Coverage-Versus-Length Plots, a Simple Quality Control Step for De Novo Yeast Genome

Total Page:16

File Type:pdf, Size:1020Kb

Load more

bioRxiv preprint doi: https://doi.org/10.1101/421347; this version posted September 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 2 Coverage-versus-Length plots, a simple quality control step for de novo yeast genome 3 sequence assemblies 4 † 5 Alexander P. Douglass*, Caoimhe E. O’Brien , Benjamin Offei*, Aisling Y. Coughlan*, † ,1 6 Raúl A. Ortiz-Merino*, Geraldine Butler , Kevin P. Byrne*, Kenneth H. Wolfe* † 7 *School of Medicine and School of Biomolecular and Biomedical Sciences, UCD Conway 8 Institute, University College Dublin, Dublin 4, Ireland. 1 9 Corresponding author: [email protected] 10 11 Abstract 12 Illumina sequencing has revolutionized yeast genomics, with prices for commercial draft 13 genome sequencing now below $200. The popular SPAdes assembler makes it simple to 14 generate a de novo genome assembly for any yeast species. However, whereas making 15 genome assemblies has become routine, understanding what they contain is still 16 challenging. Here, we show how graphing the information that SPAdes provides about the 17 length and coverage of each scaffold can be used to investigate the nature of an assembly, 18 and to diagnose possible problems. Scaffolds derived from mitochondrial DNA, ribosomal 19 DNA, and yeast plasmids can be identified by their high coverage. Contaminating data, such 20 as cross-contamination from other samples in a multiplex sequencing run, can be identified 21 by its low coverage. Scaffolds derived from the bacteriophage PhiX174 and Lambda DNAs 22 that are frequently used as molecular standards in Illumina protocols can also be detected. 23 Assemblies of yeast genomes with high heterozygosity, such as interspecies hybrids, often 24 contain two types of scaffold: regions of the genome where the two alleles assembled into 25 two separate scaffolds and each has a coverage level C, and regions where the two alleles 26 co-assembled (collapsed) into a single scaffold that has a coverage level 2C. Visualizing the 27 data with Coverage-versus-Length (CVL) plots, which can be done using Microsoft Excel or 28 Google Sheets, provides a simple method to understand the structure of a genome assembly 29 and detect aberrant scaffolds or contigs. We provide a Python script that allows assemblies 30 to be filtered to remove contaminants identified in CVL plots. 31 1 bioRxiv preprint doi: https://doi.org/10.1101/421347; this version posted September 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 32 100-word article summary 33 We describe a simple new method, Coverage-versus-Length plots, for examining de novo 34 genome sequence assemblies. These plots enable researchers to detect scaffolds that have 35 unusually high or unusually low coverage, which allows contaminants, and scaffolds that 36 come from atypical parts of the organism’s DNA complement, to be detected. We show that 37 contaminants are common in yeast genomes sequenced in multiplex Illumina runs. We 38 provide instructions for making plots using Microsoft Excel or Google Sheets, and software 39 for filtering assemblies to remove contaminants. Contaminants can be detected and 40 removed, even without knowing their source. 41 42 Keywords: Genomics, Genome assembly, Bioinformatics, Yeast 43 44 45 Introduction 46 It is now easy and cheap to sequence a yeast genome using the Illumina platform. 47 Genome sequencing projects are usually described as either resequencing projects or de 48 novo assembly projects. In resequencing projects, Illumina reads from the strain to be 49 studied are mapped onto a reference genome from the same species (e.g. Saccharomyces 50 cerevisiae S288C), in order to find nucleotide polymorphisms or mutations. In de novo 51 assembly projects, the Illumina reads from the strain to be studied are assembled without 52 using a reference, to produce a set of contigs or scaffolds for the strain. De novo assembly is 53 used in several specific situations: (i), where no suitable reference genome sequence exists 54 (e.g., if the species has not been sequenced before); (ii), where the researcher chooses to 55 ignore the reference (e.g., to explore the pan-genome in natural isolates of S. cerevisiae); 56 (iii), where the strain being studied comes from an unknown species; or (iv), for mixed 57 samples, such as metagenomics projects. For any newly-discovered yeast species, in order 58 to publish a formal taxonomic description in the International Journal of Systematic and 59 Evolutionary Microbiology, authors are now requested to include a (de novo) sequence 1 60 assembly of its genome . 