bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 2

3

4

5 6

7

8

9 The p97-UBXN1 complex regulates aggresome formation 10 11 Sirisha Mukkavalli1, Jacob Aaron Klickstein1, Betty Ortiz2, Peter Juo2 and Malavika Raman1#

12

13 1, 2 Department of Developmental Molecular and Chemical Biology

14 Tufts University School of Medicine

15 Boston MA 02111

16

17 # Address correspondence to Malavika Raman, [email protected]

18

19 Short title: p97 complexes and aggresome formation

20

21

1 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

22 Abstract

23 The recognition and disposal of misfolded proteins are essential for the maintenance of cellular

24 homeostasis. Perturbations in the pathways that promote degradation of aberrant proteins contribute to a

25 variety of protein aggregation disorders broadly termed proteinopathies. It is presently unclear how diverse

26 disease-relevant aggregates are recognized and processed for degradation. The p97 AAA-ATPase in

27 combination with a host of adaptor proteins functions to identify ubiquitylated proteins and target them for

28 degradation by the ubiquitin-proteasome system or through autophagy. Mutations in p97 cause multi-system

29 proteinopathies; however, the precise defects underlying these disorders are unclear given the large number of

30 pathways that rely on p97 function. Here, we systematically investigate the role of p97 and its adaptors in the

31 process of formation of aggresomes which are membrane-less structures containing ubiquitylated proteins that

32 arise upon proteasome inhibition. We demonstrate that p97 mediates both aggresome formation and clearance

33 in proteasome-inhibited cells. We identify a novel and specific role for the p97 adaptor UBXN1 in the process

34 of aggresome formation. UBXN1 is recruited to ubiquitin-positive aggresomes and UBXN1 knockout cells are

35 unable to form a single aggresome, and instead display dispersed ubiquitin aggregates. Furthermore, loss of

36 p97-UBXN1 results in the increase in Huntingtin polyQ aggregates both in mammalian cells as well as in a

37 C.elegans model of Huntington’s Disease. Together our work identifies evolutionarily conserved roles for p97

38 and its adaptor UBXN1 in the disposal of protein aggregates.

2 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

39 Introduction

40 The process of protein translation, folding, and targeting to subcellular compartments is intrinsically

41 error-prone and is therefore continuously and closely monitored by various quality control mechanisms1-4.

42 Proper folding and sorting of proteins can be affected by transcription and translation errors, as well as thermal

43 stress or pH fluctuations. As a result, an estimated 30% of newly synthesized proteins are misfolded4,5. Such

44 proteins are engaged by chaperone systems to rescue functionality; however, should this approach fail, these

45 proteins are rapidly and efficiently cleared by the ubiquitin-proteasome system (UPS) and autophagy3. These

46 protein quality control mechanisms ensure that protein aggregates do not accumulate in normal cells. However

47 aberrant accumulation of protein aggregates that are frequently ubiquitylated is a hallmark of several human

48 disorders such as amyloidosis, diabetes, and neurodegeneration, suggesting that failure of these systems to

49 prevent or clear the protein aggregates may have deleterious consequences6,7.

50 A variety of cellular stressors, such as proteasome impairment as examined in this study, result in a

51 substantial increase and aggregation of misfolded, ubiquitylated proteins. These small protein aggregates are

52 dynamically recruited to a structure known as the aggresome8-10. Aggresomes are membrane-less, juxta-

53 nuclear structures encased in intermediate filament vimentin cages. In the prevailing model, ubiquitylated

54 proteins are recognized by histone deacetylase 6 (HDAC6) and delivered by retrograde transport via the

55 dynein motor to the microtubule organizing center11. Aggresomes are not mere storage sites for protein

56 aggregates, but actively recruit chaperones, E3 ligases such as tripartite motif-containing 50 (TRIM50), the

57 26S proteasome, autophagy receptors such as p62 and neighbor of BRCA1 gene 1 (NBR1), and lysosomes to

58 rescue functional, or degrade non-functional proteins10,12,13. Thus, aggresomes are generally believed to be

59 cytoprotective structures that contribute to cell survival by sequestering misfolded, aggregation-prone proteins,

60 and alleviating proteotoxic stress14. However, their long-term persistence is detrimental to cell viability.

61 Numerous studies have reported the recruitment of the p97 AAA-ATPase to aggresomes and other

62 disease-causing protein aggregates11,15-18. p97 is a ubiquitin-selective unfoldase, that processes proteins for

63 degradation by the 26S proteasome19,20. The functionality of p97 is best understood in its role in ER-

64 associated degradation (ERAD), wherein misfolded proteins in the ER lumen are retro-translocated by p97 in

3 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

65 an ATP-dependent manner to facilitate proteasomal degradation21. p97 is now appreciated to regulate

66 extraction of ubiquitylated proteins from chromatin, ribosome-associated quality control, the cell cycle and to

67 contribute to the selective autophagy of organelles such as mitochondria19,22,23. Numerous dedicated p97

68 adaptor proteins mediate specificity in p97 recognition of ubiquitylated substrates. The largest family of

69 adaptors contains 13 members with conserved ubiquitin-X domains (UBXD) that bind to the N-terminus of

70 p9724. Other adaptors include hetero-dimeric ubiquitin fusion degradation 1 (UFD1) and nuclear protein

71 localization 4 (NPL4), as well as proteins that associate with the C-terminus of p97 via short linear motifs.

72 Apart from a handful of adaptors including the UFD1-NPL4 dimer that has well-defined roles in ERAD, many

73 adaptors remain largely unstudied and their specific roles in p97-regulated processes remain to be elucidated.

