'Rasayana' Herbs of Ayurveda

Journal of Ethnopharmacology 99 (2005) 165–178

Review Antioxidant approach to disease management and the role of ‘Rasayana’ herbs of Ayurveda R. Govindarajan, M. Vijayakumar, P. Pushpangadan ∗

Pharmacognosy and Ethnopharmacology Division, National Botanical Research Institute, Lucknow 226001, India Received 4 November 2004; received in revised form 22 February 2005; accepted 22 February 2005 Available online 26 April 2005

Abstract

The disease preventive and health promotive approach of ‘Ayurveda’, which takes into consideration the whole body, mind and spirit while dealing with the maintenance of health, promotion of health and treating ailments is holistic and finds increasing acceptability in many regions of the world. Ancient Ayurvedic physicians had developed certain dietary and therapeutic measures to arrest/delay ageing and rejuvenating whole functional dynamics of the body system. This revitalization and rejuvenation is known as the ‘Rasayan chikitsa’ (rejuvenation therapy). Traditionally, Rasayana drugs are used against a plethora of seemingly diverse disorders with no pathophysiological connections according to modern medicine. Though, this group of plants generally possesses strong antioxidant activity, only a few have been investigated in detail. Over about 100 disorders like rheumatoid arthritis, hemorrhagic shock, CVS disorders, cystic fibrosis, metabolic disorders, neurodegenerative diseases, gastrointestinal ulcerogenesis and AIDS have been reported as reactive oxygen species mediated. In this review, the role of free radicals in these diseases has been briefly reviewed. ‘Rasayana’ plants with potent antioxidant activity have been reviewed for their traditional uses, and mechanism of antioxidant action. Fifteen such plants have been dealt with in detail and some more plants with less work have also been reviewed briefly. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Rasayana; Antioxidant; Ayurveda; Panchkarma

Contents

1. Introduction ...... 166 2. ‘Rasayana’ concept of ‘Ayurveda’ ...... 166 3. Free radicals and their role in diseases ...... 167 3.1. Aging biology ...... 167 3.2. Atherosclerosis ...... 168 3.3. Autoimmune diseases ...... 168 3.4. Cancer ...... 168 3.5. Diabetes ...... 168 3.6. Inﬂammation ...... 168 3.7. Parkinson’s disease...... 169 3.8. Rhuematoid arthritis...... 169 4. Antioxidant defense ...... 169

Abbreviations: CAT, catalase; DPPH, 1,1-diphenyl-2-picrylhydrazyl; GSH, glutathione; GSH-px, glutathione peroxidase; GSH-R, glutathione reductase; GST, glutathione S-transferase; LDL, low density lipoproteins; LPO, lipid peroxidation; MDA, malondialdehyde; RNS, reactive nitrogen species; ROI, reactive oxygen intermediates; ROS, reactive oxygen species; SOD, superoxide dismutase; TBARS, thiobarbituric acid reactive substances ∗ Corresponding author. Tel.: +91 522 2205848; fax: +91 522 2205836. E-mail address: [email protected] (P. Pushpangadan).

5. Rasayana as antioxidants...... 169 5.1. Acorus calamus...... 170 5.2. Aloe vera ...... 170 5.3. Andrographis paniculata...... 170 5.4. Asparagus racemosus ...... 170 5.5. Azadirachta indica ...... 171 5.6. Bacopa monnieri...... 171 5.7. Desmodium gangeticum ...... 171 5.8. Phyllanthus emblica...... 171 5.9. Glycyrrhiza glabra ...... 172 5.10. Picrorhiza kurroa ...... 172 5.11. Psoralea corylifolia ...... 172 5.12. Semecarpus anacardium...... 172 5.13. Terminalia chebula...... 173 5.14. Tinospora cordifolia ...... 173 5.15. Withania somnifera ...... 173 5.16. Miscellaneous plants ...... 174 6. Conclusion ...... 174 References ...... 175

1. Introduction body. Hence any medicine that improves the quality of ‘Rasa’ (‘Rasayana’) should strengthen or promote the health of all The health promotive, disease preventive and rejuvena- tissues of the body. ‘Rasayana’ drugs act inside the human tion approach available in the Indian systems of medicine body by modulating the neuro-endocrino-immune systems like ‘Ayurveda’ is gaining greater attention and popularity and have been found to be a rich source of antioxidants in many regions of the world. A majority of the present day (Brahma and Debnath, 2003). These Rasayana plants are diseases are reported to be due to the shift in the balance of said to possess the following properties: they prevent ageing, the pro-oxidant and the antioxidant homeostatic phenomenon re-establish youth, strengthen life, brain power and prevent in the body. Pro-oxidant conditions dominate either due to diseases (Sharma, 1983; Ghanekar, 1981), all of which the increased generation of the free radicals caused by ex- imply that they increase the resistance of the body against cessive oxidative stress of the present day life, or due to any onslaught. the poor scavenging/quenching in the body caused by deple- ‘Rasayana chikitsa’ is a specialized section of Ayurveda, tion of the dietary antioxidants (Schulz et al., 2000; Dringen, which mainly deals with the preservation and promotion 2000). The disease preventive and health promotive approach of health by revitalizing the metabolism and enhancing of Ayurveda, which takes into consideration the whole body, immunity. ‘Rasayana’ therapy is done for a particular mind and spirit while dealing with the maintenance of health, period of time with strict regimen on diet and conduct. promotion of health and treating ailments, is an holistic ap- ‘Rasayana’ drugs are very rich in powerful antioxidants proach and finds increasing acceptability in many regions of and are good hepatoprotective and immunomodulating the world. The ancient Ayurvedic physicians understood the agents. ‘Rasayana’ is not a drug therapy, but is a specialized delicate cellular mechanisms of the body and the deterio- procedure practiced in the form of rejuvenation recipes, ration of the functional efficiency of the body tissues. These dietary regimen and special health promoting right conduct ancient Ayurvedic masters had thus developed certain dietary and behavior, i.e. ‘Achara Rasayana’. Shushruta (an ancient and therapeutic measures to arrest/delay ageing and rejuve- Ayurvedic surgeon) while defining ‘Rasayana’ therapy nating whole functional dynamics of the body organs. This says that it arrests ageing (‘Vayasthapam’), increase life revitalisation and rejuvenation is known as the ‘Rasayan chik- span (‘Ayushkaram’), intelligence (‘Medha’) and strength itsa’ (rejuvenation therapy). (‘Bala’) and thereby enable one to prevent disease (Sharma, 1983). ‘Rasayana’ enhances the functions of the whole body system. ‘Rasayana’ treatment for rejuvenation is done after 2. ‘Rasayana’ concept of ‘Ayurveda’ the system is thoroughly cleansed by ‘Panchakarma’ therapy (Joshi, 1998). ‘Panchakarma’ is essentially a pretreatment Ayurvedic pharmacology classifies medicinal plants into equipping the body tissues for ‘Rasayana’ therapy. Shushruta different groups according to their actions. One of these is observed that a person, whose system is not been previously the ‘Rasayana’ group. The word ‘Rasayana’ literally means cleansed by proper purification remedies, cannot expect the path that ‘Rasa’ takes (‘Rasa’: plasma; Ayana: path). good results with ‘Rasayana’ treatment. ‘Panchakarma’ is It is believed, in Ayurveda that the qualities of the ‘Rasa- a method of purifying the body system by five methods dhatu’ influence the health of other dhatus (tissues) of the called ‘Vamana’ (emesis), ‘Virechana’ (purgation), ‘Vasti’ R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178 167

(enema), including ‘Asthapana’ (medicated enema), ‘Nasya’ burden in the body either due to environmental condition (nasal medication) and ‘Rakta moksha’ (blood letting) or produced within the body, it leads to oxidative stress, (Trikamji, 1994). According to the ‘Caraka Samhita’, one which may result in tissue injury and subsequent diseases of the ancient treatises of ‘Ayurveda’, if a disease is not sub- (Finkel and Holbrook, 2000). Since free radicals play such jected to ‘Panchakarma’, the rejuvenation therapy may not an important role in the disease scenario of an individual, be effective. ‘Panchakarma’ is advised for treating broad cat- a thorough understanding of the various physiologically egory of conditions like arthritis, rheumatism, neurological, significant free radicals is of paramount importance before muscular skeletal disorders and also degenerative conditions the search of the radical scavengers or the antioxidant like infertility, menstrual problems, obesity, respiratory principles to treat the physiological disorders caused disorders, gastrointestinal disorders, etc. ‘Panchakarma’ by them. may be administered with curative and corrective drugs Free radicals may be designated as molecular sharks that along with having powerful antioxidant activity (Devaraj, damage molecules in cell membranes, mitochondria (the 1980). cell’s energy plants), DNA (the cell’s intelligence) and are There has been a plenty of research on the plants used as very unstable, tend to rob electrons from the molecules in the Rasyana drugs in order to reason them in the modern context. immediate surrounding in order to replace their own losses. Puri (1970a,b, 1971, 1972) gave an account of the herbs used Reactive oxygen species (ROS) is a collective term, which •− • in various ‘Rasayana’ preparations while Udupa (1973) stud- includes not only the oxygen radicals (O2 , and OH) but ied the effects of ‘Rasayana’ drugs on psychosomatic stress. also some non-radical derivatives of oxygen. These include ‘Rasayana’ drugs have been proven to treat epilepsy (Singh hydrogen peroxide (H2O2), hypochlorous acid (HOCl) and and Murhty, 1989), convulsive disorders (Diwedi and Singh, ozone (O3)(Bandhopadhyay et al., 1999). 1992) and to reduce anxiety, apprehension and keep the mind Over about 100 disorders like rheumatoid arthritis, hem- calm and cool (Puri, 2003). Plenty of study has been under- orrhagic shock, cardiovascular disorders, cystic fibrosis, taken to provide scientific evidence to the ‘Rasayana’ drugs metabolic disorders, neurodegenerative diseases, gastroin- as immunomodulators and adaptogens. Wagner (1994) after a testinal ulcerogenesis and AIDS have been reported as ROS detailed study concluded that ‘Rasayana’ preparations, which mediated. Some specific examples of ROS mediated diseases act both as herbal immunostimulant and adaptogens, regulate include Alzheimers disease, Parkinson’s disease, Atheroscle- the immunological and endocrine systems with relatively low rosis, Cancer, Down’s syndrome and ischemic reperfusion doses, without damaging the autoregulative functions of the injury in different tissues including heart, liver, brain, kidney organisms. ‘Rasayana’ drugs haven been reported to treat and gastro intestinal tract. The role played by ROS in stress- generalized weakness (Jayaram et al., 1993) and afford pro- induced gastric ulcer and inflammatory bowel diseases have tection from cyclophosphamide-induced luekopenia (Kumar been well established, as well as their involvement in the pro- et al., 1994). cess of ageing. The role of radicals in various diseases is dealt in detail.

3. Free radicals and their role in diseases 3.1. Aging biology

Free radicals are natural by-products of our own In the biological process of aging, the following metabolism. These are electrically charged molecules that cause–effect relationships are demonstrated: formation attack our cells, tearing through cellular membranes to of intra and intermolecular cross-linkings, as in the case react and create havoc with the nucleic acids, proteins, and of muscle cells aging. Modiﬁcations of immunological enzymes present in the body. These attacks by free radicals, reactions, usually resulting in decrease of their activities. collectively known as oxidative stress, are capable of causing Telomere shortening with decrease or interruption of cell cells to lose their structure, function and can eventually proliferation, which can mean an unbalance between cells destroy them. They are continuously produced by our body’s lost and reposition rates, culmination with organ and system use of oxygen such as in respiration and some cell-mediated failure and death of the organism. Cell damages provoked by immune functions. They are also generated through envi- free radicals are common during aging; once in this life step ronmental pollutants, cigarette smoke, automobile exhaust, cells produce less concentrations of antioxidant enzymes like radiation, air-pollution, pesticides, etc. (Li and Trush, 1994). superoxide dismutase (SOD), catalase (CAT), etc. Gene ac- Normally there is a balance between the amount of free tivation with inevitable aging-related physiological changes radicals generated in the body and the antioxidant defense (Harman, 1998; Ferrari, 2001). In healthy human cente- systems that scavenge/quench these free radicals preventing narians, although both plasmatic and red blood cell-SOD them from causing deleterious effects in the body (Nose, were decreased (in concentration with the increasing levels 2000). The antioxidant defense systems in the body can only since <60 years until 99 years), the remarkable increase of protect the body when the amount of the free radicals is plasmatic Vitamins A and E contribute the ﬁrst indication within the normal physiological level. But when this balance that these vitamins are favorable to longevity (Mecocci et al., is shifted towards more of free radicals, increasing their 2000). 168 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178

3.2. Atherosclerosis gest that they could contribute to all stages of carcinogenesis, however an excess of ROS/RNS can inhibit the cell prolif- It is a disease of arteries characterized by a local thicken- eration. Hence the net effect will depend upon the amount ing of the vessel wall that develops in the inner coat (Tunica of ROS/RNS generated and the extent of antioxidant defense intima). It is now believed and accepted that ROS/RNS play existing (Marnett, 1987). an important role in initiation and development of atherosclerosis. There are a number of roles believed to be played by the 3.5. Diabetes oxidants in atherogenesis: firstly, activation of macrophages or their monocyte precursors (Mitchinson and Ball, 1987). It has been postulated that the etiology of the compli- Secondly, normal macrophages possess some low density cations of diabetes involves oxidative stress perhaps as a lipoprotein (LDL) receptors. LDL bound to these receptors is result of hypoglycemia (Hunt et al., 1990). Glucose itself taken up with enhanced efficiency, so that cholesterol rapidly and hyperglycemia-related increased protein glycosylation accumulates with in the macrophage and may convert it to are important sources of free radicals (Wolff and Dean, 1987). a foam cell (Mitchinson and Ball, 1987). Thirdly, any lipid Elevated glucose causes slow but significant non-enzymatic peroxides present in LDL could conceivably contribute to the glycosylation of proteins in diabetes (Brownlee et al., 1984). initial endothelial cell damage that is thought to start off the Glucose auto-oxidise in the presence of transition metal ions whole process. Fourth, it has been suggested that products generating oxygen free radicals, which make the membrane formed in peroxidized LDL such as lysophosphotidylcholine vulnerable to oxidative damage. As the diabetogenic action (Mitchinson and Ball, 1987) might act as a chemotactic fac- can be prevented by the SOD, CAT, and other hydroxyl rad- tors for blood monocytes, encouraging their recruitment into ical scavengers such as ethanol, dimethyl urea, there is evi- an atherosclerotic lesion. Fifth, low concentration of perox- dence to suggest that the incidence of diabetes involves su- ides might accelerate cycloxygenase and lipoxygenase catal- peroxide anion and hydroxyl radicals. In addition to these ysed reactions in endotheliym and in any platelets present enzymes, glutathione reductase (GSH-R) and glutathione-S- leading to enhanced formation of eicosanoids (Yokoda et al., transferanse (GST) provide GSH and help to nutralize toxic 1988). electrophiles, respectively. There are clear cut evidence to show the role of free radicals in diabetes and studies indi- 3.3. Autoimmune diseases cate that tissue injury in diabetes may be due to free radicals (Grankvist et al., 1981). The significance of oxidative stress It seems likely that ROS, RNS and released enzymes such in the disease pathology is uncertain but is frequently pro- as proteases play some role in tissue damage in the autoim- posed to be related to the hyperglycaemia. Other possible mune diseases. Hence therapy against them might prove ben- sources include elevated plasma lipids leading to increased eficial. Example, urinary excretion of F2 isoprostanes is ele- lipid oxidation and decreased levels of antioxidant defense vated in scleroderma patients suggesting increased lipid per- systems (Baynes and Thorpe, 1999). oxidation (LPO). Also the levels of nitrate plus nitrite tend to be higher in the patients suffering from autoimmune diseases, 3.6. Inflammation indicating more NO• generation (Halliwell and Gutteridge, 1999). An inflammatory response implicates macrophages and neutrophils, which secrete a number of mediators (eicosi- 3.4. Cancer noids, oxidants, cytokine and lytic enzymes) responsible for initiation, progression and persistence of acute or chronic Most tumors form discrete masses but in the leukemias, state of inflammation (Lefkowitz et al., 1999). NO along •− the tumor cells are spread through the bone marrow or lym- with superoxide (O2 ) and the products of their interaction phoid tissues and circulate in the blood. DNA damage plays initiates a wide range of toxic oxidative reactions causing a very important role in carcinogenesis and any agent, which tissue injury (Hogg, 1998). Likewise, the neutrophils is capable of chemically modifying DNA could be carcino- too produce oxidants and release granular constituents genic. ROS/RNS fall into this category. Hydroxyl radical at- comprising of lytic enzymes performing important role in tack upon DNA generates a whole series of modified purine inflammatory injury (Yoshikawa and Naito, 2000). Reactive and pyrimidine bases many of which are known to be muta- oxygen intermediates (ROI) are believed to be mediators genic. Attack of •OH upon deoxyribose also yields a multi- of inflammation and responsible for the pathogenesis of plicity of products. It is well known that increased production tissue destruction in rheumatoid arthritis (Valentao et al., of ROS can cause DNA damage in cells (Cerutti, 1994). Ox- 2002). The role of ROS/RNS in inflammation is clearly idative damage to lipids and to proteins could also lead to demonstrated by the anti-inflammatroy effects of the an- mutagenic effects. One of effects of several tumor promot- tioxidants. Niric oxide synthase inhibitors are also effective ers including oxidative stress is to decrease the gap func- as anti-inflammatory agents in carrageenan-induced rat tional communication, and finally ROS may also be involved paw odema method as SOD. These may be due to the •− •− in metastatin. Thus, the multiple effects of ROS/RNS sug- removal of O2 by SOD, so preventing O2 dependent R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178 169 formation of a factor chemotactic for nutrophils (Miller et al., idizable substrate, that significantly delays or prevents oxi- 1992). dations of that substrate”. The term oxidizable substrate includes every type of molecule found in vivo. Antioxidant 3.7. Parkinson’s disease defense include the antioxidant enzymes like SOD, CAT, GSH-px, etc, low molecular agents and dietary antioxidants There have been several reports on the role of ROS/RNS (Halliwell and Gutteridge, 1999). in neurodegenertive diseases. Parkinson’s disease usually appears in the middle to old age often as a rhythmic tremor in a foot or hand especially when the limb is at rest. Comparison 5. Rasayana as antioxidants of the brains of Parkinson’s disease with that of the neurologi- cally normal brains shows several parameters consistent with The concept of developing drugs from plants used in in- increased oxidative stress and defective mitochondrial func- digenous medical system is much older, while in some cases tion. Damaged mitochondria may generate more ROS than direct links between a local and biomedical use exists, in •− • − usual and ROS/RNS (including O2 , OH, ONOO ) can in- other cases the relationship is much more complex (Heinrich activate complex I. Hence it is possible that oxidative stress and Gibbons, 2001). Traditionally, ‘Rasayana’ drugs are and mitochindrial defects form a vicious cycle (Halliwell and used against a plethora of seemingly diverse disorders with Gutteridge, 1999). no pathophysiological connections according to modern medicine. Looking at these diverse applications adaptogenic 3.8. Rhuematoid arthritis agents from this group of ‘Rasayanas’ were identified by Rege et al. (1999). It has been reported that the ‘Rasayanas’ ROI produced by activated phagocytes in the in- are rejuvenators, nutritional supplements and possess strong flamed joints have been implicated along with prostanoids, antioxidant activity. They also have antagonistic actions on leukotrienes and proteases, as mediators of inflammation and the oxidative stressors which giving rise to the formation of the pathogenesis of tissue destruction (Krane et al., 1990). different free radicals. Therefore, the therapeutic indication Many drugs commonly used in the day to day treatment of of these drugs can include the diseases relating to all the rheumatoid arthritis are believed to mediate their therapeu- above systems. Their antistress/adaptogenic actions have tic actions by multiple mechanisms, one of them being sug- made them therapeutically far more important (Brahma gested is a reduction of oxidant damage at sites of inflamma- and Debnath, 2003). The strong antioxidant activity of tion by drugs either acting as ROI scavengers or inhibitors of any ‘Rasayana’ was found to be 1000 times more potent ROI production by phagocytes (Aruoma, 1993). In humans, than ascorbic acid, ␣-tocopherol, and probucol (Sharma there are intrinsic enzymatic and non-enzymatic antioxidants et al., 1992). For example, oral administration of ‘Brahma detoxifying mechanisms that help to maintain a low ROI con- rasayana’ (50 mg/animal for 10 and 30 days) significantly centration in the body (Seiss, 1991). Enzymatic mechanisms increased the liver antioxidant enzymes such as SOD, CAT include SOD, which dismutates superoxide radicals, CAT along with tissue and serum levels of GSH. Thus, indicating and GSH-px that reduce H2O2 to water and molecular oxy- that ‘Brahma rasayana’ could ameliorate the oxidative dam- gen (Halliwell and Gutteridge, 1999). age produced in the body by radiation (Rekha et al., 2001). ‘Rasayana’ preparations also increased stem cell proliferation and also prevented free radical-induced injury produced 4. Antioxidant defense by radiation (Puri, 2003). Hanna et al. (1994) also reported the prevention of oxidant stress by ‘Student Rasayana’. It is evident through the reactions of oxygen, that it is toxic; Since free radicals are implicated in a number of physio- still only the aerobes survive its presence, primarily because logical disorders as described above and with the ‘Rasayana’ they have evolved an inbuilt antioxidant defense. Antioxidant drugs of Ayurveda used in the treatment of diverse physiolog- defenses comprise: ical disorders, there is a strong case to believe that ‘Rasayana’ drugs exert their therapeutic actions by their ability to scav- • Agents that catalytically remove free radicals and other re- enge free radicals or by their antioxidant potential. There has active species like SOD, CAT, peroxidase and thio specific been a review on some plants of Indian traditional medicine antioxidants. with antioxidant activity (Scartezzini and Speroni, 2000) and • Proteins that minimize the availability of peroxidase such a review of immunemodulators from ‘Ayurveda’ especially of as iron ions, copper ions and haem. the ‘Rasayana’ drugs (Agarwal and Singh, 1999). But there is • Proteins that protect biomolecules against oxidative dam- not a single review of the ‘Rasayana’ drugs of the ‘Ayurveda’, age example heat shock proteins. as antioxidants. Some important plants like Allium sativum, • Low molecular mass agents that scavenge ROS and RNS, Centella asiatica, Ocimum sanctum, Vitis vinifera and Zin- example GSH, ascorbic acid, tocopherol. giber officinale have been extensively reviewed in the recent The antioxidants may be defined as “any substance, when past. Important ‘Rasayana’ drugs are reviewed in detail for present at low concentrations compared with that of an ox- their antioxidant activity here. 170 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178

5.1. Acorus calamus 5.3. Andrographis paniculata

Acorus calamus Linn. (family: Acoraceae, Ayurvedic Andrographis paniculata (Burm. f.) Wall ex. Nees (fam- name: ‘Vacha’) is a semi-aquatic, perennial, aromatic herb ily: Acanthaceae, Ayurvedic name: ‘Kalmegh’), which has with creeping rhizomes. Since antiquity, calamus rhizome has widespread distribution in India, was found to be a substi- been used for medicinal baths, in incense and tea. It used tra- tute for Swertia chirayta and it became popular as green ditionally for flatulent colic and chronic dyspepsia (Parotta, chirayta. In ‘Ayurveda’, the leaf juice is a household rem- 2001). In ‘Ayurveda’, the rhizome is used as an aromatic, edy for flatulence, loss of appetite, bowel complaints of chil- stimulant, bitter, tonic, carminative, anti-spasmodic, emetic, dren, diarrhea, dysentery, dyspepsia, and general debility; it expectorant, emmenagogue, aphrodisiac, laxative, and di- is preferably given with the addition of aromatics. Decoction uretic (Kapoor, 2001). It has also been ethnobotanically used or infusion of the leaves gives good results in sluggish liver, in asthma, bronchitis, body ache, cold, cough and inflamma- neuralgia, in general debility, in convalescence after fevers, tion (Jain, 1991). The ethyl acetate extract of Acorus cala- and in advanced stages of dysentery (Kapoor, 2001). Andro- mus was found to be potent antioxidant by inhibition of 1,1- graphis paniculata significantly decreased kidney TBARS diphenyl-2-picrylhydrazyl (DPPH) free radical (Acuna et al., level (P < 0.005) in normal rats along with increase in the 2002). Antioxidant activity (in vitro) by DPPH scavenging at activity of SOD and CAT, but had no significant effect on three different concentrations (0.2, 0.1 and 0.01 g/ml) showed GSH-px activity in diabetic rats showing that it possesses an a maximum activity of 86.43% at 0.2 g/ml (Govindarajan et antihyperglycaemic property, and may also reduce oxidative al., 2003a). stress in diabetic rats (Zhang and Tan, 2000). Administra- tion of Andrographis paniculata showed protective effect in the activity of SOD, CAT, GSH-px, GSH-R as well the level 5.2. Aloe vera of GSH with decreased activity of lipid peroxidase proving it has antioxidant and hepatoprotective activity (Trivedi and Aloe vera Linn. (family: Aloaceae, Ayurvedic name: Rawal, 2001). ‘Kalmegh’ treated group showed a significant ‘Kumari’) is commonly known as aloe. In ‘Ayurveda’, dried decrease in activity of LDL and MDA formation and CAT, juice of Aloe vera is cathartic and given in constipation. GSH-px and GSH-R showed significant increases only at the The expressed juice of Aloe vera in the form of an ointment higher dose in the liver (Singh et al., 2001). in vaseline has been found to hasten healing of wounds of thermal burns and radiation injury. It has been found that 5.4. Asparagus racemosus aloe compound is very useful in cases of functional sterility and disturbed menstrual function. It is a favorite remedy for Asparagus racemosus Willd. (family: Asparagaceae, intestinal worms in children. The Ayurvedic drug known as Ayurvedic name: ‘Shatavari’), is a tall climber under-shrub ‘Kumari asava’ is useful in general debility, cough, asthma, found all over India. Almost all parts of this plant are used piles, epilepsy and colic (Kapoor, 2001). 8-C-␤-d-[2-O-(E)- by the Indian traditional system of medicine (‘Ayurveda’ and Coumaroyl]glucopyranosyl-2-[2-hydroxy]-propyl-7-metho- ‘Unani’) for the treatment of various ailments in human be- xy-5-methylchromone, a potent antioxidative compound ings. In particular, the roots are used in dysentery, diarrhoea, has been isolated from a methanolic extract of Aloe (Lee tuberculosis, leprosy, skin diseases, epilepsy, inflammations, et al., 2000). Aloesin derivatives isorabaichromone together and as an expectorant (Jain, 1991; Nadkarni, 1976). The aque- with feruloylaloesin and p-coumaroylaloesin from Aloe vera ous extracts of both fresh and dried roots were found to have showed potent DPPH radical and superoxide anion scaveng- amylase and lipase activities (Kapoor, 2001). The antioxi- ing activities. Electron spin resonance (ESR) using the spin dant effect of an active fraction consisting of polysaccha- trapping method suggested that the potent superoxide anion rides (termed as P3) fraction was more pronounced against scavenging activity of isorabaichromone may have been due LPO, as assessed by TBARS formation, while that of the to its caffeoyl group (Yagi et al., 2002). Polysaccharides and crude extract was more effective in inhibiting protein oxi- flavonoids fractions along with aloe extracts showed sig- dation. Both the crude extract and P3 fraction also partly nificant antioxidant activity (Hu et al., 2003). Experimental protects against radiation-induced loss of protein thiols and investigations performed after 3, 7 and 10 days exposure to inactivation of SOD. The inhibitory effects of these active radiation showed that Aloe vera treatment has significantly principles, at the concentration of 10 ␮g/ml, are compara- minimized the radiation-induced increase in the amount of ble to that of the established antioxidants GSH and ascorbic malondialdehyde (MDA) in liver, lungs, and kidney tissues acid (Kamat et al., 2000). The Asparagus racemosus extract of irradiated rats. Significant amelioration in SOD and CAT supplemented mice displayed an improvement in GSH-px activities was observed (Saada et al., 2003). The combination activity and GSH content and reduction in membranal LPO of extracts of Withania somnifera and Aloe vera was more (Parihar and Hemnani, 2003). Antioxidant compound race- effective in reducing oxidative damage in brain regions mofuran was isolated from Asparagus racemosus, which re- than the supplementation of single plant extract (Parihar et vealed activity against DPPH with IC50 value of 130 ␮M al., 2004). (Wiboonpun et al., 2004). Asparagus racemosus (100 and R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178 171

250 mg/kg body weight) for 3 weeks significantly reversed CAT and GSH-px activities (Bhattacharya et al., 2000a). It antioxidant enzymes like SOD and CATin liver and kidney in showed a dose-dependent free radical scavenging capacity diabetic rats. It possesses moderate antidiabetic activity, but and a protective effect on DNA cleavage and was confirmed it exhibits potent antioxidant potential in diabetic conditions by a significant protective effect on H2O2-induced cytoxic- (Govindarajan et al., 2004). ity and DNA damage in human non-immortalized fibroblasts (Russo et al., 2003). Treatment with Bacopa monnieri extract 5.5. Azadirachta indica significantly increased the antioxidant enzymes such as CAT, SOD, GSH-px and the levels of GSH, inhibited lipid perox- Azadirachta indica A. Juss. (family: Meliaceae, Ayurvedic idation and reduced the tumor markers (Rohini et al., 2004). name: ‘Nimba’) is commonly known as neem. It is very useful in blood disorders, eye diseases, intermittent fever, 5.7. Desmodium gangeticum as well as persistent low fever. Oil is very useful in leprosy, skin diseases, ulcers, and wounds. The bark contains a Desmodium gangeticum (L.) DC. (family: Fabaceae, resinous bitter principle and is usually prescribed in the Ayurvedic name: ‘Shalparni’) is a small shrub of tropical re- form of a tincture or an infusion. It is also regarded as gion which has been used in Indian system of medicine as a beneficial in malarial fever (Kapoor, 2001). The antioxidant bitter tonic, febrifuge, digestive, anticatarrhal, antiemetic, in property of Azadirachta indica has been reported (Rao et al., inflammatory conditions of chest and various other inflam- 1998). Neem leaf extracts (100, 200 and 400 mg/kg) showed matory conditions (Chopra et al., 1956). Though the roots its chemoprotective effects on potent gastric carcinogen of the plant are one of the ingredients of popular Ayurvedic N-methyl-N-nitro-N-nitrosoguanidine (MNNG)-induced drug – Dashmoola, a potent rejuvenating formulation used in oxidative stress by decreasing LPO and enhancing the an- ‘Ayurveda’, the aerial parts of this plant are mostly used as tioxidant enzymes like SOD, CAT, GSH-px and GST in male a substitute in Dashmoola. Desmodium gangeticum extract rats (Subapriya et al., 2003). Ethanolic neem leaf extract has potent antioxidant activity, achieved by scavenging abil- exerts protective effects against MNNG-induced genotox- ities observed against DPPH, nitric oxide, ferryl-bipyridyl icity and oxidative stress by augmenting host antioxidant and hypochlorous acid and LPO activity (Govindarajan et defence mechanisms (Subapriya et al., 2004). Azadirachta al., 2003b). indica extract demonstrated anticancer activity by increasing the distribution of antioxidant elements and GST activity 5.8. Phyllanthus emblica to protect cells in preneoplastic nodules in cancer treated groups (Hanachi et al., 2004). Modulatory effects of garlic Phyllanthus emblica L. (family: Euphorbiaceae, Ayurve- and neem leaf on hepatic and blood oxidant–antioxidant dic name: ‘Amalaki’) is considered best among ‘Rasayana’ status may play a key role in preventing cancer development so called ‘Acharasayana’ (Puri, 2003). In ‘Ayurveda’, fresh at extrahepatic sites (Arivazhagan et al., 2004). fruit is used in inflammation of the lungs and of the eyes as a collyrium. The seeds are used in the treatment of asthma, 5.6. Bacopa monnieri bronchitis, and biloiousness. The dried fruit is useful in hemorrhage, diarrhea, and dysentery. In combination with iron Bacopa monnieri (Linn.) Penn. (family: Scrophulariaceae, it is used as a remedy for anemia, jaundice, and dyspepsia. Ayurvedic name: Brahmi). Leaves and stalks are very use- Acute bacillary dysentery may be cured by drinking a syrup ful in the stoppage of urine, which is accompanied by ob- of amla with lemon juice. ‘Chyvanaprash’, a popular prepara- stinate costiveness. A poultice made of the boiled plant is tion containing Emblica officinalis, is very useful in anemia, placed on the chest in acute bronchitis and other coughs of asthma, inflammations of the lungs and eye diseases (Kapoor, children. Leaves also give satisfactory results in cases of as- 2001). The active tannoids of Emblica officinalis consisting thenia, nervous breakdown, and other low adynamic con- of emblicanin A (37%), emblicanin B (33%), punigluconin ditions. It is also given in combination with ‘Ghrita’ (ani- (12%) and pedunculagin (14%), administered in the doses of mal fat), a well-known Ayurvedic medicine (brahmi ghrita) 5 and 10 mg/kg, i.p., and deprenyl (2 mg/kg, i.p.), induced an in cases of hysteria and epilepsy. It is also useful in insan- increase in both frontal cortical and striatal SOD, CAT and ity, neurasthenia, aphonia and hoarseness (Kapoor, 2001). GSH-px activity, with concomitant decrease in LPO in brain Bacopa monnieri, is clinically used for memory enhanc- areas when administered once daily for 7 days (Bhattacharya ing, epilepsy, insomnia and as mild sedative. It protected et al., 1999). Fresh juice of Emblica fruits (50 and 100 mg/kg the autooxidation and FeSO4-induced oxidation of GSH body weight) given orally twice daily for 14 days increased on lower doses 100 ␮g/ml and below, but on higher con- the activities of cardiac SOD, CAT and GSH-px, with a concentrations it enhanced the rate of oxidation (Tripathi et comitant decrease of LPO in Ischemia-reperfusion-induced al., 1996). Extract of Bacopa monnieri was assessed on rat rats (Bhattacharya et al., 2002). Emblica officinalis inhibited brain frontal cortical, striatal and hippocampal SOD, CAT LPO induced with Fe(2+)/ascorbate along with inhibition of and GSH-px activities, following administration for 7, 14 hydoxyl and superoxide radical (Sabu and Kuttan, 2002). A or 21 days which induced a dose-related increase in SOD, standardized extract of Emblica officinalis was found to have 172 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178 a long-lasting and broad-spectrum antioxidant activity, thus pound decoction of its root, liquorice, raisins, and neem bark showing that Emblica is suitable for use in anti-aging, sun- is very curative; in dyspepsia with severe pains, the powder of screen and general purpose skin care products (Chaudhuri, ‘kutki’, Acorus calamus, chebulic myrobalan, and plumbago 2002). Administration of Emblica tannoids (10 and 20 mg, root in equal parts is given in doses of 28 ml with cow’s urine. po) for 21 days, concomitant with the stress procedure, in- In clinical studies on patients of infective hepatitis with jaun- duced a dose-related alteration in the stress effects. Thus, dice, Picrorhiza kurroa was reported to have led to a rapid fall antistress ‘Rasayana’ activity of Emblica officinalis may be, in serum bilirubin levels toward normal range and quicker at least partly due to its tendency to normalize stress-induced clinical recovery with no untoward effects. Picrorhiza kurroa perturbations in oxidative free radical scavenging activity led to beneficial results in the management of bronchial (Bhattacharya et al., 2000b). The presence of ‘Amlaki’ re- asthma. The drug is also reported to produce marked resulted in an enhanced cell survival, decreased free radical duction in serum cholesterol and coagulation time (Kapoor, production and higher antioxidant levels (Sairam et al., 2003). 2001). Picroliv, the active principle of Picrorhiza kurrooa, Emblica officinalis causes myocardial adaptation and protects and its main components which are a mixture of the iridoid against oxidative stress in ischemic-reperfusion injury in rats glycosides, picroside-I and kutkoside possess the properties (Rajak et al., 2004). of antioxidants which appear to be mediated through activity like that of SOD, metal ion chelation and xanthine oxidase 5.9. Glycyrrhiza glabra inhibition (Chander et al., 1992). The extract (1 mg/ml) showed marked protection (up to 66.68%) against peroxi- Glycyrrhiza glabra Linn. (family: Fabaceae, Ayurvedic dation of liver phospholipids besides, reduced GSH showed name: ‘Yashtimadhu’) is commonly known as licorice. In very encouraging activity. The extract also exhibited signif- Ayurveda, root in infusion, decoction, or extract is used icant free radical scavenging activity (Govindarajan et al., as a demulcent in inflammatory or irritable conditions of 2003c). the bronchial tubes, bowels, and catarrh of the genitouri- nary passage, such as cough, hoarseness, sore throat, asthma 5.11. Psoralea corylifolia and dysuria (Kapoor, 2001). Seven constituents, with antioxidant capacity were isolated from Glycyrrhiza glabra Psoralea corylifolia Linn. (family: Leguminoceae, which include isoflavans hispaglabridin A, hispaglabridin Ayurvedic name: ‘Vakuchi’). In Ayurveda, seed powder B, glabridin, and 4-O-methylglabridin, the two chalcones, is used in leprosy and leukoderma internally; and is also isoprenylchalcone derivative and isoliquiritigenin, and the applied in the form of paste or ointment externally. As a isoflavone, formononetin (Vaya et al., 1997). The effect of laxative it is particularly used in bilious disorders (Kapoor, the consumption of glabridin, an isoflavan isolated from 2001). A meroterpene and four flavonoids bakuchiol, Glycyrrhiza glabra root, on the susceptibility of low den- bavachinin, bavachin, isobavachin and isobavachalcone sity lipoprotein to oxidation was moderate in atherosclerotic were isolated from the seeds of Psoralea corylifolia as apolipoprotein E deficient mice (Belinky et al., 1998). Rab- antioxidative components. They showed broad antioxidative bits were treated (orally) with a preparation of Glycyrrhiza activities in rat liver microsomes and mitochondria. They glabra for 30 days and in parallel were exposed to vibration inhibited NADPH-, ascorbate-, t-BuOH- and CCl4-induced stress (30 days). The licorice preparation reduced CAT activ- LPO in microsomes. They also prevented NADH-dependent ity in the peripheral blood and increased animal resistance to and ascorbate-induced mitochondrial LPO (Haraguchi et vibration stress (Oganesyan, 2002). Five new prenylated di- al., 2002). Psoralea corylifolia showed higher activity in hydrostilbenes, ␣,␣-dihydro-3,5,4-trihydroxy-4,5-diisop- phospholipid peroxidation inhibition (Tang et al., 2004). entenylstilbene, ␣,␣-dihydro-3,5,3,4-tetrahydroxy-4,5-di- Bakuchiol, corylifolin, corylin and psoralidin isolated from isopentenylstilbene, ␣,␣-dihydro-3,5,4-trihydroxy-5-isop- Psoralea corylifolia had strong antioxidant activities, and entenylstilbene, ␣,␣-dihydro-3,5,3-trihydroxy-4-methoxy- especially psoralidin had stronger antioxidant property than 5-isopentenylstilbene, and ␣,␣-dihydro-3,5,3,4-tetrahyd- butylated hydroxy toluene (Jiangninga et al., 2005). roxy-5-isopentenyl stilbene with antioxidant activity were isolated (Biondi et al., 2003). 5.12. Semecarpus anacardium

5.10. Picrorhiza kurroa Semecarpus anacardium Linn. f. (family: Anacardiaceae, Ayurvedic name: Bhalatak) is commonly known as marking Picrorhiza kurroa Royle ex Benth (family: Scrophulari- nut. In ‘Ayurveda’, the juice of the shell of the nut is a power- aceae, Ayurvedic name: ‘Kutki’), is found in the Himalayan ful escharotic; it is given in small doses with some bland oil region growing at an altitude of 3000–5000 m. It is a well- or butter in leprous and scrofulous affections, syphilis, skin known herb in Ayurvedic system of medicine and has tradi- diseases, epilepsy, nervous debility, neuralgia, asthma, dys- tionally been used to treat disorders of the liver and upper res- pepsia, and piles. The bruised nut is used as an abortifacient piratory tract, reduce fever and treat dyspepsia, chronic disor- by placing it in the mouth of the uterus; also given as ver- ders and scorpion sting (Jain, 1991). In bilious fever, a com- mifuge. Equal parts of marking nut and chebulic myrobalams R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178 173 and sesamum seeds are made into a confection (‘Kshir pak’) starch obtained from the roots and stems of the plant is useful and administered in doses of 3–4 gm. It is used with advan- in diarrhea and dysentery, it is also a nutrient. The fresh plant tage in simple chromic enlargement of the spleen without is more efficacious than the dried plant. Its watery extract, any hepatic complication or fever. It is used in many neurotic, known as Indian quinine, is very effective in fevers due to cold cardiac troubles; the rate of the heartbeat is usually increased or indigestion; the plant is commonly used in rheumatism, under its influence. It is also useful in cases of pneumonia urinary diseases, dyspepsia, general debility, syphilis, skin (Kapoor, 2001). Administration of Semecarpus anacardium diseases, bronchitis, spermatorrhea, and impotence (Kapoor, nut extract 150 mg/kg body weight for 14 days on adjuvant 2001). As ‘Rasayana’, juice is given with honey or raw sugar arthritis brings back the altered antioxidant defense com- (Puri, 2003). Extract of Tinospora cordifolia has been shown ponents evidenced by the increased level of non-enzymatic to inhibit the LPO and superoxide and hydroxyl radicals in antioxidants (GSH, Vitamin E, Vitamin C) and enzymatic vitro (Mathew and Kuttan, 1997). Oral administration of an antioxidants (CAT and GSH-px except SOD) to near normal aqueous Tinospora cordifolia root extract (2.5 and 5.0 g/kg) levels (Vijayalakshmi et al., 1997). Semecarpus anacardium for 6 weeks resulted in a decrease in the levels of plasma nut extract administration induces the in vivo antioxidant TBARS, ceruloplasmin and ␣-tocopherol in alloxan diabetic defense system in aflatoxin B1 mediated hepatocellular car- rats. The root extract also causes an increase in the levels cinoma with marked increase in antioxidant levels and a dra- of GSH and vitamin C in alloxan diabetes rats (Prince and matic elevation in cytochrome P450 content (Premalatha and Menon, 1999). Oral administration of 2.5 g and 5.0 g/kg body Sachdanandam, 1999). Alcoholic extract of pericarp showed weight of the aqueous extract of the roots for 6 weeks re- significant protection against FeSO4-induced lipid peroxida- sulted in a significant reduction in TBARS and an increase in tion, as compared with whole native nut and seeds. Mecha- reduced GSH, CAT and SOD in alloxan diabetic rats (Prince nism of action may be through metal chelation or activation and Menon, 2001, Prince et al., 2004). The arabinogalactan of endogenous antioxidant enzymes (Tripathi and Singh, polysaccharide isolated from Tinospora cordifolia showed 2001). good protection against iron-mediated LPO of rat brain homogenate as revealed by the TBARS and lipid hydroperoxide 5.13. Terminalia chebula assays and high reactivity towards DPPH, superoxide radicals and the most damaging of radicals, the hydroxyl rad- Terminalia chebula Retz. (family: Combretaceae, ical (Subramanian et al., 2002). Aqueous extract inhibited Ayurvedic name: ‘Haritaki’). In ‘Ayurveda’, myrobalans are the formation of ferryl–bipiridyl complex by chelating Fe2+ used in fevers, cough, asthma, urinary diseases, piles and ions in a dose dependent manner. It also inhibited ferrous worms. It is also useful in chronic diarrhea and dysentery, sulphate mediated LPO in a dose-dependent manner (Goel flatulence, vomiting, colic and enlarged spleen and liver. et al., 2002). Tinospora cordifolia was effective in elevating Chebulic myrobalans are extensively used in combination the GSH levels, expression of the gamma-glutamylcysteine with belleric and embolic myrobalans under the name ligase and Cu–Zn SOD genes and also exhibited strong free of ‘Triphala’ and also as adjuncts to other medicines in radical scavenging properties against ROS and RNS as stud- numerous diseases (Kapoor, 2001). As a ‘Rasayana’, 3 g ied by electron paramagnetic resonance spectroscopy (Rawal of ‘Haritaki’ is used in the morning in empty stomach for et al., 2004). body strengthening and anti-aging (Puri, 2003). Terminalia chebula (fruits, brown) were stronger antioxidants than 5.15. Withania somnifera alpha-tocopherol, while Terminalia chebula (fruit coat) and Terminalia chebula (fruits, black) were weaker antioxidant Withania somnifera Dunal (family: Solanaceae, extracts than alpha-tocopherol and butylated hydroxy toluene Ayurvedic name: ‘Ashwagandha’) has been in use for in inhibition of LPO in vitro (Saleem et al., 2001). Emblica more than 2500 years. The roots of the plant are categorised officinalis inhibited LPO induced with Fe(2+)/ascorbate as ‘Rasayanas’, a group of plant-derived drugs that are along with inhibition of hydoxyl radical, and superoxide reputed to promote health and longevity by augmenting scavenging (Sabu and Kuttan, 2002). Terminalia chebula defense against disease, arresting the aging process, revi- showed maximum inhibition in the TBARS formation, talising the body in debilitated conditions, increasing the restore antioxidant enzyme SOD from the radiation-induced capability of the individual to resist adverse environmental damage (Naik et al., 2003). Terminalia chebula exhibited factors and creating a sense of mental well-being (Weiner antioxidant activity at different magnitudes of potency for and Weiner, 1994). In ‘Ayurveda’, it is used as nerve tonic, anti-LPO, anti-superoxide radical formation and free radical aphrodosiac, sedative, antirhuematism, for the treatment of scavenging activities (Cheng et al., 2003). constipation. It relieves inflammation, pain, backache and it stimulates sexual impulses and increases sperm count. 5.14. Tinospora cordifolia It is considered as a ‘Rasayana’ for strength, vigor and rejuvenation. Powders of Withania (100 g) and Tinospora Tinospora cordifolia (Willd.) Miers. (family: Menisper- (50 g) and Tinospora starch (10 g) are mixed and half a maceae, Ayurvedic name: ‘Guduchi’). In ‘Ayurveda’, the spoon of this powder is taken with half teaspoons of ghee 174 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178 and two teaspoons of honey (Puri, 2003). Root is used as plex and LPO (Vijayakumar et al., 2005). Alcoholic extract of an application in obstinate ulcers and rheumatic swelling. It the seeds of Mucuna pruriens (Linn.) DC. has an antilipid per- infuses fresh energy and vigor in a system worn out owing oxidation property, which is mediated through the removal of to any constitutional disease like syphilis, and in rheumatic superoxides and hydroxyl radicals (Tripathi and Upadhyay, fever. Powdered root is very useful with equal parts of ghee 2002). The antioxidant components of Piper species, viz., and honey for impotence or seminal debility. As nutrient and Piper cubeba, green pepper, Piper brachystachyum, Piper health restorative to the pregnant and old people, a decoction longum and Piper nigrum constitute a very efficient system of the root is recommended (Kapoor, 2001). Thirty days in scavenging a wide variety of reactive oxygen species. An- treatment Withania somnifera root produced a significant tioxidant potential of Piper species was further confirmed by decrease in LPO, and an increase in both SOD and CAT thus their ability to curtail in vitro LPO by around 30–50% with indicating that Ashwagandha root powder possesses free concomitant increase in GSH content (Karthikeyan and Rani, radical scavenging activity (Panda and Kar, 1997). Active 2003). In ferric reducing/antioxidant power (FRAP)/DPPH glycowithanolides, sitoindosides VII-X and withaferin A of assays, boiled ethanolic extracts of Plumbago zeylanica L. Withania somnifera (10 and 20 mg/kg, i.p.), administered were the most effective, while in the ABTS assay boiled once daily for 21 days, induced a dose-related increase aqueous extracts were the most efficient. These extracts also in SOD, CAT and GSH-px activity in frontal cortex and significantly inhibited LPO induced by cumene hydroper- striatum, which was statistically significant on days 14 and oxide, ascorbate-Fe(2+) and peroxynitrite. Thus, Extracts 21 (Bhattacharya et al., 1997). Administration of Withania of Plumbago zeylanica and its active ingredient plumbagin somnifera in the doses of 0.7 and 1.4 g/kg body weight per have significant antioxidant abilities that may possibly ex- day along with equivalent doses of lead acetate for 20 days plain some of the reported therapeutic effects (Tilak et al., significantly decreased LPO and increased the activities of 2004). ABTS assay showed that the ethanolic extract of Sida antioxidant enzymes, viz., SOD and CAT, thus retaining cordifolia L. was found to be most potent along with rela- normal peroxidative status of the tissues (Chaurasia et al., tive antioxidant capacity for the water infusions and potent 2000). Withania somnifera glycowithanolides, administered inhibition of LPO. Evolvulus alsinoides and Cynodon dacty- orally 1 h prior to the stress procedure for 21 days, in the lon were also found to be moderately active (Auddy et al., doses of 10, 20 and 50 mg/kg, induced a dose-related reversal 2003). of the stress effects. Withania somnifera glycowithanolides tended to normalise the augmented SOD and LPO activities and enhanced the activities of CAT and GSH-px indicating 6. Conclusion that, at least part of chronic stress-induced pathology may be due to oxidative stress, lending support to the clinical Ayurvedic concept of ‘Rasayana’ seems not only to em- use of the plant as an antistress adaptogen (Bhattacharya et body the principal aspects of new hypothesis centered on a al., 2001). Treatment with Withania somnifera successfully immuno-endocrine psycho neuro axis but also to go beyond attenuated GSH-px activity and inhibited LPO in a dose it by encompassing the entire human system with its diverse dependent manner. Withania somnifera inhibited both the and complicated immunoendocrine pathway (Handa, 1993). LPO and protein oxidative modification induced by copper It was well known to Ayurvedic physicians that the delicate (Gupta et al., 2003). The combination of extracts of Withania cellular machinery of the body suffers from trauma, result- somnifera and Aloe vera was more effective in reducing ing in wear and tear on different body structures and the oxidative damage in brain regions than the supplementation deterioration of the functional capacity. For this, procedures of single plant extract (Parihar et al., 2004). Given the of revitalization and rejuvenation (Rasayana therapy) were increasing recognition that chronic stress, particularly when adopted to increase the power of resistance to disease, these the individual is unable to cope with the stressor, may procedures retarded advancement of aging also. underlie the increasing incidence of stress-related physical The data in the review of the plants for their antioxidant and mental disorders, there is need for an effective antistress activity so far prove that ‘Rasayana’ plants could exert a more adaptogen. The answer probably lies in the ‘Ayurvedic’ global and nonspecific antioxidant effect. However, it is also ‘Rasayana’, the most promising of which is Withania evident that each plant is unique in its action and may be ex- somnifera (Weiner and Weiner, 1994). erting specific protective effects on specific organ/enzymes more than others. There is also tremendous amount of reports 5.16. Miscellaneous plants of the plants as antioxidants under various disease conditions like diabetes, cancer, atherosclerosis and arthritis, proving Curculigo orchioides Gaertn. had high antioxidant ac- that the mechanism involved may be in curing these dis- tivity in 2,2-azinobis[3-ethylbenzothiazoline-6-sulfonate] eases may be of antioxidants. From the review, it is evident (ABTS) assay (Tang et al., 2004). Hygrophila auriculata that most of the ‘Rasayana’ plants possess potent antioxi- (Schum.) Hiene. extract showed good radical scavenging dant activity. But still there is lacuna in the existing knowl- activity against DPPH with moderate scavenging activity edge. Firstly, some ‘Rasayana’ group of plants like Alpinia against Nitric oxide, hydroxyl radical, ferryl bipyridyl com- galanga, Argyreia speciosa, Boerhaavia diffusa, Convolvu- R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178 175 lus pluricaulis, Myristica fragrans, Tribulus terrestris, Ferula Auddy, B., Ferreira, M., Blasina, F., Lafon, L., Arredondo, F., Dajas, F., foetida, etc. which are used extensively in ‘Ayurveda’ have Tripathi, P.C., Seal, T., Mukherjee, B., 2003. Screening of antioxidant not been tested for their antioxidant potential. Most of the activity of three Indian medicinal plants, traditionally used for the management of neurodegenerative diseases. Journal of Ethnopharma- reports claim to validate the traditional claim of the plant as a cology 84, 131–138. ‘Rasayana’, but the proper mechanism of the action of these Bandhopadhyay, U., Das, D., Banerjee, R.K., 1999. Reactive oxygen plants is not clear. species: oxidative damage and pathogenesis. Current Science 77, Secondly, there are a number of preparations or formu- 658–666. lations, which are sold in the name of ‘Rasayana’, whose Baynes, J.W., Thorpe, S.R., 1999. Role of oxidative stress in diabetic complications: a new perspective on an old paradigm. Diabetes 48, activity, or the use has not been established. The ethnophar- 1–9. macological claims of these preparations need to be validated Belinky, P.A., Aviram, M., Fuhrman, B., Rosenblat, M., Vaya, J., 1998. to make them more acceptable. Also the method and mode The antioxidative effects of the isoflavan glabridin on endogenous of the treatment mentioned in the Ayurvedic texts needs to constituents of LDL during its oxidation. Atherosclerosis 137, 49–61. be understood before undertaking any biological screening. Bhattacharya, A., Chatterjee, A., Ghosal, S., Bhattacharya, S.K., 1999. Antioxidant activity of active tannoid principles of Emblica officinalis Thirdly, clinical efficacy of these preparations though re- (amla). Indian Journal of Experimental Biology 37, 676–680. ported by the continuous use by traditional practices has not Bhattacharya, A., Ghosal, S., Bhattacharya, S.K., 2000b. Antioxidant ac- been scientifically validated. The personalized medicine is tivity of tannoid principles of Emblica officinalis (amla) in chronic still followed by Ayurveda, making it difficult for the global stress induced changes in rat brain. Indian Journal of Experimental acceptance, as the exact mechanism or indications for their Biology 38, 877–880. Bhattacharya, A., Ghosal, S., Bhattacharya, S.K., 2001. Antioxidant effect uses are not clear. of Withania somnifera glycowithanolides in chronic footshock stress- Thus, a more focused research and understanding is re- induced perturbations of oxidative free radical scavenging enzymes quired to validate the ‘Rasayana’ drugs as antioxidants. There and lipid peroxidation in rat frontal cortex and striatum. Journal of are challenges ahead for researchers in ‘Ayurveda’ for vali- Ethnopharmacology 74, 1–6. dating the claims of the Ayurvedic treatment in the light of Bhattacharya, S.K., Bhattacharya, A., Kumar, A., Ghosal, S., 2000a. An- tioxidant activity of Bacopa monniera in rat frontal cortex, striatum the modern scientific knowledge and understanding, thereby and hippocampus. Phytotherapy Research 14, 174–179. make the system globally acceptable. This requires a highly Bhattacharya, S.K., Bhattacharya, A., Sairam, K., Ghosal, S., 2002. Effect integrated approach that combines the best of the traditional of bioactive tannoid principles of Emblica officinalis on ischemia- wisdom and modern scientific knowledge and expertise. reperfusion-induced oxidative stress in rat heart. Phytomedicine 9, Several studies are going on throughout the world to iden- 171–174. Bhattacharya, S.K., Satyan, K.S., Ghosal, S., 1997. Antioxidant activ- tify antioxidant compounds that are pharmacologically po- ity of glycowithanolides from Withania somnifera. Indian Journal of tent with low profile of side effects. Ayurveda, the oldest Experimental Biology 35, 236–239. medical system in the world, provides lots of lead to find Biondi, D.M., Rocco, C., Ruberto, G., 2003. New dihydrostilbene deriva- active and therapeutically useful compounds from plants. tives from the leaves of Glycyrrhiza glabra and evaluation of their ‘Rasayana’ formulations in Indian traditional medicine may antioxidant activity. Journal of Natural Products 66, 477–480. Brahma, S.K., Debnath, P.K., 2003. Therapeutic importance of Rasayana have antioxidant activity arising from individual plants, and drugs with special reference to their multi-dimensional actions. may act synergistically to prevent aging and related degenera- Aryavaidyan 16, 160–163. tive diseases. Further studies to isolate active principles from Brownlee, M., Vlassara, H., Cerami, A., 1984. Non-enzymic glycosylation these plants and their pharmacological validation in terms of and the pathogenesis of diabetic complications. Annals of Internal modern medicine will be of great medicinal importance in Medicine 101, 527–530. Cerutti, P.A., 1994. Oxy-radicals and cancer. Lancet 344, 862. future. Chander, R., Kapoor, N.K., Dhawan, B.N., 1992. Picroliv, picroside-I and kutkoside from Picrorhiza kurroa are scavengers of superoxide anions. Biochemical Pharmacology 44, 180–183. Chaudhuri, R.K., 2002. Emblica cascading antioxidant: a novel natural References skin care ingredient. Skin Pharmacology and Applied Skin Physiology 15, 374–380. Acuna, U.M., Atha, D.E., Ma, J., Nee, M.H., Kennelly, E.J., 2002. An- Chaurasia, S.S., Panda, S., Kar, A., 2000. Withania somnifera root extract tioxidant capacities of ten edible North American plants. Phytotherapy in the regulation of lead-induced oxidative damage in male mouse. Research 16, 63–65. Pharmacological Research 41, 663–666. Agarwal, S.S., Singh, V.K., 1999. Immunomodulators: a review of studies Cheng, H.Y., Lin, T.C., Yu, K.H., Yang, C.M., Lin, C.C., 2003. Antiox- on Indian medicinal plants and synthetic peptides. Proceedings of idant and free radical scavenging activities of Terminalia chebula. Indian Science Academy 65B, 179–204. Biological and Pharmaceutical Bulletin 26, 1331–1335. Arivazhagan, S., Velmurugan, B., Bhuvaneswari, V., Nagini, S., 2004. Chopra, R.N., Nayar, S.L., Chopra, I.C., 1956. Glossary of Indian Medic- Effects of aqueous extracts of garlic (Allium sativum) and neem inal Plants. CSIR Publication, New Delhi, India, p. 84. (Azadirachta indica) leaf on hepatic and blood oxidant–antioxidant Devaraj, T.L., 1980. The Panckarma Treatment of Ayurveda. India Book status during experimental gastric carcinogenesis. Journal of Medical Centre, Delhi, India. Food 7, 334–339. Diwedi, K.K., Singh, R.H., 1992. A clinical study of Medhya ‘Rasayana’ Aruoma, O.I., 1993. Use of DNA damage as a measure of pro-oxidant therapy in the management of convulsive disorders. Journal of Re- actions of antioxidant food additives and nutrient components. In: search in Ayurvedha and Sidha 13, 97–106. Halliwell, B., Aruoma, O.I. (Eds.), DNA and Free Radicals. Ellis Dringen, R., 2000. Glutathione metabolism and oxidative stress in neu- Horwood, London, pp. 315–327. rodegenration. European Journal of Biochemistry 267, 49–103. 176 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178

Ferrari, C.K.B., 2001. Oxidative stress pathophysiology: searching for Joshi, S., 1998. Ayurveda and ‘Panchkarma’. Motilal Banarasidas Pub- an effective antioxidant protection. International Medical Journal 8, lishers, Delhi, India. 175–184. Kamat, J.P., Boloor, K.K., Devasagayam, T.P., Venkatachalam, S.R., Finkel, T., Holbrook, N.J., 2000. Oxidants, oxidative stress and biology 2000. Antioxidant properties of Asparagus racemosus against dam- of ageing. Nature 408, 239–247. age induced by gamma-radiation in rat liver mitochondria. Journal of Ghanekar, B.G., 1981. Sutrasthana. In: Sushrut Samhita. Motilal Banarasi- Ethnopharmacology 71, 425–435. das, Varanasi, p. 3. Kapoor, L.D., 2001. Hand book of Ayurvedic Medicinal plants. CRC Goel, H.C., Prem Kumar, I., Rana, S.V., 2002. Free radical scaveng- Press, Washington, DC, pp. 18–19. ing and metal chelation by Tinospora cordifolia, a possible role in Karthikeyan, J., Rani, P., 2003. Enzymatic and non-enzymatic antioxidants radioprotection. Indian Journal of Experimental Biology 40, 727– in selected Piper species. Indian Journal of Experimental Biology 41, 734. 135–140. Govindarajan, R., Agnihotri, A.K., Khatoon, S., Rawat, A.K.S., Mehro- Krane, S.M., Conca, W., Stephenson, M.I., Amento, E.P., Goldring, M.B., tra, S., 2003a. Pharmacognostical evaluation of an antioxidant 1990. Mechanisms of matrix degradation in rheumatoid arthritis. An- plant—Acorus calamus. Natural Product Sciences 9, 264–269. nals of the New York Academy of Sciences 580, 340–354. Govindarajan, R., Rastogi, S., Vijayakumar, M., Rawat, A.K.S., Shir- Kumar, P., Kuttan, R.V., Kuttan, G.G., 1994. Chemoprotective action of waikar, A., Mehrotra, S., Pushpangadan, P., 2003b. Studies on the ‘Rasayana’ against cyclophosphamide toxicity. Tumori 80, 306–308. antioxidant activities of Desmodium gangeticum. Biological and Phar- Lee, K.Y., Weintraub, S.T., Yu, B.P., 2000. Isolation and identification of maceutical Bulletin 26, 1424–1427. a phenolic antioxidant from Aloe barbadensis. Free Radical Biology Govindarajan, R., Vijayakumar, M., Rawat, A.K.S., Mehrotra, S., 2003c. and Medicine 28, 261–265. Free radical scavenging potential of Picrorhiza kurroa Royle ex Benth. Lefkowitz, D.L., Gelderman, M.P., Fuhrmann, S.R., Graham, S., Starnes, Indian Journal of Experimental Biology 41, 875–879. J.D., Lefkowitz, S.S., Bollen, A., Moguilevsky, N., 1999. Neu- Govindarajan, R., Vijayakumar, M., Rao, Ch.V., Kumar, V., Rawat, trophilic lysozyme-macrophage interactions perpetuate chronic inflam- A.K.S., Pushpangadan, P., 2004. Action of Asparagus racemosus mation associated with experimental arthritis. Clinical Immunology against streptozotocin-induced oxidative stress. Natural Product Sci- 91, 145–155. ences 10, 177–181. Li, Y., Trush, M.A., 1994. Reactive oxygen dependent DNA damage Grankvist, K., Marklfund, S., Taljedal, I.B., 1981. Superoxide dismutase resulting from the oxidation of phenolic compounds by a copper redox is prophylactic against alloxan diabetes. Nature 294, 158–161. cycle. Cancer Research 54, 1895s–1898s. Gupta, S.K., Dua, A., Vohra, B.P., 2003. Withania somnifera (Ashwa- Marnett, L.J., 1987. Peroxyl free radicals: potential mediators of tumor gandha) attenuates antioxidant defense in aged spinal cord and inhibits initiation and promotion. Carcinogenesis 8, 1365. copper induced lipid peroxidation and protein oxidative modifications. Mathew, S., Kuttan, G., 1997. Antioxidant activity of Tinospora cordifolia Drug Metabolism and Drug Interaction 19, 211–222. and its usefulness in the amelioration of cyclophosphamide induced Halliwell, B., Gutteridge, J.M.C., 1999. Antioxidant defenses. In: Free toxicity. Journal of Experimental and Clinical Cancer Research 16, Radicals in Biology and Medicine, third ed. Oxford University Press, 407–411. New York, p. 175. Mecocci, P., Polidori, M.C., Troiano, L., Cherubini, A., Cecchetti, R., Hanachi, P., Fauziah, O., Peng, L.T., Wei, L.C., Nam, L.L., Tian, T.S., Pini, G., 2000. Plasma antioxidants and longevity: a study on health 2004. The effect of Azadirachta indica on distribution of antioxidant centenarians. Free Radical Biology and Medicine 28, 1243–1248. elements and glutathione S-transferase activity in the liver of rats Miller, M.J., Sadowska, K.H., Chotinaruemol, S., Kakkis, J.L., Clark, during hepatocarcinogenesis. Asia Pacific Journal of Clinical Nutrition D.A., 1992. Amelioration of chronic ileitis by nitric oxide synthase 13, S170. inhibition. Journal of Pharmacology and Experimental Therapeutics Handa, S.S., 1993. ‘Rasayana’ drugs. Part I. Pharma Times 25, 9–15. 264, 11–16. Hanna, A.N., Kauffman, E.M., Newman, H.A., Sharma, H.M., 1994. Pre- Mitchinson, M.J., Ball, R.Y., 1987. Macrophages and atherogenesis. vention of oxidant stress by Student Rasayana (SR). Advanced Ex- Lancet 2, 146–148. perimental Medical Biology 366, 444–445. Nadkarni, A.K., 1976. Nadkarni’s Indian Materia Medica, vol. 1. Popular Haraguchi, H., Inoue, J., Tamura, Y., Mizutani, K., 2002. Antioxidative Prakashan, Bombay, p. 153. components of Psoralea corylifolia (Leguminosae). Phytotherapy Re- Naik, G.H., Priyadarsini, K.I., Satav, J.G., Banavalikar, M.M., Sohoni, search 16, 539–544. D.P., Biyani, M.K., Mohan, H., 2003. Comparative antioxidant ac- Harman, D., 1998. Aging: phenomenon and theories. American New York tivity of individual herbal components used in Ayurvedic medicine. Academy of Sciences 854, 1–7. Phytochemistry 63, 97–104. Heinrich, M., Gibbons, S., 2001. Ethnopharmacology in drug discovery: Nose, K., 2000. Role of reactive oxygen species in regulation of physio- an analysis of its role and potential contributions. Journal of Pharmacy logical functions. Biological and Pharmaceutical Bulletin 23, 897–903. and Pharmacology 53, 425–432. Oganesyan, K.R., 2002. Antioxidant effect of licorice root on blood cata- Hogg, N., 1998. Free radicals in disease. Seminar in Reproductive En- lase activity in vibration stress. Bulletin of Experimental Biology and docrinology 16, 241–248. Medicine 134, 135–136. Hu, Y., Xu, J., Hu, Q., 2003. Evaluation of antioxidant potential of Aloe Panda, S., Kar, A., 1997. Evidence for free radical scavenging activity of vera (Aloe barbadensis Miller) extracts. Journal of Agricultural Food Ashwagandha root powder in mice. Indian Journal of Physiology and Chemistry 51, 7788–7791. Pharmacology 41, 424–426. Hunt, J.V., Smith, C.C.T., Wolff, S.P., 1990. Auto-oxidative glycosyla- Parihar, M.S., Chaudhary, M., Shetty, R., Hemnani, T., 2004. Suscep- tion and possible involvement of peroxides and free radicals in LDL tibility of hippocampus and cerebral cortex to oxidative damage in modification by glucose. Diabetes 39, 1420–1424. streptozotocin treated mice: prevention by extracts of Withania som- Jain, S.K., 1991. Dictionary of Indian Folk Medicine and Ethnobotany. nifera and Aloe vera. Jouranl of Clinical Neuroscience 11, 397–402. Deep Publications, New Delhi. Parihar, M.S., Hemnani, T., 2003. Experimental excitotoxicity provokes Jayaram, S., Walwaikar, P.P., Rajadhyaksha, S.S., 1993. Evaluation of oxidative damage in mice brain and attenuation by extract of Aspara- efficacy of a preparation containing a combination of Indian medicinal gus racemosus. Journal of Neural Transmission 111, 1–12. plants in patients of generalized weakness. Indian Drugs 30, 498–500. Parotta, J.A., 2001. Healing Plants of Peninsular India. CABI Publishing, Jiangninga, G., Xinchu, W., Houb, W., Qinghuab, L., Kaishuna, B., 2005. Oxon, UK, pp. 106–107. Antioxidants from a Chinese medicinal herb—Psoralea corylifolia L. Premalatha, B., Sachdanandam, P., 1999. Semecarpus anacardium L. nut Food Chemistry 91, 287–292. extract administration induces the in vivo antioxidant defence sys- R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178 177

tem in aflatoxin B1 mediated hepatocellular carcinoma. Journal of harishi Ayurveda herbal mixtures. Pharmacology Biochemistry and Ethnopharmacology 66, 131–139. Behavior 43, 1175–1182. Prince, P.S., Kamalakkannan, N., Menon, V.P., 2004. Restoration of an- Sharma, P., 1983. Chikithsasthana. In: Charaka Samhita. Chaukhamba tioxidants by ethanolic Tinospora cordifolia in alloxan-induced dia- Orientalia, Varanasi. betic Wistar rats. Acta Poloniae Pharmaceutica 61, 283–287. Singh, R.H., Murhty, A.R.V., 1989. Medhya ‘Rasayana’ therapy in the Prince, P.S., Menon, V.P., 1999. Antioxidant activity of Tinospora cordi- management of Apsmara viz-a-viz epilepsies. Journal of Research and folia roots in experimental diabetes. Journal of Ethnopharmacology Education in Indian Medicine 8, 13–16. 65, 277–281. Singh, R.P., Banerjee, S., Rao, A.R., 2001. Modulatory influence of An- Prince, P.S., Menon, V.P., 2001. Antioxidant action of Tinospora cordi- drographis paniculata on mouse hepatic and extrahepatic carcinogen folia root extract in alloxan diabetic rats. Phytotherapy Research 15, metabolizing enzymes and antioxidant status. Phytotherapy Research 213–218. 15, 382–390. Puri, H.S., 1970a. Indian medicinal plants use in elixirs and tonics. Quar- Subapriya, R., Kumaraguruparan, R., Abraham, S.K., Nagini, S., 2004. terly Journal of Crude Drug Research 10, 1555–1566. Protective effects of ethanolic neem leaf extract on N-methyl-N-nitro- Puri, H.S., 1970b. Chavanprasha – an ancient Indian preparation for res- N-nitrosoguanidine-induced genotoxicity and oxidative stress in mice. piratory diseases. Indian Drugs 7, 15–16. Drug Chemistry and Toxicology 27, 15–26. Puri, H.S., 1971. Vegetable aphrodisiacs of India. Quarterly Journal of Subapriya, R., Kumaraguruparan, R., Chandramohan, K.V., Nagini, Crude Drug Research 11, 1742–1748. S., 2003. Chemoprotective effects of ethanolic extract of neem Puri, H.S., 1972. Aphrodisiacs in India. Indian Drugs 9, 11–14. leaf against MNNG-induced oxidative stress. Pharmazie 58, 512– Puri, H.S., 2003. ‘Rasayana’—Ayurvedic herbs for longevity and rejuve- 517. nation. Taylor and Francis, London. Subramanian, M., Chintalwar, G.J., Chattopadhyay, S., 2002. Antioxi- Rajak, S., Banerjee, S.K., Sood, S., Dinda, A.K., Gupta, Y.K., Gupta, dant properties of a Tinospora cordifolia polysaccharide against iron- S.K., Maulik, S.K., 2004. Emblica officinalis causes myocardial adap- mediated lipid damage and gamma-ray induced protein damage. Re- tation and protects against oxidative stress in ischemic-reperfusion dox Reports 7, 137–143. injury in rats. Phytotherapy Research 18, 54–60. Tang, S.Y., Whiteman, M., Peng, Z.F., Jenner, A., Yong, E.L., Halliwell, Rao, A.D., Devi, K.N., Thyagaraju, K., 1998. Isolation of antioxidant B., 2004. Characterization of antioxidant and antiglycation properties principle from Azadirachta seed kernels: determination of its role on and isolation of active ingredients from traditional chinese medicines. plant lipoxygenases. Journal of Enzyme Inhibition 4, 85–96. Free Radical Biology and Medicine 36, 1575–1587. Rawal, A.K., Muddeshwar, M.G., Biswas, S.K., 2004. Rubia cordifolia Tilak, J.C., Adhikari, S., Devasagayam, T.P., 2004. Antioxidant proper- Fagonia cretica linn and Tinospora cordifolia exert neuroprotection by ties of Plumbago zeylanica, an Indian medicinal plant and its active modulating the antioxidant system in rat hippocampal slices subjected ingredient, plumbagin. Redox Reports 9, 219–227. to oxygen glucose deprivation. BMC Complementary and Alternative Trikamji, Y. (Ed.), 1994. Shushruta Samhita. Chaukhambha Surbharathi Medicine 4, 11. Prakasan, Varanasi, India. Rege, N.N., Thatte, U.M., Dahanukar, S.A., 1999. Adaptogenic proper- Tripathi, Y.B., Chaurasia, S., Tripathi, E., Upadhyay, A., Dubey, G.P., ties of six Rasayana herbs used in Ayurvedic medicine. Phytotherapy 1996. Bacopa monniera Linn. as an antioxidant: mechanism of action. Research 13, 275–291. Indian Journal of Experimental Biology 34, 523–526. Rekha, P.S., Kuttan, G., Kuttan, R., 2001. Effect of brahma rasayana Tripathi, Y.B., Singh, A.V., 2001. Effect of Semecarpus anacardium nuts on antioxidant system after radiation. Indian Journal of Experimental on lipid peroxidation. Indian Journal of Experimental Biology 39, Biology 39, 1173–1175. 798–801. Rohini, G., Sabitha, K.E., Devi, C.S., 2004. Bacopa monniera Linn. ex- Tripathi, Y.B., Upadhyay, A.K., 2002. Effect of the alcohol extract of tract modulates antioxidant and marker enzyme status in fibrosarcoma the seeds of Mucuna pruriens on free radicals and oxidative stress in bearing rats. Indian Journal of Experimental Biology 42, 776–780. albino rats. Phytotherapy Research 16, 534–538. Russo, A., Izzo, A.A., Borrelli, F., Renis, M., Vanella, A., 2003. Free Trivedi, N.P., Rawal, U.M., 2001. Hepatoprotective and antioxidant prop- radical scavenging capacity and protective effect of Bacopa monniera erty of Andrographis paniculata (Nees) in BHC induced liver damage L. on DNA damage. Phytotherapy Research 17, 870–875. in mice. Indian Journal of Experimental Biology 39, 41–46. Saada, H.N., Ussama, Z.S., Mahdy, A.M., 2003. Effectiveness of Aloe Udupa, K.N., 1973. Psychosomatic stress in ‘Rasayana’. Journal of Re- vera on the antioxidant status of different tissues in irradiated rats. search in Indian Medicine 8, 1–2. Pharmazie 58, 929–931. Valentao, P., Fernndes, E., Canvalho, E., Andrade, P.B., Seabra, R.M., Sabu, M.C., Kuttan, R., 2002. Anti-diabetic activity of medicinal plants Bastos, M.L., 2002. Antioxidant activity of Hypericum androsaenium and its relationship with their antioxidant property. Journal of infusion scavenging effect on superoxide radical, hydroxyl radical Ethnopharmacology 81, 155–160. and hypochlorous acid. Biological and Pharmaceutical Bulletin 25, Sairam, M., Neetu, D., Deepti, P., Vandana, M., Ilavazhagan, G., Kumar, 1324–1327. D., Selvamurthy, W., 2003. Cytoprotective activity of Amla (Emblica Vaya, J., Belinky, P.A., Aviram, M., 1997. Antioxidant constituents from officinalis) against chromium (VI) induced oxidative injury in murine licorice roots: isolation, structure elucidation and antioxidative capac- macrophages. Phytotherapy Research 17, 430–433. ity toward LDL oxidation. Free Radical Biology and Medicinedkjdot Saleem, A., Ahotupa, M., Pihlaja, K., 2001. Total phenolics concentration 23, 302–313. and antioxidant potential of extracts of medicinal plants of Pakistan. Vijayakumar, M., Govindarajan, R., Shirwaikar, A., Kumar, V., Rawat, Zeitschrift fur¨ Naturforschung C 56, 973–978. A.K.S., Mehrotra, S., Pushpangadan, P., 2005. Free radical scavenging Scartezzini, P., Speroni, E., 2000. Review on some plants of Indian tra- and lipid peroxidation inhibition potential of Hygrophila auriculata. ditional medicine with antioxidant activity. Journal of Ethnopharma- Natural Product Sciences. 11, 61–66. cology 71, 23–43. Vijayalakshmi, T., Muthulakshmi, V., Sachdanandam, P., 1997. Salubrious Schulz, J.B., Lindnau, J., Seyfriend, J., Dichgans, J., 2000. Glutathione effect of Semecarpus anacardium against lipid peroxidative changes in oxidative stress and neuro-degeneration. European Journal of Bio- adjuvant arthritis studied in rats. Molecular and Cellular Biochemistry chemistry 267, 4904–4911. 175, 65–69. Seiss, H., 1991. Oxidative stress: from basic research to clinical applica- Wagner, H., 1994. Therapy and Prevention with Immunomodulatory and tions. American Journal of Medicine 91, 375–385. Adaptogenic Plant Drugs. Update – Ayurveda, Bombay, pp. 24–26. Sharma, H.M., Hanna, A.N., Kauffman, E.M., Newman, H.A.I., 1992. In- Weiner, M.A., Weiner, J., 1994. Ashwagandha (Indian ginseng). In: Herbs hibition of human low-density lipoprotein oxidation in vitro by Ma- that heal. Quantum Books, Mill Vallery, pp. 70–72. 178 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178

Wiboonpun, N., Phuwapraisirisan, P., Tip-pyang, S., 2004. Identification Yokoda, M., Kitta, T., Kikawa, Y., Ogorochi, T., Narumiya, S., Kawai, of antioxidant compound from Asparagus racemosus. Phytotherapy C., 1988. Stimulated arachidonate metabolism during foam cell Research 18, 771–773. transformation of mouse peritoneal macrophages with oxidized Wolff, S.P., Dean, R.T., 1987. Glucose auto-oxidation and protein modi- low density lipoprotein. Journal of Clinical Investigation 81, 720– fication: the potential role of autooxidative glycosylation in diabetes. 729. Biochemical Journal 245, 243–246. Yoshikawa, T., Naito, Y., 2000. The role of neutrophils and inflammation Yagi, A., Kabash, A., Okamura, N., Haraguchi, H., Moustafa, S.M., in gastric mucosal injury. Free Radical Research 33, 785–794. Khalifa, T.I., 2002. Antioxidant, free radical scavenging and anti- Zhang, X.F., Tan, B.K., 2000. Antihyperglycaemic and antioxidant prop- inflammatory effects of aloesin derivatives in Aloe vera. Planta Medica erties of Andrographis paniculata in normal and diabetic rats. Clinical 68, 957–960. and Experimental Pharmacology and Physiology 27, 358–363. Journal of Ethnopharmacology 99 (2005) 179–184

Protective effect of Khamira Abresham Uood Mastagiwala against free radical induced damage in focal cerebral ischemia

Seema Yousuf, Soﬁyan Salim 1, Muzamil Ahmad 1, Abdullah Shaﬁque Ahmed 1, Mubeen Ahmed Ansari, Fakhrul Islam ∗

Neurotoxicology Laboratory, Department of Medical Elementology and Toxicology, Jamia Hamdard (Hamdard University), Hamdard Nagar, New Delhi 110062, India Received 23 October 2004; received in revised form 5 December 2004; accepted 10 December 2004 Available online 7 April 2005

Abstract

The effect of Khamira Abresham Uood Mastagiwala (KAUM) (a preparation of Indian System of Unani Medicine) on the activity of antioxidant enzymes, glutathione reductase (GR), glutathione S-transferase (GST), glutathione peroxidase (GPx), catalase (CAT) and the content of glutathione (GSH) and thiobarbituric acid reactive substances (TBARS) was studied in the middle cerebral artery occluded (MCAO) rats after 15 days pretreatment (200 mg/kg body weight (b.wt.), orally) of Khamira Abresham Uood Mastagiwala. The rats were trained and assessed for neurobehavioral activity using Cook’s climbing pole. The middle cerebral artery of adult male Wistar rats was occluded for 2 h and reperfused for 22 h. The activity of GPx, GST, GR, catalase and content of GSH was decreased significantly in MCAO group as compared with sham. The rats of MCAO + KAUM group have shown a significant protection in the activity of above-mentioned antioxidant enzymes and content of glutathione when compared with MCAO group. The significantly elevated level of TBARS in MCAO group was depleted significantly by the pretreatment of animals with KAUM in MCAO group. The neurobehavioral assessment has also strengthened the above biochemical data thereby indicating that the therapeutic intervention of KAUM, which is a potent cardiac and melancholic tonic, can be used to prevent or reduce the deterioration caused by free radicals thereby preventing subsequent pathological and biochemical changes which occur during cerebral ischemia. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Cerebral ischemia; Khamira Abresham Uood Mastagiwala; Free radicals; Antioxidant enzymes; Cook’s climbing pole

1. Introduction ischemic damage. Also, Shah and Vohora (2002) reported the protective effect of Swarna Bhasma and Unani Kushta Traditional herbs have potentials for preventing patho- Tila Kalan on cerebral ischemia induced oxidative damage. logical outcome of neurodegenerative diseases (Ichikawa One of the myriad of events following cerebral ischemia is and Tetsuya, 2002). Several studies reported the effect of oxidative stress which poses a threat to the brain environment traditional herbs on free radicals induced damage in cerebral (Chan, 2001). Reactive oxygen species (ROS) have been im- ischemia. Likewise, Salim et al. (2003) have shown the plicated in the pathophysiology of many neurological disor- protective effect of Nardostachys jatamansi on cerebral ders and brain dysfunctions (Chan, 2001). Cellular functions are critically altered with increased production of free radi- ∗ Corresponding author. Tel.: +91 11 2605 9688x5567; cals after brain injury, which are generated through different fax: +91 11 2605 9663; mobile: 9818684535. cellular pathways (Lewen et al., 2000). Increased vulnerabil- E-mail addresses: [email protected], ﬁ[email protected] ity of brain to oxidative damage leads to the impairment of (F. Islam). 1 Present address: Department of Anesthesia, Critical Care Medicine, brain antioxidant systems after ischemia/reperfusion, which Johns Hopkins University School of Medicine, 600 North Wolfe Street, are responsible for failure of cerebral energy metabolism Blalock 1404-A, Baltimore, MD 21287, USA. (Pulsinelli et al., 1982). Abrupt loss of neurological functions

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.jep.2004.12.035 180 S. Yousuf et al. / Journal of Ethnopharmacology 99 (2005) 179–184 like memory dysfunction is also reported during cerebral added. Then mastagi, musk, uood, marwareed, amber (each ischemia (Hirakawa et al., 1994). Although, many synthetic 8 g), badranjaboya 84 g and sugar 1.2 kg were added to the drugs have been reported to possess therapeutic effects water and boiled till the content was reduced to 1/4 that against cerebral ischemia (Chan, 2001; Montoliu et al., gives concentrated thick syrup. Thereafter, yaqoot, marjan 2002) but its complete treatment is yet obscure. and yashab (each 4 g) were crushed and made a paste in rose Khamira Abresham Uood Mastigiwala (KAUM), a com- water and mixed thoroughly in the above-mentioned thick pound formulation used in the Indian System of Unani cold syrup (Table 1). Medicine since ages, is extensively used in the treatment of arrhythmia, palpitation and cardiac debility, effectively stim- 2.3. Animals ulates the functioning of all the basic organs of the body (Kabeer, 1951). The efficacy of KAUM on oxidative stress Male Wistar rats weighing 300–350 g were obtained from related parameters have not been scientifically explored. The the Central Animal House, Jamia Hamdard, New Delhi. They properties of this Unani drug have created our interest to study were housed in polypropylene cages in air conditioned room its possible neuroprotective implications in the stroke. and allowed free access to pelletted diet and water ad libitum. The animals were used in accordance with the procedure approved by the Animal Ethics Committee of Jamia Hamdard. 2. Material and methods 2.4. Experimental protocol 2.1. Drugs and chemicals Animals were divided into four groups each having eight Glutathione (GSH) (oxidized and reduced), nicotinamide animals for a period of 15 days. The first group served as adenine dinucleotide phosphate reduced form (NADPH), 1- sham and saline was given orally, second was middle cerebral chloro-2,4-dinitrobenzene (CDNB), 5-5-dithiobis-2-nitro- artery occluded (MCAO), i.e., ischemia was induced for 2 h benzoic acid (DTNB) and thiobarbituric acid (TBA) were followed by reperfusion for 22 h, third was pretreated for 15 purchased from Sigma–Aldrich Foreign Holding Chemical days with KAUM (200 mg/kg, orally) followed by MCAO for Company, India. Other chemicals were of analytical reagent 2 h and reperfusion for 22 h, i.e., MCAO + KAUM group, and grade. Khamira Abresham Uood Mastagiwala was procured fourth was pretreated for 15 days with drug alone, i.e., KAUM from M/s Hamdard (Waqf) Laboratories, Gaziabad, U.P., (200 mg/kg, orally). After the completion of the reperfusion India. period, the animals were assessed for neurobehavioral activity and then sacrificed. The brains were taken out to dissect hippocampus for biochemical estimations. 2.2. The recipe of the Unani formulation “Khameera Abreesham Uood Mastagiwala” 2.5. Induction of ischemia

A red hot gold piece and a red hot iron rod were immersed The right middle cerebral artery occlusion was pro- in 4 l of water for 1 min. Thereafter, Abresham (408 g) was duced using an intraluminal ﬁlament model as described by

Table 1 Constituents of Khameera Abresham Uood Mastagiwala (KAUM) S. no. Name Family name Origin Content g/10 g Clinical importance 1 Abresham Bombycidae (Bombyx Animal 0.15 Strengthens/vitalizes/relaxes/stimulates heart muscles, (Silk Cocoon) Mori Linn) nervine tonic, memory enhancer, bronchodilator, vasodilator (Sifiuddin, 1999) 2 Uood (Eagle-wood) Liliaceae Plant 0.01 Stimulant, cholagogue, deobstructant, nervine tonic, carminative (Sifiuddin, 1999). 3 Badranjiboya Labiatae (Lamiaceae) Plant 1.14 Strengthens heart, exhilarant, melancholic disorders, (Mountain Balm) nervine tonic (Sifiuddin, 1999). 4 Amber (Ambergris) Araucariaceae Plant 0.02 Exhilarant, stimulant, antiseptic, nervous debility, delirium, epilepsy (Sifiuddin, 1999). 5 Mastagi (Mastich) Pistaciaceae Plant 0.01 Stimulant, catarrh, astringent (Sifiuddin, 1999). 6 Marjan (Coral) Acroporidea Animal 0.03 Nervine tonic, vertigo, headache, giddiness, asthma, scrofulous afflictions, T.B. (Sifiuddin, 1999). 7 Kehruba (Vateria) Dipterocarpaceae Plant 0.03 Antibacterial, carminative (Rafiquddin, 1995) 8 Marwareed (Pearl) Pteriacea Mineral 0.05 Stimulant, nutritive, tones heart & brain muscles, epilepsy, asthma (Deshaprabhu, 1982; Sifiuddin, 1999). 9 Yaqoot (Ruby) Corundum variety Mineral 0.03 Cardiac tonic, tranquilizer, epilepsy, anticoagulant, melancholic disorders (Sifiuddin, 1999). 10 Yashab (Jade) Silicates Mineral 0.03 Cardio protective (Deshaprabhu, 1982). Words italicized are in Urdu/Persian and the parentheses include names in English. S. Yousuf et al. / Journal of Ethnopharmacology 99 (2005) 179–184 181

Salim et al. (2003). In brief, the rats were anesthetized with 2.8.3. Catalase chloral hydrate (400 mg/kg, i.p.), a 4-0 nylon monofilament, The activity of catalase (CAT)(EC 1.11.1.6) was measured was inserted into the external carotid artery and advanced into by the method of Claiborne (1985). Change in absorbance the internal carotid artery. Two hours after the induction of was recorded at 240 nm and enzyme activity was calculated ischemia, the filament was slowly withdrawn and the animals in terms of nmol H2O2 consumed by using a molar extinction were then returned to their cages. In sham-operated rats, the coefficient of 43.6 M−1 cm−1. external carotid artery was surgically prepared for insertion of the filament but the filament was not inserted. 2.8.4. Glutathione reductase Glutathione reductase (GR) (EC 1.6.4.2) activity was 2.6. Behavioral study measured according to the method of Carlberg and Mannerviek (1975). The enzyme activity was quantitated The behavioral test in each group was performed before at 25 ◦C by measuring the disappearance of NADPH at and after occlusion and reperfusion. The experiment was per- 340 nm. The activity was calculated as nmol NADPH oxi- formed between 9.00 a.m. and 4.00 p.m. at standard labora- dized min−1 mg−1 protein using molar extinction coefficient tory conditions. All tests were performed and analyzed by of 6.22 × 103 M−1 cm−1. subject blind to the experiment.

