DOCSLIB.ORG

Expression of Cell–Cell Interacting Genes Distinguishes HLXB9/TEL from MLL-Positive Childhood Acute Myeloid Leukemia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression of Cell–Cell Interacting Genes Distinguishes HLXB9/TEL from MLL-Positive Childhood Acute Myeloid Leukemia Letters to the Editor 1657 an 8 base-pair guanine mononucleotide repeat sequence Conflict of interest makes this reported variant suspicious for an artifact of PCR amplification rather than a true somatic mutation. This is a The authors declare no conflict of interest. well-known phenomenon that is commonly seen as an artifact 1,2 1 1 after PCR amplification of a region of DNA with homopolymer O Abdel-Wahab , O Kilpivaara , J Patel , runs.6,7 Moreover, slipped-strand mispairing of the PCR L Busque3 and RL Levine1,2 1 polymerase resulting in this in vitro frameshift does not Leukemia Service, Memorial Sloan Kettering Cancer Center, 6,7 New York, NY, USA; necessarily occur in every PCR amplification product, which 2 explains the variable presence of this allele in different patients Human Oncology and Pathogenesis Program, Memorial Sloan Kettering Cancer Center, New York, NY, USA and as assessed by Sanger resequencing, which has limited 3Research Centre, Maisonneuve-Rosemont Hospital, sensitivity. To improve our ability to detect this variant, Montreal, Quebec, Canada we perfomed amplification of this region of ASXL1 followed E-mail: [email protected] by sensitive mass spectrometry (Sequenom, San Diego, CA, USA) to distinguish between PCR products with 8 versus 9 guanine nucleotides in paired tumor and normal DNA (Figure 1b). When we performed PCR amplification followed References by (Seqeunom, San Diego, CA, USA) mass spectrometry for this variant in 10 paired samples from samples with myelodysplastic 1 Gelsi-Boyer V, Trouplin V, Adelaide J, Bonansea J, Cervera N, syndrome, myeloproliferative neoplasm and chronic myelomo- Carbuccia N et al. Mutations of polycomb-associated gene ASXL1 in nocytic leukemia, this variant was detected in tumor and normal myelodysplastic syndromes and chronic myelomonocytic leukaemia. Br J Haematol 2009; 145: 788–800. DNA in every instance. This again strongly suggests that this 2 Boultwood J, Perry J, Pellagatti A, Fernandez-Mercado M, alteration is not a somatic mutation. Finally, we performed Fernandez-Santamaria C, Calasanz MJ et al. Frequent mutation of Sanger sequencing of ASXL1 in granulocyte DNA extracted from the polycomb-associated gene ASXL1 in the myelodysplastic 96 individuals with no evidence of any hematologic disorder. syndromes and in acute myeloid leukemia. Leukemia 2010; 24: The c.1934dupG p.Gly646TrpsfsX12 variant was readily appar- 1062–1065. ent in 425% of samples from patients without hematologic 3 Boultwood J, Perry J, Zaman R, Fernandez-Santamaria C, Littlewood T, Kusec R et al. High-density single nucleotide polymorphism array disease (Figure 1c). Although mutations in ASXL1 have been analysis and ASXL1 gene mutation screening in chronic myeloid reported in individuals without clinical evidence of a hemato- leukemia during disease progression. Leukemia 2010; 24: 1139–1145. logic disorder at the time of DNA acquisition, the fact that this 4 Carbuccia N, Murati A, Trouplin V, Brecqueville M, Adelaide J, sample is found repeatedly in paired tumor and normal DNA Rey J et al. Mutations of ASXL1 gene in myeloproliferative makes this unlikely to be a somatic