74 Mutations in p97 have been identified in individuals with a variety of aggregation-based disorders

75 collectively termed multi-system proteinopathies (MSP). These include Amyotrophic Lateral Sclerosis (ALS),

76 Inclusion Body Myopathy (IBM), Paget’s Disease (PD) and Frontotemporal Dementia (FTD), among others 25-

77 27. Approximately 20 of the 50 disease-associated mutations that have been identified to date span the N-

78 terminus, linker, and first ATPase domain. This region is utilized for interaction with UBXD adaptors, and some

79 reports suggest that these mutations impact the balance of UBXD adaptors associated with p97 and may

80 underlie disease phenotypes28,29. Disease-relevant mutations in p97 impact virtually all known p97 functions,

81 making it difficult to identify a single pathway impacted in disease. However, one striking feature common to

82 these disorders is the accumulation and persistence of ubiquitin-positive insoluble aggregates in patient tissue.

83 Previous studies investigating the relationship between p97 and aggresomes reached conflicting

84 conclusions with some studies supporting a role for p97 in aggresome formation18,30, while others suggesting a

85 role in clearance17,31. Furthermore, the role of p97-associated adaptors has not been examined. Understanding

86 the role of specific p97 complexes and the mechanisms by which they recognize, sequester and clear

87 aggregates may spur the development of agents that mitigate aggregation-based disorders. We sought to

88 address the role of p97 and the UBXD family of adaptors in the formation and subsequent clearance of

89 aggresomes. We find that in cells with impaired proteasomal function, p97 is required for both the formation

90 and clearance of ubiquitylated substrates at aggresomes. Importantly, we provide evidence that the p97 UBXD

4 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

91 adaptor UBXN1 is uniquely required for the formation of aggresomes. The failure to form and clear

92 aggresomes via p97 complexes negatively impacts cell viability. We extend these results to demonstrate that

93 loss of the p97-UBXN1 complex results in an increase in aggregates caused by CAG (glutamine, Q)

94 expansions (polyQ) in the Huntingtin gene both in mammalian cells as well as in a C. elegans model of

95 Huntington’s Disease (HD).

96 Our studies have identified an evolutionarily conserved p97-dependent pathway that regulates the

97 identification and disposal of ubiquitylated, misfolded aggregates.

98

99 Results

100 p97 is required for aggresome formation and clearance

101 It has been previously reported that p97 co-localizes with ubiquitin-positive aggresomes as well as

102 aggregates caused by over-expression of disease-causing mutant proteins. However, whether p97 escorts

103 ubiquitylated substrates to aggresomes or aids in disassembly and clearance of protein aggregates is

104 presently unclear17,18,30,31. We treated cells with the proteasome inhibitor Bortezomib (Btz) in a time-course

105 study and visualized aggregates by staining for ubiquitin. We observe aggresomes forming in the perinuclear

106 region as early as 8 hours and by 18 hours a single large aggresome is apparent (Supplementary Figure 1A

107 and B). We use 18 hours of Btz treatment in all following studies except in instances where we co-treated cells

108 with the p97 inhibitor CB-5083 (Figure 1). In these experiments, aggresome formation was visualized at 8

109 hours as incubation with both Btz and CB-5083 for 18 hours resulted in significant cell death. Consistent with

110 previous studies, we find that p97 is recruited to a ubiquitin-positive, perinuclear aggresome (Figure 1A). We

111 also observe ubiquitin staining in nuclear structures resembling the nucleolus (Supplementary Figure 1A, 18

112 hrs). Although previous studies have reported the redistribution of ubiquitylated proteins to the nucleolus upon

113 proteasome impairment the significance of this observation is presently unclear32 and nuclear aggregates were

114 not included in our analysis. To measure cellular aggregates, their area, and spatial distribution, we developed

115 a facile ImageJ macro called AggreCount that allows for rapid and unbiased image analysis33. AggreCount

5 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

116 reports several metrics: (i) total number of cellular aggregates, (ii) percent cells with aggregates, (iii)

117 aggregates per cell, (iv) area of aggregates, and (v) localization of aggregates (cytosol, perinuclear or nuclear).

118 Aggresomes are identified based on (1) perinuclear localization, and (2) a minimum area cut-off that was

119 empirically determined as the mean perinuclear aggregate area in Btz treated cells for the 8 or 18 hour time

120 point (Supplementary Figure 1B). To investigate the role of p97 in aggresome formation we used a two-

121 pronged approach, utilizing shRNA-mediated depletion of p97, as well as acute inhibition with CB-5083, an

122 ATP-competitive p97 specific inhibitor. We created stable, doxycycline-inducible shRNA HeLa Flp-in TRex cell

123 lines that allowed us to achieve transient, partial depletion of p97 without overtly impacting cell viability

124 (Supplementary Figure 1C). Two independent sh-p97 cell lines were treated with doxycycline (to deplete p97)

125 and Btz to promote aggresome formation, followed by release into drug-free media for a further 24 hours to

126 monitor clearance. We imaged ubiquitin-positive aggregates by immunofluorescence and analyzed aggregates

127 using AggreCount (Supplementary Figure 1D and E). We find that long-term p97 depletion results in an

128 increase in the percentage of cells with aggresomes and that the aggresomes were larger (mean perinuclear

129 aggregate area: 6.78 +/- 0.85 µm2), when compared to wild-type cells (mean perinuclear aggregate area: 4.2

130 +/- 0.15 µm2 ) (Supplementary Figure 1D and E). Notably, while wildtype cells cleared aggresomes upon

131 removal of Btz, ubiquitin-positive aggresomes and aggregates persisted in a significant fraction of p97-