1 http://ijs.microbiologyresearch.org/content/journal/ijsem/about 2 bioRxiv preprint doi: https://doi.org/10.1101/421347; this version posted September 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 61 One of the most widely-used assembly programs for de novo yeast genome 62 sequences is SPAdes (Bankevich et al. 2012). SPAdes assembles genomes into contigs or 63 scaffolds, depending on the type of Illumina data that is input (single reads, paired-end 64 reads, or mate-pair reads). Contigs are contiguous stretches of assembled genome 65 sequence. Scaffolds are groups of contigs, whose relative order and orientation is known, but 66 which are separated by short gaps of unknown sequence (represented by poly-N regions in 67 the scaffold sequence). A typical yeast genome sequencing project will generate about 1.5 68 gigabases of raw data (e.g., 10 million Illumina reads of 150 bp each), which can be 69 assembled by SPAdes in a few hours on a standard laptop, giving more than 50x coverage 70 of the genome. 71 As the capacity of Illumina machines has grown, it has become increasingly common 72 that samples are sequenced in multiplex, i.e. genomic libraries are constructed from pooled 73 samples, using a different index (or pair of indexes) for each sample, and then sequenced 74 together in the same flowcell. For example, an Illumina HiSeq 4000 machine can sequence 75 96 yeast samples in multiplex in a single flowcell. It should be noted that the Illumina 76 multiplex methodology uses up to four separate sequencing reactions to obtain data from a 77 single flowcell spot containing a genomic DNA fragment: the library index(es) are sequenced 78 in 1-2 reactions using different primers than are used to sequence one or both ends of the 2 79 genomic DNA fragment . There is therefore some potential for mix-ups in which genomic 80 DNA reads are assigned to the wrong index and hence to the wrong sample. 81 The drawback to our ability to sequence genomes faster and cheaper is that the 82 amount of time and care spent on human examination of each sequence must inevitably 83 decrease (Lu and Salzberg 2018). Gross errors such as the assignment of a genome 84 sequence to the wrong species (Stavrou et al. 2018; Watanabe et al. 2018; Shen et al. 2016; 85 Pavlov et al. 2018), or yeast genome sequences that include many contigs from 86 contaminating bacteria (Donovan et al. 2018), are increasingly present in public databases. 87 In addition, the genome sequences of some yeast isolates have proven difficult to assemble 88 because they are highly heterozygous, in some cases because they are interspecies hybrids 89 (Pryszcz et al. 2015; Pryszcz and Gabaldon 2016; Schröder et al. 2016; Braun-Galleani et al. 90 2018). In this report, we present a simple method that can be used for quality control of an 91 Illumina genome assembly, by making use of the information that SPAdes produces about 92 the length and coverage of each contig or scaffold. 2 https://support.illumina.com/downloads/indexed-sequencing-overview-15057455.html 3 bioRxiv preprint doi: https://doi.org/10.1101/421347; this version posted September 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 93 94 Materials and Methods 95 All the example assemblies we present were made using SPAdes version 3.11.1 96 (Bankevich et al. 2012), downloaded from http://cab.spbu.ru/software/spades/. Illumina 97 FASTQ files were obtained by our laboratory using commercial DNA sequencing services, 98 except for Hanseniaspora osmophila NCYC58 for which we downloaded FASTQ files from 99 http://opendata.ifr.ac.uk/NCYC/ and assembled them (Table 1). We did not carry out any 100 data preprocessing steps. 101 Instructions for how to make a CVL plot from a SPAdes output file using common 102 spreadsheet programs are given in Box 1. 103 104 Results 105 SPAdes (Bankevich et al. 2012) is a popular assembly program because it is simple 106 to install, runs in a few hours on a laptop, and makes good assemblies ‘out of the box’ with 107 its default settings. It produces two main output files, called contigs.fasta and 108 scaffolds.fasta. The scaffolds.fasta file may include some poly-N regions where 109 two contigs have been joined with a gap between them, because their relative order and 110 orientation is known.
Recommended publications
  • Methods for De-Novo Genome Assembly

