Mechanisms of Single Ig Il-1-Related Receptor Mediated Suppression of Colon Tumorigenesis

MECHANISMS OF SINGLE IG IL-1-RELATED RECEPTOR MEDIATED SUPPRESSION OF COLON TUMORIGENESIS

JUNJIE ZHAO

Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy

Dissertation Advisor Xiaoxia Li, Ph.D.

Department of Molecular Medicine

CASE WESTERN RESERVE UNIVERSITY

May 2016

CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the dissertation of

Junjie Zhao

Candidate for the degree of Ph.D.*

Committee Chair

Brian Cobb, Ph.D.

Research Advisor

Xiaoxia Li, Ph.D.

Committee Member

Donal Luse, Ph.D.

Committee Member

Booki Min, Ph.D.

Committee Member

Bo Shen, M.D.

Date of Defense

March 8, 2016

*We also certify that written approval has been obtained for any proprietary contained

therein.

ii TABLE OF CONTENTS

LIST OF TABLES ...... 1

LIST OF FGIURES ...... 2

ABSTRACT ...... 4

Chapter 1 Introduction To The Role Of Toll-Like Receptor And Interleukin 1

Receptors In Colon Tumorigenesis

SIGIRR, A NEGATIVE REGULATOR OF TLR-IL-1R SIGNALING ...... 8

TLR-IL-1R SUPERFAMILY AND COLON TUMORIGENESIS ...... 10

SIGIRR IN INTESTINAL EPITHELIAL CELLS ...... 14

SIGIRR IN ADAPTIVE IMMUNE CELLS ...... 16

SUMMARY ...... 19

Chapter 2 Human Colon Tumors Express A Dominant-Negative Form Of Sigirr

That Promotes Inflammation And Colitis-Associated Colon Cancer In Mice

Loss Of N-Linked Glycosylation On Sigirr In Colorectal Cancer ...... 23

SIGIRRΔE8 Is A Common Variant In Colon Cancer Cells With Reduced Complex

Glycan Modification ...... 26

Rna Sequencing Reveals Increased Expression Of SIGIRRΔE8 In Colorectal Cancer .. 29

SIGIRRΔE8 Is A Dominant Negative Mutant Retained In The Er And Traps

Full-Length Sigirr ...... 33

Loss Of Modification By Complex Glycan Is Sufficient To Inactivate SIGIRR In Vivo 39

iii DISCUSSION ...... 48

MATERIALS AND METHODS ...... 53

Chapter 3 Il-17-Signaling Induces Plet1 Expression In Lgr5-Positive Cells

Contributing To Tumorigenesis

Il17rc Deficiency Attenuates Colon Tumor Development ...... 63

Il-17rc-Deficiency Impairs Regenerative Response Following Dss-Induced Injury .. 63

Il-17 Novel Target Genes Are Highly Induced In Regenerating And Tumor Tissues . 68

Plet1+Lgr5+ Mark A Highly Proliferative Cell Population Expressing Il-17-Target

Genes ...... 69

Plet1 Promotes Erk1/2 Activation, Tissue Repair And Tumorigenesis ...... 72

DISCUSSION ...... 75

MATERIALS AND METHODS ...... 79

Chapter 4 Summary And Future Directions

THE ROLE OF SIGIRR IN COLONIC EPITHELIAL CELLS ...... 85

THE ROLE OF SIGIRR IN COLONIC EPITHELIAL CELLS ...... 87

BIBLIOGRAPHY ...... 88

iv List of Tables

Table 1.1 Summary of evidence for receptors inhibited by SIGIRR……………………11

List of Figures

Figure 2.1 SIGIRR loses modification in colon cancer.…………………………….….24

Figure 2.2 SIGIRR is N-linked glycosylated protein….……………………………….25

Figure 2.3 SIGIRRΔE8 is a common variant in colon cancer cells………………………27

Figure 2.4 Standard Curve of the assay..………………………………………………28

Figure 2.5 RNA sequencing revealed increased expression of SIGIRRΔE8……………30

Figure 2.6 Normalized exon8 expression using……………..…………………………32

Figure 2.7 SIGIRR expression pattern in colon…..……………………………………34

Figure 2.8 SIGIRRΔE8 is a dominant negative mutant …...……………………………36

Figure 2.9 Colon cancer array data.……………………………………………………40

Figure 2.10 SIGIRR co-localization quantification…...…………………………….…42

Figure 2.11 Loss of glycan is sufficient to inactivate SIGIRR.………………………..44

Figure 2.12 AOM/DSS model………………………..………………………………..45

Figure 2.13 Dominant negative impact in vivo………………………………………..47

Figure 2.14 Model of SIGIRR mediated tumor suppression…………………………..50

Figure 3.1 IL-17RC mediates colon tumorigenesis in CAC model..………….………....…64

Figure 3.2 IL-17RC-deficiency impacts wound healing…………………….…………65

Figure 3.3 IL-17RC-dependent gene analysis ……………………………………………67

Figure 3.4 PLET1 is induced from colonic crypts during DSS treatment………………..…70

Figure 3.5 Lgr5 specific ablation of ACT1 impairs CAC tumorigenesis.……………..71

Figure 3.6 PLET1 is an ERK5-target and promotes P-ERK1/2 signaling …….………73

Figure 3.7 The Cas9/gRNA-targeting site in mouse Plet1………….……………….…74

Figure 3.8 Model for IL-17 signaling in tissue repair and colon tumorigenesis...... …76

3 Mechanisms of Single Ig Il-1-Related Receptor Mediated Suppression of Colon Tumorigenesis

Abstract

JUNJIE ZHAO

Inappropriate activation of the Toll-IL-1R (TL-IL-1) signaling by commensal bacteria contributes to the pathogenesis of inflammatory bowel diseases and colitis-associated cancer. SIGIRR is negative regulator of TL-IL-1 signaling. It is highly expressed in colonic epithelial cells, and Th17 cells, serving as a brake for both innate and adaptive immune system. SIGIRR deficient mice are highly susceptible to both chemical-induced and genetically based tumorigenesis, indicating that SIGIRR functions as a suppressor of colon tumorigenesis. In this treatment, we examined the cellular and molecular mechanisms of SIGIRR mediated suppression of tumor suppression.

While it has been shown that epithelial-cell derived SIGIRR inhibits colon tumorigensis in mouse models, the role of SIGIRR expression in human colonic cells during the carcinogenesis remains elusive. Most SIGIRR detected in human colon cancer tissues was cytoplasmic, whereas in non-tumor tissues it was found at the cell membrane. RNA sequence analyses revealed increased expression of a SIGIRR mRNA isoform,

SIGIRRΔE8, in colorectal cancer tissues compared to paired non-tumor tissues. SIGIRRΔE8 functions as a dominant negative mutant that traps full-length SIGIRR in the cytoplasm and prevents it from trafficking to the membrane. SIGIRR deficiency in T cell leads to hyper Th17 activity. Abrogation of the signaling of IL-17, the signature cytokine of

4 Th17, attenuated the tumorigenic process by limiting the tissue repair activity. A effector downstream gene, Plet1 was identified as an IL-17 target gene that is highly induced in response to tumorigenic treatment and was required for the tissue repair process and subsequent tumorigenesis. The studies presented herein identify SIGIRR as a negative regulator of human colorectal cancer through its impact on both T cells and colonic epithelial cells.

Chapter 1: Introduction to The Role of Toll-like Receptor and Interleukin 1 Receptors in Colon

Tumorigenesis

Portions of this Chapter are published in:

Zhao J, Zepp J, Bulek K, Li X. SIGIRR a negative regulator of colon tumorigenesis Drug Discov Today Dis Mech. 2011 Winter;8(3-4):e63-e69. Epub 2012 Mar 15.

6 The intestinal tract is inhabited by trillions of microbes collectively referred to as commensal microflora. The host has developed a mutualism with commensal bacteria where they are beneficial to each other. An important aspect of this relationship is the

“microbial tolerance” installed by host immune system. A group of membrane proteins, named Toll-like Receptors (TLRs) can recognize molecules derived intestinal-resident and pathogenic bacteria and initiate inflammatory response, mounting the defense attack.

Inappropriate activation of these receptors is implicated in the pathogenesis of inflammatory bowl disease (IBD). Patients with ulcerative colitis (UC), a type of inflammatory bowl disease, stand a higher risk of developing colon cancer, indicating an association of inflammation and tumorigensis . The chronic inflammation process is commonly believed to be the cause of neoplastic transformation of the intestinal epithelium. Therefore, the “microbial tolerance” of the intestinal epithelial layer is not only important for controlling local inflammation but also for preventing tumorigenesis in the colon.

Many mechanisms have been proposed to explain how the host immune system selectively ignores resident bacteria but retains its ability to fight pathogenic invasion. A popular model suggests that the temporally and spatially regulated expression of TLRs can restrict their exposure to pathogen associated pattern molecules (PAMPs), which are the cognate ligands derived from bacterial components in order to avoid rampant activation of inflammatory responses. However, the dilemma of this model is that the

TLRs expressed in the intestine are not completely blind to the commensal flora. In fact, signaling through TLRs provides gut epithelium with tonic signals critical for the survival for intestinal epithelial cells (IECs) and tissue repair after injury. Another mechanism

7 known to contribute to the tolerance relies on negative regulators of TLR signaling, among which the Single Immunoglobulin IL-1 Receptor Related molecule (SIGIRR or

Tir8) is an important member.

SIGIRR, a negative regulator of TLR-IL-1R signaling

The Toll-IL-1 receptor (TLR-IL-1R) superfamily is defined by the presence of an intracellular Toll/IL-1 receptor (TIR) domain. These receptors play crucial roles in the immune response and can be divided into two main subgroups based on their sequence feature. The Leucine Rich Repeat motif (LRR)-containing subgroup consists of at least ten TLRs. These receptors have received intense attention as different TLRs can be activated by specific pathogen products. The immunoglobulin (Ig) domain-containing subgroup includes the IL-18R, ST2 and IL-1R, whose ligands are major inflammatory mediators. While IL-18 signaling is important for Th1 immunity, IL-33 has been identified as the ligand for ST2 and plays a crucial role in Th2 immunity. Importantly,

IL-1 has recently been shown to play an essential role in Th17 cell differentiation.

The TLR-IL-1Rs can induce TAK1 (TGFβ-activated kinase 1)- and MEKK3 (MAP kinase kinase kinase 3)-dependent pathways, involving cascades of kinases organized by multiple adapter molecules into parallel and sequential signaling complexes, leading to the activation of the transcription factor NFκB, which plays a crucial role in cell survival.

TLR-IL-1Rs also mediate mRNA stabilization and translational control of cytokines/chemokines and cell cycle regulators, which is essential for effective inflammatory response and tissue repair. TLR-IL-1Rs-mediated TAK1-dependent NFκB activation is coupled with post-transcriptional regulation through receptor proximal

8 signaling events to induce the robust production of cytokines and chemokines in bone- marrow-derived macrophages. Differentially, the TLR-IL-1Rs-mediated MEKK3- dependent pathway is uncoupled from post-transcriptional regulation and only induces expression of genes that are not regulated at post-transcriptional levels. These genes include inhibitory molecules A20 and IκBα, which exert an overall inhibitory effect on inflammatory gene expression. SIGIRR is a negative regulator of the TLR-IL-1R signaling. SIGIRR deficiency sensitizes mice to LPS induced septic shock. It also leads to excessive inflammation during Mycobacterium tuberculosis infection. The expression of SIGIRR is strategically positioned in epithelial cells but not in macrophages, which suggests differential pathway activation in different cell types. While the TAK1- dependent pathway may serve for inflammatory response, the MEKK3-dependent pathway may be responsible for controlled tonic activation of NFκB, which is essential for cell survival and tissue repair.

SIGIRR is a transmembrane protein with a single Ig domain and a cytoplasmic portion that shares highly conserved motifs with Toll-IL-1 Receptor (TIR) domain. TIR domain of SIGIRR protein is divergent from that of the IL-1 receptor in two amino acid residues that are crucial for signaling transduction, rendering it defective in mediating downstream events. Nevertheless, it retains the ability to mediate homotypic interaction with other

TIR domain-containing proteins. SIGIRR inhibits IL-1R and TLR signaling pathways through differential mechanisms. SIGIRR interferes with the heterodimerization of Ig domains of the receptor subunits of the IL-1R, whereas the intracellular TIR domain inhibits both IL-1R and TLR signaling by attenuating the recruitment of receptor proximal signaling components to the receptor.

9 SIGIRR negatively regulates signal transduction of several receptors of the TLR-IL-1R superfamily. Overexpression of SIGIRR can inhibit NFκB-dependent luciferase expression mediated by IL-18R, IL-1R, ST2, TLR4 and TLR9. SIGIRR-deficient kidney epithelial cells showed increased NFκB and JNK activation in response to IL-1β, LPS and CpG DNA. Similarly, in bone-marrow-derived dendritic cells (DCs), SIGIRR deficiency increased IL-12 production in response to imiquimod treatment, indicating that SIGIRR plays a similar role in the TLR7 mediated signaling. In one of our previous studies, we reported that SIGIRR overexpression could not inhibit NFκB activation through TLR5 and TLR3. Moreover in SIGIRR-deficient kidney epithelial cells there was no significant difference in response to flagellin or poly I:C. In contrast to this study,

Zhang and colleagues observed that overexpression of SIGIRR in human airway epithelial cells could attenuate the production of cytokines induced by flagellin (Table 1).

These studies suggest that a more detailed investigation is needed to define the spectrum of receptors inhibited by SIGIRR and how this corresponds to cell-type.

TLR-IL-1R superfamily and colon tumorigenesis

As mentioned earlier, TLR-IL-1R signaling plays a crucial role in the active cross talk between the commensal microflora and the host. Mice deficient in MyD88, TLR2 or

TLR4 failed to launch the tissue repair program after DSS insult, rendering them susceptible to DSS-induced colitis. Initiation of the tissue repair program requires the engagement of TLRs with their cognate ligands, which are derived from the commensal bacteria. Thus, the TLR-IL-1R and gut microflora have a beneficial impact on the homeostasis of the intestinal epithelium. Unfortunately, the beneficial role played by the

11 same signaling can also be an omen for cancer. Microbial infection, injury, inflammation and tissue repair are all associated with the development of colon tumorigenesis. For example, UC-associated cancer involves the inflammation of the submucosa, which is induced by direct contact with the intestinal microflora. The tumorigenic processes resulting from tissue injury and inflammation is also mediated by TLR-IL-1R signaling.

Studies using MyD88 deficient mice have demonstrated a protective effect of MyD88 deficiency against tumorigenesis in APCMin/+ mice, a murine model of spontaneous tumorigenesis in the intestinal tract. Similar results were obtained from studies with the

TLR4 knockout mice, which were resistant to AOM/DSS-induced colorectal cancer.

Thus, the signaling through MyD88, especially the ones mediated by TLR4, seems to be required for carcinogenesis. However, MyD88 deficiency became a tumor-promoting factor in the AOM/DSS model, in which dextran sodium sulfate (DSS) was used to enhance the genetic lesion induced by pro-carcinogen azoxymethane (AOM). IL-18 knockout mice share the similar phenotypes with MyD88 deficient mice in the

AOM/DSS-induced colon cancer model, displaying increased tumor formation and growth. Consistent with this finding, deficiency in components of inflammasome, the machinery producing IL-1β and IL-18, renders mice susceptible to AOM/DSS-induced colon carcinogenesis. The complexity of phenotypes manifested by these knockout mice indicates that the TLR-IL-1R signaling plays multiple roles in the process. The knockout mice used in previous studies mostly were defective in either the signaling pathway or the production of cytokine, which has largely limited our scope since compensating mechanism may take over in the absence of TLR-IL-1R signaling and complicate the scenario.

12 This problem was resolved with the advent of SIGIRR-knockout mice. Because SIGIRR negatively regulates the signaling, its deficiency does not debilitate the pathway. Rather, it exaggerates the intensity of the original signal, providing a model of excessive TLR-IL-

1R signaling and enabling us to look at the same problem from another side. SIGIRR- knockout mice exhibit deregulated homeostasis with increased proliferation and decreased apoptosis of the IECs. Constitutive phosphorylation of IκB and JNK was observed in crypt cells isolated from SIGIRR-deficient mice, which was accompanied by increased production of proinflammatory mediator in physiological state. SIGIRR deficiency increases the susceptibility to DSS-induced colitis. NFκB target genes, Bcl-xL and CyclinD1, are highly induced in SIGIRR-deficient colon, contributing to the increased cell survival and proliferation. In the AOM/DSS model, SIGIRR-deficient mice showed increased tumor incidence, total tumor number as well as tumor size. Indicating that SIGIRR is a negative regulator of tumor promotion and progression. In addition, increased expression of classic tumor promoters including IL-6 and Cox-2 was found in the knockout mice. Moreover, SIGIRR was demonstrated to decrease tumor initiation in the ApcMin/+ model, where it also suppressed tumor growth. Interestingly, in both models the effect of SIGIRR deficiency depends on the presence of commensal microflora, suggesting the TLRs mediated signaling is the initiator of the aggravated inflammation and tumorigenesis.

The tumor-suppressing function of SIGIRR in colon carcinogenesis was demonstrated in three separate studies. But the mechanism underlying its function remains to be elucidated because the previous studies have used the complete SIGIRR-knockout mice in which SIGIRR expression is absent in all cell types. However, the colon consists of

13 multiple cellular compartments. Underlying the epithelium is a layer of mucosal tissue called lamina propria which houses a variety of immune cells including T cells and DCs.

The effect of SIGIRR deficiency may be an intrinsic defect of the IECs. It is also possible that the lamina propria provides an input to the IECs through cytokines produced by T cells and DCs where SIGIRR is also abundantly expressed. In the following review we will discuss the function of SIGIRR in each cell type and how it could impact the tumorigenesis.