mutation.8 neoplasms. Leukemia 2009; 23: 2183–2186. The findings reported above indicate that the most commonly 5 Carbuccia N, Trouplin V, Gelsi-Boyer V, Murati A, Rocquain J, Adelaide J et al. Mutual exclusion of ASXL1 and NPM1 mutations in reported mutation in ASXL1, to date, is not a somatic mutation. a series of acute myeloid leukemias. Leukemia 2010; 24: 469–473. Much of the literature on the mutational frequency and clinical 6 Fazekas A, Steeves R, Newmaster SG. Improving sequencing quality correlates of ASXL1 mutations should be reanalyzed with this in from PCR products containing long mononucleotide repeats. mind. The 8 mononucleotide guanine repeat sequence in the BioTechniques 2010; 48: 351–355. reference sequence for ASXL1 in this region may confound 7 Clarke LA, Rebelo CS, Goncalves J, Boavida MG, Jordan P. PCR delimitation of the true repeat number in this region. These amplification introduces errors into mononucleotide and dinucleo- tide repeat sequences. Mol Pathol 2001; 54: 351–353. findings also further highlight the importance of the use of paired 8 Abdel-Wahab O, Manshouri T, Patel J, Harris K, Yao J, Hedvat C et al. normal tissue for accurate detection of true somatic mutations Genetic analysis of transforming events that convert chronic myelo- rather than polymorphisms of PCR/sequencing artifacts. proliferative neoplasms to leukemias. Cancer Res 2010; 70: 447–452. Expression of cell–cell interacting genes distinguishes HLXB9/TEL from MLL-positive childhood acute myeloid leukemia Leukemia (2010) 24, 1657–1660; doi:10.1038/leu.2010.146; a separate cohort of MLL-negative infant AML characterized by published online 1 July 2010 an early disease onset (o2 years) as well as t(7;12) HLXB9/TEL ( ¼ MNX1/ETV6) rearrangement and with concomitant high Molecular characterization of leukemic cells is a continuously expression of HLXB9 (MNX1). Surprisingly, all patients relapsed emerging field and has become fundamental for therapy having a 3-year EFS of 0%.2,3 The role of HLXB9, a transcription stratification and prediction of event-free survival (EFS). Infant factor of the family of homeobox proteins is rarely studied in acute myeloid leukemia (AML) is in 460% cases characterized hematopoiesis and the data regarding its ability to cause by a genomic rearrangement involving the mixed lineage malignant transformation of hematopoietic stem cells (HSCs) is leukemia (MLL) locus (11q23) and the expression of a fusion not yet available. Interestingly, germline mutations of HLXB9 protein (450 fusion partners are described). Patients lead to annorectal malformations and Currarino syndrome in with primary diagnosis of MLL-positive leukemia are young children, but hematopoietic abnormalities are not described.4 (o2 years) and have generally an inferior outcome compared The poor clinical outcome in this HLXB9/TEL-positive leukemia with MLL-negative patients.1 We and others recently described subset prompted us to comprehensively characterize the two Leukemia Letters to the Editor 1658 t(7;12) CCGACTTCAACTGCT TGCAGC CA Actin HLXB9 Exon1 TEL Exon3 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 breakpoint t(7;12) vs 11q23 down-regulated up-regulated PBX3 EDIL3 HOXA6 CNTNAP5 HOXA5 ANGPT1 HOXA10 DSG2 HOXA3 ITGA9 HOXA4 ITGAV HOXA7 KDR HOXA9 SIGLEC6 HOXA2 HOX genes cell-cell interacting genes 123456123456 11q23 t(7;12) HLXB9HOXA9 MEIS1 C-MYB HLXB9/ 0.20 0.10 0.50 HLXB9/ neg. 1.40 MLL/ENL HLXB9 TEL+ 0.40 TEL contr. 