2.6.1. Conditioned avoidance response (CAR) 2.8.5. Estimation of reduced glutathione This experiment was done in Cook’s climbing pole appara- The reduced glutathione was determined by the method tus (Cook and Wieldley, 1957). The conditioned stimulus was of Jollow et al. (1974). The yellow color developed was ␭ buzzer for 10 s and unconditioned stimulus was foot shock read immediately at 412 nm in spectrophotometer ( -20, ␮ delivered through the grid of floor applied for 10 s. After Perkin-Elmer). The GSH content was calculated as gof training, the animals kept in Cook’s climbing pole chamber GSH/g of fresh tissue by using molar extinction coefficient × 3 −1 −1 jumped on the pole on hearing the buzzer to avoid electric of 13.6 10 M cm . shock and failure results in foot shock. All the animals which showed 100% CAR were again tested for their performance 2.8.6. Estimation of TBARS after surgery and reperfusion of 22 h. The assay for thiobarbituric acid reactive substance (TBARS) was done according to the method of Islam 2.7. Tissue preparation et al. (2002). The absorbance of the color was read at 535 nm and TBARS was calculated as nmoles of TBARS After producing MCAO and assessment of CAR, the ani- formed per h/g tissue using a molar extinction coefficient of mals were sacrificed immediately and their brains were taken 1.56 × 105 M−1 cm−1. out to dissect hippocampus. Post mitochondrial supernatant (PMS) obtained from 10% homogenate of tissue was used for the estimation of various parameters related to oxidative 2.8.7. Protein estimation stress. It was determined by the method of Lowry et al. (1951).

2.8. Biochemical estimations 2.8.8. Statistical analyses Results are expressed as mean ± S.E. of eight animals. 2.8.1. Glutathione peroxidase Differences between the means of experimental and control Glutathione peroxidase (GPx) (EC 1.11.1.9) activity was groups were analysed statistically using Student’s t-test. measured at 37 ◦C by coupled assay system as described by Wheeler et al. (1990). The change in absorbance was recorded at 340 nm and the enzyme activity was calculated as nmol 3. Results NADPH oxidized min−1 mg−1 protein using molar extinc- × 3 −1 −1 tion coefficient of 6.22 10 M cm . 3.1. Effect of MCAO on the activity of GPx, GR, GST, CAT and protection by KAUM 2.8.2. Glutathione S-transferase Glutathione S-transferase (GST) (EC 2.5.1.18) activity Table 2 shows the effect of MCAO and protection by was measured by the method of Habig et al. (1974). The KAUM on the activity of GPx, GR, GST and CAT. The activ- change in absorbance was recorded at 340 nm and the enzyme ity of GPx, GR, GST and CAT were significantly decreased activity was calculated as nmol CDNB conjugate formed in MCAO group (p < 0.001) as compared to sham and atten- min−1 mg−1 protein using a molar extinction coefficient of uated significantly (p < 0.001) in MCAO + KAUM group as 9.6 × 103 M−1 cm−1. compared to MCAO group. 182 S. Yousuf et al. / Journal of Ethnopharmacology 99 (2005) 179–184

Table 2 Effect of cerebral ischemia on the activities of glutathione peroxidase, glutathione reductase, glutathione S-transferase and catalase and protection with Khamira Abresham Uood Matagiwala (KAUM) Enzymes Treatment Sham MCAO MCAO + KAUM KAUM only GPx (nmol NADPH oxidized 16.30 ± 0.25 9.84 ± 0.15* (39.63% ↓) 13.86 ± 0.10## (40.85% ↑) 16.00 ± 0.42(1.84% ↓) min−1 mg−1 protein) GR (nmol NADPH oxidized 38.01 ± 0.29 28.93 ± 0.26*(23.88% ↓) 31.31 ± 0.55#(8.22% ↑) 37.60 ± 0.56(1.07% ↓) min−1 mg−1 protein) GST (nmol CDNB conjugate 17.85 ± 0.21 10.07 ± 0.10*(43.58% ↓) 14.42 ± 0.16##(43.19% ↑) 18.11 ± 0.14(1.45% ↑) formed min−1 mg−1 protein) * # Catalase (nmol H2O2 consumed) 6.55 ± 0.45 3.61 ± 0.43 (44.88% ↓) 4.82 ± 0.28 (33.51% ↑) 6.17 ± 0.25(5.80% ↓) Values are expressed as mean ± S.E. Signiﬁcance was determined by Student’s t-test. Values in parentheses show the percentage increase or decrease with respect to their control. ∗ p < 0.001 sham vs. MCAO. # p < 0.01, ##p < 0.001 MCAO vs. MCAO + KAUM.

3.2. Effect of MCAO on GSH and TBARS content and its protection by KAUM

Fig. 1 shows the effect of MCAO on GSH () and TBARS (), and their protection with KAUM. The formation of TBARS was elevated significantly (p < 0.001) in MCAO group when compared with sham and its level was significantly depleted (p < 0.001) in MCAO + KAUM group when compared with MCAO group. The level of GSH was depleted significantly (p < 0.001) in MCAO group as compared to sham and its level was increased significantly (p < 0.001) in MCAO + KAUM group as compared to MCAO group.

3.3. Effect of MCAO on CAR and its protection by KAUM Fig. 2. Effect of KAUM (200 mg/kg) on conditioned avoidance response (CAR). The results are expressed in % avoidances. Values in parentheses Fig. 2 shows the effect of MCAO on CAR and its im- include percent change in loss of CAR in sham vs. MCAO; MCAO vs. provement with KAUM. The loss of CAR in Sham, MCAO, MCAO + KAUM and sham vs. KAUM groups. MCAO + KAUM and KAUM group was 33.33, 66.67, 50 and 16.67%, respectively. The loss of CAR was decreased by 33.34% when MCAO group was compared with sham group whereas the loss of CAR was increased in MCAO + KAUM group when compared with MCAO by 16.67% and it was 16.33% when sham was compared with KAUM group.

4. Discussion

Traditional formulations have been shown to have medicinal and therapeutic value (Shah and Vohora, 2002; Salim et al., 2003), but little experimental evidence is available to substantiate the neuroprotective action. In order to use traditional Unani formulation to treat stroke more reliably and more widely, we investigated the neuroprotective action of KAUM. Our results demonstrated a significant restor- ing effect on antioxidant enzymes, a subsequent decrease in Fig. 1. Effect of KAUM (200 mg/kg) on the content of ( ) GSH and ( ) TBARS and improvement in behavioral activities in groups TBARS in the hippocampus. Values are expressed as mean ± S.E. Signif- icance was determined by Student’s t- test. *p < 0.001 sham vs. MCAO; pretreated with KAUM when compared with their respective #p < 0.001 MCAO vs. MCAO + KAUM. Units for GSH are ␮g GSH/g tissue controls. About 50 years back, Kabeer (1951) had reported and for LPO nmoles of TBARS/h/g tissue. the significance of this drug on various ailments of heart, S. Yousuf et al. / Journal of Ethnopharmacology 99 (2005) 179–184 183 brain, melancholia and various other disorders. Since then were considerably depleted after ischemia/reperfusion and therapeutic effect of this Unani formulation has been used in depletion of TBARS suggests that the drug may be used as a the treatment of various related disorders (Sifiuddin, 1999). possible neuroprotective agent. But there is no report of this drug on the prevention of stroke. To the best of our knowledge, this study provides the first scientific data on the efficacy of this drug on focal cerebral Acknowledgments ischemia. KAUM inhibited the content of TBARS and increased Authors are thankful to the Central Council for Research level of GSH (Fig. 1) when given to the ischemic groups. in Unani Medicine, Ministry of Health and Family Welfare, Since GSH content reflects the cellular physiological re- Government of India, New Delhi, for financial assistance and sponse, the effect of KAUM on these two biochemical indices Dr. Asim Ali Khan, Lecturer, Department of Surgery, Faculty suggest that KAUM not only functions as a simple antioxidant of Unani Medicine, Jamia Hamdard, New Delhi, for help and to inhibit lipid peroxidation but also as a modulator of cellular cooperation. antioxidant potential by the restoration of GSH, which is an oxy-radical scavenger. KAUM’s constituent Abresham contains the protein sericin, which is reported to resist oxidation (Zhang, 2002) and also suppresses lipid peroxidation (Kato References et al., 1998) providing the proof of lipid peroxide inhibitory Carlberg, I., Mannerviek, B., 1975. Glutathione reductase levels in rat nature of KAUM. brain. Journal of Biological Chemistry 250, 5475–5480. Intracellular antioxidant enzymes determine the cellular Chan, P.H., 2001. Reactive oxygen radicals in signaling and damage in sensitivity to oxidative damage. The decreased activity of the ischemic brain. Journal of Cerebral Blood Flow and Metabolism glutathione dependent enzymes, GPx, GR and GST in the 21, 2–14. MCAO group resulted from the imbalance between ROS pro- Claiborne, A., 1985. Catalase activity. In: Greenwald, R.A. (Ed.), Hand Book of Methods for Oxygen Radical Research. CRC Press, Boca duction and the endogenous scavenging system. Ultimately, Raton, pp. 283–284. the imbalance may form a vicious circle which results in the Cook, L., Wieldley, E., 1957. Behavioral effects of some neurophar- collapse of the endogenous system. The pretreated KAUM macological agents. Annals of New York Academy of Sciences 66, group has shown a significant increase which might be due to 740–752. the restoration of the imbalance in the production and scav- Deshaprabhu, S.B., 1982. The Wealth of India, vol. VII–X. Publications and Information Directorate, Council of Scientific and Industrial Re- enging of free radicals. Our results are in agreement with search (CSIR), New Delhi, pp. 202–440. Xuejiang et al. (1999), Shah and Vohora (2002) and Salim Habig, W.H., Pabst, M., Jakoby, W.B., 1974. Glutathione S-Transferase: et al. (2003) who have shown that the treatment of rats with the first enzymatic step in mercapturic acid formation. Journal of herbal formulations/or plants extract resulted the increased Biological Chemistry 249, 7130–7139. activity of these enzymes because of the ROS scavenging Hirakawa, M., Tamura, A., Anathema, H., Nakayama, H., Sano, K., 1994. Disturbance of retention of memory after focal cerebral ischemia in activity of these traditional drugs which might lead to the rats. Stroke 25, 2471–2475. restoration of the depleted enzymes. The protection offered Ichikawa, H., Tetsuya, K., 2002. In vitro antioxidant potentials of tradi- by KAUM could also be due to the vasodilating/strengthening tional chinese medicine, shengmai san and their relation to in vivo activity of KAUM which might lead to increased supply of protective effect on cerebral oxidative damage in rats. Biological and blood to the infracted area thus supplying both energy and Pharmaceutical Bulletin 25, 898–903. Islam, F., Zia, S., Sayeed, I., Zafar, K.S., Ahmad, A.S., 2002. Selenium oxygen to the damaged tissue. induced alteration on lipids, lipid peroxidation, and thiol group in Passive avoidance response in MCAO had latency shorter circadian rhythm centers of rat. Biological Trace Element Research than that of sham animals, indicating an impairment of learn- 90, 1–12. ing ability. The results of KAUM pretreated animals have Jollow, D.J., Mitchell, J.R., Zampaghone, N., Gillete, J.R., 1974. Bro- shown an improved response, indicating that KAUM’s ac- mobenzene induced liver necrosis: protective role of glutathione and evidence for 3, 4-bromobenzene oxide as the hepatotoxic intermediate. tion can interfere with functional effects of brain ischemic Pharmacology 11, 161–169. injury on learning ability. Our data has shown that KAUM Kabeer, U., 1951. Bayaaz-e-Kabeer, Part II, 15th ed. Daftarul Miyah, may be used as a therapy for the oxidative stress related dis- Billimaran, New Delhi, pp. 66–68. orders, although further studies are required to identify the Kato, N., Sato, S., Yamanaka, A., Yamada, H., Fuwa, N., Nomura, M., specific agent of KAUM participating in each biochemical 1998. Silk protein, sericin, inhibits lipid peroxidation and tyrosinase activity. Bioscience Biotechnology and Biochemistry 62, 145–147. step for the brain damage protection. Lewen, A., Matz, P., Chan, P.H., 2000. Free radical pathways in CNS injury. Journal of Neurotrauma 17, 871–890. Lowry, O.H., Rosenbrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein 5. Conclusion measurement with folin phenol reagent. Journal of Biological Chem- istry 193, 265–275. Montoliu, C., Humet, M., Canales, J.J., Burda, J., Planells-Cases, R., Oxidative damage represents one of the important arms in Sanchez-Baeza, F., Carbonell, T., Perez-Paya, E., Messeguer, A., cerebral ischemic damage and the ability of KAUM to ame- Ferrer-Montiel, A., Felipo, V., 2002. Prevention of in vivo excitotoxi- liorate the enzymes activity and level of glutathione, which city by a family of trialkylglycines, a novel class of neuroprotectants. 184 S. Yousuf et al. / Journal of Ethnopharmacology 99 (2005) 179–184

Journal of Pharmacology and Experimental Therapeutics 301, 29–36. Sifiuddin, H., 1999. Unani Adviya Mafarruda, VIII ed. Tariki Urdu Bu- Pulsinelli, W.A., Brierley, J.B., Plum, F., 1982. Temporal profile of neu- reau, R.K. Puram, New Delhi, pp. 65–294. ronal damage in a model of transient cerebral forebrain ischemia. Wheeler, R., Jhaine, A.S., Elsayeed, M.N., Omaye, T.S., Korte, J.W.D., Annals of Neurology 11, 491–498. 1990. Automated assays for superoxide dismutase, catalase, glu- Rafiquddin, H., 1995. Kunzul Adviya. Aligarh Muslim University Publi- tathione peroxidase and glutathione reductase activity. Analytical Bio- cation Division, Aligarh, pp. 568–570. chemistry 184, 193–199. Salim, S., Ahmad, M., Zafar, K.S., Ahmad, A.S., Islam, F., 2003. Protec- Xuejiang, W., Magara, T., Konishi, T., 1999. Prevention and re- tive effect of Nardostachys Jatamansi in rat cerebral ischemia. Phar- pair of cerebral ischemia-reperfusion injury by Chinese herbal macology Biochemistry Behavior 74, 481–486. medicine, shengmai san, in rats. Free Radical Research 31, 449– Shah, Z.A., Vohora, S.B., 2002. Antioxidant/restorative effects of calcined 455. gold preparations used in Indian systems of medicine against global Zhang, Y.Q., 2002. Applications of natural silk protein sericin in bioma- and focal models of ischaemia. Pharmacology and Toxicology 90, terials. Biotechnological Advances 20, 91–100. 254. Journal of Ethnopharmacology 99 (2005) 185–192

Immunosuppressive properties of an ethyl acetate fraction from Euphorbia royleana Sarang Bani∗, Anpurna Kaul, Beenish Khan, Sheikh Fayaz Ahmad, K.A. Suri, N.K. Satti, Musarat Amina, G.N. Qazi

Division of Pharmacology, Regional Research Laboratory, Canal Road, Jammu Tawi 180001, India Received 12 January 2004; received in revised form 20 December 2004; accepted 20 December 2004

Abstract

The objective of the study was to investigate the activity of the ethyl acetate (EA) fraction of Euphorbia royleana latex on cellular and humoral-mediated immune responses and phagocytic function of the cells of the reticuloendothelial system in mice. Oral administration of EA at doses of 50, 100 and 200 mg/kg p.o. in mice with sheep red blood cells (SRBC) as an antigen-inhibited both the delayed-type hypersensitivity reaction and the production of circulating antibody titre. Reduction of CD4+ T cell counts in the peripheral whole blood and the neutrophil counts in pleural exudates of the animals treated with EA was observed by ﬂowcytometric analysis. Process of phagocytosis was also inhibited in in vivo and in vitro experimental test models. The oral LD50 in both rats and mice was more than 2.5 g/kg body weight. © 2005 Published by Elsevier Ireland Ltd.

Keywords: Euphorbia royleana; Cellular; Humoral; Flowcytometry; Co-receptors

1. Introduction has been of interest for many years. Thus, a detailed study of EA was taken up to establish its immunomodulatory activity. Euphorbia royleana Boiss (Family: Euphorbiaceae) is a shrub commonly found on the dry slopes of Himalayan range at an altitude between 3000 and 5000 ft. Its latex is used as 2. Methodology a remedy for joint pains in traditional system of medicine and is also filled in hollow cavities of decayed teeth to check 2.1. Chemicals infection (Kaushik, 1988). We have shown ethyl acetate fraction (EA) from the latex Fluoroisothiocyanate (FITC)-labeled CD4 anti-mouse of Euphorbia royleana to have significant anti-inflammatory monoclonal antibody, phycoerytherin (PE)-labeled CD8 anti- and anti-arthritic activity in experimental animals (Bani et mouse monoclonal antibody, FACS lysing solution (BD al., 1996). On the basis of these properties, it was anticipated Biosciences); phosphate buffer saline, cyclosporin (Sigma– that EA fraction should have a bearing on the immune system Aldrich, India); gumacacia (Hi Media). of the test animals, as inflammation in general and arthritis in particular are closely related to the immune status of a 2.2. Plant material living being. The immune system is involved in the etiology as well as pathophysiologic mechanisms of these diseases. Euphorbia royleana was collected from the Nandini area Modulation of the immune responses to alleviate the diseases of Jammu (Jammu and Kashmir State, India) and authenticated by T.N. Srivastava, taxonomist at Janki Ammal Herbar- ∗ Corresponding author. ium of the Institute (Regional Research Laboratory, Jammu, E-mail address: [email protected] (S. Bani). India), where voucher specimen has been deposited.

2.3. Preparation of plant fraction 2.5. Antigen

The latex was collected and kept in a refrigerator Fresh sheep red blood cells (SRBC) were collected asepti- overnight. It was extracted with 85% ethanol at room temper- cally from the jugular vein of sheep and stored in cold sterile ature while stirring. The 85% ethanol extract thus obtained Alsever’s solution, were washed three times with pyrogen- was then triturated with ethyl acetate at room temperature free sterile saline (NaCl, 0.9% (w/v)) and adjusted to the × 9 and ﬁltered to obtain the ethyl acetate fraction. A ﬂow sheet concentration of 5 10 cells/mL for immunization and chal- of systematic fractionation procedure is presented below: lenge at the required time schedule.

The ethyl acetate fraction was found to contain four major spots by Co-T.L.C (mobile phase; petrol ether:EtOAc::4:1) 2.6. Effect on general behaviour and maximum dose in comparison to pure cycloyleanol (Rf, 0.45), lupeol (0.35), tolerance in mice friedelan-3-␣-ol (Rf, 0.29) and isotaraxerol (Rf, 0.27) present in the extract. Graded doses of the test drug were administered orally to Further fractionation of EA fraction did not give any frac- group of 8 rats and 10 mice by the method of Singh et al. tion, which biologically showed more activity than EA; there- (1978). The animals were observed for ﬁrst 2 h continuously fore, further work was carried out on EA fraction only. and then at half-hourly interval for next 6 h for changes in reactivity, gait, motor activity, ptosis, respiration rate, writhing, 2.4. Animals etc. A high dose toxicity effect resulting into mortality was recorded over 1-week period and the acute oral LD50 was Male Balb/c mice weighing 20–24 g, 10–12-week-old, calculated. were employed in groups of six for the study. All the animals were maintained in plastic cages at 22 ± 2◦C with 2.7. Delayed-type hypersensitivity response (DTH) 12-h light/12-h dark cycle and free access to pellet food (Lipton India Ltd.) and water. According to ethical regula- The method of Doherty (1981) was followed. Test ma- tions on animal research, all animals used in experimental terial was administered 2 h after SRBC injection and once work received humane care. Drugs were prepared as a ho- daily on consecutive days. Six days later, the thickness of the mogenized suspension in gum acacia (1%, w/v) and were left hind food was measured with a spheromicrometer (pitch, administered orally daily once a day for the duration of 0.01 mm) and was considered as a control. The mice were experiment. then challenged by injecting the same amount of SRBC in- S. Bani et al. / Journal of Ethnopharmacology 99 (2005) 185–192 187 tradermally into the left hind footpad. The foot thickness was measured again after 24 h.

2.8. Humoral antibody response

Mice were immunized by injecting 20 ␮Lof5× 109 SRBC/mL intraperitoneally (i.p.) on day 0, and the blood samples were collected on day +7 (before challenge) for primary antibody titre and on day +14 (7 days after challenge) for secondary antibody titre. Haemagglutination antibody titres were determined following the microtitration technique described by Nelson and Mildenhall (1967). BSA-saline alone served as a control.

2.9. Skin allograft rejection

The modified method of Billingham and Medawar (1951) Fig. 1. Effect of EA on homologous graft rejection in mice. was followed to study the skin allograft rejection time in mice. Graded doses of test material were administered to the animals for 7 days and graft rejection time (GRT) was were used in a multiparametric flowcytometric assay to quan- recorded by daily observation of epithelial skin layer survival. tify the lymphocyte subsets associated with the cell-mediated Control group was given vehicle only, and another group immune response. received cyclosporine as standard at 5 mg/kg body weight FITC-labeled anti-mouse CD4 (L3T4) monoclonal anti- daily for 7 days. body that reacts with the CD4 differentiation antigen expressed on MHC class II-restricted T cells that includes most 2.10. Lymphocyte immunophenotyping helper cells and PE-labeled CD8 monoclonal antibody that reacts with CD8 differentiation antigen present on MHC Immunophenotyping focuses on lymphocyte populations class-I-restricted T cells were used to determine the percent- involved in acquired immunity. Specific molecules present on age of CD4+ and CD8+ T cells in control and treated group the cell surface defines characteristics of lymphocytes such of animals. as state of activation or functional capabilities. Immuniza- These antibodies were added directly to 100 ␮L of whole tion of Balb/c mice was carried out by injecting 20 ␮Lof blood, which was then lysed using whole blood lysing reagent 5 × 109 SRBC/mL i.p. Drug administration was carried out (BD Biosciences). Following the final centrifugation, sam- for 5 days. Same amount of SRBC was then injected into ples were resuspended in phosphate buffer saline (pH, 7.4) the mice for the challenge on day 6 and blood was collected and analyzed directly on the flowcytometer (LSR, BD Bio- after 24 h of challenge in heparinised tubes from retro-orbital sciences) using Cell Quest Pro Software (BD Biosciences). plexus for estimation of CD4+ and CD8+ T cells. Later, the To CD4+ and CD8+ T cells in the whole blood of the chal- blood was again collected on day 14 to see the secondary lenged animals, a fluorescence trigger was set on the FITC response and determine the effect of EA on the T cell subsets (FLI) parameter to analyse CD4+ and PE (FL2) param- CD4 and CD8. eter to collect CD8+ events. Fluorescence compensation, Murine monoclonal antibodies conjugated to a fluo- data analysis, and data presentation was performed using rochrome and directed against co-receptors CD4 and CD8 Cell Quest Pro software. Data transformation for compen-

Table 1 Effect of EA on SRBC-induced delayed-type hypersensitivity (DTH) response (CM1) and humoral response in mice Treatment dose (mg/kg p.o.) Cell-mediated immune response Humoral immune response

Paw swelling (mm) in mice day 7 Habt [log 2] 7th day Sabt [log 2] 14th day

Mean ± S.E. % Change Mean ± S.E % Change Mean ± S.E. % Change Control SRBC 0.81 ± 0.04 – 6.50 ± 0.22 – 6.66 ± 0.22 – +EA [25] 0.68 ± 0.16 16.04 ↓ 5.66 ± 0.21 12.92 ↓ 6.00 ± 0.22 09.90 ↓ +EA [50] 0.63 ± 0.02 a 22.22 ↓ 5.16 ± 0.16a 20.61 ↓ 5.83 ± 0.16 12.46 ↓ +EA [100] 0.48 ± 0.03 b 40.74 ↓ 4.66 ± 0.20b 28.30 ↓ 5.50 ± 0.22a 17.41 ↓ +EA [200] 0.45 ± 0.02 b 44.44 ↓ 5.00 ± 0.25a 23.07 ↓ 5.66 ± 0.21a 15.01 ↓ +Cyclosporin [5] 0.35 ± 0.02 c 56.79 ↓ 4.00 ± 0.25b 38.46 ↓ 4.00 ± 0.25 b 39.93 ↓ n = 6; (a) P < 0.05; (b) P < 0.01; (c) P < 0.001; Habt, humoral antibody titre; Sabt, secondary antibody titre; (↓) reduction. 188 S. Bani et al. / Journal of Ethnopharmacology 99 (2005) 185–192

Fig. 2. Flowcytometric analysis of T cell surface antigen CD4 (FITC-conjugated monoclonal antibody) and CDS (PE-conjugated monoclonal antibody), day 7. sated data was done using default values provided by the 2.12. Flowcytometric analysis of neutrophil migration software. in vivo

2.11. Macrophage phagocytic response Flowcytometry as a tool for evaluation of neutrophils is particularly useful because of their larger size than mono- 2.11.1. In vitro cytes and lymphocytes when analysed on the forward scatter The method of Lehrer (1981) was followed. The percent- (FSc). The percentage of these can be analysed by selec- age and average number of Candida albicans cells (heat- tively ‘gating’ the neutrophils without physical separation of killed) ingested by peritoneal murine macrophages was cal- the cells. Pleurisy in rats was induced by injecting 0.5 mL culated. of carageenan (1%, w/v in distilled water) into the pleural cavity of the rats by the method of Meacock and Kitchen 2.11.2. In vivo (1979). The test drug was administered orally 1 h before and The phagocytic clearance of the endothelial system was 6 h after the carrageenan injection. After 24 h of carageenan assayed in groups of six mice each by injecting i.v. 160 mg/kg injection, the pleural exudates were collected in phosphate of 1.6% suspension of gelatin stabilized carbon particles (Atal buffer saline, and neutrophil count was carried out. et al., 1986). Blood samples were collected before and at intervals varying between 2 and 90 min after carbon injection. An aliquot (10 ␮L) of blood samples were lysed with 2.13. Statistical analysis 2 mL of 0.1% acetic acid and the transparency determined spectrophotometrically at 675 nm (Uvikon 810, spectropho- The results were expressed as mean ± S.E.M. and are pre- tometer, Kontron Ltd., Switzerland) (Hudson and Hay, 1980). sented as fold increase/decrease values compared with the EA was administered orally for 7 days, and 30 min prior to untreated control. Statistical signiﬁcance was determined by the carbon injection. The rate of carbon clearance termed as Student’s t-test, comparing the experimental group to the con- phagocytic index was calculated. trol group. S. Bani et al. / Journal of Ethnopharmacology 99 (2005) 185–192 189

Fig. 3. Flowcytometrlc analysis of T cell surface antigen CD4 (FITC-conjugated monoclonal antibody) and CD8 (PE-conjugated monoclonal antibody), day 14.

3. Results Table 2 3.1. Effect on general behaviour and maximum dose Effect of EA on phagocytic function of murine peritoneal macrophages tolerance in mice Treatmenta (dose ␮g/mL) % Phagocytosis (in vitro study) Mean ± S.E. Mice and rats treated with EA at a maximum oral dose Control 25.33 ± 1.26 of 2500 mg/kg did not show any difference in gross general EA [25] 25.16 ± 1.33 (0.67%) ↓ ± ↓ behaviour compared with the control group of animals that EA [50] 22.00 0.90 (13.14%) EA [100] 20.80 ± 0.75 (17.88%) ↓ were administered only the vehicle. No mortality was ob- EA [200] 17.50 ± 0.72 a (30.91%) ↓ served over an observation period of 7 days. EA [400] 15.50 ± 0.56 a (38.80%) ↓ EA [800] 14.26 ± 0.40 b (43.70%) ↓ Cyclosporin [10] (standard) 11.80 ± 1.08 b (53.41%) ↓ 3.2. Delayed-type hypersensitivity response Treatmentb (dose mg/kg) Phagocytic index (in vivo EA when administered orally at 50–200 mg/kg doses study) Mean ± S.E. showed a decrease of 16.04–44.44% in DTH response in Control 1.26 ± 0.12 mice. Cyclosporin at 5 mg/kg p.o. produced 56.79% decrease EA [25] 1.26 ± 0.14 ± ↓ (Table 1). EA [50] 1.20 0.12 (4.76%) EA [100] 1.00 ± 0.14 (20.63%)↓ EA [200] 0.92 ± 0.12 a (26.98%) ↓ 3.3. Humoral antibody response EA [400] 0.90 ± 0.08 a (28.57%) ↓ EA [800] 0.88 ± 0.12 b (30.15%) ↓ Cyclosporin [5] (standard) 0.72 ± 0.10 b (42.85%) ↓ EA (50–200 mg/kg p.o.) produced a dose-related de- Figures in parentheses represent percentage change; (a) P < 0.01 decrease; crease in the primary antibody synthesis. Maximum ef- (b) P < 0.001 decrease. fect was observed at 100 mg/kg (28.30% decrease) after a Number of observations for each dose = 6. which the suppressive effect waned and was 23.07% at b Number of animals in each group = 6. 190 S. Bani et al. / Journal of Ethnopharmacology 99 (2005) 185–192

200 mg/kg oral dose. Cyclosporin used as a standard drug 3.5. Lymphocyte immunophenotyping showed 38.46% decrease in antibody synthesis at the dose of 5 mg/kg oral dose (Table 1). EA also effectively decreased EA showed effect of 10.91% of CD4+ and 6.90% of CD8+ the secondary antibody production but its suppressive ef- T cells and 12.17% of CD4+ and 6.39% of CD8+ T cells at fect was more signiﬁcant on primary antibody synthesis 100 and 200 mg/kg p.o. dose, respectively. The control values (Table 1). were 15.23% of CD4+ and 7.63% of CD8+ T cells. This shows a signiﬁcant decrease in CD4+ and CD8+ T cell count (Fig. 2). 3.4. Skin allograft rejection Cyclosporin, a standard T cell inhibitor at 5 mg/kg oral dose inhibited both CD4+ and CD8+ T cells showed 7.74% of Oral administration of EA at 50, 100 and 200 mg/kg de- CD4+ and 3.79% of CD8+ T cells. layed the skin allograft rejection time in mice (days) by 15.5, The same set of experiment was repeated on day 14 and 22.0 and 24.0%, respectively. Cyclosporin at 5 mg/kg in- the observation made for the secondary response. EA at creased the rejection time by 34.5% (Fig. 1). 100 mg/kg dose showed 9.16% of CD4+ and 6.03% of CD8+

Fig. 4. Effect of EA on neutrophU count in carrageenan-induced pleurisy (in vivo) in rats. S. Bani et al. / Journal of Ethnopharmacology 99 (2005) 185–192 191

T cells and at 200 mg/kg showed 8.53% of CD4+ and 4.22% T cells (CD8+) lyse the endothelial cells on the graft, CD4+ + + of CD8 T cells. This shows EA to have sustained suppressive Th1 activate macrophages and CD4 Th2 aid in antibody pro- effect even after its administration was discontinued after 5 duction. T cells expressing CD4 are increased when there is days. At 200 mg/kg p.o. dose EA had significant inhibitory a general expansion due to active immunological activity of effect on both CD4+ and CD8+ T cells. The control values the T cell and inhibition of this observation shows immuno- stood at 10.15% of CD4+ and 6.00% of CD8+ T cells. Cy- suppressive activity. closporin, however, showed 7.84% of CD4+ and 3.94% of Macrophages and polymorphonuclear leucocytes (neu- CD8+ T cells (Fig. 3). trophils) survey the body for foreign antigens, which they destroy by making toxic molecules such as the reactive oxy- 3.6. Phagocytic response gen intermediate molecules. Continued production of these toxic molecules by overactive macrophages and neutrophils 3.6.1. In vitro not only destroys the foreign antigens but also the tissues EA was tested at the doses of 25, 50, 100, 200, 400 and surrounding them. The inhibition of humoral response by 800 ␮g/mL. The significant percent decrease was observed at EA (Table 1) also indicates the reduced responsiveness of the dose 200, 400 and 800, where the effect was 30.91, 38.80 macrophages and subsets of T and B lymphocytes, involved and 43.70%, respectively. Cyclosporin at 10 ␮g/mL showed in antibody synthesis (Benacerraf, 1978). This is evident by 53.41% decrease in phagocytosis of heat killed Candida al- the decrease in clearance of carbon particles from the reticu- bicans by the murine macrophages (Table 2). loendothelial system and also reduction in the rate of phagocytosis in vitro by murine macrophages, thereby, suggesting 3.6.2. In vivo the reduction in the functioning of macrophages after treat- Oral administration of EA for 7 days decreased the ment with EA (Table 2). CD4+ T cell inhibition by EA may be clearance rate of carbon particles from circulation in mice one of the factors responsible for the decrease in the function- (Table2). The decrease in phagocytic index was 4.76–28.57% ing of the macrophages as the activation of primary cells of at dose range of 50–800 mg/kg. The effect was statistically phagocytosis is one major effector function of CD4+ T cells. highly significant at higher doses. The reduction in percentage neutrophil count in the animals treated with EA further proves this (Fig. 4). 3.7. Flowcytometric analysis of neutrophil migration in Since EA not only suppresses cell-mediated immunity but vivo also humoral immune responses, it appears very promising in the treatment of autoimmune diseases. The findings demon- Oral administration of EA fraction at the doses of strate it to have a potent immunosuppressive potential, which 100–200 mg/kg inhibited the polymorphonuclear leucocytes is suggestive of its possible therapeutic usefulness. Its ap- in a dose-dependent manner (Fig. 4). Maximum effect was parent safety over long-term administration is encouraging observed at 200 mg/kg. enough to warrant further studies to explore its possible role in modern clinical practice.

4. Discussion and conclusion References A dose as high as 2500 mg/kg p.o. in both mice and rats caused neither any observable negative symptom nor death Atal, C.K., Sharma, M.L., Kaul, A., Khajuria, A., 1986. Immunomodu- in these animals over 1-week period of study. lating agents of plant origin. Part 1: preliminary screening. Journal of In immune-related studies, EA produced a dose- Ethnopharmacology 18, 133–141. dependent decrease in DTH reaction in mice (Table 1) show- Bani., S., Chand, D., Suri, K.A., Suri, O.P., Sharma, O.P., 1996. Anti- ing suppression on ‘T’ lymphocytes and accessory cell types inflammatory effects of an ethyl acetate extract of Euphorbia royleana. Phytotherapy Research 10, 285–291. required for the expression of the reaction (Dean et al., 1979; Benacerraf, B., 1978. A hypothesis to relate the specific of T lymphocytes Luster et al., 1982a,b). Supporting hypothesis of T lympho- and the activity of I region-specific Ir genes in macrophages and B cytes inhibition is the increase in the homologous skin graft lymphocytes. Journal of Immunology 120, 1809–1812. rejection time in mice treated with EA (Fig. 1). The basic Billingham, R.E., Medawar, P.B., 1951. The technique of free skin graft- mechanism involved in increase in graft rejection time is the ing in mammals. Journal of Experimental Biology 28, 385–402. Dean, J.H., Padarath Singh, M.L., Jerrels, T.R., 1979. Application of suppression of T lymphocytism, and this is supported by sig- immunocompetence assays for defining immunosuppression. Annals + + nificant inhibitory effect of EA on CD4 and CD8 T cells. of the New York Academy of Sciences 320, 579–590. After transplantation, MHC peptide complexes of the foreign Doherty, N.S., 1981. Selective effect of immunosuppressive agents against organ are recognized by CD4+ and CD8+ T cells of the re- the delayed hypersensitivity response and humoral response to sheep cipient as non-self antigens. These T cells differentiate into red blood cells in mice. Agents and Actions 11, 237–242. Hudson, L., Hay, F.C., 1980. Practical Immunology, second ed. Blackwell, effector T cells and stimulate an immune response. After T London, pp. 73–92. cells differentiate and migrate to the site, macrophages and Kaushik, P. (1988). Indigenous Medicinal Plants. Today and Tommorrow, other inflammatory agents are mediated to the site. Cytotoxic New Delhi, p. 160. 192 S. Bani et al. / Journal of Ethnopharmacology 99 (2005) 185–192

Lehrer, R.I., 1981. Ingestion and destruction of Candida albicans. In: Nelson, D.S., Mildenhall, P., 1967. Studies on cytophilic antibodies. Adams, D.O., Edelson, P.J., Koren, H. (Eds.), Methods for Studying The production by mice of macrophage cytophilic antibodies to Mono-Nuclear Phagocytes. Academic Press, New York, pp. 693–708. sheep erythrocytes: relationship to the production of other anti- Luster, M.L., Dean, J.H., Moore, J.A., 1982a. Evaluation of immune bodies and development of delayed-type hypersensitivity. Australian functions in toxicology. In: Wallace Hayes, A. (Ed.), Principles and Journal of Experimental Biology and Medical Sciences 45, 113– Methods of Toxicology. Raven Press, New York, pp. 561–586. 130. Luster, M.L., Dean, J.H., Boorman, G.A., 1982b. Cell mediated immunity Singh, G.B., Srimal, R.C., Nityanand, S., Dhawan, B.N., 1978. Pharma- and its application in toxicology. Environmental Health Perspectives cological studies on 3-(-p-ﬂuorebenzoyl-propyl)-2,3,4,5,6-hexahydro- 43, 31–36. 1-(H)-pyrazino-(1,2-a)-quinoline hydrochloride (compound 69/183). Meacock, S.C.R., Kitchen, B.A., 1979. Effects of the non-steroidal anti- Drug Research 28, 1403–1406. inﬂammatory drug benoxaprofen on leucocyte migration. Journal of Pharmacy and Pharmacology 31, 366–370. Journal of Ethnopharmacology 99 (2005) 193–197

Antimicrobial properties of Phrygilanthus acutifolius A. Daud, A. Gallo, A. Sanchez´ Riera ∗

Departamento de Biolog´ıa del Desarrollo, Instituto Superior de Investigaciones Biológicas (INSIBIO) y Universidad Nacional de Tucumán (UNT), Chacabuco 461, 4000-San Miguel de Tucumán, Tucumán, Argentina Received 1 November 2003; received in revised form 23 December 2004; accepted 19 January 2005 Available online 25 April 2005

Abstract

Ethanol extract of flowers of Phrygilanthus acutifolius (Ruiz & Pav.) Eichler (Loranthaceae) inhibited the growth of both Gram (+) bacteria (Staphylococcus aureus, Staphylococcus saprophyticus and Enterococcus faecalis) and Gram (−) bacteria (Serratia marcescens, Acinetobacter sp. and Pseudomonas aeruginosa). This extract was bactericidal against Staphylococcus aureus and bacteriostatic against Pseudomonas aeruginosa. Morphological evidence suggests that the extract causes the swelling of the bacterial body of Staphylococcus aureus, the disintegration of the cell surface and the cell death. Bactericidal activity was optimal at pH 7.5 and was not affected by different ionic strengths. The presence of Mg2+ in the culture medium of Phrygilanthus acutifolius diminished the sensitivity of Pseudomonas aeruginosa strain against the extract. Test results would tend to corroborate the folk belief that the flowers of this plant are efficacious against respiratory infections and would justify its further investigation. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Phrygilanthus acutifolius; Loranthaceae; Antimicrobial activity; Argentine medicinal plants

1. Introduction and their preparation from their father/grandfather. Accord- ing to this survey, it was found that the extracts from flowers Traditional medicine in developing countries uses a wide was use to treat respiratory diseases and infections. How- variety of natural products in the treatment of common in- ever, there are no references on the uses of this species in the fections (Low et al., 2002; Rojas et al., 2001). Argentine literature. indigenous culture has a long-standing tradition of healing Therefore, the aim of the present work is to evaluate the with medicinal plants, especially in the prevention or cure antimicrobial potential of aqueous and ethanol extracts of of gastrointestinal, respiratory and skin diseases (Martinez Phrygilanthus acutifolius flowers on several Gram (+) and Crovetto, 1965, 1981). Gram (−) microorganisms of medical importance. In Tucuman,´ Argentina, Phrygilanthus acutifolius (Ruiz & Pav.) Eichler (Loranthaceae) (Abbiatti, 1943), a hemipar- asite, is found in the mountains surrounding the Calchaqu´ı Valleys; it takes its vulgar name, “corpus”, from the festivity 2. Materials and methods of Corpus Christie, when it is in full bloom. Amaicha del Valle (Tucuman)´ was visited in order to carry out and ethnomedical 2.1. Plant materials investigation on the medicinal uses of this species. The people we interviewed were traditional healers and families belong- The plant materials used in this study consisted of the ing to the village. They had learned about medicinal plants flowers of Phrygilanthus acutifolius (Ruiz & Pav.) Eichler (Corpus) collected during the flowering season (May–June) in Amaicha del Valle,in the province of Tucuman,´ Argentina. ∗ Corresponding author. Fax: +54 381 4248025. The voucher herbarium specimen (no. 511125) was identi- E-mail address: [email protected] (A.S. Riera). fied by using morphological, anatomical and histochemical

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.jep.2005.01.043 194 A. Daud et al. / Journal of Ethnopharmacology 99 (2005) 193–197 techniques, in comparison with an identified specimen at the was used as negative control. The microorganism control con- Herbarium “Miguel Lillo” of San Miguel de Tucuman,´ Tu- sisted of a seeded petri dish with no plant material, solvent cuman,´ Argentina. (70% ethanol) or chloramphenicol. Results were recorded as the mean of triplicate experiments. 2.2. Preparation of plant extracts Bacterial growth inhibition was determined as the diameter of the inhibition zones around the holes. The inhibition Ethanol and aqueous extracts were made from the flow- diameter was the average of four measurements per hole. ers of the plant under study. The dried materials were milled into particles of about 5–10 mm in diameter. For the ethanol 2.5. Determination of Minimum Inhibitory extracts, 20 g samples of flowers were soaked for 5 days Concentration (MIC), Minimal Bactericidal in 100 ml of 70% ethanol. For the aqueous extracts, sam- Concentration (MBC) and Minimal Bacteriostatic ples were soaked for 2 days in 100 ml of water. All extracts Concentration (MBS) were filtered through no. 1 Whatman paper and evaporated to dryness in an air current. The dry-crude extracts were ir- The MICs were determined by the agar dilution method. radiated with ultraviolet light for 24 h for sterilization; steril- Two-fold serial dilutions of the extract (100 mg/ml in 70% ity was confirmed by plating each sample suspension on ethanol) were prepared in MH agar from 10 to 0.1 mg/ml. Sol- Muller–Hinton¨ (MH) agar. All extracts were dry-stored in vent, antibiotic and microorganism controls were also ana- sterile eppendorf at 4 ◦C until used for the screening of an- lyzed. Bacterial inoculum (2 ␮l) (OD550 = 1) was seeded onto timicrobial activity. At that time, the extracts were recon- the agar. The plates were incubated at 37 ◦C for 18 h. The MIC stituted to a concentration of 200 mg/ml in 70% ethanol or was considered the lowest concentration of the sample that sterile water. prevents visible growth. MBC and MBS were determined by sub-culturing the negative samples. MBC were defined as 2.3. Bacterial strains the lowest concentration that yielded negative sub-cultures and MBS as the lowest concentration that produced positive Strains of Pseudomonas aeruginosa, Acinetobacter sp. growth. (resistant to piperacilline, ceftazidime, cefepime and gentamicine), Klebsiella pneumoniae (resistant to cephalothin, ampicillin, ciprofloxacine, gentamicine, amikacine; cepho- 2.6. Effect of different ionic strengths, pHs and cation 2+ taxime, ampicillin-sulbactam and ampicillin-clavulanic (Mg ) on the antibacterial activity acid), Enterococcus faecalis, Staphylococcus aureus (resistant to oxacilline), Staphylococcus saprophyticus (penicillin- In order to determine the effect of different pHs on the resistant), Serratia marcescens, Escherichia coli, all of them antibacterial activity of the ethanol extract, bacterial cells × 6 ␮ human pathogenic strains and Escherichia coli K12 strain (1 10 CFU/ml) were incubated with 50 l of ethanol ex- ◦ ␮ 4100 were used. These bacterial strains were clinical isolates tract for 1 h at 37 C in the presence of 75 l of 10 mM sodium from the Bacteriological Section of the Instituto de Micro- citrate buffer (pH 5.0) or 10 mM of sodium phosphate (pHs biolog´ıa “Dr. L. Verna”, Facultad de Bioqu´ımica, Qu´ımica y 7.5 and 8.0), both supplemented with 100 mM of NaCl. Farmacia, Universidad Nacional de Tucuman.´ In order to find out the effect of ionic strength, similar Bacterial strains were maintained on MH agar. For inocu- assays were performed, using 10 mM sodium phosphate (pH lum preparations, bacteria were sub-cultured in brain–heart- 7.5) containing different concentrations of NaCl (25, 50, 100 infusion (BHI) at 37 ◦C for 8 h and adjusted to a suspension and 150 mM). 2+ of 1 × 106 to 2 × 106 CFU/ml. The optical density (OD) at The effect of Mg on the antibacterial activity was also 550 nm of each culture was measured with a Spectronic 601 assayed. Bacterial cells were incubated in 10 mM sodium spectrophotometer. phosphate (pH 7.5) with 100 mM NaCl in the presence or absence of MgCl2 (0.5 mM). 2.4. Assay for inhibition of bacterial growth Controls lacking ethanol extract were set-up. At the end of incubation, samples were serially diluted with sterile saline The antimicrobial activity of the extract from the flowers solution, plated in duplicate on MH agar and incubated for was determined by the “hole-plate diffusion method” (Bennet 18 h to allow colony count. et al., 1996). The tested bacterial suspension was homoge- neously seeded onto petri dishes containing 15 ml of the MH 2.7. Effect of temperature on the antibacterial activity agar medium. Holes were aseptically bored into the agar with a hollow punch and 25 ␮l aliquots of the extract were placed In order to determine the effect of temperature, 75 ␮lof into wells with a sterile pipette. The plate was kept for 1 h at dry-crude extract were placed in eppendorf and kept in a room temperature for the diffusion of the extract into the agar. water bath for 20 min at 100 ◦C. After heating, the samples Subsequently, the plate was incubated at 37 ◦C for 18 h. Chlo- were reconstituted, and subsequently tested for antibacterial ramphenicol was used as positive control and 70% ethanol activity as describe above. A. Daud et al. / Journal of Ethnopharmacology 99 (2005) 193–197 195

2.8. Morphology Table 1 Minimal Inhibitory Concentration, Minimal Bacteriostatic Concentration Antibacterial action was determined by electron mi- and Minimal Bactericidal Concentration of Phrygilanthus acutifolius extracta croscopy in accordance with the technique of Shigeharu (2000). Gram (+) bacteria (Staphylococcus aureus) at a con- Bacteria Ethanol extract centration of 1 × 106 CFU/ml were incubated for 18 h at MICb M Bacteriostatic M Bactericidal c d 37 ◦C in 20 mM Tris–HCl buffer, pH 7.4, containing 0.15 M (mg/ml) C (mg/ml) C (mg/ml) . . NaCl, 1 mM CaCl2 and 1 mM MnCl2, in the presence of Staphylococcus aureus 0 625 – 0 625 ethanol extract (100 mg). Chloramphenicol (positive control) Pseudomonas aeruginosa 2.52.55.0 and 70% ethanol (negative control) were incubated for the Cloramphenicol – – – a Agar dilution method, mean value N =3. same period. After incubation, bacteria were washed twice b with 0.85% NaCl solution and incubated for 1 h in saline solu- MIC: Minimal Inhibitory Concentration. c M Bacteriostatic C: Minimal Bacteriostatic Concentration. tion containing a macromolecular tracer, horseradish perox- d M Bactericidal C: Minimal Bactericidal Concentration. idase (HRP) 2 mg/ml (Sigma). The samples were fixed with 2.7% glutaraldehyde-sodium phosphate buffer (pH 7.4) con- Staphylococcus aureus, an oxacillin-resistant strain. These taining 0.01 M of CaCl or 0.22 mM sucrose. Then, they were 2 bacteria were sensitive to chloramphenicol (30 ␮g) between post fixed in 1% Osmium tetroxide solution. Ultra-thin sec- 20 and 24 mm in diameter. The Minimum Inhibitory Concen- tions were contrasted with uranyl acetate and lead citrate. The tration of the extract, 0.625 mg/ml (Table 1), was identical materials were then included in resin spun. The screens were to the Minimum Bactericidal Concentration. The Staphylo- observed and photographed with a Zeiss 902 transmission coccus aureus strain was chosen on the basis of its clinical electron microscope (TEM). importance in cases of infection. It acquires its resistance due to the presence of penicillin-binding protein (PBP) of high- molecular weight and has a very low-affinity for lactamic 3. Results and discussion antibiotics (Hardman et al., 1996)(Table 2). Electron microscopy techniques revealed that the extract The preliminary biological screening of the extracts also had an effect on the morphology of the strain under study. showed that the aqueous extract had no antimicrobial activity The untreated culture remained unaltered, while swelling of while the ethanol extract showed activity. The results of the the bacterial body and disintegration of the cell surface was antimicrobial activity test, as shown in Fig. 1, revealed that found in an 18 h extract-treated culture. This may be due to the growth of the Gram (+) bacterial strains (Staphylococ- injury of the cell wall and alterations in the cytoplasmic mem- cus aureus, Staphylococcus saprophyticus and Enterococcus brane permeability, resulting in the loss of cytosol and finally faecalis) was affected by the extract by forming clear inhi- in cell death. Significant morphological changes were ob- bition zones between 8 and 12 mm in diameter. The great- served in the cells-treated with 100 ␮g/ml of chlorampheni- est inhibition zones were found against clinical isolates of col as compared with the intact cells (Fig. 2).

Fig. 1. Antimicrobial activity of the extracts of ﬂowers of Phrygilanthus acutifolius. Zone of inhibition measured in mm by agar diffusion assay for ethanol extract of Phrygilanthus acutifolius on nine human patogen microorganisms. Data are reported as the mean ± S.D. from three different experiments. All experiments were performed by seeding 25 ␮l of ethanol extract. The inhibition diameter was the average of four measurements per hole. Chloramphenicol was used as a standard antibiotic at a concentration of 30 ␮g/ml and the inhibition diameter was 20.0 ± 2.0. 196 A. Daud et al. / Journal of Ethnopharmacology 99 (2005) 193–197

Table 2 Effect of ionic strength and divalent cations +Ethanol Extract −Ethanol Extract Staphylococcus aureus Pseudomonas aeruginosa Staphylococcus aureus Pseudomonas aeruginosa NaCl concentrations (mM) 25 0 0 UNC UNC 50 0 0 UNC UNC 100 0 0 UNC UNC 150 0 0 UNC UNC Divalent cations +Mg2+ 4 ± 1 195 ± 5 UNC UNC −Mg2+ 0 0 UNC UNC UNC: uncountable number of colonies. Mean value N =3.

The extract evidenced different inhibitory properties increasingly higher NaCl concentrations ranging from 25 to against Gram (−) bacteria (Fig. 1). Thus, Klebsiella pneumo- 150 mM. Activity was not affected either by different pH or niae, Escherichia coli wild strain and Escherichia coli K12 by different ionic strength (Table 2). 4100 were not affected, while Serratia marcescens, Acineto- The presence of Mg2+ in the culture medium of Phry- bacter sp. and Pseudomonas aeruginosa showed a moderate gilanthus acutifolius diminished the sensitivity of the Pseu- zone of growth inhibition, indicating that they might be sus- domonas aeruginosa strain against the extract, an increase in ceptible. MIC studies revealed that about 2.5 mg/ml of extract the MIC values being observed (data not shown). This effect was required for growth inhibition in Pseudomonas aerug- is probably explained by the fact that divalent cations stabilize inosa. The MBC for this species was always found to be the outer membrane of Gram (−) bacteria. Ca2+ and/or Mg2+ two-fold higher than MIC values, thus the extract exhibited are necessary for salt bridging between LPS and phospho- bacteriostatic activity at a lower concentration and bacterici- lipids within the bilayer matrix (Lugtemberg and Alphem, dal activity at a higher concentration. The greater resistance 1983). of Gram (−) bacteria to plant extracts has been documented Our results suggest the presence in the crude extract of previously (Palombo and Semple, 2001). This resistance is active constituents that interact with target molecules; this probably due to the differences in cell wall structure between interaction would involve electrostatic-binding to negatively Gram (+) and Gram (−) bacteria; the Gram (−) outer mem- charge surface molecules. brane acting as a barrier to many substances, including an- The results of the present investigation indicate the exis- tibiotics (Tortora et al., 2001). tence of compounds with antimicrobial activity in the ethanol All bacterial organisms tested were sensitive to chlo- extract of the flowers of Phrygilanthus acutifolius. Although ramphenicol, which was used as a control antibiotic and no previous reports concerning the antibacterial activity of which exerted a higher inhibitory effect on bacterial growth the plant species studied could be found in the literature, our 14–22 mm in diameter than the ethanol extract (Fig. 1). The results would support the efficacy of its traditional use in low-bioactivity of the crude extract would result either from the treatment of respiratory infections known by interviews dilutions of its active constituents or from the antagonism with healer and rural people of Amaicha del Valle (Tucuman,´ in the bioactivity among extract constituents (Ibrahim et al., Argentina). Approximately, 60% of those who were pooled 1997). responded about the use of the flower for respiratory diseases We measured antibacterial activity under different experi- (data not shown). mental conditions of pH, ionic strength and divalents cations Further phytochemical studies are required to establish the (Mg2+). The assays were affected at pHs 5, 7.5 and 8 and at types of compounds responsible for the bioactivity of this

Fig. 2. TEM of ethanol extract-treated Staphylococcus aureus (magniﬁcation: ×28,800). (A) 70% Ethanol, (B) treated and (C) chloramphenicol. A. Daud et al. / Journal of Ethnopharmacology 99 (2005) 193–197 197 medicinal plant and to determine the value of the ethnob- Ibrahim, M.B., Owonubi, M.O., Onaolapo, J.A., 1997. Antimicrobial ef- otanical approach (Cox and Balick, 1994) for the screening fects of extracts of leaf, stem and root bark of Anogiessus leicar- of plants as potential sources of bioactive substances. pus on Staphylococcus aureus NCTC 8198, Escherichia coli NCTC 10418 and Proteus vulgaris NCTC 4636. J. Pharma. Res. Dev. 2, 20– 26. Low, C.A.M., Regnier, T.J.C., Korsten, L., 2002. Medicinal bul- Acknowledgements bous plants of South Africa and their traditional relevance in the control of infectious diseases. J. Ethnopharmacol. 82, 147– This research was supported by CIUNT grants to A. 154. Sanchez´ Riera. We are grateful to the Microbiology Course Lugtemberg, B., van Alphem, L., 1983. Molecular architecture and functioning of the outer membrane of Escherichia coli and other Gram of the Universidad Nacional de Tucuman´ for providing the negative bacteria. Biochim. Biophys. Acta 737, 51–115. strains. We wish to thank Mrs. Virginia Mendez´ for her proof- Martinez Crovetto, R., 1965. Estudios etnobotanicos II. Nombres de plan- reading. tas y su utilidad segun´ los indios tobas del este de Chaco. Bonplandia 4, 270–333. Martinez Crovetto, R., 1981. Las Plantas Utilizadas en Medicina Popular en el Noroeste de Corrientes, Republica´ Argentina, Fundacion´ M. References Lillo, Tucuman,´ Argentina. Palombo, E.A., Semple, S.J., 2001. Antibacterial activity of tradi- Abbiatti, D., 1943. Sinopsis de las Lorantaceas argentinas. Revista Ar- tional Australian medicinal plants. J. Ethnopharmacol. 77, 151– gentina de Agronom´ıa 10, 1–25. 157. Bennet, J.V., Brodie, J.L., Benner, J.L., Kirby, W.M.M., 1996. Simpliﬁed Rojas, G., Levaro,´ J., Tortoriello, J., Navarro, V., 2001. Antimicrobial accurate method for antibiotic assays of clinical specimens. Appl. evaluation of certain plants used in Mexican traditional medicine for Microbiol. 14, 170–177. the treatment of respiratory disease. J. Ethnopharmacol. 74, 97–101. Cox, P.A., Balick, M.J., 1994. The ethnobotanical approach to drug dis- Shigeharu, K., 2000. Enzymes responsible for the bactericidal effect in covery. Sci. Am. 270, 60–65. extracts of vitelline and fertilization envelopes of rainbow trouts eggs. Hardman, J.G., Limbird, L.E., Goodman Gilman, A., 1996. Las Bases Zygotes 8, 257–265. Farmacologicas´ de la Terapeutica,´ vol. 45, Novena edicion,´ McGraw- Tortora, G.J., Funke, B.R., Case, C.L., 2001. Microbiology: An Introduc- Hill Interamericana, Tomo II, Cap., p. 1145. tion. Benjam´ın Cummings, San Francisco, p. 88. Journal of Ethnopharmacology 99 (2005) 199–202

Antidiabetic plants used by Sikkim and Darjeeling Himalayan tribes, India

D.R. Chhetri a,∗, P. Parajuli b, G.C. Subba c

a Post Graduate Department of Botany, Darjeeling Government College, Darjeeling 734101, India b Department of Neurosurgery, Wayne State University and Karmanos Cancer Institute, Detroit, MI 48201, USA c Government Diosgenin Factory, Gairibas, Darjeeling 734502, West Bengal, India Received 7 June 2004; received in revised form 13 December 2004; accepted 25 January 2005 Available online 11 April 2005

Abstract

Sikkim and Darjeeling Himalayan region is characterized by a rich floral diversity and an equally rich ethnomedicinal tradition. Herbal medicine is the dominant system of medicine practiced by the local tribes of this region for the treatment of diabetes. During the course of the present studies it was found that 37 species of plants belonging to 28 families are used as antidiabetic agents in the folk medicinal practices in the region and 81% of these plants are hitherto unreported as hypoglycemic agents. This finding may lead to serious research towards developing new and efficient drugs for diabetes. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Diabetes; Antidiabetic plants; Hypoglycemic agents; Traditional medicine

1. Introduction medical system (Kameswararao et al., 2003). To treat diabetes, the tribal people in these parts of the Himalayas are Sikkim and Darjeeling Himalaya is situated between found to use herbal treatments either alone or in combination 87◦59 and 88◦53 East longitude and, 26◦31 and 28◦10 with other forms of treatments. Herbal drugs are prescribed North latitude in India (Fig. 1). This region is rich in ﬂoral widely because of their effectiveness, less side effects and diversity, many endemic elements and a number of species, relatively low cost (Venkatesh et al., 2003). Therefore, in- which have become rare, threatened or endangered. (Pandey, vestigation on such agents from traditional medicinal plants 1991; Bhujel, 1996). The major ethnic groups of the region has become more important (Suba et al., 2004). Here, we re- are the Nepalese, Lepchas and Bhutias (Tibetans). The tribes port 37 species of plants used as antidiabetic agents by the of this Himalayan region also have rich ethnomedicinal tradi- traditional healers of Sikkim and Darjeeling Himalayas. tions for which a few literatures are available (Biswas, 1956; Bennet, 1983; Yonzone et al., 1984; Srivastava et al., 1987; Venu et al., 1990; Pandey, 1991; Rai and Sharma, 1994; Rai 2. Methodology et al., 1998; Rai and Bhujel, 1999, 2002; Das and Mandal, 2003). Regular ﬁeld trips to different areas of Darjeeling and Diabetes affects about 5% of the global population Sikkim hills were conducted between September 2001 and (Chakraborty and Rajagopalan, 2002) and management of April 2003 to collect the ethnomedicinal information and diabetes without any side effects is still a challenge to the herbarium specimens. The tribal people including local healers, Jhankris, Bijuwas and Fedangwas (Nepalese traditional ∗ Corresponding author. Present address: P.O. Box No. 79, Darjeeling- healers), Bongthings and Mon-Bongthings (Lepcha medicine HPO, Darjeeling 714101, India. Tel.: +91 354 2259054. men and women, respectively) Lamas (Bhutia priest) and vil- E-mail address: [email protected] (D.R. Chhetri). lage elders were interviewed. The help of the socio-cultural

Table 1 Antidiabetic medicinal plants from Sikkim and Darjeeling Himalayas Botanical name family, voucher specimen no. Habit Local name: N-Nepali; Method of use and administration L-Lepcha; T-Tibetan 1234 Abroma augustaa (L.) L.f., Sterculiaceae, Shrub Ulatkamal (N) Stem bark and leaf decoction (10–20 ml) GCS 373 taken one time each alternate day in empty stomach for 4–6 week. Abutilum indicumb (L.) Sw., Malvaceae, Shrub Ghantiphool (N) Decoction of stem bark (25–50 ml) given DRC 178 two times daily (after principal meals) for 3–4 weeks. Aconitum palmatumb D. Don., Herb Seto bikhumma (N); Nyini Root decoction (10–15 ml) taken with a cup Ranunculaceae, DRC 166 (L); Bhongnanukpo (T) of milk one time daily (after lunch) for 7–10 days. Aloe barbadensisc Mill, Liliaceae, DRC 161 Herb Ghew kumari (N); Kumari Fresh leaf pulp (40–50 g) taken once a day in (T) empty stomach for 10–12 weeks. Asparagus racemosusa Willd., Liliaceae, Climbing shrub Kurilo (N); Neusiri (T) Decoction of tender shoots (25 ml) taken DRC 102 once a day for 6–8 weeks. Berberis aristataa DC., Berberidaceae, DRC Shrub Sano Chutro (N); Sutangkung Root bark extract (5–10 ml) taken twice daily 111 (L); Skyerba (T) (after breakfast and dinner) for 1–2 weeks Boenninghausenia albiﬂorad (Hook. f.) Herb Chirbirpatay (N) The whole plant is crushed without water Reich ex Meissn., Rutaceae, DRC 180 and the juice (5–10 ml) taken one to two times daily for 3–4 weeks. Calamus rotanga (L.), Arecaceae, GCS 338 Climbing shrub Bet (N) Raw fruit (1–2) taken as masticatory two times daily (after breakfast and lunch) for 6–8 weeks. Campylandra aurantiacad Baker, Liliaceae, Herb Nakima (N) Flowers are made into curry and taken with DRC 179 staple food two times per week for 4–6 weeks Cannabis sativab (L.), Cannabaceae, GCS Under shrub Bhang (N) Leaf extract (5–10 ml) taken two times daily 329 for 3–4 weeks. Catharanthus roseuse (L.) G. Don., Herb Sada bahar (N) Raw leaf (1–2) chewed daily for 2 weeks. Apocynaceae, DRC 161 Cinnamomum tamalad (Buch.-Ham.) Nees Tree Sinkauli (N); Napsor (L); Decoction of stem bark taken three times and Eberm., Lauraceae, GCS 378 Mensing (T) daily for 3–4 weeks Cissampelos pareiraa (L.), var.hirsuta Climber Batulpatay (N) Root bark extract (5–10 ml) tken one to two (Buch.-Ham ex DC) Forman, Menisper- times daily for 2–3 weeks maceae, PPR 219 Coccinea grandisa (L.) Voigt., Climber Tilkor (N) Fresh root extract (5–10 ml.) taken two times Cucurbitaceae, PPR 286 daily (before principal meals) for 3–4 weeks Costus speciosusb (Koening) Sm., Herb Betlouri (N); Ruyang (L) Decoction of rhizome (10–20 ml) taken two Costaceae, PPR 249 to three times daily for 2–4 weeks Ficus racemosaf (L.), Moraceae, DRC 127 Tree Dumri (N) Fruit juice (20–25 ml) taken two times daily (before meals) for 4–8 weeks Girardiana heterophyllab Decne., Shrub Bhangre sisnu (N) Root decoction (25–50 ml) taken two times Urticaceae, PPR 228 daily for 4–8 weeks Gynocardia odorataa R. Br., Flacourtiaceae, Tree Gantay (N); Tukkung (L) Fruit juice (10–15 ml) taken one time daily DRC 150 for 2 weeks Ipomoea batatusg (L.) Lamk., Herb Sagarkhanda (N) The juice of the aerial part of the plant Convolvulaceae, PPR 238 (25–30 ml) taken two times daily for 3–4 weeks Litsea cubebag Pers., Lauraceae, GCS 344 Tree Siltimmur (N) One raw fruit chewed as masticatory two times daily for 4–6 weeks Momordica chrantiaa (L.), Cucurbitaceae, Climber Karela (N) Fruit extract (25 ml) taken two times daily GCS 368 for 12–14 weeks Nardostachys jatamansia DC., Valerianaceae, Herb Jatamansi (N), Spanpos (T) Decoction of rootstock (30–50 ml) taken DRC 154 once daily for 2–3 weeks Oroxylum indicumc (L.) Vent., Tree Totola (N), Phagorip (L), Stem bark decoction (15–20 ml) or juice Bignoniaceae, DRC 134 Sonaka (T) (5–10 ml) taken two to three times daily Paederia foetidaa (L.), Rubiaceae, DRC 138 Climber Birilahara (N), Takpoedrik Leaf infusion (50–60 ml) taken one time in (L) the morning for 2–3 weeks Panax pseudoginsengd Wall., Araliaceae, Herb Panch patay (N) Dried rhizome powder (0.5–1 g) taken one DRC 123 time daily with warm milk Picrorhiza kurrooad Royle ex Benth., Herb Kutki (N), Putse sel (T) Dry rhizome powder (0.5 g) taken with two Scrophulariaceae, DRC 189 tablespoon of curd and a pinch of pepper power one time daily for 1–2 weeks D.R. Chhetri et al. / Journal of Ethnopharmacology 99 (2005) 199–202 201

Table 1 (Continued ) Botanical name family, voucher specimen no. Habit Local name: N-Nepali; Method of use and administration L-Lepcha; T-Tibetan 1234 Potentilla fulgensc Wall., Rosaceae, DRC Herb Banmula (N) Decoction of root (20–25 ml) taken two 171 times daily for 4–8 weeks Quercus lanatad Sm., Fagaceae, PPR 248 Tree Banj (N) Decoction of stem bark (20–25 ml) taken one or two times daily for 2–3 weeks Saraca asocae (Roxb.) De Wilde, Tree Asok (N) Infusion of the dry flower (50–100 ml) taken Caesalpiniaceae, GCS 334 two times daily (before principal meals) for 4–5 weeks Stephania glabrab (Roxb.) Miers, Climber Tamarkay (N), Kanthey (L) Root decoction (20–25 ml) taken with milk Menispermaceae, PPR 212 two to three times daily for 1–2 weeks Swertia angustifoliad Buch.-Ham.ex D. Herb Patlay Chireto (N) Infusion of whole plant (40–50 ml) taken Don., Gentianaceae, DRC 121 two times daily (before principal meals for 3–4 weeks Swertia chirayitab (Roxb. ex Flem.) Karst., Herb Chireto (N), Rungkyon (L), Infusion of the whole plant (50–60 ml) taken Gentianaceae, DRC 187 Tagota (T) one time daily in empty stomach for 2 weeks Swertia pedicellatab Banerji, Gentianaceae, Herb Chireto (N) Decoction of shoot (20–25 ml) taken two DRC 151 times daily (before meals) for 4–6 weeks Syzygium cuminiie (L.) Skeels, Myrtaceae, Tree Kyamuna (N), Dzambu (T) Decoction of stem bark (25–30 ml) taken PPR 209 three times daily for 2–3 weeks Trigonella foenum-graecuma (L.), Fabaceae, Herb Methi (N) Sprouted seeds mixed with chilly, salt and PPR 243 garlic and ground into a paste. 5–10 g of the paste taken with two principal meals daily Urtica dioicaa (L.), Urticaceae, DRC 163 Herb Sisnu (N), Sarong (L) Decoction of young leaves and shoots (50–100 ml) taken as curry one or two times daily with meals for 4–8 weeks Zingiber officinalea Rosc., Zingiberaceae, Herb Adua (N), Heng (L), Beasga Decoction of rhizome (25–50 ml) taken as DRC 162 (T) herbal tea with a pinch of salt two to three times daily for 8–12 weeks a Kirtikar and Basu (1998). b Das and Mandal (2003). c Kumar (2002). d Polunin and Stainton (1984). e Jain (1994). f Chatterjee and Pakrashi (1991). g Gurung (2002). organizations of each group was taken for approaching and or juice (by crushing the fresh plant parts with or without wa- building up of rapport with the traditional healers of each ter) and paste or powder (by grinding the fresh or dried plant community. Preliminary identification of collected plant ma- parts). terials, their local names and information regarding their mode of use were recorded with the help of these traditional medicine practitioners and village elders. Information ob- 3. Results and discussion tained and cross checked with at least seven different infor- mants only has been incorporated here. Subsequently, the In the present study, it was found that a total of 37 species collected plants were identified at the Panchavati Greentech of plant belonging to 28 different families are utilized as an- Research Society, Darjeeling, and the voucher herbarium tidiabetic agents by the tribal people Sikkim and Darjeeling specimens were deposited in the herbarium of the Medici- Himalayan region. Of these, 30 species of plants (81%) have nal Plants Division, Panchavati Greentech Research Society, not been reported as hypoglycemic agents in the Dictionary Darjeeling, India. of Indian Folk Medicine and Ethnobotany (Jain, 1991). This In the enumeration, data on the plants used as hypo- emboldens us to conclude that herbal medicine is still the glycemic agents are presented which consist of the botanical dominant medicine for diabetes in this area. name, family, voucher specimen number, habit, local name in The efficacy of these ethnomedicinal plants needs to be Nepali (N), Lepcha (L) and Tibetan (T) (wherever available) subjected to pharmacological validation. Some antidiabetic followed by the method of use and administration (Table 1). plants may exert their action by stimulating the function References used for identification have been mentioned as su- or number of ␤-cells and thus increasing insulin release perscript letters against the name of each plant. The present (Persaud et al., 1999). In some other plants, the effect is due study reports the use of medicinal plants in the form of infu- to decreased blood glucose synthesis due to the decrease of sion or decoction (by soaking in hot water or boiling), extract the activity of enzymes like glucose-6-phosphatase, fructose 202 D.R. Chhetri et al. / Journal of Ethnopharmacology 99 (2005) 199–202

Biswas, K., 1956. Common Medicinal Plants of Darjeeling and Sikkim Himalaya. Bengal Government Press, West Bengal, Calcutta. Chakraborty, R., Rajagopalan, R., 2002. Diabetes and insulin resistance associated disorders: disease and the therapy. Current Science 83, 1533–1538. Chatterjee, A., Pakrashi, S.C., 1991. The Treatise on Indian Medicinal Plants, vol. I. Publication and Information Directorate, CSIR, New Delhi. Das, A.P., Mandal, S., 2003. Some Medicinal Plants of Darjeeling Hills, WWF-India. West Bengal State Office, Kolkata. Gurung, B., 2002. The medicinal plants of Sikkim Himalaya. Maples, Chakung. Jain, S.K., 1991. Dictionary of Indian Folk Medicine and Ethnobotany. Deep Publications, New Delhi. Jain, S.K., 1994. Medicinal Plants. National Book Trust, India, New Delhi. Kameswararao, B., Kesavulu, M.M., Apparao, C., 2003. Evaluation of antidiabetic effect of Momordica cymbalaria fruit in alloxan-diabetic rats. Fitoterapia 74, 7–13. Kirtikar, K.R., Basu, B.D., 1998. Indian Medicinal Plants, vol. I–IV. Bishen Singh Mahendra Pal Singh, Dehradun. Kumar, S., 2002. The Medicinal Plants of North-East India. Scientific Publishers (India), Jodhpur. Lewis, W.H., Vaisberg, A., Lamas, G., Sarasara, C., Elvin-Lewis, M., 2004. Advantage of ethnomedically based research for searching new pharmaceuticals. Ethnobotany 16, 10–15. Madar, Z., 1984. Fenugreek (Trigonella foenum-graecum) as a means of reducing postprandial glucose levels in diabetic rats. Nutrition Report International 29, 1267–1273. Pandey, V.N., 1991. Medico-Ethno-Botanical Explorations in Sikkim Hi- Fig. 1. Map of Sikkim and Darjeeling Himalayas showing the study area. malayas. Central Council for Research in Ayurveda and Siddha, Gov- ernment of India, New Delhi. Persaud, S.J., Al-Majed, H., Raman, A., Jones, P.M., 1999. Gymnema 1,6-bisphosphatase, etc. In still other plants, the activity is sylvestre stimulates insulin release in vitro by increased membrane due to slow absorption of carbohydrate and inhibition of glu- permeability. Journal of Endocrinology 163, 207–212. cose transport (Madar, 1984). However, these products may Polunin, O., Stainton, A., 1984. Flowers of the Himalaya. Oxford Uni- interact with the conventional diabetes medicines (Shane- versity Press, New Delhi. Rai, P.C., Sarkar, A., Bhujel, R.B., Das, A.P., 1998. Ethnomedicinal stud- McWhorter, 2001). Therefore, a cautious approach should ies in some fringe areas of Sikkim and Darjeeling Himalaya. Journal be adopted before administering these drugs. Of course, this of Hill Research 11, 12–21. primary information is important in view that it may lead to Rai, L.K., Sharma, E., 1994. Medicinal Plants of Sikkim serious pharmacological research and can provide great value Himalayas—Status Uses and Potential. Bishen Singh Mahen- in selecting plant material for drug discovery (Lewis et al., dra Pal Singh, Dehradun. Rai, S.K., Bhujel, R.B., 1999. Notes on some less known ethnomedici- 2004). nal plants from Darjeeling Himalayas. Journal of Hill Research 12, 160–163. Rai, S.K., Bhujel, R.B., 2002. Ethnic uses of some monocotyledonous Acknowledgements plants in the Darjeeling Himalayan region. In: Das, A.P. (Ed.), Per- spectives of Plant Biodiversity. Bishen Singh Mahendra Pal Singh, Dehradun, pp. 635–644. The authors are thankful to the authorities of the Depart- Shane-McWhorter, L., 2001. Biological complimentary therapies: a focus ment of Forests, Government of Sikkim, Sikkim, India; Pan- on botanical products in diabetes. Diabetes Spectrum 14, 199–208. chavati Greentech Research Society, Darjeeling, India; All Srivastava, T.N., Kapaki, B.K., Atal, C.K., 1987. Ethnomedico-botanical India Lepcha Association and other tribal organizations for investigations in Sikkim. Journal of Economic and Taxonomic Botany 11, 413–421. various helps provided during the present study. The anony- Suba, V., Murugesan, T., Rao, R.B., Ghosh, L., Pal, M., Mandal, S.C., mous reviewers of the paper are thankfully acknowledged for Saha, B.P., 2004. Antidiabetic potential of Barleria lupulina extract their constructive suggestions. in rats. Fitoterapia 75, 1–4. Venkatesh, S., Reddy, G.D., Reddy, B.M., Ramesh, M., Appa Rao, A.V.N., 2003. Antihyperglycemic activity of Caralluma attenuata. Fitoterapia 74, 274–279. References Venu, P., Kumar, V., Bhasin, M.K., 1990. Human activity and its impacts on vegetation: a case study in Sikkim Himalayas. Journal of Human Bennet, S.S.R., 1983. Ethnobotanical studies in Sikkim. Indian Forester Ecology 1, 27–38. 109, 577–581. Yonzone, G.S., Yonzone, D.K.N., Tamang, K.K., 1984. Medicinal plants Bhujel, R.B., 1996. Studies on the dicotyledonus flora of Darjeeling dis- of Darjeeling district. Journal of Economic and Taxonomic Botany 5, trict. Ph. D. Thesis. North Bengal University, Darjeeling, India. 605–616. Journal of Ethnopharmacology 99 (2005) 203–209

Preliminary pharmacological studies on Piper chaba stem bark

Md. Tauﬁq-Ur-Rahman a,∗, Jamil Ahmad Shilpi b, Muniruddin Ahmed c, Chowdhury Faiz Hossain d

a School of Biological Sciences, University of Manchester, Oxford Road, M13 9PL Manchester, UK b Pharmacy Discipline, Life Science School, Khulna University, Khulna 9208, Bangladesh c Department of Pharmacology and Clinical Pharmacy, University of Dhaka, Dhaka 1000, Bangladesh d Department of Pharmacognosy and National Center for Natural Products Research, School of Pharmacy, University of Mississippi, MS, USA Received 24 May 2004; received in revised form 9 December 2004; accepted 28 January 2005 Available online 11 April 2005

Abstract

Piper chaba Hunter (Piperaceae) is a common pepper in the southern part of Bangladesh. Various parts of this plant have been extensively used in different traditional formulations including ayurveda. In order to rationalize the ethnomedical uses of this plant in a number of ailments, the methanol extract of the stem bark was subjected to preliminary evaluation for analgesic, anti-inflammatory, diuretic, anti-diarrhoeal, effect on gastrointestinal motility and CNS depressant activity in mice and rat at 125, 250 and 500 mg/kg body weight doses. The extract at given doses significantly and dose dependently reduced the frequency of acetic acid induced writhing in mice, prolonged the tail flicking latency in mice, reduced Carrageenan-induced paw edema volume in rat, delayed the onset as well as reduced the frequency of castor oil induced diarrhoeal episodes in mice, decreased gastrointestinal motility as assessed by the charcoal motility test in mice and prolonged pentobarbitone induced sleeping time in mice. However at the same doses, the extract exhibited moderate diuretic activity only at the highest dose. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Analgesic activity; Anti-inﬂammatory activity; Diuretic activity; Anti-diarrhoeal activity; CNS depressant activity; Charcoal motility test

1. Introduction post-delivery pain in mothers and also useful in rheumatic pains and diarrhoea (Yusuf et al., 1994). The plant Piper chaba Hunter (Piperaceae) is a climbing, Previous phytochemical investigation of the stem bark glabrous shrub available in various parts of India and Malay of the plant revealed the presence of lignan (Bhandari Islands (Kirtikar and Basu, 1980). In Bangladesh, it grows et al., 1998) and alkaloids such as piperamine 2,4-decadienoic in plenty in Khulna division and more specifically in the acid piperidide, kusunokinin and pellitorine (Connolly et al., Satkhira–Bagerhatt area. Like other plants of Piper genus, 1995). Root has been reported to contain some alkamides the plant enjoys vast folklore uses, as traditional medicine. such as piperine, sylvatine, piplartine and piperlonguminine The root is alexiteric; useful in asthma, bronchitis, con- and ␤-sitosterol (Patra and Ghosh, 1974). A novel piperine sumption. The fruit is pungent; thermogenic, anthelmintic, dimer called chabamide has also been indentified in the stem expectorant, carminative; improves appetite and taste and bark (Rukachaisirikul et al., 2002). Besides ␤-caryophyllene, also useful in asthma, bronchitis, fever, inflammation, piles, caryophyllene oxide and few monoterpene hydrocarbons, pain in the abdomen and at the anus. The fruit has stimulant a moderate content of sesquiterpenes and high amount of and carminative properties, and is used in haemorrhoidal aliphatic hydrocarbons have been found in the fruit oil of the affections (Kirtikar and Basu, 1980). Stem is used to alley plant (Tewtrakul et al., 2000). A survey of literature reveals that there has been dearth of information on pharmacological ∗ studies with Piper chaba Hunter. One previous investigation, Corresponding author. Present address: Department of Pharmacology, University of Cambridge, CB2 1PD, UK. which is rather pharmacokinetic than pharmacological, re- E-mail address: [email protected] (Md. Taufiq-Ur-Rahman). vealed that the crude extract of the plant increased the oral

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.jep.2005.01.055 204 Md. Tauﬁq-Ur-Rahman et al. / Journal of Ethnopharmacology 99 (2005) 203–209 bioavailability of sulfadiazine and tetracycline hydrochloride nichrome wire and the time taken to withdraw the tail was (Atal et al., 1980). In another study, the crude extract was recorded 40 min after the administration of test material found to possess antibacterial activity (Sarker et al., 1991). (125, 250 and 500 mg/kg). A maximum cut-off time of 10 s Recently, the 80% aqueous acetone extract from the fruit of was observed to minimize undue tissue damage as a result Piper chaba as well as some isolated alkamides were found of over exposure of the tail to heat. The control and positive to be protective against ethanol and indornethacin induced control group received normal saline and morphine HC1 gastric lesions in rats (Morikawa et al., 2004). solution (2 mg/kg, s.c.), respectively.