SIGIRR in intestinal epithelial cells

SIGIRR is highly expressed in the colon epithelium, which undergoes continuous and rapid renewal. TLR-mediated NFκB activation in gut epithelial cells has been suggested to provide the survival signal, termed tonic signal. In absence of SIGIRR, the tonic signal was exaggerated, resulting in increased expression of genes important for cell survival and proliferation, including Cyclin D1, c-Myc and Bcl-xL. Adoptive transfer experiments revealed that TLR4 expressed by IECs is important for recruiting Cox-2 expressing macrophages that amplify the size and number of dysplastic lesion. Corroboratively, intestinal epithelial-specific expression of SIGIRR in SIGIRR-knockout mice largely rescued the deregulated homeostasis and decreased tumorigenesis, suggesting that epithelial-derived SIGIRR is a primary effector in suppressing colon tumorigenesis.

SIGIRR dampens the excessive secretion of chemokines to reduce the recruitment of immune cells to the colon, decreasing the intensity and duration of the inflammation, which results in better resolution of colitis and tumor formation.

14 NFκB has long been a suspected mediator between tumorigenesis and inflammation.

Activation of NFκB leads to a pro-survival transcriptional program. Inhibition of NFκB upon TNFα stimulation induces cell apoptosis. Intestinal epithelial specific knockout of

IKKβ, an upstream kinase crucial for NFκB activation, decreased tumor multiplicity but not tumor size in an AOM/DSS model, suggesting that activation of NFκB contributed to tumor initiation and tumor promotion. Hyper-activation of NFκB can increase the production of IL-6, which can then act on IECs to activate STAT3. The IL-6-STAT3 axis has been shown to be important for early stages of colon tumorigenesis. In addition, the level of phosphorylated STAT3, the active form of the transcription factor, is elevated in colorectal carcinomas from human patients. Moreover, activation of STAT3 has also been shown to enhance tumor growth in xenograft models.

Activation of NFκB, JNK and mTOR pathway was also enhanced in SIGIRR-deficient

IECs. JNK can cross talk with Wnt signaling, which controls the proliferation and differentiation of intestinal epithelial stem cells. A positive feedback connects the two pathways through c-Jun, the substrate of JNK and TCF4, a component of TCF4/β-catenin complex. Enhanced activation of JNK can accelerate colitis-induced tumorigenesis. mTOR pathway has been shown to promote the cell cycle progression by enhancing the translation of cell cycle regulators. It has also been shown to influence Wnt-β-catenin pathway by phosphorylating GSK3β, which controls the stability of β-catenin.

Importantly, the increased anaphase bridge index (ABI) that contributed to tumor initiation can be explained by the hyper-activation of mTOR activity. ABI is an indicator of chromosome instability. mTOR hyper-activation was reported to result in G1-S phase acceleration and eventually chromosome instability.

15 Another relevant signaling pathway that might have contributed is the activation of ERK in ApcMin/+ model. One study suggests that the protective effect conferred by MyD88 deficiency in ApcMin/+ mice is a result of inactivation of ERK. ERK stabilizes the oncoprotein MYC and prevents its degradation. SIGIRR deficiency can exaggerate the activation of ERK in the IECs by commensal bacteria, which can explain the increased c-

Myc level reported in SIGIRR-deficient ApcMin/+ colonocytes.

SIGIRR in adaptive immune cells

Induction of adaptive immune surveillance is an important part of the intestinal immune system to guard against commensal and pathogenic microbes, involving professional antigen presenting cells and lymphocytes that reside in the organized lymphoid structures of the intestinal immune system. In response to commensal or pathogenic microbes, the professional antigen presenting cells (DCs) are able to produce cytokines to regulate the differentiation of CD4+ Th cells. T helper cells differentiate into functionally distinct effector subsets. Th1 cells produce IFN-γ and regulate cellular immunity, whereas Th2 cells produce IL-4, IL-5, IL-13 and regulate humoral immunity. While Th1-cell activation is associated with Crohn's disease, Th2 cytokines are often detected in patients with UC, the latter of which is associated with increased risk of developing colon cancer.

Th17 cell subset has also recently been shown to regulate tissue inflammatory responses.

While Th17 cells have been implicated in the generation of protective immunity to extracellular bacterial infection, exaggerated activation probably leads to abrogation of mucosal T cell homeostasis, leading to intestinal inflammation.

16 SIGIRR expression was highly induced in polarized Th2 and Th17 cells, but its expression remains low in naïve T cells and Th1 cells. A novel cytokine IL-33, an IL-1 family member, signals via ST2 receptor and promotes T helper type 2 (Th2) responses.

SIGIRR can form a complex with ST2 upon IL-33 stimulation and specifically inhibit IL-

33/ST2-mediated signaling. Its expression is highly induced during Th2 cell polarization and upon restimulation. Importantly, SIGIRR-deficient Th2 cells produce higher levels of

‘Th2 cytokines’, including IL-4, IL-5 and IL-13 than that in wild-type cells. IL-33- induced Th2 response was enhanced in SIGIRR-deficient mice compared to that in wild- type control mice, suggesting a negative regulatory role of SIGIRR in Th2 response via

IL-33/ST2 signaling in vivo. The response type may be important in that Th1-cell mediated response is likely to generate macrophages that has antitumor activity, whereas

Th2-cell mediated response tends to polarize macrophages to a tumor-promoting phenotype. Thus, SIGIRR deficiency could lead to hyper activity of Th2 cells, which can exacerbate the intestinal inflammation and nurture a microenvironment for tumorigenesis.

Recent studies have also shown that IL-1-mediated signaling in T cells is essential for

Th17 differentiation/maintenance and autoimmune disease. While SIGIRR expression was induced during Th17 differentiation, SIGIRR deficiency leads to enhanced expansion of Th17 cells and increased induction of Th17 associated cytokines (IL-17, IL-

17F, IL-21 and IL-22). Importantly, IL-1 stimulation results in increased Th17 cell expansion in differentiated SIGIRR-deficient Th17 cells, suggesting that the impact of

SIGIRR on Th17 effector function is probably through its modulation on IL-1 signaling in differentiated Th17 cells. Consistent with these findings, it has been shown that

SIGIRR deficiency exacerbated Th17 cell responses in fungal infection and increased

17 severity of systemic autoimmune diseases. In DSS-induced colitis model, SIGIRR- deficient colon tissues produced more IL-13, IL-17 as well as IFN-γ compared to that in wild-type mice, indicating the potential contribution of T cell-derived SIGIRR in the modulation of Th17 cell activation and function during intestinal inflammation. Th17 cells and IL-17 have been implicated in colon tumorigenesis. In a mouse model of enteroxoigenic Bcteroid fragilis (ETBF), a predominant Th17-mediated colitis was observed, which eventually resulted in tumorigenesis. Blockade of IL-17A alone was enough to inhibit the infection-associated carcinogenesis. The strong association between

Th17 cells and colitis suggests a scenario in which excessive inflammation resulting from unhampered expansion of SIGIRR-deficient Th17 cells enhances the tumorigenic environment.

Despite a modest expression level in the DCs, SIGIRR has been shown to play an important role in regulating dendritic cell function. Lech and colleagues have reported a protective effect of SIGIRR in both hydrocarbon oil-induced and homozygous Lpr mouse model of systemic lupus erythematosus (SLE). In the former study the authors showed that SIGIRR suppressed TLR7 mediated activation of dendritic cell, protecting the mouse from hydrocarbon oil-induced lupus. In the latter work, they demonstrated that lack of

SIGIRR led to enhanced activation of DCs upon lupus autoantigen exposure, increasing its expression of proinflammatory and antiapoptotic mediators. Dendritic cell derived

SIGIRR is also a crucial regulator of antidonor reactivity of kidney grafts. Being an important population in the lamina propria, dendritic cell might be the primary source of tumor-promoting cytokines including IL-6 and TNFα.

18 Summary

TLR-IL-1R signaling plays a crucial in the mutualism between host and commensal microbes residing in the intestinal tract. The commensal bacteria trigger different TLRs to maintain the tonic signal that is essential for epithelial homeostasis and tissue repair.

However, the same signal can also lead to chronic inflammation that promotes the tumorigenesis in the colon. The delicate balance is maintained by SIGIRR through inhibition of the TLR-IL-1R signaling. SIGIRR deficiency resulted in severe colitis and associated carcinogenesis in both chemical induced model as well as spontaneous model of colon cancer. The mechanism underlying the effect of SIGIRR deficiency could be epithelial intrinsic as well as a result of the input from hyperactive T cells and DCs . Due to the different function of SIGIRR in different cell types, the precise contribution to colitis-associated tumorigenesis from different cellular compartments is not yet known.

Despite the complexity resulting from the multiple roles of SIGIRR, SIGIRR deficiency has provided a precious tool for probing the function of TLR-IL-1R signaling. The expression pattern of SIGIRR is highly conserved among vertebrates, with high expression found in the intestinal tract, which suggests a conserved function of SIGIRR in the intestine. Existing evidence suggests that SIGIRR also modulates innate immune response in differentiated human IECs. Moreover, in UC patients, SIGIRR expression is lower in disease active tissue compared to normal tissue. Given its unique role in controlling inflammation and tumorigenesis, SIGIRR holds the potential of being a valuable biomarker in related diseases.

Chapter 2:

Human Colon Tumors Express a Dominant-Negative Form of SIGIRR That

Promotes Inflammation and Colitis-Associated Colon Cancer in Mice

Portions of this chapter are published in

Zhao J, Bulek K, Gulen MF, Zepp JA, Karagkounis G, Martin BN, Zhou H, Yu M, Liu X, Huang E, Fox PL, Kalady MF, Markowitz SD, Li X. Human Colon Tumors Express a Dominant-Negative Form of SIGIRR That Promotes Inflammation and Colitis- Associated Colon Cancer in Mice. Gastroenterology. 2015 Dec;149(7):1860-1871.e8. doi: 10.1053/j.gastro.2015.08.051. Epub 2015 Sep 5

20 Colorectal carcinoma (CRC) is one of the leading causes of cancer-related mortality in the United States. The development of the CRCs exemplifies the multistep transformation model of tumorigenesis.They arise from mutational activation of oncogenes coupled with inactivation of tumor suppressor genes as a result of genomic instability.2 Somatic mutations accumulate in benign adenomas over time and with the influence from environmental factors such as inflammation, eventually lead to malignant transformation into carcinoma.

Inappropriate activation of toll-interleukin-1 receptor (TLR-IL-1R) signaling by commensal bacteria contributes to the pathogenesis of inflammatory bowel diseases and colitis-associated cancer. The single immunoglobulin interleukin 1 receptor related molecule (SIGIRR, also named TIR8) plays a critical role in modulating intestinal inflammation and suppressing colon tumorigenesis. SIGIRR is a unique member of the

TLR-IL-1R superfamily, with a single immunoglobulin (Ig) extracellular domain and a

TIR intracellular domain. SIGIRR is highly expressed in intestinal epithelial cells and functions as a negative regulator for IL-1, IL-33, LPS and CpG signaling. We and others previously reported that SIGIRR-deficient mice are more susceptible to chemical induced colitis and exhibit increased tumorigenesis in the murine model of colitis-associated colon cancer. SIGIRR deficiency also leads to increased colon tumor burden in the ApcMin mice.

Although previous studies have established SIGIRR as a suppressor of colon tumorigenesis in mice, the importance of SIGIRR in human colorectal cancer has not been determined. In this study, we found that SIGIRR is frequently inactivated in human

21 colorectal cancer due to the expression of a dominant negative SIGIRR isoform. The

SIGIRR isoform SIGIRRΔE8 is encoded by a transcript lacking the exon 8 of the SIGIRR gene. SIGIRRΔE8 showed increased retention in the cytoplasm and loss of complex glycan modification compared to the full-length SIGIRR, potentially due to its interaction with the endoplasmic reticulum (ER) resident protein RPN1 (a subunit of oligosaccharyltransferase complex). Moreover, SIGIRRΔE8 was able interact with full- length SIGIRR protein to sequester it from complex glycan modification and cell surface expression. RNA sequencing detected significant increased exclusion of exon 8 in human colorectal cancer in a cohort of 68 pairs of normal and colon cancer samples.

Consistently, human colon cancer showed predominantly cytoplasmic localization of

SIGIRR in contrast to the cell membrane expression in normal tissue, potentially due to the dominant negative effect of SIGIRRΔE8. Consistently, using transgenic mice expressing a SIGIRR mutant bearing mutated glycosylation motif, we showed that loss of modification by complex glycan and lack of cell surface expression inactivated the tumor suppressor function of SIGIRR in vivo. In summary, our results suggest that the expression of a cancer-associated dominant negative SIGIRR isoform (SIGIRRΔE8) results in inactivation of SIGIRR function through increased ER retention, loss of appropriate glycosylation and cell surface expression, implicating SIGIRR as an important regulator of colorectal cancer in human.

22 Results

Loss of N-Linked Glycosylation on SIGIRR in Colorectal Cancer

We examined SIGIRR expression in freshly isolated human colonic epithelial cells and tumor tissues together with a panel of colon cancer cell lines derived from different patients (VACO cell lines) by Western blotting. SIGIRR was detected as multiple bands ranging from 44 kDa (size predicted based on full-length cDNA) to 90 kDa in the normal colonic epithelial cells (Figure 2.1A and B). Interestingly, the colon cancer cell lines and the colorectal cancer specimen showed a drastic reduction of the smear band above 55 kDa and a concurrent increase of the bands migrating below the 55-kDa marker (

Figure 2.1A and B).

These observations prompted us to investigate which modification led to the smear band of SIGIRR above 55 kDa. Because SIGIRR is a transmembrane protein, we suspected that the modification in colonic epithelial cell-derived SIGIRR was due to N-linked glycosylation. Overexpressing human SIGIRR cDNA yielded highly modified forms of

SIGIRR (Figure 2.2A). There are 4 putative glycosylation motifs in the ectodomain of

SIGIRR, which are conserved between mouse and human (Figure 2.2B). We mutated the predicted sites by site-directed mutagenesis changing the asparagines to serines. Upon mutation of all of the 4 putative sites (SIGIRRN31/73/86/102S), SIGIRR was reduced to the unmodified form 44 kDa (Figure 2.2A), confirming that SIGIRR is N-linked glycosylated protein. Moreover, PNGase F treatment of lysates from normal human colonic epithelial cells reduced the slow-migrating smear band to its predicted size (Figure 2..2C), indicating the SIGIRR is N-linked glycosylated in vivo. N-linked glycosylation is a

Figure 2.1 SIGIRR loses modification in colon cancer. (A) Lysates of normal epithelial cells isolated from human colon epithelium (normal colonic epithelial cells) and colon cancer cell lines (Vaco cell lines) were analyzed by Western blotting. (B) Lysates of normal epithelial cells isolated from normal human colon epithelium (Normal 1–10) and colorectal cancer tissue (Cancer1–5) were analyzed by Western blotting. SIGIRR, single immunoglobulin and toll-interleukin 1 receptor.

Figure 2. 2 SIGIRR is N-linked glycosylated protein. (A) Three micrograms of FLAG- tagged wild-type and mutant SIGIRR cDNAs were transfected into HeLa cells and harvested for Western blot analysis. (B) Partial cDNA sequences of human and mouse SIGIRR show conserved N-linked glycosylation motifs (underlined). *Conserved amino acid residues. (C) Normal colon epithelial cell lysates from 3 individuals were treated (+) or untreated (−) with PNGase F to remove N-linked glycosylation. Treated lysates were subjected to Western blotting. (D) Three micrograms of FLAG-tagged wild-type (WT) SIGIRR cDNA was transfected into HeLa cells followed by treatment with kifunensine at 5 ng/mL for the indicated time and Western blot analysis. SIGIRR, single immunoglobulin and toll-interleukin 1 receptor.

25 multistep process that starts in ER, where the nascent protein acquires high-mannose modification and is transported to Golgi apparatus to receive further modification by complex glycan. Based on the band pattern of SIGIRR, we hypothesized that the smear band that was reduced in the colon cancer cell lines was due to complex glycan modification on SIGIRR. The complex glycan modification requires the enzymatic trimming of high-mannose modification by mannosidase, which can be inhibited by kifunensine, resulting in blockade of global complex glycan modification. We found that

Kifunensine treatment indeed abolished the smear bands above 55 kDa of wild-type

SIGIRR (Figure 2.2D), indicating that the smear band represents the complex glycan modified SIGIRR.