1.20 0.15 0.08 HLXB9 1.00 0.06 0.30 0.80 0.10 0.60 0.04 0.20 to actin 0.05 0.40 0.02 0.10 0.20 relative expression expression relative 0.00 0.00 0.00 0.00 CFU after 3rd replating t(7;12) 11q23*t(7;12) 11q23* t(7;12) 11q23* t(7;12) 11q23* Figure 1 Gene expression profiling and transformation process. Bone marrow or peripheral blood mononuclear cells were obtained from the leukemia laboratory, Giessen, Germany and informed consent was obtained from all families. (a) RT–PCR amplifying the HLXB9/TEL-fusion transcript. Indicated is the in-frame fragment variant at 194 bp as well as the out-of-frame variant at 330 bp (nested PCR primer: HLXB9-F1 50-CTTCCAGCTGGACCAGTGGCTG-30; TEL-R1 50-CTGAAGGAGTTCATAGAGCACATC-30; HLXB9-F2 50-CACCGCGGGCATGATCCTGC-30; TEL-R2 50-ATCGATAGCGAAAGTCCTCTT-30). Shown are 18 representatives out of 42 screened samples. (b) Sequence of the HLXB9/TEL breakpoint fusing HLXB9 exon 1 and TEL exon 3. (c) Microarray analysis was carried out on RNA samples (Trizol; Invitrogen, Darmstadt, Germany) of six HLXB9/TEL- and six MLL/AF9-positive patients using Human Gene 1.0 ST Array (Affymetrix). In all, 1554 significant differentially regulated genes are illustrated. Red indicates relative upregulation and green downregulation. (d) Listed are selected significantly (Po0,05) altered genes in t(7;12) patients compared with t(11q23) patients representing a group of downregulated HOX genes and upregulated cell–cell interacting genes. (e) Relative expression of HLXB9, HOXA9, MEIS1 and C-MYB in t(7;12) and 11q23 patients. Quantitative real-time PCR was carried out in triplicates using TaqMan primer probe assays (Applied Biosystems, Darmstadt, Germany). Samples were normalized to b-ACTIN and DCt values were calculated. A significant difference was found for HLXB9 expression (Po0,05, Mann–Whitney U-test). t(7;12)-positive AML: n ¼ 5; t(11q23) AML/ALL: n ¼ 8, nMLL-positive ALL and AML patients. (f) Bone marrow of 5-FU-treated wild-type mice was collected, transduced with a g-retroviral pMSCV vector with the transgenes MLL/ENL, HLXB9, HLXB9/TEL, HLXB9/TEL þ HLXB9 or an empty vector and plated on methylcellulose. After three rounds of replating, cells were analyzed for their ability to form colonies. entities of MLL- and HLXB9/TEL-positive AML regarding their polymerase chain reaction, French-American-British (FAB) cellular morphology, transcriptional profile and transformation subtype M5), who met the following criteria: diagnosis of process. AML, ageo2 years, blast content 460%, no trisomy 21. The MLL-positive cohort comprised six patients (t(9;11); Immunologic analysis revealed AML with coexpression of MLL-AF9, verified by fluorescence in situ hybridization and T-cell-associated antigens CD4 (mean: 81.25%), CD7 (mean: 26%) Leukemia Letters to the Editor 1659 Table 1 Patient characteristics Age (years) Karyotype Morphology Immunology V(D)J CD34 CD117 HLXB9/TEL 0.4 47, XX, t(7;16) (q36;q12), +mar M2 CD4/CD7 Neg 72 68 0.7 48, XY, t(7;12)(q36;p13),
Load more

Recommended publications
  • Supplementary Materials for the Oncogenic Runx3–Myc