132 depleted cells (Supplementary Figure 1D and E). In the second approach, we acutely inhibited p97 using CB-

133 5083 concurrently with proteasome inhibition (for 8 hours) to determine the impact on aggresome formation

134 and clearance (Figure 1B-G). Surprisingly, concurrent CB-5083 treatment with Btz resulted in a decrease in the

135 number of cells with aggresomes compared to Btz treatment alone even though the percentage of cells with

136 aggregates was comparable between the two samples (Figure 1B-E). We then visualized clearance of

137 aggresomes in the presence of CB-5083 (1 µM of CB-5083 was the highest tolerated dose in release

138 experiments due to significant cell death at higher concentrations of the drug) and found an increase in the

139 persistence of ubiquitin conjugates (Figure 1B, compare lane 5 and 6). This was confirmed in imaging studies

140 where we find an increase in aggregates and to a lesser extent aggresomes, relative to untreated cells (Figure

6 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

141 1C, F and G). We conclude that long-term depletion of p97 (~72 hours in shRNA-based studies) results in the

142 accumulation of various p97 substrates that are recruited to aggresomes increasing the size and percentage of

143 aggresomes. However acute treatment (8 hours in CB-5083 studies) leads to direct inhibition of processes that

144 recruit ubiquitylated substrates to aggresomes. Our studies suggest that the duration of p97 inhibition or

145 depletion can have distinct outcomes that should be taken into account when designing studies to interfere

146 with p97 function.

147

148 The p97 adaptors UBXN1 and NPL4 are localized to aggresomes

149 Given the significant role of p97 in aggresome formation and clearance, we next investigated the role of

150 p97 adaptors in this process. We focused on the UBXD family, as these are the largest family of dedicated p97

151 adaptors, and many contain ubiquitin-associated domains (UBA) for associating with ubiquitin chains on

152 substrates. Notably, p97 mutations known to cause MSP, have been reported to alter UBXD adaptor

153 binding28,29. We also tested the involvement of the UFD1-NPL4 dimer as they participate in most known p97-

154 dependent processes. We first screened for UBXD adaptors that localized to the aggresome upon proteasome

155 inhibition using antibodies to endogenous proteins. Of the nine adaptors tested (seven UBXD proteins, UFD1

156 and NPL4), we found that UBXN1 was the only UBXD adaptor that robustly localized to the aggresome

157 (Mander’s co-efficient of localization: 0.9 +/- 0.087, Figure 2A, Supplementary Figure 1A, Supplementary

158 Figure 2A). Consistent with previous reports,34 we also observed recruitment of UFD1 and NPL4 to

159 aggresomes (Mander’s co-efficient of localization: UFD1: 0.842 +/- 0.065, NPL4: 0.870+/- 0.073, Figure 2B).

160 In contrast, the UBXD adaptor p47 was not present at aggresomes (Figure 2B). In time-course studies, we find

161 that UBXN1 is recruited as early as 6 hours post-Btz treatment to aggresome-like structures as soon as

162 ubiquitin staining is visible (Supplementary Figure 1A). We verified that UBXN1 structures were aggresomes

163 by staining with canonical aggresome markers such as Proteostat, HDAC6, and the 20S proteasome (Figure

164 2C). In agreement with the dependence of aggresome formation on the microtubule network, nocodazole

165 treatment caused the dispersal of aggresomes and numerous, UBXN1 and ubiquitin-positive foci were

166 observed instead (Figure 2D). UBXN1 localization to aggresomes was not limited to HeLa cells but was

7 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

167 observed in multiple cell types including the neuroblastoma cell line SH-SY5Y and the multiple myeloma cell

168 line MM1.S (Supplementary Figure 2B and C). We next asked if the localization of UBXN1 to ubiquitin-positive

169 aggregates was limited to those formed as a result of proteasome inhibition or if UBXN1 recognized a wider

170 array of protein aggregates induced by distinct mechanisms. We found UBXN1 does not co-localize with stress

171 granules formed as a result of sodium arsenite treatment (Figure 2E). Unexpectedly, we observe the

172 recruitment of another p97 adaptor, p47 to stress granules; the significance of this is presently under

173 investigation (Figure 2E). UBXN1 is not recruited to P-bodies that are sites of mRNA decay (Figure 2F).

174 However, UBXN1 colocalization was observed with aggresome-like induced structures (ALIS) that contain

175 defective ribosomal products that arise from treatment with translational poisons such as puromycin

176 (Supplementary Figure 2D)35. Consistent with previous reports, we find that aggresome formation and poly-

177 ubiquitin accumulation can be reversed by inhibiting protein translation with cycloheximide (Supplementary

178 Figure 2E and F)36. Taken together, we have identified UBXN1 as an aggresome-localized protein that likely

179 recognizes specific types of misfolded, ubiquitylated proteins.

180

181 UBXN1 is required for the formation of aggresomes

182 To determine the role of UBXN1 in aggresome formation, we used UBXN1 knock-out (KO) HeLa Flp-in

183 TRex cell lines created using CRISPR-Cas9 gene-editing that we published previously (Figure 3A)35. We

184 assessed aggresome formation in response to Btz treatment in two separate UBXN1 KO clonal lines. We find

185 that loss of UBXN1 results in the loss of a single perinuclear aggresome and an increase in aggregates

186 throughout the cytosol (Figure 3B and E, Supplementary Figure 3A). We additionally verified the UBXN1 KO

187 phenotype by transient depletion of UBXN1 with two separate siRNAs and similarly observed the loss of

188 aggresomes (Supplementary Figure 3B). Notably, there was no change in total ubiquitin conjugates between

189 wildtype and UBXN1 KO cells (Figure 3C). To rule out off-target effects, we introduced doxycycline-inducible

190 GFP-UBXN1 into the single FRT site in the UBXN1 KO cell line. Induction of GFP-UBXN1 reinstated

191 aggresome formation as well as GFP-UBXN1 localization to these structures in response to Btz treatment

192 (Figure 3A, D, and E). We examined the possibility of rapid onset and dissolution of aggresomes in KO cells

8 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

193 that were missed in our endpoint assay and performed time-course studies in the UBXN1 KO cells treated with

194 Btz. However, we were unable to observe aggresomes at all time points tested, ruling out temporal differences

195 in aggresome formation in UBXN1 KO cells (Figure 3F).