SIGIRRΔE8 Is a Common Variant in Colon Cancer Cells With Reduced Complex

Glycan Modification

To determine whether the defect in SIGIRR glycosylation was due to changes of glycosylation enzymes (trans-defect) or alterations/mutations in SIGIRR (cis defect), we transfected exogenous SIGIRR cDNA into the Vaco400 cells that showed defective

SIGIRR glycosylation (Figure 1.1A). Surprisingly, exogenous SIGIRR was normally modified by complex glycan, suggesting a cis defect of endogenous SIGIRR (

Figure 2.3A). We then performed 5′ rapid amplification of cDNA ends (5′RACE) to analyze of RNA from Vaco400 cells and repeatedly encountered 2 SIGIRR transcripts: a full-length SIGIRR mRNA and a novel variant that lacks the exon 8 (SIGIRRΔE8)

(Figure 2.3B). Exon 8 encodes part of the intracellular TIR domain. Exclusion of exon

8 leads to frameshift of the 3′ sequence, resulting in a SIGIRR isoform with a shorter

Figure 2.3 SIGIRRΔE8 is a common variant in colon cancer cells with reduced complex glycan modification. (A) Vaco 400 cells were transfected with FLAG-tagged SIGIRR (+) or empty vector, followed by Western blotting. (B) RNA from Vaco400 cells was used for 5′ RACE analysis, using primer targeting 5′ end (RACE P) and oligo(dT) targeting poly(A) tail. The product from the reaction was resolved on a 1.5% agarose gel. Blue boxes indicate the exons encoding the TIR domain. Red lines show the positions of the amplicons used to quantify SIGIRRΔE8 in panel C. (C) Quantitative analysis of the of SIGIRRΔE8 versus full-length SIGIRR transcript expressed as percentage of the SIGIRRΔE8 in normal colonic epithelial cells, colorectal cancer tissue, and colon cancer cell lines. Locations of amplicons used in the assay are shown as A1 and A2 (B). (D) Indicated amounts of full-length SIGIRR or SIGIRRΔE8 were transfected into HeLa cells together with NFκB-dependent luciferase, followed by luciferase assay and Western blotting. (E) Three micrograms of full-length SIGIRR or SIGIRRΔE8 cDNA was transfected into HeLa cells. Eight hours after transfection, cells were treated with 5 ng/mL kifunensine for indicated times and harvested for Western blot analysis. Error bars represent standard errors of mean (SEM) of 3 technical replicates. RACE, rapid amplification of cDNA ends; SIGIRR, single immunoglobulin and toll-interleukin 1 receptor.

Figure 2.4 (A) Standard curve is shown for the quantification of the percentage of SIGIRRΔE8 over total SIGIRR. (B) Real-time PCR analysis of total SIGIRR expression in indicated samples using amplicon targeting exon 4. Error bar represents standard error of the mean (SEM) of biological replicates. (C) Increasing amounts of SIGIRRΔE8 were cotransfected with full-length SIGIRR into HeLa cells. Cell lysates were subjected to Western blotting using anti-SIGIRR antibody. Note the similar band pattern between coexpression of SIGIRRΔE8 with full-length SIGIRR and the endogenous SIGIRR in Vaco400 cells. SIGIRR, single immunoglobulin and toll-interleukin 1 receptor.

28 cytoplasmic tail. The percentage of isoform (SIGIRRΔE8) over total SIGIRR was increased in the colorectal cancer specimen as well as in the colon cancer cell lines compared to freshly isolated normal human colonic epithelial cells (Figure 2.3C and 2.4A and B). We tested the ability of SIGIRRΔE8 to inhibit IL-1R signaling with luciferase assay. Deletion of exon 8 substantially abolished the ability of SIGIRR to inhibit IL-1β– induced NFκB activation (Figure 2.3D). Interestingly, SIGIRRΔE8 exhibited loss of smear band above 55 kDa that was substantial compared to that of the full-length SIGIRR, although the missing exon did not contain the motifs for N-linked glycosylation

(Figure 2.3D). Although kifunensine treatment shrank the size of full-length SIGIRR, it failed to reduce the size of SIGIRRΔE8, implying lack of complex glycan modification on

SIGIRRΔE8 (Figure 2.3E).

RNA Sequencing Reveals Increased Expression of SIGIRR ΔE8 in Colorectal Cancer

To more rigorously assess the association of SIGIRR ΔE8 with human colon cancer, we analyzed RNA sequencing data of 68 pairs of normal and cancerous colorectal tissue samples. To quantify SIGIRRΔE8 expression levels, we took 2 different approaches to analyze the RNA sequencing data: calculating both the junction reads and computing the number of reads from exon 8. We first compared the number of junction reads of exons 7 and 9 (exclusion of exon 8) with that of exons 8 and 9 (inclusion of exon 8). We calculated the ratio of exons 7 and 9 (excluding exon 8) reads to exons 8 and 9 (including exon 8) reads for each sample to compute the percentage of SIGIRRΔE8 as part of the total

SIGIRR transcript in cancer and paired normal tissue. The analysis detected a statistically significant increase in the junction reads for the exclusion of exon 8 (SIGIRRΔE8) in the colorectal cancer (Figure 2.5A). In a second approach, we normalized the abundance of

Figure 2.5 RNA sequencing revealed increased expression of SIGIRRΔE8 in colorectal cancer. RNA sequencing data from 68 pairs of normal colon and colorectal cancer were analyzed for reads counts. (A) Each dot represents the percentage of SIGIRRΔE8 as the part of total SIGIRR transcript, calculated based the ration of junction read number (exon s 7–9 vs exon s 7–8). (B) Each dot represents the Log2(RPKMExon8/RPKMExon 3) value of each sample, which was derived by calculating the ratio of RPKM values of exon 8 and the exon 3, followed by transforming the data with Log function with 2 as base. Line and error bars represent means and 95% confidence intervals. (C) Volcano plot showing the log2 (fold difference) and –log10 (P values) of genes up-regulated in SIGIRRΔE8-high tumors compared to SIGIRRΔE8-low tumors. Genes of functional interest are highlighted in red and listed in the table on the right. SIGIRR, single immunoglobulin and toll-interleukin 1 receptor.

30 exon 8 to a reference exon (exon 3) by computing the ratio of RPKM values (eg,

RPKMExon8/RPKMExon3). Indeed, we found that tumor samples had reduced a

RPKMExon8/RPKM Exon3 ratio compared with that of normal tissue (Figure 2.5B) and that this reduction held regardless of the choice of reference exon (Figure 2.6). It should be noted that, although SIGIRRΔE8 showed increased expression in the cancer samples, it is not exclusively expressed by only cancer cells as SIGIRRΔE8 accounts for 10% of the total SIGIRR transcripts in normal tissue (Figure 2.5A and B). Recent studies have suggested that normal intestinal stem cells express a gene signature similar to that of the colorectal cancer stem cells. We therefore examined whether the level of SIGIRRΔE8 was elevated in LGR5+ cells in both normal and cancer cells. We analyzed the relative abundance of SIGIRRΔE8 in LGR5+ and LGR5− cells sorted from human colon but failed to detect a difference in SIGIRRΔE8. Results suggest that the detected increase of the percentage of SIGIRRΔE8 relative to total SIGIRR expression in colon cancer tissues might be due to the oncogenic transformation rather than reflecting the cellular constituent of the samples (Figure 2.7A). Moreover, we did not detect differences in the percentage of SIGIRRΔE8 relative to total SIGIRR expression in normal colon organoids maintained in stem cell culture (high LGR5 expression) and differentiation culture conditions (low LGR5 expression) (Figure 2.7B). Taken together, these data indicate that tumor tissues express significantly more SIGIRRΔE8 than paired normal tissues, suggesting that the exclusion of exon 8 is an event associated with colorectal cancer.

We then wondered whether there might be differential gene expression profiles between

SIGIRRΔE8 high versus SIGIRRΔE8 low colon cancers. We interrogated the RNA sequencing dataset and found that more than 100 genes were significantly up-regulated in

Figure 2.6 (A) Log2(RPKMExon8/RPKMReference Exon) values were computed using RPKM values of other coding region exons as reference were plotted for each sample. (B) Log2(RPKMExon8/RPKMReference Exon) values were computed using RPKM values of other coding region exons as reference were plotted as a bar graph showing the significant reduction in tumor samples. *P < .01; **P < .001.

32 SIGIRRΔE8 high cancer tissue compared with SIGIRRΔE8 low cancer tissue. Among the most significantly up-regulated genes, we found increased expression of immune- response–associated genes (such as T-cell receptor alpha, immunoglobulin heavy variable, and defensins), implying the possible association of SIGIRRΔE8 high colon cancer with a proinflammatory microenvironment (Figure 2.5C). This feature is consistent with the role of SIGIRR as a negative regulator of inflammatory responses. In addition, we also found up-regulation of genes implicated in cancer growth (aldehyde dehydrogenase 1, dual oxidase 2, cathepsin E) and metastasis (matrix metallopeptidase 8,

10, and 20) in SIGIRRΔE8 high cancer tissue comparing with that in SIGIRRΔE8 low cancer tissue (Figure 2.5C).

SIGIRRΔE8 Is a Dominant Negative Mutant Retained in the ER and Traps Full-

Length SIGIRR

It is important to note that both 5′ RACE and RNA sequencing analyses detected substantial expression of full-length SIGIRR transcript in colon cancer cell lines

(Figure 2.3C) and colon cancer tissues (Figures 2.5B and C). One critical question is whether and how SIGIRRΔE8 exerts its impact in the presence of full-length SIGIRR.

Because SIGIRR could form homodimer through its ectodomain and TIR domain, we postulated that the SIGIRRΔE8 might act in a dominant negative fashion via its interaction with full-length SIGIRR. We indeed found that SIGIRRΔE8 attenuated the ability of full- length SIGIRR to inhibit IL-1R signaling in a dose dependent manner (Figure 2.8A).

SIGIRRΔE8 also blocked the complex glycan modification of SIGIRR and converted it to the high-mannose modified SIGIRR (band below 55 kDa) (Figure 2.8A). These data are

Figure 2.7 (A) Normal colon mucosa and colorectal cancer tissue was enzymatically dissociated to generate single cell suspension. Cells were stained with fluorescein isothiocyanate- conjugated anti-Epcam and phycoerythrin (PE)-congjugated LGR5. Epcam+LGR5+ cells were sorted and subjected to real-time PCR analysis. (B) Normal colon crypts were cultured under previously described condition to derive organoids. Established organoids were then cultured under stem cell condition (+WRN) or differentiating condition (−WRN) followed by real-time PCR analysis. (C) Normal human colon paraffin sections were stained with anti-SIGIRR (green), anti Na+-K+ ATPase antibody (red) and DAPI. (D) Normal human colon paraffin section were stained

34 with anti-SIGIRR (green),anti β-Catenin antibody (red) and 4',6-diamidino-2- phenylindole (DAPI).

consistent with a dominant negative role of SIGIRRΔE8. In support of this, we indeed found that SIGIRR could interact with SIGIRRΔE8 (Figure 2.8B). Notably, the high- mannose–modified SIGIRR bands from cotransfection of wild-type SIGIRR and

SIGIRRΔE8 resembled the endogenous SIGIRR band pattern in the Vaco400 cell line, implicating the possible dominant negative role of endogenous SIGIRRΔE8 in suppressing the complex glycan modification full-length SIGIRR in the Vaco400 cell line.

Because our data showed that SIGIRRΔE8 blocks the complex glycan modification of full- length SIGIRR, we wondered whether SIGIRRΔE8 might have a defect in cell surface expression and also interferes with that of full-length SIGIRR. Thus, we first employed in situ protein biotinylation assay to specifically quantify the expression of SIGIRR on the cell membrane. Although the complex glycan modified full-length SIGIRR (when expressed alone) was found on the cell membrane, we failed to detect the expression of

SIGIRRΔE8 on cell membrane (Figure 2.8C). However, the coexpression of SIGIRRΔE8 prevented the cell surface expression of full-length SIGIRR (Figure 2.8C). The colon cancer cell line Ls174t expresses endogenous full-length SIGIRR and SIGIRRΔE8

(SIGIRRΔE8 makes up 45% of total SIGIRR) (Figure 2.3C). We also detected complex glycan-modified endogenous SIGIRR on the cell surface ( Figure 2.8D). Interestingly,

SIGIRR was reported to be an interacting partner with RPN1 in a large-scale 2-yeast hybrid screening. RPN1 is a subunit of the ER resident oligosaccharyltransferase complex, implicated in facilitating N-linked glycosylation for a subset of membrane proteins. Indeed, we detected interaction of SIGIRR with RPN1 (Figure 2.8D). Notably,

36 Figure 2.8 SIGIRRΔE8 is a dominant negative mutant and prevents cell surface expression and complex glycan modification of full-length SIGIRR. (A) Indicated amounts of HA tagged full-length SIGIRR and FLAG-tagged SIGIRRΔE8 were transfected into HeLa cells together with NFκB-dependent luciferase. Transfected cells were subjected to luciferase assay and Western blot analysis. Error bar represents SEM of 3 technical replicates. (B) HeLa cells were transfected with either 2 µg of HA-tagged full-length SIGIRR alone or together with 4 µg of FLAG-tagged SIGIRRΔE8. Transfected cells were lysed, and lysates were immunoprecipitated with anti-FLAG antibody followed by Western blotting. (C) HeLa cells were transfected with indicated amounts of full-length SIGIRR and/or SIGIRRΔE8. Transfected cells were subjected to in situ biotinylation assay, followed by Western blotting analysis. (D) Cancer cell line Ls174t with expression of endogenous SIGIRR (SIGIRRΔE8 makes up 45% of total SIGIRR) with stable expression of scramble shRNA or shRNA targeting endogenous SIGIRR were subjected to in situ biotinylation assay (left) or immunoprecipitation (right) with anti- RPN1 antibody, followed by Western blotting. (E) HeLa cells were cotransfected with 2 µg FLAG-tagged RPN1 and a total of 4 µg of HA-tagged full-length SIGIRR and/or HA- tagged SIGIRRΔE8. Transfected cells were lysed, and the lysates were immunoprecipitated with anti-FLAG antibody followed by Western blot analysis. (F) Paraffin-embedded sporadic colorectal caner, colitis-associated cancer tissue samples and their respective paired normal controls were stained with anti-SIGIRR and anti-Na+-K+ ATPase (membrane marker [left]) or anti-RPN1(ER marker [right]) primary antibodies, followed by corresponding secondary antibodies and DAPI . Staining was visualized using confocal microscopy at 40× magnification (bar = 50 µm) or 62× magnification (bar = 3 µm). All experiments were repeated at least 3 times, yielding consistent results. Ctr, IgG control; DAPI, 4′,6-diamidino-2-phenylindole; IP, immunoprecipitation; HA, hemagglutinin; PD, pull-down; WCL, whole-cell lysates; shRNA, short hairpin RNA; SIGIRR, single immunoglobulin and toll-interleukin 1 receptor.

37 it is the SIGIRR without complex glycan modification that binds to RNP1, and

SIGIRRΔE8 showed much stronger interaction with RPN1 than with full-length

SIGIRRΔE8 (Figure 2.8E). Interestingly, coexpression with SIGIRRΔE8 enhanced the interaction between full-length SIGIRR with RPN1 (Figure 2.8E), suggesting that

SIGIRRΔE8 might inhibited the function of full-length SIGIRR by trapping it in the ER and preventing the decoration by complex glycan.

Considering the loss of cell surface expression of SIGIRRΔE8 and its ability to trap full- length SIGIRR, we wondered whether the increased expression of SIGIRRΔE8 might lead to abnormal SIGIRR subcellular localization in human colon cancer tissue. We stained for SIGIRR in normal human colonic tissue and in cancer tissue. A stark difference in the localization of SIGIRR was observed between normal and cancer tissues (Figure 2.8F), including sporadic colorectal cancer and colitis-associated cancer tissues. Normal colonic epithelial cells showed predominantly membrane localization of SIGIRR, as indicated by colocalization with the membrane marker Na+-K+ ATPase (Figure 2.8F). The membrane localization of SIGIRR was maintained throughout the crypt, including the bottom of the crypt where the stem cells reside (Figure 2.7 C and D). In contrast, colorectal cancer cells exhibited cytoplasmic staining of SIGIRR and increased co-localization with the ER marker RPN1 ( Figure 2.8F), implicating increased retention of SIGIRR in the ER in human colon cancer.

To characterize the pattern of SIGIRR expression in a larger cohort, we stained for

SIGIRR in a total of 110 cases of colorectal cancer and normal samples on a tissue array.

Consistently, while SIGIRR was localized to the cell membrane in normal tissue and

38 adenoma tissue, its cytoplasmic expression was increased in the cancer tissues (Figure

2.9). We observed an inverse correlation between the membrane expression of SIGIRR

(as measured by the colocalization signal with Na+-K+ ATPase) and the tumor grade, with the poorly differentiated cancer (grade III) showing predominantly cytoplasmic

SIGIRR staining (Figure 2.10A). In support of this, while the percentage of SIGIRRΔE8 is significantly elevated in the cancer tissues compared to normal and adenoma tissues

(Figure 2.10C), which is suggestive of a cancer-specific event.

Loss of Modification by Complex Glycan Is Sufficient to Inactivate SIGIRR In Vivo

Our results above suggest that the mode of action that inactivates SIGIRR in colorectal cancer represents a novel mechanism whereby functionality of SIGIRR is abolished through its altered subcellular localization and glycosylation. We next seek to establish transgenic models of SIGIRR mutants to test the importance of complex glycan modification and cell surface expression of SIGIRR in vivo. Because SIGIRRΔE8 also lacks the critical TIR domain essential for the molecule to function (interacting with

TLRs-IL-1R family members), SIGIRRΔE8 may not be ideal for testing the impact of loss of complex glycan modification and reduced cell surface expression of SIGIRR.

Interestingly, SIGIRRN86/102S (with point mutations at N86 and N102 to serines) had substantially reduced complex glycan modification and failed to come to cell surface

(Figures 2.2A and 2.11A), similar to defect observed with SIGIRRΔE8, making it an ideal candidate for testing our hypothesis. Furthermore, SIGIRRN86/102S was indeed defective of inhibiting IL-1R signaling in cell culture experiments (Figure 2.11B). Thus, we decided

Figure 2.9 Colon cancer tissue array of 110 cases was stained with anti-SIGIRR (green), anti-Na+-K+ATPase (red) antibodies, and DAPI (blue). Representative images from normal colon tissues (A) and adenoma (B), grade I∼II colorectal cancer tissues (C and D), and grade III colorectal cancer tissues (E and F) are shown. Bar = 25 µm. DAPI, 4',6- diamidino-2-phenylindole; SIGIRR, single immunoglobulin and toll-interleukin 1 receptor.

40 to use SIGIRRN86/102S to study the role of complex glycan modification and cell surface expression of SIGIRR in tumorigenesis.