    Supplementary Materials for The oncogenic Runx3–Myc axis defines p53-deficient osteosarcomagenesis Shohei Otani†, Yuki Date†, Tomoya Ueno, Tomoko Ito, Shuhei Kajikawa, Keisuke Omori, Ichiro Taniuchi, Masahiro Umeda, Toshihisa Komori, Junya Toguchida, Kosei Ito* †These authors contributed equally. *Correspondence to: [email protected] Department of Molecular Bone Biology, Graduate School of Biomedical Sciences, Nagasaki University, 1-7-1 Sakamoto, Nagasaki, 852-8588, Japan. This file includes: Figs. S1 to S13 Tables S1 and S2 1 Fig. S1 Up- and down-regulated transcription factors in p53-deficient osteosarcomagenesis in human and mouse. (A) OS development in the tibia of a representative osteoprogenitor-specific p53 knockout mouse (Osterix/Sp7-Cre; p53fl/fl). Arrows indicate the tumor. Osterix-Cre is expressed in BM-MSCs of adult mice as well (56). Right panel: radiograph. A scale bar = 1 cm. (B) Principal component analysis (PCA) of RNA-seq data comparing OS tissues (OS) and normal osteoblasts (OB) in human and mouse. (C) MA plot presentation of RNA-seq data comparing OS and OB. The seven TFs (Fig. 1, A and B) are indicated by red dots. (D) Prognostic efficacy of the seven transcription factors (Fig. 1, A and B) as determined by Kaplan–Meier analysis of survival in the OS patients in the TARGET cohort. **p < 0.01; *p < 0.05. 2 Fig. S2 Runx3 is required for tumorigenicity of p53-deficient OS. (A) Levels of the indicated proteins in OS (mOS) in 14 individual OS mice and newborn calvaria, as determined by western blotting. (B) Tumorigenicity of clonal mOS cells isolated from mOS (arrow) in individual OS mice (left) was evaluated by allograft in nude mice (BALB/c nu/nu mice; right).
    [Show full text]
  • From Clonal Hematopoiesis to Therapy-Related Myeloid Neoplasms: the Silent Way of Cancer Progression
    biology Review From Clonal Hematopoiesis to Therapy-Related Myeloid Neoplasms: The Silent Way of Cancer Progression Carmelo Gurnari 1,2,3 , Emiliano Fabiani 1,4,* , Giulia Falconi 1 , Serena Travaglini 1 , Tiziana Ottone 1,5, Antonio Cristiano 1 and Maria Teresa Voso 1,5 1 Department of Biomedicine and Prevention, University of Rome Tor Vergata, 00133 Rome, Italy; [email protected] (C.G.); [email protected] (G.F.); [email protected] (S.T.); [email protected] (T.O.); [email protected] (A.C.); [email protected] (M.T.V.) 2 Immunology, Molecular Medicine and Applied Biotechnology, University of Rome Tor Vergata, 00133 Rome, Italy 3 Department of Translational Hematology and Oncology Research, Taussig Cancer Institute, Cleveland Clinic, Cleveland, OH 44195, USA 4 Saint Camillus International, University of Health Sciences, 00131 Rome, Italy 5 Laboratorio di Neuro-Oncoematologia, Fondazione Santa Lucia, 00179 Rome, Italy * Correspondence: [email protected] Simple Summary: In the last decades the improved management of cancer patients and the overall prolonged life expectancy contributed to the increased number of patients at risk of late clonal events such as therapy-related myeloid neoplasms (t-MN). The discovery of clonal hematopoiesis of indeterminate potential (CHIP) in normal individuals has shed light on the pathophysiologic mecha- nism behind the process of myeloid evolution, defining CHIP carriers at higher risk of progression. Moreover, different patterns of clonal evolution have been identified in case of t-MN development after anti-cancer treatment exposure. The growing body of evidence in this field allowed the creation Citation: Gurnari, C.; Fabiani, E.; of dedicated cancer survivorship programs and “CHIP-Clinics” in order to specifically address the Falconi, G.; Travaglini, S.; Ottone, T.; issue of CHIP in patients undergoing anti-cancer treatment and develop measure of early detection Cristiano, A.; Voso, M.T.