196 While we did not observe other UBXD adaptors recruited to the aggresome, we nevertheless asked if

197 other adaptors were required for the formation of aggresomes. We created a p47 KO cell line and a NPL4

198 knockdown cell line using CRISPR-Cas9 gene-editing in HeLa Flp-in TRex cells (Figure 4A). We used siRNA-

199 mediated depletion of p47 and NPL4 to confirm our findings and to additionally examine the roles of UFD1 and

200 FAF1 (Supplementary Figure 4A and B). In addition to UBXN1, both NPL4 and UFD1 (but not p47 or FAF1)

201 were required for aggresome formation (Figure 4A-C and Supplementary Figure 4A and B). These findings are

202 in agreement with prior studies that identified a role for the UFD1-NPL4 dimer in aggresome formation and are

203 not all together surprising given the importance of UFD1-NPL4 in p97 activity. To determine whether UBXN1

204 and UFD1-NPL4 functioned together on a single p97 hexamer or if they were part of exclusive p97 complexes

205 we performed two-step affinity purifications in cells transfected with FLAG-NPL4 and Myc-UBXN1. In the first

206 step, FLAG-NPL4 associated complexes were affinity purified via the FLAG epitope, and bound proteins were

207 eluted with FLAG peptide. Endogenous p97 in the eluate was purified with a p97 antibody and the presence of

208 Myc-UBXN1 was determined by immunoblotting. As seen in Figure 4D, UBXN1 was bound to the same p97

209 hexamer as NLP4 and the interaction was modestly stimulated by Btz treatment (lanes 7, 8, 11, and 12). We

210 next attempted the co-depletion of UBXN1 and UFD1-NPL4 to observe the effect on aggresome formation.

211 However, the co-depletion of UBXN1 and UFD1 or NPL4 in (by dual siRNA transfection) combination with Btz

212 resulted in cell death precluding further analysis. Collectively, our studies have uncovered a novel role for

213 UBXN1 in mediating aggresome formation.

214

215 p97 association is required for the role of UBXN1 in aggresome formation

216 Our results thus far suggest that p97 and its adaptors UBXN1 and UFD1-NPL4 are required for

217 aggresome formation. Since the UFD1-NPL4 dimer functions in many p97-dependent processes, we focus on

218 the role of UBXN1 in aggresome formation for the remainder of the study.

9 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

219 UBXN1 contains an N-terminal UBA domain that associates with ubiquitin and C-terminal ubiquitin-X

220 (UBX) domain that interacts with p97, separated by a coiled-coil region (Figure 5A). We asked whether the

221 association with ubiquitin and/ or p97 was required for aggresome formation. We mutated conserved residues

222 within the UBA domain (Met13 and Phe15 to Ala, UBAmut) that mediate association with the hydrophobic

223 isoleucine patch on ubiquitin or the UBX domain (Phe265Pro266Arg267 truncated to Ala-Gly, UBXmut) that

224 associates with the N-terminus of p97. GFP-tagged mutants were introduced into the FRT site within the

225 UBXN1 KO cell line and equal levels of induction of GFP-tagged proteins was determined by immunoblotting

226 (Figure 5A and B). We verified that the mutants were unable to bind ubiquitin or p97 using co-

227 immunoprecipitation assays in HEK293T cells expressing Myc-tagged UBXN1 constructs (wildtype, UBAmut or

228 UBXmut) and probing for endogenous ubiquitin or p97. As predicted, the UBXN1 UBAmut failed to bind ubiquitin

229 conjugates and UBXN1 UBXmut was deficient in p97 binding (Supplementary Figure 5A and B). We next

230 induced expression of GFP-UBXN1 wildtype, UBAmut, or UBXmut in UBXN1 KO cells and assessed aggresome

231 formation (based on perinuclear localization and size). Re-expression of wildtype UBXN1 rescued aggresome

232 formation as before. However, UBXmut expressing cells did not form aggresomes as well as the wildtype GFP-

233 UBXN1; in these cells, the ubiquitin-positive aggregates were dispersed and fewer aggresomes were formed

234 (Figure 5C-E). The UBXN1 UBAmut also had modest defects in aggresome formation but not to the extent

235 observed with the UBXmut (Figure 5C-E, Supplementary Figure 5C). Notably, when we measured the fraction of

236 cells that contained both cytosolic and perinuclear aggregates, it was comparable between wildtype and the

237 two mutants, indicating that the aggregate burden was similar in all cases, ruling out increased clearance in the

238 mutant expressing cells (Figure 5D). These results suggest that association of UBXN1 with p97 (and to a

239 lesser extent ubiquitin) is an important requirement in aggresome formation. To determine whether deregulated

240 aggresome dynamics resulting from p97, UBXN1, or NPL4 loss of function impacted cell survival in the face of

241 proteasome impairment, we measured cell viability using a luminescence-based assay. We find that depletion

242 of p97, UBXN1, and NPL4 sensitized cells to Btz treatment compared to wildtype cells (Figure 5F). Importantly,

243 re-expression of wildtype UBXN1 but not UBAmut or UBXmut rescued survival to levels observed in wildtype cells

244 treated with Btz (Figure 5F). Taken together, our results suggest that the distinct steps of aggresome formation

10 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

245 and clearance are mediated by UBXN1, UFD-NPL4, and p97 respectively and that both these events are

246 independently important for alleviating proteotoxic stress.