We created gut epithelium-specific SIGIRR transgenic mice by expressing flag-tagged wild-type SIGIRR (WT-SIGIRR) and mutant SIGIRRN85/101S (MT-SIGIRR) under the control of transcriptional regulatory elements derived from a fatty acid-binding protein gene.26 The glycosylation sites are conserved between mouse and human SIGIRR, with human N86 and N102 corresponding to mouse N85 and N101 (Figure 2.2B). The

SIGIRR transgenes were specifically expressed in intestine and colon but not in other tissues (data not shown). SIGIRRN85/101S showed loss of the smear bands above 55 kDa

(Figure 2.11C), indicating that mutation at these 2 sites reduced the complex glycan modification in vivo. Immunofluorescence revealed that MT-SIGIRR exhibited predominantly cytoplasmic localization, whereas WT-SIGIRR showed strong cell surface expression ( Figure 2.11D).

To compare the functionality of MT-SIGIRR with that of WT-SIGIRR in vivo, we crossed WT-SIGIRR and MT-SIGIRR transgenic mice onto SIGIRR−/− background and subjected them to azoxymethane (AOM) and dextran sulfate sodium (DSS) (AOM-DSS) treatment. As we reported before, re-expression of WT-SIGIRR in colonic epithelial cells reduced the number and size of tumors (Figure 2.12). In contrast, mice with MT-SIGIRR had a tumor burden similar to that in SIGIRR−/− mice (Figure 2.12). Taken together, these results suggest that loss of complex glycan modification and cell surface expression render SIGIRR defective in suppressing colitis-associated tumorigenesis.

Figure 2.10 (A) Colocalization signal of SIGIRR and Na+-K+ATPase was quantified for each sample on the tissue array described previously. The signal intensity was correlated with the tumor grade. (B) Immunostaining of a stage II colon cancer for SIGIRR showing the progressive changes from normal to cancer. (C) RNA from adenoma tissue (7 cases in total) and normal tissue was analyzed with real-time PCR. SIGIRR, single immunoglobulin and toll-interleukin 1 receptor.

42 Because coexpression of SIGIRRN85/101S suppressed the full-length SIGIRR modification and cell surface expression in vitro (Figure 2.11A), we then tested the dominant negative function of the MT-SIGIRR in vivo. We crossed MT-SIGIRR onto SIGIRR+/− background to test the impact of MT-SIGIRR expression on endogenous SIGIRR protein.

Consistent with the in vitro experiments, MT-SIGIRR expression significantly reduced the modification of endogenous wild-type SIGIRR protein in mouse colonic epithelial cells (Figure 2.13A). Moreover, expression of the MT-SIGIRR increased the average tumor number and tumor size when the mice were subjected to AOM-DSS treatment (

Figures 2.13B and C). Interestingly, the phenotype of MT-SIGIRR is reminiscent of the gene expression profile observed in SIGIRRΔE8 high human colon cancers, which is suggestive of an inflammatory microenvironment. Among the genes that are upregulated in SIGIRRΔE8 high human colon cancer, we found increased expression of Mmp8 and

Duox2 in the tumor burden from MT-SIGIRR, SIGIRR+/− mice compared to that in

SIGIRR+/− mice (Figure 2.13D). In addition, MT-SIGIRR–expressing tumors showed increased expression of inflammatory cytokines such as IL-17A and IL-6. Consistent with the cytokine levels, activation of the downstream transcription factors STAT3, and

NFκB, both of which are tumor-promoting factors, was increased in the tumors expressing MT-SIGIRR. Increased activation of these transcription factors was associated with elevated expression their target genes including Bcl-xL and Cox2 (Figure 2.13E).

Results suggest that MT-SIGIRR is capable of acting as dominant negative mutant to suppress wild-type SIGIRR function in vivo, leading to inflamed microenvironment that favors tumor formation and growth.

Figure 2.11 Loss of modification by complex glycan is sufficient to inactivate SIGIRR. (A) HeLa cells were transfected with SIGIRR, SIGIRRΔE8, or SIGIRRN86/106Sand subjected to in situ biotinylation assay followed by Western blot analysis. PD, pull-down; WCL, whole-cell lysates. (B) HeLa cells were transfected with indicated amounts of SIGIRR (WT), or SIGIRRN86/106S(N86/10S) together with NFκB-dependent luciferase followed by luciferase assay and Western blotting. Bar represents SEM of 3 technical replicates. (C) Colon lysates from mice of indicated genotypes were subjected to Western blot analysis. (D) Colon tissue from mice of indicated genotypes were stained with FLAG antibody to visualize the localization of the transgene product. SIGIRR, single immunoglobulin and toll-interleukin 1 receptor.

Figure 2.12 Mice of indicated genotypes were subjected to AOM-DSS induced colon tumorigenesis. (A) Tumor numbers were recorded and plotted. (n = 8 for SIGIRR+/−, n = 7 for SIGIRR−/−, n = 15 for WT-SIGIRR, n = 12 for MT-SIGIRR). (B) Tumor size distribution in mice underwent experiment described for A. (C) Representative

45 macroscopic view of colons from mice of indicated genotypes after the AOM-DSS treatment and H&E staining of tumors from mice of indicated genotypes. (D) 15 days after the initiation of the tumorigenic protocol, the colons were taken for ex vivo culture for 12 hours. Supernatant from the organ culture were subjected to ELISA. (n = 5, error bar represents SEM) (E) Colons from experiments described for panel D were lysed and the lysates were subjected to Western blotting. Each lane represents one mouse. (F) Gene expression analysis by real-time PCR of tumors from mice underwent AOM-DSS. Error bar represents SEM; *P < .05; **P < .0001. AOM-DSS, azoxymethane and dextran sulfate sodium; ELISA, enzyme-linked immunosorbent assay; MT, mutant; SIGIRR, single immunoglobulin and toll-interleukin 1 receptor; WT, wild type.

Figure 2.13 Loss of modification by complex glycan is sufficient to inactivate SIGIRR in tumorigenesis. (A) Colonic epithelial cell lysates from MT-SIGIRR, SIGIRR+/− mouse, and SIGIRR+/− mouse were subjected to Western blot analysis with anti-SIGIRR

47 antibody. (B) Mice of indicated genotypes were subjected to AOM-DSS treatment. Tumor numbers and sizes were recorded and plotted. (n = 7 for SIGIRR+/−; n = 10 for MT-SIGIRR, SIGIRR+/−). (C) Representative macroscopic view of colons from mice of indicated genotypes after the AOM-DSS treatment and H&E staining of tumors. (D) Tumors from mice of indicated genotypes were subjected to real-time PCR analysis of indicated genes. (E) Tumor lysates were subjected to Western blotting. Each lane represents 1 mouse. HT-29 cells were infected with lentivirus carrying an empty vector, shRNA targeting SIGIRR, or SIGIRRΔE8 cDNA under a CMV promoter. Cells were cultured in the presence or absence of IL-1β for 5 days, followed by crystal violet staining for formed colonies and colorimetric quantification of the colony formation. Error bar represents SEM. *P < 0.05. AOM-DSS, azoxymethane (AOM) and dextran sulfate sodium (DSS); CMV, cytomegalovirus; H&E, hematoxylin and eosin; MT, mutant; SIGIRR, single immunoglobulin and toll-interleukin 1 receptor; TG, transgenic.

Consistent with the increased tumor growth in MT-SIGIRR, SIGIRR+/− mice, we found that overexpression of SIGIRRΔE8 and SIGIRRN86/102S in HT-29 colon cancer cell line increased the colony formation capacity of the HT-29 cells in the presence of IL-1β compared to those with empty vector (Figure 2.13F). Taken together, our data suggest that modification by complex glycan and cell surface expression is required for SIGIRR to inhibit excessive intestinal inflammation and tumorigenesis.

Discussion

In this study, we identified a dominant negative isoform of SIGIRR, SIGIRRΔE8 that is strongly associated with human colon cancer. Increased expression of SIGIRRΔE8 was found in a cohort of 68 cases of colorectal cancer tissues compared with paired normal tissues. SIGIRRΔE8 exhibited reduced modification by complex glycan with increased retention in the cytoplasm. This cytoplasmic retention of SIGIRRΔE8 is likely due to its interaction with ER protein RPN1, resulting in decreased expression on the cell membrane and loss of the inhibitory effect on IL-1R signaling. On the other hand,

48 SIGIRRΔE8 retains the ability to interact with full-length SIGIRR thereby exerting a dominant negative effect on the function of full-length SIGIRR. Importantly, SIGIRR exhibited drastically increased cytoplasmic localization and decreased cell surface expression in human colon cancer compared to normal tissue, consistent with the increased ratio of SIGIRRΔE8 versus full-length SIGIRR. Thus the exclusion of exon 8 is a mode of action commonly taken by colorectal cancer to inactivate SIGIRR via dominant negative effect of SIGIRRΔE8 (Figure 2.14).

The tumorigenesis of CRC is a multistep process, during which mutations of oncogenes and tumor suppressor genes accumulate to enable malignant transformation.2 and 3

Alternative splicing is one of the mechanisms cancer cells use to overcome suppression to gain growth advantage. Our previous structure-function analysis showed that the TIR domain of SIGIRR contributes to the suppression of TLR4, IL-1R, and ST2. Exclusion of exon 8 compromised the integrity of the TIR domain in SIGIRR. Meanwhile, deletion of exon 8 also prevented the protein from trafficking to the cell membrane. Thus, exclusion of exon 8 represents an efficient way to ensure the inactivation of SIGIRR to gain growth advantage.

One important question is what controls the expression of SIGIRRΔE8. Interestingly, sequence analysis predicted exon 8 would be a “weak” exon (with a high probability of exclusion) due to the short intron between exon 7 and exon 8 and a secondary structure within this intron. Intriguingly, we found a CTCF binding site in exon 8, and CTCF binding to its cognate DNA motif has been reported to promote the inclusion of weak exons. Notably, the binding of CTCF can be reduced by methylation on its binding site.

Figure 2.14 Diagram showing the proposed model of SIGIRR inactivation in human colorectal cancer. Normal colonic epithelial cells express the full-length SIGIRR protein as the dominant form, which is modified by complex glycan and is localized on the cell membrane, where it inhibits interluekin-1 receptor (IL-1R). In colorectal cancer, overexpression of the SIGIRRΔE8 isoform leads to the retention of full-length SIGIRR in the endoplasmic reticulum (ER), preventing its modification in the Golgi apparatus and localization to the cell membrane.

As such, we postulate that in the normal colonic epithelial cells, CTCF constitutively binds to the cognate sequence in exon 8 to promote the expression of full length SIGIRR.

However, the CTCF binding may be reduced as a result of the hyper-methylation in the cancer cells, leading to expression of SIGIRRΔE8. Our preliminary results indeed showed that the expression of SIGIRRΔE8 was decreased by treatment with decitabine

50 (unpublished data, 2015), an inhibitor for DNA methytransferase. The regulation of

SIGIRRΔE8 expression by methylation and CTCF represents an interesting prospect for future investigation.

Increased ER retention of SIGIRRΔE8 was an unexpected observation. However the regulation of protein trafficking by cis-elements was documented before. A likely possibility is that deletion of exon 8 changed the conformation of the cytoplasmic domain of SIGIRR, which in turn exposed a cryptic ER retention signal that promotes the retrograde transport of the protein from Golgi body. Therefore, the regulation of SIGIRR modification by complex glycan and its membrane expression may be tightly regulated by retrograde transport, as abnormal retrograde trafficking has been linked to many diseases. Recently, a study found that dysregulation of the trafficking of TLRs leads to spontaneous intestinal inflammation. Collectively, the drastic impact of exclusion of exon

8 on the intracellular trafficking and glycosylation of SIGIRR may represent a novel mode of action that promotes cancer development.

Exclusion of exon 8 resulted in aberrant trafficking of SIGIRR, which leads to a drastic loss of complex glycan modification and abolishes its cell surface expression. Colon cancer cells are known to exhibit abnormal glycosylation of proteins. We used a glycosylation mutant that showed substantially reduced complex glycan modification and defective cell surface expression to model the impact of SIGIRRΔE8 in tumorigenesis. By re-expressing wild-type and glycosylation mutant SIGIRR specifically in the colonic epithelia cells of SIGIRR-deficient mice, we demonstrated that the complex glycan modification and cell surface expression is required for the functionality of SIGIRR

51 in vivo. Future studies are required to investigate whether SIGIRR might be inactivated in a subset of colon cancer patients at the levels of glycosylation without impacting on its intracellular trafficking.

52 Materials and Methods

Ethical Guidelines

Collection and analysis of clinical samples (normal epithelium and colon cancer specimen) was approved by the Institutional Review Board of the Cleveland Clinic

Foundation. The Institutional Animal Care and Use Committees of the Cleveland Clinic approved all animal experiments.

RNA Sequencing Analysis

RNA sequencing analysis was performed on a previously described dataset.18 The analysis of differential exon expression was based on reads per kilobase per million

(RPKM) mapped read values derived as previously described.18 Analysis of junction reads was performed by aligning raw sequencing data with the spliced transcripts alignment to a reference (STAR) software followed by enumeration of individual read counts. Sequencing and genotype data were deposited in the European Genome-Phenome

Archive (http://www.ebi.ac.uk/ega/) under accession number EGAS00001000288.

Biological Reagents and Cell Culture

Recombinant human IL-1β was purchased from R&D Systems. Anti-hemagglutinin (HA) and anti-FLAG (H3663) antibodies were purchased from Sigma-Aldrich. Anti-SIGIRR antibody used in immunostaining (code HPA023188) was validated by the human protein atlas project and purchased from Sigma-Aldrich. Anti-SIGIRR antibody for Western blotting (code AHP1784T) was purchased from AbD Serotec (Oxford, UK). Anti-RPN1

53 (code ab123904) and anti-Na+-K+ ATPase (code ab58475) antibodies were purchased from Abcam (Cambridge, MA). Human colon cancer tissue array was purchased from

Abcam.

Luciferase Reporter Assays

HeLa cells were transiently transfected using FuGENE 6 (Roche Diagnostics,

Indianapolis, IN) with NFκB luciferase reporter plasmid following the manufacturer′s protocol. Empty vector was used to ensure all wells received equal amounts of DNA. 24 h after transfection, cells were stimulated with 1 ng/mL IL-1β for 8 hours. Cells were lysed, and luciferase activity was assessed using reporter lysis buffer and luciferase assay reagent (Promega, Madison, WI). All results reported are technical triplicates representing at least 3 independent experiments.

Plasmid

DNA encoding N-terminal FLAG-tagged SIGIRR was cloned into the vector pCDAN3.1

(+) purchased from Invitrogen. Site-directed mutagenesis was performed on N-terminal

FLAG-tagged single immunoglobulin and toll-interleukin 1 receptor (SIGIRR) on pcDNA3.1 (+), using a QuickChange kit (Agilent Technologies, Wilmington, DE) according to the manufacturer′s instruction. In all cases, the asparagine was mutated to serine on the plasmid. 5′ rapid amplification of cDNA ends (RACE) was performed using a kit from Invitrogen (catalog 18374-058; Invitrogen, Carlsbad, CA) according to the manufacturer′s instruction. HA and FLAG-tagged Full-length SIGIRR and SIGIRRΔE8

54 expression plasmids were constructed by subcloning from the 5′ RACE product into a pcDNA3.1 (+) vector.

Construction of SIGIRR-Transgenic Mouse

Transgenic construct was generated as described before. DNA encoding mouse SIGIRR was placed under the control of transcriptional regulatory elements derived from a fatty acid-binding protein gene followed by the human growth hormone reporter (hGH) gene.

A FLAG tag was included at the N terminus of SIGIRR to distinguish the transgene from the endogenous gene. Site-directed mutagenesis was performed on the construct carrying wild-type (WT) SIGIRR sequence to generate mutant transgene. Both constructs were sent to the Transgenic and Targeting Facility at Case Western Reserve University. Mice carrying transgenes were genotyped with polymerase chain reaction to detect the presence of the hGH sequence. Transgenes were bred with SIGIRR knockout mice to generate the SIGIRR−/−, WT-SIGIRR, SIGIRR−/−, and MT-SIGIRR strains.

Tumorigenesis

Procedure 8-week-old mice (SIGIRR−/−, Fabpl-SIGIRR/Fabpl-SIGIRRN85/101S and their

SIGIRR−/− littermates were on mixed C57BL/6×129/SvJ background) were injected with azoxymethane (AOM; Sigma-Aldrich, St. Louis, MO) dissolved in 0.9% NaCl intraperitoneally at a dose of 12.5 mg/kg body weight. Five days after injection, mice were treated with 2.5% dextran sulfate sodium (DSS) in drinking water, then followed by regular water for 16 days. This cycle was repeated twice. Two weeks after the last DSS treatment, mice were sacrificed, and murine colons were removed and flushed carefully

55 with phosphate-buffered saline (PBS). Colon tumors were counted and measured using a stereomicroscope. Representative tumors were paraffin embedded and sectioned at 5 µm.

Histology analysis was carried out on hematoxylin-eosin (H&E)-stained tumor sections.

In Situ Biotinylation, Immunoprecipitaion

Biotinylation was performed by rinsing transfected cells with cold PBS followed by incubation with freshly prepared 10 mM sulfo-NHS-biotin dissolved in cold PBS for 2 hours. The labeling process was stopped by siphoning away the labeling reagent and quenching the with 100 mM glycine dissolved in PBS. The cells were then harvested and lysed for lysates. The supernatant was collected for Western blotting or enzyme-linked immunosorbent assay (ELISA) analysis. Co-immunoprecipitation was performed by incubating cell lysates with antibodies and protein A beads, or avidin conjugated beads at

4°C overnight. Precipitated protein-beads complex was washed with lysis buffer followed by elution with 2× sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-

PAGE) loading buffer.