    [Show full text]
  • The Prognostic Utility and Clinical Outcomes of MNX1-AS1 Expression in Cancers: a Systematic Review and Meta-Analysis
    The prognostic utility and clinical outcomes of MNX1-AS1 expression in cancers: a systematic review and meta-analysis Juan Li The rst aliated hospital, college of medicine, zhejiang university https://orcid.org/0000-0002-0121-7098 Wen Jin The rst aliated hospital, college of medicine, zhejiang university Zhengyu Zhang The rst aliated hospital, college of medicine, zhejiang university Jingjing Chu The rst aliated hospital, college of medicine, zhejiang university Hui Yang The rst aliated hospital, college of meicine, zhejiang university Chang Li the rst aliated hospital, college of medicine, zhejiang university Ruiyin Dong The rst aliated hospital, college of medicine, zhejiang university Cailian Zhao ( [email protected] ) https://orcid.org/0000-0001-8337-0610 Primary research Keywords: Long non-coding RNA, MNX1-AS1, Cancer, Prognosis Posted Date: March 25th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-19089/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/9 Abstract Background: Recently, emerging studies have identied that MNX1-AS1 highly expressed among variety of cancers and related with worse prognosis of cancer patients. The purpose of this study was to evaluate the relationship between MNX1-AS1 expression with clinical features and prognosis in different cancers. Methods: In this study, we searched the Web of Science, PubMed, CNKI, and Wanfang databases to nd relevant studies of MNX1-AS1. Pooled hazard ratios (HRs) and odds ratios (ORs) with 95% condence intervals (CIs) were applied to explore the prognostic and clinical signicance of MNX1-AS1. Results: A total of 9 literatures were included in this study, including 882 cancer patients.
    [Show full text]
  • Watsonjn2018.Pdf (1.780Mb)
    UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support.
    [Show full text]
  • The Landscape of Somatic Mutations in Epigenetic Regulators Across 1,000 Paediatric Cancer Genomes
    ARTICLE Received 24 Sep 2013 | Accepted 12 Mar 2014 | Published 8 Apr 2014 DOI: 10.1038/ncomms4630 The landscape of somatic mutations in epigenetic regulators across 1,000 paediatric cancer genomes Robert Huether1,*, Li Dong2,*, Xiang Chen1, Gang Wu1, Matthew Parker1, Lei Wei1, Jing Ma2, Michael N. Edmonson1, Erin K. Hedlund1, Michael C. Rusch1, Sheila A. Shurtleff2, Heather L. Mulder3, Kristy Boggs3, Bhavin Vadordaria3, Jinjun Cheng2, Donald Yergeau3, Guangchun Song2, Jared Becksfort1, Gordon Lemmon1, Catherine Weber2, Zhongling Cai2, Jinjun Dang2, Michael Walsh4, Amanda L. Gedman2, Zachary Faber2, John Easton3, Tanja Gruber2,4, Richard W. Kriwacki5, Janet F. Partridge6, Li Ding7,8,9, Richard K. Wilson7,8,9, Elaine R. Mardis7,8,9, Charles G. Mullighan2, Richard J. Gilbertson10, Suzanne J. Baker10, Gerard Zambetti6, David W. Ellison2, Jinghui Zhang1 & James R. Downing2 Studies of paediatric cancers have shown a high frequency of mutation across epigenetic regulators. Here we sequence 633 genes, encoding the majority of known epigenetic regulatory proteins, in over 1,000 paediatric tumours to define the landscape of somatic mutations in epigenetic regulators in paediatric cancer. Our results demonstrate a marked variation in the frequency of gene mutations across 21 different paediatric cancer subtypes, with the highest frequency of mutations detected in high-grade gliomas, T-lineage acute lymphoblastic leukaemia and medulloblastoma, and a paucity of mutations in low-grade glioma and retinoblastoma. The most frequently mutated genes are H3F3A, PHF6, ATRX, KDM6A, SMARCA4, ASXL2, CREBBP, EZH2, MLL2, USP7, ASXL1, NSD2, SETD2, SMC1A and ZMYM3. We identify novel loss-of-function mutations in the ubiquitin-specific processing protease 7 (USP7) in paediatric leukaemia, which result in decreased deubiquitination activity.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Familial and Somatic BAP1 Mutations Inactivate ASXL1/2-Mediated Allosteric