    Methods for De-Novo Genome Assembly

    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 28 June 2020 doi:10.20944/preprints202006.0324.v1 Methods for De-novo Genome Assembly Arash Bayat∗1,3, Hasindu Gamaarachchi1, Nandan P Deshpande2, Marc R Wilkins2, and Sri Parameswaran1 1School of Computer Science and Engineering, UNSW, Australia 2Systems Biology Initiative, School of Biotechnology and Biomolecular Sciences, UNSW, Australia 3Health and Biosecurity, CSIRO, Australia June 25, 2020 Abstract Despite advances in algorithms and computational platforms, de-novo genome assembly remains a chal- lenging process. Due to the constant innovation in sequencing technologies (Sanger, SOLiD, Illumina, 454 , PacBio and Oxford Nanopore), genome assembly has evolved to respond to the changes in input data type. This paper includes a broad and comparative review of the most recent short-read, long-read and hybrid assembly techniques. In this review, we provide (1) an algorithmic description of the important processes in the workflow that introduces fundamental concepts and improvements; (2) a review of existing software that explains possible options for genome assembly; and (3) a comparison of the accuracy and the performance of existing methods executed on the same computer using the same processing capabilities and using the same set of real and synthetic datasets. Such evaluation allows a fair and precise comparison of accuracy in all aspects. As a result, this paper identifies both the strengths and weaknesses of each method. This com- parative review is unique in providing a detailed comparison of a broad spectrum of cutting-edge algorithms and methods. Availability: https://arashbayat.github.io/asm ∗To whom correspondence should be addressed. Email: [email protected] 1 © 2020 by the author(s).
  • A Galaxy-Based Virus Genome Assembly Pipeline A

    A Galaxy-Based Virus Genome Assembly Pipeline A

    The Pennsylvania State University The Graduate School VIRAMP: A GALAXY-BASED VIRUS GENOME ASSEMBLY PIPELINE A Thesis in Integrative Biosciences by Yinan Wan © 2014 Yinan Wan Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science December 2014 The thesis of Yinan Wan was reviewed and approved* by the following: Istvan Albert Associate Professor, Bioinformatics, Biochemistry and Molecular Biology Thesis Advisor Moriah L. Szpara Assistant Professor of Biochemistry & Molecular Biology Cooduvalli S. Shashikant Associate Professor of Molecular and Development Biology Co-Director, IBIOS Graduate Program Option in Bioinformatics and Genomics Peter Hudson Willaman Professor of Biology Director, Huck Institutes of the Life Sciences *Signatures are on file in the Graduate School iii ABSTRACT Background Advances in next generation sequencing make it possible to obtain high-coverage sequence data for large numbers of viral strains in a short time. However, since most bioinformatics tools are developed for command line use, the selection and accessibility of computational tools for genome assembly and variation analysis limits the ability of individual scientist to perform further bioinformatics analysis. Findings We have developed a multi-step viral genome assembly pipeline named VirAmp that combines existing tools and techniques and presents them to end users via a web-enabled Galaxy interface. Our pipeline allows users to assemble, analyze and interpret high coverage viral sequencing data with an ease and efficiency that previously was not feasible. Our software makes a large number of genome assembly and related tools available to life scientists and automates the currently recommended best practices into a single, easy to use interface.
  • Culturing Ancient Bacteria Carrying Resistance Genes from Permafrost and Comparative Genomics with Modern Isolates

    Culturing Ancient Bacteria Carrying Resistance Genes from Permafrost and Comparative Genomics with Modern Isolates

    microorganisms Article Culturing Ancient Bacteria Carrying Resistance Genes from Permafrost and Comparative Genomics with Modern Isolates Pamela Afouda 1,2, Grégory Dubourg 1,2, Anthony Levasseur 1,2, Pierre-Edouard Fournier 2,3 , Jeremy Delerce 1, Oleg Mediannikov 1 , Seydina M. Diene 1,2 , Daniel Nahon 4, Didier Bourlès 4, Jean-Marc Rolain 1,2 and Didier Raoult 1,2,* 1 Aix Marseille Université, IRD, AP-HM, MEPHI, 13005 Marseille, France; [email protected] (P.A.); [email protected] (G.D.); [email protected] (A.L.); [email protected] (J.D.); [email protected] (O.M.); [email protected] (S.M.D.); [email protected] (J.-M.R.) 2 IHU Méditerranée Infection, 13005 Marseille, France; [email protected] 3 UMR VITROME, SSA, Aix-Marseille Université, IRD, AP-HM, IHU-Méditerranée-Infection, 13005 Marseille, France 4 Aix-Marseille University, CNRS, IRD, INRAE, Coll France, UM 34 CEREGE, Technopôle de l’Environnement Arbois-Méditerranée, BP80, 13545 Aix-en-Provence, France; [email protected] (D.N.); [email protected] (D.B.) * Correspondence: [email protected]; Tel.: +33-413-732-401; Fax: +33-413-732-402 Received: 29 March 2020; Accepted: 1 October 2020; Published: 3 October 2020 Abstract: Long considered to be a consequence of human antibiotics use by deduction, antibiotic resistance mechanisms appear to be in fact a much older phenomenon as antibiotic resistance genes have previously been detected from millions of year-old permafrost samples. As these specimens guarantee the viability of archaic bacteria, we herein propose to apply the culturomics approach to recover the bacterial content of a Siberian permafrost sample dated, using the in situ-produced cosmogenic nuclide chlorine36 (36Cl), at 2.7 million years to study the dynamics of bacterial evolution in an evolutionary perspective.
  • A New Versatile Metagenomic Assembler (Supplementary Material)