Transfection, Kifunensine, PNGase F Treatment and Western Blotting

Transfection was performed using Fugene 6 according to the manufacturer′s protocol. For kifunensine treatment, the inhibitor was added 8 hours after transfection and the cells were harvested 48 hours after transfection. PNGase F was purchased from New England

Biolabs (Ipswich, MA) and used according to the manufacturer′s instruction. Cells were lysed in lysis buffer (0.5% Triton X-100, 20 mM HEPES (pH 7.4), 150 mM NaCl, 12.5 mM β-glycerophosphate, 1.5 mM MgCl2, 10 mM NaF, 2 mM dithiothreitol [DTT], 1 mM

56 sodium orthovanadate, 2 mM EGTA, 1 mM phenylmethylsulfonyl fluoride and complete protease inhibitor cocktail from Roche). Western blotting was performed after SDS-

PAGE, following standard procedure. For analysis of immunoprecipitation samples, anti- light chain secondary antibody (Jackson Immuno Research, West Grove, PA) was used.

Quantitative Real-Time PCR

In all experiments, RNA was extracted with TRIzol (Invitrogen) followed by reverse transcription with SuperScript II reverse transcriptase (Life Technologies, Carlsbad, CA) according to the manufacturer′s instruction. Real-time PCR analysis was performed usin

SYBR Green Master mixture (Agilent Technologies). Primer sequences were Mmp8 forward-5′ CCAGCACCTATTCACTACCTC 3′ and reverse-5′

AGCATCAAATCTCAGGTGGG3′; Duox2 forward-5′

CTTCCACATCTACTTCCTGGTC 3′ and reverse-5′ AATGTCTTGGGTCTCTGGAAC

3′; SIGIRR exon4 forward-5′ ACTACAGCCTCCACGAGTAC 3′ and reverse-5′

CCATAGACTTCAGTGCTGGTC 3′; and SIGIRR exon8 forward-5′

CTCTTGGTGAACCTGAGCC 3′ reverse-5′ CCCTCGAAGGTGATGAAGATG 3′. The standard curve for quantification of SIGIRRÄE8 was established by amplifying cDNA of full-length SIGIRR and SIGIRRΔE8 mixed at the indicated ratio (total input of 10 ng of plasmids) and calculating the Ct difference.

57 Immunofluorescence

Formalin-fixed and paraffin-embedded colon sections or tumor samples were deparaffinized, rehydrated, and pretreated with 3% hydrogen peroxidase in PBS buffer for 20 minutes. Antigen retrieval in DAKO′s antigen retrieval buffer (DAKO,

Carpinteria, CA) was conducted in a steam cooker for 20 minutes at 96°C, followed by slowly cooling to room temperature. After being blocked with 10% normal goat serum, sections were incubated with primary antibody overnight at 4°C. Then, sections are washed with PBST and stained with corresponding secondary antibodies and 4',6- diamidino-2-phenylindole (DAPI). Stained slides are examined using confocal microscopy for analysis.

Colon Culture

Colon tissue from mice on day 15 of the AOM-DSS protocol was washed in cold PBS supplemented with penicillin and streptomycin. Tissue was then cut into small pieces and cultured in 12-well flat bottom culture plates (Falcon, Pittsburgh, PA) in serum-free

RPMI medium supplemented with penicillin and streptomycin. After incubation at 37°C for 24 hours, medium was collected and tested using an ELISA kit purchased from R&D

Systems (Minneapolis, MN). Colon orgagnoids were isolated following a previously described protocol. Briefly, normal colon mucosa was isolated and minced. Minced tissue was subjected to collagenase I (Sigma-Aldrich) incubation for 30 minutes at 37°C.

Digested tissue was then filtered through a 70-µm cell strainer and washed with

DMEM/F12 medium. Isolated crypts were precipitated and embedded in Matrigel

(Corning Life Sciences, Corning, NY) and cultured in the presence of mouse wnt3a,

58 human R-spoind1, human EGF, and mouse Norggin (+WNR) or in the presence of human EGF only.

Cell Sorting

Normal human mucosa and cancer tissue was washed with cold PBS and minced. Minced tissue was then digested with collagenase I at 37°C for 30 minutes. Isolated crypts were further digested with trypsin LE (Life Technologies) for 10 minutes to create single-cell suspension. Cells were then washed and stained with fluorophore conjugated antibodies. anti-human LGR5 antibody and anti-human EpCam antibody were purchased from

Miltenyi Biotec (San Diego, CA).

Statistical Analysis

Normality of data was not formally tested. Therefore non-parametric statistics was applied in all data analysis. Mann-Whitney U test was used to determine the P value of mean difference in 2-group comparison.

Chapter 3:

IL-17-signaling induces Plet1 expression in LGR5-positive cells contributing to

tumorigenesis

Portions of this chapter include data contributed by the courtesy of Dr.Jarod Zepp

60 Proper maintenance of the gastrointestinal tract is essential in preventing systemic absorption of enteric toxins and bacteria. Disturbance of the intestinal epithelium homeostasis, by physical, chemical injury or microbial infections, can lead to intestinal barrier dysfunction, which is a main feature of inflammatory bowel diseases (IBD).

Evidence suggests that colon cancer is also associated with microbial infection, injury, inflammation and tissue repair processes. While it is well documented that chronic colonic inflammation, is a major risk factor for the development of colon cancer, it is still an evolving research area for how inflammation and subsequent tissue repair are intrinsically linked to colon cancer.

SIGIRR deficiency in T cells leads to hyperactivity of the Th17 population. Previous studies have shown that CD4+ IL-17-producing, Th17 cells are abundant in the intestinal mucosa and regulated by commensal bacteria. Induction of Th17 cells has been shown to promote colon tumorigenesis in mouse models. Consistently, mice lacking IL-17A or

IL17RA are protected from intestinal/colon tumor development. In Apcmin mice, which spontaneously develop intestinal adenomas, IL-17A or IL-17RA deficiency resulted in significantly fewer adenomas. Furthermore in models of colitis associated cancer (CAC), where a pre-malignant cell is induced with the carcinogen azoxymethane (AOM) and promoted by repeated cycles of dextran sulfate sodium (DSS), mice deficient in IL-17A also develop fewer colonic tumors. However, the role of IL-17A in the intestinal tract is rather complex. Although traditionally considered only as pro-inflammatory cytokine, IL-

17A exerts a protective role in the intestine as blockade of IL-17A in IBD patients exacerbates intestinal inflammation. Hence, current evidence suggests that additional

61 functions of IL-17 signaling, other than its pro-inflammatory role, underlies the tumor- promoting effect and the precise mechanism remains to be identified.

The receptor for IL-17A is a heterodimeric complex composed of IL-17RA and IL-17RC.

In this study, we report that IL-17 provides a critical link between colon tissue repair and tumor development. IL-17RC deficiency compromised tissue repair with defective regenerative proliferation in the colon epithelium, and IL-17RC-deficient mice had markedly reduced tumor burdens in the AOM/DSS colon cancer model. Gene array analysis identified several novel IL-17 target genes, including PLET1 (a progenitor cell marker involved in wound healing), that were highly induced in DSS-treated colon tissues and tumors. While DSS induced PLET1 in the LGR5+ stem cells, LGR5+PLET1+ marked a group of highly proliferative cells with enhanced expression of IL-17 target genes. Importantly, PLET1 deficiency hindered the tissue repair and attenuated tumor formation in AOM/DSS model. Our results demonstrate that IL-17-induced PLET1 expression plays a critical role in tissue repair and colon tumorigenesis.

62 Results

IL-17RC-deficiency attenuates tumor development

We first tested how deletion of IL-17RC affected colon cancer development and progression in CAC. In Il-17rc–/– mice, AOM/DSS-induced tumor numbers and sizes were significantly reduced (Figure. 3.1A,B). Interestingly, the immune cell infiltration into the tumor, including CD4+ T cells and CD11b+ myeloid cells, were similar between

WT and Il-17rc–/– mice (Figure. 3.1C). Notably, compared to the tumors in the controls,

Il-17rc–/– tumors exhibited reduced staining for the proliferative marker Ki67, although no differences in nuclear localization of b-catenin were detected (Figure. 3.1C).

Consistent with reduced proliferation in the tumors, CYCLIN-D levels were markedly reduced in the Il-17rc–/– tumors (Figure. 3.1D). Activation of transcription factors NFkB and STAT3, were however comparable between the WT and Il-17rc–/– tumors (Figure.

3.1D). Together these results suggest that the reduced tumorigenesis is unlikely due to a decrease in inflammation in the Il-17rc-/- mice.

IL-17RC-deficiency impairs regenerative response following DSS-induced injury

Intriguingly, the Il-17rc–/– mice exhibited reduced survival compared to WT mice in spite of a decreased tumor burden (Figure. 3.1E), which led us to hypothesize that IL-17 plays a protective role in gut injury/inflammation. Indeed, the Il-17rc–/– mice lost significantly more weight after DSS treatment compared to WT (Figure. 3.2A). DSS treatment induces colonic inflammation that leads to tissue damage and upon its withdrawal tissue repair process predominates. Thus, Il-17rc–/– and control mice were treated with DSS for 5-days followed by 5 days of regular water to allow for the epithelium to recover. Notably, the

Figure 3.1. IL-17RC mediates colon tumorigenesis in CAC model. (a, top) Schematic of CAC model (a) Tumor number (b) Tumor size distribution (a and b n=12 per group), (c) IHC images from WT and IL-17RC-deficient tumor tissue stained for the indicated markers. (d) Immunoblot analysis of colon tumor tissue from the indicated mice, each lane represents one mouse. (e) Percent survival of the indicated mice throughout the CAC model. Representative images and data are shown in (c). Quantification was performed on staining of 5 tumors from each group and in 3 views per sample. Error bars represent mean ± SEM scale bars =100µm, p values shown are * <0.05.

Figure 3.2 IL-17RC-deficiency impacts colon epithelial integrity and wound healing response. (a) Weight loss during first 15 days of CAC (b) H&E or IHC staining for Ki67 in colon tissue from DSS-treated WT and IL-17RC-deficient mice. Mice were treated with DSS for 5-days followed by 5 days of regular water to allow for the epithelium to recover. (c) Quantification of Ki67 staining. (d) Serum FITC signal from mice treated with 3.5% DSS for 5 days followed by DSS withdrawal for 5 days, and then gavaged with FITC-dextran. Data shown is from a representative experiment with n=4 mice per group. (e) RT-qPCR from colon tissue of mice from day 10 of the DSS treatment, n=4 mice per group. All gene expression values were normalized to b-actin. (f) Immunoblot analysis of DSS treated colon tissue from WT or IL-17RC-deficient (KO) mice. Each lane represents a single mouse. Quantification was performed on staining of 3 colon sections from each group and in 3 views per sample. Experiments were reproduced 3 times, error bars represent mean ± SEM scale bars =100µm, p values shown are * <0.05, ** <0.01, *** <0.001.

65 Il-17rc–/– and control mice showed similar tissue injury at day 5 of DSS treatment

(Figure. 3.2B). On the other hand, whereas WT mice had replenished the DSS-injured epithelium with highly proliferative nascent crypts 5 days after DSS removal (termed d10), this tissue repair was markedly impaired in the Il-17rc–/–mice (Fig. 3.2B). In support of this, we detected less Ki67 staining in the colon of Il-17rc–/– mice on day 10 (5 days after DSS removal) compared to that of wild-type mice (Figure. 3.2B and C). We then checked the gut permeability in these mice on day 10 (5 days after DSS removal) using FITC-dextran assay. Consistently, we detected more FITC in the serum of Il-17rc–/– mice than that in littermate controls (Figure. 3.2D), suggesting that DSS-treated Il-17rc–/– mice have a defective in tissue repair.

Several studies report that STAT3-activating cytokines, IL-6, IL-11 and IL-22 are critical mediators of the colon tissue repair response and colon tumorigenesis. Nevertheless, expression of these cytokines in the colonic tissue of IL-17RC-deficient mice was equivalent to that in WT controls (Figure. 3.2E). Furthermore, STAT3 and NFkB activation were similarly active within the Il-17rc–/– colon tissue compared to littermate controls (Figure. 3.2F). Thus, the impact of IL-17 on colonic tissue repair and barrier integrity may not be due to defective production of STAT3 activating cytokines. On the other hand, it is intriguing that ERK1/2 and ERK5 activation were dramatically reduced in the IL-17RC-deficient colon tissue compared to littermate controls (Figure. 3.2F), suggesting an critical role of ERKs in IL-17-dependent tissue repair in response to DSS- induced injury.

Figure 3.3 IL-17RC-dependent gene analysis during regeneration and in established tumors. Volcano plots from Affymetrix gene-array comparing (a) day 10 (3.5% DSS for 5 days followed by DSS withdrawal for 5 days) colon tissue (n=4 per group) and (b) tumor tissue (n=5-6 per group) mRNA between WT and IL-17RC-deficient mice. Expression data were averaged and p-values derived by fold-change in expression between IL-17RC-deficient and WT, dotted line represents a p-value of 0.05 as determined by unpaired two-tailed t-test. (c) Table of genes significantly reduced in the tumors of IL-17RC-deficient mice, and their known functions, * references as cited in the text. (d) Gene expression by RT-qPCR from untreated and DSS Day 10 treated colon tissue, n=5 mice per group or (e) RT-qPCR results from normal-adjacent (N) and tumor tissue (T), n=5-6 mice per group. (f, top) Schematic of colonosphere isolation and IL-17 treatment procedure. (f, bottom) Gene expression by RT-qPCR from colonospheres generated from WT mice. Spheres were grown for one week and then treated with IL-17 (50 ng/ml) for 24 hours, shown are representative data from 3 independent experiments, RT-qPCR data in d-f were normalized to b-actin. Data presented as mean ± SEM, p values shown are * <0.05, ** <0.01, ***<0.001.

IL-17 novel target genes are highly induced in regenerating and tumor tissues

These data thus far suggest that the impact of IL-17 in colon tumorigenesis might be linked to its role in the tissue regeneration/repair process. Previous studies have suggested that genes involved in tissue repair may also contribute to the survival of pre-

67 malignant cells during tumor growth. Thus, we sought to determine IL-17-responsive genes that might link tissue repair and tumor development. We performed gene array analysis on colonic tissue during recovery-phase after DSS withdrawal (day 10) and tumor tissue (tumor) from Il-17rc–/– and WT mice. The impact of IL-17RC deficiency on the global gene expression profiles of the day 10 colon tissues and tumor tissues were determined (Figure. 3.3A and B). Interestingly, several genes with possible functions at barrier surfaces were significantly reduced in the Il-17rc–/– colon tissues and/or tumors, including Pigr, Fut2, Cd177 and Plet1 (Figure. 3.3 A, B and C). These genes were further confirmed by quantitative RT-PCR (Figure. 3.3D and E).

Next, we sought to determine whether these genes (Plet1, Cd177, Fut2 and Pigr) are directly regulated by IL-17 in colon epithelial cells. Thus we isolated primary murine colon crypt cells, which is comprised of LGR5+ stem cells and differentiated cells, and embedded these cells into a 3-D matrix (matrigel) for colonosphere formation in the presence and absence of exogenous IL-17 (Figure. 3.3E). While Pigr is a known IL-17 target gene, IL-17 also highly induced the expression of Plet1 and Cd177 in colonosphere culture (Figure. 3.3F). Although IL-17-induced Fut2 expression was modest in the colonospheres, its high expression in the DSS-treated and tumor tissues was partially dependent on IL-17RC, suggesting that IL-17 may cooperate with other extrinsic factors to promote its expression in vivo. Notably, Plet1 was the most highly induced gene in vivo both in colonic tissue during recovery-phase after DSS withdrawal (day 10) and tumor tissue (tumor).

68 PLET1+LGR5+ mark a highly proliferative cell population expressing IL-17-target genes

Previous studies have shown that intestinal stem cells (including the LGR5+ cells) are essential for tissue repair as well as tumorigenesis. We then sought to determine the cellular origin of PLET1-expression in relation to LGR5+ cells in response to DSS. We isolated colonic epithelial cells from naïve or DSS-treated Lgr5-eGFP-creERt2 mice, followed by FACS for PLET1 and LGR5 expression (Figure. 3.4A). DSS-induced PLET expression was primarily restricted to the LGR5+ cells, giving rise to two distinct cell populations, LGR5+ (G) and PLET1+/LGR5+ (G+P) (Figure. 3.4A). Interestingly, the

PLET1–expressing cells exhibited higher expression levels of late S-phase cyclins,

Cyclin A1 and Cyclin B (Figure. 3.4B). In addition, Plet1 expression co-localized with

Ki67+ cells in DSS-treated colon tissue and tumor (Figure. 3.4C). These results suggest that PLET1+/LGR5+ (G+P) marked highly proliferative cells. Furthermore, other IL-17- regulated genes, Fut2, Pigr and Cd177 were also increased in the G+P cells (Figure.

3.4B), implicating that PLET1+/LGR5+ (G+P) might be an IL-17-responsive cell population. Indeed LGR5-specific Act1-deficiency (abrogating IL-17 pathway) resulted in a substantial reduction of PLET1+/LGR5+ (G+P) cells compared to that from control mice in response to DSS (Figure. 3.4E), confirming that this DSS-induced cell population was IL-17-dependent. Consistently, the expression levels of the other IL-17 target genes were also ablated from the Act1F/–Lgr5cre cells (Figure. 3.4F). Moreover, the reduction of

PLET1+/LGR5+ (G+P) cell population in Act1F/–Lgr5cre mice was accompanied by impaired tissue repair (Figure 3.5A and B) and attenuated AOM/DSS colon

69 tumorigenesis (Figure 3.5C), implicating the functional importance of the

PLET1+/LGR5+ cell population.