    Author Manuscript Published OnlineFirst on December 28, 2017; DOI: 10.1158/0008-5472.CAN-17-2876 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Familial and Somatic BAP1 Mutations Inactivate ASXL1/2-Mediated Allosteric Regulation of BAP1 Deubiquitinase by Targeting Multiple Independent Domains Hongzhuang Peng1, Jeremy Prokop2, Jayashree Karar1, Kyewon Park1, Li Cao3, J. William Harbour4, Anne M. Bowcock5, S. Bruce Malkowicz6, Mitchell Cheung7, Joseph R. Testa7, and Frank J. Rauscher, 3rd1 1Wistar Institute, Philadelphia, PA, USA; 2HudsonAlpha Genome Sequencing Center, Huntsville AL, USA; 3Washington University in St Louis, St. Louis, MO; 4University of Miami School of Medicine, Miami, FL, USA; 5Icahn School of Medicine at Mount Sinai, New York, NY; 6University of Pennsylvania and Veterans Affairs Medical Center Philadelphia, Philadelphia PA, USA; 7Fox Chase Cancer Center, Philadelphia, PA, USA Running Title: BAP1 mutations disable ASXL1/2’s regulation of BAP1 activity Key Words: BAP1, PR-DUB, ASXL1/2, mutations, deubiquitinase, cancer, tumor susceptibility Correspondence: Frank J. Rauscher, 3rd, Wistar Institute, 3601 Spruce Street, Philadelphia, PA 19104; Phone: 215-898-0995; Fax: 215-898-3929; E-mail: [email protected]; Joseph R. Testa, 5Fox Chase Cancer Center, 333 Cottman Avenue, Philadelphia, PA; Phone: 215-728- 2610; Fax: 215-214-1623; E-mail: [email protected] Précis: Combined computational and biochemical approaches demonstrate that the BAP1- ASXL2 interaction is direct and high affinity and that many BAP1 mutations act allosterically to inhibit BAP1-ASXL2 binding. 1 Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2017 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 28, 2017; DOI: 10.1158/0008-5472.CAN-17-2876 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • Frequent Mutation of the Polycomb-Associated Gene ASXL1 in the Myelodysplastic Syndromes and in Acute Myeloid Leukemia
    Letters to the Editor 1062 5 NCT00941928 http://clinicaltrials.gov. Last updated: January 6, 2010. 8 Velardi A, Ruggeri L, Moretta A, Moretta L. NK cells: a lesson from 6 Ljunggren HG, Ka¨rre K. In search of the ‘missing self’: MHC mismatched hematopoietic transplantation. Trends Immunol 2002; molecules and NK cell recognition. Immunol Today 1990; 11: 23: 438–444. 237–244. 9 Shimizu Y, Geraghty DE, Koller BH, Orr HT, DeMars R. Transfer 7 Ljunggren HG, Malmberg KJ. Prospects for the use of NK and expression of three cloned human non-HLA-A,B,C class I major cells in immunotherapy of human cancer. Nat Rev Immunol 2007; 7: histocompatibility complex genes in mutant lymphoblastoid cells. 329–339. Proc Natl Acad Sci USA 1988; 85: 227–231. Frequent mutation of the polycomb-associated gene ASXL1 in the myelodysplastic syndromes and in acute myeloid leukemia Leukemia (2010) 24, 1062–1065; doi:10.1038/leu.2010.20; Sequences spanning exon 12 of the ASXL1 gene were amplified published online 25 February 2010 by PCR from the DNA of 300 patient samples and 111 normal controls. Primers and amplification conditions were as previously published.1 PCR products were purified and directly The identification of those genes that are frequently mutated in sequenced using the BigDye Terminator v1.1 cycle sequencing malignancies is essential for a full understanding of the molecular kit (Applied Biosystems, Foster City, CA, USA) and an ABI 3100 pathogenesis of these disorders, and often for the provision of Genetic analyzer. Sequence data were analyzed using Mutation markers for the study of disease progression.