2.4. Carrageenan-induced rat paw edema test 2. Materials and methods The method of Winter et al. (1962) was followed for the 2.1. Plant material and extract preparation test. Administration of 0.1 ml of 1% freshly prepared suspension of carrageenan (Sigma, USA) into the sub-planter The stem bark of Piper chaba Hunter was collected region of the right hind paws of each rat of four groups (each from Satkhira, Khulna division of Bangladesh, in June consisting of six animals) led to the formation of edema in 2002 and was taxonomically identified by Professor Hasan, situ due to localized inflammation. Thirty minutes prior to the Department of Botany, University of Dhaka, where a voucher administration of carrageenan solution, the test groups, the specimen has been deposited. After collection, the barks standard group and the control group received orally the ex- were cut into pieces, shade-dried and finally ground to coarse tract (125, 250 and 500 mg/kg), phenylbutazone (100 mg/kg, powder. The powdered plant material (1.5 kg) was extracted Sigma, USA) and normal saline, respectively. Paw volumes with distilled methanol at room temperature for 3 days. were measured up to a fixed mark by mercury displacement as ◦ The filtrate was concentrated in vaccuo (50 C) yielding the viewed by travelling microscope at 1–4 and 24 h after the ad- crude methanol extract (20.4 g). The crude extract obtained ministration of the standard drug and test extracts. The aver- ◦ as such was kept in refrigerator at 4 C and was diluted with age percent increase in paw volume with time was calculated normal saline prior to any pharmacological screening. and compared against the control group. Percent inhibition was calculated using the formula: 2.2. Animals V − V = c t × inhibition (%) V 100 Swiss Albino mice (n = 6 per group) of either sex, weigh- c ing 26–28 g, obtained from the Animal Resource Division, where Vc and Vt represent average paw volume of control International Center for Diarrhoeal Diseases and Research, and treated animals, respectively. Bangladesh (ICDDR, B), were used for the experiments ex- cluding the diuretic and anti-inflammatory activity screening. 2.5. Evaluation of diuretic activity For the later tests, male Wister rats (n = 6 per group) weighing 200–250 g obtained from the same source were used. The ani- The method of Lipschitz et al. (1943) as modified by Kau mals were kept in standard environmental condition, had free et al. (1984) was adopted for this test. The animals, fasted access to standard food (ICDDR, B formulated) and water ad and deprived of water for 18 h prior to the experiment, were libitum and fasted 18 h prior to their use. divided in five groups of six rats each. The first group of animals, serving as control, received normal saline (10 ml/kg, 2.3. Evaluation of analgesic study p.o.); the second group received furosemide (1 mg/kg, p.o.) as a standard: the third, fourth and fifth groups received the test 2.3.1. Acetic acid induced writhing test extract at doses of 125, 250 and 500 mg/kg, respectively. Im- The method of Koster et al. (1959) was used. Crude mediately after dosing, the animals were separately placed in extract (125, 250 and 500 mg/kg) was orally administered metabolic cages with provision for urine collection in gradua- to mice (n = 6) 1 h before i.p. injection of 0.6% (v/v) acetic ted measuring cylinders. Cumulative urine out-puts were col- acid, at a dose of 10 ml/kg, while normal saline was used lected for 5 h while animals were deprived of food and water. as control treatment. The positive control group received 100 mg/kg of acetylsalicylic acid. Writhings that occurred 2.6. Evaluation of anti-diarrhoeal activity between 5 and 15 min after acetic acid were counted. Castor oil induced diarrhoea as described by Shoba and 2.3.2. Tail flicking test Thomas (2001) was adopted. Mice were divided into con- The method of D’Amour and Smith (1941) as modified trol, positive control and test groups (n = 6). Each mouse was by Connor et al. (2000) was adopted for this test. An placed in an individual cage, the floor of which was lined analgesiometer (Medicraft Co., India) was used to record with blotting paper. Diarrhoea was induced by administering tail flick latencies. Each mouse was encased in small plastic 0.3 ml of castor oil orally to mice. The control group received chamber with the distal part of the tail placed over a heated only normal saline; the positive control group received lop- Md. Taufiq-Ur-Rahman et al. / Journal of Ethnopharmacology 99 (2005) 203–209 205 eramide HCI (5 mg/kg, p.o.; Sigma, USA); the test groups of saline served as the control. Diazepam (1 mg/kg, i.p.; Bex- received the extract (at 125, 250 and 500 mg/kg, p.o.) 40 min imco Pharma, Bangladesh) was used as standard drug. Thirty prior to castor oil charge. The time elapsed between the ad- minutes after treatments, all animals received sodium phe- ministration of castor oil and the excretion of the first diar- nobarbitone (25 mg/kg, i.p.; Rhone Poulenc, UK). The time rhoeic stool (wet faeces that left a halo on the filter paper) and between the loss and recovery of the righting reflex was the total number of faecal output by the animals and the total recorded as the sleeping time. numbers of wet faeces over a time period of 4 h were counted. 2.9. Statistical analysis 2.7. Evaluation of effect on gastrointestinal motility All data were expressed as mean ± S.E.M. and analyzed The experiment was done in accordance with Biswas et al. by Student’s t-test. (2002). The animals were divided into control, positive control and test groups consisting of six mice in each group. Each animal was given orally 1 ml of charcoal meal (3% deacti- 3. Results and discussions vated charcoal in normal saline). The test groups received the extracts at 125, 250 and 500 mg/kg body weight doses (one 3.1. Analgesic activity dose of extract per group) immediately after the charcoal meal administration. The positive control group received atropine The crude Piper chaba bark extract given orally at 125, 250 sulfate (0.1 mg/kg, i.p.) as standard drug, while the control and 500 mg/kg body weight doses, significantly (P < 0.001) group received normal saline (5 ml/kg, p.o.). After 30 min, the and dose dependently, inhibited the frequency of acetic acid animals were sacrificed and the movement of charcoal from induced abdominal constrictions in mice (Table 1). At the pylorus to caecum was measured. The charcoal movement same dose level, the extract also showed significant (P < 0.05, was expressed in terms of percentage. P < 0.02) and dose dependent prolongation of the tail flicking time of mice (Table 2). 2.8. Evaluation of effect on pentobarbitone induced sleeping time of mice 3.2. Carrageenan-induced rat paw edema

The method adopted by Ramirez et al. (1998) was fol- As can be seen from Table 3, the extract at given doses lowed. Mice (n = 6) in test groups received test extract (125, caused a sustained and signiﬁcant (P < 0.001) reduction of 250 and 500 mg/kg, p.o.) while an equal volume (10 ml/kg) carrageenan-induced paw edema volume of treated rats in

Table 1 Effect of methanol extract of Piper chaba stem bark on acetic acid induced writhing in mice Treatment Dose (mg/kg, p.o.)a Writhings (n)b Inhibition (%) Control (vehicle, 10 ml/kg, p.o.) – 68.40 ± 1.44 – Piper chaba extract 125 37.80 ± 1.83**** 44.74 250 31.89 ± 2.20**** 53.37 500 26.12 ± 2.68**** 61.80 ASA 100 19.44 ± 1.41**** 72.47 a Administered 1 h before 0.6% acetic acid (0.1 ml/10g , i.p.). b Counted for 10 min, starting 5 min after acetic acid injection; values are mean ± S.E.M.; n =6. ∗∗∗∗P < 0.001 vs. control; Student’s t-test.

Table 2 Effect of methanol extract of Piper chaba stem bark on tail flick reflex of micea Treatment Dose (mg/kg) Tail-flicking latency (s)b Elongation of tail-flicking latency (%) Control (vehicle, 10 ml/kg) – 5.1 ± 0.6 – Morphine 2, s.c. 8.8 ± 0.8*** 72.6 Piper chaba extract 125, p.o. 6.9 ± 0.5* 35.3 250, p.o. 7.4 ± 0.8* 45.1 500, p.o. 8.2 ± 0.8** 60.8 a 40 min after treatment, mice were injected s.c. with morphine (2 mg/kg. s.c.); 5 min after morphine administration, the tail flicking latency was counted for each group setting analgesiometer current at 0.4 A. b Values are mean ± S.E.M (n = 6). ∗ P < 0.05 vs. control; Student’s t-test. ∗∗ P < 0.02 vs. control; Student’s t-test. ∗∗∗ P < 0.01 vs. control; Student’s t-test. 206 Md. Taufiq-Ur-Rahman et al. / Journal of Ethnopharmacology 99 (2005) 203–209

Table 3 Effect of methanol extract of Piper chaba on Carrageenan-induced paw edema in ratsa Treatment Dose Increase in paw volume (ml × 1000) ± S.E.M. (inhibition (%)) (mg/kg p.o.) 1h 2h 3h 4h 24h Control (saline) – 58.6 ± 1.5 70.9 ± 2.0 76.7 ± 2.2 89.0 ± 1.7 47.1 ± 1.5 Piper chaba extract 125 51.1 ± 1.3*** (12.8) 56.2 ± 1.5**** (20.7) 60.2 ± 1.3**** (21.5) 71.3 ± 2.6**** (20.1) 42.1 ± 1.3 (10.6) 250 47.2 ± 1.3**** (19.4) 54.2 ± 1.6**** (23.5) 53.2 ± 1.5**** (30.6) 64.8 ± 1.8**** (27.3) 41.2 ± 1.3*** (12.5) 500 45.8 ± 2.1**** (21.8) 45.2 ± 2.8*** (36.3) 49.6 ± 1.6**** (35.3) 56.9 ± 2.3**** (36.1) 40.8 ± l.l** (13.4) Phenylbutazone 100 43.9 ± 1.5**** (25.1) 46.7 ± 1.7**** (34.1) 47.9 ± 1.8**** (37.5) 54.4 ± 2.2**** (39.0) 38.2 ± 1.3** (18.9) a Values are mean ± S.E.M (n = 6). ∗∗ P < 0.02 vs. control; Student’s t-test. ∗∗∗ P < 0.01. ∗∗∗∗P < 0.001 vs. control; Student’s t-test.

Table 4 Effect of methanol extract of Piper chaba stem bark on urinary output in ratsa Treatment Dose (mg/kg, p.o.) Total urine output (ml)b Increase (%) Control (saline, 10 ml/kg, p.o.) – 4.8 ± 0.4 – Piper chaba extract 125 3.6 ± 1.8 – 250 5.4 ± 0.4 12.5 500 6.9 ± 0.8* 43.7 Furosemide 10 8.1 ± 0.6*** 68.7 a Values are mean ± S.E.M. (n = 6). b Collected for 5 h after treatment. ∗ P < 0.05 vs. control; Student’s t-test. ∗∗∗ P < 0.001 vs. control; Student’s t-test.

Table 5 Effect of the methanol extract of Piper chaba stem bark on castor oil induced diarrhoea in micea Treatment Dose (mg/kg body Onset time of Total number of Total number of weight, p.o.) diarrhoea (min) faecal output in 4 h wet faeces in 4 h Control (normal saline) 5b 104.6 ± 3.3 13.2 ± 1.1 10.1 ± 1.4 Loperamide 5 244.8 ± 1.5**** 2.8 ± 0.8**** 1.6 ± 0.8**** Piper chaba extract 125 138.8 ± 2.6**** 10.8 ± 0.8 8.9 ± 1.8 250 158.8 ± 2.1**** 10.2 ± 0.8* 6.3 ± 0.8* 500 198.8 ± 2.4**** 8.3 ± 1.1*** 5.4 ± 1.2* a Values are mean ± S.E.M. (n = 6). b In ml/kg. ∗ P < 0.05 vs. control; Student’s t-test. ∗∗∗ P < 0.01 vs. control; Student’s t-test. ∗∗∗∗P < 0.001 vs. control; Student’s t-test. dose dependent manner. At the second hour of study, the extract at 500 mg/kg body weight dose, showed the maximum (36.3%) inhibition of edema, which was even higher than that with phenylbutazone (100 mg/kg). Table 6 Effect of methanol extract of Piper chaba bark on gastrointestinal motility a 3.3. Test for diuretic activity of mice Treatment Dose (mg/kg, p.o.) Distance traversed by As shown in Table 4, the extract showed signiﬁcant charcoal meal (%) (P < 0.05) increase in total urinary output of rats only at Control (normal saline) 5b,p.o. 86.4 ± 1.2 . ± **** 500 mg/kg body weight dose where as the standard diuretic Atropine sulfate 0 1, i.p. 44.8 1.4 furosemide exhibited 68.7% increase (P < 0.00l). Piper chaba extract 125 80.1 ± 2.2* 250 72.5 ± 1.8**** 500 54.2 ± 1.4**** 3.4. Castor oil induced diarrhoea a Values are mean ± S.E.M. (n = 6). b In ml/kg. In the castor oil induced diarrhoea model, the crude ex- ∗ P < 0.05 vs. control; Student’s t-test. tract showed about 52 and 90% prolongation of the time for ∗∗∗∗P < 0.001 vs. control; Student’s t-test. Md. Tauﬁq-Ur-Rahman et al. / Journal of Ethnopharmacology 99 (2005) 203–209 207

Table 7 Effect of the methanol extract of Piper chaba bark on phentobarbital-induced sleeping time of micea Treatment Dose (mg/kg body weight Onset of sleep (min) Duration of sleep (min) Control (normal saline) 10b p.o. 5.78 ± 0.88 19.48 ± 1.90 Diazepam 1, i.p. 2.92 ± 0.44* 39.44 ± 1.80**** Piper chaba extracts 125, p.o. 4.46 ± 1.40 21.88 ± 2.10 250, p.o. 3.38 ± 0.48* 28.56 ± 1.01 500, p.o. 3.25 ± 0.56* 34.19 ± 1.30**** a Values are mean ± S.E.M. (n = 6). b In ml/kg. ∗ P < 0.05 vs. control; Student’s t-test. ∗∗∗∗P < 0.001 vs. control; Student’s t-test. induction of diarrhoea against the control group at 250 and that acetic acid stimulates the vanilloid receptor (VR1) and 500 mg/kg body weight doses, respectively. At the same dose bradykinin B2 receptor in the pathway comprising sensory level, the extract also reduced the frequency of defaecation afferent C-fibers (Ikeda et al., 2001). Therefore, the observed by almost 23 and 37%, respectively (Table 5). Although the activity of the methanol extract might stem from its ability extract at 125 mg/kg body weight dose delayed the on-set to interfere with the synthesis and/or release of those en- time of diarrhoea by 32.7% (P < 0.001), it failed to exhibit dogenous substances or desensitization of the nerve fibers any significant reduction in diarrhoeal episodes. involved in the pain transmission pathway. Such ability may be due to presence of some active constituents, especially 3.5. Gastrointestinal motility test the alkamides many of which have been reported to inhibit prostaglandin synthesis (Stohr¨ et al., 2001). Again, the ob- The results of the charcoal motility test (Table 6), the ex- served central anti-nociceptive activity of the extract is sug- tract at 250 and 500 mg/kg body weight doses, significantly gestive of its ability to mimic the opiod like drugs in some and dose dependency decreased the propulsion of charcoal way. meal through the gastrointestinal tract by about 16 and 37% The traditional use of Piper chaba in rheumatic pain as with respect to the control group whereas the maximum inhi- well as the observed activity of the methanol extract of Piper bition (around 48%) of gastrointestinal motility was observed chaba stem bark against acetic acid induced writhing which with atropine sulphate. But anti-motility effect of the extract is an inflammatory model of pain (Vinegar et al., 1979) pro- at 125 mg/kg was not prominent compared to the standard. vided a basis for its screening for possible anti-inflammatory activity by the Carrageenan-induced rat paw edema model. 3.6. Pentobarbitone induced sleeping time Result of this experiment (Table 3) showed that the mean paw volume after carrageenan administration in animals treated The extract significantly (P < 0.001) prolonged the du- with test samples (except 500 mg/kg) increased up to the third ration of pentobarbitone induced sleeping time in mice at hour of study, and then got a declining trend. The change in 500 mg/kg body weight dose only whereas it reduced the on- paw volume at different hours of study with test compounds set time significantly (P < 0.05) at both 250 and 500 mg/kg was compared to control for the evaluation of percent inhi- body weight dose (Table 7). bition of paw edema. The extract exhibited most prominent anti-inflammatory activity at 500 mg/kg body weight dose with comparable efficacy with phenylbutazone. 4. Discussions Carrageenan-induced paw edema has been reported to have more than one phase and the initial phase has been at- The crude methanol extract of Piper chaba stem bark (at tributed to the release of histamine and serotonin (5-HT), the 125, 250 and 500 mg/kg body weight dose, p.o.) showed maintenance of edema during the plateau phase is caused by significant and dose dependent analgesic activity in both kinin-like substances and the second accelerating phase of acetic acid induced writhing and tail flick test in mice swelling are due to prostaglandin like substances (DiRosa (Tables 1 and 2) which is indicative of its ability to act in et al., 1971; DiRosa, 1972). As the crude methanol extract both peripheral and central pathways of pain. Intraperito- exhibited significant and sustained inhibition of paw edema nial administration of acetic acid causes algesia by liber- from l to 4 h, the possible mechanism of the observed anti- ating noxious endogenous substances including serotonin, inflammatory activity might be its ability to inhibit the release histamine, prostaglandin, bradykinin and substance P that of histamine, serotonin or kinin like substances or biosynthe- sensitize pain nerve endings (Collier et al., 1968; Raj, 1996). sis of prostaglandins which is consistent with the observation Of the prostanoids, mainly prostacyclin (PGI2) has been held of analgesic activity. responsible for the causation of pain following acetic acid One of the most important features of inflammation is administration (Murata et al., 1997). It has been suggested edema which is caused by the action of some inflamma- 208 Md. Taufiq-Ur-Rahman et al. / Journal of Ethnopharmacology 99 (2005) 203–209 tory autacoids like kinins, prostaglandins, leukotrienes, (such as testing with different models of analgesic, anti- etc. resulting in vasodilation, enhancement of capillary inflammatory activity and analysis of electrolyte profile of permeability and plasma exudation. Therefore, substances urine, etc.) and bioactivity guided phytochemical studies are having anti-inflammatory activity can be good candidates for required to find out the actual active constituents. being diuretic. Since the crude bark extract of Piper chaba had shown good anti-inflammatory activity as screened by Carrageenan-induced rat paw edema test, screening for possi- Acknowledgements ble diuretic activity was logical. However, the extract showed significant (P < 0.05) and substantial (43.7% increase in urine The authors are grateful to the Ministry of Science and output) only at the highest dose (500 mg/kg, p.o.) (Table 4). Technology, Government of Bangladesh, for providing the The reported traditional use of Piper chaba in diarrhoea necessary financial support to carry out the work. M.T. Rah- justified its screening for anti-diarrhoeal activity using castor man was sponsored by the Commonwealth Commission, oil induced diarrhoea in mice model. As shown in Table 5, UK. The authors gratefully acknowledge the help of Dr. the extract at given doses (125, 250 and 500 mg/kg, p.o.) S.C. Bachar and J.K. Kundu, assistant professors, Faculty significantly and dose dependently, retarded the onset time of of Pharmacy, University of Dhaka, in carrying out the anti- diarrhoea but reduced the frequency of diarrhoeal episodes inflammatory screening. significantly only at 250 and 500 mg/kg doses. Again, the results of charcoal motility test as shown in Table 6 indicate that the extract reduced the propulsive movement of small References intestine significantly (P < 0.001) and substantially only at 500 mg/kg dose. Atal, C.K., Manavalan, R., Nighojkar, R., Sarcen, A.N., Gupta, O.P., The castor oil model incorporates both secretory and 1980. Studies on Piper chaba as a bioavailable agent. Indian Drugs motility diarrhoea (Yegnanarayan and Shrotri, 1982). The 17, 266–268. Bhandari, S.P.S., Babu, U.V., Garg, H.S., 1998. A lignan from Piper liberation of ricinoleic acid from castor oil results in irrita- chaba stem. Photochemistry 47, 1435–1436. tion and inflammation of the intestinal mucosa, leading to the Biswas, S., Murugesan, T., Sinha, S., Maiti, K., Gayen, J.R., Pal, M., release of prostaglandins, which stimulates motility and se- Saha, B.P., 2002. Antidiarrhoeal activity of Strychnos potatorum seed cretion (Pierce et al., 1971). Ricinoleic acid is also reported to extract in rats. Fitoterapia 73, 43–47. reduce active Na+ and K+ absorption with decreased Na+,K+ Collier, H.O., Dinneen, L.C., Johnson, C.A., Schneider, C., 1968. The abdominal constriction response and its suppression by analgesic drags ATPase activity in the small intestine and colon (Gaginella in the mouse. British Journal of Pharmacology 32, 295–310. and Phillips, 1975). As with other laxatives, castor oil changes Connolly, J.D., Deans, R., Haque, M.E., 1995. Constituents of Piper the intestinal permeability and the histology (Mascolo et al., chaba. Fitoterapia 66, 188. 1993). The observed anti-diarrhoeal as well as anti-peristaltic Connor, J., Makonnen, E., Rostom, A., 2000. Comparison of analgesic activity of Piper chaba stem bark extract may be attributed effects of khat (Catha edulis Forsk) extract, d-amphetamine and ibuprofen in mice. Journal of Pharmacy and Pharmacology 52, 107– to possible inhibition of prostaglandin biosynthesis or to any 110. anticholinergie effect like atropine, respectively. D’Amour, F.E., Smith, D.L., 1941. A method for determining loss of pain The rationale behind the test was to assess whether the sensation. Journal of Pharmacology and Experimental Therapeutics extract possesses any depressant action on the central ner- 72, 74–79. vous system, which might contribute to the observed anal- DiRosa, M., 1972. Biological properties of carrageenan. Journal of Phar- macy and Pharmacology 24, 89–102. gesic activity. The results (Table 7) show that the extract DiRosa, M., Giroud, J.P., Willoughby, D.A., 1971. Studies of the acute significantly (P < 0.05) reduced the onset time of sleep at inflammatory response induced in rats in different sites by carrageenan 250 and 500 mg/kg doses whereas substantial and significant and turpentine. Journal of Pathology 104, 15–29. (P < 0.001) potentiation of duration of sleep was observed Gaginella, T.S., Phillips, S.F., 1975. Ricinoleic acid: current view of an only at 500 mg/dose. The observed CNS depressant activity ancient oil. Digestive Diseases 20, 1171–1177. Ikeda, Y., Ueno, A., Naraba, H., Oh-ishi, S., 2001. Involvement of vanil- might at least partially account for the acetic acid induced loid receptor VRl and prostanoids in the acid-induced writhing re- writhing inhibition by the extract. sponses of mice. Life Sciences 69, 2911–2919. Kau, S.T., Keddi, J.R., Andrews, D., 1984. A method for screening diuretic agents. Journal of Pharmacology and Experimental Therapeutics 5. Conclusions 11, 67–75. Kirtikar, K.R., Basu, B.D., 1980. Indian Medicinal Plants, vol. 1, second ed., B. Singh, M.P. Singh, India. The findings of the preliminary pharmacological screen- Koster, R., Anderson, M., DeBeer, E.J., 1959. Acetic acid analgesic ing with the methanol extract of Piper chaba stem bark screening. Federation Proceedings 18, 418–420. validates its ethnomedical use in various ailments including Lipschitz, W.L., Hadidian, Z., Kerpesar, A., 1943. Bioassay of diuret- different types of pain and diarrhoea. The observed activities ics. Journal of Pharmacology and Experimental Therapeutics 79, 97– 110. of the extract may be attributed to various active ingredients, Mascolo, N., Izzo, A.A., Barbato, F., Capasso, F., 1993. Inhibitors of mainly of the alkamides, many of which are common in the nitric oxide synthetase prevent castor oil induced diarrhoea in the rat. piperaceae family. Further, pharmacological investigations British Journal of Pharmacology 108, 861–864. Md. Taufiq-Ur-Rahman et al. / Journal of Ethnopharmacology 99 (2005) 203–209 209

Morikawa, T., Matsuda, H., Yamaguchi, I., Pongpiriyadacha, Y., Sarker, S.D., Moniruzzaman, M., Khan, S.I., Chowdhury, A.K.A., 1991. Yoshikawa, M., 2004. New amides and gastroprotective con- Antibacterial activity of Piper chaba. Bangladesh Journal of Botany stituents from the fruit of Piper chaba. Planta Medica 70, 152– 20, 679–681. 159. Shoba, F.G., Thomas, M., 2001. Study of antidiarrhoeal activity of four Murata, T., Ushikubi, F., Matsuoka, T., Hirata, M., Yamasaki, A., Sugi- medicinal plants in castor oil induced diarrhoea. Journal of Ethnophar- moto, Y., Ichikawa, A., Aze, Y., Tanaka, T., Yoshida, N., Ueno, A., macology 76, 73–76. Oh-Ishi, S., Narumiya, Shu., 1997. Altered pain perception and in- Stohr,¨ J.R., Xiao, P., Bauer, R., 2001. Constituents of Chinese Piper flammatory response in mice lacking prostacyclin receptor. Nature species and their inhibitory activity on prostaglandin and leukotriene 388, 678–682. biosynthesis in vitro. Journal of Ethnopharmacology 75, 133–139. Patra, A., Ghosh, A., 1974. Amides of Piper chaba. Phytochemistry 13, Tewtrakul, S., Hase, K., Kadota, S., Namba, T., Komatsu, K., Tanaka, K., 2889–2890. 2000. Fruit oil composition of Piper chaba Hunt., P. longum L. and Pierce, N.F., Carpenter, C.C.J., Elliot, H.I., Greenough, W.B., 1971. Ef- P. nigrum L. Journal of Essential Oil Research 12, 603–608. fects of prostaglandins, theophylline and cholera exotoxin upon trans- Vinegar, R., Truax, J.F., Selph, J.L., Johnston, P.R., 1979. Antagonism mucosal water and electrolyte movement in canine jejunum. Gastroen- of pain and hyperalgesia. Anti-inflammatory drugs. In: Vane, J.R., terology 60, 22–32. Ferreira, S.H. (Eds.), Handbook of Experimental Pharmacology, 50/II. Raj, P.P., 1996. Pain mechanisms. In: Pain Medicine: A Comprehen- Springer-Verlag, Berlin, pp. 208–222. sive Review, first ed. Mosby-Year Book, Inc., St. Louis, USA, Winter, C.A., Risley, E.A., Nuss, G.W., 1962. Carrageenan-induced edema pp. 12–24. in hind paws of the rats as an assay for anti-inflammatory drugs. Ramirez, N.N., Ruiz, J.D.Q., Arellano, B.R., Madrigal, M.T.V., Proceedings of the Society for Experimental Biology and Medicinal Michel, G.P., 1998. Anticonvulsant effects of Magnolia grandi- 3, 544–547. fora L. in the rats. Journal of Ethnopharmacology 61, 143– Yegnanarayan, R., Shrotri, D.S., 1982. Comparison of antidiarrhoeal ac- 152. tivity of some drugs in experimental diarrhoea. Indian Journal of Phar- Rukachaisirikul, T., Prabpai, S., Champung, P., Suksamrarn, A., 2002. macology 14, 293–299. Chabamide, a novel piperine dimer from stems of Piper chaba. Planta Yusuf, M., Chowdhury, J.U., Wahab, M.A., Begum, J., 1994. Medicinal Medica 68, 853–855. Plants of Bangladesh. BCSIR, Dhaka, Bangladesh, p. 193. Journal of Ethnopharmacology 99 (2005) 211–214

Ethnoveterinary medicine in the search for antimicrobial agents: Antifungal activity of some species of Pterocaulon (Asteraceae)

Ana Cristina Stein a, Maximiliano Sortino b,Cesar´ Avancini c,1, Susana Zacchino b, Gilsane von Poser a,∗

a Programa de Pós Gradua¸cão em Ciências Farmacêuticas, Universidade Federal do Rio Grande do Sul-Av. Ipiranga 2752, 90610-000 Porto Alegre, RS, Brazil b Facultad de Ciencias Bioqu´ımicas y Farmacéuticas, Universidad Nacional de Rosario, Suipacha 531, 2000 Rosario, Argentina c Faculdade de Veterinária, Depto. de Medicina Veterinária Preventiva, Universidade Federal do Rio Grande do Sul-Av. Bento Gon¸calves 9090, 90540-000 Porto Alegre, RS, Brazil Received 28 May 2004; received in revised form 5 January 2005; accepted 7 February 2005 Available online 18 April 2005

Abstract

Based on informal interview, ethnoveterinary information about plants used in the treatment of skin diseases were obtained. Plants from the genus Pterocaulon (Asteraceae) known as “quitoco” are used to treat problems popularly diagnosed as “mycoses”, which can have both fungic and bacterial etiology. In order to validate this traditional practice, the crude methanolic extracts and fractions from the aerial parts of three species of Pterocaulon (Pterocaulon alopecuroides (Lam.) D.C., Pterocaulon balansae Chodat. and Pterocaulon polystachyum D.C.) grown in southern Brazil were analyzed for the in vitro antifungal activity against a panel of standardized and clinical opportunistic pathogenic yeasts and ﬁlamentous fungi including dermatophytes by the agar dilution method. The crude methanolic extract of Pterocaulon alopecuroides was the most active followed by the extract of Pterocaulon polystachyum. Pterocaulon balansae crude methanolic extract was the less active but its lipophilic fractions showed remarkable activity mainly against the dermatophytes. © 2005 Published by Elsevier Ireland Ltd.

Keywords: Pterocaulon species; Asteraceae; Ethnoveterinary; Antifungal activity; Broth dilution assay

1. Introduction With few exceptions, veterinary and human mycology deals with the same fungal pathogens (Acha and Szyfres, Dermal and mucosal human fungal infections have in- 2003) and, therefore, the traditional or popular experience creased at an alarming rate in the last 30 years, mainly due to regarding the treatment of animal mycoses (ethnoveterinary the growing population of immunocompromised individuals treatments) is considered nowadays a valuable knowledge such as cancer patients receiving chemotherapy and patients for the discovery of new antifungal drugs for human beings submitted to organ transplantation, being treated with im- (McCorkle, 1986; Mathias-Mundy and McCorkle, 1995). munosuppressive drugs. HIV-positive patients strongly con- Both human and animal mycoses are not always success- tribute to this problem since they have developed resistence fully treated, since the available antifungal drugs are ineffec- to treatment with ﬂuconazole, the most currently used anti- tive, produce many adverse effects, show recurrence, or lead fungal (Groll et al., 1996; Denning et al., 1997; Portillo et al., to the development of resistance. There is a general consen- 2001; Schmourlo et al., 2005). sus that new antifungal agents which overpass these disadvantages are strongly needed (Selitrennikoff, 2001). Although most antibiotics in clinical use have been ob- ∗ Corresponding author. Tel.: +55 51 3165258; fax: +55 51 3305610. E-mail address: [email protected] (G. von Poser). tained from microorganisms, a renewed interest in plant an- 1 Tel.: 55 51 33166123. timicrobials in the last 20 years has been emerged. Only a very

0378-8741/$ – see front matter © 2005 Published by Elsevier Ireland Ltd. doi:10.1016/j.jep.2005.02.011 212 A.C. Stein et al. / Journal of Ethnopharmacology 99 (2005) 211–214 small fraction of the known plant species of the whole world and CEREMIC (C), Centro de Referencia Micologica,´ Fac- has been evaluated for the presence of antifungal compounds. ultad de Ciencias Bioqu´ımicas y Farmaceuticas,´ Suipacha Considering that there is a rapid rate of plant species extinc- 531, 2000 Rosario, Argentina were used: Candida al- tion, many efforts are necessary to collect and to screen plants bicans ATCC10231, Candida tropicalis C131, Saccha- in order to avoid the lost of an important source of potential romyces cerevisiae ATCC9763, Cryptococcus neoformans leads for the development of novel and environmentally safe ATCC32264, Aspergillus flavus ATCC9170, Aspergillus fu- antifungal agents. migatus ATTC26934, Aspergillus niger ATCC9029, Tri- Since the ethnoveterinary research previously carried out chophyton rubrum C110, Trichophyton mentagrophytes by Avancini (2002) indicated that “quitoco” (Pterocaulon ATCC 9972 and Microsporum gypseum C115. Yeasts were species) was useful to treat skin diseases popularly diag- grown on Sabouraud-chloramphenicol agar slants, for 48 h at nosed as mycoses in animals (although frequently they can 30 ◦C. be caused by both fungus and bacteria), we decided to test three Pterocaulon species native to southern Brazil: 2.4. Antifungal susceptibility testing Pterocaulon alopecuroides, Pterocaulon balansae and Pte- rocaulon polystachyum (Asteraceae) in order to evaluate The minimal inhibitory concentration (MIC) of each ex- their antifungal properties. The genus Pterocaulon encloses tract was determined by using broth microdilution techniques various species used in traditional medicine in different as described by the National Committee for Clinical Labora- parts of the world and antibiotic (flavonoid and sesquiter- tory Standards for yeasts (M27-A2) (NCCLS, 2002a) as well pene) (Macleod and Rasmussen, 1999), antiviral (flavonoid) as for filamentous fungi (M 38 A) (NCCLS, 2002b)inmi- (Semple et al., 1998, 1999) and cytotoxic (dichloromethane crotiters of 96 wells. MICs values were determined in RPMI extract) (Mongelli et al., 2000) activities have been reported 1640 (Sigma, St. Louis, MO, USA) buffered to a pH 7.0 with for them. MOPS. The starting inocula were approximately 1 × 103 to 5 × 103 CFU/ml. Microtiters trays were incubated at 35 ◦C for yeasts and hialophyphomycetes and at 28–30 ◦C for der- 2. Material and methods matophyte strains in a moist, dark chamber and MICs were recorded at 48 h for yeasts and a time according to the control 2.1. Plant material fungus growth, for the other fungi. The susceptibility of the standard drugs ketoconazol, terbinafine and amphotericin B Aerial parts of Pterocaulon alopecuroides (Lam.) were defined as the lowest concentration of drug which re- D.C., Pterocaulon balansae Chodat. and Pterocaulon sulted in the total inhibition of fungal growth. polystachyum D.C. were collected in Guaiba, in March, 2003. For the assay, extracts stock solutions were two-fold The plants were identified by Nelson Matzembacker (Pro- diluted with RPMI from 800 to 0.98 ␮g/ml (final vol- grama de Pos-graduac´ ¸ao˜ em Botanica,ˆ Universidade Federal ume = 100 ␮l) and a final DMSO concentration ≤1%. A vol- do Rio Grande do Sul, Brazil). Voucher specimens (59571, ume of 100 ␮l of inoculum suspension was added to each 59572 and 59567, respectively) were deposited in the herbar- well with the exception of the sterility control where sterile ium of the Federal University of Rio Grande do Sul (ICN). water was added to the well instead. The MIC was defined as the minimum inhibitory concentration of the extract which 2.2. Preparation of plant extracts resulted in total inhibition of the fungal growth. To carry out the antifungal evaluation with broth microdi- Dried and powdered plant material (aerial parts) was lution assays, concentrations of extracts up to 1000 ␮g/ml submitted to two distinct extraction processes. The to- were incorporated into the growth media following the guide- tal methanolic crude extracts (TMCE) of Pterocaulon lines of NCCLS. Extracts with MICs ≤ 800 ␮g/ml were con- alopecuroides, Pterocaulon balansae and Pterocaulon sidered active. polystachyum (100 g) were prepared in a drug:solvent ratio = 1:10 (w/v) by maceration (3 × 24 h), yielding 12, 14 and 13 g, respectively. Fractions were obtained extracting 3. Results and discussion successively the plant material (ca. 50 g) with n-hexane, dichloromethane and methanol over 12 h in a Soxhlet appa- The antifungal activity of the crude extracts and frac- ratus. The extracts were evaporated to dryness under reduced tions obtained with the aerial parts of three Pterocaulon pressure at 45 ◦C affording 3.5–4.5% HEX, 3.5–4.0% DCM species was evaluated in vitro against Candida tropicalis, and 4.5–6.0% MET, respectively. Saccharomyces cerevisiae, Aspergillus flavus, Aspergillus fumigatus, Aspergillus niger, Trichophyton mentagrophytes, 2.3. Microorganisms and media Microsporum gypseum, Candida albicans, Trichophyton rubrum and Cryptococcus neoformans. Results showed For the antifungal evaluation, strains from the Ameri- (Table 1) that all fungi tested were inhibited by the differ- can Type Culture Collection (ATCC), Rockville, MD, USA ent extracts (MIC values between 12.5 and 800 ␮g/ml) being A.C. Stein et al. / Journal of Ethnopharmacology 99 (2005) 211–214 213

Table 1 In vitro evaluation of the antifungal activity of different extracts of Pterocaulon species using the broth microdilution methods M27A2 and M38A recommended by NCCLS (MIC values are given in ␮g/ml) Plant Type of Extract C.a C.t S.c Cr.n A.fl A.n A.fu M.g T.r T.m Pterocaulon TMCE 100 100 50 25 400 400 400 50 50 50 alopecuroides HEX 200 100 200 100 >800 >800 >800 50 25 25 DCM 200 200 100 100 >800 >800 >800 50 25 25 MET 400 400 400 250 400 400 400 200 200 100 Pterocaulon TMCE >800 >800 >800 400 >800 >800 >800 200 200 200 interruptum HEX 100 50 50 50 400 200 400 25 12.512.5 DCM 200 200 100 100 400 400 400 100 50 50 MET >800 >800 500 250 >800 >800 >800 200 200 100 Pterocaulon TMCE 200 200 100 100 >800 >800 >800 50 50 50 polystachyum HEX 200 100 200 100 200 200 100 50 50 25 DCM >800 >800 500 100 >800 >800 >800 200 100 100 MET >800 >800 >800 >800 >800 >800 >800 250 250 250 Amphotericin B 1 0.50.50.25 0.50.50.50.125 0.075 0.075 Ketoconazole 0.50.125 0.50.25 0.125 0.50.25 0.05 0.025 0.025 Terbinafine 0.04 0.01 0.04 TMCE, total methanol crude extract; HEX, hexane extract; DCM, dichloromethane extract; MET, methanolic extract; C.a, Candida albicans ATCC 10231; C.t, Candida tropicalis C 131; S.c, Saccharomyces cerevisiae ATCC 9763; Cr.n, Cryptococcus neoformans ATCC 32264; A.fl, Aspergillus flavus ATCC 9170; A.n, Aspergillus niger ATCC 9029; A.fu, Aspergillus fumigatus ATCC 26934; M.g, Microsporum gypseum C 115; T.r, Trichophyton rubrum C113; T.m, Trichophyton mentagrophytes ATCC 9972.

Trichophyton mentagrophytes and Trichophyton rubrum the world (Evans, 1997) and the second one, an infection that most susceptible species. Interesting enough, 11/12 extracts affect 2–13% of the population worldwide and up to 30% of inhibit Candida spp. with MICs between ≤800 ␮g/ml, 8/12 groups at high risk such as elderly and people with diabetes with MICs ≤ 400 ␮g/ml, and 6/12 with MICs ≤ 200 ␮g/ml. (Levy, 1997; Gupta et al., 1998). These are relevant results since Candida albicans is the lead- The strongest antifungal activity was found in the n- ing primary agent causing superficial and often fatal dissem- hexane and chloroformic extracts, suggesting that coumarins inated infections in immunocompromised patients and Can- are the active substances. This class of natural products with dida tropicalis is one of the non-albicans Candida strains cur- recognized antimicrobial activity are the main constituents rently emerging in fungal infections (Powderly et al., 1999) of the lipophilic extracts of the Pterocaulon species investi- existing at present a renewal interest in these organism’s new gated until now (Vera et al., 2001). In fact, coumarins are fre- inhibitors, because drug resistance is quickly becoming a ma- quently found in the lipophilic fractions of plants belonging jor problem in the immunocompromised population (White to several families and have demonstrated antibacterial activ- et al., 1998). ities against microorganisms such as Staphylococcus aureus, Regarding the crude methanolic extracts, it is interest- Bacillus cereus, Bacillus subtilis and Nocardia gardenen. ing to note that Pterocaulon alopecuroides crude extract Their presence could justify the popular use of some Ptero- showed the best activity against Cryptococcus neoformans caulon species as a wound-healing agent and in the treatment (MIC = 25 ␮g/ml) which is the cause of the most com- of some infectious diseases (Avancini, 2002). mon life-threatening meningitis in HIV-positive patients In conclusion, Pterocaulon extracts possess a broad spec- (Michaels et al., 1999). This fungus, which is sensitive to trum of activity against a panel of opportunistic pathogenic some of the currently available antifungals in clinical use, fungi responsible for the most common fungal systemic, der- sometimes acquire resistance during the course of therapy, mal and mucosal infections that are usually very difficult to thus being new agents strongly needed (Powderly et al., eradicate. These promissory extracts open the possibility of 1990). finding new clinically effective antifungal compounds and Among Pterocaulon fractions, the HEX extract of Pte- give positive data regarding their use in fungal infections in rocaulon balansae showed a broad spectrum of action in- animals and human beings. hibiting all the fungi tested including Candida species dis- playing the strongest antifungal activity against Trichophyton species with MIC = 12.5 ␮g/ml. Trichophyton rubrum and Acknowledgements Trichophyton mentagrophytes are the main cause of athlete’s foot and onichomycoses in human beings, being the first This work was supported by FAPERGS, CNPq (Brazil) one, the most prevalent superficial infection in the developed and Agencia de Promociones Cient´ıficas y Tecnologicas´ de 214 A.C. Stein et al. / Journal of Ethnopharmacology 99 (2005) 211–214 la Argentina (grants to SAZ PICTR # 00260); and it is part Knowledge Systems. Intermediate Technology Publications, London, of the collaborative research within the “Bioactive Natural pp. 488–498. Products and their Applications” nucleus from the Associa- McCorkle, C., 1986. An introduction to ethnoveterinary research and development. Journal of Ethnobiology 6, 129–149. tion of Universities of the Montevideo Group (AUGM). Col- Michaels, S.H., Clark, R., Kissinger, P., 1999. Incidence and spectrum laboration from the Iberoamerican Program of Science and of AIDs defining illnesses among persons treated with antiretroviral Technology for the Development (CYTED) (Project X.7) is drugs. Clinical Infectious Diseases 29, 468–469. gratefully acknowledged. SAZ is gratefully acknowledged to Mongelli, E., Pampuro, S., Coussio, J., Salomon, H., Ciccia, G., 2000. the OEA (Project: Profit of the Regional Flora). Cytotoxic and DNA interaction activities of extracts from medicinal plants used in Argentina. Journal of Ethnopharmacology 71, 145–151. National Committee for Clinical Laboratory Standards (NCCLS), 2002a. Reference Method for Broth Dilution Antifungal Susceptibility Testing References of Yeasts, Approved Standard, vol. 22, second ed. NCCLS, Wayne, PA, pp. 1–29. Acha, P.N., Szyfres, S.B., 2003. Zoonoses and communicable diseases National Committee for Clinical Laboratory Standards (NCCLS), 2002b. common to man and animals. In: Bacterioses and Mycoses, vol. I, Reference Method for Broth Dilution Antifungal Susceptibility Test- third ed. Pan American Health Organization Scientific Publication, ing of Filamentous Fungi, Approved Standard, vol. 22, second ed. Washington, 401 pp. NCCLS, Wayne, PA, pp. 1–27. Avancini, C.A.M., 2002. Saneamento aplicado em saude´ e produçao˜ ani- Portillo, A., Vila, R., Freixa, B., Adzet, T., Canigueral,˜ S., 2001. Antifun- mal: etnografia, triagem da atividade antibacteriana de plantas nativas gal activity of Paraguayan plants used in traditional medicine. Journal do sul do Brasil Tese de doutorado, Programa de Pos-graduac´ ¸ao˜ em of Ethnopharmacology 76, 93–98. Agronomia. Universidade Federal do Rio Grande do Sul, Porto Ale- Powderly, W.G., Keath, E.J., Sokol-Anderson, M., 1990. Amphotericin B- gre, Brasil. resistant Cryptococcus neoformans in a patient with AIDS. Infectious Denning, D.W., Evans, E.G.V., Kibbler, C.C., Richardson, M.D., Roberts, Diseases in Clinical Practice 1, 314–316. M.M., Rogers, T.R., Warnock, D.W., Warren, R.E., 1997. Guide- Powderly, W.G., Mayer, K.H., Perfect, J.R., 1999. Diagnosis and treat- lines for the investigation of invasive fungal infections in haemato- ment of oropharingeal candidiasis in patients infected with HIV: a logical malignancy and solid organ transplantation. European Jour- critical reassessment. AIDS Research and Human Retroviruses 15, nal of Clinical Microbiology and Infectious Diseases 16, 424– 1405–1412. 436. Selitrennikoff, C.P., 2001. Antifungal Proteins. Applied and Environmen- Evans, E.G., 1997. Tinea pedis: clinical experience and efficacy of short tal Microbiology 67, 2883–2894. treatment. Dermatology 1, 3–6. Semple, S.J., Nobbs, S.F., Pyke, S.M., Reynolds, G.D., Flower, R.L.P., Groll, A.H., Shah, P.M., Mentzel, C., Schneider, M., Just-Neubling, G., 1999. Antiviral flavonoid from Pterocaulon sphacelatum, an Aus- Huebner, K., 1996. Trends in the postmortem epidemiology of inva- tralian aboriginal medicine. Journal of Ethnopharmacology 68, sive fungal infections at a university hospital. Journal of Infection 3, 283–288. 23–32. Semple, S.J., Reynolds, G.D., O’Leary, M.C., Flower, R.L.P., 1998. Gupta, A.K., Konnikov, N., Mac Donald, P., Rich, P., Rodger, N.V.V., Screening of Australian medicinal plants for antiviral activity. Journal Edmonds, M.W., 1998. Prevalence and epidemiology of toenail ony- of Ethnopharmacology 60, 163–172. chomycosis in diabetic subjects: a multicenter survey. British Journal Schmourlo, G., Mendonça-Filho, R.R., Alviano, C.S., Costa, S., 2005. of Dermatology 139, 665–671. Screening of antifungal agents using ethanol precipitation and bioau- Levy, L.A., 1997. Epidemiology of onychomycosis in special risk pop- tography of medicinal and foods plants. Journal of Ethnopharmacol- ulations. Journal of the American Podiatric Medical Association 87, ogy 96, 563–568. 546–550. Vera, N., Bardon,´ A., Catalan, C.A.N., Gedris, T.E., Herz, W., 2001. Macleod, J.K., Rasmussen, H.B., 1999. A hydroxy-␤-caryophyllene from New coumarins from Pterocaulon polystachyum. Planta Medica 67, Pterocaulon serrulatum. Phytochemistry 50, 105–108. 674–677. Mathias-Mundy, E., McCorkle, C., 1995. Ethnoveterinary medicine and White, T.C., Marr, K.A., Bowden, R.A., 1998. Clinical, cellular, and development: a review of the literature. In: Warren, D.M., Surrerwer, molecular factors that contribute to antifungal drug resistance. Clinical L., Broshenka, D. (Eds.), The Cultural Dimension of Indigenous Microbiology Reviews 11, 382–402. Journal of Ethnopharmacology 99 (2005) 215–220

Anti-inﬂammatory and analgesic properties of water–ethanolic extract from Pothomorphe umbellata (Piperaceae) aerial parts

Fabio F. Perazzo a,b,c, Gustavo H.B. Souza a, Walter Lopes a, Luis G.V. Cardoso b, Jose C.T. Carvalho b, N.P. Dhammika Nanayakkara c, Jairo K. Bastos a,∗

a Faculdade de Ciências Farmacêuticas de Ribeirão Preto, Universidade de São Paulo, Av. do Café s/n, Ribeirão Preto 14040-903, SP, Brazil b Laboratório de Fitofármacos, Universidade de Alfenas, Rod. MG 179, km 0, CP 23, Alfenas CEP 37130-000, MG, Brazil c National Center for Natural Products Research, School of Pharmacy, The University of Mississippi, MS 38677, USA Received 1 July 2004; received in revised form 14 January 2005; accepted 8 February 2005 Available online 12 April 2005

Abstract

Anti-inflammatory and analgesic activities as well as the median lethal dose (LD50) of water–ethanolic extract (PHE) of the aerial parts of Pothomorphe umbellata were evaluated in animal models. The ED50 (oral) for the inhibition of carrageenan-induced rat paw edema assay was determined to be 550 mg/kg, while the LD50 was higher than 2.0 g/kg. At a dose of 550 mg/kg, PHE inhibited the inflammatory process by 48.7% (P < 0.05) on the third hour of the assay (edema peak) when compared to the untreated control. Indomethacin, the positive control used in this test, inhibited the edema by 58.6% at a dose of 10 mg/kg, when compared to the untreated control (P < 0.05). All three fractions – hexane, methylene chloride and ethyl acetate – obtained by partition of PHE with respective solvents also showed inhibition of the edema induced by carrageenan over a period of 4 h but the methylene chloride fraction showed the best activity. The activity shown by the methylene chloride fraction at 200 mg/kg was comparable to that exhibited by indomethacin at a dose of 10 mg/kg. The number of writhings induced by a 0.6% acetic acid solution intraperitoneal injection was decreased by 22% (P < 0.05) in the group treated orally with Pothomorphe umbellata crude extract. PHE also inhibited the granulomatous tissue formation in rats by 6.2% (P < 0.05). In the same assay, topically applied dexamethasone decreased the granuloma formation by 14.2%. The above results suggest that Pothomorphe umbellata crude extract has analgesic and anti-inflammatory properties supporting its folkloric use for the treatment of these conditions. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Pothomorphe umbellata; Piperaceae; Anti-inﬂammatory; Analgesic; Ethanolic extract

1. Introduction and small conical flowers no more than 10 cm long (Stasi et al., 1989; Almeida, 1993; Hammer and Johns, 1993). Pothomorphe umbellata (L.) Miq. (Piperaceae) [syn. An evaluation of Pothomorphe umbellata leaves extract Heckeria umbellata (L.) Kunth., Piper umbellata L., Piper against malaria in mice has shown a significant reduction hilarianum Stend.] – known in Brazil as “caapeba”, “caapeba of parasitemia in a dose dependant manner (Amorim et al., do norte”, or “pariparoba” – has been used as an analgesic, 1988). In a subsequent study, however, results were incon- diuretic and anti-spasmodic agent, and also has been used clusive (Ferreira-da-Cruz et al., 2000). for the treatment of a variety of ailments including inflam- A extract of Pothomorphe umbellata leaves has shown matory disorders, malaria, asthma and gastro-intestinal dis- an analgesic and sedative effect in a rat model. Pothomor- eases. This is a common annual plant and found growing up phe peltata, a related species also widely used in folkloric to 1.5 m high. It has large round leaves, with thin branches medicine in Brazil, has been found to possess an analgesic effect (Pupo, 1988) and a potent anti-inflammatory property ∗ Corresponding author. Tel.: +55 16 602 4181; fax: +55 16 633 1941. against carragennan-induced edema in rats (Desmarchelier E-mail address: [email protected] (J.K. Bastos). et al., 2000). An investigation on the mutagenic effects of

Pothomorphe umbellata and Pothomorphe peltata revealed imals were provided only water ad libitum during the 12 h that both of these plants are devoid of mutagenic activity before experimentation. This study was conducted according (Felzenswalb et al., 1987). to internationally accepted principles of laboratory animal Chemical studies of Pothomorphe umbellata have led use. to the isolation of several natural compounds, including 4-nerolidylcatechol (Kijjoa et al., 1980) and N-benzoyl- 2.4. Drugs and chemicals mescaline (Isobe et al., 2002). The former has been found to have strong anti-oxidant activity (Ropke et al., 2003) and Acetic acid (Reagen Co.), kappa carrageenan type III could confer protection against photodamage in the skin, and (Iota-Fluka-Biochemica Co.), indomethacin (MSD Co.) and the latter was shown to have significant activity against He- dexamethasone (MSD Co.) licobacter pylori-induced gastric ulcers (Isobe et al., 2002). As a part of our investigation of Brazilian medicinal 2.5. Determination of the median lethal dose (LD ) plants with potential anti-inflammatory activity, we eval- 50 uated extracts of Pothomorphe umbellata leaves for anti- PHE was orally administered as a single dose to groups inflammatory and analgesic properties in animal models. of mice (n = 8) at different concentrations (500, 750, 1000, 1250, 1500 and 2000 mg/kg). These animals were observed for a 72-h period. The number of animal deaths was expressed 2. Material and methods as a percentile, and the LD50 was determined by probit a test using the death percentage versus the dose’s log (Thompson 2.1. Plant material and Weil, 1952). Leaves of Pothomorphe umbellata L. were collected in March 2003, in the campus of the University of Sao˜ Paulo, 2.6. Anti-inflammatory activity Ribeirao˜ Preto, SP,Brazil. A voucher specimen is deposited at the Botanic Department Herbarium (Universidade Estadual 2.6.1. Rat paw oedema induced by carrageenan ␮ de Campinas - Unicamp) under registration number UEC The inflammatory agent (carrageenan 1000 g/paw) was 127123. injected into the right hind paw planter surface of groups of rats (n = 8). Sterile saline solution (0.9%, 0.1 ml) was injected 2.2. Preparation of extract and fractions into the left paw as the control reference for the tested paw. The foot volumes of the animals were determined by ples- Leaves (500 g) of Pothomorphe umbellata were air dried timographic method described by Ferreira (1979). The foot at 40 ◦C, powdered and extracted by maceration with volume measurements were taken before the injections and water–ethanolic solution (4.0 l, 70.0%) during 2 days. The then at hourly intervals for 4 h after the injection of the in- macerate was filtered, and the extraction procedure repeated flammatory stimulus. This method was used to evaluate the twice. The concentration of the combined extracts under effectiveness of PHE and its fractions in the inhibition of the reduced pressure furnished 112 g (yield 22.47%) of crude inflammatory process by comparison with the control and water–ethanolic extract (PHE). The crude dried extract was the standard drug indomethacin. The results were obtained suspended in 3% Tween 80, 0.9% saline solution just before by measuring the volume difference between the right and the the administration to animals. left paws in comparison to both the negative control group, The water–ethanolic extract was fractionated by parti- treated with saline solution, and the positive control, treated with indomethacin. tion between MeOH:H2O 9:1 and hexanes, methylene chloride and ethyl acetate, sequentially. The dried hexane (Hex), methylene chloride (DCM) and ethyl acetate (EtOAc) ex- 2.6.2. Determination of ED50 and comparison of PHE tracts yielded 9.78 g (1.95%), 7.45 g (1.49%) and 12.40 g and its fraction with indomethacin (2.48%), respectively. Groups of rats (n = 8) were treated orally with Pothomor- phe umbellata crude extract (PHE) (100, 200, 300, 400, 500, 2.3. Animals 600, 700, 800, 900 and 1000 mg/kg) 30 min before the injection of the stimulus (carrageenan 1000 ␮g/paw) into the right Male rats (Rattus norvegicus, albinus, Wistar) and male hind paw plantar surface. The inhibition of inflammation was mice (Mus musculus, albinus, Swiss), specific pathogen free, calculated by measuring the volume difference between the weighing 150–200 and 20–25 g, respectively, were acquired right and left paws in comparison with the control group. from the Central Biotery of Universidade de Sao˜ Paulo. The ED50 was determined from the curve drawn for the percent- animals were kept in polyethylene boxes (n = 5), in a cli- age of edema inhibition as a function of the dose (Carvalho matic environment (23 ± 2 ◦C), with air humidity control, in et al., 1999). 12 h/shifts with dark/light control, with food and water ad The same procedure was used to compare Pothomor- libitum, for at least 7 days before the experiments. The an- phe umbellata crude extract (PHE) to the indomethacin F.F. Perazzo et al. / Journal of Ethnopharmacology 99 (2005) 215–220 217 and untreated control. The ED50 of PHE (550 mg/kg), indomethacin (10 mg/kg, p.o.) and 0.9% saline solution (0.5 ml, p.o.) were administered orally 30 min before the injection of carrageenan and inhibition of inflammation was determined. Similarly, the Hex, DCM and EtOAc extracts (200 mg/kg, p.o.), obtained by a solvent partition of PHE, were compared with indomethacin (10 mg/kg, p.o.) and 0.9% saline solution (0.5 ml, p.o.).

2.7. Writhing test

The writhing test was carried out as described by Koster Fig. 1. Determination of the effectiveness dose 50. Each point represents et al. (1959). Groups of mice (n = 8) were treated with the average of eight animals, expressed as inhibition percentile. Pothomorphe umbellata crude extract (550 mg/kg, p.o.), indomethacin (10 mg/kg, p.o.) and 0.9% saline solution (0.5 ml, ner (correlation coefficient r = 0.9809 and linear regres- p.o.). The muscular contraction was induced by an intraperi- 2 sion y = −9E−05x + 0.13x + 5.91). ED50 was determined toneal injection of 0.6% acetic acid solution (0.25 ml/animal) as 555.0 mg/kg (Fig. 1). In the acute toxicity assay, no 30 min after the treatment. The number of muscular contrac- deaths were observed during the 72-h period at the doses tions was counted starting 5 min after injection for a period tested. At these doses, the animals showed no stereotypi- of 20 min. Data represent the average of the total writhes cal symptoms associated with toxicity, such as convulsion, observed. ataxy, diarrhoea or increased diuresis. The median lethal dose (LD ) was determined to be higher than highest dose tested, 2.8. Granulomatous tissue induction 50 2.0 g/kg. This assay was described by Meier et al. (1950), Swingle and Shideman (1972) and Niemegeers (1975). Three groups 3.2. Carrageenan-induced rat paw edema of rats (n = 8) were used. Pellets weighing approximately 40 mg each were made with 5 mm of dental cotton tampons. There was a significant reduction (P < 0.05) in carra- The pellets were sterilized and impregnated with 0.4 ml ampi- geenan-induced rat paw edema at 550 mg/kg dose of PHE and cillin water solution at the moment of implantation. Animals at 10 mg/kg of indomethacin, over a period of 4 h (Fig. 2). were anaesthetized, and the pellets were subcutaneously in- The obtained fractions from the crude ethanol extract also troduced through an abdominal skin incision. Each group inhibited significantly (P < 0.05) the treated groups during a was treated daily, for six consecutives days, with 0.5 ml, p.o. 4-h period. of Pothomorphe umbellata crude extract (550 mg/kg daily), The treatment with PHE inhibited the formation of the dexamethasone (2 mg/kg, topically) or distilled water (0.5 ml, edema by 48.7% in the third hour of experimentation (peak p.o.). On the seventh day, the animals were sacrificed, the pel- of edema formation). This result is quite similar to the one lets dissected out and granulomas dried at 60 ◦C overnight to observed for the group treated with indomethacin, which in- determine the dried weight. The difference between the ini- hibited edema formation by 58.6%. Both results are statis- tial and final weights was considered as the weight of the granulomatous tissues produced.

2.9. Statistical analysis

The statistical analyses were done using Analysis of Variance (ANOVA) followed by the Tukey–Kramer multiple comparison test (Sokal and Rohlf, 1995). Results with P < 0.05 were considered to be signiﬁcant. Data are expressed as mean ± S.D.

3. Results

3.1. Effectiveness and lethal median dose (ED50 and LD ) Fig. 2. Effect of p.o. administration of PHE (550 mg/kg) and indomethacin 50 (10 mg/kg) on the paw edema induced by an intraplantar carrageenan injection (1000 ␮g/paw) over a 4-h period in different groups f rats (n = 8). The treatment with PHE produced a reduction of the Data are expressed as mean ± S.D. *P < 0.05, ANOVA followed by the edema induced by carrageenan in a dose-dependent man- Tukey–Kramer multiple comparison test. 218 F.F. Perazzo et al. / Journal of Ethnopharmacology 99 (2005) 215–220

Fig. 3. Effect of p.o. administration of PHE fractions (200 mg/kg of Hex, Fig. 4. Effect of p.o. administration of PHE (550 mg/kg) and indomethacin DCM and EtOAc fractions) and indomethacin (10 mg/kg) on the paw edema (10 mg/kg) in writhing induced in groups of mice (n = 8) by an intraperitoneal induced by an intraplantar carrageenan injection (1000 ␮g/paw) in different injection of 0.6% acetic acid. Data are expressed as mean ± S.D. *P < 0.05, groups of rats (n = 8). Data are expressed as mean ± S.D. *P < 0.05, ANOVA **P < 0.01, ANOVA followed by the Tukey–Kramer multiple comparison followed by the Tukey–Kramer multiple comparison test. test. tically significant compared to the control, but not between Table 1 them. In the second and fourth hours of experimentation, Effect of Pothomorphe umbellata crude hydroethanolic extract on cotton the treatment with PHE decreased the edema formation by pellet-induced granuloma pouch in rats 55.3% and 46.6%, respectively. The group treated with in- Treatment Mean weight of domethacin showed the best activity, decreasing the edema granuloma (mg) formation by 61.6% and 60.2%, respectively, after the same Control 352.85 ± 12.54 ± * period following the treatment. Both treatments were sig- Pothomorphe umbellata extract (550 mg/kg) 306.80 10.75 Topic applied dexamethasone (0.2 mg/kg) 280.16 ± 13.70** nificantly different from the control group, but not between ± * ** them. Data represent the mean S.D. (n = 6). P < 0.05, P < 0.001, significant as compared to the control. Data are expressed as mean ± S.D. (n = 8). In adittion, the three organic fractions obtained from PHE *P < 0.05, **P < 0.01, ANOVAfollowed by the Tukey–Kramer multiple com- (Hex, DCM and EtOAc) also produced an inhibitory ef- parison test. fect at 200 mg/kg dose on the carrageenan-induced edema in the third hour. The methylene chloride fraction inhibited 4. Discussion the inflammatory process by 44% when compared to the control (P < 0.01). This was comparable to the effect ob- Different preparations made from Pothomorphe umbellata served for indomethacin at 10 mg/kg, which inhibited the are commonly used in ethnobotanical practices for the treat- edema by 49%. The Hex fraction inhibited the inflamma- ment of inflammation in the Amazon region in Brazil (Stasi et tion by 25% (P < 0.05) and the ethyl acetate fraction inal., 1989). In this study, we evaluated the safety and efficacy of hibited it by 27% (P < 0.05) compared to the control group a water–ethanol extract of leaves of this species. ED50 of PHE (Fig. 3). was established as 550 mg/kg by a carrageenan-induced paw edema assay. Using acute toxicity assay, the median lethal 3.3. Writhing test dose, LD50, was determined to be higher than 2.0 g/kg. In this assay, neither deaths nor symptoms associated with toxi- ± PHE (32.14 5.36 writhes) as well as indomethacin city, such as convulsion, ataxy, diarrhoea or increased diure- ± (29.28 4.38 writhes) (P < 0.05) were effective in inhibiting sis occurred during the 72-h observation period. These results the writhings in mice when compared to the control group indicate the effectiveness and relative safety of PHE for the ± (41.14 5.42 writhes). The treated groups did not show a treatment of conditions associated with inflammation. significant difference between them. These results are shown Carrageenan-induced edema has been commonly used in Fig. 4. as an experimental animal model for acute inflammation and is believed to be biphasic. The early phase (1–2 h) 3.4. Granuloumatous tissue induction of the carrageenan model is mainly mediated by histamine, serotonin and increased synthesis of prostaglandins Daily administration of PHE (550 mg/kg, p.o) inhibited in the damaged tissues surroundings. The late phase is sus- the formation of granulomatous tissue by 6.2%, in compar- tained by prostaglandin release and mediated by bradykinin, ison to the control group (P < 0.05). Moreover, the topically leukotrienes, polymorphonuclear cells and prostaglandins applied dexamethasone reduced its formation by 8.5% in produced by tissue macrophages (Brito and Antonio, 1998). comparison to PHE (P < 0.01) and by 14.2% when compared The inhibitory activity shown by the extract of Pothomor- to the control group (P < 0.001). These results are expressed phe umbellata leaves (550 mg/kg) over a period of 4 h in in Table 1. carrageenan-induced paw inflammation was quite similar to F.F. Perazzo et al. / Journal of Ethnopharmacology 99 (2005) 215–220 219 that exhibited by the group treated with indomethacin. These Acknowledgements results indicate that it acts in later phases, probably involv- ing arachidonic acid metabolites, which produce an edema We are grateful to Fundacao Coordenacao de Aperfeicoa- dependent on neutrophils mobilization (Just et al., 1998). mento de Pessoal de Nivel Superior (Capes – CBE/PDEE The intraperitoneal administration of agents that irritate 00012/2003, Processo BEX 2824/03-5) for the “Sandwich serous membranes provokes a stereotypical behavior in mice Program” scholarship. We are also thankful to Dr. Warren and rats which is characterized by abdominal contractions, Hill Kelly (Olemiss Writing Center) for the English revision movements of the body as a whole, twisting of dorsoabdom- of this manuscript and Carlos Henrique Cenzi for technical inal muscles, and a reduction in motor activity and coordina- support. tion (Bars et al., 2001). The quantification of prostaglandins by radioimmunoassay in the peritoneal exudates of rats obtained after the intraperitoneal injection of acetic acid demon- References strated high levels of prostaglandins PGE2␣ and PGF2␣ dur- Almeida, E.R., 1993. Plantas Medicinais Brasileiras. Real Produçoes˜ ing 30 min after stimulus (Deraedt et al., 1980). It should be Graficas,´ pp. 120–121. taken into consideration that the mechanism involved in the Amorim, C.Z., Flores, C.A., Gomes, B.E., Marques, A.D., Cordeiro, R.S., genesis of the carrageenan-induced edema can cause the re- 1988. Screening for anti-malarial activity in the genus Pothomorphe. lease of prostaglandins and kinins, among other substances Journal of Ethnopharmacology (Lausanne) 4, 101–106. (Garcia-Leme et al., 1973). The writhing test has shown re- Bars, D., Gozariu, M., Cadden, S.W., 2001. Animal models of nocicep- tion. Pharmacological Reviews 53, 597–652. sults similar to that obtained in the edematogenic assay using Brito, A.R.M.S., Antonio, M.A., 1998. Oral anti-inflammatory and anti- carrageenan. ulcerogenic activities of a hydroalcoholic extract and partitioned frac- The granuloumatous tissue induction is a widely used tions of Turnera ulmifolia (Turneraceae). Journal of Ethnopharmacol- method for the assessment of anti-inflammatory substances ogy 61, 215–228. (Swingle and Shideman, 1972). For that, the topically ap- Carvalho, J.C.T., Sertie, J.A.A., Barbosa, M.V.J., Patr´ıcio, K.C.M., Ca- puto, L.R.G., Sarti, S.J., Ferreira, L.P., Bastos, J.K., 1999. Anti- plied dexamethasone treatment was the most effective, due inflammatory activity of the crude extract from the fruits of Pterodon to phospholipase A2 inactivation (Flores et al., 1993). emarginatus Vog. Journal of Ethnopharmacology 64, 127–133. The solvent partition of PHE by using three organic sol- Cuzzocrea, S., Riley, D.P., Caputi, A.P., Salvemini, D., 2001. Antioxidant vents yielded three fractions and all of them showed an therapy: a new pharmacological approach in shock, inflammation, and inhibitory effect on the carragennan-induced edema assay. ischemia/reperfusion injury. Pharmacological Reviews 53, 135–159. Deraedt, R., Jouquey, S., Delevallee, F., Flauhaut, M., 1980. Release of Moreover, the methylene chloride fraction showed the best prostaglandins E and F in an algogenic reaction and its inhibition. activity, indicating that active compounds are concentrated European Journal of Pharmacology 61, 17–24. in this fraction. The methylene chloride fraction inhibited the Desmarchelier, C., Mongelli, E., Coussio, J., Ciccia, G., 1997. Inhibition inflammatory process by 44% at 200 mg/kg when compared of lipid peroxidation and iron (II)-dependent DNA damage by extracts to the control group. This effect was comparable to that ob- of Pothomorphe peltata (L.) Miq. Brazilian Journal of Medical and Biological Research 30, 85–91. served for the group treated with indomethacin (10 mg/kg). Desmarchelier, C., Slowing, K., Ciccia, G., 2000. Anti-inflammatory ac- Regarding the active compounds previously described in this tivity of Pothomorphe peltata leaf methanol extract. Fitoterapia 71, species, Kijjoa et al. (1980) described the presence of sitos- 556–558. terol and 4-nerolidylcatechol in the leaves of this plant as Felzenswalb, I., Valsa, J.O., Araujo, A.C., Alcantara-Gomes, R., 1987. major compounds. Navarro et al. (2001) described the anti- Absence of mutagenicity of Pothomorphe umbellata and Pothomorphe peltata in the Samonella/mammalian microsome mutagenicity assay. inflammatory and immunomodulating effects obtained from Brazilian Journal of Medical and Biological Research (Ribeirao˜ Preto) the acetone extract from Sideritis foetens, which contains 20, 403–405. about 60% of the sterol mixture (campesterol, stigmasterol Ferreira, S.H., 1979. A new method for measuring variations of rats paw and ␤-sitosterol). Nevertheless, it is well known that inflam- volumes. Journal of Pharmacy and Pharmacology 31, 648. mation sites present a high concentration of free radicals, and Ferreira-da-Cruz, M., Adami, Y.L., da Espinola-Mendes, E., Figueiredo, M.R., Daniel-Ribeiro, C.T., 2000. The intraperitoneal Plasmodium anti-oxidant compounds can be helpful to avoid this process. berghei-Pasteur infection of Swiss mice is not a system that is able to The other major compound present in the leaves of Pothomor- detect the antiplasmodial activity in the Pothomorphe plant extracts phe umbellata, 4-nerolidylcatechol, has been proven to have a that are used as antimalarials in Brazilian endemic areas. Experimental high anti-oxidant potential, inhibiting Fe(II)-dependent DNA Parasitology 94, 243–247. damage and scavenging peroxyl radicals (Desmarchelier et Flores, C.A., Zappellini, A., Prado-Franceschi, J., 1993. Lipoxygenase- derived mediators may be involved in in vivo neutrophil migration al., 1997) and to confer protection against photodamage in induced by Bothrops erythromelas and Bothrops alternatus venoms. the skin (Ropke et al., 2003). Also, Cuzzocrea et al. (2001) Toxicon 31, 1551–1559. have shown that anti-oxidant therapy is a new pharmacolog- Garcia-Leme, J., Nakamura, L., Leite, M.P., Rocha e Silva, M., 1973. ical approach to inflammatory diseases. Pharmacological analysis of the acute inflammation process induced Based on the results obtained in this study, we can suggest in rat’s paw by local injection of carrageenan and heating. British Journal of Pharmacology 64, 91–98. that the extracts of Pothomorphe umbellata leaves possess an Hammer, M.L.A., Johns, E.A., 1993. Tapping an Amazonian plethora: anti-inflammatory property supporting its folkloric use in the four medicinal plants of Marajo Island, Para (Brazil). Journal of treatment of inflammatory disorders. Ethnopharmacology 40, 53–75. 220 F.F. Perazzo et al. / Journal of Ethnopharmacology 99 (2005) 215–220

Isobe, T., Ohsaki, A., Nagata, K., 2002. Antibacterial constituents against Pupo, A.S., 1988. Estudo do efeito analgesico´ de plantas medicinais da Helicobacter pylori of Brazilian medicinal plant, pariparoba. Yaku- fam´ılia Piperaceae. Monografia, UNESP, Botucatu. gaku Zasshi 122, 291–294. Ropke, C.D., Meirelles, R.R., da Silva, V.V., Sawada, T.C.H., Barros, Just, M.J., Recio, M.C., Giner, R.M., Cullar, M.J., Manez, S., Bilia, A.R., S.B.M., 2003. Pothomorphe umbellata extract prevents ␣-tocopherol 1998. Anti-inflammatory activity of unusual Lupane saponins from depletion after UV-irradiation. Photochemistry and Photobiology 78, Bupleurum fruticescens. Planta Medica 64, 404–407. 436–439. Kijjoa, A., Giesbrecht, A.M., Akisue, M.K., Gottlieb, O.R., Gottlieb, H.E., Sokal, R.R., Rohlf, F.J., 1995. Biometry: The Principles and Practice of 1980. 4-nerolidycatechol from Pothomorphe umbellata. Planta Medica Statistics in Biologial Research, 2nd ed. (Freeman) Campbell, R.C., 39, 85–87. pp. 175–205; 404–486. Koster, R., Anderson, M., DeBeer, E.J., 1959. Acetic acid analgesic Stasi, L.C., Santos, E.M.C., Moreira dos Santos, C., Hiruma, C.A., screening. Federation Proceedings 18, 418–420. 1989. Plantas medicinais na Amazonia.ˆ UNESP, Sao˜ Paulo, pp. 39– Meier, R., Schuler, W., Desaullles, P., 1950. Zur Frage des Mechanismus 40. der Hemmung des Bindegewebswachstums durch Cortisone. Experi- Swingle, K.F., Shideman, F.E., 1972. Phases of the inflammatory response entia (Basel) 6, 469–471. to subcutaneous implantation of a cotton pellet and their modification Navarro, A., De Las Heras, B., Villar, A., 2001. Anti-inflammatory and by certain anti-inflammatory agents. The Journal of Pharmacology and immunomodulating properties of sterol fraction from Sideritis foetens Experimental Therapeutics, 226–234. Clem. Biological Pharmaceutical Bulletin 24, 470–473. Thompson, W.R., Weil, C.S., 1952. On the construction of tables for Niemegeers, C.J.E., 1975. The activity of suprofen on nystatin-induced moving average interpolations. Biometrics 8, 51–54. paw oedema in rats. Arzneimittel-Forschung 23, 1516–1519. Journal of Ethnopharmacology 99 (2005) 221–227

Model of inhibition of Thermus aquaticus polymerase and Moloney murine leukemia virus reverse transcriptase by tea polyphenols (+)-catechin and (–)-epigallocatechin-3-gallate

Ales Tichopad a,Jurgen¨ Polster b, Ladislav Pecen c, Michael W. Pfafﬂ a,∗

a Physiology Weihenstephan, Zentralinstitut für Ernährung-und Lebensmittel-forschung, Technische Universität München, D-85350 Freising, Germany b Department für ‘Biowissenschaftliche Grundlagen’, Lehrstuhl für Biologische Chemie, FG Physikalische Chemie, Technische Universität München, Wissenschaftszentrum Weihenstephan, D-85350 Freising, Germany c First Medical Faculty of the Charles University, CZ-80200 Prague, The Czech Republic Received 18 March 2004; received in revised form 18 January 2005; accepted 11 February 2005 Available online 9 April 2005

Abstract

Non-nutritional polyphenolic compounds such as (+)-catechin and (−)-epigallocatechin-3-gallate (EGCG) are known as anticancer chemopreventive agents and have been utilised for medical purposes in form of tea drinking. Documented anticancer properties of these compounds result from their antioxidant effects. However, also direct alteration of an enzyme performance has been reported and deserves more attention. In this paper, a direct effect of catechin and EGCG on the performance of reverse transcription (RT) and/or polymerase chain reaction (PCR) was studied. Both tea polyphenolic compounds were added into real-time RT-PCR reactions and the fluorescence data obtained were fitted with a mathematical model. Several parameters of PCR performance were compared, obtained from the mathematical model for reactions with and without addition of (+)-catechin and EGCG. Addition of EGCG to enzyme reaction seems to inhibit the RT reaction (p < 0.05) and to slow down the DNA polymerase reaction (p < 0.001). Similarly, (+)-catechin inhibited the DNA amplification (p < 0.01) but had no effect on the RT reaction. The effects could be observed in physiological flavanol concentrations ranging from 10−5 to 10−8 M. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Reverse transcriptase; DNA polymerase; Catechin; EGCG; Real-time RT-PCR; Cancer

1. Introduction sides the use as a beverage, the medicinal properties of the green, black and Oolong tea were well known and utilised There are about 6000 polyphenols in nature. Their bio- by many peoples in Asia. The long-term tea drinking habit chemical and ethno-pharmacological role is understood only of Asians is believed to be responsible for lowering cancer poorly. The diverse interaction between flavanoids and cell incidence. Recently, these compounds are under intensive sci- proteins or enzymes protect the cells against a quick degra- entific focus for their assumed anticancer preventive and cu- dation. High flavan-3-ols (catechins) concentrations in leaves rative properties (Middleton et al., 2000; Lambert and Yang, and needles prevent them during autumn from fermentation 2003). However, evidence obtained from clinical trials and activities caused by microorganisms (Feucht et al., 2004). population studies, that would support such theories is con- Polyphenolic compounds such as catechins are supposed to flicting. This is often a result of confounding factor correlated be non-cytotoxic plant constituents for humans present in with tea drinking, such as smoking (Higdon and Frei, 2003). high concentrations in tea, but also in many other foods, such As chemopreventive agents, these compounds are assumed as apples, grapes, vine and their processed beverages. Be- to be able to halt or reverse the development and progression of tumour cells (Hayakawa et al., 2001; Morre et al., 2003). ∗ Corresponding author. Tel.: +49 8161 713511; fax: +49 8161 714204. It has been shown that EGCG can induce and also inhibit ex- E-mail address: pfaffl@wzw.tum.de (M.W. Pfaffl). pression of genes associated with the cancer progression and

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.jep.2005.02.021 222 A. Tichopad et al. / Journal of Ethnopharmacology 99 (2005) 221–227 apoptosis (Okabe et al., 2001; Ahn et al., 2003; Gupta et al., DNA polymerase and on the Moloney Murine Leukemia Virus 2003). Telomere shortening caused by this compound is dis- (MMLV) reverse transcriptase. cussed as well in literature (Seimiya et al., 2002) together with a possible interaction between histones and catechins (Polster et al., 2003). There is an abundant in vitro and less abundant 2. Materials and methods in vivo evidence of a direct as well as indirect antioxidant effect of the tea polyphenols and their derivatives (Wiseman 2.1. Tea polyphenols preparation et al., 1997; Henning et al., 2003; Cabrera et al., 2003). A direct effect such as the scavenging of reactive oxygen and (+)-Catechin and (−)-epigallocatechin-3-gallate (EGCG) nitrogen species is well studied. Inhibition of enzymes by were purchased from Sigma–Aldrich (Munich, Germany). tea polyphenols whose activity possibly increases oxidative Working dilution series in water of each compound to final stress in organism such as cytochromes (CYP), CYP P450 concentrations 10−5,10−6,10−7, and 10−8 M were prepared. (Muto et al., 2001) and CYP 1A1 (Schwarz and Roots, 2003) Blood concentrations of 10−6 to 10−7 M represent physiolog- is an example of the indirect antioxidant effect. ical concentrations occurring in human blood (Middleton et The risk of oncogene changes in cells is linked to poly- al., 2000; Higdon and Frei, 2003). merase enzymes, therefore, a possible interaction between polymerases, their activities and catechin compounds de- 2.2. RT and PCR reaction preparation serves interest. Such an action was described earlier (Tao, 1992), but this issue deserves surely more focus with an up- Samples of bovine liver tissue were stored immediately af- dated methodology and a greater public attention. ter its sampling in liquid nitrogen and then in −80 ◦C. Total In addition, anti-viral effects of tea polyphenolic com- RNA extraction was performed using the commercial prepa- pounds are also discussed in recent literature (Fassina et al., ration TriPure (Roche Diagnostics) utilising the single step 2002; Yamaguchi et al., 2002; Chang et al., 2003). Blocking extraction procedure according to Chomczynski (1993). The of reverse transcriptase or just its partial inhibition may be at following two approaches of RT-PCR were adopted differing least a particular explanation of anti-retroviral curative prop- in their separation of the reverse transcription (RT) reaction erties of these compounds (Fassina et al., 2002). Preparations from the polymerase chain reaction. containing tea extracts have been already successfully tested as effective anti-herpesvirus simplex drug (Kaul et al., 1985; 2.2.1. One-step real-time RT-PCR approach Namba et al., 1998). In this approach, the studied flavanol compounds were Presumably, the mutation probability in metazoan organ- added into reaction before starting the reverse transcription, isms can be approximated by the polymerase chain reaction and could thus influence it. The RT as well as the PCR (PCR) with its exponential strengthening of the polymerase were run together on the LightCycler platform (Roche Di- activity. However, using the updated RT-PCR systems, the agnostics) using the QuantiTect SYBR Green RT-PCR Kit analogy between the archeobacterial thermo-resistant DNA (Qiagen, Hilden, Germany). Prior to the PCR, the RT step polymerase and the DNA polymerase in living metazoans is was attached reverse transcribing 5 ng total RNA into cDNA. low. PCR performed on complementary DNA (cDNA) sub- The reaction was set according to the standard protocol rec- strate, obtained by reverse transcription from the total RNA ommended by manufacturer (Qiagen). The master-mix was or mRNA, is a routinely used tool in expression analysis in prepared as follows: 5 ␮l QuantiTect SYBR Green RT-PCR a lot of laboratories today. Either for amplification of sub- Master Mix, 0.5 ␮l forward primer (1 ␮M), 0.5 ␮l reverse strate aimed for later analysis, or as a direct precise analyt- primer (1 ␮M) and 0.1 ␮l QuantiTect RT Mix. 6.1 ␮lof ical tool, PCR offers fast, easy and cheap way to quantify master-mix was filled in glass capillaries and a 2.9 ␮lwa- and classify selected sequences of nucleic acids. In the real- ter containing 5 ng total RNA was added as RT-PCR tem- time PCR, not only final data on the quantity, but also data plate. Finally, always 1 ␮l water containing varying concen- on the whole PCR kinetic performance is available (Wittwer tration of one of the two studied compounds was added et al., 1997). This additional information reports about the into each capillary so that the final concentrations 10−5, reaction system itself. Mathematical approximation of this 10−6,10−7, and 10−8 M were achieved. Primers were de- data by suitable model yields characteristic parameters of signed and purchased from MWG Biotech (Ebersberg, Ger- reaction kinetics. These parameters can be then compared many) to amplify 359 bp long cDNA fragment of bovine between samples with experimental manipulation and con- tumour necrosis factor alpha (TNF␣), according to the lit- trol samples (Tichopad et al., 2002, 2003). Thus, an attempt erature (Wittmann et al., 2002). Capillaries with samples was started to simulate the reaction kinetics of the DNA poly- were closed, centrifuged and placed into a cycling rotor. merase (Wittwer et al., 1997) by real-time PCR on the Light- A five-step experimental run protocol was used consist- Cycler instrument (Roche Diagnostics, Basel, Switzerland). ing of (1) RT step (20 min at 50 ◦C), (2) denaturation step Additionally, the efficiency of the reverse transcriptase (RT) (15 min at 95 ◦C); (3) amplification and quantification step could be estimated. In this way, the influence of (+)-catechin repeated 45 times (15 s at 94 ◦C; 10 s at 60 ◦C; 20 s at and EGCG could be assessed on the Thermus aquaticus (Taq) 72 ◦C; 5 s at 80 ◦C with a single fluorescence measure- A. Tichopad et al. / Journal of Ethnopharmacology 99 (2005) 221–227 223 ment); (4) melting curve step (60–99 ◦C) with a heating rate of 0.1 ◦C/s and a continuous measurement (Ririe et al., 1997); (5) fast cooling step down to 40 ◦C. Each concentration of one of the two studied flavanol compound was run in triplicate. In total four flavanol concentrations, three replicates, two compounds either (+)-catechin or EGCG (each n = 12) plus eight control capillaries with reaction mix but without any flavanol were run in a single real-time RT-PCR run so that no random inter-run effect was introduced into the experiment.