70 Figure 3.4. IL-17RC-dependent gene analysis during regeneration and in established tumors. Volcano plots from Affymetrix gene-array comparing (a) day 10 (3.5% DSS for 5 days followed by DSS withdrawal for 5 days) colon tissue (n=4 per group) and (b) tumor tissue (n=5-6 per group) mRNA between WT and IL-17RC- deficient mice. Expression data were averaged and p-values derived by fold-change in expression between IL-17RC-deficient and WT, dotted line represents a p-value of 0.05 as determined by unpaired two-tailed t-test. (c) Table of genes significantly reduced in the tumors of IL-17RC-deficient mice, and their known functions, * references as cited in the text. (d) Gene expression by RT-qPCR from untreated and DSS Day 10 treated colon tissue, n=5 mice per group or (e) RT-qPCR results from normal-adjacent (N) and tumor tissue (T), n=5-6 mice per group. (f, top) Schematic of colonosphere isolation and IL-17 treatment procedure. (f, bottom) Gene expression by RT-qPCR from colonospheres generated from WT mice. Spheres were grown for one week and then treated with IL-17 (50 ng/ml) for 24 hours, shown are representative data from 3 independent experiments, RT-qPCR data in d-f were normalized to b-actin. Data presented as mean ± SEM, p values shown are * <0.05, ** <0.01, ***<0.001.

Figure 3.5 Lgr5 specific ablation of ACT1 impairs barrier integrity and CAC tumorigenesis. (a) Serum FITC signal from mice treated with 3.5% DSS for 5 days followed by DSS withdrawal for 5 days, and then gavaged with FITC-dextran. Shown is a representative experiment with n=4 mice per group. (b) Act1f/–Lgr5cre (n=5) and controls

71 (n=5) were injected with tamoxifen as described previously. The mice were then treated with 3.5% DSS for 5 days followed by DSS withdrawal for 5 days. Colons from mice of indicated genotype were stained with H&E and Ki67. (c) Tumor number and tumor size distribution from Act1f/–Lgr5cre and control mice after the CAC model. Quantification was performed on staining of 3 colon sections from each group and in 3 views per sample. Data presented as mean ± SEM, p values shown are * <0.05, ** <0.01.

PLET1 promotes ERK1/2 activation, tissue repair and tumorigenesis

We then studied how IL-17 signaling leads to up-regulation of plet1 expression. It is noteworthy that the activation of ERKs was dramatically reduced in the DSS-treated IL-

17RC-deficient colon tissue compared to littermate controls (Figure. 3.2E). We recently reported that IL-17 induced ERK5 activation controls the keratinocyte proliferation in the inflammation associated skin cancer model. We hypothesized that the same pathway also operates in the colonic epithelial cells. ERK5 activation was indeed markedly increased in colon crypt cells following IL-17 stimulation (Figure 3.6A). Furthermore, inhibitor of

MEK5 (BIX01289, the upstream MAP2K for ERK5), reduced the expression of PLET1 in DSS-treated colon crypts (Figure. 3.6C), and increased the gut permeability (Figure.

3.6B), indicating that IL-17-induced plet1 expression is ERK5-dependent during tissue repair process in the colon.

To investigate the functional importance of PLET1, we generated plet1 knockout mice using CRISPR-Cas9 technology. We introduced a frameshift in the coding region of

PLET1 to abolish the protein expression (Figure. 3.7). We subjected the Plet1-/- and

Plet1+/- littermate control mice to the same DSS treatment as described for figure2: mice were treated with DSS for 5-days followed by 5 days of regular water to allow for the epithelium to recover. Histologically, the Plet1-/- and Plet1+/- littermate control mice

Figure 3.6. PLET1 is an ERK5-target and promotes cell transformation and P- ERK1/2 signaling. (a) Lysates from colon crypts of WT mice untreated or stimulated with IL-17 (50 ng/ml) were analyzed by western blotting with the indicated antibodies. (b) Serum FITC-dextran from DSS treated or untreated (Supple. Fig 1) mice injected with BIX02189 or vehicle control, shown are representative results from two independently performed experiments. (c) Western analysis of lysates from colon epithelial cells of mice treated with BIX01289 and DSS for 5 days followed by 5 days of DSS removal. Each lane is from one mouse. Band intensity normalized to b-ACTIN is indicated below the blots. (d-f) Plet1-/- (n=5) and Plet1+/- (n=6) littermate control mice were subjected to 3.5% DSS treatment for 5 days followed by 5 days of DSS withdrawal. On day 10 mice were subjected to gut permeability assay using FITC dextran (e). The mice were sacrificed and the colons were taken for H&E and Ki67 staining (d) or western blot analysis (f). (g) Plet1+/- (n=15) and Plet1-/- (n=10) mice were subjected to AOM- DSS regiment. Number of tumors per mouse and tumor size distribution were plotted. (h) Representative image of H&E and Ki67 staining of tumors from mice of indicated genotypes. Quantification is shown as bar graph to the right. Quantification of histology

73 was performed on staining of 3 colon sections from each group and in 3 views per sample. All data presented are means ± SEM, p values shown are * <0.05, **<0.01.

Figure 3.7 The Cas9/gRNA-targeting site in mouse Plet1. (a.) The gRNA-targeting sequence is underlined and the deletion sequence is indicated in green. Exons are indicated by closed boxes and the boxed sequence indicates the BtsCl restriction site in the deletion region. (b.) PCR products were digested with the restriction enzyme BtsCl that cleaves at the Cas9 endonuclease target site and then analyzed by gel electrophoresis. PCR products generated from DNA containing deleted sequence were uncleaved and larger than the product generated from the wild-type DNA.The mutant plet1 gene expresses a truncated plet1 protein [containing 53AA from plet1 with deletion from 54 aa-end (237aa), the mature truncated protein should only contain 53-27=26 aa from plet1 given that the signal peptide is 27aa].

exhibited similar epithelial erosion, cell infiltration and edema on day 5 (d5) of DSS treatment (Figure 3.6D). On the other hand, whereas Plet+/- mice had replenished the

DSS-injured epithelium with highly proliferative nascent crypts 5 days after DSS removal (termed d10), this tissue repair was markedly impaired in the Plet1-/- mice

(Figure 3.6D). In addition, Plet1 deficiency also reduced the number of proliferating cells in the recovering epithelium 5 days after withdrawal of DSS (d10, Figure 3.6D).

74 Consistently, 5 days after withdrawal of DSS, Plet1-/- mice exhibited significantly increased gut permeability compared to the Plet1+/- littermate control (Figure 3.6E).

Interestingly, while ERK5 activation was comparable between Plet1+/- and Plet1-/- colon tissue, p-ERK1/2 levels were reduced in the Plet1-/- colon tissue from day 10

(Figure. 3.6F), suggesting that Plet1-dependent ERK1/2 activation might play an important role during the tissue repair process. Plet1-/- and Plet1+/- littermate control mice were subjected to the AOM/DSS colon cancer model. PLET1 deficiency substantially reduced the tumor numbers (Figure 3.6G). The tumors from PLET1- deficient mice showed reduced Ki67 staining, suggestive of an attenuated tumor growth

(Figure 3.6H).

Discussion

In this study, we demonstrate that IL-17 signaling links colon tissue repair and tumor development. We found that PLET1, a progenitor cell marker involved in cell proliferation is highly induced in the Lgr5+ cells in response to IL-17 stimulation. PLET1 was highly enriched in regenerating and tumor tissue in an IL-17RC–dependent manner, and marks a population of highly proliferative cells enriched for IL-17 target genes.

While ERK5-dependent emergence of PLET1 correlated with p-ERK1/2 signaling and colonic barrier function, PLET1 deficiency impaired tissue repair and tumor development, respectively, in DSS-induced colitis and AOM/DSS colitis-associated cancer models. Our results suggest that a unique stem-cell IL-17 response, denoted in part by PLET1 expression, contributes to tissue repair and colon tumorigenesis (Figure

3.8).

Figure 3.8 Model for IL-17 signaling in tissue repair and colon tumorigenesis

Through gene-array analysis of the IL-17RC-deficient colon tissues and tumors, we identified several novel IL-17-regulated genes including Pigr, Fut2, Cd177 and Plet1.

We further confirmed these genes as being regulated by IL-17 in the colonosphere culture. Functionally, these genes have been demonstrated to be important for intestinal/colonic homeostasis. Pigr, a known IL-17 target gene, functions to facilitate transport of mucosal IgA via intracellular vesicles to the gastrointestinal lumen where it can be processed into soluble IgA. In humans Fut2 is critical for processing the H-blood group antigen, the precursor to ABO antigens, at mucosal sites. What is noteworthy is that a reported 20% of Caucasians, homozygous for Fut2 null alleles, do not express

76 ABO antigens in saliva or mucus. Interestingly lack of ABO blood group antigens into body fluids has been associated with Crohn’s disease, development of oral candidiasis, recurrent urinary tract infection and infection with meningococcus to name a few.

Additionally, Cd177 is a documented neutrophil antigen as well as a marker of human colonic epithelial cells and prognostic indicator in colon cancer. Moreover, Cd177 has been reported to interact with CD31 (PECAM) expressed on endothelial cells. Thus it is conceivable that IL-17-dependent regulation of these genes promotes colonic homeostasis all of which may contribute to processes of tissue regeneration and colonic tumorigenesis.

Plet1 showed the highest induction in the wounded tissue and the tumor. It has been shown that Plet1 is up-regulated during wound healing in the skin and can directly influence migration of keratinocytes. During homeostasis, PLET1 expression is restricted to a region within the hair follicle near the upper isthmus and sebaceous gland. While this region contains other distinct progenitor cell populations, upon injury, only the PLET1 expressing cells are drawn out of this niche. Furthermore, PLET1-emergence observed with epidermal Snail-overexpression in skin tumor progression, where PLET1+ cells exhibited elevated expression of cyclins, Foxm1 and other molecules implicated in G2/M cell cycle progression and cytokinesis. Consistent with this report we found that PLET1 was associated with the Ki67 proliferation marker in DSS-treated colon tissue and tumors. Interestingly, cell surface staining of PLET1 revealed a unique cell population that is LGR5+/PLET1+–double positive. Furthermore, the double-positive cells expressed

77 high levels of the identified IL-17-dependent genes and cyclin mRNAs. Together these data are supportive of a plausible LGR5+ stem-cell intrinsic response to IL-17 signaling.

We analyzed the colon tissue for IL-17-dependent signaling pathways that are activated during the tissue repair following DSS-induced injury. Although STAT3 and NFkB have clearly been implicated in mucosal wound healing and tumorigenesis, we did not observe a substantial defect in the activation of these pathways in Il-17rc–/– tissue. Notably, there was a marked impairment in the activation of ERK5 and ERK1/2. Inhibiting the activity of MEK5 (BIX02189), the upstream MAP2K for ERK5, resulted in increased FITC- signal in the serum as well as a significant reduction in PLET1 levels. Importantly,

PLET1 deficiency indeed reduced DSS-induced ERK1/2 phosphorylation, compromised tissue repair and attenuated tumor development in AOM/DSS cancer model. Notably, IL-

22 has also been shown to promote the expression of Plet1 in the gut. Thus future investigations are required for understanding how IL-17 cross-talks with IL-22 in tissue repair and tumorigenesis.

78 Materials and Methods

Mice and husbandry

The IL-17RC-deficient mice, were provided by Dr. W. Ouyang (Genentech) and generated on C57/Bl6 background. The Act1f/f and Act1-deficient (both C57/Bl6) mice were generated as described in. The Lgr5EGFP-IRES-CreERT2 knock-in mice were originally generated as described. The Lgr5EGFP-IRES-CreERT2 mice were crossed to Act1f/f and Act1- deficient mice to generate conditional Act1f/– and Act1f/+ Lgr5cre mice. ROSA26-EGFPf was purchased from The Jackson Laboratory. Plet1 knockout mice were generated with

CRISPR technology in Dr. Yina Huang’s lab. All animal procedures were approved by the Institutional Animal Care and Use Committee of the Cleveland Clinic Foundation.

Colitis Associated Cancer Model

8-week-old gender matched mice (IL-17RC-deficient and WT littermates) were injected with Azoxymethane (Sigma) 12.5 mg/kg. 5 days after the AOM injection, mice were treated with 2.5% DSS in sterile tap water for 5 days. Following this mice were given regular water for 16 days. This cycle was repeated for three cycles, mice were sacrificed

10 days after the end of the third DSS cycle. Tamoxifen injections during the CAC procedure in Act1;Lgr5 conditional knock-outs consisted of two weekly injections of

Tamoxifen prior to AOM administration. Tamoxifen was injected on the first day of DSS treatment cycles throughout the CAC procedure. All tamoxifen injections were 5 mg/ml in corn oil. Mice were sacrificed and colons removed, they were then cut longitudinally and a person blinded to the mouse genotypes counted tumors by magnifying glass. The colon was then either placed in 10% Formalin or embedded in Optimal Cutting

79 Temperature compound (OCT) snap frozen for tissue histology. The tumors were excised and snap frozen in liquid nitrogen for further processing for RNA or protein.

Gut Permeability Assay

Age and gender matched mice were treated with 3.5% DSS for 3 days. On the third day mice were gavaged with 150 µl of 80 mg/ml 4 kDa FITC-dextran (Sigma Aldrich) in

PBS. Mice were sacrificed 4 hours later and blood was collected by cardiac puncture.

Serum fluorescence was quantified using a VictorX3 (Perkin-Elmer Life Sciences) at excitation 485 nm, emission 530 nm for 1 second.

Histology and Immunohistochemistry

Tissues were fixed with 10% formalin and placed into paraffin tissue blocks according to routine methods by AML laboratories, or tissue was embedded in optimum cutting temperature (OCT) and sectioned. Paraffin-embedded were stained according to routine methods and antigen retrieval conducted in Citrate buffer. IHC antibodies included rat anti mouse Ki67 (Dako Cytometry), rabbit anti-mouse Ki67 (Abcam), rabbit anti CD4 and CD11b (eBioscience). Light microscopy images were obtained using an Olympus

BX41 microscope (Olympus Corp.) Immunofluorescence staining was conducted with frozen tissue embedded in OCT sectioned (10µm) and fixed in acetone:methanol for 10 minutes. Secondary antibody conjugated with either, Alexa-Fluor 488 or 594 (Life

Technologies) were used. Sections were mounted with VectaShield fluorescent Mounting

Media (Vector Lab Inc.) containing DAPI to visualize nuclei. a-PLET1 (clone 1D4) was as described (Depreter et al 2008). Rabbit antibody to human PLET1 (C11orf34) was

80 from Sigma-Aldrich Prestige Antibodes by Atlas Antibodies, Visualization of GFP was conducted in fresh tissue fixed overnight in 4% paraformaldehyde, de-hydrated in 20% sucrose then placed in OCT and flash frozen and sectioned. Staining for GFP was conducted on OCT-embedded tissue, fixed for 10 minutes in 2% PFA, and incubated for

2 hours at room temperature with Rabbit a-GFP 8334 (Santa Cruz Biotech) TUNEL assay was performed on frozen sections using TUNEL staining kit (Roche).

Immunofluorescence images were generated using a Leica DM2500 or EVOS Floid

(Applied Biosystems) and fluorescent images were processed using the NIH ImageJ program. Formalin-fixed, paraffin-embedded colon cancer biopsy specimens were obtained from the Department of Pathology, CWRU. Immunofluorescence images were generated as indicated above. Following immunofluorescence microscopy, the same sections were washed in PBS for 4 times and subjected to H&E staining. Quantification of images were either performed with ImageJ to calculate positive signals per view or by manually counting number of positive cells in a crypt or an area equivalent of a crypt in case no discerning structure could be found.

Gene array profiling

A total of 200 ng RNA from whole colon tissue was used for target labeling, and the target preparation was done on a Biomek FXP (Beckman Coulter, Brea, CA) using a

GeneChip HT 3′ IVT Express Kit (Affymetrix, Santa Clara, CA). Labeled cRNA were hybridized on an Affymetrix GeneChip HT-MG-430PM-96 (Affymetrix). All array hybridization, washing, and scanning were performed on GeneTitan (Affymetrix), according to the manufacturer’s recommendations. Anti-log RMA data were used. P

81 value was determined by two-tailed t-tests, p-value of <0.05 were considered significant.

Volcano plots were generated by taking the –Log2 fold-ratio difference in expression value between WT and IL-17RC-deficient tissue and plotting on the x-axis and –Log10 of p-value was plotted on the y-axis and the graphs were generated in Prism 5.0 software

(Graphpad). The biological replicates used for gene array profiling are as follows; Day

15, 4-WT and 4-KO; Tumor 5-WT and 6-KO.

RNA isolation and quantitative PCR

For RNA isolation of colon tissue, freshly isolated colon tissue was snap-frozen in liquid nitrogen and stored at -80°C until processing. Colon tissue was isolated using miR-Vana

RNA isolation Kit (Life Technologies, Ambion) according to the provided protocol.

Colon tissue was homogenized in lysis/binding buffer provided in the kit. Superscript II

Reverse Transcription Kit (Invitrogen) was used to make cDNA from 0.2 – 1 µg total

RNA and rt-PCR performed on a Veriti 96-well ThermoCycler (Applied Biosystems).

Quantitative RT-PCR was carried out using published primers as well as those deposited in PrimerBank (Harvard), oligos were generated by Invitrogen, and SYBR Green

(Applied Biosystems) on a Step-One Plus Real-time PCR machine (Applied Biosystems).