    [Show full text]
  • Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Expression Pattern of the Class I Homeobox Genes in Ovarian Carcinoma
    J Gynecol Oncol Vol. 21, No. 1:29-37, March 2010 DOI:10.3802/jgo.2010.21.1.29 Original Article Expression pattern of the class I homeobox genes in ovarian carcinoma Jin Hwa Hong1, Jae Kwan Lee1, Joong Jean Park2, Nak Woo Lee1, Kyu Wan Lee1, Jung Yeol Na1 Departments of 1Obstetrics and Gynecology, 2Physiology, Korea University College of Medicine, Seoul, Korea Objective: Although some sporadic reports reveal the link between the homeobox (HOX) genes and ovarian carcinoma, there is no comprehensive analysis of the expression pattern of the class I homeobox genes in ovarian carcinoma that determines the candidate genes involved in ovarian carcinogenesis. Methods: The different patterns of expression of 36 HOX genes were analyzed, including 4 ovarian cancer cell lines and 4 normal ovarian tissues. Using a reverse transcription-polymerase chain reaction (RT-PCR) and quantification analysis, the specific gene that showed a significantly higher expression in ovarian cancer cell lines than in normal ovaries was selected, and western blot analysis was performed adding 7 ovarian cancer tissue specimens. Finally, immunohistochemical and immunocytochemical analyses were performed to compare the pattern of expression of the specific HOX gene between ovarian cancer tissue and normal ovaries. Results: Among 36 genes, 11 genes had a different level of mRNA expression between the cancer cell lines and the normal ovarian tissues. Of the 11 genes, only HOXB4 had a significantly higher level of expression in ovarian cancer cell lines than in normal ovaries (p=0.029). Based on western blot, immunohistochemical, and immunocytochemical analyses, HOXB4 was expressed exclusively in the ovarian cancer cell lines or cancer tissue specimens, but not in the normal ovaries.
    [Show full text]
  • Role of the Bap1/Asxl1 Complex in Malignant Transformation and Therapeutic Response
    ROLE OF THE BAP1/ASXL1 COMPLEX IN MALIGNANT TRANSFORMATION AND THERAPEUTIC RESPONSE by Lindsay Marie LaFave A Dissertation Presented to the Faculty of the Louis V. Gerstner, Jr. Graduate School of Biomedical Sciences, Memorial Sloan Kettering Cancer Center in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy New York, NY July, 2015 ____________________________ ______________________ Ross L. Levine, MD Date Dissertation Mentor © 2015 Lindsay Marie LaFave DEDICATION To my parents, without your endless support and dedication none of this would have been possible. To my sister, for being the very best of friends and always making me laugh To my loving husband, for the constant happiness you bring me. You are my everything. iii ABSTRACT Role of the BAP1/ASXL1 Complex in Malignant Transformation and Therapeutic Response Somatic mutations in epigenetic modifiers have recently been identified in hematopoietic malignancies and in other human cancers. However, the mechanisms by which these epigenetic mutations lead to changes in gene expression and disease transformation have not yet been well delineated. Epigenetic modifiers include chromatin regulators that modify post-translational modifications on histone molecules. Mutations in ASXL1 (Addition of sex combs-like 1) are a common genetic event in a spectrum of myeloid malignancies and are associated with poor prognosis in acute myeloid leukemia (AML) and myelodysplastic syndromes (MDS). We investigated the role of ASXL1 mutations on target gene expression and chromatin state in hematopoietic cell lines and mouse models. We performed loss-of-function in vitro experiments in AML cell lines and conducted expression analysis. Loss of ASXL1 resulted in increased expression of the posterior HOXA cluster.
    [Show full text]