2.2.2. Two-step RT real-time-PCR approach In this approach, the mRNA was reverse transcribed with the MMLV reverse transcriptase into cDNA separately on another platform (TGradient, Biometra, Gottingen,¨ Germany). The studied flavanols were added after the RT reaction. The Fig. 1. Real-time fluorescence history of two-step RT-PCR with flavanol − two-step RT real-time PCR was employed additionally to treatment. (--) Control group; (-᭹-) 10 6 M (+)-Catechin treatment; (-᭹-) study the effect of flavanol exclusively on the polymerase re- dotted baseline is no template water control. Inlay: four-parametric sigmoid model (described by Eq. (1)), x is the cycle number, f(x) the computed action without a possible effect on the RT. If the RT itself is function of the fluorescence at cycle x, y0 the background fluorescence, a affected, the performance of the following polymerase reac- the difference between maximal fluorescence reached at plateau phase and tion would also be altered since the cDNA concentration at background fluorescence (i.e. the plateau height), e the natural logarithm the start of the PCR differs between samples. base, x0 the co-ordinate of the first derivative maximum of the model or Within this approach the same, above-mentioned, 359 bp inflexion point of the curve, CP is the co-ordinate of the second derivative maximum of the model, calculated by the LightCycler software 3.5 (Roche TNF␣ (Wittmann et al., 2002) was amplified using the Diagnostics) and b describes the slope at x0 in the log–linear phase. LightCycler–FastStart DNA Master SYBR Green I (Roche Diagnostics). It is a ready-to-reaction mix for PCR that con- The following general scheme can be given: tains Taq DNA polymerase and DNA double-strand specific SYBR Green I dye for detection (Morrison et al., 1998). The a—high a detects high real-time PCR product obtained after polyphenols were added into PCR reaction diluted in varying all cycles; concentration in 1 ␮l water. The concentrations of both com- b—low b detects high polymerase reaction efficiency pounds present in the PCR were the same like in the one-step (Tichopad et al., 2003); approach. Triplicate design with eight additional control re- x0—high x0 detects delay in the detectable phase of the actions was adopted as well as in the one-step approach. All reaction, comparable to CP; 32 samples were performed within one run. y0—high y0 detects high RT product obtained.

2.3. Statistical analysis Further parameter analysed was the crossing point (CP), which is also named Ct value. The parameter CP is not a Using SigmaPlot software (SPSS Inc., Illinois, USA) the part of the four-parametric sigmoid model but can be ob- four parametric sigmoid model (Tichopad et al., 2002), ac- tained by differentiation of the corresponding Eq. (1).Itisa cording to Eq. (1), was used to fit the fluorescence raw data central term of the real-time PCR quantification (Wittwer et observations (Fig. 1) generated by LightCycler software ver- al., 1997; Rasmussen, 2001). In brief, CP gives the number sion 3.5 (Roche Diagnostics). of PCR cycles at which the fluorescence generated by PCR a product reaches a defined fluorescence level. In this sense, it f (x) = y0 + (1) is a direct measure for the initial concentration of nucleic acid + −(x−x0/b) 1 e in the sample. This threshold level can be set by user subjec- In total, 64 reaction kinetics curves were obtained by fit- tively or it is based on an exact computing algorithm. The ting the fluorescence raw data of each single sample with the CP applied within this paper was obtained direct from Light- model. In the four-parametric sigmoid model, x is the cycle Cycler software version 3.5 (Roche Diagnostics) based on a number, f(x) the computed function of the fluorescence in de- special computation method (Wittwer et al., 2001), where CP pendence of cycle number x, y0 the background fluorescence, is placed into the positive maximum of the second derivative a the difference between maximal fluorescence reached at of the curve (Fig. 1), computed on smoothed PCR fluores- plateau phase and background fluorescence (i.e. the plateau cence data. Thus, CP denotes the second derivative maximum height), e the natural logarithm base, x0 the co-ordinate of and x0 is the first derivative maximum, of the described math- the first derivative maximum of the model or inflexion point ematical model. CP gives information similar to x0, and is less of the curve, and b describes the slope at x0 in the log–linear influenced by reaction inhibitors and inhomogenities, like the phase. PCR efficiency (parameter b; Tichopad et al., 2003). 224 A. Tichopad et al. / Journal of Ethnopharmacology 99 (2005) 221–227

In the two-step RT-PCRreaction the y0 parameter becomes irrelevant for the analysis since it reflects only the pipetting error and the background noise of the measuring optic system of the LightCycler. In the one-step approach, parameters a, b, x0 and CP were analysed together with the y0 parameter. Here, the higher y0 the higher the cDNA synthesis efficiency of the previous RT reaction was. This parameter becomes an interesting hint to assume RT efficiency, provided, the one- step approach was employed. All further statistics was done using the SAS 8.02 software. Effect of the flavanols was inspected for all model parameters. Comparison of samples with one of the two flavanols versus control group was carried out. The one-way ANOVA test was employed, testing, whether there are differences between the samples containing a special flavanol (each n = 12) and the control group (n = 8). The differences between dilution steps of flavanol added into samples were Fig. 2. Effect of EGCG on RT reaction parameter y0 presented in log transformation on PCR reaction parameter b. The first box represents eight reac- disregarded in the model. The ANOVAmodel was reduced to tions with no EGCG added. Following boxes of n = 3 represent reactions with the present/absent character. The applied measurement taken various concentration of EGCG added. The length of the box represents the as the dilution steps of factor 10 was too great and the assump- interquartile range (the distance between the 25th and the 75th percentiles), tion of dilution response would thus weaken the test’s differ- the solid line interior represents the mean and the thin line in the box interior entiation between groups with present and absent flavanol. represents the median. Since the statistical design was heavily unbalanced, the procedure generalised linear model (GLM) was employed. Data steep exponential phase and sudden plateau termination of the was plotted and visually inspected (not all figures shown). reaction, resulting in a high plateau phase (compare Fig. 1). A table of p-values for parameters of the sigmoidal model Inspection of the melting curve of the amplification product was established (Table 1). Statistical probability of obtaining showed no side products generated during the reaction (e.g. results with p < 0.05 was considered significant. Where sig- primer-dimers). nificant statistics was obtained a short comment was given The four-parametric sigmoid model could tightly fit the 2 (Table 1). fluorescence data (r > 0.999, n = 64) and thus produced reliable model parameters for the further estimation. These parameters were subsequently compared between the con- 3. Results trol group and the positive samples, employing the one- way ANOVA test (Table 1). Before employing the one-way Modified extraction procedure of the total RNA from ANOVA test the data was checked for the Gaussian distribu- bovine samples according to Chomczynski (1993) could pro- tion and equal variance between groups. Where this condition duce highly pure RNA extract with high integrity as inspected was fulfilled computation of the one-way ANOVA test was by electrophoresis and melting curve inspection (Ririe et al., performed directly on the data. Often, no linear trend in the 1997). The RT as well as the PCR reaction showed a good model parameters corresponded to the dilution series (Fig. 2) performance and gave a typical shaped sigmoidal curve with a or the error distribution within the dilution groups was heavily

Table 1 The signiﬁcance of the alteration of parameters by EGCG and (+)-catechin in one-step and two-step real-time RT-PCR approach

abx0 y0 CP (A) One-step approach Catechin p-value 0.8052 0.1858 0.9416 0.4086 0.5315 The addition of agent causes –––– – EGCG p-value 0.1051 0.5921 0.6113 0.0294 0.5171 The addition of agent causes –––LowerRTproduct –

abx0 CP (B) Two-step approach Catechin p-value 0.0815 0.0015 <0.0001 0.8843 The addition of agent causes – Decrease of PCR efﬁciency Delay of PCR – EGCG p-value 0.0919 0.777 <0.0001 <0.0001 The addition of agent causes – – Delay of PCR Delay of PCR

a, b, x0, y0 are the parameters of the four-parametric sigmoid model and CP is the fundamental parameter of the real-time PCR quantification. Significantly altered parameters are indicated. Beneath the respective significant p-value a comment on the impact of the finding on the reaction is given. A. Tichopad et al. / Journal of Ethnopharmacology 99 (2005) 221–227 225

reverse transcriptase performance in addition of two tea flavanol compounds (+)-catechin and EGCG using real-time PCR with reverse transcribed mRNA (Wittwer et al., 1997; Ririe et al., 1997; Rasmussen, 2001). This experimental model with both enzymes was just a rough approximation of biological conditions in a real cell. We compared several reaction trajectories obtained with or without the addition of these two flavanol compounds. Monitoring the reaction kinetics of real-time PCR or/and real-time RT-PCR (Wittwer et al., 1997) is a possible way to study the performance of a DNA polymerase and also reverse transcriptase under various conditions. If a suitable mathematical model is applied to fit the reaction history a quantitative analysis of the reaction kinetics is possible (Tichopad et al., 2002). The one-step real-time RT-PCR approach applied here fa- Fig. 3. Effect of (+)-catechin on PCR reaction parameter b (direct reaction cilitated the look at effect of added agents on the performance efficiency presented in log transformation). of the RT reaction and the reverse transcriptase enzyme in particular. An effect of EGCG on the one-step RT-PCR was unequal (Fig. 3). For this reason, no linear regression analy- significantly present as decrease of final cDNA product after sis or adjustment to the dilution-covariate (ANCOVAmodel) RT reaction. This showed that EGCG inhibits processes such was performed. Figs. 2 and 3 were chosen to demonstrate the as retroviral reproduction directly on the reverse transcrip- difference between the control group and groups with vari- tion level. This is in accordance with reported anti-retroviral ous concentrations of the two compounds. They also show the properties of EGCG and other flavanol compounds in cell error distribution and the pattern of the concentration effect. and tissue cultures (Tao, 1992; Fassina et al., 2002). The effect of EGCG on the RT reaction was statistically As the in vitro experiments herein were very restrictive, significant (p = 0.029) and caused a lower RT product yielded with relatively few reactants in comparison to complex con- (Table 1). The decrease of the y0 value due to EGCG addition ditions in the living cell nucleus, we can assume direct effect was approximately 0.2 fluorescence units. No response to on the reverse transcriptase MMLV enzyme itself. the concentration gradient, in the form of a linear trend, was Employing the two-step RT-PCR approach, one can see an present on the data plot. effect of both compounds on the polymerase reaction. With Other parameters reflecting an effect on the subsequent (+)-catechin, the direct efficiency and the reaction delay was polymerase reaction remained unaffected. This is logical, as altered in a sense of PCR inhibition. Also with EGCG the there was no longer the same cDNA concentration in samples delay of the reaction is present and reported by change of pa- at the beginning of the polymerase reaction. This interfered rameters x0 and CP.Different model parameters are altered by with the real effects of flavanols during the following PCR adding either of the two flavanols. This could be explained cycling. Therefore the two-step approach had to be employed only partially. Each of the two compounds has possibly a to get rid of any interference with the prior RT. different saturation plateau in its inhibition of the reaction. In the two-step approach, both compounds caused very This effect may cause the kinetic curve of the PCR to have significant (p < 0.0001) delay of reaction as reflected by later a slightly different history and therefore the model param- reaching of the x0 or the CP (p < 0.0001). (+)-Catechin caused eters to shift. In all significant results obtained, there were +0.22 shift in the x0, that is, the reactions containing (+)- no alterations of the investigated parameters towards better catechin reached their first derivative maximum, in average, performance of the polymerase reaction. This is a strong indi- 0.22 cycles later. Adding EGCG into reaction caused a shift of cation that EGCG as well as (+)-catechin inhibits or just slows 0.17 for x0 and 0.27 for CP. (+)-Catechin caused additionally down the efficiency rate of PCR. Since the reaction system is a direct efficiency decrease of the reaction as reported by the relatively simple, containing just few reaction components, b parameter change of 0.04 (p = 0.0015). This decrease of we assume a direct effect on the Taq polymerase itself. efficiency was strongly linearly concentration dependent, but The range of dilution of flavanols added to the reaction the error distribution between different concentration groups was biologically relevant as to be able to inhibit the PCR was heavily unequal (Fig. 3). polymerase and RT reaction. Even low concentrations, down to from 10−5 to 10−8 M, exhibit significant inhibitory effect on the investigated enzymes, compared to untreated controls. 4. Discussion Unfortunately, no quantitative conclusion can be drawn from the used flavanols concentrations. We studied the inhibition of the Thermus aquaticus (Taq) The real-time PCR approach employed to study the per- polymerase and Moloney Murine Leukemia Virus (MMLV) formance of a polymerase reaction is not the most common 226 A. Tichopad et al. / Journal of Ethnopharmacology 99 (2005) 221–227 but surely a very sensitive one. Unfortunately, the real-time Chomczynski, P.A., 1993. Reagent for single-step simultaneous isolation PCR cannot be used quantitatively in this study, because of RNA. BioTechniques 15, 532–536. the fluorescence data is directly analysed. There is always Fassina, G., Buffa, A., Benelli, R., Varnier, O.E., Noonan, D.M., Albini, A., 2002. Polyphenolic antioxidant (-)-epigallocatechin-3-gallate from a great deal of background noise of fluorescence that is hard green tea as a candidate anti-HIV agent. AIDS 16, 939–941. to quantify. Because of this background noise it is impossible Feucht, W., Treutter, D., Polster, J., 2004. Flavanol binding of nuclei from to quantitatively express the difference between the treated tree species. Plant Cell Reproduction 22, 430–436. and the control samples. However, the model can detect very Gupta, S., Hussain, T., Mukhtar, H., 2003. Molecular pathway for (-)- sensitively each increase or decrease shift in the reaction epigallocatechin-3-gallate-induced cell cycle arrest and apoptosis of human prostate carcinoma cells. Archives of Biochemistry and Bio- system. physics 410, 177–185. The PCR can only roughly simulate the biological condi- Hayakawa, S., Saeki, K., Sazuka, Y., Shoji, Y., Ohta, T., Kaji, K., You, tions in the eukaryotic cell. The fact that the Taq polymerase M., Isemura, M., 2001. Apoptosis induction by epicatechin gallate is of archeobacterial and not of eukaryotic origin must be involves its binding to FAS. Biochemical and Biophysical Research taken into account. On the other hand, the PCR model of Communications 24, 1102–1106. Henning, S.M., Fajardo-Lira, C., Lee, H.W., Youssefian, A.A., Go, V.L., DNA replication in vivo can restrict the reaction to only few Heber, D., 2003. Catechin content of 18 teas and a green tea ex- compounds present, facilitating thus more robust interpreta- tract supplement correlates with the antioxidant capacity. Nutrition tion. Surely, more tightly focused study must be performed and Cancer 45, 226–235. to disclose whether flavanol compounds can decrease the risk Higdon, J.V., Frei, B., 2003. Tea catechins and polyphenols: health ef- of mutation during DNA replication by slowing the rate of fects metabolism and antioxidant functions. Critical Reviews in Food Science and Nutrition 43, 89–143. enzyme reaction. Kaul, T.N., Middleton Jr., E., Ogra, P.L., 1985. Antiviral effect of Further we can assume, that the applied PCR reaction with flavonoids on human viruses. Journal of Medical Virology 15, 71–79. 45 cycles is a model for cell proliferation with 45 mitoses, Lambert, J.D., Yang, C.S., 2003. Cancer chemopreventive activity where DNA is also doubled. Herein, a significant influence and bioavailability of tea and tea polyphenols. Mutation Research on polymerase activity is given. If we speculate how many 523–524, 201–208. Middleton Jr., E., Kandaswami, C., Theoharides, T.C., 2000. The effects cell cycles (with an average epithelium cell life span of a of plant flavonoids on mammalian cells: implications for inflamma- few days) are occurring in the gut epithelium during a hu- tion, heart disease, and cancer. Pharmacology Reviews 52, 673–751. man life of 75 years, we may estimate the significance of the Morre, D.J., Morre, D.M., Sun, H., Cooper, R., Chang, J., Janle, E.M., inhibitory effect of flavanols in the gut. Gastrointestinal cell 2003. Tea catechin synergies in Inhibition of cancer cell proliferation proliferation rate will be slowed down and therefore, the risk and of a cancer specific cell surface oxidase (ECTO-NOX). Pharma- cology and Toxicology 92, 234–241. of gut cancer may be markedly reduced. Morrison, T.B., Weis, J.J., Wittwer, C.T., 1998. Quantification of low-copy To conclude, employing modern and sensitive diagnostic transcripts by continuous SYBR Green I monitoring during amplifi- method, we present sensitive evidence in this paper, that the cation. BioTechniques 24, 954–958. tea flavanols (+)-catechin and EGCG can inhibit and slow Muto, S., Fujita, K., Yamazaki, Y., Kamataki, T., 2001. Inhibition by green down the DNA polymerase reaction and reverse transcrip- tea catechins of metabolic activation of procarcinogens by human cytochrome P450. Mutation Research 479, 197–206. tion. This is of concern as far as anticancer properties of this Namba, T., Kurokawa, M., Kadota, S., Shiraki, K., 1998. Development compounds are discussed. of antiviral therapeutic agents from traditional medicines. Yakugaku Zasshi 118, 383–400. Okabe, S., Fujimoto, N., Sueoka, N., Suganuma, M., Fujiki, H., 2001. − Acknowledgement Modulation of gene expression by ( )-epigallocatechin gallate in PC- 9 cells using a cDNA expression array. Biological and Pharmaceutical Bulletin 24, 883–886. The authors thank Prof. W. Feucht from the Lehrstuhl Polster, J., Dithmar, H., Feucht, W., 2003. Are histones the targets fur¨ Obstbau of the Technical University of Munich for his for flavan-3-ols (catechins) in nuclei. Biological Chemistry 384, initiating this paper and plenty of inspiring ideas. 997–1006. Rasmussen, R., 2001. Quantification on the LightCycler instrument. In: Meuer, S., Wittwer, C., Nakagawara, K. (Eds.), Rapid Cycle Real- Time PCR: Methods and Applications. Springer, Heidelberg, pp. References 21–34. Ririe, K.M., Rasmussen, R.T., Wittwer, C.T., 1997. Product differentia- Ahn, W.S., Huh, S.W., Bae, S.M., Lee, I.P., Lee, J.M., Namkoong, S.E., tion by analysis of DNA melting curves during the polymerase chain Kim, C.K., Sin, J.I., 2003. A major constituent of green tea, EGCG, reaction. Analytical Biochemistry 245, 154–160. inhibits the growth of a human cervical cancer cell line, CaSki cells, Schwarz, D., Roots, I., 2003. In vitro assessment of inhibition by natural through apoptosis, G(1) arrest, and regulation of gene expression. polyphenols of metabolic activation of procarcinogenes by humans DNA Cell Biology 22, 217–224. CYP1A1. Biochemical and Biophysical Research Communications Cabrera, C., Gimenez, R., Lopez, M.C., 2003. Determination of tea com- 303, 902–907. ponents with antioxidant activity. Journal of Agriculture and Food Seimiya, H., Oh-hara, T., Suzuki, T., Naasani, I., Shimazaki, T., Tsuchiya, Chemistry 51, 4427–4435. K., Tsuruo, T., 1991. Telomere shortening and growth inhibition of Chang, L.K., Wei, T.T., Chiu, Y.F., Tung, C.P., Chuang, J.Y., Hung, S.K., human cancer cells by novel synthetic telomerase inhibitors MST-312, Li, C., Liu, S.T., 2003. Inhibition of Epstein-Barr virus lytic cycle MST-295 and MST. Molecular Cancer Therapy 1, 657–665. by (-)-epigallocatechin gallate. Biochemical and Biophysical Research Tao, P., 1992. The inhibitory effects of catechin derivatives on the activi- Communications 301, 1062–1068. ties of human immunodeficiency virus reverse transcriptase and DNA A. Tichopad et al. / Journal of Ethnopharmacology 99 (2005) 221–227 227

polymerases. Zhongguo Yi Xue Ke Xue Yuan Xue Bao 14, 334–338. (TNF-alpha) gene expression in somatic milk cells. Milk Science In- Tichopad, A., Dilger, M., Schwarz, G., Pfaffl, M.W., 2003. Standardized ternational 57, 63–66. determination of real-time PCR efficiency from a single reaction set- Wittwer, C.T., Gutekunst, M., Lohmann, S., 2001. Method for quantifi- up. Nucleic Acids Research 31, 122. cation of an analyte. US Patent No. 6,303,305 B1. Tichopad, A., Dzidic, A., Pfaffl, M.W., 2002. Improving quantitative real- Wittwer, C.T., Ririe, K.M., Andrew, R.V., David, D.A., Gundry, R.A., time RT-PCR reproducibility by boosting primer-linked amplification Balis, U.J., 1997. The LightCycler: a microvolume multisample fluo- efficiency. Biotechnology Letters 24, 2053–2056. rimeter with rapid temperature control. BioTechniques 22, 176–181. Wiseman, S.A., Balentine, D.A., Frei, B., 1997. Antioxidants in tea. Crit- Yamaguchi, K., Honda, M., Ikigai, H., Hara, Y., Shimamura, T., 2002. ical Reviews in Food Science and Nutrition 37, 705–718. Inhibitory effects of (-)-epigallocatechin gallate on the life cycle of Wittmann, S.L., Pfaffl, M.W., Meyer, H.H.D., Bruckmaier, R.M., 2002. human immunodeficiency virus type 1 (HIV-1). Antiviral Research 5-Lipoxygenase, cyclo-oxygenase-2 and tumor necrosis factor alpha 53, 19–34. Journal of Ethnopharmacology 99 (2005) 229–237

Use of Pavo cristatus feather extract for the better management of snakebites: Neutralization of inﬂammatory reactions

Satish K. Murari a, Felix J. Frey b, Brigitte M. Frey b, There V. Gowda a, Bannikuppe S. Vishwanath a,∗

a Department of Studies in Biochemistry, University of Mysore, Manasagangothri, Mysore 570006, Karnataka, India b Division of Nephrology and Hypertension, Inselspital CH-3010, Berne, Switzerland Received 19 August 2004; received in revised form 3 February 2005; accepted 12 February 2005 Available online 11 April 2005

Abstract

In Indian traditional medicine, peacock feather in the form of ash (Bhasma) or water extract are used against snakebite and to treat various problems associated with lungs. This study was aimed to evaluate the water extract of peacock feather (PCF) against the local tissue damage caused due to snakebite. PCF water extract showed inhibition towards phospholipase A2 enzyme activity from snake venom (Naja naja and Vipera russelii), inflammatory fluids (synovial, pleural, ascites) and normal serum in a dose-dependent manner. Hyaluronidase and proteases are other major enzymes in snake venoms responsible for local tissue damage. PCF water extract inhibited hyaluronidase and proteolytic enzyme activities from Vipera russelii, Naja naja and Trimeresurus malabaricus venom. The active principle is a hydrophilic molecule easily extractable in water or polar solvents. PCF water extract gave positive results for the presence of protein and secondary metabolites like carotenoids and steroids. Analysis of metal ions revealed that iron is the major ion (>20-fold). Other metal ions detected in smaller amount are copper, chromium, zinc and nickel. The least amount of ion detected is gold. Co-injection of PCF water extract with snake venom and inflammatory PLA2 enzymes neutralize the edema inducing activity of all the PLA2 enzymes studied. Since it inhibits hyaluronidase and proteases enzyme activity from snake venom PCF water extract is a powerful neutralizing agent, which has therapeutic application against venom toxicity. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Pavo cristatus; Phospholipase A2; Hyaluronidases; Proteases; Anti-inﬂammatory activity; Synovial ﬂuid; Metal ions; Snake venom

1. Introduction of pro-inflammatory lipid mediators such as prostaglandins, leukotrienes, lipoxins and platelet activating factor (Glaser et Snake’s envenomation involves subcutaneous or intra- al., 1993). Injection of purified PLA2 enzyme from synovial muscular injection of venom into the prey/human victims. fluid and from snake venom into animal joints confirmed the The pathology of envenomation includes both local and sys- development of an acute inflammatory response with edema, temic effects (Warrell, 1996). Local effects include severe swelling of synovial cells and hyperplasia (Vishwanath et inflammatory reactions, hemorrhage and local tissue necro- al., 1988; Bomalaski and Clark, 1993). Venom proteases are sis. The venom toxins responsible for these local effects are responsible for tissue necrosis and hemorrhagic activity at phospholipase A2 (PLA2), protease and hyaluronidase en- the site of envenomation. These proteases interfere in the zymes (Chippaux et al., 1991). PLA2 enzyme plays a key blood coagulation mechanism and act either anti- or proco- role in many inflammatory reactions by releasing free arachi- agulants and are responsible for tissue damage (Weinstein et donic acid, which is the rate-limiting step for the production al., 1991; Jagadeesha et al., 2002). Hyaluronidase enzymes precede with the diffusion of target-specific toxins into sys- ∗ Corresponding author. Tel.: +91 821 2515525x52; fax: +91 821 2421263. temic circulation. Agents, which promote this process, are E-mail address: skmuom [email protected] (B.S. Vishwanath). referred to as ‘Spreading factors’. The spreading action of

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.jep.2005.02.027 230 S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237 hyaluronidase enzyme in snake venoms is through selective these enzymes can be of greater use in the management of degradation of hyaluronan in the extracellular matrix in hu- snakebite victims along with anti-venom therapy. man skin and muscle tissue sections (Escalante et al., 2000; Anai et al., 2002; Girish et al., 2004a, 2004b). The lethal systemic effects of venoms are due to the spe- 2. Materials and methods cific toxins like neurotoxins (presynaptic and postsynaptic), cardiotoxins, nephrotoxins, toxins affecting the blood clot- 2.1. Feather collection ting mechanism (procoagulants, anticoagulation and platelet aggregation), and myotoxins, which are highly specific and Pavo cristatus feather were purchased from ayurvedic induce toxicity at the target organs (Barrett, 1986; Paul, shops in local market, Mysore, India. 1993; Kini, 1997; Rosenberg, 1997; Estevao-Costa et al., 2000). The activities of these specific toxins are facilitated 2.2. Preparation of extract by hyaluronidase enzyme, which is presumed to be the critical event in spreading of toxins from the site of injection Entire Pavo cristatus feather (PCF) without shaft were cut to systemic circulation. Vasodilatation due to inflammatory into fine pieces. Feather pieces, 50 mg were taken in 2.0 ml of reactions induced by PLA2 enzyme and softening of tissue water and different buffer solutions of various molarity and and necrosis at the site of envenomation by protease enzymes pH to extract hydrophilic/water-soluble compounds. To ex- indirectly helps the easy spreading of the lethal toxins in the tract hydrophobic/organic compounds, 50 mg feather pieces systemic circulation. Inhibition of these enzyme activities were extracted with organic solvents of different polarity. The will result in the minimal tissue destruction and decreases samples were vortex-mixed vigorously for 10 min. Similar the spreading of the specific toxins into the systemic regions. extraction was carried out for individually separated coloured Incorporation of these enzyme inhibitors as a cocktail would regions of PCF as described in Fig. 1. The extracted sample complement and enhance the efficiency of anti-venom ther- was centrifuged at 20,000 × g and the clear supernatant was apy. used for further in vitro analysis. For in vivo PLA2 induced The general treatment for snakebite is the use of mono- hind paw edema, 200 mg of feather was extracted separately valent or polyvalent antiserum. These antiserums suffer in 2.0 ml of water. The extracted sample was lyophilized and from certain inherent drawbacks and do not provide pro- was re-dissolved in same volume of saline. tection against local tissue damage (Homma and Tu, 1970). Treatment of snake venom toxicity is greatly enhanced 2.3. Chemicals with a compound, which could overcome the deficiency of antiserum. A great deal of search has been focused on Escherichia coli cells and hyaluronic acid were purchased traditional medicines. Botanical cure is very well practised from Sigma-Aldrich Company. [14C] Oleic acid was ob- in Indian and Chinese medicine. Several plants recorded tained from Perkin Elmer Life Sciences Inc., USA, fatty as antidote against venoms in popular use have antidotal acid free BSA was obtained form PAA Laboratories GmbH, properties due to great number of active compounds they Austria. Scintillation cocktail were obtained from Packard contain (Duke, 1985; Bernard et al., 2001). Crude extracts Biosciences B.V. The Netherlands. Vipera russelii and Naja from the root of Aristolochia radix, Gymnema sylvestra, naja snake venoms were purchased from Haffkine Institute, Sarasparilla hemidesmus indicus and Mimosa puidca Mumbai, India. Human pleural fluid (HPF), synovial fluid exhibited anti-venom properties (Tsai et al., 1980; Kini and (SF) and serum from normal person (NS) were obtained from Gowda, 1982a, 1982b; Alam et al., 1994; Girish et al., 2004a, Mysore Medical College Hospital, Mysore. Human samples 2004b). Later the active components aristolochic acid from Aristolochia radix and Aristolochia indica, and gymnemic acid from Gymnema sylvestra plants were isolated and characterized for their anti-venom properties (Vishwanath et al., 1987; Kini and Gowda, 1982a, 1982b). From the plant extract of Eclipta prostrata, wedelolactone, sitosterol and stigmasterol neutralize the myotoxicity, hemorrhagic and coagulant properties of crotalid venoms (Mors et al., 1989; Melo et al., 1994). In Indian traditional ayurvedic medicine apart from plants, animal products are also used. In Indian folk medicine aqueous extract of peacock feather is administered orally against snakebite. However detailed scientific study in these reports are lacking. The aim of the present study is to examine the effect of various extracts of peacock feather on the potent venom enzymes Fig. 1. Pavo cristatus feather with different coloured regions marked from like PLA2, proteases and hyaluronidase. The inhibitors of 1to6. S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237 231

were collected from patient volunteers according to the guide- 2.9. Determination of secondary metabolites lines mentioned by the institutional ethics committee for biomedical research and individual signed the informed pa- Secondary metabolites in the PCF water extract were de- tient consent form. Trimeresurus malabaricus snake venom termined qualitatively as described (Vishnoi, 1985). Sec- and Ehrlich ascites fluid (EAF) was obtained from Prof. B.K. ondary metabolites tested are carotenoids, steroids, alkaloids, Sharath, Department of Biosciences and Prof. B.P. Salimath, flavonoids and triterpenes. Department of Biotechnology, University of Mysore, India. All other reagents and chemicals used were of analytical 2.10. Estimation of metal ions grade and all solvents were redistilled before use. Metal ions of PCF water extract were estimated quantita- 2.4. Animals tively by using GBC Avanta PM Atomic Absorption Spec- trophotometer. Male Swiss Wistar mice weighing 20–22 g obtained form the Central Animal House Facility, Department of Studies in 2.11. Assay of phospholipase A2 activity Zoology, University of Mysore, Mysore, India. The animal 14 care and handling were conducted in compliance with the PLA2 activity was assayed with [ C] oleate-labeled au- national regulations for animal research. The animal experi- toclaved Escherichia coli cells as substrate according to ments were carried out after reviewing, the protocols by the the published method (Rothut et al., 1983; Vishwanath et Animal Ethical Committee of the University of Mysore. al., 1993). The reaction mixture, 350 ␮l contained 100 mM Tris–HCl, pH 8.0; 5.0 mM Ca2+ and 3.15 × 109 autoclaved Escherichia coli cells (corresponding to 10,000 CPM and 2.5. Partial purification of PLA2 from inflammatory fluids and serum 60 nmol of lipid phosphorous). The amount of enzyme protein concentration was chosen such that 10–15% hydrolysis of substrate was obtained when incubated at 37 ◦C for 60 min. PLA2 was partially purified from serum and other inflam- The reaction components were mixed in the following order: matory fluids according to the previously published method 2+ (Vishwanath et al., 1996). Normal serum and other inflam- buffer, Ca , water and enzyme source (snake venom, par- matory fluids were centrifuged at 3000 × g for 10 min. Cen- tially purified PLA2 from serum and inflammatory fluids). trifuged fluids, 5.0 ml was extracted with equal volumes of The reaction was started by adding labeled Escherichia coli ␮ 0.36N sulphuric acid and kept overnight at 4 ◦C. The sul- cells. The reaction was terminated by adding 100 l of 2.0 M ␮ phuric acid was removed by dialysis (membrane with molec- HCl and 100 l of fatty acid free BSA (100 mg/ml). The tubes × ular weight cutoff of 6000–8000 Da) against 10 mM sodium were vortex-mixed and centrifuged at 20,000 g for 5 min. An aliquot (140 ␮l) of the supernatant containing released acetate buffer pH 4.5 at room temperature with minimum 14 three changes. The dialyzed samples were incubated for 5 min [ C] oleic acid was mixed with scintillation cocktail and in boiling water, resulted in the formation of a white precip- counted in a Hewlett Packard Liquid Scintillation Analyzer itate. Precipitated sample was centrifuged at 20,000 × g for TRI-CARB 2100 TR. 30 min. The supernatant was used as a source for PLA2. 2.12. Hyaluronidase assay

2.6. Estimation of protein Hyaluronidase activity was assayed by estimating the amount of N-acetyl glucosamine (NAGA) released accord- Protein content in PCF extract was measured by the ing to the method (Reissig et al., 1955). The reaction mixture method (Lowry et al., 1951), using bovine serum albumin 300 ␮l contained 200 ␮g of hyaluronan, 0.2 M sodium ac- as standard. etate buffer pH 5.0 containing 0.15 M NaCl and increasing amounts of PCF water extract pre-incubated for 5 min with 2.7. Determination of carbohydrate content by total 200 ␮g of venom samples were incubated at 37 ◦C for 90 min. sugar estimation Activity in the absence of extract was considered 100%. The change in absorbance was monitored at 585 nm. Ac- Carbohydrate content in PCF extract was determined by tivity was expressed as millimoles of N-acetyl glucosamine the phenol–sulphuric acid method (Dubois et al., 1956). Glu- released/90 min at 37 ◦C. cose was taken as the standard. 2.13. Proteolytic activity 2.8. Estimation of phenolic compounds Proteolytic activity was determined according to the Phenolic compounds in PCF extracts were determined by method (Satake et al., 1963) using 2% casein in 0.02 M the colorimetric method described (Swain and Hillis, 1959). Tris–HCl buffer pH 8.5, as substrate for venom and trypsin Phenol was used as reference standard. and 2% casein in 0.02 M citrate buffer pH 6.0 as substrate 232 S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237 for papain. Venom sample (200 ␮g each), trypsin (5 ␮g) 3.2. Inhibition of Vipera russelii PLA2 activity by PCF and papain (5 ␮g) were incubated separately with 1 ml of extract buffer substrate for 45 min at 37 ◦C. The unhydrolyzed casein was precipitated by the addition of 1.5 ml of 0.44 M Inhibitions of Vipera russelii PLA2 enzyme activity by trichloroacetic acid. The hydrolyzed casein in the super- PCF extracted in water and various buffers are shown in natant (1 ml) was determined using Folinciocalteu’s reagent. Fig. 2. Maximum inhibition of >40% was observed with wa- The activity in the absence of extract was considered 100%. ter extract. Tris–HCl buffer 0.2 M at different pH value exhib- One unit of activity is defined as the amount of enzyme ited PLA2 inhibition. However, the inhibition was 13–45%. required to cause an increase in absorbance of 0.01 at Buffers with extreme pH values like pH 2.0 of 0.2 M HCl/KCl 660 nm/min. and pH 9.0 of 1.0 M Tris base exhibits >40% inhibition. Phos- phate buffer and citrate buffer (0.1 M) at different pH values 2.14. Phospholipase A2 induced hind paw mouse edema did not show any PLA2 inhibition. Citrate and phosphate buffers failed to extract any PLA2 inhibitor compounds from Mouse paw edema was carried out according the method peacock feather or the extracted material is unstable in these (Yamakawa et al., 1976). To induce edema six different salt solutions. PLA2’s were used. The PLA2 enzymes were injected s.c. Following aqueous extractions, PCF were extracted in into the right hind mice paw in 50 ␮l saline (1 ␮gofPLA2 different polar, non-polar and mixture of organic solvents. from Naja naja; 1.5 ␮gofPLA2 from Vipera russelii;1␮g The inhibitions of Vipera russelii snake venom PLA2 from of PLA2 from HPF; 200 ng of PLA2 from HSF; 0.9 ␮gof these PCF extracts of organic solvents are shown in Fig. 3. PLA2 from EAF; 25 ␮gofPLA2 from serum of normal per- Doles mixture, methanol and acetone extracts exhibited son) with and without PCF water extract. In all the cases the >70% inhibition. The extracts of chloroform, heptane and left paw received the same volume of saline, which served hexane showed least inhibition of 1.2, 10 and 21%, respec- as control. After 45 min, mice were sacrificed by cervical tively. These data suggest that the inhibitory compounds are dislocation and both legs were removed at ankle joints and hydrophilic in nature and easily extractable in aqueous or weighed individually. The increase in weight due to edema polar solvents and not in non-polar solvents. Good PLA2 was calculated as the edema ratio, which equals the weight inhibition was observed with water and acetone extract of of edematous leg × 100/weight of the normal leg. Minimum PCF. Using these solvent systems, the different brightly edema dose is defined as the microgram of protein causing coloured regions as marked in Fig. 1 was separately extracted an edema ratio of 120%. Edema ratio is calculated as defined and tested for Vipera russelii venom PLA2 inhibition. Only above.

2.15. Statistical analysis

All the experiments were repeated for ﬁve independent observations. Data are presented as mean ± S.D. Statisti- cal signiﬁcance of the data was determined by Student’s t-test.

3. Results

3.1. PCF extractions

To extract both polar and non-polar compounds separately from Pavo cristatus feather, it was subjected to extraction with different solutions. For polar compounds feather was extracted with water and different buffers of varying pH, having different molarity. For non-polar compounds feather was extracted with organic solvents of different polarity. Both the extracted samples appeared light yellowish in colour indicating the extraction of some coloured pigments from the feather. Since the feather is brightly coloured in speciﬁc regions, different distinct coloured regions marked as 1–6 Fig. 2. Inhibition of Vipera russelii venom PLA2 enzyme activity by peacock feather extracted with different buffers: (1) water; (2) 0.2 M HCl/KCl pH 2; as shown in Fig. 1 were extracted with acetone and wa- (3) 0.2 M Tris–HCl pH 7.2; (4) 0.2 M Tris–HCl pH 8; (5) 0.2 M Tris–glycine ter. Various PCF extracted samples were checked for PLA2 pH 8.1; (6) 2 M glycine–NaOH pH 10.1; (7) 0.1 M Tris pH 7.4; (8) 1 M Tris inhibition. pH 9. S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237 233

Table 1 Qualitative analysis of PCEF aqueous extract for the metal ions Metal ions mg/l Iron 10.6 Copper 0.44 Chromium 0.367 Zinc 0.22 Nickel 0.15 Gold 0.002

Naja naja and Trimeresurus malabaricus snake venoms, inflammatory fluids like pleural fluid and Ehrlich ascites fluid and acid extracted serum samples (Fig. 4). The water extract of PCF inhibited all PLA2 enzymes in a dose-dependent manner. The least inhibited PLA2 enzyme was that of Naja naja snake venom (55% inhibition at 100 ␮l of PCF water extract). All other snake venom, inflammatory fluids and serum PLA2 enzymes are inhibited >80% at 100 ␮l of PCF water extract. These data clearly suggest that the water extract contained a PLA2 inhibitor that is more sensitive in inhibiting inflammatory and serum PLA enzyme than snake venom PLA Fig. 3. Inhibition of Vipera russelii venom PLA2 enzyme activity 2 2 by PCF extracted with different organic solvents: (1) doles mixture enzyme. [isopropanol:petroleum ether:1N H2SO4 = 40:10:1]; (2) chloroform; (3) Since the feather extract gave positive results for the pres- methanol; (4) alcohol; (5) hexane; (6) acetone; (7) heptane; (8) chlo- ence of macromolecules like proteins and small molecules form:methanol [2:1]; (9) methanol:acetic acid [99:1]. like steroids, carotenoids and several metal ions the nature of inhibitory compounds was checked using several parameters. the coloured region 5 showed 40 and 50% inhibition with the The feather extract was subjected to extensive dialysis, am- extraction of acetone and water, respectively. Other regions monium sulphate precipitation, acid hydrolysis and boiling. did not show any PLA2 inhibition. Further characterization The inhibitory compound loses its activity on heating and of feather inhibitor from region 5 was carried out in on acid hydrolysis. Since the activity retained after dialysis water-extracted samples. indicated that the inhibitory molecule is a macromolecule or an aggregation product of micromolecules. On 100% 3.3. Biochemical characterization of PCF water extract

In PCF water extract, carbohydrate and phenolic compounds were absent and the major macromolecule detected was protein. In the extracted sample the protein concentration was 400 ␮g/ml. PCF water extract was tested for several secondary metabolites. The extract showed positive results for the presence of carotenoids and steroids and other metabolites like alkaloids, ﬂavonoids and triterpenes were absent.

3.4. Detection of metal ions in the PCF water extract

Since the feather colour has metallic texture, the water- extracted sample was subjected to detection of various metal ions. Six metal ions are detected in the PCF extract and their concentration are given in Table 1. The major metal ion present is iron, which is more than 20 times higher than the next major ion, which is copper. The least detected amount of ion is gold.

3.5. In vitro inhibition of PLA2 activity Fig. 4. Inhibition of different snake venom PLA2 and inflammatory PLA2 by PCF water extract: () Vipera russelii;() Naja naja;() Trimeresurus The PLA2 inhibitory effect of PCF water extract was malabaricus;(×) synovial fluid; () asites fluid; () normal serum. Values checked with different PLA2 enzymes from Vipera russelii, are mean ± S.D. of five independent determinations. 234 S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237 ammonium sulphate precipitation the inhibitory activity of the extract was retained in the supernatant and not in the precipitate fraction. This data ensures that the inhibitory molecule is not protein in nature. The role of metal ions and other small molecules has to be established clearly.

3.6. In vitro inhibition of hyaluronidase activity

The other key enzyme involved in local tissue damage and inﬂammation is hyaluronidase enzyme. The PCF water extract was checked for its inhibitory effect on hyaluronidase enzyme. Fig. 5 shows the effect of PCF water extract on Naja naja and Vipera russelii venom hyaluronidase enzyme activity. PCF water extract inhibits the hyaluronidase enzyme activity of both the venom in a dose-dependent manner. Com- pared to Naja naja venom, Vipera russelii venom exhibited highest hyaluronidase activity. Hyaluronidase enzyme activity was completely inhibited by PCF water extract at above 125 ␮l concentration. The inhibition is more for Naja naja hyaluronidase enzyme, than Vipera russelii hyaluronidase ac- Fig. 5. Inhibition of Naja naja and Vipera russelii hyaluronidase by PCF ± tivity. water extract. Values are mean S.D. of ﬁve independent determinations: () Naja naja;() Vipera russelii.

3.7. In vitro inhibition of proteolytic enzyme activity Snake venoms are rich in serine protease and metallopro- Snake venom proteases are involved in hemorrhage and teases (Faiz et al., 1996). Proteases from plant latex known tissue necrosis. The PCF water extract on proteolytic activity to induce hemorrhage in mice are rich in cysteine protease of Naja naja, Vipera russelii and Trimeresurus malabaricus (Barrett, 1986). The effect of PCF water extract on trypsin venom was studied (Fig. 6A). Trimeresurus malabaricus (serine protease) and on papain (cysteine protease) was stud- venom showed very high (>10-fold) proteolytic activity ied (Fig. 6B). PCF water extract inhibits both proteases in a compared to Naja naja and Vipera russelii venom. PCF dose-dependent manner. The inhibition with serine proteases water extract inhibited proteolytic enzyme activity of all is one-fold higher compared to cysteine protease, indicating the venom in a dose-dependent manner. With all the above that the PCF water extract more speciﬁcally inhibits serine venom the inhibition was more than 55%. protease.

Fig. 6. (A) Inhibition of different snake venom protease by PCF water extract. Values are mean ± S.D. of ﬁve independent determinations: () Trimeresurus malabaricus;() Naja naja;() Vipera russelii. (B) Inhibition of trypsin and papain by PCF water extract. Values are mean ± S.D. of ﬁve independent determinations: () papain; () trypsin. S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237 235

are responsible for local tissue damage (Shashidharamurthy et al., 2002; Jagadeesha et al., 2002). The lethality of systemic toxins depends upon the amount and also on the rate at which these toxins diffuse into the systemic circulation for transport to their sites of action (Girish et al., 2004a, 2004b). An early neutralization of local tissue damage is a prerequi- site in the better management of snakebite. In this direction several inhibitors were checked for these hydrolytic enzymes. Indian peafowl feathers are used against snakebite (Samudralwar and Garg, 1996) and are valued in ayurvedic medicine as Mayur chandrika bhasma (ML No ND/AYU/4; Vaidhya, 1946; Lakshmipatishastri, 1973) and used as antiemetic, anti-spasmodic, relieves hiccough, asthma, vomiting and various other problems associated with lungs (Bhandari, 1925; Yadav, 1980). The extraordinary variety and brilliance of feather colour is due to its pigments. The feathers of a hooded Pitohui bird, Pitohui dichrous contained a toxic steroidal alkaloid homobatrachotoxin that function as a de- fensive chemical (Dumbacher et al., 1992). This purified toxin caused numbness, burning and sneezing on contact with Fig. 7. Effect of PCF water extract on PLA induced paw edema. Different 2 human buccal and nasal tissue and highly toxic when injected volumes of PCF water extract was mixed with different PLA2 enzyme in a mixture of 50 ␮l saline and injected into the mouse footpad. Values of edema into mice. These observations suggest that the bird feathers ratio are expressed as mean ± S.D. (n = 6), P values < 0.01 were considered contain many more chemical substances that have different significant when compared to the control by Student’s t-test: () Naja naja; function apart from giving plumage patterns. × ( ) Vipera russelii;( ) synovial fluid; ( ) ascites fluid; ( ) pleural fluid; In this study it has been found out that peacock feather (᭹) normal serum. contained several bioactive components, which are potentially active against snake venom enzymes involved in local 3.8. Neutralization of PLA2 induced hind paw mice tissue damage. Though alkaloid was detected in the feathers edema of a hooded Pitohui bird, peacock feather did not show the presence of any alkaloids. On the other hand it showed pos- It is very well established that injection of PLA2 into the itive results for secondary metabolites such as carotenoids mouse footpad induces edema. All these PLA2 tested from and steroids. The characterization of these carotenoids and serum, inflammatory fluids and snake venom induce edema steroids in this peacock feather for their inhibitory activity when injected into the mouse footpad. Snake venom PLA2 has to be established. Apart from secondary metabolites sev- (Naja naja and Vipera russelii) induces maximum edema of eral metal ions like iron, copper, nickel, zinc and gold are 180%. On the other hand serum induces inflammation up to detected in the PCF extract. Similar observations were made 140%. The PCF water extract on administration with these in the ash sample of peacock feather (Samudralwar and Garg, PLA2 enzymes neutralizes the edema inducing activity. The 1996). Since the dialyzed sample of PCF extract retained the neutralization by PCF water extract is dose-dependent and inhibitory activity against PLA2 enzyme these ions have no neutralized completely the edema activity of all the enzymes role in inhibiting the enzyme activity. studied (Fig. 7). The PCF extract apart from snake venom PLA2 also inhibits PLA2 from inflammatory fluids like pleural fluid, Ehrlich ascites fluid and acid extracted serum samples. This 4. Discussion extract preferentially inhibits the inflammatory PLA2 as compared to snake venom PLA2. The current data clearly in- In snakes production and release of venom is an evolution- dicates the therapeutic importance of this molecule as an anti- ary adaptation primarily to immobilize the prey and secondar- inflammatory compound. Many powerful anti-inflammatory ily to defense and to support digestion. To bring about these drugs like salicylates, indomethacin, and drugs, which effects each species have unique venom composition with suppresses allergic reaction like disodium cromoglycate different amounts of hydrolytic enzymes and specific sys- inhibits the hyaluronidase enzyme activity (Guerra, 1946; temic toxins (Chippaux et al., 1991; Sasa, 1999). Because of Szary et al., 1975; Yingprasertchai et al., 2003). In ethno- this complex mixture venom toxicity is a multiple poisoning pharmacology several traditional compounds used against due to the combined action of hydrolytic enzymes and spe- snakebite and to promote wound healing were subsequently cific toxins and become a medical emergency (Ohsaka, 1979). demonstrated to possess anti-hyaluronidase activity. These The common hydrolytic enzymes found in most venom are include flavonoids, tannins, curcumins, cinnamic acid and proteolytic enzymes, phospholipases and hyaluronidases and glycyrrhizin from licorice (Kuppusamy and Das, 1991; 236 S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237

Fluruya et al., 1997). In folk medicine the same plant extract Barrett, A.J., 1986. The cystatins: a diverse superfamily of cysteine pep- are also used as anti-inflammatory drugs suggesting that tidase inhibitors. Biomedica Biochimica Acta 45, 1363–1374. Bernard, P., Scior, T., Didier, B., Hibert, B., Hibert, M., Berthon, J.Y., many anti-inflammatory drugs inhibits both PLA2 enzyme 2001. Ethnopharmacology and bioinformatic combination for leads and hyaluronidase activity. Similarly the PCF water extract discovery: application to phospholipase A2 inhibitors. Phytochemistry inhibits both inflammatory PLA2 activity and hyaluronidase 58, 865–874. enzyme activity indicating its usefulness in regulating the lo- Bhandari, C.R., 1925. Vanoshadhi Chandrodaya. The Time Table Press, cal tissue damage. Another beneficial factor with PCF water Banaras, India, p. 1666. extract is its preferential inhibition of serine proteases over Bomalaski, J.S., Clark, M.A., 1993. Phospholipase A2 and arthritis. Arthritis and Rheumatism 36, 190–198. cysteine proteases, which are the major proteases of all snake Chippaux, J.P., Williams, White, J., 1991. Snake venom variability: meth- venoms responsible for local tissue necrosis. Co-injection ods of study results and interpretations. Toxicon 29, 1279–1303. of PCF water extract with all the six PLA2 enzymes studied Dubois, M., Gillies, K.A., Hamilton, J.K., Rebers, P.A., Smith, F., 1956. completely neutralizes the edema inducing activity in a dose- Colorimetric method for determination of sugars and related sub- dependent manner. The concomitant inhibition of in vitro stances. Analytical Chemistry 28, 350–356. Duke, J.A., 1985. Hand Book of Medicinal Herbs. CRC Press, Boca PLA2 activity and in vivo edema inducing activity suggests Raton, USA, p. 120. that PCF water extract has a powerful anti-inflammatory Dumbacher, J.P., Beehler, B.M., Spande, T.F., Garraffo, H.M., Daly, J.W., compound, which has greater therapeutic application. Since 1992. Homobatrachotoxin in the genus Pitohui: chemical defense in this PCF water extract also inhibits hyaluronidase enzyme birds? Science 258, 799–801. and proteolytic enzyme, its usefulness in treating snakebite Escalante, T., Franceschi, A., Rucavado, A., Gutierrez, J.M., 2000. Ef- fectiveness of Batimastat: a synthetic inhibitor of matrix metallo- victims becomes more relevant. It has been pointed out that proteinases, in neutralizing local tissue damage induced by BaP1: even if no complete neutralization of the venom occurred a hemorrahagic metalloproteinase from the venom of the snake Both- the time of death was often increased. In areas where rops asper. Biochemical Pharmacology 60, 269–274. no antiserum treatment is available or even possible these Estevao-Costa, M.I., Diniz, C.R., Magalhaes, A., Markland, F.S., Sanchez, antidotes could play an important role by effectively bridging E.F., 2000. Action of metalloproteinases mytalysin I and II on several components of the hemostatic and fibrinolytic systems. Thrombosis the time until qualified support is available. Research 99, 363–376. Faiz, M.A., Falkous, G., Harris, J.B., Mantle, D., 1996. Comparison of protease and related enzyme activities in snake venoms. Comparative Biochemistry and Physiology, Part B: Biochemistry and Molecular 5. Conclusion Biology 1138, 199–204. Fluruya, T., Yamagata, S., Shimoyama, Y., Fujihara, M., Morishima, N., The results from this preliminary study are first of a kind Ohtsuki, K., 1997. Biochemical characterization of glycyrrhizin as an reported from Pavo cristatus feather, which has neutralizing effective inhibitor for hyaluronidases from bovine testis. Biological compounds against snake venom enzymes responsible for lo- and Pharmaceutical Bulletin 20, 973–977. Girish, K.S., Mohanakumari, H.P., Nagaraju, S., Vishwanath, B.S., Kem- cal tissue necrosis. Present studies create ways in developing paraju, K., 2004a. Hyaluronidase and protease activity from Indian new anti-snake venom preparations, which are useful in the snake venoms: neutralization by Mimosa pudica root extract. Fitoter- management of snakebite. apia 75, 378–380. Girish, K.S., Shashidharamurthy, R., Nagaraju, S., Gowda, T.V., Kem- paraju, K., 2004b. Isolation and characterization of hyaluronidase a “Spreading factor” from Indian cobra (Naja naja) venom. Biochimie Acknowledgements 86, 193–202. Glaser, K.B., Mobilio, D., Chang, J.Y., Senko, N., 1993. Phospholipases A2 enzymes: regulation and inhibition. Trends in Pharmacological We wish to extend our gratitude to Department of Sci- Sciences 14, 92–98. ence and Technology, Government of India (Grant No. Guerra, F., 1946. Hyaluronidase inhibition by sodium salicylate in SP/SO/B21/2000) for supporting this research and grateful rheumatic fever. Science 103, 686–687. to the faculties at Government Ayurvedic Hospital, Mysore. Homma, M., Tu, A.T., 1970. Antivenin for the treatment of local tissue SKM thank Council of Scientific and Industrial Research, damage due to envenomation by southeast Asian snakes. The Amer- ican Journal of Tropical Medicine and Hygiene 19, 880–884. Government of India for Senior Research Fellowship. Jagadeesha, D.K., Shashidharamurthy, R., Girish, K.S., Kemparaju, K., 2002. A non-toxic anticoagulant metalloprotease: purification and characterization from Indian cobra (Naja naja naja) venom. Toxicon 40, 667–675. References Kini, R.M., 1997. Venom Phospholipase A2 Enzymes: Structure, Function and Mechanism. Wiley, New York, p. 134. Alam, M.I., Auddy, B., Gomes, A., 1994. Isolation, purification and partial Kini, R.M., Gowda, T.V., 1982a. Studies on snake venom enzymes. Part I. characterization of viper venom inhibiting factor from the root extract Purification of ATPase, a toxic component of Naja naja venom and its of the Indian medicinal plant sarsaparilla (Hemidesmus indicus R Br.). inhibition by potassium gymnemate. Indian Journal of Biochemistry Toxicon 32, 1551–1557. and Biophysics 19, 152–157. Anai, K., Sugiki, M., Yoshida, E., Maruyama, M., 2002. Neutralization of Kini, R.M., Gowda, T.V., 1982b. Studies on snake venom enzymes. Part a snake venom haemorrhagic metalloproteinase prevents coagulopa- II. Partial characterization of ATPase from Russell’s viper (Vipera rus- thy after subcutaneous injection of Bothrops jararaca venom in rats. selli) venom and their interaction with potassium gymnemate. Indian Toxicon 40, 63–68. Journal of Biochemistry and Biophysics 19, 342–347. S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237 237

Kuppusamy, U.R., Das, N.P., 1991. Inhibitory effects of flavonoids on Szary, A., Kowalczyk-Bronisz, S.H., Gieldanowski, J., 1975. In- several venom hyaluronidases. Experientia 47, 1196–2000. domethacin as inhibitor of hyaluronidase. Archivum Immunologiae Lakshmipatishastri, S.V., 1973. Yogarattanakara. In: Brama- et Therapiae Experimentalis (Warsz) 23, 131–134. hashankarashastri, B.S. (Ed.), Vidhyotani Hindi Commentary Tsai, L.H., Yang, L.L., Chang, C., 1980. Inactivation of Formosan snake Charadi Chikitsa. Choukambha Samskrita Series Office, Varanasi, venoms in vivo by aristolochic acid, the chemical component of India, pp. 453–457. Aristolochia radix. Journal of the Formosan Medical Association 74, Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein 352–358. measurement with the Folin Phenol reagent. The Journal of Biological Vaidhya, Y.T.A., 1946. Vamanaadhikara. Sri Baidyanath Ay. Bhavan, Chemistry 193, 265–275. Kolkata, India, p.51. Melo, P.A., Nascimento, M.C., Mors, W.B., Suarez-Kurtz, G., 1994. Inhi- Vishnoi, N.K., 1985. Advanced Practical Organic Chemistry. Vikas Pub- bition of the myotoxic and hemorrhagic activities of crotalid venoms lishing, India, p. 36. by Eclipta prostrata (Asteraceae) extracts and constituents. Toxicon Vishwanath, B.S., Kini, R.M., Gowda, T.V., 1987. Characterization 32, 595–603. of three edema inducing phospholipase A2 enzymes from Habu ML No ND/AYU/4 (AYU.MED), SHREE Baidyanath Ayurved Bhavan (Trimeresurus flavoviridis) venom and their interaction with the al- Ltd., Great Nag Road, Nagpur, India. kaloid aristolochic acid. Toxicon 25, 501–515. Mors, W.B., Nascimento, M.C., Parente, J.P., Silva, M.H., Melo, P.A., Vishwanath, B.S., Fawzy, A.A., Franson, R.C., 1988. Edema induc- Juarez-Kurtz, G., 1989. Neutralization of lethal and Myotorattlesnake ing activity of phospholipase A2 purified from human synovial venom by extracts and constituents of the plant Eclipta prostrata fluid and inhibition by aristolochic acid. Inflammation 12, 549– (Asteraceae). Toxicon 27, 1003–1009. 561. Ohsaka, A., 1979. Hemorrhagic, necrotizing and edema forming effects Vishwanath, B.S., Frey, F.J., Bradbury, M.J., Dallman, M.F., Frey, of snake venoms. In: Lee, C.Y. (Ed.), Snake Venoms. Handbook for B.M., 1993. Glucocorticoid deficiency increases phospholipase A2 Experimental Pharmacology. Springer-Verlag, Berlin, pp. 52–77. activity in rats. The Journal of Clinical Investigation 92, 1974– Paul, V.K., 1993. Animal and insect bites. In: Singh, M. (Ed.), Medical 1980. Emergencies in Children, 2nd ed. Sagar Publications, New Delhi, Vishwanath, B.S., Fux, C.A., Uehlinger, D.E., Frey, B.M., Franson, R.C., India, pp. 20–80. Frey, F.J., 1996. Haemodialysis activates phospholipase A2 enzyme. Reissig, J.L., Stominger, J.L., Leloir, L.F., 1955. A modified colorimetric Nephrology Dialysis Transplantation 11, 109–116. method for the estimation of N-acetylamino sugars. The Journal of Warrell, D.A., 1996. Venoms, toxins and poisons of animals and Biological Chemistry 217, 959–969. plants. In: Wealtherall, D.J., Ledingham, J.G.G., Warrell, D.S. (Eds.), Rosenberg, P., 1997. Pitfalls to avoid in the study of correlations between Textbook of Medicine. Oxford University Press, Oxford, pp. 130– enzymatic activity and pharmacological properties of phospholipase 148. A2 enzyme. In: Kini, R.M. (Ed.), Venom Phospholipase A2 Enzymes: Weinstein, S.A., Schmidt, J.J., Bernheimer, A.W., Smith, L.A., 1991. Structure, Function and Mechanism. Wiley, UK, pp. 155–184. Characterization and amino acid sequences of two lethal peptides iso- Rothut, B., Russo-Marie, F., Wood, J., Di Rosa, M., Flower, R.J., 1983. lated from venom of Wagler’s pit viper, Trimeresurus wagleri. Toxicon Further characterization of the glucocorticoid induced antiphosphli- 29, 227–236. pase protein ‘Renocortin’. Biochemical and Biophysical Research Yadav, A.V., 1980. Dravyaguana Part I and II. Baidyanath Publications, Communications 117, 878–884. Calcutta, India, p. 794. Samudralwar, D.L., Garg, A.N., 1996. Minor and trace elemental de- Yamakawa, M., Nozaki, M., Hokama, Z., 1976. Fractionation of termination in the Indian herbal and other medicinal preparations. sakishima–habu (Trimeresurus elegans) venom and lethal hemorrhagic Biological Trace Element Research 54, 113–121. and edema forming activity of the fractions. In: Ohsaka, A., Hayashi, Sasa, M., 1999. Diet and snake venom evolution: can local selection alone K., Sawai, Y. (Eds.), Animal, Plant and Microbial Toxins, vol. 1. explain intraspecific venom variation? Toxicon 37, 249–252. Plenum Press, New York, p. 97. Satake, M., Murata, Y., Suzuki, T., 1963. Studies on snake venom XIII. Yingprasertchai, S., Bunyasrisawt, S., Ratanabanangkoon, K., 2003. Chromatographic separation and properties of three proteinases from Hyaluronidase inhibitors (sodium cromoglycate and sodium auro- Agkistrodon halys blomhoffii venom. Journal of Biochemistry (Tokyo) thiomalate) reduce the local tissue damage and prolong the survival 53, 438–447. time of mice injected with Naja kaouthia and Calloselasma rhodos- Shashidharamurthy, R., Jagadeesha, D.K., Girish, K.S., Kemparaju, K., toma venoms. Toxicon 42, 635–646. 2002. Variations in biochemical and pharmacological properties of Indian cobra (Naja naja naja) venom due to geographical distribution. Molecular and Cellular Biochemistry 229, 93–101. Swain, T., Hillis, W.E., 1959. The phenolic constituents of Prunus do- Further reading mestica. I. The quantitative analysis of phenolic constituents. Journal of the Science of Food and Agriculture 10, 63–67. Markland, F.S., 1997. Snake venoms. Drugs 54, 1–10. Journal of Ethnopharmacology 99 (2005) 239–244

Punica granatum ﬂower extract, a potent ␣-glucosidase inhibitor, improves postprandial hyperglycemia in Zucker diabetic fatty rats

Yuhao Li a,∗, Suping Wen b, Bhavani Prasad Kota a, Gang Peng a, George Qian Li a, Johji Yamahara c, Basil D. Roufogalis a

a Herbal Medicines Research and Education Centre, Faculty of Pharmacy, A15, The University of Sydney, Sydney, NSW 2006, Australia b Department of Health Sciences, University of Technology, Sydney, Australia c Pharmafood Institute, Kyoto, Japan Received 2 November 2004; received in revised form 12 January 2005; accepted 12 February 2005 Available online 9 April 2005

Abstract

Postprandial hyperglycemia plays an important role in the development of type 2 diabetes and has been proposed as an independent risk factor for cardiovascular diseases. The ﬂowering part of Punica granatum Linn. (Punicaceae) (PGF) has been recommended in Unani literature as a remedy for diabetes. We investigated the effect and action mechanism of a methanolic extract from PGF on hyperglycemia in vivo and in vitro. Oral administration of PGF extract markedly lowered plasma glucose levels in non-fasted Zucker diabetic fatty rats (a genetic model of obesity and type 2 diabetes), whereas it had little effect in the fasted animals, suggesting it affected postprandial hyperglycemia in type 2 diabetes. In support of this conclusion the extract was found to markedly inhibit the increase of plasma glucose levels after sucrose loading, but not after glucose loading in mice, and it had no effect on glucose levels in normal mice. In vitro, PGF extract demonstrated a potent inhibitory effect on ␣-glucosidase activity (IC50: 1.8 ␮g/ml). The inhibition is dependent on the concentration of enzyme and substrate, as well as on the length of pretreatment with the enzyme. These ﬁndings strongly suggest that PGF extract improves postprandial hyperglycemia in type 2 diabetes and obesity, at least in part, by inhibiting intestinal ␣-glucosidase activity. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Punica granatum; Postprandial hyperglycemia; ␣-Glucosidase; Diabetes; Zucker diabetic fatty rats

1. Introduction tributing factors to the development of atherosclerosis, even in diabetes mellitus (Ceriello, 2000). Postprandial hyper- At the present time it is estimated that 150 million people glycemia plays an important role in the development of type worldwide have diabetes and that this will increase to 220 2 diabetes mellitus and complications associated with the million by 2010 and 300 million by 2025. Globally, the per- disease, such as micro- and macro-vascular diseases (Baron, centage of type 2 diabetes (non insulin-dependent diabetes 1998), and has been proposed as an independent risk factor mellitus) is greater than 90% (Zimmet et al., 2001). Patients for CVD (Ceriello, 1998). Therefore, control of postprandial with diabetes have an increased risk of cardiovascular disease hyperglycemia is suggested to be important in the treatment (CVD). Recently, much attention has been paid to evidence of diabetes and prevention of cardiovascular complications. that abnormalities of the postprandial state are important con- Punica granatum Linn. (PG), commonly known as pomegranate, is a small tree, belonging to the Punicaceae family. Pomegranate is grown mainly in Iran, India and Abbreviations: FPG, fasting plasma glucose; PG, Punica granatum; the USA, but also in most Near and Far East countries. PGF, Punica granatum ﬂowers; ZL, Zucker lean; ZDF, Zucker diabetic fatty; Pomegranate juice and wine have become increasingly pop- CVD, cardiovascular disease ∗ Corresponding author. Tel.: +61 2 9351 8585; fax: +61 2 9351 8638. ular because of the attribution to the plant of important bio- E-mail address: [email protected] (Y. Li). logical actions (Schubert et al., 1999), including antioxidant

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.jep.2005.02.030 240 Y. Li et al. / Journal of Ethnopharmacology 99 (2005) 239–244 activity and cardiovascular protection (Aviram et al., 2002). 2.4. Bioassay In Ayurvedic medicine almost all parts of PG are used for the treatment of numerous disorders. Only PG flowering part 2.4.1. Effects on plasma glucose level in ZDF rats (PGF), however, has been recommended in Unani literature Test sample (suspended in 5% acacia) and vehicle were as a remedy for diabetes (Jurjani, 1878; Majoosi, 1889). It orally given by a gavage once daily for 2 weeks. Animals has been reported that the aqueous-ethanolic extract of the were weighed once every 3–4 days for regulating the volume flowers led to a blood glucose lowering effect in rats (Jafri of the test sample. Plasma glucose levels were determined by et al., 2000). However, the action mechanism of the PGF the glucose oxidase method before (week 0) and 1 h after last remains unknown. Furthermore, PGF has not been investi- administration of test sample and vehicle (week 2) under non- gated in type 2 diabetic animals. Zucker diabetic fatty (ZDF) fasted and fasted (20 h) conditions. Blood was taken from the rats have been frequently used as a genetic model for obesity orbital sinus under halothane anesthesia. and type 2 diabetes (Kasiske et al., 1992; Alemzadeh and Tushaus, 2004; Tikellis et al., 2004). In the present study, we 2.4.2. Effects on plasma glucose level in sucrose- and have investigated the effects of methanolic extract from PGF glucose-loaded mice on hyperglycemia and also clarified its mechanism of action Test samples and vehicle were given orally to mice fasted through studies in ZDF rats and enzyme inhibition in vitro. for 20 h. Sixty minutes later, sucrose (1 g/kg in distilled water), glucose (0.5 g/kg in distilled water) or water was administered orally. Plasma glucose levels were determined 30 min 2. Materials and methods after administration of sucrose, glucose or water (see figure legends for details). 2.1. Animals 2.4.3. Effect on ␣-glucosidase activity in vitro All experimental procedures were carried out in accor- Experiment was carried out by the method previously de- dance with the Guiding Principles for the Care and Use of scribed (Li et al., 2004). Briefly, 200 ␮lof␣-glucosidase solu- Laboratory Animals approved by the Animal Ethics Com- tion (0.6 U/ml) was pre-incubated with 200 ␮l of test sample mittee of the University of Sydney, Australia. Male ZDF (dissolved in DMSO, DMSO final concentration: 2%) or ve- and Zucker lean (ZL) rats, aged 13–14 weeks were obtained hicle for 5 min. The reaction was started by adding 200 ␮l from Monash University Animal Services, Vic., Australia. of 37 mM sucrose and terminated after 30 min incubation at Male ddY mice were purchased from Kiwa Laboratory An- 37 ◦C by heating at 90–100 ◦C. The formation of glucose was imals (Wakayama, Japan). Animals were housed in an air- determined. Inhibition rates were calculated as a percent of conditioned room at 23 ± 1 ◦C with a 12 h light/dark cycle blank controls, and the IC50 value was defined as the concen- and were provided with standard food and water ad libitum. tration required to inhibit 50% of the ␣-glucosidase activity Animals were allowed free access to diet and water for 1 under the assay conditions specified. week before starting the experiments. To better understand the effect of PGF, several experiments were undertaken at different concentrations of enzyme 2.2. Drugs and reagents (␣-glucosidase: 0.3, 0.6, 1.5, 3 and 6 U/ml) and substrate (sucrose: 7.5, 15, 30, 60 and 120 mM), and at different pretreat- ␣-Glucosidase (EC 3.2.1.20) was purchased from ment times (0, 5, 30, 60 and 120 min). Sigma–Aldrich Chemical Co. (St. Louis, MO, USA). Acarbose (Glucobay, Bayer, Leverkusen, Germany) was 2.5. Statistics purchased from a pharmacy in Japan. A kit for glucose determination was purchased from Wako Pure Chemical All results are expressed as mean ± S.E.M. Data were an- Industry (Osaka, Japan). alyzed by one-factor ANOVA. If a statistically significant effect was found, the Newman–Keuls test was performed to 2.3. Preparation of extract isolate the difference between the groups. Values of P < 0.05 were considered statistically significant. PGF was collected in June, 2002 in Maharashtra, India, and identified. A voucher specimen was deposited at the herbarium of the Herbal Medicines Research and Education 3. Results Centre, Faculty of Pharmacy, the University of Sydney, Aus- tralia. Air-dried and ground PGF (1 kg) were extracted at 3.1. PGF extract markedly lowers plasma glucose level room temperature three times with 5 vol of methanol (w/v). in non-fasted ZDF rats, but has little effect in fasted ZDF The solvent was evaporated under reduced pressure below rats 50 ◦C to give a methanolic extract (yield: 40%). The hot water extract of Salacia oblonga root was prepared as previously As shown in Fig. 1a and b, ZDF rats showed a significantly described (Li et al., 2004). higher glucose level than ZL rats under the fasted condition, Y. Li et al. / Journal of Ethnopharmacology 99 (2005) 239–244 241

Fig. 1. Effect of Punica granatum ﬂower (PGF) extract on plasma glucose Fig. 2. PGF extract inhibits the increase of plasma glucose levels after su- levels. PGF has little effect in fasted Zucker diabetic fatty (ZDF) rats after 2 crose loading in mice. PGF extract (250–1000 mg/kg, p.o.) dose-dependently weeks of treatment (a), whereas it lowers plasma glucose levels in non-fasted inhibits the increase of plasma glucose levels after sucrose loading (a). PGF ZDF rats in the same time period (b). PGF extract (500 mg/kg, suspended extract (0–500 mg/kg) has no effect after glucose loading (the second and in 5% acacia) or vehicle was administered by oral gavage once daily for third bars from the right) or in fasted normal mice (the ﬁrst bar from the 2 weeks. Plasma glucose levels were determined by the glucose oxidase left (b). Acarbose (300 mg/kg) also inhibited plasma glucose accumulation method before (week 0) and 1 h after the last administration of test sample after sucrose feeding (a), but not after glucose loading (b). Test samples and and vehicle (week 2) under non-fasted (normal access to food and water) and vehicle were given by a gavage to mice fasted for 20 h; 60 min later, sucrose fasted (for 20 h) conditions. All values are mean ± S.E.M. (n = 5). *P < 0.05. (1 g/kg), glucose (0.5 g/kg) or vehicle were administered orally. Plasma glu- ZL, Zucker lean rats. cose levels were determined 30 min after administration of sucrose, glucose or vehicle. All values are mean ± S.E.M. (n = 8–10). *P < 0.05. and the level was much higher in non-fasted than in the fasted condition. PGF extract reduced plasma glucose levels ing ␣-glucosidase concentration shifted the dose–response by 43.1% under non-fasted conditions, whereas it showed curve for PGF to higher concentrations (Fig. 4a). Increas- little effect under fasted conditions. ing ␣-glucosidase concentration (from 0.3 to 6 U/ml) increased the IC50 of PGF extract substantially (from 0.8 to ␮ 3.2. PGF extract inhibits increase of glucose level in 23.5 g/ml, Fig. 4b). Increasing the sucrose concentration sucrose-, but not glucose-loaded mice

Plasma glucose levels of mice were increased after oral loading of sucrose (Fig. 2a) or glucose (Fig. 2b). PGF extract dose-dependently (250–1000 mg/kg, p.o.) inhibited the increase in sucrose-loaded mice (plasma glucose levels were reduced by 13.9%, 19.7%, and 20.6%, respectively), whereas it showed little effect in glucose-loaded mice. Acarbose (300 mg/kg, p.o.) also showed similar effects (10.6% reduction of plasma glucose level in sucrose- loaded mice). Additionally, PGF extract (500 mg/kg) did not affect plasma glucose levels in fasted mice (the ﬁrst left bar, Fig. 2b).