247 Our studies indicate that UBXN1 acts early in the recognition of ubiquitylated substrates to mediate

248 aggresome formation in collaboration with p97. Given that p97-depleted or inhibited cells were also unable to

249 clear aggregates upon Btz removal, we asked if the same was true for the aggregates observed in cells lacking

250 UBXN1. Surprisingly, we find that cells lacking UBXN1 or NPL4 were capable of clearing aggregates upon Btz

251 removal (Supplementary Figure 5D). One possibility is that p97 utilizes distinct partners for the formation and

252 clearance of aggresomes. p97 has been reported to associate with HDAC6 in prior studies and HDAC6

253 overexpression enhances clearance of aggregates in cells expressing p97 disease mutants18. In agreement

254 with previous studies17, we find that p97 and HDAC6 associate with each other when transiently

255 overexpressed in cells (Supplementary Figure 5E). The depletion of HDAC6 resulted in the loss of aggresomes

256 as expected (Supplementary Figure 5F). Notably, HDAC6-depleted cells were less able to clear aggregates

257 upon Btz removal (Supplementary Figure 5F). Taken together, our data suggest that p97-UBXN1 is required

258 for the formation of aggregates, but that aggresome clearance is mediated via other p97 adaptors or

259 interactors, possibly HDAC6.

260

261 Loss of p97 and UBXN1 leads to an increase in Huntingtin polyQ aggregates

262 We were interested in determining whether UBXN1 has roles in the recognition of disease-relevant

263 aggregates. Expansion of a CAG tract in the first exon of the huntingtin (htt) gene beyond a threshold of

264 approximately 35-40 repeats causes Huntington’s disease (HD) and results in a mutant HTT protein containing

265 an expanded polyglutamine (polyQ) segment37. Expression of exon 1 htt fragments longer than 40 residues

266 leads to the formation of insoluble amyloid-like aggregates of HTT known as inclusion bodies38-40 (that are

267 most reminiscent of aggresomes) and contributes to neurodegeneration. We used a previously published,

268 doxycycline-inducible HTT polyQ91-mCherry U2OS cell line to investigate the role of UBXN1 in inclusion body

11 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

269 formation41. Treatment with doxycycline leads to the appearance of ubiquitin and mCherry-Q91 positive

270 aggregates in about 1-2% of cells consistent with previous studies41,42. A recent study suggested that the

271 ubiquitylation of HTT inclusion bodies is not a pre-requisite for their formation. We used the ubiquitin E1

272 inhibitor TAK-273 at a dose that depleted endogenous ubiquitin conjugates in both untreated and Btz treated

273 cells (Supplementary Figure 6A) and indeed found that Q91 inclusion bodies still formed but were not

274 ubiquitylated (Supplementary Figure 6B). However, in cells treated with TAK-273, there were significantly more

275 Q91 inclusion bodies compared to untreated cells, to a similar extent as Btz treatment (Supplementary Figure

276 6C). Unlike the role of p97 in aggresome formation (Figure 1), we find that inhibition of p97 using CB-5083

277 resulted in an increase in Q91 inclusion bodies (Supplementary Figure 6C). Thus, while the formation of HTT

278 inclusion bodies does not require ubiquitylation, it is dependent on the ubiquitin-proteasome system and p97

279 for clearance.

280 We observed recruitment of UBXN1 to Q91 aggregates where it formed a ring-like structure around the

281 aggregate, similar to ubiquitin (Figure 6A). We tested the impact of UBXN1 depletion on Q91 aggregate

282 formation using siRNA transfection followed by microscopy. Surprisingly, loss of UBXN1 resulted in an

283 increase in the number of polyQ aggregates in cells in a manner comparable to proteasome or p97 inhibition

284 (Figure 6B and Supplementary Figure 6C and D). This was unexpected given the role of UBXN1 in

285 aggresome formation. The high fluorescent intensity of Q91 aggregates necessitated lower capture settings

286 during image acquisition that prevented us from quantifying smaller, less intense aggregates. To address this

287 shortcoming, we used Pulse Shape Analysis (PulSA) by flow cytometry that has been used to analyze particles

288 of different sizes including polyQ aggregates41,42. PulSA uses standard pulse width and height in the

289 fluorescent channel. The formation of HTT containing aggregates leads to a decrease in pulse width and an

290 increase in pulse height, allowing for the visualization of smaller aggregates and larger inclusion bodies. As we

291 had observed from imaging studies, PulSA analysis of p97 or UBXN1 depleted cells indicated an

292 approximately three-fold increase in polyQ inclusion bodies compared to control samples (Figure 6C). PulSA

293 also enabled us to measure smaller aggregates that were missed in the imaging studies. We found an

12 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

294 increase in smaller Q91-mCherry aggregates in cells depleted of UBXN1 or p97 suggesting that loss of this

295 complex promotes the transition of Q91 oligomers into aggregates (Supplementary Figure 6E).

