S, Wiederschain D, Maira S-M, Loo A, Miller C, DeBeaumont R, et al. PTEN- deficient cancers depend on PIK3CB. Proc Natl Acad Sci U S A. 2008;105:13057–62.

Figure legends

Fig. 1 PIK3CB induces anchorage-independent growth of MCF10A cells and positively regulates YAP/TAZ. A-B. Confirmation of the screening result that PIK3CB induces anchorage-independent growth of MCF10A cells. A. Soft agar assay confirmation of MCF10A-PIK3CB clones (C-1, C-2), which were selected from kinase screening. Both clone cell lines yielded more colonies than control cells (MCF10A-WT); B. Colony numbers from the soft agar assay (Fig. 1A) were counted and summarized in the chart. “*” indicates the difference of colony numbers between PIK3CB clone cell lines and control cell line is significant with p value <0.05; C. PIK3CB positively regulates YAP. Indirect fluorescence staining detected the subcellular localization of YAP in PIK3CB overexpressed MCF10A as well as MCF10A-control cells; D-G. HEK293A and SK-BR3 cells were transfected with luciferase reporter plasmid expressing super TEAD binding sites sequences [STBS-luc, (D)] or CYR61 promoter reporter (CYR61-luc) alone or together with plasmids expressing vector control (Ctrl) or PIK3CB (E, F) or PIK3CA-H1047R (G). Luciferase assays were carried out using a Dual Luciferase Assay Kit. The fold changes in luciferase activity were calculated by normalizing HEK293A or SK-BR3 cells transfected with STBS-luc or CYR61-luc together with PIK3CB to those transfected with STBS-luc or CYR61-luc alone with control plasmids. All the above DLAs were performed in biological triplicates.

Fig. 2 Inhibition of PI3K reduces YAP/TAZ activity. A-B. Increased YAP phosphorylation after inhibition of PI3K activity. A. MCF7 breast cancer cells were treated with PI3K inhibitor GDC0941 at a concentration of 1 µM for 5 hours before cells were lysed for western blotting analysis. YAP, phosphorylated YAP on S127 (pYAP), S6K, phosphorylation of S6K (pS6K), AKT and phosphorylated AKT on S473 (pAKT) were detected with respective antibodies. β-actin was used as loading control; B. HEK293A cells were used to establish PIK3CA/PIK3CB double knockout using the CRISPR-Cas9 system. These cells were further lysed for western blotting analysis; C. Indirect fluorescence staining detected the subcellular localization of YAP in PIK3CB overexpressed MCF10A with GDC0941 pretreatment at 1 µM for 4 hours before cells were fixed; DMSO was used for control cells with the same pretreatment; D-E. Tumor cells (MMTV-NIC) excised from engineered mice of HER2- driven primary breast cancer were checked by WB (D) and subjected to indirect

immunofluorescence staining to detect subcellular localization of YAP (E) with treatment of GDC0941 (1 µM) for 4 hours before cells were fixed, DMSO was used for control cells with the same pretreatment.

Fig. 3 PI3KCA and PIK3CB regulate YAP and TAZ through their kinase activities. A. PIK3CB but not PIK3CB kinase-dead mutant (PIK3CB-D937A) activates YAP and YAP/TAZ downstream target CYR61. MCF10A cells stably expressing control vector WPI, PIK3CB-WT-WPI and PIK3CB-D937A-WPI were established through lentiviral infection. Protein lysates were extracted from these cells for western blotting analysis with antibodies targeting pYAP (S127), YAP, CYR61, FLAG, pAKT (S473), AKT1; B. PIK3CB-D937A decreases PIK3CB-induced the transcription of CYR61. mRNA was extracted from MCF10A- WPI, MCF10A-PIK3CB, MCF10A-PIK3CB-D937A cells. Real-time PCR (RT-PCR) was performed with primers targeting CYR61 and ribosomal RNA was used as internal control. “*” indicates statistical significance; C. Kinase-dead mutants of PIK3CA/B decreased PIK3CA/B- induced YAP/TAZ activity. PIK3CA-H1047R, PIK3CA-D933A, Myr-PIK3CB, PIK3CB- D937A, control plasmid (Ctrl) were transfected with CYR61-luc into HEK293A cells for DLA. The data was achieved through normalizing cells transfected with CYR61-luc together with PI3K plasmids to those transfected with CYR61-luc with Ctrl. “*” indicates that the differences of CYR61-luc activities between PI3Ks and control are significant.

Fig. 4 PDK1 mediating PIK3CA/B-induced activation of YAP and TAZ through its kinase activity. A-B. PDK1 inhibitor abolishes the activation of YAP/TAZ by PIK3CA/B. HEK293 cells were treated with PDK1 inhibitor (GSK2334470) at 10 µM for 24 hours before protein lysates were extracted for western blotting detection (A); CYR61-luc was cotransfected with either PIK3CA- H1047R or Myr-PIK3CB into HEK293 cells with and without PDK1 inhibitor (GSK2334470) treatment at 10 µM for 24 hours. DLA was performed with DLA kit and 3 biological replicates (B); “*” indicates that the differences of CYR61-luc activities between PI3Ks and control are significant; C. MCF10A cells stably expressing control vector (Mock), PDK1, PDK1-ΔPH, PDK1-KD were established through lentiviral infection. Protein lysates were extracted from these cells for western blotting analysis with antibodies targeting myc tag, pAKT (S473), AKT1;

D. Indirect fluorescence staining detected the subcellular localization of YAP in MCF10A- Mock, PDK1, PDK1-ΔPH, PDK1-KD; E. Subcellular localization of YAP or TAZ was quantified in at least 200 cells from the immunostaining. Data are represented as mean ± SD.