3.3. PGF extract inhibits ␣-glucosidase activity in vitro

Fig. 3. PGF extract concentration-dependently inhibits ␣-glucosidase ac- We have recently reported that Salacia oblonga root, an tivity in vitro. (a) An amount of 200 ␮l ␣-glucosidase (0.6 U/ml) was pre- Ayurvedic antidiabetic medicine, inhibits postprandial hyper- incubated with 200 ␮l of PGF extract or vehicle for 5 min. The reaction was glycemia in ZDF rats, in which inhibition of ␣-glucosidase started by adding 200 ␮l of 37 mM sucrose (the ﬁnal volume: 600 ␮l) and ◦ ◦ activity plays an important role. In the present study, Salacia terminated by heating at 90–100 C after 30 min incubation at 37 C. The oblonga root extract, used as a positive control, effectively formation of glucose was determined. Inhibition rates were calculated as ␣ ␮ percentages relative to blank controls, and IC50 values were calculated from inhibited -glucosidase activity (IC50: 4.3 g/ml, Fig. 3b). the dose-inhibition curves. (b) The water extract from Salacia oblonga root Interestingly, PGF extract showed a more potent effect on was used as a positive control. Each experiment was done for three times in ␣-glucosidase activity (IC50: 1.8 ␮g/ml, Fig. 3a). Increas- duplicate. 242 Y. Li et al. / Journal of Ethnopharmacology 99 (2005) 239–244

Fig. 4. The inhibitory effect of PGF extract on ␣-glucosidase activity is Fig. 6. Increase in pretreatment time enhances the inhibitory effect of PGF inversely dependent on the enzyme concentration. An amount of 200 ␮l extract. An amount of 200 ␮l ␣-glucosidase (0.6 U/ml) was pre-incubated ␣-glucosidase (0.3, 0.6, 1.5, 3 and 6 U/ml) was pre-incubated with 200 ␮l with 200 ␮l of PGF extract or vehicle for 0, 5, 30, 60 or 120 min. The reaction of test sample or vehicle for 5 min. The reaction was started by adding was started by adding 200 ␮l of sucrose (37 mM) (the ﬁnal volume: 600 ␮l) 200 ␮l of 37 mM sucrose (the ﬁnal volume: 600 ␮l) and terminated by heat- and terminated by heating at 90–100 ◦C after 30 min incubation at 37 ◦C. ing at 90–100 ◦C after 30 min incubation at 37 ◦C. The formation of glucose The formation of glucose was determined. (a) Inhibition was calculated as was determined. (a) Inhibition rates were calculated as percentages of blank percentage of blank controls. The inhibition by PGF extract was enhanced controls. The inhibitions of PGF extract were attenuated by increase in en- by increasing pretreatment times. (b) IC50 value (as in Fig. 4) decreased with zyme concentrations. (b) IC50 values (the concentration to inhibit 50% of increasing pretreatment times. Each experiment was done in duplicate. ␣-glucosidase activity under the assay conditions) increased with progressive increases in enzyme concentrations. Each experiment was done in duplicate. 4. Discussion

The treatment goal for patients with type 2 diabetes mel- (7.5–120 mM) also affected the position of the dose–response litus is generally agreed to be to maintain near-normal levels curve (Fig. 5a), the IC of PGF extract increasing from 1.4 to 50 of glycemic control, both in the fasting and postprandial 2.6 ␮g/ml (Fig. 5b). Increasing the time of pretreatment with states (Ratner, 2001). Postprandial hyperglycemia is the PGF (from 0 to 120 min) progressively enhanced the effect earliest metabolic abnormality to occur in type 2 diabetes of PGF extract (Fig. 6a), with a consequent reduction in IC 50 mellitus (Lebovitz, 1998). Postprandial blood glucose levels from 2.2 to 1.2 ␮g/ml (Fig. 6b). may be elevated in the presence of normal levels of fasting plasma glucose (FPG), constituting an early stage in type 2 diabetes, which some have called “postprandial diabetes” (Baron, 1998). This state not only initiates the development of early microvascular and macrovascular complications, but also can contribute to a more rapid progression to symptomatic diabetes by causing glucose toxicity in muscle and pancreatic beta cells. Early identification of postprandial hyperglycemia and its effective control, therefore, offer the potential for early intervention and prevention of diabetic complications (Ratner, 2001). Although diet and exercise are the first steps toward achieving treatment goals, 90% of patients with type 2 diabetes cannot maintain long-term glycemic control with diet and exercise alone (Ratner, 2001). Thus, antihyperglycemic drugs are necessary for the treatment of type 2 diabetes. However, most of the currently available antidiabetes Fig. 5. The inhibitory effect of PGF extract on ␣-glucosidase activity is attenuated by an increase in substrate concentration. An amount of 200 ␮l therapies reduce FPG but have little impact on postprandial ␣-glucosidase was pre-incubated with 200 ␮l of PGF extract or vehicle for glycemic excursions; therefore, they do not normalize post- 5 min. The reaction was started by adding 200 ␮l of sucrose (7.5, 15, 30, prandial hyperglycemia (Ratner, 2001). A number of newer 60 and 120 mM) (the final volume: 600 ␮l) and terminated by heating at ␣ ◦ ◦ antidiabetes therapies—the meglitinides, -glucosidase 90–100 C after 30 min incubation at 37 C. The formation of glucose was inhibitors, and insulin lispro and aspart (Mooradian and determined. (a) Inhibition was calculated as percentage of blank controls. The inhibition by PGF extracts were attenuated by increases in sucrose (sub- Thurman, 1999; Raskin et al., 2000)—target postprandial strate) concentrations. (b) IC50 values (as in Fig. 4) increased with increasing blood glucose spikes, and these agents should be considered sucrose concentrations. Each experiment was done in duplicate. increasingly in the long-term management of patients with Y. Li et al. / Journal of Ethnopharmacology 99 (2005) 239–244 243 type 2 diabetes. Use of these agents may lead to achievement lower blood glucose levels in glucose-loaded mice, suggest of overall target glycemic levels in a greater proportion of that PGF extract inhibits carbohydrate digestion rather than patients, thus helping to prevent the excessive morbidity and the transit and absorption of glucose and other sugars in the mortality associated with the disease (Ratner, 2001). In the digestive tract. Therefore, we speculated that PGF extract present study, oral administration of PGF extract lowered had an inhibitory effect on ␣-glucosidase activity. The results plasma glucose levels in non-fasted, but not fasted, ZDF rats. obtained in vitro demonstrated that PGF is indeed an effective Furthermore, this treatment inhibited the increase of plasma ␣-glucosidase inhibitor. glucose levels after sucrose loading in mice. The results Enzyme availability directly decides the rate of an en- suggest that PGF extract may have therapeutical potential in zymatically catalyzed reaction. The catalytic activity of an postprandial hyperglycemia. enzyme is affected by the substrate concentration. To fur- ␣-Glucosidase is one of a number of glucosidases located ther understand the effect of PGF extract, we investigated the in the brush-border surface membrane of intestinal cells, and influence of the concentration of enzyme and substrate, as is a key enzyme of carbohydrate digestion (Caspary, 1978). well as pretreatment time, on the potency of ␣-glucosidase ␣-Glucosidase inhibitors block the actions of ␣-glucosidase inhibition by PGF extract. The results demonstrated that enzymes in the small intestine, which is rate-limiting in the inhibitory potency of PGF extract is inversely depen- the conversion of oligosaccharides and disaccharides to dent on the concentration of ␣-glucosidase. An increase monosaccharides, necessary for gastrointestinal absorption. in substrate concentration also attenuates to some extent Postprandial glucose peaks may be attenuated by delayed the effect of the PGF extract. ␣-Glucosidase inhibition by glucose absorption. The main benefits attributable to PGF extract was increased progressively by preincubation ␣-glucosidase inhibitors are reductions in both postprandial of the inhibitor with the enzyme. Because the time required glycemic levels and in the total range of postprandial to reach binding equilibrium varies with the enzyme con- glucose levels (Lebovitz, 1997). The clinical efficacy of centration in a bimolecular reaction mechanism, the inhibi- ␣-glucosidase inhibitors is well established. With acarbose, tion seems to reflect a slow-binding mode. The IC50 curves the most extensively studied and widely used agent of this from the experiments with different substrate concentra- class, patients with type 2 diabetes had a mean decrease in tions and pretreatment time indicates that the dose of PGF postprandial plasma glucose of approximately 50 mg/dl, and will be regulated by the amount of food intake, and when a mean decrease in HbA1c of 0.86% (Lebovitz, 1997). In used therapeutically PGF extract should be taken before a long-term randomized study, acarbose improved glycemic meals. control without weight gain in 50% of patients with type Glycosidases are not only essential to carbohydrate diges- 2 diabetes who could not achieve control by diet alone or tion, but also vital for the processing of glycoproteins and by diet combined with metformin, sulfonylureas or insulin glycolipids. Glycosidases are also involved in a variety of (Chiasson et al., 1994). However, it is well documented that metabolic disorders and other diseases such as viral attach- synthetic ␣-glucosidase inhibitors have undesirable side ment (Gruters et al., 1987) and cancer formation (Dennis effects, such as flatulence, diarrhea and abdominal cramping. et al., 1987). Because of their importance, glycosidase in- In addition, some of them may increase the incidence of hibitors can be important tools for studying the mechanisms renal tumors and serious hepatic injury and acute hepatitis of action on glycosidases and are also prospective therapeutic (Carrascosa et al., 1997; Kihara et al., 1997; Diaz-Gutierrez agents for some degenerative diseases (Winchester and Fleet, et al., 1998; Charpentier et al., 2000). 1992). Some ␣-glucosidase inhibitors such as nojirimycin, Many herbal medicines have been used in the prevention N-butyldeoxynojirimycin, and castanospermine are potent and treatment of diabetes. They have in general not been inhibitors of human immunodeficiency virus (HIV) replica- associated with marked toxic or other side effects. As for tion and HIV-mediated syncytium formation in vitro (Walker most natural medicines, however, their action mechanisms et al., 1987; Fischer et al., 1996a,b). There is much evi- need to be clarified. Although some herbal medicines have dence suggesting that the extracts of fruit from pomegranate been reported to inhibit ␣-glucosidase activity, most of the have anti-microbial (Anesini and Perez, 1993), anti-parasitic experiments have been limited to in vitro studies or to normal (Ponce-Macotela et al., 1994), anti-viral (Zhang et al., 1995) or chemical-induced diabetic animal models only (Kim et and anti-cancer (Kim et al., 2002) properties. However, the al., 1999, 2004; Muraoka et al., 2001; Ye et al., 2002; Pan et action mechanisms of these remain unclear. Our current find- al., 2003; Yoshikawa et al., 2003). In the present study, PGF ings provide a possible rationale for the purported actions of extract markedly reduced plasma glucose levels in non-fasted pomegranate and suggest further research directions on the ZDF rats, but affected neither the levels in fasted ZDF rats, action mechanisms of pomegranate and the investigation of nor interfered with plasma glucose levels in normal mice. its new therapeutic potentials. The results suggest that PGF extract interferes with transit, In conclusion, the present studies indicate that PGF extract digestion or absorption of sugars in the small intestine, rather improves postprandial hyperglycemia in type 2 diabetes, at than by other mechanisms, such as promotion of secretion least in part, by inhibiting ␣-glucosidase activity. Our findings of insulin. The combined findings of inhibition of increase provide insight into the effects and action mechanism of PGF, of plasma glucose levels after sucrose loading, and failure to an ancient medicine for diabetes. 244 Y. Li et al. / Journal of Ethnopharmacology 99 (2005) 239–244

References Kim, H.S., Kim, Y.H., Hong, Y.S., Paek, N.S., Lee, H.S., Kim, T.H., Kim, K.W., Lee, J.J., 1999. Alpha-glucosidase inhibitors from Commelina Alemzadeh, R., Tushaus, K.M., 2004. Modulation of adipoinsular axis in communis. Planta Medica 65, 437–439. prediabetic ZDF rats by diazoxide. Endocrinology 145, 5476–5484. Kim, N.D., Mehta, R., Yu, W., Neeman, I., Livney, T., Amichay, A., Anesini, C., Perez, C., 1993. Screening of plants used in Argentine folk Poirier, D., Nicholls, P., Kirby, A., Jiang, W., Mansel, R., Ramachan- medicine for antimicrobial activity. Journal of Ethnopharmacology 39, dran, C., Rabi, T., Kaplan, B., Lansky, E., 2002. Chemopreventive and 119–128. adjuvant therapeutic potential of pomegranate (Punica granatum) for Aviram, M., Dornfeld, L., Kaplan, M., Coleman, R., Gaitini, D., Nitecki, human breast cancer. Breast Cancer Research Treatment 71, 203–217. S., Hofman, A., Rosenblat, M., Volkova, N., Presser, D., Attias, J., Kim, Y.M., Wang, M.H., Rhee, H.I., 2004. A novel alpha-glucosidase Hayek, T., Fuhrman, B., 2002. Pomegranate juice flavonoids inhibit inhibitor from pine bark. Carbohydrate Research 339, 715–717. low-density lipoprotein oxidation and cardiovascular diseases: studies Lebovitz, H.E., 1997. Alpha-glucosidase inhibitors. Endocrinology and in atherosclerotic mice and in humans. Drugs under Experimental and Metabolism Clinics of North America 26, 539–551. Clinical Research 28, 49–62. Lebovitz, H.E., 1998. Postprandial hyperglycaemic state: importance and Baron, A.D., 1998. Postprandial hyperglycemia and ␣-glucosidase in- consequences. Diabetes Research and Clinical Practice 40, S27–S28. hibitors. Diabetes Research and Clinical Practice 40, S51–S55. Li, Y., Peng, G., Li, Q., Wen, S., Huang, T.H., Roufogalis, B.D., Yama- Carrascosa, M., Pascual, F., Arest, S., 1997. Acarbose-induced acute se- hara, J., 2004. Salacia oblonga improves cardiac fibrosis and inhibits vere hepatotoxicity. Lancet 349, 698–699. postprandial hyperglycemia in obese Zucker rats. Life Sciences 75, Caspary, W.F., 1978. Sucrose malabsorption in man after ingestion of 1735–1746. alpha-glucosidehydrolase inhibitor. Lancet 1, 1231–1233. Majoosi, A.I.A., 1889. Kamilussanah. Munshi Nawal Kishore, Lucknow Ceriello, A., 1998. The emerging role of post-prandial hypergly- (Urdu translation by Kantoori), pp. 145. caemic spikes in the pathogenesis of diabetic complications. Diabetic Mooradian, A.D., Thurman, J.E., 1999. Drug therapy of postprandial hy- Medicine 15, 188–193. perglycemia. Drugs 57, 19–29. Ceriello, A., 2000. The post-prandial state and cardiovascular disease: Muraoka, O., Ying, S., Yoshikai, K., Matsuura, Y., Yamada, E., Mine- relevance to diabetes mellitus. Diabetes-Metabolism Research and Re- matsu, T., Tanabe, G., Matsuda, H., Yoshikawa, M., 2001. Synthe- views 16, 125–132. sis of a nitrogen analogue of salacinol and its alpha-glucosidase in- Charpentier, G., Riveline, J.P., Varroud-Vial, M., 2000. Management of hibitory activity. Chemical and Pharmaceutical Bulletin (Tokyo) 49, drugs affecting blood glucose in diabetic patients with renal failure. 1503–1505. Diabetes and Metabolism 26, 73–85. Pan, G.Y., Huang, Z.J., Wang, G.J., Fawcett, J.P., Liu, X.D., Zhao, X.C., Chiasson, J.L., Josse, R.G., Hunt, J.A., Palmason, C., Rodger, N.W., Ross, Sun, J.G., Xie, Y.Y., 2003. The antihyperglycaemic activity of berber- S.A., Ryan, E.A., Tan, M.H., Wolever, T.M., 1994. The efficacy of ine arises from a decrease of glucose absorption. Planta Medica 69, acarbose in the treatment of patients with non-insulin-dependent di- 632–636. abetes mellitus. A multicenter controlled clinical trial. Annals of In- Ponce-Macotela, M., Navarro-Alegria, I., Martinez-Gordillo, M.N., ternal Medicine 15, 928–935. Alvarez-Chacon, R., 1994. In vitro effect against Giardia of 14 plant Dennis, J.W., Laferte, S., Waghorne, C., Breitman, M.L., Kerbel, R.S., extracts. Revista De Investigacion Clinica 46, 343–347. 1987. Beta 1–6 branching of Asn-linked oligosaccharides is directly Raskin, P., Riis, A., Guthrie, R.A., Jovanovic, L., Leiter, L., 2000. Use associated with metastasis. Science 236, 582–585. of insulin aspart, a fast-acting insulin analog, as the mealtime insulin Diaz-Gutierrez, F.L., Ladero, J.M., Diaz-Rubio, M., 1998. Acarbose- in the management of patients with type 1 diabetes. Diabetes Care induced acute hepatitis. American Journal of Gastroenterology 93, 23, 583–588. 481. Ratner, R.E., 2001. Controlling postprandial hyperglycemia. American Fischer, P.B., Karlsson, G.B., Butters, T.D., Dwek, R.A., Platt, F.M., Journal of Cardiology 88, 26H–31H. 1996a. N-butyldeoxynojirimycin-mediated inhibition of human im- Schubert, S.Y., Lansky, E.P., Neeman, I., 1999. Antioxidant and munodeficiency virus entry correlates with changes in antibody recog- eicosanoid enzyme inhibition properties of pomegranate seed oil and nition of the V1/V2 region of gp120. Journal of Virology 70, fermented juice flavonoids. Journal of Ethnopharmacology 66, 11–17. 7143–7152. Tikellis, C., Wookey, P.J., Candido, R., Andrikopoulos, S., Thomas, M.C., Fischer, P.B., Karlsson, G.B., Dwek, R.A., Platt, F.M., 1996b. N- Cooper, M.E., 2004. Improved islet morphology after blockade of the butyldeoxynojirimycin-mediated inhibition of human immunodefi- renin-angiotensin system in the ZDF rat. Diabetes 53, 989–997. ciency virus entry correlates with impaired gp120 shedding and gp41 Walker, B.D., Kowalski, M., Goh, W.C., Kozarsky, K., Krieger, M., Rosen, exposure. Journal of Virology 70, 7153–7160. C., Rohrschneider, L., Haseltine, W.A., Sodroski, J., 1987. Proceed- Gruters, R.A., Neefjes, J.J., Tersmette, M., De Goede, R.E.Y., Tulp, A., ings of the National Academy of Sciences of the United States of Huisman, H.G., Miedema, F., Ploegh, H.L., 1987. Interference with America 84, 8120–8124. HIV-induced syncytium formation and viral infectivity by inhibitors Winchester, B., Fleet, G.W., 1992. Amino-sugar glycosidase inhibitors: of trimming glucosidase. Nature 330, 74–77. versatile tools for glycobiologists. Glycobiology 2, 199–210. Jafri, M.A., Aslam, M., Javed, K., Singh, S., 2000. Effect of Punica Ye, F., Shen, Z., Xie, M., 2002. Alpha-glucosidase inhibition from a granatum Linn. (flowers) on blood glucose level in normal and Chinese medical herb (Ramulus mori) in normal and diabetic rats and alloxan-induced diabetic rats. Journal of Ethnopharmacology 70, mice. Phytomedicine 9, 161–166. 309–314. Yoshikawa, M., Pongpiriyadacha, Y., Kishi, A., Kageura, T., Wang, Jurjani, M.I., 1878. Zakheera-Khwarzam-Shahi. Munshi Nawal Kishore, T., Morikawa, T., Matsuda, H., 2003. Biological activities of Sala- Lucknow (Urdu translation), pp. 540. cia chinensis originating in Thailand: the quality evaluation guided Kasiske, B.L., O’Donnell, M.P., Keane, W.F., 1992. The Zucker rat model by alpha-glucosidase inhibitory activity. Yakugaku Zasshi 123, 871– of obesity, insulin resistance, hyperlipidemia, and renal injury. Hyper- 880. tension 19, 110–115. Zhang, J., Zhan, B., Yao, X., Gao, Y., Shong, J., 1995. Antiviral activity Kihara, Y., Ogami, Y., Tabaru, A., Unoki, H., Otsuki, M., 1997. Safe of tannin from the pericarp of Punica granatum L against Herpes and effective treatment of diabetes mellitus associated with chronic virus in vitro. Chung Kuo Chung Yao Tsa Chih 20, 556–558. liver diseases with an alpha-glucosidase inhibitor, acarbose. Journal Zimmet, P., Alberti, K., Shaw, J., 2001. Global and societal implications of Gastroenterology 32, 777–782. of the diabetes epidemic. Nature 414, 782–787. Journal of Ethnopharmacology 99 (2005) 245–252

Effect of bee venom on aromatase expression and activity in leukaemic FLG 29.1 and primary osteoblastic cells

Kap-Sung Kim a, U-Shik Choi a, Seung-Duk Lee a, Kyung-Ho Kim a, Kang-Hyun Chung b, Young-Chae Chang c, Kwan-Kyu Park c, Young-Choon Lee d, Cheorl-Ho Kim a,∗

a Department of Acupuncture, Biochemistry and Molecular Biology, College of Oriental Medicine, Dongguk University and National Research Laboratory for Glycobiology, Kyungju, Kyungbuk 780-714, Korea b Department of Food Science and Technology, Seoul National University of Technology, Seoul 139-743, Korea c Department of Pathology, College of Medicine, Daegu Catholic University, Daegu, Korea d Faculty of Biotechnology, Dong-A University, Pusan 604-714, Korea Received 5 July 2004; received in revised form 3 February 2005; accepted 17 February 2005 Available online 11 April 2005

Abstract

The effect of bee venom aqua-acupunture (BVA) (api-toxin), a traditional immunosuppressive Korean aqua-acupuncture, on the bone function in human osteoblastic cells was studied. To provide insights into the effect of BVA on aromatase activity in bone-derived cells, we examined the human leukaemic cell line FLG 29.1, which is induced to differentiate toward the osteoclastic phenotype by TPA and TGF-␤1, and the primary ﬁrst-passage osteoblastic cells (hOB). Southern blot of RT-PCR products with a 32P-labeled cDNA probe for the human aromatase demonstrated that FLG 29.1 and hOB cells express aromatase mRNA. Gene expression and enzyme activity were stimulated in a time-dependent fashion by 5.0 ␮l/ml BV and by either 1–50 nM TPA or 0.01–0.5 ng/ml TGF-␤1, with maximal responses after 2–3 h exposure. After 24 h incubation of the cells in the absence of these stimuli the aromatase mRNA and the protein were barely detectable. These ﬁndings demonstrate that cells of the osteoclastic lineage synthesize aromatase in vitro by the local cytokine of TGF-␤1 and BVA. These can offer an explanation for the lack of development of osteoarthritis in BVA-treated patients. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Rheumatoid arthritis; Bee venom aqua-acupunture (BVA); Aromatase; Gene expression; Activity; Human leukaemic cell FLG 29.1; Primary osteoblastic cells

1. Introduction into the patients inhibit cytokine production from both T cells and macrophages and potent effects on RA. In addi- Bee venom aqua-acupunture (BVA) (api-toxin) has been tion, it was also investigated that the anti-inﬂammatory ef- widely used in the treatment of some immune-related dis- fect of the BVA on an acute inﬂammatory process using the ease, especially rheumatoid arthritis (RA) and satisfactory carrageenan-induced edema test (Winter et al., 1962). Treat- results are obtained (Kwon et al., 2001, 2002). However, lit- ment with BVA could inhibit the onset and development of tle is known about the mode of action of this medication arthritis and the immune responses to collagen, but that BVA on RA. Previously, BVA inhibited production of IL-1␤ and cannot change the severity when the disease was established. TNF-␣ from macrophages in response to in vivo stimula- It was suggested that the local conversion of sex steroid tion with bacterial lipopolysaccharides when the extract was precursors to estrogens could be involved in the pathogen- administered into mice once a day for 7 days (Shin, 2002; esis of postmenopausal osteoporosis. Estrogen biosynthesis Kwon et al., 2001), suggesting that the BVA administered is catalyzed by the enzyme complex aromatase/cytochrome P450 mainly in the adipose tissue with androstenedione as ∗ Corresponding author. Tel.: +82 54 770 2663; fax: +82 54 770 2281. the principal precursor (Grodin et al., 1973; Simpson et al., E-mail address: [email protected] (C.-H. Kim). 1989). However, there is increasing evidence that glucocor-

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.jep.2005.02.025 246 K.-S. Kim et al. / Journal of Ethnopharmacology 99 (2005) 245–252 ticoids, known stimulators of estrogen formation in adipose previously described (Hong et al., 2002). For primary hu- tissue (Simpson et al., 1981), enhance both aromatase activ- man osteoblastic cells, bone specimens were obtained from ity (Tanaka et al., 1993; Nawata et al., 1995) and its gene the iliac crest of a patient (men; 35 years) undergoing cor- expression in osteoblast-like cells (Nawata et al., 1995), sug- rective surgery after traumatic fracture. The patient had not gesting that locally synthesized estrogen may act directly on signs or symptoms of bone or joint disease. The study was bone formation. Thus, aromatase activation stimulates skele- approved by the Institutional Review Board of the Dong- tal modeling and increases bone size and mass in growing guk University, and written informed consent was obtained rats, and aromatase inhibition impairs skeletal modeling and from patient. We obtained RNA from primary first-passage decreases bone size and mass. hOB from cultures of trabecular bone explants as previously Therefore, in this study, we examined the influence of described (Siggelkow et al., 1999). These hOB cells have BVA on osteoblastic cellular responses by using human os- been shown to represent the phenotype of the mature osteoblastic cells. To evaluate the possible synthesis of estro- teoblast, were grown at 37 ◦C, maintained in phenol red- gen in cells of the osteoclastic lineage, we used the human free minimal essential medium (MEM) supplemented with leukemic cell line FLG 29.1, which is induced to differentiate 10% charcoal-stripped fetal calf serum (cs-FCS), and were toward the osteoclastic phenotype by phorbol esters (Gattei cultured in serum-free MEM supplemented with 0.125% et al., 1992) and transforming growth factor-␤1 (TGF-␤1) (w/v) bovine serum albumin (BSA) for 4 days prior to RNA (Fiorelli et al., 1994), and also the primary first-passage os- isolation. teoblastic cells (hOB). The present results clearly demonstrated that the BVAstrongly stimulated aromatase activation 2.3. Reverse transcription-polymerase chain reaction in FLG19.1 and hOB cells in vitro. In this paper, we have (RT-PCR) evaluated BVA for its effectiveness on cellular responses to aromatase expression in the human osteoblastic cells. In an Poly(A)+ RNA was isolated from FLG 29.1 using attempt to gain further insight into the mode of action of oligo (dT) affinity chromatography according to Oligotex BVA, we also investigated the effects of BVA on the enzyme kit instructions (Quiagen Korea Co., Seoul, Korea). To- activity. tal RNA from adipose tissue specimens, obtained from The results clearly demonstrate that FLG 29.1 and hOB women undergoing elective abdominal surgery who gave cells express functional aromatase and that BVA, with to- written consent, was isolated using a commercial kit (Quia- gether phorbol esters and TGF-␤1, induce an increase of both gen Co. or Promega Co.). First strand cDNA synthesis aromatase mRNA and enzymatic activity. and PCR amplification were performed as previously described (Kim et al., 2001) with minor modifications. Briefly, 100 ng of poly(A)+ RNA or 1 ␮g of total RNA was re- 2. Materials and methods verse transcribed using 20 units of moloney leukemia virus reverse transcriptase (Stratagen, La Jolla, CA, USA) 2.1. Materials ina50␮l volume. PCR amplification was carried out in 50 ␮l PCR buffer (10 mM Tris–HCl, pH 8.3) with Saline-mixed BVA was purchased from Monmouth Pain 2.5 mM MgCl2, 200 ␮M dNTP with 0.5 units of cloned Institute Inc., New Jersey, USA as an i.p. injection grade for Thermus aquaticus DNA polymerase (Amplitaq, Perkin- human. Each bial contained 10 ml of the BVA. For applica- Elmer, Korea), and 0.1 ␮M of each primer. One PCR cy- tion in cell culture, randomly selected bials were suspended in cle (30 cycles total) consisted of denaturation at 94 ◦C for normal saline at a concentration of 5 ␮l/100 ␮l. In some case, 1 min, annealing at 60 ◦Cor66◦C for 1 min, and poly- original concentration of BV was used. Culture flasks and merization at 72 ◦C for 1 min. PCR products were elec- dishes were obtained from Nunc (Roskilde, Denmark). Media trophoresed on 1–1.5% agarose gel, visualized by ethid- and sera for cell culture were purchased from Jeil Biotech Ser- ium bromide staining and photographed under UV light. vices (Daegu, Korea). [␣-32P]-dCTP was from DuPont-NEN The sequences of sense and anti-sense primers (Bioneer Co., (Boston, MA) or from Amersham International Co. (Seoul, Korea) were 5-GAATATTGGAAGGATGCACAGACT, cor- Korea). The human ␤-actin cDNA insert and the ExpressHyb responding to a sequence in exon 9, and 5-GGGTAAA- hybridization solution were purchased from Clontech (Palo GATCATTTCCAGCATGT, complementary to a sequence Alto, CA). All other chemicals and biochemicals were of of exon 10 of the human aromatase gene (Steele et al., analytical grade and were purchased from Sigma Chemical 1987), respectively; with an expected product of 293 bp, Co. (St. Louis, MO) or Boehringer Mannheim Biochemicals previously used in human breast tumor tissues (Koos et (Seoul, Korea). al., 1993), or 5-CCGGCCTTGTTCGTATGGTCA, corresponding to a sequence in exon 5 (sense primer) and 5- 2.2. Cell culture GTCTCATCTGGGTGCAAGGA, complementary to a sequence of exon 10 of the human aromatase gene (anti- FLG 29.1 cells were cultured in RPMI-1640 culture sense primer) with an expected product of 987 bp, previ- medium, supplemented with 10% fetal calf serum (FCS) as ously used in human osteoblast-like cells (Nawata et al., K.-S. Kim et al. / Journal of Ethnopharmacology 99 (2005) 245–252 247

1995). The mRNA integrity and the amplification efficiency two times to ensure that the results were quantitatively of aromatase transcripts were evaluated by the amplification reproducible. of a ␤-actin sequence (expected size = 224 bp) from equivalent amounts of poly(A)+ RNA of each sample. The se- 2.5. Densitometric analysis quences of sense and anti-sense primers for ␤-actin amplification were 5 -CCC AGC ACA ATG AAG ATC AA-3 The intensity of the bands obtained from PCR studies was (sense primer), corresponding to a sequence in exon 4, and estimated with Gel-Print System (Core Bio Corp., Seoul, Ko- 5 -TTT CTG CGC AAG TTA GGT TTT GAC AA-3 , correa), as described previously (Park et al., 2005). The values responding to a sequence in exon 5 (anti-sense primer). PCR are expressed as means ± S.E. analyses were repeated 2–4 times on each sample to control whether relative differences in yield of PCR products between samples reflected differences in mRNA concentra- 2.6. Analytical methods tions or random assay variability. The transcripts were visualized by ethidium bromide staining of agarose gel. To Protein contents were determined by a Protein assay kit test the specificity of the transcripts, the RT-PCR products of Bio-Rad Laboratories (Richmond, CA, USA). were electrophoresed through a 1.5% agarose gel, blotted onto a nylon membrane, and hybridized with a 32P-labeled 2.7. Statistics human aromatase cDNA probe (Kim et al., unpublished results). Data were expressed as mean ± S.D. Statistical differences were analyzed using one-way analysis of variance. 2.4. Aromatase activity assay Significance was adjusted for multiple comparisons of means using Bonferroni’s approximation. The aromatase activity was estimated by determining the incorporation of tritium from [3H]androstenedione ([3H]A; 1b, 2b-N-3H)androst-4-ene-3,17-dione; 42 Ci/mM; 1Ci = 42 3. Results GBq; New England Nuclear, UK) into [3H]water (Means et al., 1989) in FLG 29.1 cells. Cells were seeded in the appro- 3.1. Effect of BVA on aromatase expression in the cells priate growth medium with or without 5% dextran-charcoal stripped FCS (DCS-FCS) in the absence or presence of var- To amplify aromatase mRNA, poly(A) RNA from un- ious stimuli. After 3–48 h, cells were washed, re-suspended treated and TPA-treated FLG 29.1 cells and total RNA from in fresh medium with or without 5% DCS–FCS, and in- human adipose tissue, used as control, were reverse tran- cubated (1 × 106 cells/well) in 6-well plates with [3H]A scribed. The aromatase cDNA was amplified by using either at 0.5 nM to 100 nM concentrations for kinetic studies, or a sense primer corresponding to a sequence in exon 9 and an with 2 nM [3H]A for single point determination of enzy- anti-sense primer corresponding to a sequence in exon 10 of matic activity, at 37 ◦C in humidified atmosphere for 6 h, the human aromatase gene (Means et al., 1989). The products unless otherwise stated. After condensing water paper by of the expected size from the different amplification (987 bp) placing the culture plates on ice for 15 min, cells were were observed in samples from FLG 29.1 cells and adipose then pelleted and the incubation medium was removed. Af- tissue (Fig. 1). Treatment of BV induced the expression of ter cells were then washed twice with phosphate-buffered the aromatase with increasing activity by a dose-dependent saline (2.6 mM KCl/1.4 mM KH2PO4/140 mM NaCl/8 mM manner (0–10 ␮l/ml). It was clearly induced by 24 h treat- Na2HPO4·7H2O/0.5 mM MgCl2·6H2O/1 mM CaCl2), pro- ment with 50 nM TPA (Fig. 1), known to affect FLG 29.1 tein content was determined. The incubation medium and cell differentiation (Nestler, 1993). The BVAinduction of the the combined saline washes were pushed through a pre- 987 bp transcript appeared to be dose-dependent with max- equilibrated Sep-Pak C18 minicolumn into a counting vial imal expression after 2–4 h of treatment (Fig. 2). Similarly, (Nestler, 1993). The column was washed with water to re- TGF-␤1 induced aromatase expression by dose-dependent move residual [3H]water. Scintillation liquid (15 ml) was manner after 3 h treatment, although the expression level was added and the radioactivity was counted after equilibra- much lower than those of BVA or TPA. The same products tion. Each experiment was conducted in triplicate. To of the expected size as that of FLG 29.1 cells were also ob- establish the non-specific release of [3H]water duplicate served in samples from the primary first-passage hOB from aliquots of [3H]A-supplemented cell-free medium were in- cultures of trabecular bone explants (Fig. 3). Treatment of cubated and the blank value, which averaged 0.8% of the BVAinduced the expression of the aromatase with increasing added radioactivity after 6 h incubation, was subtracted activity by a dose-dependent manner (0 to 10 ␮l/ml). Treat- from the amount measured in the experimental incuba- ments for 50 nM TPA or TGF-␤1 induced the aromatase ex- tions. The aromatase activity was expressed as fmol of pression. However, the expression level by TGF-␤1 was al- [3H]A metabolized/mg cell protein/6 h. Each experiment most same level of BVA or TPA, as compared to the FLG was conducted in triplicate and was repeated at least 29.1 cells. 248 K.-S. Kim et al. / Journal of Ethnopharmacology 99 (2005) 245–252

Fig. 1. RT-PCR amplification of aromatase mRNA from FLG 29.1 cells and human adipose tissue. Poly(A)+RNA from cells treated with 10 ␮l/ml BVA Fig. 3. RT-PCR amplification of aromatase mRNA from the primary first- (lane 1), 5 ␮l/ml BVA (lane 2) or untreated (lane 3) for 24 h. RNAs from passage hOB and Southern blot of RT-PCR products from the hOB with a 50 nM TPA-treated cells (lane 5) and human adipose tissue (lane 4) were 32P-labeled human aromatase cDNA. (A) Poly(A)+RNA from cells treated reverse transcribed using couples of primers and the amplification products with 50 nM TPA (lane 1), 1.0 ng/ml TGF-␤1 (lane 2), 5.0 ␮l/ml BVA (lane were visualized by ethidium bromide staining. The position and the size of 3), 2.0 ␮l/ml BVA(lane 4), 0.5 ␮l/ml BVA(lane 5) for 24 h or untreated (lane marker fragments are reported on the left, while the position and the expected 6) were reverse transcribed using couples of primers and the amplification sizes of the transcripts are reported on the right (987 bp). Result treated with products were visualized by ethidium bromide staining. (B) Southern blot 10 ␮l/ml BVA has been used as control (100%). analysis of panel A. The expected sizes of the transcripts are reported on the right. (C) Equivalent amounts of poly(A)+ mRNA of each sample were 3.2. Effect of BVA on aromatase activity analyzed for the amplification of a human ␤-actin sequence.

Aromatase activity was determined in FLG 29.1 cells and 3 3 leased from [ H]A. In all experimental conditions the rate the primary first-passage hOB by measuring [ H]H2O re- of aromatase activity was linear for up to 24 h incubation (data not shown). Therefore, the enzymatic activity was evaluated by incubating [3H]A for 6 h. BVA markedly increased the enzymatic activity in a dose-dependent fashion, reaching the maximum at 5 ␮l/ml concentration with no significant differences up to 10 ␮l/ml concentration (Table 1). To evaluate the specificity of the assay, FLG 29.1 cells and the primary first-passage hOB after 4 h exposure to culture medium supplemented with 5 ␮l/ml BVA were incubated with 2 nM [3H]A in the absence or presence of 100 nM to 1 ␮M concentration of the non-steroidal aromatase inhibitor CGS16949A (Buzdar, 2001). CGS16949A inhibited the aromatase activity with a dose-dependent fashion reaching approximately 90% suppression of the enzyme activity (not shown). A similar pattern of induction was shown by TPA and TGF-␤1 in both cell types. After 24 h incubation, although the mean values of aromatase activity in both cells treated with the different agents were higher than in untreated cells, only those under BVA and TPA treatment were significantly different from the control (Table 2). On the con- trary, either 0.5 mM dibutyryl cAMP (Bt2-cAMP) or 50 nM Fig. 2. Time- and dose-dependent effect of BVA and TGF-␤1 on aromatase dexamethasone (DEX) did not significantly affect the basal ␮ RT-PCR products. FLG 29.1 cells were treated with 5 l/ml BVA for 0 (lane rate of the enzyme activity (Table 2). With respect to the 1), 2 h (lane 2) and 4 h (lane 3). Also, cells were treated with 0.01 ng/ml TGF-␤1 (lane 4), 0.1 ng/ml TGF-␤1 (lane 5) and 1.0 ng/ml TGF-␤1 (lane DEX effect on aromatase activity, Shozu et al. (2001) re- 6) for 24 h and the aromatase mRNA expression was evaluated by RT-PCR ported that DEX induces aromatase activity in the THP-1 analysis. The size and the position of the expected transcript of 987 bp is cell line and fetal human osteoblast-like cells. However, the reported. Equivalent amounts of poly(A)+ mRNA of each sample were ana- THP-1 cell line is different cell line from our present FLG ␤ lyzed for the amplification of a human -actin sequence(not shown). Result 29.1 cells that differentiates into macrophage/osteoclast-like treated with 5 ␮l/ml BVA for 4 h has been used as control (100%). K.-S. Kim et al. / Journal of Ethnopharmacology 99 (2005) 245–252 249

Table 1 Effect of different concentrations of BVA on the aromatase activity by FLG 29.1 cells and the primary first-passage hOB BVA (␮l/ml) 0 0.1 1 2 5 10 Aromatase activity (fmol/mg/protein/6 h) in FLG 29.1 cells 12.3 ± 1.3 23.5 ± 1.6 32.4 ± 2.5 48.4 ± 3.6 89.5 ± 6.5 93.2 ± 6.5 Aromatase activity (fmol/mg/protein/6 h) in hOB cells 16.4 ± 1.2 31.3 ± 2.3 38.3 ± 3.6 54.3 ± 5.6 121.2 ± 8.3 95.6 ± 7.8 After 24 h in the appropriate medium supplemented with the indicated concentrations (␮l/ml) of BVA, 2 nM [3H]A was added to the cells. The enzymatic activity was measured after 2 h incubation. Results are expressed as mean ± S.D. of triplicates from two separate experiments. cells which possesses high aromatase activity. In addition, (Shin, 2002; Kwon et al., 2001), suggesting that the BVA ad- fetal human osteoblast-like cells show different phenotype ministered into the patients inhibit cytokine production from that can differentiate into osteoblastic or osteoclastic lineage both T cells and macrophages and potent effects on RA. during cultivation, showing difference from the present pri- On the other hand, BVA treatment, which began concur- mary human osteoblastic cells obtained from the adult bone rently with a booster injection, also significantly suppressed tissues. the development of arthritis and immune responses to collagen. The precise mechanisms accounting for these phe- nomena are not clear, but similar observations were made by 4. Discussion Asano et al. (1998), who showed that delayed traditional Chi- nese extract treatment could suppress development of arthritis BVA is widely used in the chronic management and the and of immunity to collagen. It is observed that BVA is able treatment of RA, particularly, in Korea. However, the mech- to suppress clonal expansion of helper T cells, when it is ad- anism by which the BV modify the clinical status of RA ministered intraperitoneally into rat. Therefore, although the are not well understood. There is general consensus that mechanism(s) by which BVA exerts suppressive effects on CD4+ T cells act as initiators of RA, by migrating to the clonal T cell expansion is not well understood, this regimen affected joints, recognizing peptides derived from processed might theoretically lead to specific clonal depletion and result antigens, and releasing several types of cytokines (Firestein in inhibition of development of the diseases. An alternative and Zvaifler, 1990; Panayi et al., 1992). Such cytokines en- explanation is that the time of a booster injection may still be hance the function of other cells, especially macrophages within the induction phase of arthritis. Since the clinical treat- to produce pro-inflammatory cytokines including IL-1␤ and ment with immunosuppressing agents such as cyclosporin A TNF-␣ (Feldmann et al., 1996). BVA also inhibited produc- and FK-506 had a beneficial effect in patients with refractory tion of IL-1␤ and TNF-␣ from macrophages in response to RA (Weinblatt et al., 1987; Yocum, 1994), BVA might be a in vivo stimulation with bacterial lipopolysaccharides when useful tool for the treatment of RA. It would be incredible if the extract was administered into mice once a day for 7 days the drugs as powerful as this did not have serious toxicity, but

Table 2 Effect of BVA, TPA, TGF-␤1, Bt2cAMP and dexamethasone on aromatase activity in FLG 29.1 cells and hOB cells Agents Aromatase activity (fmol/mg protein/2 h) after time treatment 2h 12h 24h FLG 29.1 cells None 16.7 ± 2.4 (n = 6) 11.4 ± 1.6 (n = 5) 10.5 ± 3.5 (n =4) +5 ␮l/ml BVA 87.3 ± 14.3 (n =4)** 76.8 ± 4.5 (n =5)** 33.3 ± 5.3 (n =6)* +50 nM TPA 43.3 ± 4.3 (n =4)* 41.5 ± 6.2 (n =3)* 21.3 ± 2.5 (n =5)* +TGF-␤1 (0.1 ng/ml) 45.3 ± 5.2 (n =5)* 36.5 ± 4.3 (n =4)* 25.2 ± 3.5 (n =4)* +0.5 mM Bt2cAMP 14.3 ± 1.6 (n = 3) 10.5 ± 2.2 (n = 3) 9.4 ± 1.1 (n =4) +50 nM DEX 12.2 ± 3.1 (n = 4) 12.1 ± 2.1 (n = 3) 9.6 ± 2.3 (n =3) hOB cells None 16.5 ± 2.4 (n = 3) 13.6 ± 2.2 (n = 4) 12.1 ± 1.2 (n =3) +5 ␮l/ml BVA 95.4 ± 21.2 (n =5)** 68.6 ± 7.2 (n =4)** 43.3 ± 4.6 (n =3)* +50 nM TPA 56.7 ± 5.7 (n =3)* 47.3 ± 5.4 (n =3)* 42.2 ± 4.4 (n =5)* +TGF-␤1 (0.1 ng/ml) 62.3 ± 5.6 (n =3)** 42.4 ± 6.4 (n =5)* 34.3 ± 6.4 (n =3)* +0.5 mM Bt2cAMP 16.3 ± 2.3 (n = 4) 14.3 ± 3.2 (n = 4) 12.2 ± 4.3 (n =4) +50 nM DEX 13.4 ± 5.2 (n = 3) 12.3 ± 3.6 (n = 4) 10.4 ± 2.2 (n =4) After the indicated incubation times with the different agents, 2 nM [3H]A was added to the cells and the enzymatic activity was evaluated after 6 h incubation. ∗ P < 0.05, significantly different from each normal control as expressed to “None”. ∗∗ P < 0.01, significantly different from each normal control as expressed to “None”. 250 K.-S. Kim et al. / Journal of Ethnopharmacology 99 (2005) 245–252 further studies will be necessary to answer this question. The sion in a transient fashion, however, enzyme activity although recommended dose of BVAin the management and treatment time-dependently modulated by the different agents, are de- of rat CIA will be 20 ␮l/kg, which is two-firth of human ther- tectable. However, cAMP was ineffective in stimulating aro- apeutic dose. However, biochemical and metabolic analysis matase activity in both cells of FLG 29.1 cells and hOB cells. of the constituents of BVA have to be analyzed in further Thus, it can be speculated that the induction of aromatase delineating its mechanisms of action in arthritis. gene is probably mediated by protein kinase C-dependent Sex hormones appear to play an important role as mod- transcriptional mechanism. In fact, TPA is well known acti- ulators of autoimmune disease onset/perpetuation. Steroid vators of protein kinase C-dependent early gene transcription hormones are implicated in the immune response, with es- (Treisman, 1986; Nishizuka, 1984). In addition, there is in- trogens as enhancers at least of humoral immunity, and creasing evidence that also TGF-␤ action can be transduced androgens and progesterone (and glucocorticoids) as nat- by phosphorylation events (Purohit et al., 1992). ural immune suppressors. Steroid hormones can be con- On the other hand, serum levels of estrogens have been verted along defined pathways to downstream hormones in found to be normal in RA patients and synovial fluid levels the periphery. The estrogen-synthesizing enzyme complex (SF) of proinflammatory estrogens relative to androgens are termed aromatase cytochrome P450 is implicated in bone significantly elevated in RA patients (Cutolo et al., 2003). metabolism. The cells of osteoclastic lineage can express The increased estrogen concentrations observed in RA SF aromatase cytochrome P450 gene and the enzyme activity are characterized mainly by the hydroxylated forms, in par- was markedly and transiently induced by the phorbol ester ticular 16 ␣-hydroxyestrone, having a mitogenic stimulat- TPA or TGF-␤1. The regulation of the human aromatase ing role, suggesting that steroid pre-hormones are converted cytochrome P450 gene expression by various agents, such to pro-inflammatory estrogens in the synovial tissue in the as glucocorticoids, cAMP analogs, a variety of growth fac- presence of inflammatory cytokines. It was also reported tors and phorbol esters (Simpson et al., 1994; Harada et al., that 17-␤ estradiol (E2) enhances the expression of mark- 1993), is suggestive of a control of aromatase expression. ers of cell growth and proliferation (Cutolo et al., 2003). In in vivo effects of estrogen deficiency in a murinemodel Recently, the same group reported that the increased estro- for RA, the RA lesions were entirely recovered by pharma- gen concentration observed in RA SF is characterized by cological levels of estrogen administration (Yoneda et al., the hydroxylated forms, in particular 16␣-hydroxyestrone, 2004), indicating that estrogen deficiency may play a cru- that is a mitogenic and proliferative endogenous hormone cial role in acceleration of autoimmune arthritis. Another ro- (Cutolo et al., 2004). In contrast to 16␣-hydroxylated es- dent model of estrogen deficiency is the aromatase-knockout trogens, the 2-hydroxylated forms inhibit growth promoting (ArKO) mouse. Using the ArKO mice, Shim et al. (2004) effects of E2 and were found low in RA SF. Therefore, it revealed that estrogen deficiency results in an autoimmune was suggested that dose-related conversion to pro- or anti- disease, suggesting that estrogen might have clinical value inflammatory downstream metabolites of estrogens might in the prevention or treatment of RA. In patients with RA, support the dual role of estrogens (pro- or anti-inflammatory) 17␤-estradiol was thought to play a dual pro- and anti- for example during estrogen replacement therapy, depending inflammatory role depending on its concentration or probably on local concentration (i.e. SF in RA) of 16␣-hydroxyestrone conversion to downstream mitogenic 16 ␣-hydroxyestrone or or 2-hydroxyestrogens. The presence in the RA SF of an naturally occurring anti-estrogens such as 2-hydroxyestrone. altered sex hormone balance resulting in lower immuno- This study in RA patients clearly demonstrates a large shift to suppressive androgens and higher immunoenhancing estro- mitogenic estrogens in relation to endogenous anti-estrogens. gens, might determine a favorable condition for the devel- Both steroids are converted from the precursor 17␤-estradiol opment of the immunomediated RA synovitis and synovial and estrone. In patients with RA, the magnitude of conversion hyperplasia. to the mitogenic 16 ␣-hydroxyestrone is greatly upregulated, In conclusion, the present results clearly demonstrated that which likely contributes to maintenance of the proliferative the BVAstrongly stimulated aromatase activation in FLG19.1 state in these diseases (Weidler et al., 2004). and hOB cells in vitro, allowing possible in vitro estrogen FLG 29.1 and hOB cell aromatase activities are not in- production by bone-derived cells, as also demonstrated in duced by cAMP analogs and dexamethasone. This is in con- cells of the osteoblastic lineage (Tanaka et al., 1993; Nawata trast to other systems (Simpson et al., 1989; Simpson et al., et al., 1995; Centrella et al., 1994; Fiorelli et al., 1998). The 1994; Purohit et al., 1992). However, the stimulation by TGF- results also explain that BVA is mechanistically effective for ␤1 is inductive. Bone matrix is one of the major storage sites the bone metabolism. for TGF-␤1 and TGF-␤ isoforms are directly involved in bone remodeling via an autocrine and/or paracrine mechanism of action (Centrella et al., 1994). Moreover, it was re- Acknowledgment cently demonstrated that FLG 29.1 and hOB cells produce TGF-␤1 and bear functional receptors for the growth fac- This work was supported by National Research Labora- tor (Fiorelli et al., 1994). Interestingly, both TGF-␤1 and tory Program (2002-2007) of Ministry of Science and Tech- phorbol ester appear to induce aromatase mRNA expres- nology, Korean. K.-S. Kim et al. / Journal of Ethnopharmacology 99 (2005) 245–252 251

References ble for estrogen biosynthesis. Journal of Biological Chemistry 264, 19385–19391. Asano, K., Matsuishi, J., Yu, Y., Kasahara, T., Hisamitsu, T., 1998. Sup- Nawata, H., Tanaka, S., Tanaka, S., Takayanagi, R., Sakai, Y., Yanase, pressive effects of Tripterygium wilfordii Hook f, a Chinese traditional T., Ikuyama, S., Haji, M., 1995. Aromatase in bone cell: associa- medicine, on collagen arthritis. Immunopharmacology 39, 117–126. tion with osteoporosis in postmenopausal women. Journal of Steroid Buzdar, A.U., 2001. A summary of second-line randomized studies of Biochemistry and Molecular Biology 53, 165–174. aromatase inhibitors. Journal of Steroid Biochemistry and Molecular Nestler, J.E., 1993. Interleukin-1 stimulates the aromatase activity of hu- Biology 79, 109–114. man placental cytotrophoblasts. Endocrinology 132, 566–570. Cutolo, M., Capellino, S., Montagna, P., Villaggio, B., Sulli, A., Seriolo, Nishizuka, Y., 1984. The role of protein kinase C in cell surface signal B., Straub, R.H., 2003. New roles for estrogens in rheumatoid arthritis. transduction and tumor promotion. Nature 308, 693–698. Clinical and Experimental Rheumatology 21, 687–690. Panayi, G.S., Lachburry, J.S., Kingsley, J.S., 1992. The importance of the Cutolo, M., Villaggio, B., Seriolo, B., Montagna, P., Capellino, S., Straub, T cell in initiating and maintaining the chronic synovitis of rheumatoid R.H., Sulli, A., 2004. Synovial fluid estrogens in rheumatoid arthritis. arthritis. Arthritis and Rheumatism 35, 729–736. Autoimmunology Review 3, 193–198. Park, W.H., Kim, S.H., Kim, C.H., 2005. A new matrix metalloproteinase- Feldmann, M., Brennan, F.M., Maini, R.N., 1996. Role of cytokines in 9 inhibitor 3, 4-dihydroxycinnamic acid (caffeic acid) from methanol rheumatoid arthritis. Annual Review of Immunology 14, 397–440. extract of Euonymus alatus: isolation and structure determination. Centrella, M., Horowitz, M.C., Wozney, J.M., McCarthy, T.L., 1994. Toxicology 207, 383–390. Transforming growth factor-␤b gene family members and bone. En- Purohit, A., Flanagan, A.M., Reed, M.J., 1992. Estrogen synthesis by docrinology Review 15, 27–39. osteoblast cell lines. Endocrinology 131, 2027–2029. Fiorelli, G.R., Ballock, T., Wakefield, L.M., Sporn, M.B., Gori, F., Masi, Shim, G.J., Warner, M., Kim, H.J., Andersson, S., Liu, L., Ekman, J., L., Frediani, U., Tanini, A., Bernabei, P.A., Brandi, M.L., 1994. Imamov, O., Jones, M.E., Simpson, E.R., Gustafsson, J.A., 2004. Role for autocrine TGF-␤ 1 in regulating differentiation of a human Aromatase-deficient mice spontaneously develop a lymphoprolifera- leukemic cell line toward osteoclast-like cells. Journal of Cellular tive autoimmune disease resembling Sjogren’s syndrome. Proceed- Physiology 160, 482–490. ings of the National Academy of Sciences U.S.A. 101, 12628– Fiorelli, G., Frediani, U., Martineti, V., Franchi, A., Gori, F., 12633. Franceschelli, F., Tanini, A., Serio, M., Brandi, M.L., 1998. Aromatase Shin, Y.S., 2002. Bee venom produces antinociceptive and anti- expression and activity in the human leukaemic cell line FLG 29.1. inflammatory effects on rheumatoid arthritis in rats. Thesis for Master Journal of Steroid Biochemistry and Molecular Biology 66, 105–112. Degree, Dongguk University Graduate School, Kyungju, Korea. Firestein, G.S., Zvaifler, N.J., 1990. How important are T cells in chronic Shozu, M., Sumitani, H., Murakami, K., Segawa, T., Yang, H.J., Inoue, rheumatoid synovitis? Arthritis and Rheumatism 33, 768–773. M., 2001. Regulation of aromatase activity in bone-derived cells: pos- Gattei, V., Bernabei, P.A., Pinto, A., Bezzini, R., Ringressi, A., Formigli, sible role of mitogen-activated protein kinase. Journal of Steroid Bio- L., Tanini, A., Attadia, V., Brandi, M.L., 1992. Phorbol ester induced chemistry and Molecular Biology 79, 61–65. osteoclast-like differentiation of a novel human leukemic cell line Siggelkow, H., Rebenstorff, K., Kurre, W., Niedhart, C., Engel, I., Schulz, (FLG 29.1). Journal of Cell Biology 116, 437–447. H., Atkinson, M.J., Hufner, M., 1999. Developmental of the osteoblast Grodin, J.M., Siiteri, P.K., MacDonald, P.C., 1973. Source of estrogen phenotype in primary human osteoblasts in culture: comparison with production in the postmenopausal women. Journal of Clinical and rat calvarial cells in osteoblast differentiation. Journal of Cellular Bio- Endocrinological Metabolism 36, 207–214. chemistry 75, 22–35. Harada, N., Utsumi, T., Takagi, Y., 1993. Tissue-specific expression of Simpson, E.R., Ackerman, G.E., Smith, M.E., Mendelson, C.R., 1981. Es- the human aromatase cytochrome P-450 gene by alternative use of trogen formation in stromal cells of adipose tissue of women: induc- multiple exons 1 and promoters, and switching of tissue-specific exons tion of glucocorticoids. Proceeding of National Academy of Sciences 1 in carcinogenesis. Proceeding of National Academy of Sciences of of U.S.A. 78, 5690–5694. U.S.A. 90, 11312–11316. Simpson, E.R., Merrill, J.C., Hollub, A.J., Graham-Lorence, S., Mendel- Hong, H.T., Kim, H.J., Kim, D.W., Lee, Y.C., Park, Y.G., Kim, H.M., son, C.R., 1989. Regulation of estrogen biosynthesis by human adi- Choo, Y.K., Kim, C.H., 2002. Inhibitory effect of a Korean traditional pose cells. Endocrinology Review 10, 136–148. medicine, Honghwain-Jahage (water extracts of Carthamus tinctorius Simpson, E.R., Mahendroo, M.S., Means, D., Kilgore, M.W., Hinshel- L. seed and Homminis placenta) on interleukin-1-mediated bone re- wood, M.M., Graham-Lorence, S., Amarneh, B., Ito, Y., Fisher, C.R., sorption. Journal of Ethnopharmacology 79, 143–148. Michael, D., Mendelson, C.R., Bulun, S.E., 1994. Aromatase cy- Kim, K.W., Kim, S.W., Min, D.S., Kim, C.H., Lee, Y.C., 2001. Genomic tochrome P450, the enzyme responsible for estrogen biosynthesis. structure of human GM3 synthase gene (hST3Gal V) and identifi- Endocrinology Review 15, 342–355. cation of mRNA isoforms on the 5 untranslated region. Gene 273, Steele, R.E., Mellor, L.B., Sawyer, W.K., Wasvary, J.M., Browne, L.J., 163–171. 1987. In vitro and in vivo studies demonstrating potent and se- Koos, R.D., Banks, P.K., Inkster, S.E., Yue, W., Brodie, A.M., 1993. lective estrogen inhibition with the nonsteroidal aromatase inhibitor Detection of aromatase and keratinocyte growth factor expression in CGS16949A. Steroids 50, 147–161. breast tumors using reverse transcription-polymerase chain reaction. Tanaka, S., Haji, M., Nishi, Y., Yanase, T., Takayanagi, R., Nawata, H., Journal of Steroid Biochemistry and Molecular Biology 45, 217– 1993. Aromatase activity in human osteoblast-like osteosarcoma cell. 225. Calcified Tissue International 52, 107–109. Kwon, Y.B., Lee, J.D., Lee, H.J., Han, H.J., Mar, W.C., Kang, S.K., Beitz, Treisman, R., 1986. Identification of a protein-binding site that mediates A.J., Lee, J.H., 2001. Bee venom injection into an acupuncture point transcriptional response of the c-fos gene to serum factors. Cell 46, reduces arthritis associated edema and nociceptive responses. Pain 90, 567–574. 271–280. Weidler, C., Harle, P., Schedel, J., Schmidt, M., Scholmerich, J., Straub, Kwon, Y.B., Lee, H.J., Han, H.J., Mar, W.C., Kang, S.K., Yoon, O.B., R.H., 2004. Patients with rheumatoid arthritis and systemic lupus ery- Beitz, A.J., Lee, J.H., 2002. The water-soluble fraction of bee venom thematosus have increased renal excretion of mitogenic estrogens in produces antinociceptive and anti-inflammatory effects on rheumatoid relation to endogenous antiestrogens. Journal of Rheumatology 31, arthritis in rats. Life Sciences 71, 191–204. 489–494. Means, G.D., Mahendroo, M.S., Corbin, C.J., Mathis, J.M., Powell, F.E., Weinblatt, M.E., Coblyn, J.S., Fraser, P.A., 1987. Cyclosporin A treat- Mendelson, C.R., Simpson, E.R., 1989. Structural analysis of the gene ment of refractory rheumatoid arthritis. Arthritis and Rheumatism 30, encoding human aromatase cytochrome P-450, the enzyme responsi- 11–17. 252 K.-S. Kim et al. / Journal of Ethnopharmacology 99 (2005) 245–252

Winter, C.A., Risley, E.A., Nuss, G.W., 1962. Carrageenan-induced edema murine autoimmune arthritis associated with receptor activator of nu- in hind paw of the rat as an assay for antiinﬂammatory drugs. Pro- clear factor-kappa B ligand-mediated osteoclastogenesis. Endocrinol- ceedings of the Society of Experimental Biology and Medicine 111, ogy 145, 2384–2391. 544–547. Yocum, D.E., 1994. The use of immunomodulators in early rheuma- Yoneda, T., Ishimaru, N., Arakaki, R., Kobayashi, M., Izawa, T., toid arthritis. Seminars in Arthritis and Rheumatism 23, 44– Moriyama, K., Hayashi, Y., 2004. Estrogen deﬁciency accelerates 49. Journal of Ethnopharmacology 99 (2005) 253–257

Antibacterial properties of common herbal remedies of the southwest Christopher David Romero, Suzzette Fontenelle Chopin ∗, Gregory Buck, Elvia Martinez, Michelle Garcia, Lisa Bixby

Texas A and M University-Corpus Christi, Physical and Life Sciences, 6300 Ocean Drive, CS 130D, Corpus Christi, TX 78412, USA Received 26 August 2004; received in revised form 11 February 2005; accepted 17 February 2005 Available online 7 April 2005

Abstract

Curanderismo, widely practiced in the southwest, is an alternative medical system that has been neglected by scientiﬁc research. This project analyzed the antibiotic properties of 23 common herbal remedies used in South Texas to treat wounds and infections. Ethanolic tinctures and aqueous extracts of each plant were prepared and applied to blank diffusion disks. These disks were desiccated and used in Kirby-Bauer disk diffusion susceptibility tests on three bacteria: Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. Control disks contained solvent only. The efﬁcacy of the tinctures and aqueous extracts was compared to that of commercially prepared antibiotic diffusion disks. No inhibition was observed with the aqueous extracts. The various tincture-saturated disks produced zones of clearance ranging from 1 to 5 mm. Ten plants consistently inhibited bacterial growth of Staphylococcus aureus. None of the plants tested produced consistent inhibition of the two Gram-negative species, Pseudomonas aeruginosa and Escherichia coli. No zones of clearance were produced by the solvent-only control disks. The zones of clearance produced by commercial antibiotics were, on average, larger and more uniform than those produced by the tincture disks. Thus, it appears that some of the herbal remedies used in folk medicine are potentially effective antibacterial agents against Staphylococcus aureus. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Antibacterial activity; Herbal remedies; Curanderismo; Folk medicine

1. Introduction with Spanish herbal lore and Catholicism. This vibrant system has roots in Moorish Spain, Grecian humoral medicine, The use of complementary and alternative medicine and Aztecan mythology. Curanderismo is not a static (CAM) has increased dramatically over the past 15 years. system; it has continued its evolution and now often In 1990, an estimated 34% of Americans used some form of incorporates allopathic pharmaceuticals (Trotter, 2001). The CAM, spending $14 billion dollars out of pocket (Eisenberg acceptance of Curanderismo in predominantly Hispanic et al., 1998). By 1997, this figure had jumped to 42% of the communities throughout the United States is still very high U.S. population using CAM, at a cost of $34 billion dollars (Trotter, 2001). A survey of Hispanic outpatients in Denver (Eisenberg et al., 1998). By 1998, visits to CAM providers Colorado showed that 91.3% of them were familiar with had risen to 629 million (Neal, 2001). This trend is expected Curanderismo, and 29.1% had been to a Curandero (Padilla to increase within the United States. Reliable scientific in- et al., 2001). This is probably an under-representation of formation about the safety and efficacy of such treatments is usage within the Hispanic community because for many lacking. One CAM modality that has received little attention individuals, Curanderismo is the primary and sole form is Curanderismo. This health care system has evolved within of health care. Thus, this survey, which was taken in a the Hispanic communities of North America since Spanish clinic, missed the most devout and dependent users of colonialism. It is a blend of indigenous beliefs and practices Curanderismo. One of the main tools used for healing within Curanderismo is herbal remedy. Many of these remedies are ∗ Corresponding author. Tel.: +1 361 825 6022; fax: +1 361 825 3719. used to treat conditions that commonly result from bacterial E-mail address: [email protected] (S.F. Chopin). infections of the gastrointestinal and urinary tracts and in

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.jep.2005.02.028 254 C.D. Romero et al. / Journal of Ethnopharmacology 99 (2005) 253–257 wound infections. The aim of this study was to determine 2.2. Tincture preparation if these treatments were efficacious through direct antibacterial actions. Aqueous and ethanolic plant extracts were Tinctures of the 23 herbs were prepared for the disk dif- evaluated using Kirby-Bauer disk diffusion susceptibility fusion test. The active portion of each plant sample was pul- tests against three common bacteria: Staphylococcus aureus, verized in 95% ethanol using a mortar and pestle. Bark sam- Pseudomonas aeruginosa, and Escherichia coli. ples were macerated in a coffee grinder before they were pulverized. The samples were then placed into individual jars and additional ethanol was added until the samples were fully saturated. The final volume of ethanol was recorded but 2. Materials and methods varied among the samples due to variations in absorbance between the plant materials. The labelled jars were stored 2.1. Plant material in the dark at room temperature for one week and agitated daily to facilitate extraction. Tinctures were not filtered prior Herbs used in this study were selected based upon his- to use to prevent the exclusion of any potentially active torical use, anecdotal evidence, and availability. Family constituents. members and local herbalists were consulted for their advice on plant selection. Leonardo Carillo, Ph.D., a professor of Mexican–American studies and an expert in 2.3. Aqueous preparation Mexican–American folk medicine, provided initial guidance in plant selection. Frank Fregoso, a respected figure in the Aqueous extracts were made from the 10 plants that produced clearance in the ethanolic analysis. Two to three grams Hispanic community of Corpus Christi and herbal purveyor, ◦ also supplied direction. In addition, several texts (Moore, of plant material was placed in 100 ml of 100 C sterile de- 1990; Gruenwald, 1998; Peirce, 1999; WHO, 1999, 2001) ionized water (DI H2O). The plant material was allowed to were used as references for determining the accepted tradi- steep in the water for up to 10 min with the temperature maintained at 100 ◦C and then returned to room tempera- tional usage of the plants tested. All plants tested were re- ◦ ported as being anti-infectives. ture. Aqueous extracts were stored at 3 C and used within The following plants were analyzed using fresh sam- 24 h of preparation. ples: Artemisia ludoviciana (Asteraceae), Castela emoryi (Simaroubaceae), Chenopodium ambrosioides (Chenopo- 2.4. Disk preparation diaceas), Equisetum hyemale (Equisetaceae), Leucophyl- lum frutescens (Scrophulariaceae), Rosmarinus officinalis Sterile blank diffusion disks were weighed and placed (Lamiaceae), Salvia farinacea (Lamiaceae), Salvia greg- into labelled trays for each tincture or aqueous extract. gii (Lamiaceae), Salvia leucantha (Lamiaceae), Salvia Each disk was saturated with 25 ␮l of an individual ethanol officinalis (Lamiaceae), Salvia sinaloensis (Lamiaceae), tincture or aqueous extract. After the solvent had fully Spilanthes acmella (Asteraceae), Tagetes lucida (Aster- evaporated, the disks were re-weighed and the extract aceae/Compositae). concentrations were calculated (Table 1). Control disks were The following plants were analyzed using desiccated sam- prepared by saturating sterile blank disks in either ethanol ples: Achillea millefolium (Asteraceae), Berberis vulgaris or sterile DI H2O and allowing all the solvent to evaporate. (Berberidaceae), Commiphora molmol (Burseraceae), Echi- Commercially available antibiotic diffusion disks were used nacea purpurea (Asteraceae/Compositae), Galium aparine as standards for comparison. Ten micrograms of ampicillin (Rubiaceae), Glycyrrhiza glabra (Fabaceae), Matricaria was used on Escherichia coli,30␮g of cefotaxime was used chamomilla (Asteraceae), Pimenta dioica (Myrtaceae), Un- against Pseudomonas aeruginosa, and 30 ␮g of vancomycin caria tomentosa (Rubiaceae), Zea mays (Poaceae). was used on Staphylococcus aureus. The plant samples used in this experiment were obtained from a variety of sources. Some were purchased live from nurseries and maintained in the University’s greenhouse. 2.5. Kirby-Bauer disk diffusion susceptibility testing Plants obtained from commercial nurseries were reported to be pesticide free. Others were gathered from the Laguna 2.5.1. Bacterial dilutions Atascosa National Wildlife Refuge in South Texas with per- Isolated colonies of the three bacteria were placed into in- mission from the refuge. Some of the plant samples were dividual tubes containing 10 ml of room temperature, sterile purchased in whole, dried form at health food stores and folk DI H2O. The tubes were then adjusted to a turbidity of 0.5 healing shops in Corpus Christi. Tammy White, Texas A&M McFarland Units by the addition of isolate colonies or sterile University-Corpus Christi’s resident botanist, authenticated DI H2O. Turbidity was verified through spectrophotometry live plant specimens. The portions of the living plants used comparison with a 0.5 McFarland Standard. The dilutions in this study were not desiccated prior to testing at the advice were used within 15 min of their preparation and were vor- of folk healers within the community. texed prior to each use. C.D. Romero et al. / Journal of Ethnopharmacology 99 (2005) 253–257 255

Table 1 Average clearance for 10 effective ethanol tinctures Kirby-Bauer disk diffusion susceptibility analysis results: effective plants Average zone clearance diameter (mm) Plant tested Common name Portion used Average Staphylococcus Escherichia coli Pseudomonas concentration aureus aeruginosa (␮g/␮l) 12 h 18 h 12 h 18 h 12 h 18 h Achillea millefoliuma Yarrow Stems/ﬂowers 26 2.52.50000 Berberis vulgarisa Barberry Bark 18 1 1 0 0 0 0 Commiphora molmola Myrrh Resin 192 1 1 0 0 0 0 Galium aparinea Cleavers Stems 27 2 2 0 0 0 0 Glycyrrhiza glabraa Licorice root Root 21 2 2.5000.50.5 Matricaria chamomillaa Chamomile Flowers 27 3 3 0 0 0 0 Pimenta dioicaa Allspice Dried berries 45 1 1 0 0 0.50 Salvia greggiib Autumn sage Leaves 12 1 1 0 0 0 0 Uncaria tomentosaa Cat’s claw Bark 29 1 1 0 0 0 0 Zea maysa Corn silk Silk 28 1 1 0 0 0 0 a Desiccated plant material tested. b Fresh plant material tested.

2.5.2. Disk diffusion analysis not produced on either Escherichia coli or Pseudomonas One hundred fifty millimetre plates of Mueller Hinton agar aeruginosa. were inoculated using sterile swabs with the bacterial dilu- A. millefolium (yarrow) produced an average zone of tions. Inoculations were done along three axes in a rolling clearance measuring 2.5 mm with a range of 1–3 mm. motion to ensure uniform bacterial distribution and growth. Berberis vulgaris (barberry) produced consistent zones of After the plates were labelled, the disks were placed on the clearance measuring 1 mm. Clearance with Commiphora surface of the agar along with a commercial antibiotic and a molmol (myrrh) ranged from slight to 1 mm clearance. solvent control disk. The plates were inverted and incubated Galium aparine (cleavers) produced an average zone of at 35 ◦C. Observations were made at 12 and 18 h. Measure- clearance of 2 mm with a range of 1–3 mm. Glycyrrhiza ments were made from the outer edge of the disks to the inner glabra (licorice root) produced an average zone of clearance edge of any zones of clearance produced. Six trials were con- measuring 2.5 mm with a range of 2–3 mm. ducted for each plant species on the three bacteria. Matricaria chamomilla (chamomile) produced a 2.5 mm Solvent-only and commercially prepared antibiotic (ampi- average zone of clearance with a range of 1.5–4 mm. Pi- cillin, cefotaxime and vancomycin) diffusion disks were used menta dioica (allspice) produced an average zone of clear- as controls. ance measuring 1 mm with a range of slight inhibition to 2 mm of clearance. Salvia greggii (autumn sage) produced consistent zones of clearance measuring 1 mm. Uncaria to- 3. Results and discussion mentosa (cat’s claw) produced an average zone of clearance measuring 1 mm with a range of 0.5–1 mm. Zea mays (corn No zones of clearance were produced by the solvent-only silk) produced an average zone of clearance measuring 1 mm control disks (Table 2). The zones of clearance produced with a range of no clearance to 2 mm. by commercial antibiotics were, on average, larger and The ineffectiveness of some tinctures might reflect the more uniform than those produced by the tincture disks lack of antibacterial compounds in the plants. However, the (Tables 1 and 2). Ten of the ethanol extracts tested pro- observed lack of bacterial inhibition might be attributed to the duced consistent zones of clearance on Staphylococcus season at which the plants were harvested or the conditions in aureus (Table 1). None of the aqueous extracts produced which they grew. Soil composition and seasonal variations in zones of clearance. Consistent zones of clearance were temperature, light and water availability can greatly influence

Table 2 Average clearance zone diameters for control disks Kirby-Bauer disk diffusion susceptibility analysis Average zone clearance diameter (mm) results: controls Controls Average concentration ( ␮g) Staphylococcus aureus Escherichia coli Pseudomonas aeruginosa

12 h 18 h 12 h 18 h 12 h 18 h Ethanol n/a 0 0 0 0 0 0 Ampicillin 10 n/a n/a 9 9 n/a n/a Cefotaxime 30 n/a n/a n/a n/a 8 8 Vancomycin 30 6 6 n/a n/a n/a n/a 256 C.D. Romero et al. / Journal of Ethnopharmacology 99 (2005) 253–257 the biochemical composition of plants. It is also possible that tions, but ineffective against bacterial infections. In addition, the active chemical constituents might not have been soluble this study did not address the issue of metabolite efficacy. in ethanol or water. Once metabolized by the human body, the metabolites of the The plant material obtained from folk healing shops extracts may become effective. could not be fully authenticated. In 1994, Congress passed Minimal inhibition concentration assays will be run to de- the Dietary Supplement Health and Education Act, which termine the concentration at which the extracts are effective. classified herbal remedies as supplements and restricted The two Gram-negative species of bacteria were relatively FDA control to ensuring that these supplements do not claim resistant to all of the tinctures tested, suggesting that the bac- to affect disease. Thus, unlike Germany and Japan the United tericidal effect might be related to the peptidoglycan layer States does not regulate the production process for herbal in Gram-positive cell walls. Alternatively, the passage of the products. active compound through the Gram-negative cell wall may Another confounding factor was that the plant material be inhibited. Other bacterial species will be used to deter- obtained from health food stores and folk healing shops mine if the tinctures are selectively effective against Gram- was desiccated, whereas the plant material used from positive bacteria. Additional plants used medicinally in the living specimens was not. The drying process may cause southwest will also be studied, as will the chemical compo- conformational changes to occur in some of the chemical sition of the efficacious plants. This research highlights the constituents found in these herbs. Thus, both fresh and pressing need for further investigation into indigenous and dried plant material should be tested to determine if such CAM therapies. The use of such treatments has far outpaced a difference exists. The active factor would be expected to the amount of scientific information available to consumers be more concentrated in dried preparations than in fresh and health care providers. A precarious environment exists plant material, and in this study desiccated samples were on where patient safety is jeopardized because of a lack of qual- average more efficacious. Some herbalists consulted about ity research. One example is the negative and potentially life plant selection believed that herbs obtained from traditional threatening interaction between St. John’s wort and alpra- folk healing shops would be more efficacious than those from zolam (Markowitz et al., 2003). Other examples include the health food stores, but such differences were not noted in this bleeding associated with Ginkgo biloba (Rowin and Lewis, study. 1996; Gilbert, 1997; Vale, 1998). Many of the antibiotic compounds already identified in Another concern is that patients often do not report their herbs are aromatic or saturated organic molecules, making CAM usage to their physicians (Giveon et al., 2004). This ethanol an ideal solvent (Cowan, 1999). It is common in Cu- situation becomes even more critical in the Hispanic com- randerismo for herbal tinctures to be made using grain al- munity. For many Hispanics language and cultural barriers cohol or Tequila, setting a precedent for ethanol extraction. prevent them from receiving proper health care (Duggleby, However, the most common mode of use in the community 2003). This sense of alienation and economic constraints is as an aqueous tea. The method of plant extract preparation cause portions of the Hispanic population to depend solely did mirror traditional preparation techniques with the excep- on Curanderismo for their health care. The more information tion that a higher concentration of ethanol was employed and available about the efficacy and limitations of Curanderismo, preparation was conducted in an aseptic fashion. None of the the better health care providers can treat those individuals aqueous extracts produced zones of inhibition in the Kirby- who rely so heavily upon it. Bauer analysis. This might have resulted from the lack of Antibiotic resistance has become a global concern (Westh solubility of the active constituents in aqueous solutions, or, et al., 2004). In a recent study done in New York City, up to perhaps, the hot water denatured such constituents. In either 50% of Streptococcus pneumonia isolates obtained from two event, these results call into question the efficacy of herbal institutions were resistant to erythromycin (Lin et al., 2004). teas made from these plants. Future trials using solvents of Since its emergence in 1961, methicillin-resistant Staphylo- various polarities will explore the effects of solvent compo- coccus aureus (MRSA) has spread to nearly every continent, sition on extract efficacy. reaching near epidemic proportions in some countries becom- It is quite possible that some of the plants that were in- ing one of the most common pathogens in hospitals world- effective in this study do not possess antibiotic properties. wide (Aires de Sousa and de Lencastre, 2004). Numerous Some plants produced slight to moderate bacterial inhibition studies have identified compounds within herbal plants that (1–5 mm) but did so inconsistently and without any true clear- are effective antibiotics (Basile et al., 2000; Cowan, 1999). ance. A possible explanation for this is that some of the plant Traditional healing systems around the world that utilize extracts may have contained antibacterial constituents, but herbal remedies are an important resource for the discov- were not present in sufficient concentrations to be effective. ery of new antibiotics (Okpekon et al., 2004); some tradi- Some of the plants tested were selected for their history of tional remedies have already produced compounds that are treating gastrointestinal infections. Such infections might not effective against antibiotic-resistant strains of bacteria (Kone´ have bacterial etiologies, but rather be caused by viral or pro- et al., 2004; Sato et al., 2000). The results of this study in- tozoan infections. These herbal remedies might very well be dicate the need for further research into traditional health effective in treating viral or protozoan gastrointestinal infec- systems. C.D. Romero et al. / Journal of Ethnopharmacology 99 (2005) 253–257 257

4. Conclusions Gruenwald, J. (Ed.), 1998. Physicians Desk Reference for Herbal Medicines, 2nd ed. Medical Economics, Montvale, NJ. Several of the herbs used by Curanderismo in the south- Kone,´ W.M., Kamanzi Atindehou, K., Terreaux, C., Hostettmann, K., Traore,´ D., Dosso, M., 2004. Traditional medicine in North Cote-ˆ west exhibit some degree of antibacterial activity towards d’Ivoire: screening of 50 medicinal plants for antibacterial activity. Staphylococcus aureus. These herbs include A. millefolium, Journal of Ethnopharmacology 93, 43–49. Berberis vulgaris, Commiphora molmol, Galium aparine, Lin, K., Tierno, P.M., Komisar, A., 2004. Increasing antibiotic resis- Glycyrrhiza glabra, Matricaria chamomilla, Pimenta dioica, tance of streptococcus species in New York City. Laryngoscope 114, Salvia greggii, Uncaria tomentosa, and Zea mays. None 1147–1150. Markowitz, J.S., Donovan, J.L., DeVane, C.L., Taylor, R.M., Ruan, Y., of the plants tested in this study consistently inhibited the Wang, J.S., Chavin, K.D., 2003. Effect of St John’s wort on drug growth of Pseudomonas aeruginosa or Escherichia coli. metabolism by induction of cytochrome P450 3A4 enzyme. Journal Further research is necessary to determine the identity of the of the American Medical Association 290, 1500–1504. antibacterial compounds found within these plants and also Moore, M., 1990. Los Remedios: Traditional Herbal Remedies of the to determine their full spectrum of efﬁcacy. Southwest. Red Crane Books, Santa Fe. Neal, R., 2001. Report by David M. Eisenberg, M.D., on complementary and alternative medicine in the United States: overview and patterns of use. Journal of Alternative and Complementary Medicine 7, 19–21. Acknowledgments Okpekon, T., Yolou, S., Gleye, C., Roblot, F., Loiseau, P., Bories, C., Grellier, P., Frappier, F., Laurens, A., Hocquemiller, R., 2004. An- National Science Foundation grants #0139195, #0331686 tiparasitic activities of medicinal plants used in Ivory Coast. Journal of Ethnopharmacology 90, 91–97. and #9624602; Texas A&M University-Corpus Christi; Padilla, R., Gomez, V., Biggerstaff, S.L., Mehler, P.S., 2001. Use of cu- Leonardo Carillo, PhD; Lillian Waldbaser, PhD; Tammy randerismo inapublic healthcare system. Archives of Internal Medicine White, M.S.; Laguna Atascosa National Wildlife Refuge; 161, 1336–1340. Frank Fregoso of Tex-Mex Curios Inc. Peirce, A., 1999. Practical Guide to Natural Medicines. William Morrow and Company, Inc., New York. Rowin, J., Lewis, S., 1996. Spontaneous bilateral subdural hematomas associated with chronic Ginkgo biloba ingestion. Neurology 46, References 1775–1776. Sato, Y., Suzaki, S., Nishikawa, T., Kihara, M., Shibata, H., Higuti, T., Aires de Sousa, M., de Lencastre, H., 2004. Bridges from hospitals to 2000. Phytochemical ﬂavones isolated from Scutellaria barbata and the laboratory: genetic portraits of methicillin-resistant Staphylococcus antibacterial activity against methicillin-resistant Staphylococcus au- aureus clones. FEMS Immunology and Medical Microbiology 40, reus. Journal of Ethnopharmacology 72, 483–488. 101–111. Trotter, R.T., 2001. Curanderismo: a picture of Mexican-American folk Basile, A., Sorbo, S., Giordano, S., Ricciardi, L., Ferrara, S., Montesano, healing. The Journal of Alternative and Complementary Medicine 7, D., Castaldo Cobianchi, R., Vuotto, M.L., Ferrara, L., 2000. Antibac- 129–131. terial and allelopathic activity of extract from Castanea sativa leaves. Vale, S., 1998. Subarachnoid haemorrhage associated with Ginkgo biloba. Fitoterapia 71, 110–116. Lancet 352, 3. Cowan, M.M., 1999. Plant products as antimicrobial agents. Clinical Mi- Westh, H., Zinn, C.S., Rosdahl, V.T., Sarisa Study Group, 2004. An inter- crobiology Reviews 12, 564–582. national multicenter study of antimicrobial consumption and resistance Duggleby, W., 2003. Helping Hispanic/Latino home health patients man- in Staphylococcus aureus isolates from 15 hospitals in 14 countries. age their pain. Home Healthcare Nurse 21, 174–179. Microbial Drug Resistance 10, 169–176. Eisenberg, D.M., Davis, R.B., Ettner, S.L., Appel, S., Wilkey, S., Van WHO, 1999. WHO monographs on selected medicinal plants. Vol. 1. Rompay, M., Kessler, R.C., 1998. Trends in alternative medicine use World Health Organization, Geneva: (http://www.who.int/medicines/ in the United States, 1990–1997: results of a follow-up national sur- library/trm/medicinalplants/monograph volume one.shtml). vey. Journal of the American Medical Association 11, 1569–1575. WHO, 2001. WHO monographs on selected medicinal plants. Vol. 2. Gilbert, G., 1997. Ginkgo biloba (Correspondence). Neurology 4, 1137. World Health Organization, Geneva: (http://www.who.int/medicines/ Giveon, S.M., Liberman, N., Klang, S., Kahan, E., 2004. Are people who library/trm/medicinalplants/monograph volume two.shtml). use “natural drugs” aware of their potentially harmful side effects and reporting to family physician? Patient Education and Counseling 53, 5–11. Journal of Ethnopharmacology 99 (2005) 259–264

Antioxidant phenolic constituents from Fagopyrum dibotrys Kai-Jin Wang, Ying-Jun Zhang ∗, Chong-Ren Yang ∗∗

State Key Laboratory of Phytochemistry and Plant Resources in West China, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650204, PR China Received 14 October 2004; received in revised form 13 February 2005; accepted 19 February 2005 Available online 7 April 2005

Abstract

Fagopyrum dibotrys (D. Don.) Hara. is an erect perennial Polygonaceous herb. In China, its rhizome was used as folk medicine for the treatment of lung diseases, dysentery and rheumatism. The crude aqueous acetone extract from the rhizomes of this plant exhibited high antioxidant activity (SC50 = 10.95 ␮g/mL) in 1,1-diphenyl-2-picryldydrazyl (DPPH) radical scavenging assay. Detailed chemical investigation on the extract led to the isolation of two new phenols (1 and 2), together with 14 known antioxidant phenolic compounds (3–16). Their structures were determined by detailed spectroscopic analysis. The two new compounds were characterized as 3-methyl-gossypetin 8-O- ␤-d-glucopyranoside (1) and 1,3,6-tri-p-coumaroyl-6-feruloyl sucrose (diboside A, 2). The radical scavenging activity of all the isolated compounds was also described. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Fagopyrum dibotrys; Antioxidant phenolics; Diboside A; Flavonol glycoside

1. Introduction et al., 1994), but there are no reports on their antioxidant activity. Our preliminary experiment showed that the 60% The genus Fagopyrum (Polygonaceae), comprising of 15 aqueous acetone extract of the rhizomes of Fagopyrum species, is mainly distributed in the North Temperate Zone. dibotrys exhibited considerable antioxidant activity on Eight species, including some common crops and medicinal 1,1-diphenyl-2-picryldydrazyl (DPPH) radical scavenging plants occur in China: buckwheat (Fagopyrum esculentum assay. This observation propelled us to perform a detailed Moench.), tartary buckwheat (Fagopyrum tartaricum (L.) bioassay-guided chemical investigation on this plant, which Gaertn.), Fagopyrum urophyllum (Bur. Et Franch.) H. Gross., led to the isolation of a new ﬂavonol glycoside methyl ether etc. Fagopyrum dibotrys (D. Don.) Hara. is an erect perennial (1) and a new phenylpropanoid ester sucrose (2), together herb, growing mainly in China, India, Vietnam, Thailand with 14 known compounds. This paper describes the struc- and Nepal. Its rhizome was used as folk medicine in China ture elucidation of the new compounds (1–2) on the basis of for the treatment of lung diseases, dysentery and rheumatism spectroscopic method and the antioxidant activity of these (Editorial Board of Zhong Hua Ben Cao (China Herbal), isolated compounds on DPPH radical scavenging assay. State Administration of Traditional Chinese Medicine, 1999). Previous chemical studies showed the presence of some phenolics and other compounds in the rhizome, such 2. Materials and methods as hecogenin, ␤-sitosterol, p-coumaric acid, ferulic acid and shakuchirin (Liu et al., 1983; Yao et al., 1989; Zhang 2.1. Plant material

The dried rhizome of Fagopyrum dibotrys was bought ∗ Corresponding author. Tel.: +86 871 5223235; fax: +86 871 5150124. ∗∗ Co-corresponding author. from Kunming herbal medicinal market and identiﬁed by E-mail addresses: [email protected] (Y.-J. Zhang), Prof. C. R. Yang, Kunming Institute of Botany, Chinese [email protected] (C.-R. Yang). Academy of Sciences.