296 We next asked if p97-UBXN1 regulated polyQ aggregation in vivo. We used transgenic worms

297 expressing YFP-polyQ40 under the control of the unc-54 myosin heavy chain promoter to direct expression in

298 the body wall muscle cells (mQ40)43. Previous studies have demonstrated that mQ40 marks a threshold at

299 which the reporter begins to aggregate in worms43. There are two isoforms of p97 (cdc-48.1 and cdc-48.2) with

300 redundant functions in worms. In addition, six UBXD adaptors (including ubxn-1) and ufd-1 and npl-4 are

301 conserved. We crossed cdc-48.1, ubxn-1, and ubxn-4 (worm ortholog of mammalian UBXD2) mutant worms

302 with the mQ40 strain. To accurately quantify aggregates in control and mutant strains, worms were age-

303 matched at the L4.4 vulval development stage, and aggregates were quantified by microscopy. We found that

304 control mQ40 worms typically had on average 20 aggregates, however cdc-48.1 and ubxn-1 mutant worms

305 had a two-fold increase in mQ40 aggregates in agreement with our findings in mammalian cells (Figure 6D and

306 E). This finding is in agreement with a previous study where the over-expression of either cdc-48 isoform in

307 mQ40 expressing worms partially suppresses Q40 aggregation44. Surprisingly, ubxn-4 mutant worms also

308 displayed an increase in mQ40 aggregates, indicating that additional adaptors may be utilized for HTT

309 aggregate clearance in worms (see Discussion).

310 In summary, we have identified an evolutionarily conserved role for p97-UBXN1 in the recognition,

311 formation, and clearance of ubiquitylated protein aggregates.

312 Discussion

313 Cellular proteostasis networks are complex yet flexible to accommodate the need for thousands of

314 proteins to perform various cellular functions while minimizing protein misfolding and aggregation. Defects in

315 this large network result in multi-system proteinopathies, and several recent reports suggest that the age-

316 related decline in the quantity, capacity, and efficiency of these systems may be an underlying cause of these

317 disorders7. Whether aggregates observed in human diseases are causative of disease-relevant phenotypes or

318 if they represent a cytoprotective structure meant to sequester and shield aggregates is controversial.

13 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

319 However, at least in the case of polyQ inclusions observed in Huntingtin’s disease, the soluble

320 microaggregates are believed to be more toxic than the inclusion body14,45,46.

321 In this study, we have identified a novel role for the p97 adaptor UBXN1 in the recognition of specific

322 types of cellular aggregates. UBXN1 is the only UBXD adaptor that robustly localizes to aggresomes and cells

323 lacking UBXN1 have a diminished ability to form a single aggresome but instead display an increased number

324 of dispersed microaggregates. In particular, the total ubiquitin burden (measured by immunoblotting total

325 cellular ubiquitin conjugates as well as quantifying cytosolic and perinuclear aggregates by imaging) remains

326 comparable in wildtype and UBXN1 KO cells. While p97 has been implicated in a large number of ubiquitin-

327 dependent events, few of its numerous adaptors have been linked to these processes. Indeed, apart from the

328 UFD1-NPL4 dimer that functions in most p97 processes (due to dual roles in enhancing ubiquitylated substrate

329 binding to p97 as well as stimulating p97’s unfoldase activity)20,47 many of its adaptors including UBXN1 remain

330 poorly studied. A single UFD1-NPL4 dimer is believed to associate with the p97 hexamer, and at least in the

331 case of FAF1 and UBXD7, UFD1-NPL4 association with the p97 hexamer is a pre-requisite for binding48. Our

332 studies suggest that a fraction of the cellular pool of UBXN1 and the UFD1-NPL4 dimer associate with the

333 same p97 hexamer. The presence of dual adaptors on p97 may increase the capacity of a single hexamer in

334 capturing multiple substrates or may enhance the avidity of substrate interaction by providing multiple ubiquitin-

335 binding domains on the same molecule. Surprisingly, neither UBXN1 nor NPL4 are required for aggresome

336 clearance following Btz removal and suggests that p97 may switch adaptors for clearance purposes. In support

337 of this, we and others have found that p97 interacts with HDAC6, which is required for aggresome clearance

338 and may collaborate with p97 in this process. Identifying sites of interaction between these molecules and

339 testing interaction-deficient mutants in aggresome formation will provide conclusive evidence for the role of a

340 p97-HDAC6 complex in aggresome clearance. What factors may dictate adaptor choice during these distinct

341 phases remains to be determined.

342 Surprisingly, depleting p97 protein levels or inhibiting its catalytic activity have distinct outcomes in

343 terms of aggresome formation. We find that long term depletion of p97 leads to an increase in cells with

344 aggresomes that are larger compared to control cells. In contrast, acute p97 inhibition with CB-5083 leads to

14 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

345 loss of aggresomes. Previous studies using ubiquitin remnant capture proteomics suggest that while many p97

346 and 26S proteasome targets are shared, p97 additionally processes ubiquitylated substrates that are not

347 proteasomal targets 49. Thus, the long-term accumulation of these substrates may contribute to the enhanced

348 aggresome phenotype. In contrast, both depletion and inhibition of p97 lead to defects in the clearance of

349 aggresomes.