    A New Versatile Metagenomic Assembler (Supplementary Material)

    metaSPAdes: a new versatile metagenomic assembler (Supplementary Material) Sergey Nurk1,*,**, Dmitry Meleshko1,*, Anton Korobeynikov1,2 and Pavel A Pevzner1,3 1Center for Algorithmic Biotechnology, Institute for Translational Biomedicine, St. Petersburg State University, St. Petersburg, Russia 2Department of Statistical Modelling, St. Petersburg State University, St. Petersburg, Russia 3Department of Computer Science and Engineering, University of California, San Diego, USA *These authors contributed equally to this work **corresponding author, [email protected] Data preprocessing 2 Modifying the decision rule in exSPAnder for metagenomic data 3 Reducing running time and memory footprint of metaSPAdes 4 Bulge projection approach 6 Nx statistics 7 Analysis of the SYNTH dataset 8 CAMI datasets 10 Analysis of the CAMI datasets 14 BenchmarKing SPAdes against metaSPAdes 17 Effect of novel algorithmic approaches in metaSPAdes on assembly quality 21 Analysis of the HMP dataset 25 References 27 1 Supplemental Material: Data preprocessing The SYNTH, HMP, MARINE, and SOIL datasets were pre-processed to remove adaptors and trim low- quality segments of the reads. We used cutadapt software v 1.9.1 (Martin 2011), trimming bases with PHRED quality < 20 from 3’ end (parameter -q 20). Adaptor sequences were identified for each dataset individually, using FastQC v0.11.3 and manual reads inspection: SYNTH: -q 20 -a GAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT HMP: -q 20 -a AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG
  • Spades: a New Genome Assembler for Single-Cell Sequencing

    Spades: a New Genome Assembler for Single-Cell Sequencing

    Problem setting and preparing data The SPAdes approach SPAdes: a New Genome Assembler for Single-Cell Sequencing Algorithmic Biology Lab St. Petersburg Academic University A. Bankevich, S. Nurk, D. Antipov, A.A. Gurevich, M. Dvorkin, A. Korobeynikov, A.S. Kulikov, V.M. Lesin, S.I. Nikolenko, S. Pham, A.D. Prjibelski, A.V. Pyshkin, A.V. Sirotkin, N. Vyahhi, G. Tesler, M.A. Alekseyev, P.A. Pevzner August 27, 2012 Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer Outline 1 Problem setting and preparing data Assembly: problem and pipeline Error correction: BayesHammer 2 The SPAdes approach De Bruijn graphs, mate-pairs, and simplification Paired de Bruijn graphs and repeats Algorithmic Biology Lab, SPbAU SPAdes Problem setting and preparing data Assembly: problem and pipeline The SPAdes approach Error correction: BayesHammer Single-cell sequencing Recent years have seen the advent of single-cell sequencing as a way to sequence genomes that we previously couldn’t. It turns out that many bacteria (“dark matter of life”) cannot be sequenced by standard techniques, most often because they cannot be cloned millions of times to get large DNA samples needed for regular sequencing. This is usually due to the fact that these bacteria come in metagenomic samples (ocean samples, microbiomes of larger organisms etc.) and cannot be cultivated alone. For now, metagenomic analysis can yield more or less only individual genes. Single-cell sequencing can
  • Computational Protocol for Assembly and Analysis of SARS-Ncov-2 Genomes