2.2. General experimental procedures Table 1 1 13 H (400 MHz) and C (100 MHz) NMR spectral data of 1 in DMSO-d6

[␣]D was carried out on a JASCO-20 polarimeter. IR spec- No. C H (J in Hz) tra were recorded on a Bio-Rad FTS-135 spectrometer with 2 155.4 (s) KBr pellets. UV spectra were recorded on a UV 210A Shi- 3 137.5 (s) madzu spectrometer. 1D- and 2D-NMR spectra were run on 4 177.5 (s) . Bruker AM-400 and DRX-500 instruments with TMS as in- 4a 103 3 (s) 5 157.0 (s) 12.55 (s, OH-5) ternal standard. The MS data were recorded on a VG Auto 699.3 (d) 6.19 (1H, s) Spec-3000 spectrometer. DPPH radical (Aldrich Chemical 7 157.0 (s) Co.) scavenging assay was performed on Emax precision mi- 8 125.6 (s) croplate reader. Column chromatography was performed on 8a 148.8 (s) 1 121.6 (s) Diaion HP20SS (Mitsubishi Chemical Co.), MCI-gel CHP- 2 115.5 (d) 7.74 (1H, d, 2.00) ␮ 20P (75–150 m, Mitsubishi Chemical Co.), Sephadex LH- 3 145.0 (s) 20 (25–100 ␮m, Pharmacia Fine Chemical Co. Ltd.), Chro- 4 148.5 (s) matorex ODS (100–200 mesh, Fuji Silysia Chemical Co. 5 115.8 (d) 7.72 (1H, d, 8.15) Ltd.), and Toyopearl HW-40F (37–70 ␮m, Tosoh Co.). TLC 6 121.1 (d) 6.90 (1H, dd, 2.00, 8.15) 3-OCH3 59.6 (q) 3.78 (3H, s) was carried out on silica gel G precoated plates (Qingdao 1 106.7 (d) 4.59 (1H, d, 7.75) Haiyang Chemical Co.) with benzene–ethyl formate–formic 2 74.2 (d) acid (3:6:1). Spots were detected by spraying with ferric chlo- 3 76.2 (d) ride (FeCl ) and 10% sulfuric acid reagents followed by heat- 4 69.3 (d) 3 ing. 5 77.2 (d) 6 60.6 (t) 3.15–3.72 (2H, m, overlapped) 2.3. Extraction and isolation −1 1 (3.78); IR (KBr) νmax 3441, 2924 and 1629 cm ; H NMR The dried rhizome (6.0 kg) of Fagopyrum dibotrys was ex- 13 (400 MHz, DMSO-d6) and C NMR (100 MHz, DMSO- tracted three times with 15 L of 60% aqueous acetone at room d6) see Table 1; negative ion HRFAB-MS m/z: 493.0977 temperature. The combined extract was concentrated under − − [M − H] , calcd. for [C22H21O13] : 493.0982. reduced pressure to give a residue (600 g), which showed ␮ SC50 value as 10.95 g/mL on the DPPH assay. Accordingly, 2.3.2. Diboside A (2) further isolation was carried out. α 21 + . ◦ White amorphous powder, [ ]D 15 56 (0.68, The crude extract was applied to Diaion HP20SS col- MeOH); UV (MeOH) λmax (nm) (log ε): 228 (4.16), umn eluted with H2O–MeOH (1:0–0:1) and then 50% ace- 315 (4.40); IR (KBr) νmax 3400, 1700, 1630, − tone to give nine fractions (A1–A9). Fraction A7 was sub- 1515, 1268 and 1170 cm 1; 1H NMR (500 MHz, 13 jected to column chromatography on Sephadex LH-20 eluted CD3OD) and C NMR (125 MHz, CD3OD) data − with H2O–MeOH (1:0–0:1) and EtOH to give 1 (10 mg), see Table 2; negative FAB-MS m/z: 955 [M − H] , − 4 (11 mg) and 5 (14 mg). A9 was separated by column 809 [M − H − 146(coumaroyl)] , 779 [M − H − 176 chromatography on Sephadex LH-20 (EtOH) and silica (feruloyl)]−, 663 [M − H − 146(coumaroyl)-146(coumaro- − gel (CH3Cl–MeOH–H2O, 10:1:0.1, lower layer) to give 2 yl)] , 517 [M − H − 146(coumaroyl)-146(coumaroyl)- − (13 mg) and 3 (11 mg). Fraction A5 was chromatographed 146(coumaroyl)] , 341 [M − H − 146(coumaroyl)-146(cou- on Sephadex LH-20 and Chromatorex ODS eluted with maroyl)-146 (coumaroyl)-176(feruloyl)]−; negative ion − H2O–MeOH (1:0–0:1) to give 7 (150 mg), 15 (50 mg) and HRFAB-MS m/z: 955.2706 [M − H] , calcd. for − 16 (70 mg). A8 was subjected to column chromatography [C49H47O20] : 955.2660. on Sephadex LH-20 eluted with H2O–MeOH (1:0–0:1) and EtOH to give 6 (12 mg) and 8 (8 mg). A1 was separated by 2.4. DPPH radical scavenging assay column chromatography on Sephadex LH-20 eluted with EtOH–H2O (1:0–1:1) and Chromatorex ODS eluted with The DPPH assay was performed as described (Yoshida H2O–MeOH (1:0–0:1) to give 9 (100 mg) and 10 (20 mg). et al., 1989). In this assay, ascorbic acid was used as positive A3 was repeatedly chromatographed on Sephadex LH-20, control, reaction mixtures containing an ethanolic solution Chromatorex ODS, MCI-gel CHP-20P and Toyopearl HW- of 200 ␮M DPPH (100 ␮L) and two-fold serial dilutions 40F eluted with H2O–MeOH (1:0–0:1) to give 11 (20 mg), of sample (dissolved in 100 ␮L ethanol, with amounts of 12 (17 mg), 13 (10 mg) and 14 (11 mg). sample ranging from 2 to 1000 ␮g/mL) were placed in a 96-well microplate and incubated at 37 ◦C for 30 min. 2.3.1. 3-Methyl-gossypetin 8-O-␤-d-glucopyranoside After incubation, the absorbance was read at 517 nm by (1) an Emax precision microplate reader and mean value was α 21 + . ◦ Yellow amorphous powder, [ ]D 31 58 (0.095, obtained from three duplicated readings. Scavenging activity DMSO); UV (MeOH) λmax (nm) (log ε): 203 (4.33), 278 was determined by the following equation: % scavenging K.-J. Wang et al. / Journal of Ethnopharmacology 99 (2005) 259–264 261

Table 2 activity = 100 × (Acontrol − Asample)/Acontrol. The SC50 value 1 13 H (500 MHz) and C (100 MHz) NMR spectral data of 2 in CD3OD was obtained through extrapolation from linear regression No. 1H(J in Hz) 13C analysis and denoted the concentration of sample required Fructose to scavenge 50% of DPPH radicals. 1 4.35 (2H, m) 66.3t 2 103.4s 3 5.67 (1H, d, 8.76) 79.3d 4 4.74 (1H, m) 74.1d 3. Results and discussion 5 4.23 (1H, m) 81.0d 6 4.57 (2H, m) 65.5t The 60% aqueous acetone extract of air-dried rhizomes Glucose of Fagopyrum dibotrys exhibited obvious antioxidant ac- 1 5.59 (1H, d, 3.83) 92.9d tivity (SC50 = 10.95 ␮g/mL) on DPPH radical scavenging 2 3.50 (1H, m) 72.9d assay. The crude extract was further fractionated and pu- 3 3.69 (1H,m) 74.9d rified over Diaion HP 20SS, Sephadex LH-20, Chroma- . 4 3.30 (1H, m) 72 2d torex ODS, MCI-gel CHP-20P and silica gel to give two 5 3.32 (1H, m) 72.4d 6 4.33 (1H, m), 4.73 (1H, m) 65.6t new compounds 1 and 2, as well as 14 known compounds (3–16). The known ones were identified as lapathoside A Phenylpropanoids Glu-6-O-p-coumaroyl (3)(Takasaki et al., 2001), quercetin (4)(Wenkert and Got- 1 127.1s tlieb, 1977), 3-methylquercetin (5)(Bacon et al., 1978), 3,5- 2 7.30 (1H, d, 8.67) 131.1d dimethylquercetin (6), rutin (7)(Wenkert and Gottlieb, 1977), 3 6.76 (1H, d, 8.67) 116.1d emodin-8-O-␤-d-glucopyranoside (8)(Steglich and Losel, 4 161.3s 1969), gallic acid (9), 6-O-galloyl-d-glucose (10)(Nonaka 5 6.76 1H, d, 8.67) 116.1d 6 7.30 (1H, d, 8.67) 131.1d and Nishioka, 1983), (+)-catechin (11)(Nonaka et al., 1983a), − 7 7.55 (1H, d, 16.00) 146.8d ( )-epicatechin (12)(Nonaka and Nishioka, 1982), procyani- 8 6.23 (1H, d, 16.00) 114.8d din B-1 (13)(Nonaka et al., 1981), procyanidin B-2 (14) 9 169.3s (Nonaka et al., 1981), 3,3-di-O-galloyl-procyanidin B-2 (15) Fru-1-O-p-coumaroyl (Nonaka et al., 1981) and 3 -O-galloyl-procyanidin B-2 (16) 1 127.4s (Nonaka et al., 1983b) by the spectroscopic evidences and 2 7.44 (1H, d, 8.80) 131.5d comparing with literature data (Fig. 1). . 3 6.79 (1H, d, 8.80) 116 7d Compound 1 was obtained as a yellow amorphous pow- 4 161.0s 5 6.78 (1H, d, 8.80) 116.7d der. Its molecular formula was assigned as C22H22O13 on 6 7.44 (1H, d, 8.80) 131.5d the basis of the negative ion high-resolution (HR) FAB mass − 7 7.70 (1H, d, 15.90) 148.2d spectrum (MS) (m/z: 493.0977 [M − H] , calcd. 493.0982) 8 6.43(1H, d, 15.90) 114.3d and the 13C DEPT NMR spectrum. The 13C NMR spectrum . 9 168 4s showed the presence of 15 carbon signals due to the flavonol Fru-3-O-p-coumaroyl skeleton, a set of signals arising from a glucopyranosyl moi- 1 127.2s δ δ ety [anomeric H: 4.59 (J = 7.75 Hz), anomeric C: 103.4 2 7.38 (1H, d, 8.70) 131.2d δ δ 3 6.77 (1H, d, 8.70) 116.3d (d)] and a methoxyl group [ H 3.78 (3H, s), C 59.6 (q)]. The 1 4 161.2s H NMR spectrum exhibited a characteristic proton signal 5 6.77 (1H, d, 8.70) 116.3d at δ 12.55 corresponding to a free hydroxyl at C-5, a singlet 6 7.38 (1H, d, 8.70) 131.2d proton signal at δ 6.19 arising from H-6 of ring A and an 7 7.63 (1H, d, 8.70) 147.1d ABX coupling system [δ 7.74 (1H, d, J = 2.00 Hz), 7.72 (1H, 8 6.30 (1H, d, 8.70) 114.7d 9 168.4s d, J = 8.15 Hz), 6.90 (1H, dd, J = 2.00, 8.15 Hz)] referring to the 3,4-dihydroxylated ring B. These 1H and 13C NMR Fru-6-O-feruloyl spectral features were closely related to those of gossypetin 1 127.7s 2 7.16 (1H, d, 1.76) 111.7d 8-O-glucoside (Nawwar and Buddrus, 1981), except for the 3 149.2s appearance of the additional methoxyl signal. In the HMBC 4 150.4s spectrum (Fig. 2), the methoxyl proton signal at δ 3.78 was 5 6.79 (1H, d, 8.20) 116.3d correlated with δ 137.5 (C-3), indicating that the methoxyl 6 6.99 (1H, dd, 1.76, 8.20) 124.4d . group was linked at C-3 of the flavonol skeleton. In addi- 7 7.59 (1H, d, 15.82) 147 1d δ 8 6.46 (1H, d, 15.82) 115.9d tion, HMBC correlations of the 5-OH proton at 12.55 with 9 168.9s δ 99.3 (C-6), 100.3 (C-4a) and 157.0 (C-5), and the glucose δ δ (O-Me) 3.80 (3H, s) 56.5q anomeric proton signal at 4.59 with 125.6 (C-8) were also observed, which confirmed the location of the glucopyranosyl moiety on C-8 position. On the basis of the above evidences, compound 1 was determined to be 3-methyl-gossypetin 8-O- ␤-d-glucopyranoside. 262 K.-J. Wang et al. / Journal of Ethnopharmacology 99 (2005) 259–264

Fig. 1. Structures of phenolic antioxidants from Fagopyrum dibotrys.

The molecular formula of compound 2 was determined (3400, 1700, 1630, 1515, 1268 and 1170 cm−1) absorptions to be C49H48O20 on the basis of negative ion HRFAB-MS suggested the existence of hydroxyl and ␣, ␤-unsaturated − (m/z: 955.2706, [M − H] calcd. 955.2660) and the 13C aromatic ester groups in 2. The 1H and 13C NMR spectra DEPT NMR spectrum. The UV (228, 315 nm) and IR exhibited typical signals rising from p-coumaroyl moiety, feruloyl moiety and a sucrose unit (Table 2), which were similar to those of vanicoside B (1,3,6-tri-p-coumaroyl-6- feruloyl sucrose) isolated from Polygonum pensylvanicum (Zimmermann and Sneden, 1994). In the NOESY spectrum of 2 (Fig. 3), cross peaks between the methoxyl group at δ 3.80 (3H, s) and an aromatic proton at δ 7.16 (1H, d, J = 1.76 Hz) conﬁrmed the presence of the feruloyl moiety, in which the methoxyl group was linked to C-3. Characteristic fragment ion peaks in negative FAB-MS were also observed at m/z 809 [M − H − 146(coumaroyl)]−, 779 [M − H − 176(feruloyl)]−, 663 [M − H − 146(coumaroyl)- 146(coumaroyl)]−, 517 [M − H − 146 (coumaroyl)- 146(coumaroyl)-146(coumaroyl)]− and 341 [M − H − 146 Fig. 2. Important HMBC correlations of compound 1. (coumaroyl)-146 (coumaroyl)-146(coumaroyl)-176(ferul- K.-J. Wang et al. / Journal of Ethnopharmacology 99 (2005) 259–264 263

Table 3 DPPH radical scavenging activity of compounds 1–16 from Fagopyrum dibotrys

Compounds SC50 (␮M) Ascorbic acid (CK) 30.79 1 37.99 2 199.48 3 165.52 4 13.68 5 31.23 6 24.40 7 42.49 8 61.80 9 12.10 Fig. 3. Important HMBC and NOESY correlations of compound 2. 10 25.17 11 22.64 12 17.39 oyl)]−. The above observations indicated that 2 was a 13 18.40 . sucrose acylated by three p-coumaric acids and one ferulic 14 15 31 15 10.12 acid. 16 7.94 Locations of p-coumaroyl and feruloyl moieties on su- SC50: radical scavenging activity (concentration in ␮M required for 50% crose were determined as follows. The proton and carbon reduction of DPPH radical). signals of p-coumaroyl, feruloyl and sucrose moieties of 2 were assigned by 2D NMR techniques, including the 1H–1H Flavonoids have generally been considered as important COSY, HMQC and NOESY. In the 13C NMR spectrum of antioxidants. Eleven flavonoids, including quercetin (4) and 2, signals of C-1, C-6 of fructose and C-6 of glucose in the its derivatives 1, 5–7, as well as the major constituents of sucrose moiety were shifted to lower field (+2 to +3 ppm), Fagopyrum dibotrys, flavan-3-ols and its derivatives (11–16), while C-2, C-5 of fructose and C-5 of glucose were shifted were isolated from Fagopyrum dibotrys. The activity order of to higher field (−2to−3 ppm), comparing with those of su- quercetin derivatives was shown to be 4 > 6 > 5 > 1 > 7, sug- 13 crose [ C NMR data (100 MHz, in CD3OD): δ 64.0 (C-1), gesting that the presence of 3-hydroxyl group is important 105.3 (C-2), 79.3 (C-3), 75.7 (C-4), 83.8 (C-5), 63.4 (C-6), to their radical-scavenging capabilities. When the hydroxyl 93.6 (C-1 ), 73.2 (C-2 ), 74.7(C-3 ), 71.3 (C-4 ), 74.41 (C-5 ) group at C-3 of quercetin was substituted with methoxyl and 62.2 (C-6 )]. These observations suggested that the C-1, group, it gave a negative influence for the activity. And if a C-6 of fructose and C-6 of glucose were esterified. In the bigger substituent like O-glycosyl was linked at C-3, the ac- HMBC spectrum of 2 (Fig. 3), the long-range correlations tivity was greatly reduced probably for the steric hindrance of H-1, H-3 and H-6 of sucrose with C-9, C-9 and C-9 (Cioffi et al., 2002; Braca et al., 2003). rising from three p-coumaroyl groups, and H-6 of sucrose All of the flavan-3-ols displayed higher radical- with C-9 of feruloyl group indicated that the acylated po- scavenging activities (7.94–22.64 ␮M) than ascorbic acid. sitions of the three coumaroyl groups were at C-1, C-3 and Among the isolated compounds, 15 and 16 were the most C-6 of sucrose and the feruloyl group was attached at C-6 active ones due to the molecule possessing more phenolic hy- of the sucrose. Accordingly, compound 2 was characterized droxyl groups, particularly the galloyl and catechol groups. as 1,3,6 -tri-p-coumaroyl-6-feruloyl sucrose, named diboside These main constituents may play an important role for the A. antioxidant activity of Fagopyrum dibotrys. The above results The antioxidant activity of compounds 1–16 was mea- will promote the reasonable usage of this herb. sured in DPPH assay (Table 3). Comparing with the positive control ascorbic acid, compounds 4, 6 and 9–16 displayed higher activities, while 1–3, 5, 7 and 8 showed only lower Acknowledgement activities. Gallic acid (9), the well-known natural antioxidant found The authors are grateful to the staff of the analytical group widely in plants, and its derivative, 10, exhibited higher free at the state key laboratory of phytochemistry and plant re- radical-scavenging activities than ascorbic acid. While, com- sources in West China, Kunming Institute of Botany, Chinese pounds 2, 3 and 8, the minor constituents from Fagopyrum di- Academy of Sciences for their measurement of spectral data. botrys and without trihydroxylphenyl or o-dihydroxylphenyl groups existing in the molecule, showed lower activities. This References result is consistent with the previous reports and suggests that three or two adjacent phenolic hydroxyl group in the molecule Bacon, J.D., Urbatsch, L.E., Bragg, L.H., Mabry, T.J., Neuman, P., Jack- is a key factor for enhancing the activity (Guo et al., 1999; son, D.W., 1978. The flavonoids of tetragonotheca (Compositae). Phy- Okawa et al., 2001). tochemistry 17, 1939–1943. 264 K.-J. Wang et al. / Journal of Ethnopharmacology 99 (2005) 259–264

Braca, A., Fico, G., Morelli, I., Simone, F.D., Tome, F., Tommasi, N.D., glucoside gallate, galloylglucose and isolindleyin. Chemical and Phar- 2003. Antioxidant and free radical scavenging activity of flavonol maceutical Bulletin 31, 1652–1658. glycosides from different Aconitum species. Journal of Ethnopharma- Nonaka, G., Nishioka, I., Nagasawa, T., Oura, H., 1981. Tannins and re- cology 86, 63–67. lated compounds. I. Rhubarb (1). Chemical and Pharmaceutical Bul- Cioffi, G., D’Auria, M., Braca, A., Mendez, J., Castillo, A., Morelli, letin 29, 2862–2870. I., Simone, F.D., Tommasi, N.D., 2002. Antioxidant and free-radical Okawa, M., Kinjo, J., Nohara, T., Ono, M., 2001. DPPH (1, 1-diphenyl- scavenging activity of constituents of leaves of Tachigalia paniculata. 2-picrylhydrazyl) radical scavenging activity of flavonoids obtained Journal of Natural Products 65, 1526–1529. from some medicinal plants. Biological and Pharmaceutical Bulletin Editorial Board of Zhong Hua Ben Cao (China Herbal), State Adimin- 24, 1202–1205. istration of Traditional Chinese Medicine, 1999. Zhong Hua Ben Steglich, W., Losel, W., 1969. Bestimmung der stellung von on O- Cao (China Herbal), vol. 2. Shanghai Science and Technology Press, substituenten bei 1,8-dihydroxy-anthrachinon-derivaten mit hilfe der Shanghai, pp. 629–632. NMR-spektroskopie. Tetrahedron 25, 4391–4399. Guo, Q., Zhao, B., Shen, S., Hou, J., Xin, W., 1999. ESR study on the Takasaki, M., Kuroki, S., Kuzuka, M., Konoshima, T., 2001. New phenyl- structure–antioxidant activity relationship of tea catechins and their propanoid esters of sucrose from Polygonum lapathifolium. Journal of epimers. Biochimica et Biophysica Acta 1427, 13–23. Natural Products 64, 1305–1308. Liu, Y.L., Fang, Q.N., Zhang, X.C., Feng, X.X., Zhang, L.F., He, X.W., Wenkert, E., Gottlieb, H.E., 1977. Carbon-13 nuclear magnetic resonance 1983. Study on the active constituents from Fagopyrum dibotrys. Acta spectroscopy of flavonoid and isoflavonoid compounds. Phytochem- Pharmaceutica Sinica 18, 545–547. istry 16, 1811–1816. Nawwar, M., Buddrus, J., 1981. A gossypetin glucuronide sulphate from Yao, R.C., Huang, M.F., Wu, Y.R., Yang, C.R., 1989. Active constituents the leaves of Malva sylvestris. Phytochemistry 20, 2446–2448. of anti-tumor from Fagopyrum cymosum. Acta Botanica Yunnanica Nonaka, G., Ezaki, E., Hayashi, K., Nishioka, I., 1983a. Flavanol gluco- 11, 215–218. sides from rhubarb and Rhaphiolepis umbellate. Phytochemistry 22, Yoshida, T., Mori, K., Hatano, T., Okumura, T., Uehara, I., Komagoe, 1659–1661. K., Fujita, Y., Okuda, T., 1989. Studies on inhibition mechanism of Nonaka, G., Kawahara, O., Nishioka, I., 1983b. Tannins and related com- autoxidation by tannins and flavonoids. V1) Radical-scavenging effects pounds XV. A new class of dimeric flavan-3-ol gallate, theasinensins of tannins and related polyphenols on 1, 1-diphenyl-2-picrylhydrazyl A and B, and proanthocyanidin gallate from green tea leaf. (1). Chem- radical. Chemical and Pharmaceutical Bulletin 37, 1919–1921. ical and Pharmaceutical Bulletin 31, 3906–3914. Zhang, W.J., Li, X.C., Liu, Y.Q., Yao, R.C., Nonaka, G., Yang, C.R., Nonaka, G., Nishioka, I., 1982. Tannins and related compounds VII. 1994. Phenolic constituents from Fagopyrum dibotrys. Acta Botanica Phenylpropanoid-substituted epicatechin, cinchonains from Cinchona Yunnanica 16, 354–356. succirubra(1). Chemical and Pharmaceutical Bulletin 30, 4268–4276. Zimmermann, M.L., Sneden, A.T., 1994. Vanicosides A and B, protein Nonaka, G., Nishioka, I., 1983. Tannins and related compounds X. kinase C inhibitors from Polygonum pensylvanicum. Journal of Natural Rhubarb (2): Isolation and structures of a glycerol gallate, gallic acid Products 57, 236–242. Journal of Ethnopharmacology 99 (2005) 265–272

Inﬂuence of extracts of Stryphnodendron polyphyllum Mart. and Stryphnodendron obovatum Benth. on the cicatrisation of cutaneous wounds in rats

Gisely C. Lopes a, Andreia´ C.C. Sanches b, Celso V. Nakamura a, Benedito P. Dias Filho a, Luzmarina Hernandes c,Joao˜ Carlos P. de Mello a,∗

a Programa de Pós-gradua¸cão em Ciências Farmacêuticas da Universidade Estadual de Maringá,Maringá,PR,BR-87020-900,Brazil b Programa de Pós-gradua¸cão em Fármacos e Medicamentos da Unesp,Araraquara,Brazil c Departamento de Ciências Morfofisiológicas da Universidade Estadual de Maringá,Maringá,Brazil Received 14 January 2005; received in revised form 24 February 2005; accepted 24 February 2005 Available online 26 April 2005

Abstract

Stem bark of the two species Stryphnodendron polyphyllum Mart. and Stryphnodendron obovatum Benth., Leguminosae, was investigated for wound healing, antibacterial and antioxidant activity. These plants contain 12 and 19% tannins in their stem bark, respectively, and are widely used in traditional medicine in Brazil. The total content of phenolics of the crude extract (CE) of Stryphnodendron obovatum was 76.95 ± 2.98% (CV = 3.87%) and of the ethyl-acetate fraction (EAF) was 89.13 ± 0.34% (CV = 0.38%); whereas in Stryphnodendron polyphyllum the CE phenolics content was 51.62 ± 1.53% (CV = 2.96%) and the EAF phenolics content was 59.00 ± 1.91% (CV = 3.24%). The tannin content of CE from Stryphnodendron obovatum [36.58 ± 0.35% (CV = 0.98%)] was about 11% higher than in CE from Stryphnodendron polyphyllum [25.43 ± 0.96% (CV = 3.77%)]. The difference between the species was even greater in the EAF: in Stryphnodendron obovatum the EAF phenolics content was 55.01 ± 0.36% (CV = 0.65%), whereas in Stryphnodendron polyphyllum the content was 36.16 ± 0.42% (CV = 1.16%). The healing effect of ointments containing 2.5% crude lyophilised extract (PCE) and 2.5% ethyl-acetate lyophilised fraction (PEA) of the stem bark of Stryphnodendron polyphyllum and Stryphnodendron obovatum was studied in cutaneous wounds of Wistar® rats after 4, 7 and 10 days of treatment. Epithelial cell proliferation in the area of re-epithelialisation of the wounds was evaluated by counting the metaphases blocked by vincristine sulfate. With PCE an increase in epidermal growth was observed after 4 and 7 days of treatment with Stryphnodendron polyphyllum, and after 7 and 10 days of treatment with Stryphnodendron obovatum. Wounds treated with PEA of Stryphnodendron obovatum showed increased epidermal growth only 4 days after the treatment; for Stryphnodendron polyphyllum, epidermal growth was observed after 4 and 7 days of treatment. Both the CE and the EAF fractions of Stryphnodendron polyphyllum and Stryphnodendron obovatum showed antibacterial activity against Staphylococcus aureus with MIC values of 125 and 250 ␮g/ml, respectively. Gram-negative bacteria tested were not inhibited by extracts and fractions at concentrations >1000 ␮g/ml. The antioxidant activity through reduction of the DPPH radical in TLC, conﬁrmed the anti-radical properties of these extracts in both species. CE and EAF of both species showed a radical scavenging activity (RSA) and protected DPPH from discolouration, already at 0.032 ␮g/ml. The extract from Stryphnodendron polyphyllum were more effective than those Stryphnodendron obovatum, although the former had a lower tannin content. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Stryphnodendron obovatum; Stryphnodendron polyphyllum; Epidermal proliferation; Antibacterial activity; Antioxidant activity; Tannins

1. Introduction

The genus Stryphnodendron Mart., a member of the family Leguminosae, presently includes 32 taxa: 29 species, 1 ∗ Corresponding author. Tel.: +55 44 2614816; fax: +55 44 2636231. subspecies and 2 varieties, with characteristic geographi- E-mail address: [email protected] (J.C.P.d. Mello). cal distribution and habitat (Occhioni, 1990). The species

Stryphnodendron polyphyllum Mart. and Stryphnodendron 2. Materials and methods obovatum Benth. grow in open fields and savannah regions in Brazil, where they are both popularly known as “barba- 2.1. Plant material and preparation of extracts timao”.˜ Extracts of the stem bark are used traditionally by the local population to treat leucorrhea and diarrhea, as anti- Stem bark was collected from individuals of Stryphnoden- inflammatory and antiseptic agents and to promote blood dron polyphyllum Mart. in May 2002, in the city of Abadia clotting and wound healing (Correa,ˆ 1926). de Goias,´ State of Goias´ in central Brazil (16◦4532.4S; Cicatrisation is a natural biological process, through which 49◦2506.5W; altitude 860 m). Stem bark from Stryphn- the damaged tissue re-establishes haemostasis. In this pro- odendron obovatum Benth. was collected in February 2001 cess, three phases are recognised in response to injury of in the city of Assis, State of Sao˜ Paulo (22◦3520.8S; the skin in adult mammals: inflammation, epithelialisation, 50◦2418.7W; altitude 546 m). and remodeling. When the lesion reaches the dermis, the de- The species were identified by Prof. Dr. Cassia Monicaˆ struction of capillary vessels results in formation of a clot that Sakuragui. Voucher specimens are deposited in the herbar- functions as a temporary barrier and as a source of chemotac- ium of the Department of Biology of the State University of tic signals which attract several types of inflammatory cells Maringa´ under numbers HUM 9139 and 8583. to the injury site. This haemostatic inflammatory phase is fol- Air-dried stem bark (900 and 500 g) was extracted with lowed by the migration and proliferation of the keratinocytes acetone:water (7:3; 9 and 5 l) by turbo-extraction (Ultra- from those tissues remaining intact at the site (Coulombe, turrax® UTC115KT; 20 min; t ≤ 40 ◦C). The combined ex- 1997). tracts were filtered and evaporated under reduced pressure Restoration of epithelial continuity is defined as closing and then lyophilised (CE; 253 and 119 g). A portion (200 of the wound. Closing is accomplished by the combination and 100 g) was redissolved in 2 and 1 l H2O and extracted of two mechanisms: the migration of the keratinocytes to the with EtOAc (6 and 4 l). After evaporation of solvents under insulted site, and the contraction of myofibroblasts around reduced pressure and lyophilisation, the EtOAc extract and the site, which exercise a centripetal force that moves the the remaining H2O phase yielded dark brown solids of 31.2 edges of the wound closer to each other (Coulombe, 1997; and 17.9 g (EAF), and 114 and 70.5 g (WF), respectively from Montandon et al., 1977). Stryphnodendron polyphyllum and Stryphnodendron obova- In recent years, interest has increased in obtaining drugs tum, as described by Mello et al. (1999). from plants with high tannin contents, which have potential use in promoting cicatrisation of wounds (Schulz et al., 2.2. Animal treatment 2002). Studies on stem-bark extracts of Stryphnodendron adstringens (Mart.) Coville have demonstrated that these have Adult male albino Wistar® rats (Rattus norvegicus albi- significant wound-healing (Eurides et al., 1996; Panizza et nus) weighing from 180 to 200 g were used for the study. al., 1988; Vieira et al., 1998), anti-inflammatory (Lima et al., The animals were maintained in individual cages, on a 12- 1998) and anti-ulcerogenic properties (Audi et al., 1999). h light/dark cycle, temperature 22 ◦C, with water and chow Because of this biological activity, the chemical composi- (Nuvital®) ad libitum. The animals were divided into three tion of several species of Stryphnodendron has been investi- groups of five animals each. The Animal Ethics Committee gated, including Stryphnodendron adstringens (Mello et al., of the University of Maringa´ approved the experimental pro- 1996a, 1996b, 1999), Stryphnodendron obovatum (Sanches cedure (protocol number 040/2003). et al., 2002; Sanches, 2004) and Stryphnodendron polyphyl- The animals were anaesthetised by inhalation of ethyl lum (Lopes et al., 2003). All three have similar chemical ether. After manual depilation and asepsis, two square cuta- constitutions but vary in the content of the total tannins neous excisions were made on the back of each animal, close which may be responsible for the pharmacological activity to the cervical area, after demarcation with a stainless steel of members of this genus. Tannins promote the cicatri- delimitor measuring about 7 mm in diameter. The wounds sation of wounds through several cellular mechanisms: were then washed and measured. Each experimental wound chelation of free radicals and reactive species of oxygen, (left side) was treated daily with an ointment containing the promoting contraction of the wound and increasing the crude extract (PCE) or ethyl-acetate fraction (PEA), each at formation of capillary vessels and fibroblasts (Fernandez 2.5% concentration. Each control wound (right side) on each et al., 2002) and inducing keratinocyte proliferation, but do animal was treated only with ointment base (O/W with hy- not act on the differentiation towards cornified cells (Deters drophilic characteristics and aseptic preparation) (Prista and et al., 2001). Da Fonseca, 1993). In the present work, we evaluated the influence of crude After 4, 7 and 10 days, the animals of each group and ethyl-acetate extracts of stem bark from Stryphnoden- were killed. Two hours before it was killed, each animal dron polyphyllum and Stryphnodendron obovatum on the re- was injected with 1 mg/kg body weight of vincristine epithelialisation of cutaneous wounds in Wistar® rats, and sulfate (Oncovin®, Eli Lilly), a metaphase arrest agent analysed the antibacterial and antioxidant activity of these that blocks mitosis primarily by inhibiting the dynamics of extracts. spindle microtubules (Jordan et al., 1992). The rats were G.C. Lopes et al. / Journal of Ethnopharmacology 99 (2005) 265–272 267 anaesthetised by ethyl-ether inhalation and the wounded by Glasl (1983), with slight modifications. Briefly, 117 mg skin was removed. The samples were spread on cards, of the CE or 211 mg of the EAF was dissolved in water fixed in Bouin’s solution for 6 h and embedded in paraffin. (250 ml; MS). A 5 ml aliquot was diluted in water to 25 ml. Sections of 4 ␮m thickness were prepared. The slides were A 2 ml aliquot was transferred to a 25-ml vial with 1 ml of then stained with haematoxylin and eosin. The samples Folin–Ciocalteu phenol reagent and 10 ml water, and made taken from the skin were used for studies of epithelial cell up to volume with a solution of 14.06% sodium carbonate. growth. After 15 min the absorbance was measured at 691 nm (TP). Water was used as the blank. For determination of the non- 2.3. Morphometry of the wounds adsorbent polyphenols (NAP), 10 ml of the MS was transferred with 100 mg of hide-powder and vortexed for 60 min. The maximum length and width of each wound were mea- Next, the solution was filtered and 5 ml was diluted in water sured with calipers on the day the wound was made and the to 25 ml. A 2-ml aliquot was transferred to 25-ml vial with day the animal was killed; the area of the wound was calcu- 1 ml of the Folin–Ciocalteu phenol reagent and 10 ml water, lated from these measurements. The degree of contraction of and made up to volume with a 14.06% sodium carbonate so- the wound was determined from the difference between the lution. After 15 min the absorbance was measured at 691 nm initial and final areas. The means of the differences between (NAP). Water was used as the blank. The percentage of to- the experimental wounds and controls were compared, for tal phenolics and tannins were determined (in triplicate) as each group of subjects and for each extract studied. follows: 15625Abs 15625Abs 2.4. Cell proliferation TP(%) = NAP(%) = 1000m 1000m The cellular proliferation of the epidermis was evaluated TT(%) = TP − NAP by counting the epithelial cells blocked in metaphase, in the basal and supra-basal layers in the area of re-epithelialisation. where TP = total phenolics (%); NAP = non-adsorbent pheno- In each wound of each animal, the number of blocked lics (%); TT = total tannins (%); Abs = absorbance; m = mass metaphases was counted in 40 microscope fields, with the (g) of CE or EAF. aid of a 250 ␮m ocular reticle fitted in an Olympus BX40® microscope, and a 40× objective. The results were expressed 2.8. Antioxidant activity as number of metaphases/10 mm. The antioxidant potential was evaluated by the method 2.5. Statistical analysis of reduction of the radical 2,2-diphenyl-1-picrylhydrazyl (DPPH) 0.2% in methanol by thin-layer chromatography The results were analised by unpaired Student’s t-test. (TLC), using n-butanol:acetic acid:water (3:1:1) as the elu- The significance level adopted was P < 0.05 for cicatrisa- ent system. The standards were quercetin (Merck), gal- tion analyse. The radical scavenging activity was analised by lic acid (Roth) and rutin (Merck), each at a concentration nonparametric test (one-way ANOVA and Newman–Keuls; of 10 mg/5 ml. The CE and the EAF test solutions were P < 0.0001). made up to a concentration of 100 mg/5 ml (Hostettmann et al., 2003). All solutions were applied at 20 ␮lonthe 2.6. Antibacterial activity TLC. The capacity of the prepared extracts to scavenge the “sta- The antibacterial activity of the crude extract (CE) and ble” free radical 2,2-diphenyl-1-picrylhydrazyl (DPPH) was ethyl-acetate fraction (EAF) against Staphylococcus aureus monitored according to the method of Hatano et al. (1988), (ATCC 25923), Bacillus subtilis (ATCC 6623),Escherichia with slight modifications. CE or EAF (5 mg) was dissolved coli (ATCC 25922), and Pseudomonas aeruginosa (ATCC in 10 ml of methanol and diluted to obtain five solutions 15442) was studied. The antibacterial property was studied (0.032–20 ␮g/ml) with a final volume of 5 ml. A 4 ml aliquot by the microdilution method for determination of the mini- was added to a methanolic solution of DPPH (1 mM, 0.5 ml). mum inhibitory concentration (MIC) and minimum bacterici- The mixture was vortexed for 15 s and then left to stand at dal concentration (MBC), using the reference antimicrobials room temperature for 30 min. The absorbance of the result- penicillin, vancomycin and tetracycline (NCCLS, 2000). ing solutions was read spectrophotometrically at 517 nm. A methanolic solution of DPPH that had decayed and hence 2.7. Determination of total phenolics and tannins in the no longer exhibited a purple colour (i.e., 2 mg of BHT dis- crude and ethyl-acetate extracts solved in 4 ml of methanol with 0.5 ml of the DPPH solution added) was chosen for background correction, instead The total phenolics (TP) content in the crude extract (CE) of pure methanol. A solution of 0.5 ml DPPH and 4 ml of the and ethyl-acetate fraction (EAF) from both species was esti- methanol was used as a positive control. The radical scaveng- mated by a colorimetric assay based on procedures described ing activity (RSA) was calculated as a percentage of DPPH 268 G.C. Lopes et al. / Journal of Ethnopharmacology 99 (2005) 265–272 discolouration using the equation: 1 − Ae %RSA = 100 × Ad where Ae is the absorbance of the solution when an extract has been added at a particular level, and Ad is the absorbance of the DPPH solution with nothing added.

3. Results

3.1. Clinical evaluation

Wounds treated daily with ointments containing extracts Fig. 2. Differences between the initial and final areas (mm2) of cuta- of Stryphnodendron polyphyllum Mart. and Stryphnodendron neous wounds treated with 2.5% PEA of Stryphnodendron polyphyllum. Mean ± S.D. (n =5)*P < 0.05 compared to the control. obovatum Benth., and with ointment base, were observed after 4, 7 and 10 days. In all the experimental groups, the 4-, 7- 3.3. Evaluation of cellular epithelial proliferation and 10-day-old wounds formed a dry, dark-brown crust which thickened with time. No exudate or contamination was ob- In the experiments with extracts of Stryphnodendron obo- served. Removal of the crust at 10 days did not cause bleeding, vatum, the number of metaphases increased after 7 and 10 indicating that by this time the wounds were re-epithelialised. days of treatment in the wounds treated with PCE. With PEA, The control wounds formed a moist red crust, with no con- cellular proliferation in the area of re-epithelialisation (epi- tamination (Fig. 1). dermis) increased significantly over the control by day 4. Af- ter this period, the number of mitoses in the treated wounds 3.2. Morphometry of the wounds declined, with inhibition by day 7 (Figs. 3 and 4). In the experiments with extracts of Stryphnodendron poly- In the experiments with wounds treated with PCE of both phyllum, wounds treated with PCE and PEA showed an in- species of Stryphnodendron and in the control wounds, cica- crease in cellular proliferation of the epidermis after 4 and trisation usually developed. There was no significant differ- 7 days of treatment; after 10 days there was no significant ence between the treated wounds and the controls. increase (Figs. 5 and 6). Fig. 2 compares the differences between the initial and final areas of the control wounds and the wounds treated with 3.4. Antibacterial activity PEA from Stryphnodendron polyphyllum after 4, 7 and 10 days. There was no significant difference between the treated The inhibitory and bactericidal effects of CE and EAF and control wounds, for the PEA from Stryphnodendron obo- against the pathogens studied by the microdilution method vatum (results not shown). are shown in Table 1. CE and EAF obtained from Stryphn- odendron polyphyllum showed inhibitory activity against the Gram-positive bacteria Staphylococcus aureus with MIC values of 125 ␮g/ml and MBC values of 250 ␮g/ml. In Bacil-

Fig. 3. Effect of the treatment of cutaneous wounds with 2.5% PCE of Stryphnodendron obovatum on the number of metaphases in the epidermis, Fig. 1. Cutaneous wounds in Wistar® rats after 7 days of treatment. Left: counted in 40 microscope ﬁelds, each ﬁeld 250 ␮m. Mean ± S.D. (n =5) wound treated with PEA; right: control wound treated with ointment base. *P < 0.05 compared to the control. G.C. Lopes et al. / Journal of Ethnopharmacology 99 (2005) 265–272 269

Table 1 Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of crude extract and ethyl-acetate fraction of Stryphnoden- dron polyphyllum and Stryphnodendron obovatum using the microdilution method Extracts MIC (MBC) (␮g/ml)

Staphylococcus Bacillus Pseudomonas Escherichia aureus subtilis aeruginosa coli Stryphnodendron polyphyllum CE 125 (250) 250 (250) >1000 >1000 EAF 125 (250) 250 (250) >1000 >1000 Stryphnodendron obovatum Fig. 4. Effect of the treatment of cutaneous wounds with 2.5% PEA of CE 250 (250) 1000 (>1000) >1000 >1000 Stryphnodendron obovatum on the number of metaphases in the epidermis, EAF 250 (250) 1000 (>1000) >1000 >1000 counted in 40 microscope ﬁelds, each ﬁeld 250 ␮m. Mean ± S.D. (n =5) *P < 0.05 compared to the control. 3.5. Determination of total phenolics and tannins in the crude and ethyl-acetate extracts

The content of total phenolics and tannins of the CE and EAF of both species was evaluated, adapted from the method proposed by Glasl (1983), calculated as a percentage of the total phenolics and total tannin content. The total phenolics of the CE of Stryphnoden- dron obovatum was 76.95 ± 2.98% (CV = 3.87%) and in the EAF was 89.13 ± 0.34% (CV = 0.38%), whereas in Stryphnodendron polyphyllum the total phenolics of the CE was 51.62 ± 1.53% (CV = 2.96%) and in the EAF was 59.00 ± 1.91% (CV = 3.24%). The tannin content of Fig. 5. Effect of the treatment of cutaneous wounds with 2.5% PCE of the CE of Stryphnodendron obovatum [36.58 ± 0.35% Stryphnodendron polyphyllum on the number of metaphases in the epider- (CV = 0.98%)] was about 11% higher than the CE of Stryphn- ␮ ± mis, counted in 40 microscope fields, each field 250 m. Mean S.D. (n =5) odendron polyphyllum [25.43 ± 0.96% (CV = 3.77%)]. In the *P < 0.05 compared to the control. EAF the difference between the species was even greater. In Stryphnodendron obovatum the content was 55.01 ± 0.36% lus subtilis, MIC and MBC were 250 ␮g/ml. CE and EAF (CV = 0.65%), whereas in Stryphnodendron polyphyllum the ± of Stryphnodendron obovatum showed lower activity, with content was 36.16 0.42% (CV = 1.16%). MICs of 250 and 1000 ␮g/ml in Staphylococcus aureus and Bacillus subtilis respectively. All extracts and fractions 3.6. Antioxidant activity at concentrations >1000 ␮g/ml did not inhibit the Gram- negative bacteria species studied. The CE and EAF of Stryphnodendron polyphyllum and Stryphnodendron obovatum all showed a capacity to reduce the radical 2,2-diphenyl-1-picrylhydrazyl (DPPH.)to the same degree as the reference substances through TLC. The two species differed with respect to radical scavenging activity (RSA). Whereas Stryphnodendron polyphyllum showed activity between 70.10% and 74.78%, Stryphnoden- dron obovatum fell to nearly half this value (35.85% to 36.40%) at a concentration of 4 ␮g/ml. At higher concentrations (8 and 20 ␮g/ml), the extracts from both species showed practically the same RSA. At the lowest concentration (0.032 ␮g/ml), the CE of both species showed similar RSA values (40.01% and 32.70%). However, the EAF showed a higher RSA for Stryphnodendron polyphyllum (37.18%), versus 12.54% for Stryphnodendron obovatum. Fig. 6. Effect of the treatment of cutaneous wounds with 2.5% PEA of The results were analysed and the significance was obtained Stryphnodendron polyphyllum on the number of metaphases in the epider- ␮ mis, counted in 40 microscope fields, each field 250 ␮m. Mean ± S.D. (n =5) by P < 0.0001 at concentration of 0.032 g/ml for CE and *P < 0.05 compared to the control. EAF of both species (Fig. 7). 270 G.C. Lopes et al. / Journal of Ethnopharmacology 99 (2005) 265–272

membranes, tannins cause the precipitation of proteins, which renders the superficial layers impermeable to noxious agents (Haslam et al., 1989), shrinking colloidal structures. This astringent action deprives bacteria of a favourable growth medium, producing an indirect antibacterial effect (Schulz et al., 2002). The tannins also promote capillary vasoconstric- tion, which decreases vascular permeability and causes a local anti-inflammatory effect (Kapu et al., 2001; Mota et al., 1985) and impedes the formation of inflammatory exudates, hindering the development of microorganisms. The mechanism by which barbatimão stimulates the cellular proliferation of keratinocytes in cicatrisation is unknown. The difference between the two species studied in the degree Fig. 7. Radical scavenger activity of CE and EAF from the stem bark of Stryphnodendron polyphyllum Mart. and Stryphnodendron obovatum Benth. of stimulation of cellular proliferation may be a function of on 2,2-diphenyl-1-picrylhydrazyl free radical (DPPH). ()CEofStryphn- the difference in the tannin content of the stem bark, which odendron polyphyllum,() EAF of Stryphnodendron polyphyllum,()CE in Stryphnodendron polyphyllum is 12% and in Stryphnoden- of Stryphnodendron obovatum,() EAF of Stryphnodendron obovatum. dron obovatum is 19%; alternatively, the difference may be *** P < 0.0001. due to the presence of different types of these compounds. In both species, several condensed tannins have been isolated 4. Discussion and identified (Sanches, 2004; Sanches et al., 2002; Lopes et al., 2003) and this discussion is according Santos et al. Cutaneous injury is characterised by fibroplasia, angio- (2002). The tannins may act directly by stimulating the occur- genesis and re-epithelisation. The response to injury involves rence of mitoses. Alternatively, the tannins may act indirectly the migration and proliferation of cells such as fibroblasts, en- by preventing development of edema at the lesion site, since dothelial and epithelial cells, deposition of connective tissue excessive edema retards cicatrisation (Sanchez Neto et al., and contraction of the wound (Clark, 1996). The cicatrisation 1993). process proceeds naturally, as the damaged tissue attempts to The anti-inflammatory properties of the tannins may have re-establish haemostasis. However, risk factors such as infec- contributed to the superior results from PEA in the acute tions and excessive inflammatory reaction may compromise treatment, compared to the groups treated with PCE, be- the repair process. cause EAF contains a narrower range of condensed tan- Stem bark of Stryphnodendron adstringens (Mart.) Cov- nins (monomers, dimers, trimers, tetramers, up to the size ille, Stryphnodendron obovatum Benth. and Stryphnoden- of oligomers), whereas CE contains all these and also much dron polyphyllum Mart. have been used for the treatment larger polymers (Mello et al., 1996a, 1996b, 1999; Thompson of wounds, burns and other cutaneous injuries. The tannins et al., 1972). Moreover, the content of total tannins present present in the preparations are thought to be responsible for in the EAF and consequently in PEA is higher than that de- this activity (Correa,ˆ 1926; Favoretto et al., 1985; Jorge Neto termined in CE, and also by inference in PCE. et al., 1996). In a comparative study of the composition of tannins of In the cicatrisation experiment, the application of ointment three species, all popularly known as barbatimão (Stryphn- containing crude extract (PCE) from Stryphnodendron obo- odendron adstringens, Stryphnodendron polyphyllum and vatum stimulated proliferation significantly: the epidermis Dimorphandra mollis), Santos et al. (2002) demonstrated the re-epithelised (P < 0.05) after 7 and 10 days of treatment. In existence of differences in the structure of the tannins be- the wounds treated with Stryphnodendron polyphyllum, the tween the two genera, as well as between the two species of number of blocked metaphases was significantly (P < 0.05) Stryphnodendron. TLC analyses showed a larger degree of higher after 4 and 7 days of treatment (Figs. 3 and 5). polymerisation for the extracts from the genus Stryphnoden- The ointment containing the ethyl-acetate fraction (PEA) dron, compared with Dimorphandra. According to Santos et stimulated cellular proliferation in the initial phase of cicatri- al. (2002), the degree of polymerisation is an important factor sation. This action was more lingering for Stryphnodendron in biological activity, for instance the affinity for proline-rich polyphyllum, lasting for up to 7 days (Fig. 6). For Stryphn- proteins such as skin collagen. odendron obovatum, PEA stimulated proliferation after only The results obtained with Stryphnodendron polyphyllum 4 days of treatment (Fig. 4). However, there was a decline in are similar to those obtained by Palermo et al. (2002), who the number of mitoses after 7 days. The stimulation returned analysed epidermal proliferation in excisional wounds in by treatment day 10, although this change was not significant Wistar® rats treated with 1% PEA of Stryphnodendron ad- in relation to the control wounds. stringens. The authors observed a significant increase in the Tannins have been used in dermatology because of their number of blocked metaphases after 4 and 7 days of treat- strong astringent property, which positively affects wound ment. According to Santos et al. (2002), Stryphnodendron healing. When applied topically onto the skin or mucous polyphyllum contains higher levels of phenolic compounds G.C. Lopes et al. / Journal of Ethnopharmacology 99 (2005) 265–272 271 that precipitate proteins than Stryphnodendron adstringens. comparative studies such as the present one add to existing However, both species contain similar levels of condensed information and increase confidence in the healing properties tannins, which implies that the analysed activity is affected of members of the genus Stryphnodendron, confirming the by the content of condensed tannins and not by the content ethnopharmacological value of the genus. of total phenols. In the evaluation of the effect of 2.5% PCE and PEA, there was no significant difference in the contraction of Acknowledgments wounds treated with Stryphnodendron obovatum, and the controls. Wounds treated with PEA of Stryphnodendron The authors are grateful for financial support from Capes, polyphyllum contracted significantly less than the con- CNPq and the Fundaçao˜ Araucaria.´ The Instituto Florestal trol wounds by day 7 (Fig. 2). This may be related to of the state of Sao˜ Paulo gave permission to collect Stryphn- the higher tannin content in Stryphnodendron obovatum odendron obovatum. Our gratitude to Maria Euride Carlo [55.01 ± 0.36% (CV = 0.65%)] than in Stryphnodendron Cancino, Admir Arantes, Claudio´ Roberto Novello for tech- polyphyllum [36.16 ± 0.42% (CV = 1.16%)]. nical support. Special thanks to Dr. Eneri Vieira de Souza The contraction of a skin wound involves the reduction of Leite Mello for valuable contributions to the accomplishment all or part of the defect through centripetal movement of the of this work. surrounding skin (Montandon et al., 1977). Wounds treated with barbatimão extract generally formed a dry, thick brown crust. The crust of control wounds was moist, red and ap- References parently thinner. It is possible that the crust of the wounds treated with barbatimão acted as a physical barrier, hindering Audi, E.A., Toledo, D.P., Peres, P.G., Kimura, E., Pereira, W.K.V., the contraction of the wounds treated with PEA of Stryphn- Mello, J.C.P. de Nakamura, C.V., Alves-do-Prado, W., Cuman, odendron polyphyllum. Nevertheless, sub-crustal cicatrisa- R.K.N., Bersani-Amado, C.A., 1999. Gastric antiulcerogenic effects of Stryphnodendron adstringens in rats. Phytotherapy Research 13, tion was not compromised. Studies by Eurides et al. (1996) 264–266. and Vieira et al. (1998), both with Stryphnodendron adstrin- Clark, R.A.F., 1996. Wound repair: overview and general considerations. gens, reported the same effect. In: Clark, R.A.F. (Ed.), The Molecular and Cellular Biology of Wound According to Montandon et al. (1977), in practice, when a Repair. Plenum Press Co, New York, pp. 3–50. wound is made experimentally, independently of its form, the Correa,ˆ M.P., 1926. Dicionario´ das plantas uteis´ do Brasil e das exoticas´ cultivadas. Imprensa Oficial VI, Rio de Janeiro, p. 747. elastic forces of the neighbouring skin will increase the size Coulombe, P.A., 1997. Towards a molecular definition of keratinocute of the wound considerably and give it a form corresponding activation after acute injury to stratified epithelia. Biochemical and to the local lines of tension. In Fig. 2, that effect was observed Biophysical Research Communications 236, 231–238. after 4 days of treatment with PEA of Stryphnodendron poly- Deters, A., Dauer, A., Schnetz, E., Fartasch, M., Hensel, A., 2001. High phyllum. molecular compounds (polysaccharides and proanthocyanidins) from Hamamelis virginiana bark: influence on human skin keratinocyte On the other hand, the formation of a crust over a non- proliferation and differentiation and influence on irritated skin. Phy- exudative wound favours the cicatrisation process, because tochemistry 58, 949–958. the exudates promote the disaggregation of the crust and the Eurides, D., Mazzani, A., Belleff, M.E., Silva, L.A.F., Fioravante, M.C.S., development of microorganisms (Oliveira, 1992). Troncoso Neto, N.S., Campos, V.A., Silvestrini Junior, P.L., 1996. Microbial infections cause increased complications in the Morfologia e morfometria da reparaçao˜ tecidual de feridas cutaneasˆ de camundongos tratadas com soluçao˜ aquosa de barbatimao˜ (Stryphn- healing process. The results observed with CE and EAF of odendron barbatiman Mart.). Revista da Faculdade de Zootecnia. Vet- Stryphnodendron polyphyllum and Stryphnodendron obo- erinaria´ e Agronomia de Uruguaiana 3, 37–42. vatum indicated a moderate activity against Gram-positive Favoretto, A.L., Contrera, M.G.D., Petenusci, S.O., Silva-Netto, C.R., bacteria, the pathogens that are usually involved in skin Lopes, R.A., 1985. Açao˜ cicatrizante do extrato aquoso de casca infections. de barbatimao˜ Stryphonodendron obovatum Benth. em ulceras´ por contençao˜ em ratos. Revista da Escola de Farmacia´ e Odontologia de Antioxidant activity contributes favourably to the cicatri- Alfenas 8, 7–12. sation of wounds, because the production of reactive oxygen Fernandez, O., Capdevila, J.Z., Dalla, G., Melchor, G., 2002. Efficacy species during the process of inflammatory reaction aggra- of Rhizophora mangle aqueous bark extract in the of open surgical vates the disorders in the tissues. The anti-radical properties wounds. Fitoterapia 73, 564–568. observed in CE and EAF of both species probably favoured Glasl, H., 1983. Zur Photometrie in der Drogenstandardisierung – 3. Gehaltsbestimmung von Gerbstoffdrogen. Deutsche Apotheker cicatrisation, but this activity cannot be correlated exclusively Zeitung 123, 1979–1987. with tannins (Fernandez et al., 2002; Haslam, 1996). Haslam, E., Lilley, T.H., Ya, C., Gaffney, S.H., Spencer, C.M., Martin, A synergistic effect of all these factors evaluated may be R., Magnolato, D., 1989. Some observations on the role of plant involved in the wound healing observed in the species stud- polyphenols in traditional herbal medicines. Farmaceutisch tijdschrift ied. Synergistic effects were more pronounced in Stryphn- voor Belgie 66, 21–33. Haslam, E., 1996. Natural polyphenols (vegetable tannins) as drugs: pos- odendron polyphyllum. sible modes of action. Journal of Natural Products 59, 205–215. Although the exact physiological mechanisms of action Hatano, T., Kagawa, H., Yasuhara, T., Okuda, T., 1988. Two news of the tannins in wound healing are not totally explained, flavonoids and other constituents in licorice root: their relative astrin- 272 G.C. Lopes et al. / Journal of Ethnopharmacology 99 (2005) 265–272

gency and radical scavenging effects. Chemical and Pharmaceutical Occhioni, E.M.L., 1990. Consideraçoes˜ taxonomicasˆ no generoˆ Stryphn- Bulletin 36, 2090–2097. odendron Mart. (Leguminosae-Mimosoideae) e distribuiçao˜ geografica´ Hostettmann, K., Queiroz, E.F., Vieira, P.C., 2003. Princ´ıpios ativos de das especies.´ Acta Botanicaˆ Brasilica 4, 153–158. plantas superiores. EdUFSCar, Sao˜ Carlos, 152 p. Oliveira, H.P., 1992. Traumatismo nos animais domesticos.´ Cadernos Jordan, M.A., Thrower, D., Wilson, L., 1992. Effects of vinblastine, Tecnicos´ da Escola de Veterinaria´ de Belo Horizonte 1, 01–57. podophyllotoxin and nocodazole on mitotic spindles. Implications for Palermo, D., Pereira, L.C.M.S., Mello, J.C.P., Hernandes, L., 2002. Ativi- the role of microtubule dynamics in mitosis. Journal of Cell Science dade cicatrizante do barbatimao˜ [Stryphnodendron adstringens (Mar- 102, 401–416. tius) Coville] em feridas cutaneas.ˆ Arquivos da Apadec 6, 2. Jorge Neto, J., Fracasso, J.F., Camargo Neves, M.C.L., Santos, L.E., Panizza, S., Rocha, A.B., Gecchi, R., Silva, R.A.P., 1988. Stryphnoden- Banuth, V.L., 1996. Tratamento de ulcera´ varicosa e lesoes˜ de pele dron barbadetiman (Vellozo) Martius: teor em tanino na casca e com Calendula officinalis L. e/ou com Stryphnodendron barbadetiman sua propriedade cicatrizante. Revista de Cienciasˆ Farmaceuticasˆ 10, (Vellozo) Martius. Revista de Cienciasˆ Farmaceuticasˆ 17, 181–186. 101–106. Kapu, S.D., Ngwai, Y.B., Kayode, O., Akah, P.A., Wambebe, Prista, L.N., Da Fonseca, A., 1993. Manual de Terapia Dermatologica´ e C., Gamaniel, K., 2001. Anti-inflammatory, analgesic and anti- Cosmetologia. Roca, Sao˜ Paulo, pp. 226–229. lymphocytic activities of the aqueous extract of Crinum giganteum. Sanches, A.C.C., Mundo, S.R., Silva, P.E.R., Nakamura, C.V., Mello, Journal of Ethnopharmacology 78, 7–13. J.C.P., 2002. Pharmacognostic study and antibacterial activity of the Lima, J.C.S., Martins, D.T.O., De Souza Jr., P.T., 1998. Experimental stem bark extract Stryphnodenderon obovatum Benth, Leguminosae. evaluation of stem bark of Stryphnodendron adstringens (Mart.) Cov- 50th Annual Congress of the Society for Medicinal Plant Research, ille for antiinflammatory activity. Phytotherapy Research 12, 218–220. 2, Barcelona-Espanha, p. 301. Lopes, G.C., Nakamura, C.V., Dias Filho, B.P., Mello, J.C.P., 2003. Es- Sanches, A.C.C., 2004. Estudo farmacognostico´ das cascas de Stryphn- tudos f´ısico-qu´ımico, qu´ımico e biologico´ de extratos das cascas de odendron obovatum Benth., atividade antioxidante, antimicrobiana e Stryphnodendron polyphyllum Mart. (Leguminosae). Revista Brasileira da açao˜ cicatrizante dos seus extratos. Master of Science Dissertation. de Farmacognosia 13, 24–27. UNESP, Araraquara, SP, Brazil, 210 p. Mello, J.C.P. de Petereit, F., Nahrstedt, A., 1996a. Flavan-3-ols and Sanchez Neto, R., Barone, B., Teves, D.C., Simoes,˜ M.J., Novo, Prodelphinidins from Stryphnodendron adstringens. Phytochemistry N.F., Juliano, Y., 1993. Aspectos morfologicos´ e morfometricos´ da 41, 807–813. reparaçao˜ tecidual de feridas cutaneasˆ de ratos com e sem trata- Mello, J.C.P. de Petereit, F., Nahrstedt, A., 1996b. Prorobinetinidins from mento com soluçao˜ de papa´ına a 2%. Acta Cirurgica´ Brasileira 8, Stryphnodendron adstringens. Phytochemistry 42, 857–862. 18–23. Mello, J.C.P., de Petereit, F., Nahrstedt, A., 1999. A dimeric proan- Santos, S.C., Costa, W.F., Ribeiro, J.P., Guimaraes,˜ D.O., Ferri, P.H., Fer- thocyanidin from Stryphnodendron adstringens. Phytochemistry 51, reira, H.D., Seraphin, J.C., 2002. Tannin composition of barbatimao˜ 1105–1107. species. Fitoterapia 73, 292–299. Montandon, D., D’andiras, G., Gabbiani, G., 1977. The mechanism of Schulz, V., Hansel,¨ R., Tyler, V.E., 2002. Fitoterapia Racional – Um guia wound contraction and epithelialization. Clinics in Plastic Surgery 4, de fitoterapia para as cienciasˆ da saude,´ 4th ed. Manole, Sao˜ Paulo. 325–346. Thompson, R.S., Jacques, D., Haslam, E., Tanner, R.J.N., 1972. Plant Mota, M.L.R., Thomas, G., Barbosa Filho, J.M., 1985. Anti-inflammatory proantocyanidins. Part 1. Introduction; the isolation, structure, and actions of tannins isolated from the bark of Anacardium occidentale distribution in nature of plant procyanidins. Journal of the Chemical L. Journal of Ethnopharmacology 13, 289–300. Society, Perkin Transactions 1, 1387–1399. NCCLS (National Committee for Clinical Laboratory Standards), 2000. Vieira, F.C., Leite-Mello, E.V.S., Mello, J.C.P., 1998. Cicatrizaçao˜ cutaneaˆ Methods for Dilution Antimicrobial Susceptibility Tests for Bacte- em feridas de ratos apos´ aplicaçao˜ topica´ de pomadas de barbatimao˜ ria that Grow Aerobically. Approved Standard M7-A5, vol. 20, #2. e nebacetin. In: Simposio´ de Plantas Medicinais do Brasil. Aguas´ de National Committee for Clinical Laboratory Standards, Wayne, PA; Lindoia:´ Departamento de Psicobiologia e Farmacologia da Escola 5th ed. Paulista de Medicina, 188. Journal of Ethnopharmacology 99 (2005) 273–279

Ethnobotanical study of some Ghanaian anti-malarial plants

Alex Asase a,b, Alfred A. Oteng-Yeboah a, George T. Odamtten a, Monique S.J. Simmonds b,∗

a Department of Botany, University of Ghana, P.O. Box LG 55 Legon, Ghana b Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AB, UK Received 18 January 2005; received in revised form 24 February 2005; accepted 24 February 2005 Available online 18 April 2005

Abstract

An ethnobotanical study was conducted in the Wechiau Community Hippopotamus Sanctuary area in Ghana, through interviews and quadrate studies, to investigate the range and abundance of species used in the treatment of malaria. Forty-one species belonging to 17 families were encountered during the study. Of the 17 families studied Leguminosae and Anacardiaceae predominated in terms of number of species used to treat malaria. Eight plant species namely, Afraegle paniculata (Rutaceae), Haematostaphis barteri (Anacardiaceae), Indigo era pulchra (Leguminosae), Monanthotaxis sp. (Annonaceae), Ozoroa insignis (Anacardiaceae), Strychnos innocua (Loganiaceae), Strychnos spinosa (Loganiaceae) and Xeroderris stuhlmannii (Leguminosae) have not previously been documented for the treatment of malaria in Ghana. The results are discussed and recommendations made for future research to support the conservation and sustainable harvesting of the species reported to have medicinal properties. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Ethnobotany; Malaria; Wechiau; Medicinal plants; Conservation

1. Introduction 2003). Thus it is important to search for new anti-malarial compounds, either synthetic or natural compounds that kill Malaria is caused by a single celled protozoan para- either the vector or parasite. sites called Plasmodium and transmitted to man thought the The use of plant-derived drugs for the treatment of malaria anopheles mosquito. It is one of the major fatal diseases in has a long and successful tradition. For example, quinine iso- the world, especially in the tropics and is endemic in some lated from Cinchona and quinghaosu from Artemisia annua 102 countries with more than half of the world population at L. illustrates the potential value of investigating tradition- risk (Symth, 1994). ally used anti-malarial plants for developing pharmaceuti- In spite of control programmes in many countries there cal anti-malarial drugs (Srisilam and Veersham, 2003). In has been very little improvement in the control of malaria Ghana, several plant species including Alstonei boonei De and infections can reduce the effectiveness of labour and can Willd (Apocynaceae), Azadirachta indica A. Juss, (Meli- lead to both economic and human loses. Control of malaria is aceae), Cryptolepis sanguinolenta (Lindl.) Schttr. (Asclepi- complex because of the appearance of drug resistant strains of daceae), Morinda lucida Benth. (Rubiaceae), Nauclea latifo- Plasmodium and with the discovering that man may become lia Sm. (Rubiaceae) and Ocimum viride Willd. (Lamiaceae) infested with species of simian (monkey) malaria (Symth, are used in the treatment of malaria (Ayitey-Smith, 1989; 1994). At the same time the anopheles mosquito have devel- Abbiw, 1990; Mshana et al., 2001). oped resistance to many insecticides (Srisilam and Veersham, The aim of this study was to collate information from an indigenous group of people living in the Wechiau Community ∗ Hippopotamus Sanctuary area of Ghana about their current Corresponding author. Tel.: +44 208 332 5340; fax: +44 208 332 5328. E-mail address: [email protected] (M.S.J. Simmonds). traditional uses of plants for the treatment of malaria.

2. Materials and methods 2.2. Ethnobotanical survey

2.1. Study area The following three techniques were used to obtain information about the species of plants used in the treatment of malaria in the study area: The study area at Wechiau is about 42 km southwest of Wa in the Upper West Region of Ghana and positioned on lati- 1. Field interviews; involved walking with local people in ◦ ◦ tude 09 49 762 N and longitude 02 40 965 W. The area has the areas where they normally collected their medicinal been demarcated as a conservation sanctuary called Wechiau plants while interviewing them. After picking a plant, they Community Hippopotamus Sanctuary and covers an area of consulted among themselves the anti-malarial uses of the 40 km2 along the banks of the Black Volta River. The vege- plant. The three local people involved in this study were tation is Guinea savannah. There are two main ethnic groups those selected by the sanctuary management board as hav- in the area namely the Brefo and Wale. The area has an es- ing the greatest knowledge about the traditional uses of timated population of 8700 people. The sanctuary is one of plants in the area. the few in Ghana where local people are taking full control 2. House-to-house interviews; 14 local people were inter- of the management of their natural resources. viewed using a questionnaire. Local trained guides served

Table 1 Methods of identiﬁcation and percentage of people with knowledge their anti-malarial use (PPK) and preference ranking (PR) of species used to treat malaria in the Wechiau Community Hippopotamus Sanctuary, Ghana Species (voucher numbers) Families Method of interviews PPK PR

Field House-to-house Plants collected by people Acanthospermum hispidum DC (GC 47761) Asteraceae * 9.81 Afraegle paniculata (Shum & Thonn.) Engl. (GC 47780) Rutaceae * 4.81 Afzelia africana Sm. (GC 47762) Leguminosae * 9.81 Anogeissus leiocarpa Guill & Perr. (GC 47763) Combretaceae * * 4.82 Azadirachta indica A. Juss. (GC 47764) Meliaceae * 29.32 Carica papaya L. (GC 47765) Caricaceae * 9.82 Cassia sieberiana DC (GC 47799, AA) Leguminosae * 9.83 Cochlospermum tinctorium Perr. (GC 47766) Bixaceae * 9.83 Combretum ghasalense Engl. & Diels (GC47767) Combretaceae * * 9.82 Combretum sp. L. (GC 47768) Combretaceae * 4.81 Ficus gnaphalocarpa Steud. ex Miq. (GC 47769) Moraceae * 14.61 Ficus platyphylla Del. (GC4770) Moraceae * 4.81 Gardenia ternifolia Schum. & Thonn (GC 47771) Rubiaceae * * 9.82 Haematostaphis barteri Hook. f. (GC 47772) Anacardiaceae * 9.83 Hyptis spicigera Lam. (GC 47773) Lamiaceae * 4.81 Indigofera pulchra Willd. (GC 47774) Papilionaceae * * 9.83 Jatropha curcas L. (GC 47775) Euphorbiaceae * 9.81 Jatropha gossypiifolia L. (GC 47776) Euphorbiaceae * 9.81 Khaya senegalensis A.Juss. (GC 47777) Meliaceae * * 4.82 Lannea acida A. Rich. (GC 47778) Anacardiaceae * 9.81 Leucas martinicensis (Jacq.) R. Br. (GC 47779) Lamiaceae * 9.81 Mangifera indica L. (GC 47780) Anacardiacae * 24.41 Mitragyna inermis (Willd). K. Schum. (GC 47799) Rubiaceae * * * 24.43 Monanthotaxis sp. Baill. (GC 47781) Annonaceae * 19.52 Nauclea latifolia Sm. (GC 47782) Rubiacaea * * 4.82 Ocimum canum L. (GC 47800) Lamiaceae * 4.81 Ozoroa insignis Del. (GC 47783) Anacardiaceae * 4.82 Parinari polyandra Benth. (GC 47784) Chrysobalanaceae * 4.82 Parkia biglobosa (Jacq.) R Br. ex G. Don. (GC 47785) Leguminosae * 4.82 Paullinia pinnata L. (GC 47786) Sapindaceae * 4.81 Pericopsis laxiﬂora (Benth ex Baker) (GC 47787) Leguminosae * 9.81 Pseudocedrela kotschyi Harms (GC 47798) Meliaceae * 14.63 Pterocarpus erinaceus Cam (GC 47789) Leguminosae * 4.81 Ricinus communis L. (GC 47790) Euphorbiaceae * 4.81 Senna occidentalis L. (GC 47791) Leguminosae * 4.82 Sterculia setigera Del. (GC 47792) Sterculiaceae * 4.81 Strychnos innocua Del. (GC 47793) Loganiaceae * * 4.83 Strychnos spinosa Lam. (GC 47794) Loganiaceae * 4.82 Tamarindus indica L. (GC 47795) Leguminosae * 4.82 Vernonia amygdalina Del. (GC 47796) Asteraceae * * 14.63 Xeroderris stuhlmannii (Taub.) Mendonca. (GC 47797) Leguminosae * * 4.81 A. Asase et al. / Journal of Ethnopharmacology 99 (2005) 273–279 275

as interpreters during the conduct of the interviews. The integer (1, 2 or 3) with the most effective plants assigned questionnaire had prompts for the source of information, a value of 3. For example, if a plant was thought to be identify of the plant species, methods of preparation, pre- very effective in the treatment of malaria it was given a scription and administration. value 3. 3. Interviews with herbalist; four herbalists in the area were identified with the assistance of the sanctuary manage- The data from the ecological sampling were used to deter- ment board. It was arranged for them to collect plants mine the distribution and density of the anti-malarial plants they used in the treatment of malaria. They were then in- from the sanctuary area. The distribution of the plants was de- terviewed about how they used these plants. termined from the number of times a species occurred in the total number of quadrates examined. The density of a species In addition to the above techniques, samples of the species was also evaluated from the mean number of individuals of identified as having anti-malarial activity were collected and the species per unit area. further informal interviews were conducted in order to collect information about other uses of these species in the sanctuary. Vouchers of the species collected during the study 3. Results were deposited at the Ghana Herbarium (GC), Legon, Ghana (Table 1). The identification of the species was authenticated 3.1. Anti-malarial plants by comparison with herbarium vouchers and with the Flora of West Tropical Africa (Hutchinson and Dalziel, 1937). The A total of 41 species from 36 genera and 17 plant fami- authorities of the species were confirmed using the Electronic lies were identified during the ethnobotanical surveys as be- Plant Information Centre (EPIC, 2004). ing used to treat malaria. The species, their families, survey Twenty-two people from the Brefo (17) and Wale (5) areas method used to identify their uses, percentage of people in- were interviewed over a period of 6 months. In most cases terviewed with knowledge about their use to treat malaria they were interviewed on more than one occasion. Twelve and the preference ranking of the species are presented in out of the 22 (54.5%) people interviewed were males and all Table 1. The greatest number of species used to treat malaria of them were older than 20 years. The people interviewed in the sanctuary were identified during the house-to-house included Christians, Muslims and believers of local spiritual and field interviews which identified 31 (75.6%) and 14 tradition and other non-religious people. Only two of the peo- (34%) of the species, respectively. Only seven species were ple had some level of formal education. identified by asking herbalists to collect anti-malaria plants. However, five of these seven species were considered to 2.3. Distributional ranges of species be very effective anti-malarial species (Table 1). There was some overlap in the species identified using the different in- To determine the distributional ranges of the anti- terviewing methods. Mitragyna inermis (Willd) K. Schum malarial plants identified through the ethnobotanical surveys, was the only species identify by all three survey methods. quadrates of sizes, 25 m × 25 m, 5 m × 5m and 1m× 1m The other species frequently identified included Azadirachta were randomly taken in the study area. Forty-one quadrates indica and Mangifera indica L. (Table 1: high PPK val- of each size were studied. The 25 m × 25 m and 5 m × 5m ues). Eight species were reported to be most effective for quadrates were used to assess species of trees and shrubs, the treatment of malaria in the sanctuary included the most whereas the 1 m × 1 m quadrates were used to assess the frequently cited, Mitragyna inermis, as well as Cassia siebe- herbaceous or ground cover species. riana DC, Cochlospermum tinctorium Perr, Haematostaphis barteri Hook. f., Indigofera pulchra Willd., Pseudocedrela 2.4. Data analyses kostchyi Harms, Strychnos innocua Del., and Vernoniaamyg- dalina Del. The information obtained through the ethnobotanical in- Of the 17 families containing anti-malarial species the terviews was analysed with regard to the following parame- most predominant family in terms of number of species was ters: the Leguminosae with nine species (Table 1). A list of the lo- (i) Taxonomic diversity, growth forms and parts of the plant cal names, habits and how the plants are used in the treatment used to treat malaria. of malaria in the area are presented in Table 2. Trees consti- (ii) The percentage of people who have knowledge about the tuted 62% of the total plant species used to treat malaria in use of a species in the treatment of malaria was evaluated the study area and only two (5%) species were climbers. A using the formula (PPK): (number of people interviewed total of 45 herbal preparations were recorded as some prepa- citing species/number of people interviewed) × 100. rations included the use of more than one species. For ex- (iii) Preference ranking (PR) method was similar to that used ample, Azadirachta indica and Ocimum canum L. were of- by Martin (1995). In this case the plants were ranked ten used in more than one of the preparations. Most of the according to their level of effectiveness in the treatment preparation involved boiling the leaves and then drinking the of malaria by the local people. Each rank is given an infusion. 276 A. Asase et al. / Journal of Ethnopharmacology 99 (2005) 273–279

Table 2 Growth forms and local names of species of plants that are used to treat malaria in the Wechiau Community Hippopotamus Sanctuary, Ghana and information about the other uses of these species Species Growth forms Lobi name Wale name How plants are used to treat malaria and other uses Acanthospermum hispidum Herb Bongore Malaria: grind whole plant with hot pepper, sieve and drink as required. Afraegle paniculata Tree Malaria: boil roots and drink as required. Other uses: extract of boiled roots used to treat stomach aches Afzelia africana Tree Malaria: boil leaves and drink as required. Other uses: leaves fed to livestock; stems used to carve lobi sculptures Anogeisus leiocarpus Tree Sisinrah Siirah Malaria: boil leaves and twigs, and massage body with decoction for 3 days. Other uses: extract of boiled stem bark used to treat stomach aches Azadirachta indica Tree Akagyatia Malaria: (1) pound leaves, sieve and use for enema. (2) Boil leaves with leaves of Jatropha gossypifolia and Combretum sp., drink and use for steam baths. Other uses: grown as a shade tree; leaf extracts used to treat fevers Carica papaya Tree Kwalentia Malaria: boil leaves with leaves of Azadirachta indica. Drink as desired and use for steam baths. Other uses: peeled fruits eaten raw Cassia sieberiana Shrub Vabine Malaria: boil chopped roots and drink as desired. Add sugar to taste. Other uses: extract of boiled roots used to treat stomach aches and taken as aphrodisiac Cochlospermum tinctorium Herb Gbelonbile Malaria: boil chopped roots and drink as desired. Other uses: extract of boiled roots used to treat yellow fever Combretum ghasalense Shrub Popal Kpamara Malaria: boil leaves with that of Jatropha gossipifolia and whole plant of Ocimum canum, and drink. Use also for steam baths. Other uses: used as fuel wood Combretum sp. Shrub Kpekakra Malaria: boil leaves with stem bark of Mangifera indica, leaves of Azadirachta indica and drink as desired. Other uses: leaves fed to livestock Ficus gnaphalocarpa Tree Konkon Malaria: pound roots with roots of Gardenia ternifolia and Anogessius leiocarpus. Mould into ball and dry. Mash in water and drink Ficus platyphylla Tree Selinge Malaria: boil leaves and stems barks, drink as desired. Massage body with decoction. Other uses: extract of boiled leaves used as a “body builder” Gardenia tenifolia Shrub Dajeda Dajugo Malaria: boil leaves and twigs, and drink as desired. Other uses: planted around houses as a hedge Haematostaphis barteri Tree Dole Genbereni Malaria: boil leaves with leaves of Pseudocedrela kotschyi and Ficus ghaphalocarpa. Drink mornings and evenings and massage body. Other uses: fruits eaten raw Hyptis spicigera Herb Donbeleva Malaria: boil leaves and drink. Other uses: insect repellent against mosquitoes Indigofera pulchra Herb Balesama Malaria: boil whole plants, drink and massage body Jatropha curcas Shrub Nato Malaria: boils leaves with leaves of Azadirachta indica and Carica papaya. Drink and use for bathing. Other uses: planted as a hedge. Latex from twigs used to treat mouth sores Jatropha gossypiifolia Shrub Natogyere Malaria: boil leaves with leaves of Combretum ghaselensis and whole plant of Ocimum canum,and drink. Use also for steam baths. Other uses: planted as a hedge Khaya senegalensis Tree Koke Malaria: boil stem bark and drink. Other uses: stems and leaves boiled together and extract drunk as a blood tonic; stems used for building boats Lannea acida Tree Manvora/Vaaworo Gbentore Malaria: boil leaves with leaves of Azadirachta indica and Mangifera indica. Drink and use in steam baths. Other uses: timber used in house building Leucas martinicensis Herb Donbeleva Malaria: boil whole plant with Hyptis spicigeria and drink as required Mangifera indica Tree Mango Mango Malaria: boil stems barks and drink as required. Other uses: fruits eaten raw Mitragyna inermis Tree Yiela Yiele Malaria: (1) Boil leaves and twigs, and drinks. (2) Boil twigs with whole plant of Indigofera pulchra. Drink 3 times daily. Other uses: branches used for rooﬁng houses Monanthotaxis sp. Climber Woretia Malaria: boil leaves and drink three times daily. Massage body with decoction. Other uses: extract of boiled roots boiled taken to treat stomach aches A. Asase et al. / Journal of Ethnopharmacology 99 (2005) 273–279 277

Table 2 ( Continued ) Species Growth forms Lobi name Wale name How plants are used to treat malaria and other uses Nauclea latifolia Shrub Gongan Gounge Malaria: (1) pound roots, add lemon juice and palm wine, and drink as desired. (2) Boil leaves and drink as desired. Other uses: fruits eaten raw Ocimum canum Herb Worobagnui Malaria: (1) boil whole plant with leaves of Azadirachta indica, Combretum ghaselensis and Mitrgyana inermis and drink. (2) Boil leaves with that of Mangifera indica, Mitragyna inermis and whole plants of Indigofera indica and drink. Use also for steam baths. Other uses: seeds soaked and infusion applied to eyes to treat eye problems Ozoroa insignis Shrub Dato Malaria: boils leaves and twigs, and drink. Other uses: used as fuel wood Parinari polyandra Shrub Bongekapala Malaria: boil leaves, drink and use for bathing Parkia biglobosa Tree Dowa Dowa Malaria: boil leaves and steam barks, and drink as required. Other uses: extract of boiled stem bark, fruits and seeds used to treat stomach aches. Fruit eaten raw and seed used as spice Paullinia pinnata Shrub Chiau Malaria: boil leaves and drink. Bath mornings and evenings Pericopsis laxiflora Tree Malaria: boil leaves with that of Combretum sp. and Pericopsis laxiflora, and drink as required. Other uses: timber used for roofing Pseudocedrela kotschyi Tree Kpela Kpela Malaria: boil twigs and leaves, and drink as required. Other uses: extracts from boiled stem bark used to treat stomach aches and timber used for building Pterocarpus erinaceus Tree Pulinyie Malaria: boils leaves with leaves of Afzelia africana. Drink and use for steam baths. Other uses: leaves used to feed livestock and branches used for fuel wood Ricinus communis Shrub Beton Malaria: squeeze leaves in a pot to ferment. Bath with fermented solution. Other uses: planted as a hedge Senna occidentalis Herb Bontore Malaria: boil leaves with leaves of Mangifera indica and Carica papaya. Drink and bath decoction. Other uses: boil whole plant and extract drunk to reduce swelling Sterculia setigera Tree Bulinyanie Malaria: boil leaves and drink. Other uses: branches used for roofing Strychnos innocua Tree Kolan Polea Malaria: boil leaves and drink as required Strychnos spinosa Tree Dajekokora Polane Malaria: boil leaves and drink. Grind twigs, add to pomade and smear on body. Other uses: fruit eaten raw Tamarindus indica Tree Malaria: boil leaves and stem bark, and drink. Other uses: leaves cooked with porridge to make it taste sour. Fruit eaten raw Vernonia amygdalina Shrub Jankpantire Malaria: boil leaves in a maize dough solution (‘Konbire’ in Lobi) and drink Xeroderris stuhlmannii Tree Malaria: boil leaves with that of Combretum sp. and Pericopsis laxiflora, and drink as required. Other uses: branches used for roofing