350 We find that depletion of p97 and UBXN1 increases polyQ-containing aggregates in mammalian cells in

351 vitro and in a C.elegans model of Huntington’s disease. Using PuLSA, we show that depletion of p97 and

352 UBXN1 in mammalian cells leads to an increase in smaller aggregates reminiscent of the aggresome

353 phenotype. However, we also observe an increase in large inclusion bodies, which is distinct from the role of

354 p97-UBXN1 in aggresome formation. What factors could account for these different phenotypes? Inclusion

355 bodies share several features with aggresomes; they are ubiquitylated, frequently (though not exclusively) form

356 near the perinuclear area, are dependent on microtubules for their formation, and recruit similar protein quality

357 control components 50. However, there may be distinctions that influence what proteins are recruited to each

358 structure and the discrete steps that culminate in their removal. Aggresomes are composed of a diverse array

359 of ubiquitylated proteasomal substrates, whereas inclusion bodies are seeded by misfolded HTT that

360 eventually trap other cellular components. UBXN1 may implement aggresome formation via association with a

361 distinct cohort of proteins (both ubiquitylated substrates and regulators). However, the increase in smaller

362 polyQ aggregates in UBXN1-depleted cells may enable direct seeding of larger inclusion bodies. We have

363 previously shown that loss of UBXN1 impairs the clearance of ALIS 35 whereas UBXN1 appears to have no

364 role in aggresome clearance further underscoring distinctions in how different aggregates are handled by the

365 same protein. In worms, ubxn-1 does not appear to be the sole p97 adaptor in the recognition of inclusion

366 bodies, we find that ubxn-4 mutant worms also have increased polyQ aggregates. Mammalian UBXD2

367 (ortholog of ubxn-4) is a component of ERAD and the increased polyQ aggregation that we observe in ubxn-4

368 may be due to inhibition of ERAD and the accumulation of misfolded proteins that exacerbates polyQ

369 aggregation. Further studies are warranted to explore the role of other p97 adaptors in polyQ aggregation.

15 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

370 How does UBXN1 recognize cargo destined for the aggresome? One possibility is the recognition of

371 ubiquitin chains on substrates by the UBA domain in UBXN1. However, our studies with UBA and UBX

372 mutants suggest that while ubiquitin binding is important, it is not as critical as p97 interaction. This suggests

373 that additional features of aggresome-destined substrates may be directly or indirectly sensed by UBXN1.

374 Recently, components of the linear ubiquitin chain assembly complex (LUBAC) E3 ligase were shown to be

375 recruited to and modify HTT polyQ inclusion bodies with linear ubiquitin chains51. LUBAC recruitment was

376 dependent on p97, and both p97 recruitment and LUBAC-mediated linear ubiquitylation of HTT polyQ

377 aggregates were required for efficient clearance. What other protein quality control components associate with

378 UBXN1 and the types of ubiquitin linkages are recognized by UBXN1 and will be a topic of future studies.

379 Aggresomes were identified more than twenty years ago8, yet the full complement of proteins that are

380 recruited to aggresomes remains incomplete. It is unclear what distinguishes different types of protein

381 aggregates from one another and how specific components of protein quality control pathways are

382 appropriately engaged. For example, aggresomes have long been known to be encased in intermediate

383 filament vimentin cages. Yet it was only recently that it was demonstrated that vimentin specified the

384 recruitment of proteasomes to aggresomes and is an important determinant in how aggregates are triaged as

385 adult neural stem cells exit quiescence52. Given the prevalence of protein aggregates in numerous

386 neurodegenerative diseases, a complete understanding of the principles that govern aggresome formation and

387 clearance will aid in our understanding of disease-relevant aggregates. Our study demonstrates that the

388 process of aggresome formation and clearance are distinct events mediated by multiple proteins. Given the

389 role of p97 mutations in human disorders related to aggregate clearance, it will be of interest to determine

390 whether UBXN1 regulates their formation and if targeting this event may have therapeutic benefit.

391

392 Materials and Methods

393 Cell lines and culture

16 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

394 HEK-293T (ATCC), HeLa Flp-in TRex (a kind gift from Brian Raught, University of Toronto), SHSY-5Y

395 (a kind gift from Wade Harper, Harvard Medical School), and U2OS HTTQ91-mCHERRY (a kind gift from Ron

396 Kopito, Stanford University) cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented

397 with 10% fetal bovine serum (FBS) and 100 U/ml penicillin and streptomycin. Multiple Myeloma MM1.S cells

398 (gift from Filemon Dela Cruz, Memorial Sloan Kettering), were cultured in RPMI-1640 containing 10% FBS and

399 100U/ml penicillin and streptomycin. Cells are tested for mycoplasma contamination on a routine basis. Cells

400 were maintained in a humidified, 5% CO2 atmosphere at 37°C.

401

402 Antibodies, chemicals, and reagents

403 The rabbit p97 antibody used for immunofluorescence (10736-AP), UBXN1 (16135-1-AP), UFD1 (10615-1-

404 AP), NPL4 (11638-1-AP), FAF1 (10271-1-AP), UBXD1 (14706-1-AP), UBXD2 (21052-1-AP), UBXD3 (26062-

405 1-AP), UBXD5 (13109-1-AP), p47 (15620-1-AP) antibodies are from Proteintech. Rabbit p97 antibody for

406 immunopurification and immunoblotting is from Bethyl (A300-589A), mouse FLAG-M2 antibody was from

407 Sigma; mouse ubiquitin (FK2) antibody used for immunofluorescence was from EMD Millipore; ubiquitin

408 antibody (clone P4D1) for immuno-blotting, GAPDH (sc-47724), and mouse Myc antibody was from Santa

409 Cruz (sc-40). Rabbit HDAC6 antibody (clone D2E5) was from Cell Signaling Technologies (7558), 20S

410 proteasome antibody (MCP257) was from EMD Millipore. Bortezomib and TAK273 were from Selleckchem,

411 puromycin, doxycycline, cycloheximide, and nocodazole were from Sigma. Anti-FLAG magnetic beads were

412 from Sigma and Myc magnetic beads were from Pierce.

413

414 siRNA transfections and generation of CRISPR-Cas9 knockout cell lines

415 pTRIPZ sh-p97 hairpin vectors were purchased from Open Biosystems (clone D1: V2THS_111071

416 Clone D5: V2THS_201657). For the generation of shp97 stable cell lines, lentivirus was produced and

417 packaged in HEK293T cells reported previously and subsequently used to infect HeLa Flp-in TRex cells.

