Peroxisome Proliferator–Activated Receptor- Regulates Fatty Acid Utilization in Primary Human Skeletal Muscle Cells
Total Page：16
File Type：pdf, Size：1020Kb
Peroxisome Proliferator–Activated Receptor-␣ Regulates Fatty Acid Utilization in Primary Human Skeletal Muscle Cells Deborah M. Muoio,1,2 James M. Way,3 Charles J. Tanner,2 Deborah A. Winegar,3 Steven A. Kliewer,3 Joseph A. Houmard,2 William E. Kraus,1 and G. Lynis Dohm2 In humans, skeletal muscle is a major site of peroxisome proliferator–activated receptor-␣ (PPAR-␣) expres- sion, but its function in this tissue is unclear. We eroxisome proliferator–activated receptor (PPAR)- investigated the role of hPPAR-␣ in regulating muscle ␣,-␦, and -␥ belong to a family of nuclear hormone lipid utilization by studying the effects of a highly receptors that are bound and activated by fatty selective PPAR-␣ agonist, GW7647, on [14C]oleate me- Pacids and/or their derivatives, and they regulate tabolism and gene expression in primary human skeletal genes that are involved in lipid metabolism. PPAR-␥, which is muscle cells. Robust induction of PPAR-␣ protein ex- expressed primarily in adipose tissue, promotes adipocyte pression occurred during muscle cell differentiation and differentiation and activates transcription of genes involved corresponded with differentiation-dependent increases in lipogenesis and fatty acid esterification (1). Conversely, in oleate oxidation. In mature myotubes, 48-h treatment PPAR-␣, initially identified as the molecular mediator of a with 10–1,000 nmol/l GW7647 increased oleate oxida- class of chemical compounds that induces peroxisomal tion dose-dependently, up to threefold. Additionally, proliferation in rodent liver, is expressed most abundantly in GW7647 decreased oleate esterification into myotube tissues that are characterized by high rates of -oxidation (1). triacylglycerol (TAG), up to 45%. This effect was not ␣ ␣ abolished by etomoxir, a potent inhibitor of -oxida- Studies in PPAR- –null mice indicate that the subtype tion, indicating that PPAR-␣–mediated TAG depletion plays a critical role in maintaining constitutive activity of does not depend on reciprocal changes in fatty acid -oxidative pathways in liver and heart, as well as mediating catabolism. Consistent with its metabolic actions, adaptive metabolic responses to starvation (2,3). Further- GW7647 induced mRNA expression of mitochondrial more, in response to stresses that perturb fatty acid metabo- enzymes that promote fatty acid catabolism; carnitine lism, PPAR-␣ null mice accumulate massive levels of neutral palmityltransferase 1 and malonyl-CoA decarboxylase lipids in hepatic and cardiac tissues (2,3). These studies increased ϳ2-fold, whereas pyruvate dehydrogenase ki- demonstrate that in rodents, PPAR-␣ deficiency results in nase 4 increased 45-fold. Expression of several genes profound dysregulation of systemic lipid homeostasis. that regulate glycerolipid synthesis was not changed by The role of PPAR-␣ in humans is less clear. Drugs that GW7647 treatment, implicating involvement of other are PPAR-␣ activators are used therapeutically as potent targets to explain the TAG-depleting effect of the com- hypolipidemic agents (4), and new evidence suggests that pound. These results demonstrate a role for hPPAR-␣ in they might also prove effective for treating obesity and regulating muscle lipid homeostasis. Diabetes 51: 901–909, 2002 insulin resistance (5); however, the precise mechanisms that underlie the efficacy of these compounds still remain obscure. Investigations of PPAR-␣–mediated responses have historically focused on the liver, which in rodents is the tissue that expresses PPAR-␣ most abundantly (1). From the 1Department of Medicine and Cell Biology, Duke University Medical ␣ Center, Durham, North Carolina; the 2Department of Biochemistry and the However, unlike their effect in rodents, PPAR- –selective Human Performance Laboratory, East Carolina University, Greenville, North drugs do not induce peroxisomal proliferation in human Carolina; and the 3Departments of Molecular Endocrinology and Metabolic liver (6), indicating some degree of species specificity with Diseases, GlaxoSmithKline, Research Triangle Park, North Carolina. Address correspondence and reprint requests to Deborah M. Muoio, P.O. regard to target genes and/or tissues. Recent animal stud- Box 3327, Duke University Medical Center, Durham, NC 27710. E-mail: ies have shown that treatment with PPAR-␣ agonists [email protected]. Received for publication 22 August 2001 and accepted in revised form 4 affects gene expression in skeletal muscle (7–10), suggest- January 2002. ing that these compounds might target skeletal muscle D.M.M. has received funding from GlaxoSmithKline to support studies directly. Importantly, in humans, skeletal muscle is a focused on developing new drug therapies to