    Computational Protocol for Assembly and Analysis of SARS-Ncov-2 Genomes

    PROTOCOL Computational Protocol for Assembly and Analysis of SARS-nCoV-2 Genomes Mukta Poojary1,2, Anantharaman Shantaraman1, Bani Jolly1,2 and Vinod Scaria1,2 1CSIR Institute of Genomics and Integrative Biology, Mathura Road, Delhi 2Academy of Scientific and Innovative Research (AcSIR) *Corresponding email: MP [email protected]; AS [email protected]; BJ [email protected]; VS [email protected] ABSTRACT SARS-CoV-2, the pathogen responsible for the ongoing Coronavirus Disease 2019 pandemic is a novel human-infecting strain of Betacoronavirus. The outbreak that initially emerged in Wuhan, China, rapidly spread to several countries at an alarming rate leading to severe global socio-economic disruption and thus overloading the healthcare systems. Owing to the high rate of infection of the virus, as well as the absence of vaccines or antivirals, there is a lack of robust mechanisms to control the outbreak and contain its transmission. Rapid advancement and plummeting costs of high throughput sequencing technologies has enabled sequencing of the virus in several affected individuals globally. Deciphering the viral genome has the potential to help understand the epidemiology of the disease as well as aid in the development of robust diagnostics, novel treatments and prevention strategies. Towards this effort, we have compiled a comprehensive protocol for analysis and interpretation of the sequencing data of SARS-CoV-2 using easy-to-use open source utilities. In this protocol, we have incorporated strategies to assemble the genome of SARS-CoV-2 using two approaches: reference-guided and de novo. Strategies to understand the diversity of the local strain as compared to other global strains have also been described in this protocol.
  • Sequencing and Comparative Analysis of &lt;I&gt;De Novo&lt;/I&gt; Genome

    Sequencing and Comparative Analysis of <I>De Novo</I> Genome

    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Dissertations and Theses in Biological Sciences Biological Sciences, School of 7-2016 Sequencing and Comparative Analysis of de novo Genome Assemblies of Streptomyces aureofaciens ATCC 10762 Julien S. Gradnigo University of Nebraska - Lincoln, [email protected] Follow this and additional works at: http://digitalcommons.unl.edu/bioscidiss Part of the Bacteriology Commons, Bioinformatics Commons, and the Genomics Commons Gradnigo, Julien S., "Sequencing and Comparative Analysis of de novo Genome Assemblies of Streptomyces aureofaciens ATCC 10762" (2016). Dissertations and Theses in Biological Sciences. 88. http://digitalcommons.unl.edu/bioscidiss/88 This Article is brought to you for free and open access by the Biological Sciences, School of at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Dissertations and Theses in Biological Sciences by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. SEQUENCING AND COMPARATIVE ANALYSIS OF DE NOVO GENOME ASSEMBLIES OF STREPTOMYCES AUREOFACIENS ATCC 10762 by Julien S. Gradnigo A THESIS Presented to the Faculty of The Graduate College at the University of Nebraska In Partial Fulfillment of Requirements For the Degree of Master of Science Major: Biological Sciences Under the Supervision of Professor Etsuko Moriyama Lincoln, Nebraska July, 2016 SEQUENCING AND COMPARATIVE ANALYSIS OF DE NOVO GENOME ASSEMBLIES OF STREPTOMYCES AUREOFACIENS ATCC 10762 Julien S. Gradnigo, M.S. University of Nebraska, 2016 Advisor: Etsuko Moriyama Streptomyces aureofaciens is a Gram-positive Actinomycete used for commercial antibiotic production. Although it has been the subject of many biochemical studies, no public genome resource was available prior to this project.
  • De Novo Assembly