All gene expression data were normalized to ms-actin or hs-gapdh as controls. Unique primers used in this study, mPlet1 forward; tcatccgtgaaaatggaaca reverse; tggctgtagtcttggctgtg. mCd177 forward; gggtgactccaaaacaatcg reverse; ctaacatccaggccgatagc. mFut2 forward; acctccagcaacgaatagtga reverse; gccgatggaattgatcgtgaa. mPigr forward; ccggcacacccggaaatac reverse;

82 Isolation and culture conditions of colonospheres

Colonosphere culture protocol was adapted from (Yui et al., 2012). After the isolation cells were either re-suspended in media for sorting of GFP-positive cells, DMEM-F12, 1x

N2 and B27 supplements (from Invitrogen/Gibco), Pen/Strep, 10 µM HEPES, 10 µM

Y27632 Rock inhibitor (Sigma Aldrich), or suspended in growth media which consisted of DMEM/F12, 1% BSA, 30 ng/ml Wnt3a (R&D systems) 500 ng/ml Rspo1(R&D systems), 50 ng/ml noggin (R&D systems), 20 ng/ml EGF (Peprotech), 50 ng/ml HGF

(R&D systems), + 10 µM Y27632 (Sigma) for the first two days. The cells were further embedded in growth factor reduced Matrigel (BD biosciences) and grown on 96– or 48– well plates, the media was refreshed every two days.

Statistical Analysis

Raw datasets were first tested for normality by the Kolmogorov-Smirnov test. Data were then analyzed using unpaired t test or the Mann-Whitney rank-sum test where appropriate. Two-way analysis of variance (ANOVA) was conducted for grouped analyses. P-values less than or equal to 0.05 were considered statistically significant. All statistics and graphical analyses were conducted with Mac Prism 5.0 software

(GraphPad).

Chapter 4:

Summary and Future Directions

84 The role of SIGIRR in colonic epithelial cells

The process of carcinogenesis is a stepwise activation of oncogenes and loss of tumor suppressor genes. Stochastic events that lead to mutation on DNA level or regulation on the epigenetic level enable the tumor cell to gain growth advantage and expand in uncontrolled fashion. Differentially expressed genes are of great interest to cancer biology as they may be drivers of the carcinogenic process. In our study, we identified a prevalent expression of an isoform of SIGIRR that is overexpressed in human colon cancer. This isoform encodes a protein that can act as a dominant negative mutant to suppress the function of the full-length protein. In conjunction with evidence from mouse studies, we postulate that SIGIRR is an important regulator in human colorectal cancer.

Our study highlights the importance of investigating the regulation of proteins on a post- transcriptional in the study of cancer biology. SIGIRR expression exhibited diagnostically distinct subcellular localization and modification in cancer cells compared to normal colonic epithelial cells. In particular, the alteration of subcellular distribution is also noted in prostate cancer, where the expression of high cytoplasmic SIGIRR expression was associated with biochemical recurrence with a hazard ratio of 2.31. The evidence collectively suggests that alteration of SIGIRR expression on the post- transcriptional level may be a common mechanism for the dysregulation of SIGIRR function. A concerted effort should be devoted to determine the expression of SIGIRRΔE8 in different types of human malignancies.

85 In the context of colorectal cancer, a burning question is whether SIGIRRΔE8 expression impacts survival of colorectal cancer patients. Our study suggest an inverse correlation of

SIGIRRΔE8 expression and colorectal cancer survival. Such study would require extensive effort to analyze cohorts of patient tumor samples to determine the abundance of this isoform in tumor sample on RNA level and also the subcellular localization of

SIGIRRΔE8. It should be point out that most public databases do not contain enough information to allow such analysis. This illustrates the limitation of large scale profiling studies that have been done so far. Previous studies have focused on the transcriptomic level, which only represents a small fraction of the dynamic regulation on the proteomic level. Therefore, much information is lost from the data collection. The advent of RNA sequencing technology now allows the detection of changes on a more precise level to afford insight into more levels of regulation that eluded the investigation in the past.

Another interesting question raised by our study is the regulation of SIGIRRΔE8 expression. Since SIGIRRΔE8 is overexpressed in the cancer, the mechanism of its regulation must be one unique to cancer cells. Since we failed to identify any mutations in SIGIRR gene per se, it is most likely that the regulation occurs on the epigenetic level.

The exon 8 of SIGIRR gene is in a unique genomic location heavily loaded with epigenetic markers. The exon resides among several CpG islands that are subjected to methylation modification. It also contains cognate sequence of several transcription factors and modulators. Chief among these elements is the CTCF binding site. Since

CTCF has been shown to regulate alternative splicing and is down regulated in many types of caner, it is possible that SIGIRRΔE8 is an indication of CTCF down-regulation or

86 failure to bind to its cognate sequence. The CRSPR technology now allows precise editing of the genome. The hypothesis can be tested by altering the CTCF binding sequence in a normal colon cells followed by analysis of SIGIRRΔE8 expression.

It is equally interesting that SIGIRRΔE8 fails to traffic to the plasma membrane as a result of its altered intracellular domain. The phenomenon indicates that intracellular trafficking of membrane protein requires the proper conformation of the cytoplasmic region. It would be interesting to establish an inducible system that allows controlled expression of fluorescent protein tagged SIGIRRΔE8 and trace the movement of the protein. This experimental system would resolve the question whether SIGIRRΔE8 is trapped in the ER or it is actively being retrieved from the golgi/ plasma membrane. The two different scenarios would entail distinct regulatory mechanism.

The role of SIGIRR in T cell compartment

SIGIRR functions as a negative feedback to regulate the activity of Th17 cells. In this study we showed that the signature cytokine of Th17, IL-17, promotes tumorigenesis in mouse models of colitis-associated tumorigenesis. Although chronic inflammation has long been attributed to the increased cancer incidence in human, the precise mechanism is complex. In our study, we found that the inflammation and tumorigenesis was uncoupled upon the abrogation of IL-17 signaling. Induction of IL-17 was required for the tissue repair process responsible for the healing of wounded tissue when the colon epithelium sustains injury from either chemical or pathogenic insult. While the healing process is

87 beneficial as an expedient measure to fend of infection, chronic long term wound healing increases the chance of cancer formation by encouraging progenitor cells carrying oncogenic mutation to expand and take over. As such the negative regulation of the IL-17 signaling by SIGIRR is crucial for the proper maintenance of he colon epithelium.

Our study suggests that the expression of SIGIRR in the T cell compartment may influence the susceptibility to colon carcinogenesis. The next step of the study should look at the expression of SIGIRR in T cells in colorectal cancer patients and healthy individuals. Interestingly, SIGIRRΔE8 was shown to be expressed in a human T cell lymphoma cell line and CTCF is also a regulator of Th17 function. Therefore, the same mechanism that regulates SIGIRRΔE8 expression in the colonic cells may also exist in T cells and exert impact on the regulation of Th17 population in patients.

In addition to Th17 cells, SIGIRR is also highly expressed in Th2 cells. SIGIRR deficiency also leads to hyper Th2 activity. One of the signature cytokine of Th2 cells is

IL-13. IL-13 is involved in the allergic reaction and type 2 immune response that expels parasite infection. However, IL-13 is also known to suppress the surveillance function of the immune system, which is critical for eliminating nascent tumor growth in healthy individuals. Therefore, it would be interesting to test the role of IL-13 neutralization in T cell specific SIGIRR knockout mice to determine the contribution of the hyperactive Th2 population. Of note, CTCF is also a regulator of the Th2 fate commitment. The very same mechanism again, may play a role of regulating SIGIRR in human patients with signature

Th2 cell related disease, including cancer.

88 Bibliography

Hooper LV, Gordon JI. Commensal host-bacterial relationships in the gut. Science.

2001;292(5519):1115–8.

Clevers H. At the crossroads of inflammation and cancer. Cell. 2004;118(6):671–4.

Balkwill F, Charles KA, Mantovani A. Smoldering and polarized inflammation in the

initiation and promotion of malignant disease. Cancer Cell. 2005;7(3):211–7.

Rakoff-Nahoum S, Medzhitov R. Regulation of spontaneous intestinal tumorigenesis

through the adaptor protein MyD88. Science.

Takeda K, Kaisho T, Akira S. Toll-like receptors. Annu Rev Immunol. 2003;21:335

Kropf P, et al. Signaling through the T1/ST2 molecule is not necessary for Th2

differentiation but is important for the regulation of type 1 responses in nonhealing

Leishmania major infection. Infect Immun. 2003;71(4):1961–71.

Bulek K, et al. The essential role of single Ig IL-1 receptor-related molecule/Toll IL-1R8

in regulation of Th2 immune response. J Immunol. 2009;182(5):2601–9.

Chung Y, et al. Critical regulation of early Th17 cell differentiation by interleukin-1

signaling. Immunity. 2009;30(4):576–87.

Yao J, et al. Interleukin-1 (IL-1)-induced TAK1-dependent Versus MEKK3- dependent

NFkappaB activation pathways bifurcate at IL-1 receptor-associated kinase

modification. J Biol Chem. 2007;282(9):6075–89.

Siegel R, Ward E, Brawley O, et al. Cancer statistics, 2011: the impact of eliminating

socioeconomic and racial disparities on premature cancer deaths. CA Cancer J

Clin 2011;61:212-36.

Fearon ER, Vogelstein B. A genetic model for colorectal tumorigenesis. Cell

1990;61:759-67.

Markowitz SD, Bertagnolli MM. Molecular origins of cancer: Molecular basis of

colorectal cancer. N Engl J Med 2009;361:2449-60.

Fukata M, Shang L, Santaolalla R, et al. Constitutive activation of epithelial TLR4

augments inflammatory responses to mucosal injury and drives colitis-associated

tumorigenesis. Inflamm Bowel Dis 2011;17:1464-73.

Santaolalla R, Sussman DA, Ruiz JR, et al. TLR4 activates the beta-catenin pathway to

cause intestinal neoplasia. PLoS One 2013;8:e63298.

Ullman TA, Itzkowitz SH. Intestinal inflammation and cancer. Gastroenterology

2011;140:1807-16.

Kaler P, Augenlicht L, Klampfer L. Macrophage-derived IL-1beta stimulates Wnt

signaling and growth of colon cancer cells: a crosstalk interrupted by vitamin D3.

Oncogene 2009;28:3892-902.

Zhao J, Zepp J, Bulek K, et al. SIGIRR, a negative regulator of colon tumorigenesis.

Drug Discov Today Dis Mech 2011;8:e63-e69.

Garlanda C, Riva F, Bonavita E, et al. Decoys and Regulatory "Receptors" of the IL-

1/Toll-Like Receptor Superfamily. Front Immunol 2013;4:180.

Thomassen E, Renshaw BR, Sims JE. Identification and characterization of SIGIRR, a

molecule representing a novel subtype of the IL-1R superfamily. Cytokine

1999;11:389-99.

Wald D, Qin J, Zhao Z, et al. SIGIRR, a negative regulator of Toll-like receptor-

interleukin 1 receptor signaling. Nat Immunol 2003;4:920-7.

Xiao H, Gulen MF, Qin J, et al. The Toll-interleukin-1 receptor member SIGIRR

regulates colonic epithelial homeostasis, inflammation, and tumorigenesis.

Immunity 2007;26:461-75.

Qin J, Qian Y, Yao J, et al. SIGIRR inhibits interleukin-1 receptor- and toll-like receptor

4-mediated signaling through different mechanisms. J Biol Chem

2005;280:25233-41.

Garlanda C, Riva F, Polentarutti N, et al. Intestinal inflammation in mice deficient in Tir8,

an inhibitory member of the IL-1 receptor family. Proc Natl Acad Sci U S A

2004;101:3522-6.

91 Garlanda C, Riva F, Veliz T, et al. Increased susceptibility to colitis-associated cancer of

mice lacking TIR8, an inhibitory member of the interleukin-1 receptor family.

Cancer Res 2007;67:6017-21.

Xiao H, Yin W, Khan MA, et al. Loss of single immunoglobulin interlukin-1 receptor-

related molecule leads to enhanced colonic polyposis in Apc(min) mice.

Gastroenterology 2010;139:574-85.

Kelleher DJ, Kreibich G, Gilmore R. Oligosaccharyltransferase activity is associated with

a protein complex composed of ribophorins I and II and a 48 kd protein. Cell

1992;69:55-65.

Seshagiri S, Stawiski EW, Durinck S, et al. Recurrent R-spondin fusions in colon cancer.

Nature 2012;488:660-4.

Dobin A, Davis CA, Schlesinger F, et al. STAR: ultrafast universal RNA-seq aligner.

Bioinformatics 2013;29:15-21.

Grady WM, Myeroff LL, Swinler SE, et al. Mutational inactivation of transforming

growth factor beta receptor type II in microsatellite stable colon cancers. Cancer

Res 1999;59:320-4.

92 Willson JK, Bittner GN, Oberley TD, et al. Cell culture of human colon adenomas and

carcinomas. Cancer Res 1987;47:2704-13.

Johnson JL, Jones MB, Ryan SO, et al. The regulatory power of glycans and their

binding partners in immunity. Trends Immunol 2013;34:290-8.

Ryan SO, Bonomo JA, Zhao F, et al. MHCII glycosylation modulates Bacteroides fragilis

carbohydrate antigen presentation. J Exp Med 2011;208:1041-53.

Stelzl U, Worm U, Lalowski M, et al. A human protein-protein interaction network: a

resource for annotating the proteome. Cell 2005;122:957-68.

Wilson CM, Roebuck Q, High S. Ribophorin I regulates substrate delivery to the

oligosaccharyltransferase core. Proc Natl Acad Sci U S A 2008;105:9534-9.

Saam JR, Gordon JI. Inducible gene knockouts in the small intestinal and colonic

epithelium. J Biol Chem 1999;274:38071-82.

Bollrath J, Phesse TJ, von Burstin VA, et al. gp130-mediated Stat3 activation in

enterocytes regulates cell survival and cell-cycle progression during colitis-

associated tumorigenesis. Cancer Cell 2009;15:91-102.

93 Grivennikov S, Karin E, Terzic J, et al. IL-6 and Stat3 are required for survival of

intestinal epithelial cells and development of colitis-associated cancer. Cancer

Cell 2009;15:103-13

Putoczki TL, Thiem S, Loving A, et al. Interleukin-11 is the dominant IL-6 family

cytokine during gastrointestinal tumorigenesis and can be targeted therapeutically.

Cancer Cell 2013;24:257-71.

Greten FR, Eckmann L, Greten TF, et al. IKKbeta links inflammation and tumorigenesis

in a mouse model of colitis-associated cancer. Cell 2004;118:285-96.

Karin M, Greten FR. NF-kappaB: linking inflammation and immunity to cancer

development and progression. Nat Rev Immunol 2005;5:749-59.

Adler AS, McCleland ML, Yee S, et al. An integrative analysis of colon cancer identifies

an essential function for PRPF6 in tumor growth. Genes Dev 2014;28:1068-84.

Michelsen K, Yuan H, Schwappach B. Hide and run. Arginine-based endoplasmic-

reticulum-sorting motifs in the assembly of heteromultimeric membrane proteins.

EMBO Rep 2005;6:717-22

Christiansen MN, Chik J, Lee L, et al. Cell surface protein glycosylation in cancer.

Proteomics 2014;14:525-46.

Kim YS, Ahn YH, Song KJ, et al. Overexpression and beta-1,6-N- acetylglucosaminylation-initiated aberrant glycosylation of TIMP-1: a "double whammy" strategy in colon cancer progression. J Biol Chem 2012;287:32467-78.

Barker N, van Es JH, Kuipers J, Kujala P, van den Born M, Cozijnsen M, Haegebarth A,

Korving J, Begthel H, Peters PJ, Clevers H. 2007. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 25;449(7165):1003-7.

Barker N, Ridgway RA, van Es JH, van de Wetering M, Begthel H, van den Born M,

Danenberg E, Clarke AR, Sansom OJ, Clevers H. 2009. Crypt stem cells as the cells-of- origin of intestinal cancer. Nature. 457(7229):608-11.

Bennett AR, Farley A, Blair NF, Gordon J, Sharp L, Blackburn CC. 2002. Identification and characterization of thymic epithelial progenitor cells. Immunity. 16(6):803-14.

Cao AT, Yao S, Gong B, Elson CO, Cong Y. 2012. Th17 cells upregulate polymeric Ig receptor and intestinal IgA and contribute to intestinal homeostasis. J Immunol.

189(9):4666-73.

Chae WJ, Gibson TF, Zelterman D, Hao L, Henegariu O, Bothwell AL. 2010. Ablation of IL-17A abrogates progression of spontaneous intestinal tumorigenesis. Proc Natl Acad

Sci. 107(12):5540-4.

Dalerba P, Kalisky T, Sahoo D, Rajendran PS, Rothenberg ME, Leyrat AA, Sim S,

Okamoto J, Johnston DM, Qian D, Zabala M, Bueno J, Neff NF, Wang J, Shelton AA,

Visser B, Hisamori S, Shimono Y, van de Wetering M, Clevers H, Clarke MF, Quake

SR. 2011. Single-cell dissection of transcriptional heterogeneity in human colon tumors.

Nat Biotechnol. 29(12):1120-7.

De Craene B, Denecker G, Vermassen P, Taminau J, Mauch C, Derore A, Jonkers J,

Fuchs E, Berx G. 2014. Epidermal Snail expression drives skin cancer initiation and progression through enhanced cytoprotection, epidermal stem/progenitor cell expansion and enhanced metastatic potential. Cell Death Differ. Feb;21(2):310-20.

Depreter MG, Blair NF, Gaskell TL, Nowell CS, Davern K, Pagliocca A, Stenhouse FH,

Farley AM, Fraser A, Vrana J, Robertson K, Morahan G, Tomlinson SR, Blackburn CC.