Fig. 5 PIK3CA/B-induced activation of YAP and TAZ is dependent on LATS and partially dependent on AKT. A-B. Activation of YAP/TAZ by PI3Ks decreases in AKT-knockout cells (HCT116-AKT-KO). HCT116-WT and AKT-KO cells were lysed for western blotting detection of AKT1, AKT2 (A); CYR61-luc was cotransfected with either PIK3CA-H1047R or Myr-PIK3CB in either HCT116 or HCT116-AKT-KO cells. DLA was carried out with DLA kit (B). “*” indicates that the differences of CYR61-luc activities between PI3Ks and control are significant; C-D. Western blot analysis of MST and LATS in MST-KO and LATS-KO HEK293A cells; E. PI3K-induced activation of YAP/TAZ is independent of MST but dependent on LATS. DLA was performed to detect PIK3CA-H1047R and PIK3CB effects on CYR61-luc reporter in wild type HEK293A as well as 293A cells with either MST or LATS knocked out. “*” indicates that the differences of CYR61-luc activities between PI3Ks and control are significant; F. Both AKT and PDK1 increase YAP/TAZ activity in LATS-KO cells. CYR61-luc was cotransfected with AKT1, PDK1 or Ctrl plasmid into HEK293A-WT, MST-KO and LATS-KO cells for 48 hours before DLA was performed. “*” indicates that the differences of CYR61-luc activities between AKT and PDK1 and control are significant; G. AKT1 increases YAP expression in LATS-KO cells but not WT cells. YAP-HA was cotransfected with either Ctrl (control) or AKT1-FLAG plasmids into both HEK293A-WT and HEK293A-KO cells for 48 hours before cells were lysed for western blotting analysis of the expression of YAP; H. AKT1 increases the expression of YAP5SA, which is independent of LATS regulation. YAP5SA-HA (LATS phosphorylation sites of YAP were mutated into A) was cotransfected with Ctrl or AKT1-FLAG into HEK293A cells for 48 hours before cells were lysed for western blotting analysis.

Fig. 6 YAP and TAZ mediate PIK3CB-induced tumorigenesis. A-B. Knockdown of YAP and TAZ dramatically decreases PIK3CB-induced anchorage- independent growth of MCF10A cells. YAP and TAZ were knocked down in MCF10A overexpressing PIK3CB cells (MCF10A-Myr-PIK3CB) using the CRISPR-Cas9 system. These cells were plated onto soft agar-containing culture plates. Colony number was counted and summarized in the chart; C-D. Coexpression of TAZ increases both PIK3CA- and PIK3CB- induced anchorage-independent growth of MCF10A cells. TAZ was stably coexpressed in MCF10A-WPI, MCF10A-PIK3CA-H1047R and PIK3CB cells. These cells were further subject to soft agar assay and colonies were counted and statistically analyzed; E-F. Cell proliferation assays with MCF10A-WPI, TAZ, PIK3CA-H1047R, PIK3CA-H1047R-TAZ, PIK3CB, PIK3CB-TAZ cells; G-H. Anoikis assay with above cell lines. Trypan blue staining was used to detect dead cells (G) and the expression of apoptosis marker cleaved-PARP was detected (H).

Fig. 7 Interaction of PI3K and YAP/TAZ in mammary tumorigenesis. A. PIK3CB and TAZ co-overexpression induces tumor growth in vivo. A xenograft mouse model (n=3/group) was used to evaluate the tumor formation of a variety of transformed MCF- 10A cells: MCF-10A/TAZ, MCF-10A/PIK3CA, MCF-10A/PIK3CB, MCF-10A/PIK3CA+TAZ and MCF-10A/PIK3CB+TAZ. A total of 4×106 cells suspended in 200 µL of cold PBS and GFR phenol-red free Matrigel (1:1 dilution) were injected subcutaneously (s.c.) into the flanks of twelve-week old Rag2-/-;Il2rg-/- mice. Six weeks post injection, only mice injected with MCF- 10A/PIK3CB+TAZ cells grew tumors. The tumors were harvested and fixed in formaldehyde and paraffin-embedded for sectioning for H&E staining and IHC staining of TAZ (1:2500 dilution) and PIK3CB (1:100 dilution). A slide was processed with the same IHC conditions without a primary antibody (control). The scale bar represents 60 µm; B. A signaling model of PI3K-induced activation of YAP and TAZ in mammary tumorigenesis. PIK3CA/B activate PDK1 through phosphorylation of PIP2 to PIP3. Activated PDK1 phosphorylates and activates AKT, which increases YAP/TAZ expression levels to mediate PI3K oncogenic functions. Increased YAP/TAZ also triggers the expression of LATS and therefore the LATS-YAP/TAZ negative feedback regulation. At the same time, activated PDK1 could inhibit LATS through some other downstream targets to counteract this negative feedback regulation. As a result, PIK3CA/B activates YAP/TAZ, which mediate the mammary tumorigenesis.

PI3K Regulates YAP/TAZ in Mammary Tumorigenesis through Multiple Signaling Pathways

Yulei Zhao, Tess Montminy, Taha Azad, et al.

Mol Cancer Res Published OnlineFirst March 15, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-17-0593

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2018/03/15/1541-7786.MCR-17-0593.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet been Manuscript edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/early/2018/03/15/1541-7786.MCR-17-0593. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.