Information about the other uses of the anti-malarial plants 3.2. Distributional ranges of anti-malarial plants in species in the sanctuary is outlined in Table 2. For example, study area boiled roots of Cassia sieberiana were used to treat stomach aches and also as an aphrodisiac. The boiled stem bark Thirteen of the 41 species used in the treatment of malaria and leaves of Khaya senegalensis A. Juss. were also drunk were found around the vicinity of habitations. These species as a blood tonic and the boiled roots of Monathotaxis sp. were often those frequently used by the residents, such as Baill. were used to treat stomach aches. In contrast, many Acanthospermum hispidum DC, Azadirachta indica, Carica of the species including Mitragyna inermis, Lannea acida papaya L., Indigofera pulchra, Mangifera indica, Jatropha A. Rich., Khaya senegalensis and Xerroderis stuhlmannii curcas L., Jatropha gossypiifolia L., Hyptis spicigera Lam., (Taub.) Mendonca. were used as sources of timber. Species Leucas martinicensis (Jacq.) R. Br, Ocimum canum, Ricinus such as Combretum ghaselensis Engl. & Diels, Ozoroa in- communis L., Senna occidentalis L., and occasionally Parkia signis Del. and Pterocarpus erinaceus Cam. were used as biglobosa (Jacq.) R. Br. Ex G. Dom. The remaining 28 species domestic sources of energy. Combretum L. sp. and Ptero- were found in the wild. Of these 28 species, 17 was recorded carpus erinaceus were also used for feeding livestock and during the ecological survey and their distribution and density Afzelia africana Sm. was used to carve the popular lobi are presented in Table 3. Of these species, the most widely sculptures. distributed species were Combretum ghasalense, Pterocar- 278 A. Asase et al. / Journal of Ethnopharmacology 99 (2005) 273–279

Table 3 Distribution and density of species used to treat malaria in the core area of Wechiau Community Hippopotamus Sanctuary Species Numbers of quadrates Relative frequency Density (m2) Relative density included/total Afzelia africana 65.3 0.0061 4.2 Anogeissus leiocarpa 12 10.6 0.0061 4.2 Cassia sieberenia 54.4 0.0072 5.0 Cochlospermum tinctorium 21.8 0.0016 1.1 Combretum ghasalense 25 22.1 0.034 23.4 Combretum sp. 11 9.7 0.012 8.3 Gardenia ternifolia 21.8 0.0016 1.1 Haematostaphis barteri 21.8 0.0032 2.2 Lannea acida 54.4 0.0048 3.3 Mitragyna inermis 15 13.3 0.012 8.3 Nauclea latifolia 21.8 0.0016 1.1 Ozoroa insignis 10.9 0.0016 1.1 Parkia biglobosa 21.8 0.0016 1.1 Pseudocedrela kotschyi 32.7 0.042 28.9 Pterocarpus erinaceus 17 15.0 0.0057 3.9 Sterculia setegera 21.8 0.0016 1.1 Tamarindus indica 43.5 0.0024 1.7 pus erinaceous, Mitragyna inermis and Anogeissus leiocarpa logical surveys. This suggests that these herbalists had a very Guill & Perr. Some of the species reported to treat malaria good knowledge of the local flora, especially the growing were not found during the quadrat studies. Such species were places of some of their important medicinal plants. flagged as ‘rare’ in the sanctuary and included two of the Most of the species used to treat malaria in the sanctuary species classed as being most effective in the treatment of are known to be anti-malarial plants and thus corroborate data malaria, Strychnos spinosa Lam. and Vernonia amygdalina, from many other sources including Irvine (1961), Ampofo as well as Afraegle paniculata (Shum & Thonn.) Engl., Ficus (1983), Ayitey-Smith (1989), Abbiw (1990), PORSPI (1992), gnaphalocarpa Steud ex Miq., Ficus platyphylla Del., Khaya Dokosi (1998) and Mshana et al. (2001). The study has also senegalensis, Monanthotaxis sp., Parinari polyandra Benth., identified and documented the anti-malarial use for the first Paullinia pinnata L., Pericopsid laxiflora (Benth. & Baker), time in Ghana of eight species namely, Afraegle paniculata, Strychnos innocua and Xeroderris stuhlmannii. Haematostaphis barteri, Indigofera pulchra, Monathotaxis sp., Ozoroa insignis, Strychnos innocua, Strychnos spinosa and Xeroderris stuhlmannii. We were not able to find any pub- 4. Discussion lished literature on the use of these species for the treatment of malaria in Ghana. The high diversity of plants reported The present survey has provided information about 41 to have anti-malaria activity during the house-to-house in- of species of plants used in the treatment of malaria in terviews could be because people were reflecting, not only the Wechiau Community Hippopotamus Sanctuary area of on what they now use to treat malaria but also on what they Ghana. The species used in the treatment of malaria rep- remember being used to treat malaria. Thus an element of resent 19.5% of the 210 species reported for the sanctuary hearsay can occur when collecting information within a group (Oteng-Yeboah and Asase, 2002). The study has also shown of people. These data need to be confirmed. how different interviewing methods can influence the scope Plant species used in the treatment of malaria in the sanc- of information obtained about the uses of each species. In- tuary area were derived from a diverse range of plant fam- terviews based on plants collected by the person being inter- ilies and there are no phylogenetic relationships among the viewed identified the least number of species, whereas the 17 families of plants used to treat malaria in the sanctuary house-to-house interviews identified the most species. The (Chase et al., 1993; Takhtajan, 1997). However, some of the field interviews were the most effective use of time as they families containing anti-malarial species including the Anac- took less time than the house-to-house interviews. Field inter- ardiaceae, Asteraceae, Leguminosae, and Rubiaceae contain views have also proved very successful in other ethnobotan- other species that are used to treat other illnesses and diseases ical studies in Ghana (Oteng-Yeboah, 1999). It is of interest in Ghana (PORSPI, 1992; Mshana et al., 2001). that although the interviews with the herbalists identified only The majority of the herbal preparations identified in this a few species as being anti-malarial most of the species they study involved boiling the plant material and then drinking selected were considered by the community to be active. The the extract. However, none of the people interviewed pro- herbalists also collected two of the effective species, Strych- vided any information about how they might “standardize” nos spinosa and Vernonia amygdalina, that were not reported treatments and the amounts used were generally vague. Thus to be grown in home gardens and not found during the eco- the quality could vary greatly among prescriptions. A. Asase et al. / Journal of Ethnopharmacology 99 (2005) 273–279 279

This lack of standardization and quality control is seen of the study and for their permission to publish the data. We by as one of the main disadvantages of traditional medicine are also thankful to ENRECA-DANIDA through the Accra- (Evans-Anfom, 1986; Sofowora, 1982). Some species were Copenhagen Research Link project on Malaria, Earthwatch also used as mixtures, which makes it more complex to stan- Institute and NCRC for support and funding. dardize as well as investigate and monitor the levels of biologically active compounds. This investigation would need to be done if quality control methods were to be developed. References The fact that the most common parts of the plant species used in the treatment of malaria were leaves and twigs is very Abbiw, D.K., 1990. Useful Plants of Ghana. Intermediate Technology encouraging for sustainable harvesting of the plants. Harvest- Publication/Royal Botanic Gardens, London/Kew. Ampofo, O., 1983. First Aid in Plant Medicine. Accra Waterville. ing roots and bark can easily threaten local populations of Ayitey-Smith, E., 1989. Prospects and Scope of Plant Medicine in Health plants unless a sustainable harvesting strategy has been de- Care. Ghana University Press. veloped (Cunningham, 2001). If a successful conservation Chase, M.W., Soltis, D.E., Olmstead, R.G., Morgan, D., Les, D.H., Mish- strategy is to be developed for the sanctuary then, priority ler, B.D., Duvall, M.R., Price, R.A., Hills, H.G., Qui, Y., Kron, K.A., should be given to supporting the sustainable harvesting of the Rettig, J.H., Conti, E., Palmer, J.D., Manhart, J.R., Systema, K.J., Michaels, H.J., Kress, W.J., Karo, K.G., Clark, W.D., Hedren, M., most effective anti-malarial plants in the sanctuary, especially Gaut, B.S., Jansen, R.K., Kim, K., Wimpee, C.F., Smith, J.F., Furnier, those with other uses such as Cassia sieberiana, Mitragyna G.R., Strauss, S.H., Xiang, Q., Plunkett, G.M., Soltis, P.S., Swensen, inermis, Haematostaphis barteri, Pseudocedrla kostchyi and S.M., William, S.E., Gadek, P.A., Quinn, C.J., Equiatre, L.E., Golen- Indigofera pulchra. As more people become aware of the berg, E., Learn Jr., G.H., Graham, S.W., Barrett, S.C.H., Dayanandan, uses of these species they could be among the most exploited S., Albert, C.A., 1993. Phylogenetics of seed plants: analysis of nu- cleotide sequences from plastid gene rbcL. Annals of the Missouri in the sanctuary and are thus likely to be the most threatened. Botanical Garden 80, 528–580. Plants earmarked as ‘rare’ in the present study could be culti- Cunningham, A.B., 2001. Applied Ethnobotany; People, Wild Plant Use vated as part of the home gardening strategy being developed and Conservation. Earthscan Publishers Limited, London. in the sanctuary. Dokosi, O.B., 1998. Herbs of Ghana. Ghana University Press. In this study recording the uses and abundance of the anti- EPIC, 2004. Electronic Plant Information Centre, Royal Botanic Gardens, Kew Published on the Internet. http://www.kew.org/epic/ (accessed 27 malarial species of plants has highlighted the importance fact December 2004). that some species with medicinal uses are not abundant. The Evans-Anfom, E., 1986. Traditional Medicine in Ghana: Practice, Prob- people living in the sanctuary area were not fully aware that lems and Prospects. Ghana Academy of Arts and Sciences. some of their medicinal plant species were becoming threat- Hutchinson, J., Dalziel, J.M., 1937. Flora of West Tropical Africa. The ened or extinct. This information can assist identify which Crown Agents, London. Irvine, F.R., 1961. Woody Plants of Ghana. Oxford University Press. species should be given priority when developing sustainable Martin, G., 1995. Ethnobotany—A Manual of Methods. Earthsacn Pub- harvesting strategies for species within the communities. To lishers Limited, London. enable people in the sanctuary maximize the use of their flora Mshana, R.N., Abbiw, D.K., Addae-Mensah, I., Adjanouhoun, E., Ahyi, in their day-to-day activities. It is important that the entire M.R.A., Ekpere, J.A., Enow-Rock, E.G., Gbile, Z.O., Noamesi, G.K., ethnoflora of the sanctuary is documented as this information Odei, M.A., Odunlami, H., Oteng-Yeboah, A.A., Sarpong, K., So- forowa, A., Tackie, 2001. Traditional Medicine and Pharmacopoeia; could assist identify conservation strategies for target species Contribution to the Revision of Ethnobotanical and Floristic Studies and thus support the health and economy of the community. in Ghana. Science and Technology Press, CSIR. Virtually, all people in the Wechiau Community Hip- Oteng-Yeboah, A.A., 1999. A survey of plant uses in three traditional popotamus Sanctuary rely on medicinal plants for the treat- groves in Guinea savanna zone of northern Ghana. In: Timberlake, ment of malaria since the nearest hospital is at Wa, about J.M., Kativu, S. (Eds.), African Plants: Biodiversity, Taxonomy and Uses. Royal Botanic Gardens, Kew, pp. 472–482. 42 km away accentuated by poor roads and means of trans- Oteng-Yeboah, A.A., Asase A., 2002. Wechiau Community Hippopota- port. Further research should be done on the comparative mus Sanctuary—preliminary data on floristics. Ghana Journal of Sci- anti-malarial activity of the different species to see if the lo- ence. Book of Abstract, p. 57. cal evaluation of the efficacy of the different species can be PORSPI, 1992. Ghana Herbal Pharmacopoeia. Policy Research and Strate- scientifically validated. gic Planning Institute, Council for Scientific and Industrial Research, CSIR, Ghana. Sofowora, A., 1982. Medicinal Plants and Traditional Medicine in Africa. Wiley, New York. Acknowledgements Srisilam, K., Veersham, C., 2003. Antimalarials of plant origin. In: Nis- han, I., Khanu, A. (Eds.), Role of Biotechnology in Medicinal and Aromatic Plants, vol. VII, pp. 17–47. We are grateful to the communities of the Wechiau Com- Symth, J.D., 1994. Animal Parasitology. Cambridge University Press. munity Hippopotamus Sanctuary area and the Sanctuary Takhtajan, A., 1997. Diversity and Classification of Flowering Plants. Management Board for providing facilities during the course Columbia University Press. Journal of Ethnopharmacology 99 (2005) 281–286

Research of enzymatic activities of fresh juice and water infusions from dry herbs

Alina Chudnicka a, Grazyna˙ Matysik b,∗

a Department of Medical Microbiology, Medical University, Chodzki 1, 20-093Lublin, Poland b Department of Chemistry, Medical University, Staszica 6, 20-081 Lublin, Poland Received 17 September 2003; received in revised form 11 February 2005; accepted 25 February 2005 Available online 12 April 2005

Abstract

Research was done on the presence of enzymes in juice obtained from fresh plant material from Chamomilla recutita L. (Rauschel)- anthodium, Lamium album L.-flos, Calendula officinalis L.-flos, Plantaginis lanceolata L.-folium and Euphrasiae rostkoviana Hayne-herba, and in the prepared water infusion of these materials; the objective was to determine the activity of enzymes which beside biologically active substances may have an influence of the final therapeutic effect of the applied plant preparations. The research was conducted by means of the API ZYM system (bioMerieux).` Higher enzymatic activities were found in fresh juices of the examined plant material than in prepared water infusions from dried plants. In both cases naphthol-AS-BI-phosphohydrolase should have highest activity. The second one in terms of activity out of 17 studied enzymes was acidic phosphatase. The highest enzymatic activity of fresh juice was found in Lamii albi flos and Calendulae officinalis flos. Water infusions showed the highest enzymatic activity in Lamii albi flos, Chamomille recutita anthodium and Plantaginis lanceolata folium. Drying the plant material resulted in decreased enzymatic activities but not in the case of naphthol-AS-BI- phosphohydrolase and acidic phosphatase which showed very low activities. The complex composition of plant materials in terms of content of biologically active substances may imply that the therapeutic effect might be directly related to the quantity and activity of plant enzymes present in preparations applied in therapeutics. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Enzymes; Herbs; API ZYM

1. Introduction oil, flavonoids, coumarins, phenolic acids, mucilage. Pharma- cological actions of Chamomilla recutita anthodium are: anti- Due to the very complex chemical nature of herbs ap- inflammatory, spasmolytic, vulnerary antimicrobial, mildly plied in therapeutics and the presence of different biologically sedative, antispasmodic and antiseptic properties. It has active substances, the determination of the biologically ac- been used for flatulent nervous dyspepsia, travel sickness tive compounds in a given plant preparation may sometimes and specifically for gastro-intestinal disorders with asso- present serious difficulties. ciated nervous irritability in children. It has been used topically for haemorrhoids, mastitis and leg ulcers (Isaac, 1.1. Characteristics of plant material 1979; Hausen et al., 1984; Tubaro, 1984; Mann and Staba, 1986). Chamomilla recutita (syn. Matricaria chamomilla L.) Lamium album L. (family Labiatae) contains as main (family Asteraceae) contains as the main compounds: volatile compounds: iridoids, flavonoids, phenolic acids, triterpenes and mucilage. Pharmacological actions of Lamii albi flos are: inflammatory diseases of mucous membranes, treatment ∗ Corresponding author. Tel.: +48 8153220413; Fax: +48 8153220413. of cough, antispasmodic, antibiotic, bacteriostatic properties E-mail address: [email protected] (Grazyna˙ Matysik). (Jaroniewski, 1992; Lewandowski, 1997).

Calendula officinalis L. (family Asteraceae) contains phrasiae rostkoviana herba, fresh and dried, in the form used as main compounds: flavonoids, terpenoids, volatile oil, for making infusions according to Polish Pharmacopoea V sesquiterpene glycosides, carotenoids, polysaccharides. (Polish Pharmacopoea, 1990). Pharmacological actions of Calendulae officinalis flos are: Water solutions of fresh juices were used in the study. They antibacterial, antiviral activities; anti-inflammatory, cyto- were obtained by crushing collected fresh plant materials and toxic activity and antitumour activity (against mouse Ehlich diluting their juices with aseptic distilled water (1:100) and carcinoma) have been documented for Calendulae officinalis by making water infusions of appropriately dried materials. flos (Peyroux, 1981; Fleischner, 1985; Wagner et al., 1985; They were obtained by infusion of 5 g (the equivalent of one Gracza, 1987; Mascolo and Capasso, 1987; Boucard-Maitre, teaspoonful) in 100 mL of aseptic distilled water at 80 ◦C 1988). until the infusion cooled to the room temperature (22 ◦C). In Plantaginis lanceolata L. (family Plantaginaceae) the The study of enzymatic activities of diluted juices and main compounds are: iridoids, flavonoids, phenolic acids, prepared infusions was conducted by means of the API tannins and polysaccharides. Pharmacological actions of ZYM system (bioMerieux,` France). It contained a set of 20 Plantaginis lanceolata folium are: the liquid extract and the microtubes in which, besides the control microtube, dehy- pressed juice of fresh plantain herb possess proven bacterio- drated substrates were included of 19 enzymes: acidic phos- static and bactericidal effects due to the tannins content. In- phatase, esterase (C4), esterase lipase (C8), lipase (C14), dications and usage: common cold, cough/bronchitis, fevers leucine arylamidase, valine arylamidase, cystine arylami- and colds, inflammation of the mouth and pharynx, inflam- dase, trypsin, chymotrypsin, alkaline phosphatase, naphthol- mation of the skin and tendency to infection. In folk medicine, AS-BI-phosphohydrolase, ␣-galactosidase, ␤-galactosidase, the pressed juice is used to treat wounds and inflammations ␤-glucuronidase, ␣-glucosidase, ␤-glucosidase, N-acetyl-␤- and as a hemotyptic (Elich, 1962; Koedam, 1977). glucosaminidase, ␣-mannosidase and ␣-fucosidase. Euphrasia rostkoviana Hayne (family Scrophulariaceae) The obtained solutions were introduced to microtubes contains as main compounds: iridoids, lignans, flavonoids, after a prior filtering by sterile Acrodisc 0.2 ␮m (Gelman tannins, phenolic acids, coumarins, volatile oil, mucilage, Sciences) which permitted removal of microorganisms and sterols and alkaloids. Pharmacological actions of Euphrasia impurities that might cause false positive or negative results in rostkoviana herba are: bacteriostatic, purgative action in mice the performed determination. An amount of 65 ␮L of the ex- has been documented. Euphrasia rostkoviana herba is used amined solutions was dispensed to all strip cupules containing for blepharitis, conjunctivitis, styes, eye fatigue symptoms, dehydrated substrates for enzymes. After incubation at 37 ◦C functional eye disorders of muscular and nervous origin, for 4 h, one drop of ZYM A reagent (Tris–hydroxymethyl- coughs and hoarseness (Salama, 1981; Sticher and Salama, aminomethane, hydrochloric acid 37%, sodium lauryl 1981; Salama and Sticher, 1983; Swiatek et al., 1984). Be- sulfate, H2O) was added and one drop of ZYM B (Fast Blue side precisely determined biologically active substances in BB, 2-methoxyethanol) to develop a positive color reaction. plant materials, such as, e.g. glycosides, flavonoids, iridoids After 5 min, the result was read (Table 1) of the activity or alkaloids, in relation to the biological character of the of the examined enzyme based on the arisen color reaction plant material, also enzymes occur—specific proteins with comparing with the result sheet enclosed to the system by catalytic properties accelerating chemical reactions in plant the manufacturer. Determination of activity of enzymes cells. Their presence in plants used in therapeutics may also present in the examined solution was expressed in ␮M/min contribute to the final therapeutic effect. Therefore, it is nec- (the quantity of hydrolyzed substrate). The results were read essary to make a dependable characteristics of enzymes oc- according to the instruction provided by the manufacturer. curring in plant preparations that may influence their action. In this work, the enzymatic activity was compared for the The objective of this work was the determination of the same concentrations of juice solutions and water infusions, enzymatic activity of juices obtained from fresh plant raw ma- and therefore further dilutions were not made when the results terials of Chamomilla recutita anthodium, Lamium albi flos, with values >16.0 × 10−5 ␮M/min were obtained. Calendula officinalis flos, Plantaginis lanceolata folium, Eu- A strip filled with aseptic distilled water was used as a phrasiae rostkoviana herba and the water infusion obtained control, which was treated in the manner analogous with the from these dried raw materials as well as a comparison of ones used in the study. the enzymatic activity of both kinds of these solutions. The plants have been applied in European folk medicine for a long time. 3. Results

The activity of 17 enzymes was examined by means 2. Materials and methods of the API ZYM system (Table 1). The highest enzymatic activity of fresh juice (dilution 1:100) (Table 2) The research material was plant raw materials of was found in Lamium albi flos in relation to acidic phos- Chamomilla recutita anthodium, Lamium albi flos, Cal- phatase and naphthol-AS-BI-phosphohydrolase—over endula officinalis flos, Plantaginis lanceolata folium, Eu- 16.0 × 10−5 ␮M/min of the hydrolyzed substrate, and in the A. Chudnicka, Gra˙zyna Matysik / Journal of Ethnopharmacology 99 (2005) 281–286 283

Table 1 Reading table (API ZYM) No. Enzyme assayed Substrate pH Corolles or color of the sample if it has an intense coloration Positive Negative 1 Control 2 Alkaline phosphatase 2-Naphthyl phosphate 8.5 Violet No colour or colour of the control if the strip has been exposed to an intense light source after addition of the reagents 3 Esterase (C4) 2-Naphthyl butyrate 6.5 Violet Very pale yellow if the strip has not been exposed to an intense light 4 Esterase lipase (C8) 2-Naphthyl caprylate 7.5 Violet 5 Lipase (C14) 2-Naphthyl myristate 7.5 Violet 6 Leucine arylamidase l-Leucyl-2-naphthylamide 7.5 Orange 7 Valine arylamidase l-Valyl-2-naphthylamide 7.5 Orange 8 Cystine arylamidase l-Cystyl-2-naphthylamide 7.5 Orange Trypsin N-benzoyl-dl-arginine-2-naphthylamide 8.5 Orange Chymotrypsin N-glutaryl-phenylalanine-2-naphthylamine 7.5 Orange 9 Acidic phosphatase 2-Naphthyl phosphate 5.4 Violet 10 Naphthol-AS-BI-phosphohydrolase Naphthol-AS-BI-phospholate 5.4 Blue 11 ␣-Galactosidase 6-Br-2-naphthyl-␣d-galactopyranoside 5.4 Violet 12 ␤-Galactosidase 2-Naphthyl-␤d-galactopyranoside 5.4 Violet 13 ␤-Glucuronidase Naphthyl-AS-BI-␤d-glucuronide 5.4 Blue 14 ␣-Glucosidase 2-Naphthyl-␣d-glucopyranoside 5.4 Violet 15 ␤-Glucosidase 6-Br-2-naphthyl-␤d-glucopyranoside 5.4 Violet 16 N-acetyl-␤-glucosaminidase 1-Naphthyl-N-acetyl-␤d-glucosaminide 5.4 Brown 17 ␣-Mannosidase 6-Br-2-naphthyl-␣d-mannopyranoside 5.4 Violet 18 ␣-Fucosidase 2-Naphthyl-␣l-fucopyranoside 5.4 Violet quantity of 12.0 × 10−5 ␮M/min for alkaline phosphatase, Water infusion of dry (Table 3) Lamium albi ﬂos also showed esterase (C4), ␣-galactosidase and ␤-galactosidase, whereas the highest activity for naphthol-AS-BI-phosphohydrolase − 8.3 × 10−5 ␮M/min was found for esterase lipase (C8) and and acidic phosphatase but with lower values, 8.3 × 10 5 − N-acetyl-␤-glucosaminidase. The activity of 2.0 × 10−5 and 4.1 × 10 5 ␮M/min, respectively. The third active to 4.1 × 10−5 ␮M/min was shown by leucine arylamidase, enzyme was esterase (C4) but with a minimum value valine arylamidase, ␣-glucosidase and ␣-mannosidase. in comparison to fresh juice, since it amounted to only

Table 2 Enzymatic activity of water solutions (dilution 1:100) of fresh herb juices from Chamomillae recutita anthodium, Lamii albi flos, Calendulae officinalis flos, Plantaginis lanceolata folium, Euphrasiae officinalis herba No. Enzyme assayed Water solution of fresh herbs juice (quantity of hydrolyzed substrate in ␮M/min)

Chamomillae recutita Lamii albi Calendulae Plantaginis Euphrasiae anthodium flos officinalis flos lanceolate rostkoviana folium herba 1 Control 0 0 0 0 0 2 Alkaline phosphatase 4.1 × 10−5 12.0 × 10−5 4.1 × 10−5 02.0 × 10−5 3 Esterase (C4) 8.3 × 10−5 12.0 × 10−5 2.0 × 10−5 2.0 × 10−5 2.0 × 10−5 4 Esterase lipase (C8) 2.0 × 10−5 8.3 × 10−5 2.0 × 10−5 2.0 × 10−5 0 5 Lipase (C14) 0 0 0 0 0 6 Leucine arylamidase 2.0 × 10−5 4.1 × 10−5 >16.0 × 10−5 12.0 × 10−5 2.0 × 10−5 7 Valine arylamidase 2.0 × 10−5 2.0 × 10−5 02.0 × 10−5 2.0 × 10−5 8 Cystine arylamidase 0 0 0 0 0 9 Acidic phosphatase 4.1 × 10−5 >16.0 × 10−5 >16.0 × 10−5 >16.0 × 10−5 >16.0 × 10−5 10 Naphthol-AS-BI-phosphohydrolase 4.1 × 10−5 >16.0 × 10−5 >16.0 × 10−5 >16.0 × 10−5 >16.0 × 10−5 11 ␣-Galactosidase 4.1 × 10−5 12.0 × 10−5 02.0 × 10−5 0 12 ␤-Galactosidase 4.1 × 10−5 12.0 × 10−5 4.1 × 10−5 2.0 × 10−5 0 13 ␤-Glucuronidase 0 0 0 0 0 14 ␣-Glucosidase 0 2.0 × 10−5 000 15 ␤-Glucosidase 4.1 × 10−5 00 00 16 N-acetyl-␤-glucosaminidase 2.0 × 10−5 8.3 × 10−5 2.0 × 10−5 4.1 × 10−5 0 17 ␣-Mannosidase 0 2.0 × 10−5 02.0 × 10−5 0 18 ␣-Fucosidase 0 0 0 0 0 284 A. Chudnicka, Gra˙zyna Matysik / Journal of Ethnopharmacology 99 (2005) 281–286

Table 3 Enzymatic activity of water infusions from dried herbs Chamomillae recutita anthodium, Lamii albi flos, Calendulae officinalis flos, Plantaginis lanceolate folium, Euphrasiae officinalis herba No. Enzyme assayed Water infusions from dried herbs (quantity of hydrolyzed substrate in ␮M/min) Chamomillaerecutita Lamii albi Calendulae Plantaginis Euphrasiae anthodium flos officinalis lanceolate rostkoviana flos folium herba 1 Control 0 0 0 0 0 2 Alkaline phosphatase 0 0 0 0 0 3 Esterase (C4) 2.0 × 10−5 2.0 × 10−5 000 4 Esterase Lipase (C8) 0 0 0 0 0 5 Lipase (C14) 0 0 0 0 0 6 Leucine arylamidase 0 0 0 0 0 7 Valine arylamidase 0 0 0 0 2.0 × 10−5 8 Cystine arylamidase 0 0 0 0 0 9 Acidic phosphatase >16.0 × 10−5 4.1 × 10−5 0 >16.0 × 10−5 2.0 × 10−5 10 Naphthol-AS-BI-phosphohydrolase 12.0 × 10−5 8.3 × 10−5 8.3 × 10−5 >16.0 × 10−5 2.0 × 10−5 11 ␣-Galactosidase 0 0 0 0 0 12 ␤-Galactosidase 0 0 0 0 0 13 ␤-Glucuronidase 0 0 0 0 0 14 ␣-Glucosidase 0 0 0 0 0 15 ␤-Glucosidase 0 0 0 0 0 16 N-acetyl-␤-glucosaminidase 0 0 0 0 0 17 ␣-Mannosidase 0 0 0 0 0 18 ␣-Fucosidase 0 0 0 0 0

2.0 × 10−5 ␮M/min. High enzymatic activity was also fresh juice from Chamomilla recutita anthodium the − shown by fresh juice from Calendulae officinalis flos. highest activity of 8.3 × 10 5 ␮M/min was found for − Similarly as in case of Lamii albi flos its activity was above esterase (C4), 4.1 × 10 5 ␮M/min for alkaline phosphatase, 16.0 × 10−5 ␮M/min for acidic phosphatase, naphthol- acidic phosphatase, naphthol-AS-BI-phosphohydrolase, AS-BI-phosphohydrolase and the third enzyme of leucine ␣-galactosidase, ␤-galactosidase, ␤-glucosidase, and the − arylamidase. Other enzymes—alkaline phosphatase, es- minimum activity of 2.0 × 10 5 ␮M/min for esterase terase (C4), esterase lipase (C8), ␤-galactosidase and lipase (C8), leucine arylamidase, valine arylamidase and N-acetyl-␤-glucosaminidase showed activity of 2.0 × 10−5 N-acetyl-␤-glucosaminidase. In water infusion, the activity − to 4.1 × 10−5 ␮M/min. In water infusion of dry herbs of acidic phosphatase was over 16.0 × 10 5 ␮M/min and only the activity of naphthol-AS-BI-phosphohydrolase of naphthol-AS-BI-phosphohydrolase also amounted to − was found of 8.3 × 10−5 ␮M/min of the substrate. In 12.0 × 10 5 ␮M/min. The third enzyme, of very low activity − case of fresh juice from Plantaginis lanceolata folium the of 2.0 × 10 5 ␮M/min was esterase (C4). No enzymatic activity of over 16.0 × 10−5 ␮M/min was shown by acidic activity of any examined solutions was found in case of phosphatase and naphthol-AS-BI-phosphohydrolase and trypsin and chymotrypsin. also high activity of 12.0 × 10−5 ␮M/min by leucine ary- For the control strip where cupules were filled with asep- lamidase. Other enzymes like esterase (C4), esterase lipase, tic distilled water no color reactions were found that would valine arylamidase, ␣-galactosidase, ␣-mannosidase and indicate falsely positive results. N-acetyl-␤-glucosaminidase showed activity of 2.0 × 10−5 An additional observation in the research was finding that to 4.1 × 10−5 ␮M/min. In water infusion of Plantaginis some enzymes still maintained their activity even after 48 h lanceolata folium high activity of two enzymes was found: from the preparation of the infusion. acidic phosphatase and naphthol-AS-BI-phosphohydrolase 16.0 × 10−5 ␮M/min each. In fresh juice from Euphrasiae rostkoviana herba just like in the solutions examined 4. Discussion before the highest activity of over 16.0 × 10−5 ␮M/min was also shown by acidic phosphatase and naphthol-AS- Plant preparations applied in medicine exhibit their ther- BI-phosphohydrolase, whereas other discovered enzymes: apeutic activity due to biologically active substances which alkaline phosphatase, esterase (C4), leucine arylamidase are present in plant cells. Nowadays, the types of biologically and valine arylamidase-showed only minimum activity of active compounds are well known in most commonly applied 2.0 × 10−5 ␮M/min. In water infusion presence of only plant drugs. Undoubtedly, the final therapeutic effect is also three enzymes was found—valine arylamidase, acidic influenced by other elements occurring in vegetal cells that phosphatase and naphthol-AS-BI-phosphohydrolase of often are not defined precisely, which might be also related to minimum activity of 2.0 × 10−5 ␮M/min. In case of the difference in therapeutic effects of particular preparations. A. Chudnicka, Gra˙zyna Matysik / Journal of Ethnopharmacology 99 (2005) 281–286 285

Plant enzymes are characterized by diversified biochem- 5. Conclusions ical activity differentiated in relation to the place of their occurrence and the kind of cells. Out of the examined Higher enzymatic activities were found in case of fresh enzymes ␤-glucosidase was immunocytochemically local- juices of the examined plant materials than in prepared water ized in the chloroplasts of mesophyll cells (Minami et al., infusions from dried plants. In both cases naphthol-AS-BI- 1997). phosphohydrolase had the highest quantity, in fresh juice its The commercial API ZYM system (bioMerieux,` France) activity was 100 times higher. The second enzyme in terms used in this work for determination of enzymes in water solu- of activity was acidic phosphatase. The highest enzymatic tions of fresh plant juice and water infusion from dry plants is activity of fresh juice was found in Lamii albi flos and next widely applied to study enzymatic activities of different bac- in Calendulae officinalis flos. Of the infusions, the highest terial species, which are often difficult to identify (Citron enzymatic activity was found in case of Lamii albi flos, et al., 1996; Bascomb and Manafi, 1998; De La Higuera Chamomille recutita anthodium and Plantaginis lanceolata et al., 1999; Heroldova et al., 2001; Sakamoto et al., 2002; folium. Samaranayake et al., 2003). Making a phenotype character- Drying of the examined plant materials caused a decrease istics by means of this test of the examined species through of enzymatic activity of infusions prepared from them. The the identification of active enzymes is a precise and simple highest activities in infusion were the same as obtained for method. juice solutions. Due to the complex composition of plant ma- API ZYM system is also applied to study enzymatic ac- terials in terms of content of biologically active substances tivities of other biological materials, such as the human skin as well as the discovered enzymatic activity of the obtained used for transplantation (Chang et al., 1998), human den- infusions, the therapeutic effect may also be connected with tal plaque microcosm biofilms enzymatic activities (Wong et the presences of plant enzymes. al., 2001) of cryopreserved porcine heart valve (Suh et al., 1999), or e.g. enzymatic activity of microorganisms isolated from wine cork (Centeno and Calvo, 2001). API ZYM sys- References tem has found applications also in examination of enzymatic activities of home dust, which is a serious allergen (Martinez Bascomb, S., Manafi, M., 1998. Use of enzyme test in charac- et al., 1999) and manure composting (Tiquia, 2002). terization and identification of aerobic and facultatively anaero- The examination of juice and plant infusions showed a bic Gram-positive cocci. Clinical Microbiology Reviews 11, 318– 340. high differentiation. In fresh juice the activity of 13 en- Boucard-Maitre, Y., 1988. Cytotoxic and antitumoral activity of Calendula zyme activites were found (Table 2). After drying of the officinalis extracts. Pharmazie 43, 220–226. plant, a decrease of enzymatic activity was observed. Out Bousquet, J., Hale, R., Guerin, B., Michel, F.B., 1980. Enzymatic activi- of the examined enzymes only four were still found ac- ties of house dust extracts. Annals of Allergy 45, 316–321. tive (Table 3), acidic phosphatase and naphthol-AS-BI- Bousquet, J., Marty, J.P., Coulomb, Y., Robinet-Levy, M., Cour, P., Michel, F.B., 1978. Enzyme determination and RAST inhibition as- phosphohydrolase, esterase (C4) and valine arylamidase. The says for orchard grass (Dactylis glomerata): a comparison of com- −5 two former ones showed very high activity of 16.0 × 10 mercial pollen extracts. Annals of Allergy 12, 11–18. − and 12.0 × 10 5 ␮M/min for Calendula officinalis flos and of Centeno, S., Calvo, M.A., 2001. Enzymatic activity of micro-organisms 16.0 × 10−5 ␮M/min for both enzymes in Plantaginis lance- isolated from cork wine stooppers. Microbios 106, 69–73. olata folium. Chang, P., Rosenquist, M.D., Lewis II, R.W., Kealey, G.P., 1998. A study of functional viability and metabolic degeneration of human The highest enzymatic activity of fresh juice (Table 2) skin stored at 4 ◦C. Journal of Burn Care and Rehabilitation 19, was found in Lamii albi flos, Calendulae officinalis 25–28. flos and Plantaginis lanceolate folium for acidic phos- Citron, D.W., Hunt Gerardo, S., Claros, M.C., Abrahamian, F., Ta- phatase and naphthol-AS-BI-phosphohydrolase (over 16.0 × lan, D., Goldstein, E.J., 1996. Frequency of isolation of Porphy- 10−5 ␮M/min). After drying of the plant material, a high romonas species from infected dog and cat bite wounds in humans and their characterization by biochemical tests and arbitrarily primed- activity of these enzymes remained in Chamomille recutita polymerase chain reaction fringerprinting. Clinical Infection Diseases anthodium and Plantaginis lanceolata folium. Naphthol-AS- 23, 78–82. BI-phosphohydrolase was also found in pollen contaminated De La Higuera, A., Gutierrez, J., Garcia-Mendoza, A., Castillo, A., 1999. with other plants parts through the enzyme activity, the esti- A new biotyping method for Streptococcus mutans with the API ZYM mation of purity of the pollen is possible, which is applied in system. Clinical Microbiology Infection 5, 88–91. Elich, J., 1962. Die antibakterille Aktivitat¨ einiger einheimischer the study of allergic reactions (Bousquet et al., 1978, 1980). Plantago-Arten. Disseratieon Universitat,¨ Berlin. Enzymatic activity of water plant extracts used in therapeu- Fleischner, A.M., 1985. Plant extracts: to accelerate healing and reduce tics results in the fact that the therapeutic effect, especially inflammation. Cosmet Toilet 100, 45–49. with local application of these preparations, may be the sum Gracza, L., 1987. Oxygen-containing terpene derivatives from Calendula of activity of the main biologically active compounds and officinalis. Planta Medica 53, 227–229. Hausen, B.M., Busker, E., Carle, R., 1984. Sensitizing capacity of comp- the enzymes maintaining their activity, which in plant blends posite plants. VII. Experimental studies with extracts and compounds may even increase their strength. This effect might be higher of Chamomilla recutita L. Rauschert and Anthemis cotula L. Planta in case of fresh plant juices. Medica 50, 229–234. 286 A. Chudnicka, Gra˙zyna Matysik / Journal of Ethnopharmacology 99 (2005) 281–286

Heroldova, M., Nemec, M., Hubalek, Z., Halouzka, J., 2001. Enzyme ternational Journal of Systematic and Evolutionary Microbiology 52, activities of Borrelia burgdorferi sensu lato. Folia Microbiologica 46, 841–849. 179–182. Salama, O., 1981. A lignan glucoside from Euphrasia rostkoviana.Phy- Isaac, O., 1979. Pharmacological investigations with compounds of tochemistry 20, 2003–2004. chamomile. I. The pharmacology of (−)alpha-bisabolol and bisabolol Salama, O., Sticher, O., 1983. Iridoid glucosides von Euphrasia ros- oxides (review). Planta Medica 35, 118–124. tkoviana. 4. Mitteilung uber Euphrasia-Glykoside. Planta Medica 47, Jaroniewski, W., 1992. Lamii albi in medicine. Herbs News, Warsaw 7, 90–94. 10 (in Polish). Samaranayake, Y.H., Samaranayake, L.P., Yau, J.Y., Dassanayake, R.S., Koedam, A., 1977. Plantago-history and use. Pharmaceutisch Weekblad Li, T.K., Anil, S., 2003. Phenotypic diversity of oral C. albicans 112, 246–252. isolated on single and sequential visits in an HIV-infectied Chinese Lewandowski, A., 1997. Lamii albi—description and use in medicine. cohord. Acta Pathologica, Microbiologica et Immunologica Scandi- Herbs News, Warsaw 5, 18–23 (in Polish). navica 1, 329–337. Mann, C., Staba, E.J., 1986. The chemistry, pharmacology, and commer- Sticher, O., Salama, O., 1981. Irydoid glukosides from Euphrasia rostko- cial formulations of Chamomille. In: Craker, L.E., Simon, J.E. (Eds.), viana. Planta Medica 42, 122–123. Herbs, Spuices, Medicinal Plants: Recent Advantages in Botany, Hor- Suh, H., Lee, J.E., Park, J.C., Han, D.W., Yoon, C.S., Park, Y.H., Cho, ticulture, and Pharmacology, vol. 1. Oryx Press, Arizona, pp. 235–280. B.K., 1999. Viability and enzymatic of cryopreserved parcine heart Martinez, J., Eraso, E., Palacios, R., Guisantes, J.A., 1999. Enzy- valve. Yonsei Medical Journal 40, 184–190. matic analyses of house dust mite extracts from Dermatophagoides Swiatek, L., Grabias, B., Chaudhuri, R.K., Calis, L., Lehmann, D., Meier, pteronyssnus and Dermatophagoides farinae (Acari Poroglyphidae) B., Sticher, O., 1984. Iridoid glycosides from Lathraea squamaria L. during different phases of culture growth. Journal of Medical Ento- (Scrophulariaceae). Farmacie Tijdschrift Belgie 61, 377–385. mology 36, 370–375. Tiquia, S.M., 2002. Evolution of extracellular enzyme activities dur- Mascolo, N., Capasso, F., 1987. Biological screening of Italian medicinal ing manure composting. Journal of Applied Microbiology 92, 764– plants for anti-inflammatory activity. Phytotherapy Research 1, 28–31. 775. Minami, Y., Takao, H., Kanafuji, T., Minura, K., Hara-Nishimura, I., Tubaro, A., 1984. Evaluation of antiinflammatory activity of a chamomile Nishimura, M., Matsubara, H., 1997. Beta-glucosidase in the Indigo extract after topical application. Planta Medica 50, 359–363. plant: intracellular localization and tissue specific expresion in leaves. Wagner, H., Proksch, A., Riess-Maurer, J., Vollmar, A., Odenthal, S., Plant and Cell Physiology 28, 1069–1074. Stuppner, H., Jurcic, K., Le Turdu, M., Heur, Y.H., 1985. Im- Peyroux, J., 1981. Propriet´ es´ anti-oedemateuses´ et anti-hyperhemiantes´ du munostimulating polysaccharides (heteroglycans) of higher plants. Calendula officinalis L. Planta Medical Phytotherapy 15, 210–216. Arzneimittelforschung 35, 1069–1071. Polish Pharmacopoea (Farmakopea Polska V), 1990. Panstwowy Zaklad Wong, L., Sisson, C., Sisson, C.H., 2001. A comparison of human den- Wydawnictw Lekarskich (PZWL), pp. 50–96. tal plaque microcosms biofilms grown in an undefined medium and Sakamoto, M., Sukuzuki, M., Umeda, M., Ishikawa, I., Benno, Y., 2002. a chemically defined artificial saliva. Archives of Oral Biology 46, Reclassiofication of Bacteroides fosythus (Tanner et al., 1986). In- 477–486. Journal of Ethnopharmacology 99 (2005) 287–292

Isolation and antimicrobial activity of two phenolic compounds from Pulicaria odora L.

A. Ezoubeiri a, C.A. Gadhi a,∗, N. Fdil b, A. Benharref c, M. Jana a, M. Vanhaelen d

a Laboratory of Phytochemistry and Medicinal Plants, Department of Biology, Faculty of Sciences, Semlalia, B.P. 2390, Marrakesh 40 000, Morocco b Laboratory of Microbiology, CHU Mohammed VI, Hospital Ibn Tofa¨ıl, Gueliz Marrakesh 40 000, Morocco c Laboratory of Chemistry of Natural Substances and Heterocycles, Department of Chemistry, Faculty of Sciences, Semlalia, B.P. 2390, Marrakesh 40 000, Morocco d Laboratory of Pharmacognosy and Bromatology, ULB, Institute of Pharmacy, Campus de la plaine-CP 205-4 Boulevard du Triomphe, B-1050 Brussels, Belgium Received 6 May 2004; received in revised form 16 February 2005; accepted 25 February 2005 Available online 7 April 2005

Abstract

The essential oil of Pulicaria odora, a Moroccan medicinal plant; was analyzed by GC–MS, and subjected to column chromatography on silica gel. Two major constituents were isolated and identified as 2-isopropyl-4-methylphenol (1) and isobutyric acid 2-isopropyl-4- methylphenylester (2), by analysis of spectroscopic data (MS, 1H NMR, 13C NMR, DEPT, COSY, HMQC and HMBC experiments). The isolated compounds are reported for the first time from Pulicaria genus. The essential oil and its major constituents (compounds 1 and 2) were examined for antibacterial and antifungal activity in vitro using the diffusion and dilution methods. Results showed that the essential oil and the 2-isopropyl-4-methylphenol (1) exhibited a very significant antibacterial and antifungal activity, while the isobutyric acid 2-isopropyl-4-methylphenylester (2) was inactive for all tested strains. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Pulicaria odora; Compositae; Essential oil; 2-Isopropyl-4-methylphenol; Isobutyric acid 2-isopropyl-4-methylphenylester; Antimicrobial activity

1. Introduction Various biological activities have been reported for some species of Pulicaria, such as cytotoxic activity of Pulicaria Pulicaria genus belongs to the family of the Composi- crispa and Pulicaria orientalis (Al-Yahyaet al., 1988; Awadh tae, tribe Inuleae, which contains 100 species (Emberger et al., 2001), antibacterial activity of Pulicaria undulata and and Chadefaud, 1960). The chemical investigation of the Pulicaria dysenterica (El-Kamali et al., 1998; Bahman et al., genus showed the occurrence of molecules such as diter- 2002), antispasmodic activity of Pulicaria glutinosa (Tanira penes (Rustaiyan et al., 1981; Singh et al., 1985; Muhammad et al., 1996) and antihistaminic effect of Pulicaria dysenterica et al., 1992), sesquiterpenes (Bohlmann et al., 1979; Zdero (Mahfouz et al., 1973). et al., 1988; San Feliciano et al., 1989; Mossa et al., 1992; Pulicaria odora L. (Compositae) is a Moroccan medicinal Dendougui et al., 2000); caryophyllenes and caryophyllane plant widely used in traditional medicine to treat back-pain, derivatives (Bohlmann and Zdero, 1981; Bohlmann et al., intestinal disorders and menstrual cramps (our own investiga- 1982; Hafez et al., 1987; Marco et al., 1992) and ﬂavonoids tion). The plant is also a constituent of the traditional remedy (Pares et al., 1981; El-Negoumy et al., 1982; Mossa et al., called “Mssakhen”, which is given to women after childbirth. 1988; Mansour et al., 1990; Christine et al., 2003). It is also a spice appreciated for its ﬂavour, which is used to perfume bread and meat. ∗ Corresponding author. Tel.: +212 44 43 46 49; fax: +212 44 43 74 12. No previous phytochemical work has been done on the E-mail address: [email protected] (C.A. Gadhi). essential oil of this specie, nor any biological study.

In this work, we report the isolation and the total struc- Table 1 1 13 tural elucidation of two major essential oil constituents of H and C-NMR data of compound 1 (300 MHz, in CDCl3) Pulicaria odora, as well as their antibacterial and antifungal 1HNMR 13CNMR activities. 1 – 150.5 2 – 134.4 3 7.12 (s) 127.0 . 2. Materials and methods 4 – 130 1 5 6.96 (d, J = 8.1 Hz) 127.0 6 6.73 (d, J = 8.1 Hz) 115.3 2.1. Plant material CH3 2.38 (s) 20.8 1 3.31 (t, J = 6.9 Hz) 27.0 Pulicaria odora was collected in March from Mrissat, at 2 1.35 (d, J = 6.9 Hz) 22.7 . 70 km on the East of Rabat (Morocco). The plant was iden- 3 1.35 (d, J = 6.9 Hz) 22 7 OH 5.28 – tified by Professor A. Ouyahya from the Scientific Institute ␦ values in ppm and coupling constants (in parentheses) in Hz. (Rabat). A voucher specimen was deposited in the botanic department (RAB No. 65346). petroleum ether–diethylether to give seven fractions. Fraction 2.2. General instrumental equipment VI (170 mg, petroleum ether–diethylether (97:3), 500 ml) and fraction IV (752 mg, petroleum ether–diethylether (98:2), 1 13 H and C NMR spectra were recorded on a Bruker 150 ml) gave pure compounds 1 and 2, respectively, while 1 Avance 300 spectrometer, operating at 300.13 MHz for H fraction I (20 mg, 100% petroleum ether, 100 ml), fraction 13 1 and 75.47 MHz for C. H chemical shifts were referred to II (12.5 mg, 100% petroleum ether, 100 ml), fraction III 13 the residual chloroform signal (7.26 ppm); C NMR were (6 mg, petroleum ether–diethylether (98:2), 400 ml), fraction referred to the central peak of CDCl3 (77.16 ppm). V (13 mg, petroleum ether–diethylether (98:2), 200 ml) and Electron impact (70 eV) GC–MS experiment was carried fraction VII (120 mg, petroleum ether–diethylether (95:5), out with a Varian 3800 Gas chromatograph coupled with a 200 ml) were mixtures. Saturn 2000 Mass spectrometer. Column chromatography was performed on silica gel 60 2.6. Identification of pure compounds (70–230 mesh, Fluka). For TLC, plastic sheets silica gel 60 F (Merck) were used. Spots were detected under UV light 254 2.6.1. 2-Isopropyl-4-methylphenol (1) or after they were sprayed with iode. Optical rotations were Yellow oil; represents 20.26% of the essential oil; EI-MS measured with a polarimeter 341 (Perkin-Elmer) at 589 nm m/z 150: 135 (100), 150 (41), 107 (25), 91 (11), 105 (10), 79 at 20 ◦C. (3), 77 (2.5); 1H and 13C-NMR data see Table 1. 2.3. Extraction of essential oil (EO) 2.6.2. Isobutyric acid 2-isopropyl-4-methyl-phenylester (2) The air-dried roots of Pulicaria odora (1 kg) were sub- Yellow oil; represents 61.93% of the essential oil. EI-MS jected to steam distillation for 4 h; they yielded a yellow oil m/z 220: 135 (100), 150 (75), 219 (56), 220 (37), 221 (53), 1 13 with a strong aromatic odour (yield of oil 0.6–0.8% w/w) and 71 (11), 105 (6); H and C NMR data: see Table 2. 20 [␣]D : −14 (c 0.005, CHCl3). The oil, dried over anhydrous sodium sulphate, was stored in air-tight glass vials, which are ◦ covered with aluminium foil at 4 C. Table 2 1 13 H and C-NMR data of compound 2 (300 MHz, in CDCl3) 2.4. GC–MS analysis 1HNMR 13CNMR 1 – 146.1 Gas chromatography was performed on a capillary silica 2 – 139.7 BP5 column (25 m × 0.32 mm i.d.; film thickness 0.25 ␮m). 3 7.22 (d, J = 1.8 Hz) 127.2 . GC was programmed from 60 to 220 ◦C with a heating rate 4 – 135 5 ◦ 5 7.10 (dd, J = 8.1, 2.1 Hz) 127.1 of 3 C/min. The carrier gas was helium (1 ml/min) and the . ◦ 6 6.97 (d, J = 8.1 Hz) 122 0 injector temperature was of 250 C. Mass spectrometer was CH3 2.43 (s) 21.1 an electron impact (EI) type (70 eV), programmed from m/z 1 3.13 (t, J = 6.9 Hz) 27.2 45 to m/z 500. 2 1.34 (d, J = 0.6 Hz) 23.0 3 1.32 (d, J = 0.9 Hz) 22.9 1 – 175.7 2.5. Fractionation of essential oil of Pulicaria odora 2 2.93 (t, J = 6.9 Hz) 34.3 3 1.46 (d, J = 0.9 Hz) 19.0 The essential oil (1.3 g) was subjected to column chro- 4 1.43 (d, J = 0.9 Hz) 18.9 matography (CC) on silica gel, using a stepwise gradient of ␦ values in ppm and coupling constants (in parentheses) in Hz. A. Ezoubeiri et al. / Journal of Ethnopharmacology 99 (2005) 287–292 289

2.7. Reduction of 2 by LiAlH4 2.9.4. Preparation of test discs Whatman no. 1 sterile filter paper discs (6 mm) were im- To a solution of 0.1 g of compound 2 in 50 ml of anhydrous pregnated respectively with the essential oil (10 ␮l), com- diethylether, it was added two equivalents of lithium and alu- pound 1 (2 ␮l) and compound 2 (2 and 5 ␮l). minium hydrid (LiAlH4). The mixture was refluxed for 24 h. Commercial antibacterial test discs (Oxoid) containing After hydrolyse, the reactional mixture was extracted with 30 ␮g/disc of Amoxicillin with clavulanic acid (AMC) was diethylether (3 × 20 ml). The organic layers were dried over used. The solution of nystatin (6 mg/ml) was prepared in anhydrous sodium sulphate, then evaporated under vacuum DMSO (10%) and deposited on filter paper disc to give yielding compound 1. 30 ␮g/disc. Disc impregnated with 10% of DMSO served as solvent control. 2.8. Thymol 2.9.5. Screening of antimicrobial activities The antibacterial and antifungal susceptibilities tests were Commercial thymol was purchased from Sigma. 1H NMR carried out using the agar diffusion method (Janssen et al., (300.13 MHz, CDCl3): ␦ = 1.29 (d, 6H, J = 6.9 Hz, H-2 ,H- 1987) followed by the dilution method for products which 3 ), 2.31 (s, 3H, CH -5) 3.22 (t, 1H, J = 6.9 Hz, H-1 ), 4.89 (s, 3 presented a bioactivity. Petri plates were prepared by pouring 1H, OH-1), 6.61 (s, 1H, H-6), 6.79 (d, 1H, J = 7.8 Hz, H-3), 13 20 ml of Mueller Hinton agar (BIO-RAD) supplemented with 7.14 (d, 1H, J = 7.8 Hz, H-4); C NMR (75.47 MHz, CDCl3): 5% defibrinated sheep blood for Streptococcus pyogenes, ␦ = 21.1 (CH -C-5), 23.0 (C-2 , C-3 ), 26.9 (C-1 ), 116.4 (C- 3 Mueller Hinton agar for all the other bacteria and Sabouraud 6), 122.0 (C-4), 126.5 (C-3), 131.8 (C-2), 136.8 (C-5), 152.7 Dextrose agar for yeast. The inoculum was spread on the (C-1); MS (EI, 70 eV), m/z: 150. top of the solidified media and allowed to dry for 10 min. The discs were then applied and the plates were left 30 min 2.9. Antimicrobial assay at room temperature to allow the diffusion of the oil before ◦ their incubation for 24 h at 37 Cin5%CO2 for Streptococ- 2.9.1. Tested compounds cus pyogenes,at37◦C in air for other bacteria and at 25 ◦C The essential oil of Pulicaria odora as well as compounds for yeast (Collins et al., 1989). The inhibition zones formed 1 and 2 were tested for antimicrobial activity. They were ster- around the discs were evaluated in millimeters. Each test was ilized by filtration through a 0.45 ␮m membrane filter before carried out in triplicate. testing. Amoxicillin with clavulanic acid (AMC) (Smithkline Minimum inhibitory concentration (MIC) was determined Beecham) served as positive controls for the tested bacteria by the dilution method as recommended by the National whereas Nystatin (Ny) (Bristol-Myers Squibb) served Committee for Clinical Laboratory Standards (NCCLS) as positive control for Candida albicans, and dimethyl- (1997). To obtain stable dispersion, stock solutions of es- sulfoxide (DMSO) (10%) solution was tested as solvent sential oil and compound 1 were prepared in 0.2% agar sus- control. pension according to the technique of Remmal et al. (1993). Further dilutions were then performed using the same sus- 2.9.2. Microorganisms pension. The final concentrations of tested products in petri Six strains of bacteria were tested: Staphylococcus dishes were 0% (control), 0.01%, 0.1%, 0.2%, 0.4% and 1% aureus (ATCC 25923), Escherichia coli (ATCC 25922), (v/v) (Benjilali et al., 1986; Tantaoui-Elaraki et al., 1993). Pseudomonas aeruginosa (ATCC 27853), Salmonella ty- Stock solutions of AMC and Nystatin were prepared in phimurium (ATCC 43971), Vibrio colerae (ATCC 14033), DMSO. Further dilutions were achieved using sterile dis- ␮ Streptococcus pyogenes (groupe A) (HITM 100) as well as tilled water yielding concentrations from 0.06 to 128 g/ml. one fungal strain Candida albicans (HITM 22). These two Solvent control was prepared with DMSO. Experiments were latter strains, Streptococcus pyogenes and Candida albicans, carried out in triplicate. Inhibition of microbial growth in the were isolated from patients hospitalised in the University plates containing tested solutions was judged by comparison Hospital Center of Marrakech (Morocco) and preserved in the with growth in blank control plates. Solvent at 10% had no Laboratory of Bacteriology of this Center (Hopitalˆ Ibn Tofail inhibition effect. Minimum inhibitory concentration (MIC) Marrakech, Morocco). They were identified using standard was defined as the lowest concentration of test samples that methods (Murray et al., 1995). resulted in a complete inhibition of visible growth.

2.9.3. Preparation of inocula 3. Results and discussion An 18 h-old culture of selected bacteria/yeast was mixed with sterile physiological saline and the turbidity was cor- Steam distillation of Pulicaria odora roots produced a yel- rected by adding sterile physiological saline until a Mac low oil with a yield of 0.6–0.8%. GC–MS analysis of the 6 Farland turbidity standard of 0.5 (10 colony forming units essential oil indicated that it consists of a mixture of more (CFU) per ml). than 70 compounds, among which ﬁve represents 90% of the 290 A. Ezoubeiri et al. / Journal of Ethnopharmacology 99 (2005) 287–292

of all spectral data, the structure of 1 was determined as 2-isopropyl-4-methylphenol. This is the first time that this compound was reported from a Pulicaria specie. However, it has previously been found as a minor constituent (0.3–0.4%) of the essential oil of Lippia graveolens HBK (Verbenaceae) from El Salvador (Vernin et al., 2001). Its identification was based only on the comparison with mass spectral data and retention indices, but no NMR spectral data were reported. Compound 2 was a yellow oil, its molecular formula C14H20O2 was inferred from the M+ peak at m/z = 220 (EI- MS). Compounds 1 and 2 showed similar features in their 1H and 13C NMR spectra (Tables 1 and 2), with the occurrence of a second isopropyl group signals in the 1H NMR spectrum of compound 2. The 13C NMR resonance at ␦ 175.7 of 2 suggested that a carbonyl moiety existed in the structure. Lower Fig. 1. Structures of compounds 1 and 2 isolated from the essential oil of field shift of C-1 (␦ 146.1 ppm) signal indicated the bonding Pulicaria odora. site of the acyl function (Chari et al., 1977). Unequivocal information could be obtained from 2D NMR (COSY, HMBC) total oil. Comparison of their retention times and mass spec- and by the reduction of 2 with LiAlH4 which afforded 1. tra with those of authentic samples and/or Nist mass spectral Therefore compound 2 is the isobutyric acid 2-isopropyl-4- database was unfruitful and no compounds could be identi- methyl-phenylester. To our knowledge, it is a new compound fied. Therefore, we carried out the separation of the essential and it represents the major constituent of the essential oil of oil on column chromatography over silica gel, using a gra- Pulicaria odora. dient of petroleum ether and diethylether as eluents. It led Compounds 1 and 2 can be considered as two thymol iso- to the isolation of two pure compounds 1 and 2 (Fig. 1), mers isolated for the first time from Pulicaria genus while which represent the two major constituents with a yield of thymol and some thymol derivatives have been previously 20.26 and 61.93%, respectively. The analysis of 1H NMR, reported in others Pulicaria species (Metwally et al., 1986; 13C NMR, DEPT, COSY, HMQC and HMBC spectral data Mossa et al., 1987; Zdero et al., 1988; Weyerstahl et al., 1999). gave the total 1H and 13C assignments for these compounds The antibacterial assay carried out by the diffusion method as in Tables 1 and 2. on the essential oil and the compounds 1 and 2, showed that Compound 1 was obtained as a yellow oil with a molecular the essential oil of Pulicaria odora and compound 1 possess ion signal at m/z = 150 (EI-MS) corresponding to the molec- an inhibitory activity against all bacteria and yeast tested, ex- 13 ular formula C10H14O. This formula was supported by C cept for Pseudomonas aeruginosa; by contrast compound 2 NMR and DEPT spectroscopy, which showed 10 carbon sig- was inactive for all (Table 3). The most susceptible strains nals due to three methyls, four methines and three quaternary were the Gram positive Staphylococcus aureus and Strepto- carbons. 1H NMR spectrum signals of 1 (Table 1) are consis- coccus pyogenes; the Gram negative strain Vibrio colerae and tent with a disubstituted phenol nucleus, with a methyl and the yeast Candida albicans. an isopropyl moieties. The isopropyl group (␦ 3.31 (1H, t, Minimum inhibitory concentrations (MIC) were deter- J = 6.9 Hz); ␦ 1.35 (6H, d, J = 6.9 Hz)) was easily determined mined for compound 1 and the essential oil by the dilution from 1H–1H COSY spectrum. method in solid media (Table 3). Compound 1 demonstrated The comparison of 1H NMR spectra of compound 1 and the most interesting inhibitory activities with MIC ranging thymol (Sigma) run in the same conditions showed identi- from1to2␮l/ml (v/v), compared to the essential oil which cal signals, except for the aromatic singlet signal which was showed MIC ranging from 2 to 10 ␮l/ml (v/v). downfield shifted from 6.61 ppm (thymol) to 7.12 ppm (compound 1). To confirm this structural difference, a mixture of thymol and compound 1 (1:1) was subjected to GC–MS yielding two distinguished peaks with different, but close, retention time. Therefore, the structure of 1 is supposed to be one thymol isomer. This was confirmed by the long range correlations observed in its HMBC spectrum (Fig. 2). In fact, the occurrence of the long range correlations between the aromatic proton (␦ 7.12 ppm) and the methine carbon of isopropyl group (C-1, ␦ 27.0 ppm) and the quaternary carbon (C-1, ␦ 150.5 ppm) suggests that the singlet should be assigned to a proton at the position 3 of the phenyl instead Fig. 2. The most important long range correlations observed in the HMBC of position 6 as in the thymol. Therefore, and in the basis spectrum of compound 1. A. Ezoubeiri et al. / Journal of Ethnopharmacology 99 (2005) 287–292 291

Table 3 Antimicrobial activity of essential oil (EO) of Pulicaria odora and of its main component 1 Microorganisms Inhibition zonea (mm) Minimum inhibitory concentration

Pulicaria odora (␮l) Antibiotics (␮g) Pulicaria odora (␮l/ml) Antibiotics (␮g/ml)

EO 1 AMCb Nyc EO 1 AMC Ny 10 2 30 30 Escherichia coli (ATCC 25922) 10 30 20 NT 10 2 2 NT Staphylococcus aureus (ATCC 25923) 20 30 35 NT 2 1 0.5 NT Pseudomonas aeruginosa (ATCC 27853) – – – NT NT NT NT NT Salmonella typhimurium (ATCC 43971) 8 24 24 NT 4 2 0.25 NT Vibrio colerae (ATCC 14033) 18 35 20 NT 4 1 1 NT Streptococcus pyogenes (A) (HITM 100) 16 30 20 NT 4 2 1 NT Candida albicans (HITM 22) 16 32 NT 18 2 1 NT 1 (–) Inactive; NT: not tested. a Includes diameter of disc (6 mm). b AMC: Amoxicillin with clavulanic acid. c Ny: Nystatin.

In conclusion, this study shows very interesting antimi- Benjilali, B., Tantaoui-Elaraki, A., Ismaili-Alaoui, M., Ayadi, A., 1986. crobial properties of the essential oil of Pulicaria odora and Methode´ d’etude´ des propriet´ es´ antiseptiques des huiles essentielles its major constituent, compound 1. par contact direct en milieu gelos´ e.´ Plantes Medicinales´ et Phytother- apie 20, 155–167. The high bioactivity of 1 is possibly related to its Bohlmann, F., Knoll, K.H., El-Emary, N.A., 1979. New type of chemical structure as a phenol derivative. In fact, according sesquiterpene lactone from Pulicaria crispa. Phytochemistry 18 (7), to Franchomme (1981) and Kurita and Koike (1983), 1231–1233. phenols are more active than alcohols than aldehydes Bohlmann, F., Zdero, C., 1981. Caryophyllene derivatives and a hy- than ketones than ethers and esters than hydrocarbons (phe- droxyisocomene from Pulicaria dysenterica. Phytochemistry 20 (11), 2529–2534. nols > alcohols > aldehydes > ketones > ethers > hydrocarbons). Bohlmann, F., Maniruddin, A., Jakupovic, J., 1982. Caryophyllane deriva- This may also explain the inactivity of compound 2. tives from Pulicaria scabra. Phytochemistry 21 (7), 1659–1661. The fact that the essential oil exhibits such antimicrobial Chari, V.M., Jordan, M., Wagner, H., Thies, P.W., 1977. A 13CNMR activity provides some scientific basis for the traditional use study of the structure of an acyl-linarin from Valeriana wallichii. of the plant by women after childbirth as an antiseptic and an- Phytochemistry 16 (7), 1110–1112. Christine, A.W., Jeffrey, B.H., Jenny, G., Renee, J.G., Geoffrey, C.K., tiinflammatory remedy to avoid post-partum complications. John, E., 2003. Variation in lipophilic and vacuolar flavonoids among Based on this, further chemical and pharmacological in- European Pulicaria species. Phytochemistry 64, 275–283. vestigations to isolate and identify minor essential oil con- Collins, C.H., Lyne, P.M., Grange, J.M., 1989. Microbiological Methods, stituents of Pulicaria odora, and to screen other potential 6th ed. Butterworths, London, p. 410. bioactivities may be recommended. Dendougui, H., Benayache, S., Benayache, F., Connoly, J.D., 2000. Sesquiterpene lactones from Pulicaria crispa. Fitoterapia 71, 373– 378. El-Kamali, H.H., Ahmed, A.H., Mohammed, A.S., Yahia, A.A.M., El- Acknowledgements Tayeb, I.H., Ali, A.A., 1998. Antibacterial properties of essential oils from Nigella sativa seeds, Cymbopogon citratus leaves, and Pulicaria The authors are grateful to Professor A. Ouyahya; from undulata aerial parts. Fitoterapia 69 (1), 77–78. the Scientific Institute of Rabat (Morocco), for the botanical El-Negoumy, S.I., Mansour, R.M.A., Saleh, N.A.M., 1982. Flavonols of identification and to Prof. R. Vanhaelen-Fastre from Institute Pulicaria arabica. Phytochemistry 21 (4), 953–954. Emberger, L., Chadefaud, M., 1960. Traite´ De Botanique. Masson & Cie, of Pharmacy of Brussels, for her excellent guidance. Paris. Franchomme, P., 1981. Fiche monographique: Origanum compactum car- vacroliferum Bentham. Phytomedecine´ 1 and 2, 13–23. References Hafez, S., Sarg, T.M., El-Domiaty, M.M., Ahmed, A.A., Melek, F.R., Bohlmann, F., 1987. Caryophyllene derivatives from Pulicaria arabica. Al-Yahya, M.A., El-Sayed, A.M., Mossa, J.S., Kozlowski, J.F., Antoun, Phytochemistry 26 (12), 3356–3358. M.D., Ferin, M., Baird, W.M., Cassady, J.M., 1988. Potential cancer Janssen, A.M., Scheffer, J.J.C., Baerheim Svendsen, A., 1987-. Antimicro- chemopreventive and cytotoxic agents from Pulicaria cripa. Journal bial activity of essential oils: a 1976–1986 literature review Aspects of Natural Products 51 (3), 621–624. of the test methods. Planta Medica, 395–398. Awadh, N.A.A., Julich, W.D., Kusnick, C., Lindequist, U., 2001. Screen- Kurita, N., Koike, S., 1983. Synergetic antimicrobial effect of ethanol, ing of Yemeni medicinal plants for antibacterial and cytotoxic activi- sodium chloride, acetic acid and essential oil components. Agricultural ties. Journal of Ethnopharmacology 74, 173–179. and Biological Chemistry 47, 67–75. Bahman, N., Gholam reza, A., Parivash, G., 2002. Antimicrobial activity Mahfouz, M., Ghazal, A., El-Dakhakhny, M., Ghoneim, M.T., 1973. Phar- of Pulicaria dysenterica. Iranian Journal of Pharmaceutical Research macological studies on the active principle isolated from Pulicaria 1, 31–32. dysenterica. Journal of Drug Research 5 (2), 151–172. 292 A. Ezoubeiri et al. / Journal of Ethnopharmacology 99 (2005) 287–292

Mansour, R.M.A., Ahmed, A.A., Melek, F.R., Saleh, N.A.M., 1990. The Remmal, A., Bouchikhi, T., Tantaoui-Elaraki, A., Ettayebi, M., 1993. flavonoids of Pulicaria incisa. Fitoterapia 61 (2), 186–187. Inhibition of antibacterial activity of essential oils by tween 80 and Marco, J.A., Sanz, J.F., Albiach, R., 1992. Caryophyllene derivatives from ethanol in liquid medium. Journal de Pharmacie de Belgique 48 (5), Pulicaria dysenterica. Phytochemistry 31 (7), 2409–2413. 352–356. Metwally, M., Dawidar, A., Metwally, S., 1986. A new thymol derivative Rustaiyan, A., Simozar, E., Ahmadi, A., Grenz, M., Bohlmann, F., 1981. from Pulicaria undulata. Chemical and Pharmaceutical Bulletin 34 A hardwickiic acid derivative from Pulicaria gnaphalodes. Phyto- (1), 378–379. chemistry 20 (12), 2772–2773. Mossa, J.S., Hifnawy, M.S., Al-Yahya, M.A., Al-Mesha, I.A., Mekkawi, San Feliciano, A., Medarde, M., Gordaliza, M., Del Olmo, E., Miguel A.G., 1987. GC/MS analysis of essential oil of Pulicaria arabica and del Corral, J.M., 1989. Sesquiterpenoids and phenolics of Pulicaria P. undulata. International Journal of Crude Drug Research 25 (2), paludosa. Phytochemistry 28 (10), 2717–2721. 113–119. Singh, P., Sharma, M.C., Joshi, K.C., Bolhamann, F., 1985. Diterpenes Mossa, J.S., Hifnawy, M.S., Al-Yahya, M.A., Hafez, M.M., Shehata, A.A., derived from clerodanes from Pulicaria angustifolia. Phytochemistry El-Feraly, F.S., 1988. Flavonoids and coumarins from three Saudi 24 (1), 190–192. Arabian compositae species. International Journal of Crude Drug Re- Tanira, M.O.M., Ali, B.H., Bashir, A.K., Wasfi, I.A., Chandranath, I., search 26 (4), 181–184. 1996. Evaluation of the relaxant activity of some United Arab Emi- Mossa, J.S., Muhammad, I., El-Feraly, F.S., Hufford, C.D., McPhail, D.R., rates plants on intestinal smooth muscle. Journal of Pharmacy and McPhail, A.T., 1992. Bisabolene and guaiane sesquiterpenes from Pharmacology 48 (5), 545–550. Pulicaria glutinosa. Phytochemistry 31 (2), 575–578. Tantaoui-Elaraki, A., Lattaoui, N., Errifi, A., Benjilali, B., 1993. Compo- Muhammad, I., El-Feraly, F.S., Mossa, J.S., Ramadan, A.F., 1992. sition and antimicrobial activity of the essential oil of Thymus brous- Terpenoids from Pulicaria glutinosa. Phytochemistry 31 (12), sonettii, T. zygis and T. satureioides. Journal of Essential Oil Research 4245–4248. 5, 45–53. Murray, P.R., Baron, E.J., Pfaller, M.A., Tenover, F.C., Yolke, R.H., 1995. Vernin, G., Lageot, C., Gaydou, E.M., Parkanyi, C., 2001. Analysis of Manual of Clinical Microbiology, 6th ed. ASM, Washington, DC. the essential oil of Lippia graveolens HBK from El Salvador. Flavour National Committee for Clinical Laboratory Standards, 1997. Methods for and Fragrance Journal 16, 219–226. dilution antimicrobial susceptibility tests of bacteria that grow aero- Weyerstahl, P., Marschall, H., Wahlburg, H.C., Christiansen, C., Rus- bically. Approved Standard M7-A4, National Committee for Clinical taiyan, A., Mirdjalili, F., 1999. Constituents of the essential oil of Laboratory Standards, Wayne, PA. Pulicaria gnaphalodes (Vent) Boiss. from Iran. Flavour and Fragrance Pares, J.O., Oksuz, S., Ulubelen, A., Mabry, T.J., 1981. 6-Hydroxy- Journal 14 (2), 121–130. flavonoids from Pulicaria dysenterica (Compositae). Phytochemistry Zdero, C., Bohlmann, F., Rizk, A.M., 1988. Sesquiterpene lactones from 20 (8), 2057. Pulicaria sicula. Phytochemistry 27 (4), 1206–1208. Journal of Ethnopharmacology 99 (2005) 293–300

Ultrasound-assisted extraction methodology as a tool to improve the antioxidant properties of herbal drug Xiao-chia-hu-tang Chu-Ting Liu, Ching-Yi Wu, Yih-Ming Weng, Chin-Yin Tseng ∗

Department of Food Science, National Chiayi University, 300 University Road, Chiayi 600, Taiwan, ROC Received 7 February 2005; received in revised form 24 February 2005; accepted 25 February 2005 Available online 7 April 2005

Abstract

Xiao-chai-hu-tang (XCHT) is an important Chinese herbal prescription for curing many types of liver diseases. The contents of bioactive constituents (saikosaponins a, c and d, baicalin, baicalein, and glycyrrhizic acid), and antioxidant properties of XCHT extracts prepared with ultrasound-assisted (US) extraction in combination with ethanol (up to 95%) as extraction modifier were studied. The results showed that the US extraction significantly increased the bioactive constituents concentrations and antioxidant properties of XCHT extracts when compared with the XCHT prepared with traditional boiling-water extraction. Among the XCHT extracts made with US extraction, the sample prepared with 95% ethanol showed the highest bioactive constituent concentrations and the best antioxidant functionalities. The results suggest that US extraction of XCHT is feasible to replace the traditional time-consuming and low efficiency preparation procedure in the future modernized and commercialized manufacture of this highly valuable Chinese herbal medicine. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Ultrasound-assisted extraction; Herbal medicine; Antioxidant activity; Hepatoprotective functionality

1. Introduction plant tissues in hot water for hours does not meet the re- quirement of productivity if the herbs are subjected for com- Extraction efficiency of bioactive compounds from medic- mercial production. Instead of the traditional boiling water inal herbs plays a key role in exerting the therapeutic func- extraction (decocting), various novel extraction techniques, tionality. In the traditional preparation procedures, the herbs including microwave digestion (Parr et al., 2001), enzymatic usually are disintegrated with grounding or smashing ma- extraction (Wilkes et al., 2000) and ultrasound-assisted (US) chines in order to increase the extraction efficiency during extraction (Wu et al., 2001), have been developed. Increased the water extraction stage. Although the extraction efficiency molecular movement rate and enhanced solvent penetration is somewhat increased by converting the herbal tissues to are believed to be the main reasons for the improved extrac- smaller pieces, boiling large amount of disintegrated herbal tion efficiency during US extraction (Tomaet al., 2001). Other advantages of US extraction include shorter extraction time, lower extraction temperature, and less bioactive compound Abbreviations: ABTS, 2,2 -azino-bis(3-ethylbenzothiazoline-6- loss (Valachovic et al., 2001; Vinatoru, 2001). sulfonic acid); DPPH, 1,1-diphenyl-2-picryl hydrazyl; EDTA, ethylene- However, the successful application of new extraction pro- diaminetetraacetic acid; GA, glycyrrhizic acid; IC50, 50% inhibition concentration; MDA, malondialdehyde; PHC, potassium hexacyanoferrate; cedure on a specific herbal medicine prescription needs solid SDS, sodium dodecyl sulfate; TBA, thiobarbituric acid; TBARS, thiobar- evidence based on the analysis of the bioactive ingredient bituric acid reactive substances; TCA, trichloroacetic acid; TEAC, Trolox contents and functional properties of the resulting herbal equivalent antioxidant capacity; TMP, 1,1,3,3-tetramethoxy propane; products (Ong and Len, 2003). Xiao-chai-hu-tang (XCHT) Tris–HCl, Tris-(hydroxymethyl) aminomethane hydrochloride; US, is an important Chinese herbal prescription for curing many ultrasound-assisted; XCHT, Xiao-chai-hu-tang ∗ Corresponding author. Tel.: +886 5 2717618; fax: +886 5 2775484. kinds of liver diseases (Yamashiki et al., 1996; Ohtake et al., E-mail address: [email protected] (C.-Y. Tseng). 2000). Other beneficial functionalities of XCHT reported in

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.jep.2005.02.018 294 C.-T. Liu et al. / Journal of Ethnopharmacology 99 (2005) 293–300 the recent literature include antioxidation (Sakaguchi et al., with a blender. The powdered herbs was mixed with 10 1993), antimutagenesis (Ohtsuka et al., 1995), anticarcino- times of extraction solution (w/v) and placed in the ul- genesis (Huang et al., 1997), immunoregulation (Borchers trasonic apparatus (DC600H DELTA Ultrasonic machine, et al., 2000; Ohtake et al., 2000), and antiinflammation Kwang-Hwa Electronic Material Co. Ltd., Taiwan) for 2 h (Kusunose et al., 2002). Since we are interested in the scale- at 40 ◦C. up production of this particular hepatoprotective herbal pre- The extraction solutions used were water and ethanol mix- scription, the objective of the present research was conducted tures with the ethanol contents adjusted to 0%, 30%, 70% to investigate the feasibility of US extraction on the prepara- and 95% (v/v). The resulting extraction mixture was filtered tion of XCHT extract. The contents of major bioactive com- with cheese close and the filtrate was concentrated with a pounds (saikosaponins a, c and d, baicalin, baicalein, and rotary evaporator (Laborota 4001, Heidolph, Germany) and glycyrrhizic acid) and antioxidant functional properties of freeze-dried (12ES Freeze Dryer, Virtis Co., Gardiner, NY) extracts were analyzed to demonstrate the enhanced extrac- giving XCHT powder. The powders derived with 0%, 30%, tion efficiency. 70% and 95% ethanol in the extraction solution were designated as SE-0, SE-30, SE-70 and SE-95, respectively. The freeze-dried powder was stored under −20 ◦C for further 2. Materials and methods tests. The XCHT powder (designated as HE-0) prepared by boiling herbs in distilled water without ethanol for 2 h 2.1. Chemicals was also prepared and used in the tests for comparison purpose. Baicalin, baicalein, glycyrrhizic acid, saikosaponin a, saikosaponin c and saikosaponin d were purchased 2.3. Analysis of saikosaponins, baicalin, baicalein, and from Wako Pure Chemical Industries Ltd. (Osaka, Japan). glycyrrhizic acid Ascorbic acid, 2,2-azino-bis(3-ethylbenzothiazoline- 6-sulfonic acid) (ABTS), cytochrome c, ethylenedi- The freeze-dried XCHT powder was dissolved in dou- aminetetraacetic acid (EDTA), ferric chloride, ferrozine, ble distilled water and the concentrations of saikosaponins Folin–Ciocalteu’s reagent, gallic acid, iron(II) chloride (saikosaponin a, c and d) were analyzed by a high per- tetrahydrate (FeCl ·4H O), 1,1-diphenyl-2-picryl hydrazyl 2 2 formance liquid chromatograph (HPLC L-7000, Hitachi, (DPPH), potassium hexacyanoferrate (PHC), dipotassium Tokyo, Japan) equipped with an Inertsil ODS-3 C column hydrogen phosphate (K HPO ), potassium dihydrogen 18 2 4 (250 mm × 4.6 mm, GL Sciences, Japan). The programmed phosphate (KH PO ), peroxidase, quercetin, sodium 2 4 gradient elution using acetonitrile–water from 40:60 (v/v) to carbonate (Na CO ), sodium dodecylsulphate (SDS), 2 3 50:50 (v/v) in 10 min at a flow rate of 1.0 mL/min and detec- 1,1,3,3-tetraethoxy propane (TEP), trichloroacetic acid tion wavelength of 203 nm were used (Park et al., 2000). For (TCA), xanthine and xanthine oxidase were purchased from the analysis of baicalin, baicalein and glycyrrhizic acid, the Sigma Chemical Co. (St. Louis, MO). Acetonitrile, ethanol, elution solution consisted of (A) 25 mM NaH PO (pH 2.5) hydrochloric acid (HCl) and methanol were purchased 2 4 and (B) acetonitrile. The initial eluent composition was set at from Merck Co. (Darmstadt, Germany). Aluminum nitrate 30% of B, gradually shifted to 100% B in 25 min, and held (Al(NO ) ) and potassium acetate (CH COOK) were 3 3 3 for 10 min before returning to initial condition. Detection purchased from J.T. Baker Co. (Phillipsburg, NJ). Hydrogen wavelength was 277 nm for baicalin, 280 nm for baicalein peroxide (H O ) was purchased from Sigma–Aldrich Inc. 2 2 and 252 nm for glycyrrhizic acid. Standard curves established (St. Louis, MO). Tris-(hydroxymethyl) aminomethane with saikosaponins (a, c and d), baicalin, baicalein, and gly- hydrochloride (Tris–HCl) and thiobarbituric acid (TBA) cyrrhizic acid were used for the calculation. were from Acros Chemical (Morris Plains, NJ). n-Butanol was purchased from Fisher Co. (Fair Lawn, NJ). 2.4. Determining of flavonoid content 2.2. Preparation of Xiao-chai-hu-tang extracts Freeze-dried XCHT powder was dissolved in double The dried roots of Bupleurum kaoi Liu were provided distilled water and flavonoid concentration was determined by Green Health Biotechnology Corporation (Yunlin, Tai- following the method described by Jia et al. (1999). XCHT so- wan). Pinelliae tuber, Ginseng radix, Zizyphi fructus, Scutel- lution (500 ␮L), ethanol (1.5 mL), Al(NO3)3 (100 ␮L, 10%), lariae radix, Glycyrrhizae radix, and Zingiberis rhizoma CH3COOK (100 ␮L, 1 M) and H2O (2.8 mL) were thor- were purchased from a local herb pharmacy. The formula- oughly mixed and kept at ambient temperature for 40 min. tion of XCHT was prepared according to Sakaguchi et al. The absorbance of reaction mixture at 415 nm was measured (1993); the ratio of Bupleurum kaoi, Pinelliae tuber, Ginseng with a spectrophotometer (U-2000 Spectrophotometer, radix, Zizyphi fructus, Scutellariae radix, Glycyrrhizae radix, Hitachi, Tokyo, Japan). Total flavonoid content was calcu- and Zingiberis rhizoma was 7:5:3:3:3:2:1 (w/w/w/w/w/w/w). lated according to a standard curve established with quer- All herbal ingredients were pooled together and powdered cetin. C.-T. Liu et al. / Journal of Ethnopharmacology 99 (2005) 293–300 295

2.5. Determination of total phenolic compounds designated concentration. XCHT solution (50 ␮L), xanthine buffer solution (400 ␮L) and H2O (530 ␮L) were thoroughly Freeze-dried XCHT powder was dissolved in double mixed; and then xanthine oxidase (20 ␮L, 1 unit/mL) was distilled water and the concentration of total phenolic added and mixed. The absorbance was measured spec- compounds was spectrophotometrically determined using trophotometrically at 295 nm for 2 min against a solvent Folin–Ciocalteu’s reagent as described by Taga et al. blank that contained no xanthine oxidase. (1984). XCHT solution (100 ␮L), Folin–Ciocalteu’s reagent (500 ␮L), sodium carbonate (400 ␮L, 7.5%) and distilled 2.10. Scavenging superoxide anions H2O (5 mL) were thoroughly mixed and kept at room temperature for 30 min before the absorbance at 760 nm Superoxide scavenging activity of XCHT extract was as- was measured. Total phenolic concentration was determined sayed with the cytochrome c reduction method (McCord and using gallic acid as standard. Fridovich, 1969). Xanthine buffer solution was prepared as described above. Xanthine buffer solution was mixed with 2.6. Scavenging DPPH radical 2mLKH2PO4 (50 mM), 2 mL EDTA (0.1 mM), 2 mL cytochrome c (0.1 mM) and 40 mL xanthine solution (0.1 mM) The scavenging of DPPH radical was assayed following to form a working solution. Aqueous XCHT solution (50 ␮L), the method of Hatano et al. (1989). A mixture of the XCHT working solution (400 ␮L) and H2O (530 ␮L) were thor- powder dissolved in methanol with an equal volume of DPPH oughly mixed and xanthine oxidase (20 ␮L, 1 unit/mL) was solution (0.1 mM) was shaken vigorously. The mixture was then added to the mixture. The absorbance was measured at kept at room temperature for 50 min before the absorbance a wavelength of 550 nm for 70 s against the solvent blank at 517 nm was measured. The scavenging activity was deter- without xanthine oxidase. mined by comparing the absorbance with that of the blank (100%) containing only DPPH solution and solvent. 2.11. Inhibition of FeCl2/ascorbic acid-induced lipid peroxidation 2.7. Reducing power Lipid peroxidation of rat liver homogenate inhibited by The XCHT powder (0–10 mg) dissolved in phosphate XCHT extracts was conducted. The liver homogenate of male buffer (2.5 mL, 0.2 M, pH 6.6) was added to potassium fer- Sprague–Dawley rats (8-week old, ca. 240 g B.W.; National ricyanide (2.5 mL, 10 mg/mL) to determine the reducing Laboratory Animal Center, Taiwan) was used for the test. power (Oyaizu, 1986). After incubation at 50 ◦C for 20 min, After rat was sacrificed, the liver tissue was taken out and ho- trichloroacetic acid (2.5 mL, 100 mg/mL) was added to the mogenized (Homogenizer, Glas-Col, Terre Haute, IN) with mixture; and the precipitate was removed with centrifuga- 150 mM Tris–HCl buffer (pH 7.2) to obtain the homogenate tion (650 × g, 10 min). The absorbance of the supernatant (10%, w/v). The homogenate was centrifuged (3500 × g, (2.5 mL) mixed with distilled water (2.5 mL) and ferric chlo- 15 min; Allegra 6R, Beckman Coulter, Fullerton, CA) and ride (0.5 mL, 1.0 mg/mL) was measured at 700 nm. the protein content of the supernatant was determined with the method described by Lowry et al. (1951). Ferrous chlo- 2.8. Total antioxidant activity ride/ascorbic acid-induced lipid peroxidation was conducted with the method described by Yoden et al. (1980) and Kimura Total antioxidant activity was measured according to et al. (1981) with modifications. The supernatant of liver the method described by Miller and Rice-Evans (1997) homogenate (250 ␮L), Tris–HCl buffer (pH 7.2, 50 ␮L), and Arnao et al. (2001) with modifications. Peroxidase ascorbic acid (0.1 mM, 50 ␮L), ferrous chloride (4 mM, (4.4 units/mL, 0.2 mL), H2O2 (50 mM, 0.2 mL), ABTS [2,2 - 50 ␮L) and XCHT extract solution (50 ␮L) were mixed and azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), 100 mM, incubated at 37 ◦C for 1 h. Immediately after incubation, 0.2 mL] and distilled water (1 mL) were mixed and kept in HCl (0.1N, 500 ␮L), SDS (9.8%, 200 ␮L), distilled water the dark for 1 h to form a bluish-green complex. After adding (900 ␮L) and TBA (0.6%, 2 mL) were added into each aqueous XCHT solution (1 mL), the absorbance at 734 nm tube. The tubes were further kept at 95 ◦C for 30 min. was measured and represented the total antioxidant activity. After cooling to room temperature, n-butanol (5 mL) was added into each tube. The tubes were vigorously shaken 2.9. Inhibiting the formation of superoxide anions and centrifuged (1000 × g, 25 min). The MDA in n-butanol layer was analyzed with a fluorescence spectrophotometer The formation of superoxide anions was conducted (F-2500 Fluorescence Spectrophotometer, Hitachi, Tokyo, according to the method described by Chang et al. (1994). Japan) with excitation wavelength 515 nm and emission Xanthine buffer solution (0.1 mM) was prepared by dissolv- wavelength 553 nm. Sample with distilled water replacing ing 3.04 mg of xanthine in 100 mL of 50 mM KH2PO4 buffer XCHT extract solution and sample using phosphate buffer solution (pH 7.8) with gentle heating and ultrasonic shaking replacing FeCl2/ascorbic acid solution were included as the until it was completely dissolved and then diluted to the positive or negative controls, respectively. Concentrations of 296 C.-T. Liu et al. / Journal of Ethnopharmacology 99 (2005) 293–300

MDA were determined from a standard curve prepared using TEP.