2008. Identification of Plet-1 as a specific marker of early thymic epithelial progenitor cells. Proc Natl Acad Sci. 22;105(3):961-6.

Gill J, Malin M, Holländer GA, Boyd R. 2002. Generation of a complete thymic microenvironment by MTS24(+) thymic epithelial cells. Nat Immunol. 3(7):635-42.

Goto Y, Obata T, Kunisawa J, Sato S, Ivanov II, Lamichhane A, Takeyama N, Kamioka

M, Sakamoto M, Matsuki T, Setoyama H, Imaoka A, Uematsu S, Akira S, Domino SE,

Kulig P, Becher B, Renauld JC, Sasakawa C, Umesaki Y, Benno Y, Kiyono H. 2014.

96 Innate lymphoid cells regulate intestinal epithelial cell glycosylation. Science.

345(6202):1254009.

Grivennikov S, Karin E, Terzic J, Mucida D, Yu GY, Vallabhapurapu S, Scheller J,

Rose-John S, Cheroutre H, Eckmann L, Karin M. 2009. IL-6 and Stat3 are required for survival of intestinal epithelial cells and development of colitis-associated cancer. Cancer

Cell.15(2):103-13.

Grivennikov SI, Wang K, Mucida D, Stewart CA, Schnabl B, Jauch D, Taniguchi K, Yu

GY, Osterreicher CH, Hung KE, Datz C, Feng Y, Fearon ER, Oukka M, Tessarollo L,

Coppola V, Yarovinsky F, Cheroutre H, Eckmann L, Trinchieri G, Karin M. 2012.

Adenoma-linked barrier defects and microbial products drive IL-23/IL-17-mediated tumour growth. Nature. 491(7423):254-8.

Guilloteau K, Paris I, Pedretti N, Boniface K, Juchaux F, Huguier V, Guillet G, Bernard

FX, Lecron JC, Morel F. 2010. Skin Inflammation Induced by the Synergistic Action of

IL-17A, IL-22, Oncostatin M, IL-1{alpha}, and TNF-{alpha} Recapitulates Some

Features of Psoriasis. J Immunol. 184(9)5263-5270.

Haagensen EJ, Kyle S, Beale GS, Maxwell RJ, Newell DR. 2012. The synergistic interaction of MEK and PI3K inhibitors is modulated by mTOR inhibition. Br J Cancer.

106(8)1386-94.

97 Hueber W, Sands BE, Lewitzky S, Vandemeulebroecke M, Reinisch W, Higgins PD,

Wehkamp J, Feagan BG, Yao MD, Karczewski M, Karczewski J, Pezous N, Bek S,

Bruin G, Mellgard B, Berger C, Londei M, Bertolino AP, Tougas G, Travis SP;

Secukinumab in Crohn's Disease Study Group. 2012. Secukinumab, a human anti-IL-17A monoclonal antibody, for moderate to severe Crohn's disease: unexpected results of a randomised, double-blind placebo-controlled trial. Gut. 61(12):1693-700.

Hyun YS, Han DS, Lee AR, Eun CS, Youn J, Kim HY. 2012. Role of IL-17A in the development of colitis-associated cancer. Carcinogenesis. 33(4):931-6

Ireland H, Kemp R, Houghton C, Howard L, Clarke AR, Sansom OJ, Winton DJ. 2004.

Inducible Cre-mediated control of gene expression in the murine gastrointestinal tract: effect of loss of beta-catenin. Gastroenterology. 126(5):1236-46.

Ivanov II, Atarashi K, Manel N, Brodie EL, Shima T, Karaoz U, Wei D, Goldfarb KC,

Santee CA, Lynch SV, Tanoue T, Imaoka A, Itoh K, Takeda K, Umesaki Y, Honda K,

Littman DR. 2009. Induction of intestinal Th17 cells by segmented filamentous bacteria.

Cell. 139(3):485-98.

Jirawatnotai S1, Hu Y, Michowski W, Elias JE, Becks L, Bienvenu F, Zagozdzon A,

Goswami T, Wang YE, Clark AB, Kunkel TA, van Harn T, Xia B, Correll M,

Quackenbush J, Livingston DM, Gygi SP, Sicinski P. 2011. A function for cyclin D1 in

98 DNA repair uncovered by protein interactome analyses in human cancers. Nature.

474(7350)230-234.

Kelly RJ, Rouquier S, Giorgi D, Lennon GG, Lowe JB. 1995. Sequence and expression of a candidate for the human Secretor blood group alpha(1,2)fucosyltransferase gene

(FUT2). Homozygosity for an enzyme-inactivating nonsense mutation commonly correlates with the non-secretor phenotype. J Biol Chem. 270(9):4640-9.

Kirchberger S, Royston DJ, Boulard O, Thornton E, Franchini F, Szabady RL, Harrison

O, Powrie F. 2013. Innate lymphoid cells sustain colon cancer through production of interleukin-22 in a mouse model. J Exp Med. 210(5):917-31.

Kuraishy A, Karin M, Grivennikov SI. 2011. Tumor promotion via injury- and death- induced inflammation. Immunity. 35(4):467-77.

Mahalia E. Page, Patrick Lombard, Felicia Ng, Berthold Göttgens, Kim B. Jensen. 2013.

The Epidermis Comprises Autonomous Compartments Maintained by Distinct Stem Cell

Populations. Cell Stem Cell. 13(4): 471–482.

Moon C, Vandussen KL, Miyoshi H, Stappenbeck TS. 2013. Development of a primary mouse intestinal epithelial cell monolayer culture system to evaluate factors that modulate IgA transcytosis. Mucosal Immunol. Nov 13.

99 Nijhof JG, Braun KM, Giangreco A, van Pelt C, Kawamoto H, Boyd RL, Willemze R,

Mullenders LH, Watt FM, de Gruijl FR, van Ewijk W. 2006. The cell-surface marker

MTS24 identifies a novel population of follicular keratinocytes with characteristics of progenitor cells. Development. 15:3027-37.

O'Connor W Jr, Kamanaka M, Booth CJ, Town T, Nakae S, Iwakura Y, Kolls JK, Flavell

RA. 2009. A protective function for interleukin 17A in T cell-mediated intestinal inflammation. Nat Immunol. 10(6):603-9.

Pickard JM, Maurice CF, Kinnebrew MA, Abt MC, Schenten D, Golovkina TV,

Bogatyrev SR, Ismagilov RF, Pamer EG, Turnbaugh PJ, Chervonsky AV. 2014. Rapid fucosylation of intestinal epithelium sustains host-commensal symbiosis in sickness.

Nature. 514(7524):638-41.

Pickert G, Neufert C, Leppkes M, Zheng Y, Wittkopf N, Warntjen M, Lehr HA, Hirth S,

Weigmann B, Wirtz S, Ouyang W, Neurath MF, Becker C. 2009. STAT3 links IL-22 signaling in intestinal epithelial cells to mucosal wound healing. J Exp Med. 206(7):1465-

72.

Putoczki TL, Thiem S, Loving A, Busuttil RA, Wilson NJ, Ziegler PK, Nguyen PM,

Preaudet A, Farid R, Edwards KM, Boglev Y, Luwor RB, Jarnicki A, Horst D,

Boussioutas A, Heath JK, Sieber OM, Pleines I, Kile BT, Nash A, Greten FR, McKenzie

BS, Ernst M. 2013. Interleukin-11 is the dominant IL-6 family cytokine during

100 gastrointestinal tumorigenesis and can be targeted therapeutically. Cancer Cell.

24(2):257-71.

Rausch P, Rehman A, Künzel S, Häsler R, Ott SJ, Schreiber S, Rosenstiel P, Franke A,

Baines JF. 2011. Colonic mucosa-associated microbiota is influenced by an interaction of

Crohn disease and FUT2 (Secretor) genotype. Proc Natl Acad Sci. 108(47): 19030–

19035.

Raymond K, Richter A, Kreft M, Frijns E, Janssen H, Slijper M, Praetzel-Wunder S,

Langbein L, Sonnenberg A. 2010. Expression of the orphan protein Plet-1 during trichilemmal differentiation of anagen hair follicles. J Invest Dermatol. 130(6):1500-13.

Sachs UJ, Andrei-Selmer CL, Maniar A, Weiss T, Paddock C, Orlova VV, Choi EY,

Newman PJ, Preissner KT, Chavakis T, Santoso S. 2007. The neutrophil-specific antigen

CD177 is a counter-receptor for platelet endothelial cell adhesion molecule-1 (CD31). J

Biol Chem. 282(32):23603-12.

Takaoka Y, Shimizu Y, Hasegawa H, Ouchi Y, Qiao S, Nagahara M, Ichihara M, Lee JD,

Adachi K, Hamaguchi M, Iwamoto T. 2012. Forced expression of miR-143 represses

ERK5/c-Myc and p68/p72 signaling in concert with miR-145 in gut tumors of Apc-Min mice. Plos One. 7(8): e42137.

Tatefuji T, Arai C, Mori T, Okuda Y, Kayano T, Mizote A, Okura T, Takeuchi M, Ohta

101 T, Kurimoto M. 2006. The effect of AgK114 on wound healing. Biol Pharm Bull.

29(5):896-902.

Tong Z, Yang XO, Yan H, Liu W, Niu X, Shi Y, Fang W, Xiong B, Wan Y, Dong C.

2012. A protective role by interleukin-17F in colon tumorigenesis. PLoS One.

7(4):e34959.

Wang K., Kim M.K., Caro G. Di, Wong J., Shalapour S., Wam J., Zhang W., Zhong Z.,

Sanchez-Lopez E., Wu L.-W., et al. Immunity 41(6):1052-63.

Yang XO, Chang SH, Park H, Nurieva R, Shah B, Acero L, Wang YH, Schluns KS,

Broaddus RR, Zhu Z, Dong C. 2008. Regulation of inflammatory responses by IL-17F. J

Exp Med. 205(5):1063-75.

Yui S, Nakamura T, Sato T, Nemoto Y, Mizutani T, Zheng X, Ichinose S, Nagaishi T,

Okamoto R, Tsuchiya K, Clevers H, Watanabe M. 2012. Functional engraftment of colon epithelium expanded in vitro from a single adult Lgr5⁺ stem cell. Nat Med. 18(4):618-23.

Zheng Y, Valdez PA, Danilenko DM, Hu Y, Sa SM, Gong Q, Abbas AR, Modrusan Z,

Ghilardi N, de Sauvage FJ, Ouyang W.Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat Med. 2008 Mar;14(3):282-9.

102 R. Siegel, E. Ward, O. Brawley, et al.Cancer statistics, 2011: the impact of eliminating socioeconomic and racial disparities on premature cancer deathsCA Cancer J Clin, 61

(2011), pp. 212–236

E.R. Fearon, B. VogelsteinA genetic model for colorectal tumorigenesisCell, 61 (1990), pp. 759–767

S.D. Markowitz, M.M. BertagnolliMolecular origins of cancer: molecular basis of colorectal cancerN Engl J Med, 361 (2009), pp. 2449–2460

M. Fukata, L. Shang, R. Santaolalla, et al.Constitutive activation of epithelial TLR4 augments inflammatory responses to mucosal injury and drives colitis-associated tumorigenesisInflamm Bowel Dis, 17 (2011), pp. 1464–1473

R. Santaolalla, D.A. Sussman, J.R. Ruiz, et al.TLR4 activates the beta-catenin pathway to cause intestinal neoplasiaPLoS One, 8 (2013), p. e63298

T.A. Ullman, S.H. ItzkowitzIntestinal inflammation and cancerGastroenterology, 140

(2011), pp. 1807–1816

103 P. Kaler, L. Augenlicht, L. KlampferMacrophage-derived IL-1beta stimulates Wnt signaling and growth of colon cancer cells: a crosstalk interrupted by vitamin D3

Oncogene, 28 (2009), pp. 3892–3902

J. Zhao, J. Zepp, K. Bulek, et al.SIGIRR, a negative regulator of colon tumorigenesisDrug Discov Today Dis Mech, 8 (2011), pp. e63–e69

C. Garlanda, F. Riva, E. Bonavita, et al.Decoys and regulatory “receptors” of the IL-

1/Toll-like receptor superfamilyFront Immunol, 4 (2013), p. 180

E. Thomassen, B.R. Renshaw, J.E. SimsIdentification and characterization of SIGIRR, a molecule representing a novel subtype of the IL-1R superfamilyCytokine, 11 (1999), pp.

389–399

D. Wald, J. Qin, Z. Zhao, et al.SIGIRR, a negative regulator of Toll-like receptor- interleukin 1 receptor signalingNat Immunol, 4 (2003), pp. 920–927

H. Xiao, M.F. Gulen, J. Qin, et al.The Toll-interleukin-1 receptor member SIGIRR regulates colonic epithelial homeostasis, inflammation, and tumorigenesisImmunity, 26

(2007), pp. 461–475

104 J. Qin, Y. Qian, J. Yao, et al.SIGIRR inhibits interleukin-1 receptor- and toll-like receptor

4-mediated signaling through different mechanismsJ Biol Chem, 280 (2005), pp. 25233–

25241

C. Garlanda, F. Riva, N. Polentarutti, et al.Intestinal inflammation in mice deficient in

Tir8, an inhibitory member of the IL-1 receptor familyProc Natl Acad Sci U S A, 101

(2004), pp. 3522–3526

C. Garlanda, F. Riva, T. Veliz, et al.Increased susceptibility to colitis-associated cancer of mice lacking TIR8, an inhibitory member of the interleukin-1 receptor familyCancer

Res, 67 (2007), pp. 6017–6021

H. Xiao, W. Yin, M.A. Khan, et al.Loss of single immunoglobulin interlukin-1 receptor- related molecule leads to enhanced colonic polyposis in Apc(min) miceGastroenterology,

139 (2010), pp. 574–585

D.J. Kelleher, G. Kreibich, R. GilmoreOligosaccharyltransferase activity is associated with a protein complex composed of ribophorins I and II and a 48 kd proteinCell, 69

(1992), pp. 55–65

S. Seshagiri, E.W. Stawiski, S. Durinck, et al.Recurrent R-spondin fusions in colon cancerNature, 488 (2012), pp. 660–664

105 A. Dobin, C.A. Davis, F. Schlesinger, et al.STAR: ultrafast universal RNA-seq alignerBioinformatics, 29 (2013), pp. 15–21

W.M. Grady, L.L. Myeroff, S.E. Swinler, et al.Mutational inactivation of transforming growth factor beta receptor type II in microsatellite stable colon cancersCancer Res, 59

(1999), pp. 320–324

J.K. Willson, G.N. Bittner, T.D. Oberley, et al.Cell culture of human colon adenomas and carcinomasCancer Res, 47 (1987), pp. 2704–2713

J.L. Johnson, M.B. Jones, S.O. Ryan, et al.The regulatory power of glycans and their binding partners in immunityTrends Immunol, 34 (2013), pp. 290–298

S.O. Ryan, J.A. Bonomo, F. Zhao, et al.MHCII glycosylation modulates Bacteroides fragilis carbohydrate antigen presentationJ Exp Med, 208 (2011), pp. 1041–1053

U. Stelzl, U. Worm, M. Lalowski, et al.A human protein-protein interaction network: a resource for annotating the proteomeCell, 122 (2005), pp. 957–968

C.M. Wilson, Q. Roebuck, S. HighRibophorin I regulates substrate delivery to the oligosaccharyltransferase coreProc Natl Acad Sci U S A, 105 (2008), pp. 9534–9539

106 J.R. Saam, J.I. GordonInducible gene knockouts in the small intestinal and colonic epitheliumJ Biol Chem, 274 (1999), pp. 38071–38082

J. Bollrath, T.J. Phesse, V.A. von Burstin, et al.gp130-mediated Stat3 activation in enterocytes regulates cell survival and cell-cycle progression during colitis-associated tumorigenesisCancer Cell, 15 (2009), pp. 91–102

S. Grivennikov, E. Karin, J. Terzic, et al.IL-6 and Stat3 are required for survival of intestinal epithelial cells and development of colitis-associated cancerCancer Cell, 15

(2009), pp. 103–113

T.L. Putoczki, S. Thiem, A. Loving, et al.Interleukin-11 is the dominant IL-6 family cytokine during gastrointestinal tumorigenesis and can be targeted therapeuticallyCancer

Cell, 24 (2013), pp. 257–271

F.R. Greten, L. Eckmann, T.F. Greten, et al.IKKbeta links inflammation and tumorigenesis in a mouse model of colitis–associated cancerCell, 118 (2004), pp. 285–

296

M. Karin, F.R. GretenNF-kappaB: linking inflammation and immunity to cancer development and progressionNat Rev Immunol, 5 (2005), pp. 749–759

107 A.S. Adler, M.L. McCleland, S. Yee, et al.An integrative analysis of colon cancer identifies an essential function for PRPF6 in tumor growthGenes Dev, 28 (2014), pp.

1068–1084

S. Shukla, E. Kavak, M. Gregory, et al.CTCF-promoted RNA polymerase II pausing links DNA methylation to splicingNature, 479 (2011), pp. 74–79

K. Michelsen, H. Yuan, B. SchwappachHide and run. Arginine-based endoplasmic- reticulum-sorting motifs in the assembly of heteromultimeric membrane proteinsEMBO

Rep, 6 (2005), pp. 717–722

M.N. Christiansen, J. Chik, L. Lee, et al.Cell surface protein glycosylation in cancerProteomics, 14 (2014), pp. 525–546

Y.S. Kim, Y.H. Ahn, K.J. Song, et al.Overexpression and beta-1,6-N- acetylglucosaminylation-initiated aberrant glycosylation of TIMP-1: a “double whammy” strategy in colon cancer progressionJ Biol Chem, 287 (2012), pp. 32467–32478

108