    De Novo Assembly

    de novo assembly Rayan Chikhi CNRS Workshop on Genomics - Cesky Krumlov January 2016 1 YOUR INSTRUCTOR IS.. - Junior CNRS researcher in Lille, France - Postdoc at Penn State, PhD at ENS Rennes, France - CompSci background Research: - Software and methods for de novo assembly: I Minia I KmerGenie I Falcon2Fastg - Collab. on large-genomes assembly projects @RayanChikhi on Twitter http://rayan.chikhi.name 2 QUESTIONS TO THE AUDIENCE - Already have data to assemble? - Plans to sequence de novo? - RNA-Seq? - PacBio? 3 COURSE STRUCTURE - Short intro - Basic definitions - Fundamentals: why assemblies are as they are - Metrics: methods for evaluation - RNA-Seq: how Trinity works - In practice: best practices ; multi-k ; visualization 4 5 What’s an assembly and how to generate one ... 6 Source: 8 Ted Talks That Teach Public Speaking (SNI) 7 THE "WHY" - Create reference genome / transcriptome - Gene content - Novel insertions - Un-mapped reads - SNPs in non-model organisms - Find SV’s (Evan’s talk) - Specific regions of interest - Metagenomics - .. 8 "WHAT" AND "HOW" BASED ON "WHY" Scenario 1: What the best possible assembly of bacteria X How high-coverage PacBio data Why Obtain a reference geome Scenario 2: What a meh-looking draft assembly of organism X How couple of Illumina lanes Why Gene content and possible viral insertions 9 ASSEMBLY: A SOLVED PROBLEM? Still a difficult problem in 2016. 1. PacBio methods are still preliminary 2. Hard to obtain good assemblies from Illumina data Conclusions of the GAGE benchmark : in terms of assembly quality, there is no single best assembler 3. High computational requirements State of the research 1.
  • Metaspades: a New Versatile Metagenomics Assembler

    Metaspades: a New Versatile Metagenomics Assembler

    metaSPAdes: a new versatile metagenomics assembler Sergey Nurk1,*,**, Dmitry Meleshko1,*, Anton Korobeynikov1,2 and Pavel A Pevzner1,3 1Center for Algorithmic Biotechnology, Institute for Translational Biomedicine, St. Petersburg State University, St. Petersburg, Russia 2Department of Statistical Modelling, St. Petersburg State University, St. Petersburg, Russia 3Department of Computer Science and Engineering, University of California, San Diego, USA *These authors contributed equally to this work **corresponding author, [email protected] Abstract While metagenomics has emerged as a technology of choice for analyzing bacterial populations, as- sembly of metagenomic data remains challenging thus stifling biological discoveries. Moreover, re- cent studies revealed that complex bacterial populations may be composed from dozens of related strains thus further amplifying the challenge metagenomics assembly. metaSPAdes addresses various challenges of metagenomics assembly by capitalizing on computational ideas that proved to be useful in assemblies of single cells and highly polymorphic diploid genomes. We benchmark metaSPAdes against other state-of-the-art metagenome assemblers and demonstrate that it results in high-quality assemblies across diverse datasets. Introduction Metagenome sequencing has emerged as a technology of choice for analyzing bacterial popula- tions and discovery of novel organisms and genes (Venter et al. 2004; Tyson et al. 2004; Yooseph et al. 2007; Arumugam et al. 2011). In one of the early metagenomics studies, Venter et al. (2004) at- tempted to assemble the complex Sargasso Sea microbial community but, as the paper stated, failed. On the other side of the spectrum of metagenomics studies, Tyson et al. (2004) succeeded in assem- bling a simple metagenomic community from a biofilm consisting of a few species.
  • Evaluation of Genome Assembly Software Based on Long Reads

    Evaluation of Genome Assembly Software Based on Long Reads

    Evaluation of genome assembly software based on long reads Laurent Bouri1,*, Dominique Lavenier2, Jean-Franc¸ois Gibrat3, and Victoria Dominguez del Angel4 1CNRS Engineer/ IFB 2CNRS Research Director, GenScale team leader 3INRA Research Director/ IFB 4ELIXIR Training Coordinator (FRANCE)/ IFB ABSTRACT During the last 30 years, Genomics has been revolutionized by the development of first- and second-generation sequencing (SGS) technologies, enabling the completion of many remarkable projects as the Human Genome Project1,2 , the 1000 Genomes Project3 and the Human Microbiome Project4. In the last decade, SGS technologies based on massive parallel sequencing have dominated the market, thanks to their ability to produce enormous volumes of data cheaply. However, often genes and regions of interest are not completely or accurately assembled, complicating analyses or requiring additional cloning efforts for obtaining the correct sequences5. The fundamental obstacle in SGS technologies for obtaining high quality genome assembly is the existence of repetitions in the sequences. A promising solution to this issue is the advent of Third-generation sequencing (TGS) technologies based on long read sequencing6. TGS technologies have been used to produce highly accurate de novo assemblies of hundreds of microbial genomes7,8, and highly contiguous reconstructions of many dozens of plant and animal genomes, enabling new insights into evolution and sequence diversity9,10. They have also been applied to resequencing analyses, to create detailed maps of structural variations in many species11. Also, these new technologies have been used to fill in many of the gaps in the human reference genome12. In this report, we compare and evaluate several genome assembly software based on TSG technology.
  • A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing

    A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing

    JOURNAL OF COMPUTATIONAL BIOLOGY Volume 19, Number 5, 2012 Original Articles # Mary Ann Liebert, Inc. Pp. 455–477 DOI: 10.1089/cmb.2012.0021 SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing ANTON BANKEVICH,1,2 SERGEY NURK,1,2 DMITRY ANTIPOV,1 ALEXEY A. GUREVICH,1 MIKHAIL DVORKIN,1 ALEXANDER S. KULIKOV,1,3 VALERY M. LESIN,1 SERGEY I. NIKOLENKO,1,3 SON PHAM,4 ANDREY D. PRJIBELSKI,1 ALEXEY V. PYSHKIN,1 ALEXANDER V. SIROTKIN,1 NIKOLAY VYAHHI,1 GLENN TESLER,5 MAX A. ALEKSEYEV,1,6 and PAVEL A. PEVZNER1,4 ABSTRACT The lion’s share of bacteria in various environments cannot be cloned in the laboratory and thus cannot be sequenced using existing technologies. A major goal of single-cell genomics is to complement gene-centric metagenomic data with whole-genome assemblies of unculti- vated organisms. Assembly of single-cell data is challenging because of highly non-uniform read coverage as well as elevated levels of sequencing errors and chimeric reads. We de- scribe SPAdes, a new assembler for both single-cell and standard (multicell) assembly, and demonstrate that it improves on the recently released E + V - SC assembler (specialized for single-cell data) and on popular assemblers Velvet and SoapDeNovo (for multicell data). SPAdes generates single-cell assemblies, providing information about genomes of un- cultivatable bacteria that vastly exceeds what may be obtained via traditional metagenomics studies. SPAdes is available online (http://bioinf.spbau.ru/spades). It is distributed as open source software. Key words: assembly, de Bruijn graph, single cell, sequencing, bacteria 1.
  • Assembly of the Mitochondrial Genome in the Campanulaceae Family Using Illumina Low-Coverage Sequencing

    Assembly of the Mitochondrial Genome in the Campanulaceae Family Using Illumina Low-Coverage Sequencing

    G C A T T A C G G C A T genes Article Assembly of the Mitochondrial Genome in the Campanulaceae Family Using Illumina Low-Coverage Sequencing Hyun-Oh Lee 1,2,†, Ji-Weon Choi 3,†, Jeong-Ho Baek 4, Jae-Hyeon Oh 5 ID , Sang-Choon Lee 1 and Chang-Kug Kim 5,* ID 1 Phyzen Genomics Institute, Seongnam 13558, Korea; [email protected] (H.-O.L.); [email protected] (S.-C.L.) 2 Department of Plant Science, Seoul National University, Seoul 08826, Korea 3 Postharvest Technology Division, National Institute of Horticultural and Herbal Science, Wanju 55365, Korea; [email protected] 4 Gene Engineering Division, National Institute of Agricultural Sciences, RDA, Jeonju 54874, Korea; fi[email protected] 5 Genomics Division, National Institute of Agricultural Sciences, RDA, Jeonju 54874, Korea; [email protected] * Correspondence: [email protected]; Tel.: +82-63-238-4555 † These authors contributed equally to this work. Received: 28 June 2018; Accepted: 25 July 2018; Published: 30 July 2018 Abstract: Platycodon grandiflorus (balloon flower) and Codonopsis lanceolata (bonnet bellflower) are important herbs used in Asian traditional medicine, and both belong to the botanical family Campanulaceae. In this study, we designed and implemented a de novo DNA sequencing and assembly strategy to map the complete mitochondrial genomes of the first two members of the Campanulaceae using low-coverage Illumina DNA sequencing data. We produced a total of 28.9 Gb of paired-end sequencing data from the genomic DNA of P. grandiflorus (20.9 Gb) and C. lanceolata (8.0 Gb). The assembled mitochondrial genome of P.