treat muscle insulin resistance. ACO, acyl-CoA oxidase; ASM, acid-soluble metabolite; CPT1, carnitine major site of PPAR-␣ expression (11), but its function in palmityltransferase 1; DFM, differentiation media; DGAT, diacylglycerol acyl- this tissue has not been well investigated. Skeletal muscle transferase; DMEM, Dulbecco’s modified Eagles medium; FBS, fetal bovine serum; GM, growth media; GPAT, glycerol-3-phosphate acyltransferase; HS- represents a principal tissue responsible for lipid uptake KMC, human skeletal muscle cell; MCAD, medium-chain acyl-CoA dehydro- and utilization, and it contributes significantly to whole- genase; MCD, malonyl-CoA decarboxylase; PDH, pyruvate dehydrogenase; body lipid homeostasis. Thus, we hypothesized that PDHK, PDH kinase; PPAR, peroxisome proliferator–activated receptor; RTQ- ␣ PCR, real-time quantitative PCR; SREBP1, sterol regulatory element binding hPPAR- plays a key role in regulating muscle lipid protein 1; TAG, triacylglycerol; TCA, tricarboxylic acid. homeostasis, and that the efficacy of PPAR-␣–selective DIABETES, VOL. 51, APRIL 2002 901 PPAR-␣ AND LIPID UTILIZATION IN HUMAN MYOCYTES TABLE 1 Primer/probes sets used for real-time quantitative PCR Gene Forward Reverse Probe ACO CCTGAGTGAACTGCCTGAGCT TTGCAGTCCAGGAGGTGAAAG CATGCCCTCACCGCTGGACTGAAGA CPT-1 CTGCAGTGGGACATTCCAAA CAACGCCTTGGCCACCT TGCCAGGCGGTCATCGAGAGTTC DGAT GTTCCTGGCCTCGGCTTT AGGCGGAACATTCGCAGA TTCCACGAGTACCTGGTGAGCGTCC GPAT ACTCCTTGGGCCTTTGCTG TTCTGGAACAGGACCACTGAAGT CCTACAGCTCTGCTGCCATCTTTGTTCA MCD CACGTGGCACTGACTGGTG TTCTGTTTCTGATGGAGGATGTTC CCAGCAACATCCAGGCAATCGTGAA PDHK2 CAC ACC CTC ATC TTT GAT G GGT CGA TGC TGC CGA TGT CAC CAA CCC AGC CCA TCC C PDHK4 TGCATTTTTGCGACAAGAATTG TTGGGTCGGGAGGATATCAA CTGTGAGACTCGCCAACATTCTGAAGGA PGC-1 GTCTCTCCTTGCAGCACAAGAA GATGACCGAAGTGCTTGTTCAG CCAAGACCAGGAAATCCGAGCCG SREBP-1 CAAGGCCATCGACTACATT TTGCTTTTGTGGACAGCAGT TGCAACACAGCAACCAGAA PGC1, PPAR co-activator 1. drugs in humans might be mediated by direct effects on acyl-CoA dehydrogenase (MCAD) was a gift from Dan Kelly (Washington skeletal muscle fuel metabolism. To test these hypotheses, University, St. Louis, MO), and monoclonal anti–hPPAR-␣ was synthesized as ␣ previously described (11). we studied the effects of a highly selective hPPAR- Determination of fatty acid metabolism. Myocytes maintained in differen- agonist, GW7647 (12), on lipid metabolism and gene tiation medium for 0 days (myoblasts) or 3–9 days (developing myotubes) regulation in primary human skeletal muscle cells were incubated at 37°C in sealed 12- or 24-well plates containing 500 or 750 l (HSKMCs). Here, we report that hPPAR-␣ regulates ex- serum-free DFM plus 12.5 mmol/l HEPES, 0.2% BSA, 1.0 mmol/l carnitine, 100 mol/l sodium oleate, 50 g/ml gentamicin, and 1.0 Ci/ml [14C]oleate (NEN, pression of genes that control muscle lipid utilization, and Boston, MA). After 3 h, the incubation media was transferred to new dishes that PPAR-␣ activation results in profound effects on fuel and assayed for labeled oxidation products (CO2 and acid-soluble metabolites metabolism, favoring lipid catabolism over neutral lipid [ASMs]) (14). The cells were placed on ice, washed twice with PBS, scraped storage. These results contribute new information regard- into a 1.5-ml eppendorf tube in two additions of 0.30 ml 0.05% SDS lysis buffer, ing the function of PPAR-␣ in human skeletal muscle and and then stored at Ϫ80°C. Cell lysates were later assayed for protein, and then total cell lipids were extracted (15). Aliquots of the lipid extracts were spotted may present important therapeutic implications for treat- on 0.25-mm silica gel G plates from Whatman (Maidstone, Kent, U.K.) and ing lipid metabolic disorders. chromatographed with hexane:diethyl ether:acetic acid (80:20:1 vol/vol) in parallel with authentic standards. [14C]oleate-labeled lipid products were RESEARCH DESIGN AND METHODS quantified using a BioScan Image 200 System (Bioscan, Washington, DC). All assays were performed in triplicate, and data are presented as the means Ϯ SE Materials. BSA (essentially fatty acid–free), carnitine, sodium oleate, and oil of results from 5 to 10 subjects. red O stain were from Sigma (St. Louis, MO). Fetal bovine serum (FBS) and Real-time quantitative PCR. Total RNA was prepared using TriZol reagent Hank’s balanced salt solution were from Life Technologies (Gaithersburg, according the manufacturer’s protocol (Life Technology), treated with DNase MD). Heat-inactivated horse serum was from Hyclone (Logan, UT). Growth I (Ambion, Austin, TX), and quantified using the RiboGreen RNA quantitation media (GM) and differentiation media (DFM) consisted of Dulbecco’s modi- kit (Molecular Probes, Eugene, OR). Real-time quantitative PCR (RTQ-PCR) fied Eagles medium (DMEM) from Life Technologies supplemented with was performed using an ABI PRISM 7700 Sequence Detection System