2.12. Statistical analysis

Data were expressed as mean ± S.D. of triplicate samples. ANOVA procedure was used to analyze the variance among the samples. Duncan’s multiple range tests, at p < 0.05, was used to determine signiﬁcant differences among sample means.

3. Results

3.1. Bioactive components in XCHT extracts

Bioactive components in XCHT extracts prepared with solvent containing different concentration of ethanol are shown in Table 1. Generally speaking, the contents of bioac- Fig. 1. Scavenging activity (%) of Xiao-chai-hu-tang extracts on 1,1- tive compounds increased when the concentration of ethanol diphenyl-2-picryl hydrazl (DPPH) radicals. Mean of triplicate samples. in the extraction fluid increased. The significantly higher amounts (p < 0.05) of all analyzed major bioactive com- 3.3. Reducing power of XCHT extracts pounds were detected when XCHT was extracted with 95% ethanol (i.e. SE-95 samples). Combination of ferric ion with K4Fe(CN)6 gives rise to the formation of Prussian blue Fe4[Fe(CN)6]3. Since the K4Fe(CN)6 is derived from the reduction of potassium fer- 3.2. DPPH radical scavenging activity ricyanide K3Fe(CN)6, the formation of Fe4[Fe(CN)6]3 can be used to represent the reducing power of the test system The lipid autooxidation is accelerated when free radi- (Oyaizu, 1986). The reducing power of XCHT extracts is cals are formed as the results of losing a hydrogen atom shown in Fig. 2. For each type of XCHT extract, the reduc- from the double bond in the structure of unsaturated fatty ing power increased as the concentration increased. However, acids. Scavenging of free radicals is one of the major an- SE-30 and SE-70 showed higher reducing power when higher tioxidation mechanisms to inhibit the chain reaction of lipid dose range (2.5–10.0 mg/mL) was used; SE-95 demonstrated oxidation. The scavenging activity of XCHT extracts is better reducing power when low dose range (0.1–1.0 mg/mL) shown in Fig. 1. The scavenging activities for all types of was tested. XCHT extracts increased as the concentration of the extracts increased. However, the calculated 50% inhibition 3.4. Total antioxidant activity of XCHT extracts concentration (IC50) values are 4.19, 4.19, 1.46, 0.58 and 0.43 mg/mL for HE-0, SE-0, SE-30, SE-7 and SE-95, re- The scavenging ability of ABTS+ free radicals is defined spectively. The results indicate that the extract obtained as TEAC (Trolox equivalent antioxidant capacity) and used from 95% ethanol exerted the strongest scavenging activ- to represent the total antioxidant activity of the testing system ity. (Miller et al., 1993, 1996). The total antioxidant activities of

Table 1 The contents of saikosaponin a, saikosaponin c, saikosaponin d, baicalin, baicalein, glycyrrhizic acid (GA), ﬂavonoids and total phenolics in Xiao-chai-hu-tang extracts Treatment Contenta (mg/g freeze-dried powder)

Saikosaponin a Saikosaponin c Saikosaponin d Baicalin Baicalein Glycyrrhizic acid Flavonoidsb Total phenolicsc HE-0 0.32 ± 0.09 e 0.40 ± 0.01 e 0.19 ± 0.05 e 0.56 ± 0.07 c 0.38 ± 0.01 d 0.29 ± 0.01 e 3.618 ± 0.05 d 12.01 ± 0.43 e SE-0 0.85 ± 0.13 d 1.73 ± 0.05 d 0.11 ± 0.01 d 0.08 ± 0.01 d 0.05 ± 0.01 e 0.74 ± 0.02 d 3.748 ± 0.14 d 14.46 ± 0.48 d SE-30 4.32 ± 0.19 c 3.89 ± 0.07 c 0.91 ± 0.11 c 0.49 ± 0.04 c 1.07 ± 0.07 c 2.68 ± 0.18 c 11.65 ± 0.41 c 27.69 ± 1.41 c SE-70 8.91 ± 0.53 b 4.47 ± 0.21 b 4.19 ± 0.16 b 19.53 ± 0.29 b 1.63 ± 0.01 a 6.41 ± 0.33 b 32.01 ± 0.69 b 53.11 ± 1.48 b SE-95 22.24 ± 0.39 a 8.03 ± 0.15 a 12.92 ± 1.16 a 23.87 ± 0.30 a 3.58 ± 0.01 b 14.05 ± 0.16 a 36.80 ± 1.46 a 64.87 ± 2.51 a a Each value represents mean ± S.D. (n = 3). Means with different letters within the same column are signiﬁcantly different (p < 0.05). b The total phenolics content expressed as gallic acid equivalent. c The ﬂavonoids content expressed as quercetin equivalent. C.-T. Liu et al. / Journal of Ethnopharmacology 99 (2005) 293–300 297

Fig. 2. Reduction power of Xiao-chai-hu-tang extracts. Mean of triplicate Fig. 4. Inhibition effect (%) of Xiao-chai-hu-tang extracts on superoxide samples. anion radical formation. Mean of triplicate samples.

XCHT extracts are shown in Fig. 3. While the dose-dependent calculated IC50 for SE-70 and SE-95 extracts were 0.89 and relationships were found for all types of XCHT extracts, SE- 0.85 mg/mL, respectively. The calculated IC50 for extracts 70 and SE-95 possessed better total antioxidant activity than prepared without ethanol (i.e. HE-0 and SE-0) were greater other types of extracts. At the level of 10 mg/mL, all types of than 10 mg/mL. extracts exerted 95% or above total antioxidant activity. 3.6. Scavenging superoxide anions 3.5. Inhibiting superoxide anion formation The scavenging activities of XCHT extracts are shown in The inhibition of superoxide formation by XCHT extracts Fig. 5. While the scavenging activities for HE-0 and SE-0 is shown in Fig. 4. For HE-0 and SE-0 extracts, only weak were relatively low, the percentage of scavenging activities inhibition effects were observed up to the level of 10 mg/mL. for all types of extracts increased as the dose increased. When As for SE-30, SE-70 and SE-95 extracts, the inhibition ef- compared at the same dose level, the scavenging activity in- fects were greater than 85% at the level of 10 mg/mL. The creased as the ethanol concentration used for preparation of

Fig. 3. Total antioxidant activity (%) of Xiao-chai-hu-tang extracts. Mean Fig. 5. Scavenging activity (%) of Xiao-chai-hu-tang extracts on superoxide of triplicate samples. anion radicals. Mean of triplicate samples. 298 C.-T. Liu et al. / Journal of Ethnopharmacology 99 (2005) 293–300

Table 2 Effects of Xiao-chai-hu-tang extract on the format of MDA in FeCl2/ascorbate-induced lipid peroxidation of rat liver homogenate Treatment MDA (nmol/mg protein of liver homogenate) 0.1 0.5 1.0 2.5 5.0 10.0 HE-0 2.18 ± 0.03* 2.12 ± 0.08* 2.07 ± 0.08* 2.09 ± 0.03* 2.10 ± 0.09* 1.85 ± 0.08* SE-0 2.42 ± 0.06 2.93 ± 0.14* 2.46 ± 0.21 2.30 ± 0.03 1.99 ± 0.06* 1.74 ± 0.15* SE-30 2.02 ± 0.04* 1.98 ± 0.14* 2.05 ± 0.15* 1.94 ± 0.04* 1.70 ± 0.03* 1.51 ± 0.27* SE-70 2.05 ± 0.11* 2.07 ± 0.16* 1.93 ± 0.11* 1.82 ± 0.12* 1.62 ± 0.14* 1.19 ± 0.04* SE-95 1.92 ± 0.06* 1.87 ± 0.18* 1.54 ± 0.03* 1.41 ± 0.11* 1.05 ± 0.05* 0.53 ± 0.06*

Positive control: 2.36 ± 0.06 (nmol/mg protein of liver homogenate, lipid peroxidation induced with FeCl2/ascorbate). Negative control: 1.03 ± 0.06 (nmol/mg protein of liver homogenate). Each value represents mean ± S.D. (n = 3). ∗ Signiﬁcantly different from positive control.

extract increased. The calculated IC50 values for SE-70 and to decrease TBARS formation in the FeCl3-induced epilep- SE-95 were 1.49 and 0.82 mg/mL, respectively. tic model system and to inhibit hippocampal neuronal death induced by 5 min of cerebral ischemia in gerbils (Hamada 3.7. Inhibition of FeCl2-ascorbic acid inducted lipid et al., 1993). Baicalin and baicalein exerted strong hydroxyl peroxidation radical, DPPH radical and alkyl radical scavenging activities in a dose-dependent pattern. Moreover, baicalin and baicalein Since the liposome peroxidation induced by reactive metal showed ferrous ion chelating activity and interfered with the ions and reducing agents is widely used to simulate the in oxidation–reduction of ferric–ferrous ions (Gao et al., 1999). vivo lipid peroxidation, inhibition of ascorbate-dependent Since the sugar moiety in the glycoside structure is reported to lipid peroxidation induced with ferrous ions of rat liver ho- reduce the overall free radical scavenging activity originated mogenate by XCHT extracts was conducted (Table 2). In from aglycone moiety (Shahidi and Wanasundara, 1992), this testing system, the detected amount of MDA, an oxi- baicalein showed better scavenging activity than baicalin. dized product, is used to demonstrate the antioxidant prop- As the highest baicalin and baicalein contents were de- erty of XCHT extracts. HE-0 and SE-0 samples showed the tected in the SE-95 sample (Table 1), the best inhibitory effect highest amounts of MDA formation for the test range of on lipid peroxidation and the highest DPPH and superoxide 0.1–10 mg/mL. The least MDA was formed when SE-95 was anion radical scavenging activity were observed with SE-95 used; and the calculated IC50 was 0.91 mg/mL. extract (Figs. 2–4). Because the polarity difference between baicalin and extraction solvents, extraction of bacialin with ethyl acetate and acetone was not successful (Lin et al., 1999). 4. Discussion Although methanol could be used as the extraction medium in ultrasonic extraction of bacialin from Scutellariae radix (Lin Xiao-chai-hu-tang (XCHT) has been used as a major cur- et al., 1999), the safety concern precludes the use of methanol ing prescription for chronic hepatitis in the traditional Chi- in consumer products as proposed in the present study. From nese herbal medicine (Yamashiki et al., 1997; Yagura et al., a practical point of view, ethanol was chosen to serve as the 2001). Baicalein (a flavonoid compound) and baicalin (gly- extraction medium and the effect of ethanol concentration on coside of baicalein) are reported to be the major bioactive the extraction efficiency was demonstrated. components in the XCHT (Inoue and Jackson, 1999; Ueda Glycyrrhizin is 50 times sweeter than sucrose and is et al., 2001). Flavonoids consist of a flavan nucleus that is the major sweet component in Glycyrrhizae radix. Upon made of two phenyl rings (denoted as A and B rings) and hydrolysis, glycyrrhizin loses two molecules of glucuronic an oxygen-containing pyran ring. The antioxidant activities acids and converts to the aglycone glycyrrhizic acid (Pan et of flavonoids are determined by the degree of hydroxyla- al., 2000). Since glycyrrhizic acid inhibits FeCl2/ascorbate- tion and by the substitution position of hydroxy groups in induced lipid peroxidation in rat liver homogenate and ex- the rings (Pietta, 2000). The free radical scavenging activity presses superoxide radical scavenging activity, it is used as of flavonoid compounds is attributed to the ortho-positioned protective agent for liver cell injury caused by many chem- hyroxyl groups in the A ring (Gao et al., 1999). icals, and is used in the treatment of chronic hepatitis and Flavonoids are currently used as therapeutic agents for cirrhosis in China and Japan (Jeong et al., 2002). Although several chronic liver diseases in China and Japan (Ueda et GA is reported to be freely soluble in alcohol, the addition al., 2001). Baicalin and baicalein possess antioxidant ac- of ethanol at the level up to 30% did not increase the ex- tivity (Bors et al., 1990). Gao et al. (2003) reported that traction efficiency of GA from Glycyrrhizae radix (Ong and baicalin reduced the TBARS content in rat liver homogenate Len, 2003). Higher concentrations of GA in the extraction and this property was attributed to the antioxidant capabil- fluids were obtained when ethanol levels were 70% and 95% ity of baicalin because the liver is the primary metabolism (Table 1). Furthermore, the enhanced beneficial bioactivi- organ for this compound. Baicalein has also been reported ties including superoxide radical scavenging activity (Fig. 5) C.-T. Liu et al. / Journal of Ethnopharmacology 99 (2005) 293–300 299 and inhibition of lipid peroxidation in rat liver homogenate Hamada, H., Hiramatsu, M., Edamatsu, R., Mori, A., 1993. Free radical (Table 2) were observed as the GA contents in the extracts scavenging action of baicalein. Archives of Biochemistry and Bio- increased. physics 306, 261–266. Hatano, T., Edamatsu, R., Mori, A., Fujita, Y., Yasuhara, T., Yoshida, Saikosaponins possessed scavenging activity against reac- T., Okuda, T., 1989. Effects of the interaction of tannins with co- tive oxygen species (Hattori et al., 1991) and inhibited perox- existing substances. VI. Effects of tannins and related polyphenols on idation of rat liver homogenate (Abe et al., 1982). The highest superoxide anion radical, and on 1,1-diphenyl-pierylhydrazyl-radical. saikosaponin content was detected in the XCHT extract pre- Chemical and Pharmaceutical Bulletin 37, 2016–2021. pared with 95% ethanol (i.e. SE-95; Table 1); moreover, the Hattori, T., Ito, M., Suzuki, Y., 1991. Studies on antinephritic effects of plant components in rat (1). Effects of saikosaponins original-type best inhibition of FeCl2/ascorbic acid-induced lipid peroxi- anti-GBM nephritis in rats and its mechanisms. Nippon Yakurigaku dation (Table 2) was derived from the SE-95 extract. Saikos- Zasshi 97, 13–21. aponins are typical triterpenoid glycosides that contain an Huang, Y., Marumo, K., Murai, M., 1997. Antitumor effects and phar- oxy-ether ring in their chemical structure. The oxy-ether ring macological interaction of xiao-chai-hu-tang (sho-saiko-to) and inter- will be destroyed under acidic conditions or during prolonged leukin 2 in murine renal cell carcinoma. The Keio Journal of Medicine 46, 132–137. extraction process (Shimizu et al., 1985). The application Inoue, T., Jackson, E.K., 1999. Strong antiproliferative effects of baicalein of high-level ethanol in the extraction process enhances the in cultured rat hepatic stellate cells. European Journal of Pharmacol- preservation of oxy-ether ring and increases the antioxidant ogy 378, 129–135. activity. Jeong, H.G., You, H.J., Park, S.J., Moon, A.R., Chung, Y.C., Kang, S.K., β In conclusion, US extraction combining with higher lev- Chun, H.K., 2002. Hepatoprotective effects of 18 -glycyrrhetinic acid on carbon tetrachloride-induced liver injury: inhibition of cytochrome els of ethanol markedly increased the extraction efficiency P450 2E1 expression. Pharmacological Research 46, 222–227. of bioactive components including flavonoids and phenolics Jia, Z., Tang, M., Wu, J., 1999. The determination of flavonoid content from XCHT raw materials. The best antioxidant capability of in mulberry and their scavenging effects on superoxide radicals. Food XCHT extracts was obtained when ethanol level was at 95%. Chemistry 64, 555–559. The results provide the optimal extraction conditions for the Kimura, Y., Kubo, M., Tani, T., Arichi, S., Okuda, H., 1981. Studies on scutellariae radix IV: effects on lipid peroxidation in rat liver. preparation of XCHT products when this health-promoting Chemical and Pharmaceutical Bulletin 29, 2610–2617. Chinese herbal medicinal prescription would be produced in Kusunose, M., Qiu, B., Cui, T., Hamada, A., Yoshioka, S., Ono, M., a commercial scale. Miyamura, M., Kyotani, S., Nishioka, Y., 2002. Effect of Sho-saiko- to extract on hepatic inflammation and fibrosis in dimethylnitrosamine induced liver injury rats. Biological and Pharmaceutical Bulletin 25, 1417–1424. Acknowledgements Lin, M.-C., Tsai, M.-J., Wen, K.-C., 1999. Supercritical fluid extraction of flavonoids from Scutellariae radix. Journal of Chromatography A The financial support (NSC-91-2317-B-415-002) from 830, 387–395. the National Science Council, the Republic of China (Tai- Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with the folinphenol reagent. The Journal of Biological wan) is gratefully acknowledged. Chemistry 193, 265–275. McCord, J.M., Fridovich, I., 1969. Superoxide dismutase: an enzymic function for erhtyrocuprein (hemocuprein). The Journal of Biological Chemistry 244, 6049–6055. References Miller, N.J., Rice-Evans, C.A., 1997. The relative contributions of ascorbic acid and phenolic antioxidants to the total antioxidant activity of Abe, H., Sakaguchi, M., Odashima, S., Arichi, S., 1982. Protective ef- orange and apple fruit juices and blackcurrant drink. Food Chemistry fect of saikosaponin-d isolated from Bupleurum falcatum L. on CCl4- 60, 331–337. induced liver injury in the rat. Naunyn-Schmiedeberg’s Archives of Miller, N.J., Rice-Evans, C.A., Davies, M.J., Gopinathan, V., Miller, A., Pharmacology 320, 266–271. 1993. A novel method for measuring antioxidant capacity and its Arnao, M.B., Cano, A., Acosta, M., 2001. The hydrophilic and lipophilic application to monitoring the antioxidant status in premature neonates. contribution to total antioxidant activity. Food Chemistry 73, 239–244. Clinical Science 84, 407–412. Borchers, A.T., Sakai, S., Henderson, G.L., Harkey, M.R., Keen, C.L., Miller, N.J., Sampson, J., Candeias, L.P., Bramley, P.M., Rice-Evans, Stern, J.S., Terasawa, K., Gershwin, M.E., 2000. Shosaiko-to and other C.A., 1996. Antioxidant activities of carotenes and xanthophylls. Kampo (Japanese herbal) medicines: a review of the immunomodu- FEBS Letters 384, 240–242. latory activities. Journal of Ethnopharmacology 73, 1–13. Ohtake, N., Suzuki, R., Daikuhara, H., Nakai, Y., Yamamoto, M., Am- Bors, W., Heller, W., Michel, C., Saran, M., 1990. Flavonoids as antiox- agaya, S., Ishige, A., Sasaki, H., Komatsu, Y., Fukuda, K., Hayashi, idants: determination of radical scavenging efficiencies. Methods in S., 2000. Modulation of lung local immune responses by oral admin- Enzymology 186, 343–356. istration of a herbal medicine Sho-saiko-to. International Journal of Chang, W.S., Chang, Y.H., Lu, F.J., Chiang, H.C., 1994. Inhibitory effects Immunopharmacology 22, 419–430. of phenolics on xanthine oxidase. Anticancer Research 14, 501–506. Ohtsuka, M., Fukuda, K., Yano, H., Kojiro, M., 1995. Effects of nine Gao, Z., Huang, K., Yang, X., Xu, H., 1999. Free radical scavenging active ingredients in Chinese herbal medicine Sho-saiko-to on 2-(2- and antioxidant activities of flavonoids extracted from the radix of furyl)-3-(5-nitro-2-furyl)acrylamide mutagenicity. Japanese Journal of Scutellaria baicalensis Georgi. Biochimica et Biophysica Acta 1472, Cancer Research 86, 1131–1135. 643–650. Ong, E.S., Len, S.M., 2003. Pressurized hot water extraction of berberine, Gao, Z., Xu, H., Chen, X., Chen, H., 2003. Antioxidant status and mineral baicalein and glycyrrhizin in medicinal plants. Analytica Chimica Acta contents in tissues of rutin and baicalin fed rats. Life Sciences 73, 482, 81–89. 1599–1607. 300 C.-T. Liu et al. / Journal of Ethnopharmacology 99 (2005) 293–300

Oyaizu, M., 1986. Antioxidative activity of browning products of glu- chondrial pathway as prooxidant. Molecular Immunology 38, 781– cosamine fractionated by organic solvent and thin-layer chromatogra- 791. phy. Nippon Shokuhin Kogyo Gakkaishi 35, 771–775. Valachovic, P., Pechova, A., Mason, T.J., 2001. Towards the industrial Pan, X., Liu, H., Jia, G., Shu, Y.Y., 2000. Microwave-assisted extraction of production of medicinal tincture by ultrasound assisted extraction. glycyrrhizic acid from licorice root. Biochemical Engineering Journal Ultrasonics Sonochemistry 8, 111–117. 5, 173–177. Vinatoru, M., 2001. An overview of the ultrasonically assisted extrac- Park, I.S., Kang, E.M., Kim, N., 2000. High-performance liquid chro- tion of bioactive principles from herbs. Ultrasonics Sonochemistry 8, matographic analysis of saponin compounds in Bupleurum falcatum. 303–313. Journal of Chromatographic Science 38, 229–233. Wilkes, J.G., Conte, E.D., Kim, Y., Holcomb, M., Sutherland, J.B., Miller, Parr, J.F., Dolic, V., Lancaster, G., Boyd, W.E., 2001. A microwave di- D.W., 2000. Sample preparation for the analysis of flavors and off- gestion method for the extraction of phytoliths from berbarium spec- flavors in foods. Journal of Chromatography A 880, 3–33. imens. Review of Palaeobotany and Palynology 116, 203–212. Wu, J., Lin, L., Chau, F., 2001. Ultrasound-assisted extraction of ginseng Pietta, P.G., 2000. Flavonoids as antioxidants. Journal of Natural Products saponins from ginseng roots and cultured ginseng cells. Ultrasonics 63, 1035–1042. Sonochemistry 8, 347–352. Sakaguchi, S., Tsutsumi, E., Yokota, K., 1993. Preventive effects of a Yagura, M., Murai, S., Kojima, H., Tokita, H., Kamitsukasa, H., Harada, traditional Chinese medicine (Sho-Saiko-to) against oxygen toxicity H., 2001. Does the control of alanine aminotransferase levels lead to a and membrane damage during endotoxemia. Biological and Pharma- regression of liver fibrosis in chronic hepatitis C patients? Hepatology ceutical Bulletin 16, 782–786. Research 19, 144–157. Shahidi, F., Wanasundara, P.K.J., 1992. Phenolic antioxidants. Critical Yamashiki, M., Nishimura, A., Nobori, T., Nakabayashi, S., Takagi, Reviews in Food Science and Nutrition 32, 67–103. T., Inoue, K., Ito, M., Matsushita, K., Ohtaki, H., Kosaka, Y., Shimizu, K., Amagaya, S., Ogihara, Y., 1985. Structural transforma- 1997. In vitro effects of Sho-saiko-to on production of granulocyte tion of saikosaponins by gastric juice and intestinal flora. Journal colony-stimulating factor by mononuclear cells from patients with of Pharmacobio-Dynamics 8, 718–725. chronic hepatitis C. International Journal of Immunopharmacology Taga, M.S., Miller, E.E., Pratt, D.E., 1984. Chia seeds as a source of nat- 19, 381–385. ural lipid antioxidants. Journal of the American Oil Chemists’ Society Yamashiki, M., Nishimura, A., Sakaguchi, S., Suzuki, H., Kosaka, Y., 61, 928–931. 1996. Effects of Japanese herbal medicine ‘Sho-saiko-to’ as a cy- Toma, M., Vinatoru, M., Paniwnyk, L., Mason, T.J., 2001. Investigation of tokine inducer. Environmental Toxicology and Pharmacology 2, 301– the effects of ultrasound on vegetal tissues during solvent extraction. 306. Ultrasonics Sonochemistry 8, 137–142. Yoden, K., Iio, T., Tabata, T., 1980. Measurement of thiobarbituric acid Ueda, S., Nakamura, H., Masutani, H., Sasada, T., Takabayashi, A., Ya- value in tissue homogenate solubilized with sodium dedecylsulphate. maoka, Y., Yodoi, J., 2001. Baicalin induces apoptosis via mito- Yakugaku Zasshi 100, 553–559. Journal of Ethnopharmacology 99 (2005) 301–308

Ethnopharmacological Communication Antifungal activities of six South African Terminalia species (Combretaceae)

P. Masoko a, J. Picard b, J.N. Eloff a,∗

a Phytomedicine Programme, Department of Paraclinical Sciences, University of Pretoria, Private Bag X04, Onderstepoort, 0110, South Africa b Department of Veterinary Tropical Diseases, Faculty of Veterinary Sciences, University of Pretoria, Private Bag X04, Onderstepoort, 0110, South Africa Received 10 September 2004; received in revised form 24 January 2005; accepted 25 January 2005 Available online 22 April 2005

Abstract

A serial microplate dilution method developed for bacteria was modiﬁed slightly and gave good results with several fungi. The antifungal activity of acetone, hexane, dichloromethane and methanol leaf extracts of six Terminalia species (Terminalia prunioides, Terminalia brachystemma, Terminalia sericea, Terminalia gazensis, Terminalia mollis and Terminalia sambesiaca) were tested against ﬁve fungal animal pathogens (Candida albicans, Cryptococcus neoformans, Aspergillus fumigatus, Microsporum canis and Sporothrix schenkii). Methanol extracted the highest quantity, but the acetone extracts had the highest antifungal activity. Some of the extracts had antioxidant activity. Most of the antifungal extracts had MIC values of c. 0.08 mg/ml, some were with MIC values as low as 0.02 mg/ml. Microsporum canis was the most susceptible microorganism and Terminalia sericea extracts were the most active against nearly all microorganisms tested. © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Combretaceae; Terminalia species; Antifungal activity; MIC

1. Introduction based medications have been handed down from generation to generation. In South Africa and also in many other African A large proportion of the South African population use countries, traditionally used medicinal plants are sold in mar- traditional medicine to serve the health needs of humans and ket places or prescribed by traditional healers in their homes animals. Medicinal plants have become the focus of intense (Fyhrquist et al., 2002). Because of this strong dependence study recently in terms of conservation and as to whether on plants as medicines, it is important to study their safety their traditional uses are supported by actual pharmacological and efﬁcacy (Farnsworth, 1994). effects or merely on folklore (Locher et al., 1995). With the Many medicinal plants produce a variety of compounds increasing acceptance of herbal medicine as an alternative of known therapeutic properties. Substances that can either form of health care, the screening of medicinal plants for inhibit the growth of pathogens or kill them and have little or bioactive compounds is important. no toxicity to host cells are considered good candidates for More than 80% of the population in developing countries developing new antimicrobial drugs. In recent years, antimi- depend on plants for their medical needs (Farnsworth, 1988; crobial properties of medicinal plants have been increasingly Balick et al., 1994). Medicinal and poisonous plants have reported from different parts of the world (Cowan, 1999). always played an important role in African society. Tradi- Higher plants are still regarded as potential sources of new tions of collecting, processing and applying plants and plant- medicinal compounds. Throughout the world, plants are used traditionally to treat many ailments, particularly infectious ∗ Corresponding author. Tel.: +27 12 529 8244; fax: +27 12 529 8252. diseases, such as diarrhoea, fever and colds (Mitscher et al., E-mail address: [email protected] (J.N. Eloff). 1987).

Members of the Combretaceae are used for many medic- (AIDS) and Terminalia species occuring widely in southern inal purposes by traditional healers. This includes treating Africa. abdominal disorders, abdominal pains, backache, bilharzia- sis, chest coughs, colds, conjunctivitis, diarrhoea, dysmenor- rhoea, earache, fattening babies, fever, headache, hookworm, 2. Materials and methods infertility in women, leprosy, pneumonia, scorpion bite, snake bite, swelling caused by mumps, syphilis, toothache, 2.1. Plant collection gastric ulcer, venereal diseases, heart diseases, cleanse the urinary system, dysentery, gallstones, sore throats, nose- Leaves were collected in summer from trees in the bleeds and general weakness (Hutchings et al., 1996; Van Lowveld National Botanical Garden in Nelspruit, South Wyk et al., 1997). Africa. Voucher specimens in the garden herbarium verified The Combretaceae consists of 18 genera, the largest of the identity of the plants. Leaves collected were from the fol- which are Combretum with about 370 species, and Termina- lowing five species with the section (Carr, 1988) in brackets: lia with about 200 species (McGaw et al., 2001). Species Terminalia prunioides M.A. Lawson (Abbreviatae), Termi- from the genus Combretum and to a lesser extent Termi- nalia brachystemma Welw. ex Hiern (Psidiodes), Terminalia nalia are most widely used for medicinal purposes, as they sericea Burch ex DC (Psidiodes), Terminalia gazensis Bak.f. are common and widely distributed throughout western and (Platycarpae), T. mollis Laws. (Platycarpae) and T. sambesi- southern Africa (McGaw et al., 2001). Many members of the aca Engl. & Diels. (Platycarpae). Combretaceae are easily characterized by the wing-shaped appendages of the fruits (Carr, 1988). 2.2. Plant storage Several investigations into the antimicrobial activity of members of the Combretaceae have been undertaken in Leaves were separated from stems and dried at room tem- recent years. Although the antibacterial properties of various perature. Most scientists have tended to use dried material Terminalia species (Silva et al., 1996; Eloff, 1999; Fyhrquist because there are a few problems associated with large-scale et al., 2002) have been investigated in depth, this is not the extraction of dried plants rather than fresh plant material case regarding their antifungal properties. Antifungal activity (Eloff, 1998a). The dried plants were milled to a fine powder of Terminalia extracts was demonstrated, but no quantitative in a Macsalab mill (Model 200 LAB), Eriez®, Bramley, and data was provided (Bhatt and Saxena, 1979; Baba-Moussa stored at room temperature in closed containers in the dark et al., 1998). This may be because the adequate methods for until used. determining MIC values are not available. Our aim in this work was to expand a serial microplate technique developed 2.3. Extraction procedure for bacteria (Eloff, 1998c) for fungi in order to determine quantitative data on antifungal activities of Terminalia Plant samples from each species were individually ex- species occurring in southern Africa. Further motivation tracted by weighing four aliquots of 1 g of finely ground was that antifungal agents are becoming more important plant material and extracting with 10 ml of acetone, hex- to combat infections of immune-compromised patients ane, dichloromethane (DCM) or methanol (technical grade suffering from the acquired immune-deficiency syndrome – Merck) in polyester centrifuge tubes. Tubes were vigor-

Fig. 1. Percentage of samples extracted by acetone (), hexane (), dichloromethane , and methanol , from the six Terminalia species: T. pru.: Terminalia prunioides, T. bra.: Terminalia brachystemma, T. ser.: Terminalia sericea, T. gaz.: Terminalia gazensis, T. mol.: Terminalia mollis and T. sam.: Terminalia sambesiaca. P. Masoko et al. / Journal of Ethnopharmacology 99 (2005) 301–308 303

Fig. 2. Chromatograms sprayed with vanillin to show compounds extracted with acetone (Ac), hexane (Hex), dichloromethane (D) and methanol (Met), in lanes from left to right for each group. ously shaken for 3–5 min in Labotec model 20.2, shaking exhaustively extract the plant material and the extracts were machine at a high speed. After centrifuging at 3500 rpm for combined. The solvent was removed under a stream of air 10 min, the supernatant was decanted into pre-weighed la- in a fume cupboard at room temperature to quantify the beled containers. The process was repeated three times to extraction.

Fig. 3. Chromatograms of extracts of different Terminalia species separated by EMW and sprayed with 0.2% DPPH, clear zones indicate antioxidant activity. Lanes from left to right in each group are acetone (Ac), hexane (Hex), dichloromethane (D) and methanol (Met). 304 P. Masoko et al. / Journal of Ethnopharmacology 99 (2005) 301–308

a 2.4. Phytochemical analysis

Chemical constituents of the extracts were analyzed by thin layer chromatography (TLC) using aluminium-backed Average Amph.B TLC plates (Merck, silica gel 60 F254). The TLC plates were developed under saturated conditions with one of the 32 0.3 64 0.46 0.4 02 0.12 02 0.15 0.3 16 0.45 0.2 5 2.5 04 0.05 02 0.27 0.4 02 0.03 02 0.1 0.2 38 ...... three eluent systems developed in our laboratory that sepa- 32 0 64 0 16 0 16 0 25 0 52 04 0 16 0 08 0 08 0 54 0 ...... rates components of Combretaceae extracts well, i.e., ethyl acetate/methanol/water (40:5.4:5): [EMW] (polar/neutral); 32 0 64 0 16 0 16 0 25 1 52 04 0 04 0 08 0 08 0 53 0 ......

Hexane DCM Methanol chloroform/ethyl acetate/formic acid (5:4:1): [CEF] (intermediate polarity/acidic); benzene/ethanol/ammonia hydrox- 16 0 64 0 02 0 02 0 16 1 52 02 0 04 0 02 0 02 0 36 0 ...... ide (90:10:1): [BEA] (non-polar/basic) (Kotze and Eloff, 2002). 16 0 64 0 08 0 08 0 64 0 52 08 0 02 0 02 0 04 0 43 0 To detect the separated compounds, vanillin-sulphuric ...... acid (0.1 g vanillin (Sigma®): 28 methanol: 1 ml sulphuric 32 0 64 0 08 0 08 0 32 0 52 02 0 04 0 02 0 08 0 41 0 ◦ ...... acid) was sprayed on the chromatograms and heated at 110 C to optimal colour development. 64 0 64 0 16 0 16 0 50 52 04 0 16 0 02 0 08 0 69 0 ...... 2.5. Antioxidant activity 32 0 32 0 02 0 02 0 32 2 52 08 0 08 0 02 0 02 0 37 0 ...... TLC was used to separate extracts as above. To de- 64 0 64 0 04 0 04 0 32 0 52 04 0 16 0 02 0 08 0 45 0 ...... tect antioxidant activity, chromatograms were sprayed with 0.2% 1,1-diphenyl-2-picryl-hydrazyl (Sigma®)(DPPH) in 16 0 32 0 16 0 16 0 16 0 52 08 0 16 0 02 0 16 0 39 0 ...... methanol as an indicator (Deby and Margotteaux, 1970). 16 0 32 0 08 0 08 0 64 0 52 08 0 16 0 02 0 08 0 41 0 ...... 2.6. Fungal test organisms 32 0 32 0 04 0 04 0 16 0 52 08 0 08 0 02 0 04 0 36 0 ......

C Five microorganisms namely, Candida albicans, Cryp- ◦ tococcus neoformans var. gattii, Aspergillus fumigatus, 32 0 64 0 16 0 16 0 64 0 52 02 0 32 0 02 0 08 0 49 0 ...... Sporothrix schenckii and Microsporum canis cultured from 08 0 64 0 16 0 32 0 16 0 52 02 0 64 0 02 0 08 0 46 0 clinical cases of disease in animals were used in the Depart- ...... ment of Veterinary Tropical Diseases, Faculty of Veterinary 16 0 64 0 08 0 16 0 32 0 52 02 0 64 0 02 0 08 0 46 0 ...... Science. Candida albicans was isolated from a Goldian ﬁnch, Cryptococcus neoformans from a cheetah, and Aspergillus fu- 64 0 64 0 16 0 16 0 16 0 52 08 0 32 0 02 0 04 0 47 0 migatus from a chicken, all of which suffered from a systemic ...... mycosis. Microsporum canis was isolated from a cat suffering from dermatophytosis and Sporothrix schenckii from a horse 64 0 64 0 32 0 16 0 16 0 52 04 0 64 0 02 0 32 0 54 0 ...... with cutaneous lymphangitis. None of the animals had been 16 0 16 0 08 0 32 0 08 0 52 02 0 32 0 02 0 16 0 38 0 ...... treated prior to sampling. These fungi represent the differ-

species after 24- and 48-h incubation at 37 ent morphological forms of fungi, namely yeasts (Candida 16 0 16 0 16 0 16 0 16 0 52 02 0 64 0 02 0 16 0 41 0 ...... albicans and Cryptococcus neoformans), thermally dimor- phic fungi (Sporothrix schenckii) and moulds (Aspergillus 32 0 32 0 16 0 32 0 32 0 52 04 0 32 0 02 0 16 0 Terminalia ...... fumigatus) and are the most common and important disease- g/ml in combined experiment, data provided here was determined in separate experiments.

␮ causing fungi of animals. All fungal strains were maintained 32 0 32 0 16 0 16 0 32 0 52 08 0 32 0 02 0 08 0 43 0.45 0 on Sabouraud dextrose agar (Oxoid, Basingstoke, UK)...... 16 0 16 0 04 0 16 0 16 0 52 04 0 64 0 02 0 16 0 40 ...... 2.7. Antifungal assays 16 0 16 0 08 0 16 0 16 0 52 04 0 32 0 02 0 16 0 38 0 ...... 2.7.1. Microdilution assay A serial microdilution assay with tetrazolium violet added 16 0 32 0 16 0 04 0 02 0 40 ...... MIC values (mg/ml) Acetone Hexane DCM Methanol Acetone Hexane DCM Methanol Acetone Hexane DCM Methanol Acetone Hexane DCM Methanol Acetone Hexane DCM Methanol Acetone Terminalia prunioides Terminalia brachystemma Terminalia sericea Terminalia gazensis Terminalia mollisas growth Terminalia sambesiaca indicator (Eloff, 1998c) was used to determine the

g/ml; originally all were <20 minimum inhibitory concentration (MIC) values for plant ex- 24 0 (h) 48 0.16 0 24 0 48 0.32 0 24 0 48 2.5 2 24 0 48 0.32 0 24 0 48 0.08 0 ␮ tracts. This method had previously been used only for antibacterial activities (Eloff, 1998c; McGaw et al., 2001). Motsei et

Values in al. (2003) also used a serial microplate dilution assay in deter- a Candida albicans Microorganisms Time Positive control: Amphotericin B (Amph.B). Table 1 Minimum Inhibitory Concentration (MIC) of six Cryptococcus neoformans Aspergillus fumigatus Sporothrix schenckii Microsporum canis Average 0 mining the antifungal activity of 24 South African medicinal P. Masoko et al. / Journal of Ethnopharmacology 99 (2005) 301–308 305 plants to three Candida albicans isolates. They determined

growth with an ELISA reader. In our experience, measur- Average ing growth by turbidity measurement has several complications (Eloff, 1998c). By applying the tetrazolium violet assay for measuring the antifungal activities, a slight modiﬁcation was made to suit fungal growth conditions. Residues of the different extracts were dissolved in acetone to a concentra-

tion of 10 mg/ml. The plant extracts (100 ␮l) were serially Hexane DCM Methanol diluted up to 50% with water in 96 well microtitre plates (Eloff, 1998c). Fungal cultures were transferred into fresh Sabouraud dextrose broth, and 100 ␮l of this was added to each well. Amphotericin B was used as the reference antibiotic and positive control, and appropriate solvent blanks were included. As an indicator of growth, 40 ␮l of 0.2 mg/ml of p-iodonitrotetrazolium violet (Sigma®) (INT) dissolved in water was added to each of the microplate wells. The covered microplates were incubated for 2–3 days at 35 ◦C and 100% relative humidity. The MIC was recorded as the lowest concentration of the extract that inhibited antifungal growth after 24 and 48 h. One is tempted to consider the 48-h value as a minimal lethal concentration, especially since no growth was apparent in the particular well after 120 h. When the cells from wells showing no growth after 48 h were incubated in fresh growth medium, fungal growth however resumed. We are following up on this matter.

3. Results and discussion

Six Terminalia species were selected for antifungal- activity screening based on their use in traditional medicinal treatments for both domestic animals and humans in southern C

Africa and availability. The majority of traditional healers use ◦ water to isolate active compounds from these plants, because water is not harmful to domestic animals and humans and is generally the only extractant available. Using only water

Table 2 Average MIC values for different extractants on all test organisms Extractants Average MIC values (mg/ml) Hexane 0.259 DCM 0.147 Acetone 0.146 Methanol 0.195 species after 24- and 48-h incubation at 37

Table 3 Average MIC values of different Terminalia species

Terminalia ssp. Average MIC values (mg/ml) Terminalia Total activity (ml/g) 24 h 48 h Terminalia prunioidesAcetone Hexane DCM Methanol Acetone Hexane DCM Terminalia brachystemma Methanol Acetone Hexane DCM Methanol Acetone Terminalia sericea Hexane DCM Methanol Acetone Hexane DCM Methanol Acetone Terminalia gazensis Terminalia mollis Terminalia sambesiaca

Terminalia prunioides 0.124 0.68 (h) 2448 463 46324 13848 231 138 231 21324 275 21348 81 463 138 81 30 85024 138 21348 163 234 1850 9 163 234 231 21324 550 144 46948 81 3700 144 69 234 14 850 925 256 144 1100 325 256 10 20 53 234 144 138 1700 20 513 1300 81 128 1875 144 41 213 30 86 81 3750 325 1150 86 513 234 344 9 2050 200 1150 81 325 344 469 50 36 2050 575 400 650 16 344 200 144 6 72 688 128 288 5 144 256 2750 3 20 100 13 1600 13 41 250 1600 2300 288 22 100 172 2000 2300 3 250 63 100 2000 1375 125 50 13 1000 31 125 400 113 4000 500 113 125 122 72 18 113 56 575 1950 500 16 1950 225 25 6 1 122 147 2350 900 1950 113 147 3900 69 17 2350 2000 244 1000 32 588 69 2350 17 125 63 225 56 275 19 4 550 1513 225 113 756 28 113 900 1513 975 900 4 5600 7 189 488 1513 700 6050 5600 125 127 31 5600 56 175 2350 63 5600 125 131 138 500 189 69 31 250 1450 588 131 66 225 525 1450 450 700 263 91 33 807 4 3025 725 6050 1450 645 45 16 5600 1150 202 7 2800 2036 250 17 212 500 48 181 263 131 1450 45 1450 194 799 692 8 8 12 41 Terminalia brachystemma 0.146 0.75 Terminalia sericea 0.163 0.80 Terminalia gazensis 0.162 0.64 Terminalia mollis 0.293 0.62 Terminalia sambesiaca 0.232 0.66 Table 4 Total activity in ml/g ofMicroorganisms six Time Candida albicans Cryptococcus neoformans Aspergillus fumigatus Sporothrix schenckii Microsporum canis Average 859 269 453 261 776 321 617 128 621 461 663 27 1303 118 186 1173 1102 121 307 2085 3242 187 157 830 306 P. Masoko et al. / Journal of Ethnopharmacology 99 (2005) 301–308 leads to difficulties in extracting non-polar active compounds. mans var. gattii, Sporothrix schenckii and Microsporum canis Success in isolating compounds from plant material is largely were 0.4, 0.3, 0.4, and 0.2 ␮g/ml, respectively, after 48-h independent on the type of the solvent used in the extraction cubation and for Aspergillus fumigatus, it was 0.2 ␮g/ml after procedure. The total percentages extracted by using different 24 h. solvents (acetone, hexane, DCM and methanol) are shown in The average value for all the extracts and Terminalia Fig. 1. Methanol was the best extractant, extracting a greater species after 24 h was 0.3 mg/ml (Table 1). Motsei et al. quantity of plant material than any of the other solvents. There (2003) found much less activity with different plants and ex- was a major difference in the methanol extractability of Ter- tractants. Of the 273 extracts evaluated, 211 (77%) had MIC minalia gazensis leaves compared with all the other species. values as high or even higher than the highest concentration This difference is not related to the sectional division of the tested (8.35 mg/ml). This indicates that the tested plants were species (Carr, 1988). The extract probably contained more much less active than the Terminalia species, or that the tech- polar compounds (Fig. 2) that may not be that interesting for nique they used was not as sensitive as the tetrazolium violet clinical application. technique we used. Hexane, dichloromethane and methanol extracts were re- Acetone and DCM extracts had the lowest average MIC dissolved in acetone because this solvent was not found to values on the tested organisms (Table 2) which were 0.146 be harmful towards bacteria (Eloff, 1998b). We found that and 0.147 mg/ml, respectively, after 24 h. Acetone and DCM acetone was also not harmful towards fungi at the concentra- are followed by methanol which had 0.195 mg/ml after tions used in the plant extracts. Because fungi grow slower 24 h, and hexane had the highest average MIC value after than bacteria, we modified Eloff’s (1998c) method by adding 24 h which was 0.259 mg/ml. Terminalia prunioides, Ter- the tetrazolium violet before incubating the fungi. This made minalia brachystemma, Terminalia sericea and Terminalia it possible to see when sufficient growth had taken place to gazensis had the lowest average values after 24 h (Table 3), determine MIC value. which were 0.124, 0.146, 0.163 and 0.162 mg/ml, respec- There was similarity in the chemical composition of the tively. All the Terminalia species had almost the same non-polar components of extracts using extractants of vary- average MIC value after 48 h ranging between 0.62 and ing polarity. This may indicate the presence of saponin-like 0.80 mg/ml. compounds in the leaves. The quantity of antifungal compounds present was also The acetone and methanol extracts had antioxidant activ- determined in Table 4. To determine which plants can be ity after spraying chromatogram with 0.2% DPPH (Fig. 3). used for further testing and isolation, not only the MIC value Hexane and dichloromethane extracts apparently did not have is important, but also the total activity. Because the MIC any antioxidant activity. value is inversely related to the quantity of antifungal com- To determine MIC values, growth was checked after 24 pounds present, an arbitrary measure of the quantity of an- and 48 h (Table 1) to determine the end point. The MIC val- tifungal compounds present was calculated by dividing the ues of most of the extracts were in the order of 0.08 mg/ml quantity extracted in milligrams from 1 g leaves by the MIC and some had values as low as 0.02–0.04 mg/ml after 24-h in- value in mg/ml. This value indicates the volume to which cubation. Amphotericin B was used as a positive control and the biologically active compound present in 1 g of the dried there was no growth in any of the wells containing antibiotic plant material can be diluted and still kill the fungi (Eloff, indicating an MIC < 0.02 mg/ml. In subsequent experiments, 1999). Extracts with higher values were considered the best to the MIC value for Candida albicans, Cryptococcus neofor- work with. From Table 4, all 96 extracts had substantial total

Fig. 4. The average antifungal activity of different leaf extracts of six Terminalia species towards Candida albicans , Cryptococcus neoformans (), Aspergillus fumigatus() Sporothrix schenckii , Microsporum canis . (Antifungal activity expressed as the inverse of MIC in mg/ml indicating the volume to which 1 mg of extract can be diluted and still inhibit the growth of the fungus). P. Masoko et al. / Journal of Ethnopharmacology 99 (2005) 301–308 307

Fig. 5. The sensitivity of different fungal pathogens to different acetone (), hexane (), dichloromethane , and methanol extracts of six Terminalia (Antifungal activity expressed as inverse of MIC in mg/ml). activity against Microsporum canis followed by Sporothrix species had values as high as 6.05 l/g. We intend to follow schenckii, especially after 24 h. Cryptococcus neoformans the in vitro experiments up with in vivo work. and Candida albicans were also reasonably sensitive, but An important question is, whether the same compound Aspergillus fumigatus was relatively resistant. inhibits different fungi and also whether the same compound All of the six tested Terminalia species (Fig. 4) had an- is present in different Terminalia species. We hope to address tifungal properties against the tested organisms. The values these aspects by bioautography, but there are still difficulties are expressed as the reciprocal of MIC, which means that in the bioautography using fungi as test organisms. 1 mg of the acetone extract diluted to 50 ml would still inhibit The results of the present work indicate that the Termina- the growth of Microsporum canis. Microsporum canis and lia species assayed possess substantial antifungal properties. Sporothrix schenckii were highly sensitive and Aspergillus This explains the use of these plants in folk medicine for the fumigatus was less sensitive (Fig. 5). The acetone extract of treatment of various diseases related to fungal infections. We Terminalia mollis was the only extract which was not ac- have started isolating the active compounds responsible for tive against Aspergillus fumigatus after 24 h at the highest the antifungal effects from Terminalia sericea. level tested. After 48-h incubation, there were changes in As- pergillus fumigatus wells; all showed fungal growth, even at the highest extract concentrations. Aspergillus fumigatus Acknowledgement is a filamentous fungus and has hyphae which grows over surfaces and inside nearly all wells. Although there was inhi- The National Research Foundation (NRF) and the Re- bition of the Aspergillus fumigatus after 24 h of incubation, search Committee, Faculty of Veterinary Science, University this inhibition was overcome by 48 h of incubation. The active of Pretoria provided financial assistance. antifungal compounds may have broken down allowing the inhibited fungus to grow, or the fungus was able to overcome the initial inhibitory effects of the antifungal compounds, and References that the minimal lethal concentration was higher than highest level tested (final concentration 2.5 mg/ml). Baba-Moussa, F., Akpagana, K., Bouchet, P., 1998. Antifungal activities of seven West African Combretaceae used in traditional medicine. Journal of Ethnopharmacology 66, 335–338. Balick, M.J., Arvigo, R., Romero, L., 1994. The development of an en- 4. Conclusion thnobiomedical forest reserve in Belixe: its role in the preservation of biological and cultural diversity. Conservation Biology 8, 316–317. The serial dilution microplate method worked well with Bhatt, S.K., Saxena, V.K., 1979. Efficacy of successive extracts of seeds of fungi after slight modifications. The antifungal activity of Anogeissus leiocarpus against some human pathogenic fungi. Indian drugs 16, 263–264. some of the extracts were at levels that would probably al- Carr, J.D., 1988. Combretaceae in southern Africa. Tree Society of south- ready therapeutically useful, leading to the distinct possibility ern Africa, Johannesburg. that some of the extracts may be applied clinically for der- Cowan, M.M., 1999. Plant products as antimicrobial agents. Clinical Mi- matophyte infections, e.g., Microsporum canis. If one extrap- crobiology Reviews 12, 564–582. olates from in vitro to in vivo activity, especially in topical Deby, C., Margotteaux, G., 1970. Relationship between essential fatty acids and tissue antioxidant levels in mice. C R Seances Society applications, it means that an acetone leaf extract from 1 g Biology Fil. 165, 2675–2681. of Terminalia sericea leaves diluted to 2.7 l would still in- Eloff J.N., 1998a. Conservation of Medicinal Plants: Selecting Medicinal hibit the growth of Microsporum canis. Extracts from other Plants for Research and Gene Banking. Monographs in systematic 308 P. Masoko et al. / Journal of Ethnopharmacology 99 (2005) 301–308

botany from the Missouri Garden 71, 209–222 In: Conservation of Hutchings, A., Scott, A.H., Lewis, G., Cunninghan, A., 1996. Zulu Medic- plants Genes III: Conservation, utilisation of African plants., Robert, inal Plants, An Inventory. University of Natal Press, Pietermarizburg, P., Adams, Janice, E., Adams, eds., Missouri Botanical Garden Press, South Africa. St. Louis, USA. Kotze, M., Eloff, J.N., 2002. Extraction of antibacterial compounds from Eloff, J.N., 1998b. Which extractant should be used for the screening Combretum microphyllum (Combretaceae). South African Journal of and isolation of antimicrobial components from plants? Journal of Botany 68, 62–67. Ethnopharmacology 60, 1–8. Locher, C.P., Burch, M.T., Mower, H.F., Berestecky, J., Davis, H., van Eloff, J.N., 1998c. A sensitive and quick microplate method to determine Poel, B., Lasure, A., Vanden Berghe, D.A., Vlietinck, A.J., 1995. Anti- the minimal inhibitory concentration of plants extracts for bacteria. microbial activity and anti-complement activity of extracts obtained Planta Medica 64, 711–713. from selected Hawaiian medicinal plants. Journal of Ethnopharmacol- Eloff, J.N., 1999. The antibacterial activity of 27 sourthern African mem- ogy 49, 23–32. bers of the Combretaceae. South African Journal of Science 95, McGaw, L.J., Rabe, T., Sparg, S.G., Jager,¨ A.K., Eloff, J.N., van Staden, 148–152. J., 2001. An investigation of the biological activity of Combretum Farnsworth, N.R., 1988. Screening plants for new medicines. In: Wilson, species. Journal of Ethnopharmacology 75, 45–50. E.O. (Ed.), Biodiversity. National Academic Press, Washington, DC, Mitscher, L.A., Drake, S., Goliapudi, S.R., Okwute, S.K., 1987. A mod- pp. 83–97. ern look at folkloric use of anti-infective agents. Journal of Natural Farnsworth N.R., 1994. The ethnobotanical approach to drug discovery: Products 50, 1025–1040. strengths and limitations. In: Prance G.T. (Ed), Ethnobotany and the Motsei, M.L., Lindsey, K.L., van Staden, J., Jager, A.K., 2003. Screen- search for new drugs. In: Ciba Foundation Symposium, 185. Chich- ing of traditionally used South African plants for antifungal activity erster, 42–59. against Candida albicans. Journal of Ethnopharmacology 86, 235–241. Fyhrquist, P., Mwasumbi, L., Haeggstrom, C.A., Vuorela, H., Hiltunen, Silva, O., Duarte, A., Cabrita, J., Pimentel, M., Diniz, A., Gomes, E., R., Vuorela, P., 2002. Ethnobotanical and antimicrobial investi- 1996. Antimicribial activity of Guinea-Bissau traditional remedies. gation of some species of Terminalia and Combretum (Combre- Journal of Ethnopharmacology 50, 55–59. taceae) growing in Tanzania. Journal of Ethnopharmacology 79, 169– Van Wyk, B.-E., van Oudtshoorn, B., Gericke, N., 1997. Medicinal plants 177. of South Africa. Briza Publications, Pretoria, South Africa. Journal of Ethnopharmacology 99 (2005) 309–312

Short communication Antibacterial screening of some Peruvian medicinal plants used in Caller´ıa District

P. Kloucek a, Z. Polesny a, B. Svobodova b, E. Vlkova c, L. Kokoska a,∗

a Department of Crop Sciences and Agroforestry, Institute of Tropics and Subtropics, Czech University of Agriculture Prague, Kamycka 129, 165 21 Prague 6-Suchdol, Czech Republic b Department of Biochemistry, Faculty of Science, Charles University in Prague, Albertov 6, Prague 128 43, Czech Republic c Department of Microbiology, Nutrition and Dietetics, Faculty of Agronomy, Czech University of Agriculture Prague, Kamycka 129, 165 21 Prague 6-Suchdol, Czech Republic Received 22 October 2004; received in revised form 22 December 2004; accepted 28 January 2005 Available online 8 April 2005

Abstract

Nine ethanol extracts of Brunfelsia grandiﬂora (Solanaceae), Caesalpinia spinosa (Caesalpiniaceae), Dracontium loretense (Araceae), Equisetum giganteum (Equisetaceae), Maytenus macrocarpa (Celastraceae), Phyllanthus amarus (Euphorbiaceae), Piper aduncum (Piper- aceae), Terminalia catappa (Combretaceae), and Uncaria tomentosa (Rubiaceae), medicinal plants traditionally used in Caller´ıa District for treating conditions likely to be associated with microorganisms, were screened for antimicrobial activity against nine bacterial strains using the broth microdilution method. Among the plants tested, Phyllanthus amarus and Terminalia catappa showed the most promising antibacterial properties, inhibiting all of the strains tested with minimum inhibitory concentrations (MICs) ranging from 0.25 to 16 mg/ml. The extract from aerial part of Piper aduncum was signiﬁcantly more active against Gram-positive (MICs ranging from 1 to 2 mg/ml) than against Gram-negative bacteria (MICs >16 mg/ml). © 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Antibacterial activity; Crude extracts; Peruvian medicinal plants; Phyllanthus amarus; Terminalia catappa

1. Introduction habitants, who still largely depend on natural resources, the important ethnomedicinal knowledge of this region survives. Caller´ıa District, part of the Coronel Portillo Province in Nevertheless, it should be verified and preserved by modern the Ucayali Department, lies in the lowlands of Peruvian scientific methods. Amazonia. Pucallpa, its administrative centre and also the The phytochemical research based on ethnopharmacolog- capital of the Ucayali Department, is situated on the banks ical informations is generally considered an effective ap- of the river Ucayali, a principal tributary of the Amazon. The proach in the discovery of new anti-infective agents from largest indigenous ethno-linguistic group living in this region higher plants. In Peru about 20,000 plant species or 8% is the Shipibo-Conibo group. The Ucayali department, for- of the total number of plants in the world can be found. merly very isolated from other parts of Peru, is now one of the Most of them are native or grow in the Peruvian Amazonia. fastest developing Peruvian regions, mainly due to extensive However, probably less than 1% has been studied for their logging. However, timber production together with shifting chemical composition and medicinal use (Desmarchelier agriculture has a devastating effect on natural ecosystems and and Schaus, 2000). In this study, we chose nine promis- can lead to high genetic erosion. Thanks to the indigenous in- ing medicinal plants used traditionally by local inhabi- tants of Caller´ıa District for treating conditions likely to ∗ Corresponding author. Tel.: +420 224382180; fax: +420 234381829. be associated with microorganisms, and evaluated them for E-mail address: [email protected] (L. Kokoska). potential antibacterial activity, in order to confirm their

Table 1 Ethnobotanical data on medicinal plants Species (family) and voucher Common name Part tested Ethnomedicinal uses specimen number Brunfelsia grandiflora D. Don Chirisanango Roots Diuretic, febrifuge, antirheumatic, antisyphilitic, against yellow fever (Solanaceae) POL 0001 (Schultes and Raffauaf, 1990; Plowman, 1977; Desmarchelier and Schaus, 2000) Caesalpinia spinosa (Molina) Kuntze Tara Pods Eyewash (Duke and Reed, 1981) (Caesalpiniaceae) POL 0002 Dracontium loretense K. Krause Sacha jergon´ Tubers Treatment of snakebites (Desmarchelier and Schaus, 2000), (Araceae) POL 0003 antidiarrheic (Schultes and Raffauaf, 1990) Equisetum giganteum L. Cola de caballo Aerial part Astringent, antidiarrheic, diuretic, emmenagogue, wound healing (Equisetaceae) POL 0004 (Desmarchelier and Schaus, 2000) Maytenus macrocarpa Briq. Chuchuhuasi Bark Anti-inflammatory, antirheumatic, tonic, aphrodisiac (Desmarchelier (Celastraceae) POL 0005 and Schaus, 2000) Phyllanthus amaraus Schum. et Chanca piedra Aerial part Diuretic, sedative, astringent, tonic, antidiabetic, antihemorrhagic, Thonn. (Euphorbiaceae) POL 0007 against jaundice and kidney diseases (Schultes and Raffauaf, 1990; Desmarchelier and Schaus, 2000) Piper aduncum L. (Piperaceae) POL Matico Aerial part Antiseptic, antidiarrheic, tonic, astringent, antirheumatic, styptic 0006 (Schultes and Raffauaf, 1990; Desmarchelier and Schaus, 2000) Terminalia catappa L. Almendra Leaves Treatment of bilious fevers and dysentery (Schultes and Raffauaf, 1990) (Combretaceae) POL 0008 Uncaria tomentosa DC. (Rubiaceae) Una˜ de gato Bark Anti-inflammatory, antidiabetic, anticancer (Desmarchelier and POL 0009 Schaus, 2000)

popular use and to detect new sources of antibacterial (Oxoid, UK). Other microorganisms were grown and tested agents. in Mueller–Hinton broth. All microbial strains and cultivation media were purchased from Oxoid (UK). Ciprofloxacin (Sigma, USA) was 2. Materials and methods checked as positive control (Table 2). 2.1. Plant material and extract preparation 2.3. Antibacterial assay After consultations with village elders and herbalists and comparing their information with literature, we chose nine In vitro antimicrobial activity was determined by the broth plants that offered good prospects (Table 1). Samples for this microdilution method (Jorgensen et al., 1999) using 96-well study were obtained from marketplace vendors and herbalists microtitre plates. Two-fold dilutions (six) of each extract were in Pucallpa, and authenticated by Z. Polesny. Voucher speci- carried out, starting from a concentration of 16 mg/ml. Each ␮ mens are deposited at the Institute of Tropics and Subtropics, well was inoculated with 5 l of bacterial suspension at a 7 ◦ Czech University of Agriculture Prague. density of 10 CFU/ml and incubated at 37 C for 24 h. The Air dried plant material (15 g of each species) was finely growth of microorganisms was observed as turbidity deter- ␧ ground and macerated at room temperature in 80% ethanol mined by the UV–vis spectrometer Helios (Spectronic Uni- for 5 days. The extract was subsequently filtered and concen- cam, UK) at 600 nm. The MIC was determined as the lowest trated in vacuo at 40 ◦C. The residue was dissolved in 10% dilution which completely prevented microbial growth. The (v/v) solution of dimethylsulfoxide (DMSO) in Tris buffer solution of DMSO (5%, v/v) in TBS served as the negative saline (TBS) of pH 7.6 (Sigma, USA) to create a concentra- control. All samples were tested in triplicate. tion of 32 mg/ml of stock solution.

2.2. Microorganisms 3. Results

The following strains of bacteria were used: Bacillus Table 1 shows the botanical name, local name, voucher cereus ATCC 11778, Bacillus subtilis ATCC 6633, Bac- specimen number, plant part investigated and popular uses teroides fragilis ATCC 25285, Enterococcus faecalis ATCC of the selected plant species. Table 2 gives a summary of the 29212, Escherichia coli ATCC 25922, Pseudomonas aerug- investigated species, the percentage yield and the obtained inosa ATCC 27853, Staphylococcus aureus ATCC 25923, MIC values. With exception of Maytenus macrocarpa, all Staphylococcus epidermidis ATCC 12228, and Streptococ- plants tested possessed antibacterial activity against at least cus pyogenes ATCC 19615. four bacterial strains (Bacillus cereus, Enterococcus faecalis, Streptococci were grown and tested in brain–heart infu- and both staphylococci) at the concentrations of 16 mg/ml or sion broth, Bacteroides fragilit in Wilkins-Chalgren anaerobe below. Extracts from aerial part of Phyllanthus amarus and broth under anaerobic conditions using Anaerobic Jar HP11 from leaves of Terminalia catappa showed the broadest spec- P. Klouceket al. / Journal of Ethnopharmacology 99 (2005) 309–312 311

Table 2 Minimum inhibitory concentrations (mg/ml) of ethanol extracts of nine Peruvian medicinal plants Species, reference compound Extract yield (%) Gram-positive Gram-negative

B.c. B.s. E.f. S.a. S.e. S.p. B.f. E.c. P.a. Brunfelsia grandiflora 13.53 4 16 8 4 4 NA 16 NA 16 Caesalpinia spinosa 48.67 8 16 0.5 16 16 – 16 NA NA Dracontium loretense 7.87 8NA8 8 16NANANANA Equisetum giganteum 7.33 8 16 8 8 16 4 8 NA NA Maytenus macrocarpa 11.93 NA NA NA NA NA – NA NA NA Piper aduncum 6.07 1 1 2 1 2 2 NA NA NA Phyllanthus amarus 13.13 16 1 0.25 4 1 4 4 16 8 Terminalia catappa 14.53 2 4 8 1 0.25 16 16 8 4 Uncaria tomentosa 6.67 1 1 0.25 1 1 NA NA 8 NA CIP (␮g/ml)a 1210.51 1 2 0.015 0.25 –: Not performed; NA: not active (>16). B.c., Bacillus cereus; B.s., Bacillus subtilis; B.f., Bacteroides fragilis; E.f., Enterococcus faecalis; E.c., Escherichia coli; P.a., Pseudomonas aeruginosa; S.a., Staphylococcus aureus; S.e., Staphylococcus epidermidis; S.p., Streptococcus pyogenes. a CIP, ciprofloxacin. trum of action against bacteria, inhibiting all of the strains Klebsiella pneumonia, Pseudomonas aeruginosa, Proteus tested with minimum inhibitory concentrations (MICs) rang- mirabilis, Salmonella paratyphi and Staphylococcus aureus ing from 0.25 to 16 mg/ml. The strongest activity (MIC (Srinivasan et al., 2001). Among compounds isolated from 0.25 mg/ml) was shown by Phyllanthus amarus and Uncaria Phyllanthus amarus, tannins corilagin, geraniin and gallic tomentosa against Enterococcus faecalis, and Terminalia cat- acid (Foo, 1993) showed in vitro activity against Bacillus sub- appa against Staphylococcus epidermidis. The extract from tilis, Staphylococcus aureus and Escherichia coli (Adesina et aerial part of Piper aduncum was significantly more active al., 2000; Gohar et al., 2003). against Gram-positive (MICs ranging from 1 to 2 mg/ml) than Antimicrobial properties of Piper aduncum have been against Gram-negative bacteria (MICs >16 mg/ml). Good ac- reported (Lentz et al., 1998; Lemos et al., 2000). Ben- tivity was observed also in the Uncaria tomentosa extract, zoic acid and benzene derivates, dihydrochalcones and which inhibited six bacteria and five of them with MICs from chromenes isolated from its leaves were active against a 0.25 to 1 mg/ml. Other extracts showed only slight inhibition variety of microorganisms including Bacillus subtilis, Es- of tested microorganisms. cherichia coli, Staphylococcus aureus, Cryptococcus neofor- Of the bacteria tested, Escherichia coli provedtobethe mans, Mycobacteria intracellulare, Micrococcus luteus and most difficult to inhibit with only slight susceptibility to Pseudomonas aeruginosa (Nair and Burke, 1990; Orjala et the Phyllanthus amarus, Terminalia catappa and Uncaria al., 1993; Orjala et al., 1994; Okunade et al., 1997). The chem- tomentosa extracts (MICs ranging from 8 to 16 mg/ml). ical composition of essential oil and its antibacterial proper- Gram-negative bacteria were generally less susceptible than ties have also been described (Tirillini et al., 1996; Maia et Gram-positive. The most sensitive bacterium was Enterococ- al., 1998; Pino et al., 2004). cus faecalis, which was inhibited by all tested species ex- High antifungal but no antibacterial activity of methanol cept Maytenus macrocarpa with MICs ranging from 0.25 to and methylene chloride extracts from Terminalia catappa 8 mg/ml. aerial part (Goun et al., 2003) has been reported. On the No growth inhibition was observed in the negative control. other hand different authors (Pawar and Pal, 2002) investigated roots of Terminalia catappa and detected good antimicrobial activity of chloroform and methanol extracts against 4. Discussion and conclusions Escherichia coli and Staphylococcus aureus, which supports our results. The phytochemical studies on Terminalia cat- The use of these plants in Peruvian Amazon folk medici- appa bark and leaves demonstrate the presence of tannins and nal remedies for treating various health problems has already flavonoid glycosides (Lin and Hsu, 1999; Lin et al., 2000). been reported (Schultes and Raffauaf, 1990; Desmarchelier Among them, gallic acid, corilagin, ellagic acid and rutin and Schaus, 2000); with the most frequent medicinal uses showed in vitro antibacterial activity (Adesina et al., 2000; of the investigated plants being antirheumatic, antidiarrheic, Basile et al., 2000; Thiem and Goslinska, 2004). astringent, diuretic and tonic (3 plants), antidiabetic and an- No previous reports on the antibacterial activity of the tiinflammatory (2 plants). However, apart from Phyllanthus other species could be found in literature. Flavonol glyco- amarus, Piper aduncum and Terminalia catappa, no scien- sides were isolated from aerial parts of Brunfelsia grandi- tific information concerning the antibacterial properties of flora (Brunner et al., 2000) and some of these structures are these plants has been reported. known to be responsible for antibacterial activity of higher Crude extract of Phyllanthus amarus collected in In- plants (Yadava and Reddy, 1998; Cui et al., 2003). Pods of dia possessed antibacterial activity against Bacillus subtilis, Caesalpinia spinosa contain up to 25% of gallic acid (Galvez 312 P. Klouceket al. / Journal of Ethnopharmacology 99 (2005) 309–312 et al., 1997) and previously this tannin isolated from Acalypha Goun, E., Cunningham, G., Chu, D., Nguyen, C., Miles, D., 2003. An- wilkesiana, Acalypha hispida and Rubus ulmifolius showed tibacterial and antifungal activity of Indonesian ethnomedical plants. in vitro antimicrobial activity when tested against B. cereus, Fitoterapia 74, 592–596. Jorgensen, J.H., Turnidge, J.D., Washington, J.A., 1999. Antibacterial sus- Staphylococcus aureus, and Escherichia coli (Adesina et al., ceptibility tests: dilution and disk diffusion methods. In: Murray, P.R., 2000; Panizzi et al., 2002). Among the classes of compounds Baron, E.J., Pfaller, M.A., Tenover, F.C., Yolken, R.H. (Eds.), Manual identified in Uncaria tomentosa (Montoro et al., 2004), an- of Clinical Microbiology, 7th ed. ASM Press, Washington, DC, pp. tibacterial activity is attributed to some triterpenes (Akbar 1526–1543. and Malik, 2002). Lemos, G.C.S., Oliveira, L.O., Eberli, B.B., Motta, O.V., Folly, M.M., 2000. Bactericidal activity of macela (Achyrocline satureioides (Lam.) From nine plants, eight showed antimicrobial properties DC.) and jaborandi-falso (Piper aduncum L.) against strains of Staphy- (89%), which confirm their popular use and justify the eth- lococcus aureus isolated from subclinical bovine mastitis. Revista nobotanical approach in the search for novel biologically ac- Brasileira de Plantas Medicinais 3, 67–72. tive compounds. For five of them this is the first report of Lentz, D.L., Clark, A.M., Hufford, C.D., Meurer-Grimes, B., Passreiter, such activity. Among the medicinal plants tested in this work, C.M., Cordero, J., Ibrahimi, O., Okunade, A.L., 1998. Antimicrobial properties of Honduran medicinal plants. Journal of Ethnopharmacol- Phyllanthus amarus and Terminaliacatappa showed the most ogy 63, 253–263. promising antibacterial properties, indicating the potential for Lin, T.C., Hsu, F.L., 1999. Tannin and related compounds from Terminalia discovery of antibacterial principles. We assume that some catappa and Terminalia parviflora. Journal of the Chinese Chemical of the previously isolated compounds could be present in Society 46, 613–618. the extracts investigated and could partially contribute to an- Lin, Y.L., Kuo, Y.H., Shiao, M.S., Chen, C.C., Ou, J.C., 2000. Flavonoid glycosides from Terminalia catappa L. Journal of the Chinese Chem- timicrobial activity reported in this study. However, further ical Society 47, 253–256. phytochemical studies are required to determine the types of Maia, J.G.S., Zohhbi, M.D.B., Andrade, E.H.A., Santos, A.S., da Silva, compounds responsible for the antibacterial effects of these M.H.L., Luz, A.I.R., Bastos, C.N., 1998. Constituents of the essential species. oil of Piper aduncum L. growing wild in the Amazon region. Flavour and Fragrance Journal 13, 269–272. Montoro, P., Carbone, V., Quiroz, J.D., De Simone, F., Pizza, C., 2004. Identification and quantification of components in extracts of Uncaria Acknowledgements tomentosa by HPLC-ES/MS. Phytochemical Analysis 15, 55–64. Nair, M.G., Burke, B.A., 1990. Antimicrobial Piper metabolite and re- This work was supported by projects 80/03-06/MZe/B and lated compounds. Journal of Agricultural and Food Chemistry 38, GACR 523/03/H076. 1093–1096. Okunade, A.L., Hufford, C.D., Clark, A.M., Lentz, D., 1997. Antimicro- bial properties of the constituents of Piper aduncum. Phytotherapy Research 11, 142–144. References Orjala, J., Erdelmeier, C.A.J., Wright, A.D., Rali, T., Sticher, O., 1993. 5 new prenylated p-hydroxybenzoic acid-derivatives with antimicrobial Adesina, S.K., Idowu, O., Ogundaini, A.O., Oladimeji, H., Olugbade, and molluscicidal activity from Piper aduncum leaves. Planta Medica T.A., Onawunmi, G.O., Pais, M., 2000. Antimicrobial constituents of 59, 546–551. the leaves of Acalypha wilkesiana and Acalypha hispida. Phytotherapy Orjala, J., Wright, A.D., Behrends, H., Folkers, G., Sticher, O., Ruegger, Research 14, 371–374. H., Rali, T., 1994. Cytotoxic and antibacterial dihydrochalcones from Akbar, E., Malik, A., 2002. Antimicrobial triterpenes from Debregeasia Piper Aduncum. Journal of Natural Products 57, 18–26. salicifolia. Natural Product Letters 16, 339–344. Panizzi, L., Caponi, C., Catalano, S., Cioni, P.L., Morelli, I., 2002. Basile, A., Sorbo, S., Giordano, S., Ricciardi, L., Ferrara, S., Montesano, In vitro antimicrobial activity of extracts and isolated constituents D., Cobianchi, R.C., Vuotto, M.L., Ferrara, L., 2000. Antibacterial and of Rubus ulmifolius. Journal of Ethnopharmacology 79, 165– allelopathic activity of extract from Castanea sativa leaves. Fitoterapia 168. 71, 110–116. Pawar, S.P., Pal, S.C., 2002. Antimicrobial activity of extracts of Termi- Brunner, G., Burger, U., Castioni, P., Kapetanidis, I., Christen, P., 2000. A nalia catappa root. Indian Journal of Medical Sciences 56, 276–278. novel acylated flavonol glycoside isolated from Brunfelsia grandiflora Pino, J.A., Marbot, R., Bello, A., Urquiola, A., 2004. Essential oils of ssp. grandiflora. Structure elucidation by gradient accelerated NMR Piper peltata (L.) Miq. and Piper aduncum L. from Cuba. Journal of spectroscopy at 14T. Phytochemical Analysis 11, 29–33. Essential Oil Research 16, 124–126. Cui, G.Y., Liu, J.Y., Tan, R.X., 2003. A new antimicrobial flavonol glyco- Plowman, T., 1977. Brunfelsia in ethnomedicine. Botanical museum side from Alchornea davidii. Chinese Chemical Letters 14, 179–180. leaflets 25, 289–320. Desmarchelier, C., Schaus, F.W., 2000. Sixty medicinal plants from the Schultes, R.E., Raffauaf, R.F., 1990. The healing forest. Dioscorides press, Peruvian Amazon, 1st ed. Lima, Peru, pp. 81–243 (privately pub- Portland, USA, p. 484. lished). Srinivasan, D., Nathan, S., Suresh, T., Perumalsamy, P.L., 2001. Antimi- Duke, J.A., Reed, C.F., 1981. Caesalpinia spinosa (Mol.) Ktz. In: Duke, crobial activity of certain Indian medicinal plants used in folkloric J.A. (Ed.), Handbook of Legumes of World Economic Importance. medicine. Journal of Ethnopharmacology 74, 217–220. Plenum Press, New York, USA, pp. 32–33. Thiem, B., Goslinska, O., 2004. Antimicrobial activity of Rubus chamae- Foo, L.Y., 1993. Amariin, a di-dehydrohexahydroxydiphenoyl hydrolyz- morus leaves. Fitoterapia 75, 93–95. able tannin from Phyllanthus amarus. Phytochemistry 33, 487–491. Tirillini, B., Velasquez, E.R., Pellegrino, R., 1996. Chemical composi- Galvez, J.M.G., Riedl, B., Conner, A.H., 1997. Analytical studies on tara tion and antimicrobial activity of essential oil of Piper angustifolium. tannins. Holzforschung 51, 235–243. Planta Medica 62, 372–373. Gohar, A.A., Lahloub, M.F., Niwa, M., 2003. Antibacterial polyphe- Yadava, R.N., Reddy, K.I.S., 1998. A new big-active flavonol glycoside nol from Erodium glaucophyllum. Zeitschrift fur Naturforschung 58, from the stems of Butea superba Roxb. Journal of Asian Natural 670–674. Products Research 1, 139–145.