418 Stable cell lines were selected with 1 µg/ml puromycin23. The depletion of p97 was achieved by treatment with

419 4 µg/ml of doxycycline for the 24-72 hrs.

17 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

420 siRNAs targeting p97 (15975124), UFD1 (4392420), NPL4 (4392420), HDAC6 (4427038) were

421 purchased from Ambion. siRNAs targeting UBXN1 (D-008652-01, D-008652-02), FAF1 (D-009106-03), p47

422 (D-017222-01) were purchased from or Dharmacon. For siRNA transfections, cells were trypsinized and

423 reverse transfected with 30 nM siRNA by using Lipofectamine 3000 (Thermo Scientific) according to the

424 manufacturer’s protocol in 6 well plates. These cells were then trypsinized and plated on 12 well plates with

425 glass coverslips where appropriate. In general, cells were harvested at 60 hrs post-transfection.

426 The CRISPR-Cas9 gene-editing system was used to generate knockout cell lines in HeLa Flp-in T-REX

427 cells. The guide sequences for UBXN1 (5’GCCGTCCCAGGATATGTCCAA3’), p47

428 (5’AGATCATCCACCAGCTCGTT3’), and NPL4 (5’GATCCGCTTCACTCCATCCG3’) were cloned into the

429 pX459 vector carrying hSpCas9 and transiently transfected into HeLa cells by using Lipofectamine 3000

430 (Thermo Scientific) according to the manufacturer’s protocol. At 36 hrs post-transfection, the cells were pulsed

431 briefly with 1 µg/ml puromycin for a further 24 hrs. The surviving cells were then serially diluted to achieve 1

432 cell / well in 96-well plates for clonal selection. The knockout of the gene of interest was verified by

433 immunoblotting. HttQ91-mCherry expression was induced by treating cells with 1 µg/ml of doxycycline for 48

434 hours.

435 Cloning and generation of inducible rescue lines

436 UBA and UBX point mutants in UBXN1 were created by overlap PCR and Gibson cloning into pDON223.

437 Gateway recombination (Thermo Scientific) was used to recombine into either the pcDNA FRT/TO-GFP or the

438 pDEST N-Myc vector. All clones were verified by Sanger sequencing. GFP-UBXN1 rescue cell lines were

439 generated by transfecting pcDNA FRT/TO-GFP-UBXN1, UBAmut, or UBXmut mutants along with pOG-44 (1:9

440 ratio) into UBXN1 KO cells by using Lipofectamine 3000. Stable integrant cells were treated with 200 µg/ml

441 hygromycin for 7-10 days until visible colonies were observed. GFP-UBXN1 wildtype expression was induced

442 with 1 µg/ml doxycycline whereas UBAmut and UBXmut were induced with 1.5 µg/ml doxycycline to achieve

443 equal levels of expression for 72 hours.

444

18 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

445 Cell lysis, transfections, and immunoprecipitation

446 Cells were lysed in mammalian cell lysis buffer (50 mM Tris-Cl [pH 6.8], 150 mM NaCl, 0.5 % Nonidet

447 P-40, Halt protease inhibitors [Pierce], and 1 mM DTT). To recover total protein (soluble and insoluble), sodium

448 dodecyl sulfate (SDS) was added to a final concentration of 1% (Figure 1B, Supplementary Figure 2F and 6A).

449 Cells were incubated at 4°C for 10 min and then centrifuged at 14,000 rpm for 15 min. The supernatant was

450 removed, and the protein concentration was estimated using the DCA assay (Bio-Rad).

451 Myc or FLAG magnetic beads in a 1:1 slurry in mammalian cell lysis buffer was added to samples and

452 rotated at 4°C overnight. A magnetic stand (Thermo Fisher) was used to wash the beads three times with lysis

453 buffer. Beads were resuspended in 25 µl SDS sample buffer, boiled briefly, and processed for SDS-PAGE and

454 immunoblotting. FLAG elutions were performed two times with the 250µg/ml 3XFLAG peptide (ApexBio) for 30

455 minutes at room temperature. Endogenous p97 was further immunoprecipitated (Bethyl) at 4°C overnight.

456 Beads were washed 3 times in lysis buffer and resuspended in Laemmli buffer and boiled briefly.

457

458 Immunofluorescence and microscopy

459 Cells were grown on coverslips (no. 1.5) in a 12-well plate treated with 1 µM bortezomib (Btz), 2 µM

460 TAK243, 2 µM CB5083 (or 1 µM CB5083 for release experiments), 100 µg/ml cycloheximide or 5 µg/ml

461 nocodazole (for the last 4 hours of Btz treatment) for the indicated times. Cells were washed briefly in

462 phosphate-buffered saline (PBS) and fixed with 4% paraformaldehyde/PBS at room temperature for 15 min or

463 ice-cold methanol for 10 minutes at -20˚C. Cells were washed in PBS then blocked in 2 % bovine serum

464 albumin (BSA) 0.3 % TritonX-100 in PBS for 1 h. The coverslips were incubated with the indicated antibodies

465 in a humidified chamber overnight at 4°C. Coverslips were washed and incubated with the appropriate Alexa

466 Fluor-conjugated secondary antibodies (Molecular Probes) for 1 h in the dark at room temperature. Cells were

467 washed with PBS, and nuclei were stained with Hoechst dye and mounted onto slides. All images were

468 collected using a Nikon A1R scan head with a spectral detector and resonant scanners on a Ti-E motorized

469 inverted microscope equipped with a 60XPlan Apo 1.4-numerical-aperture (NA) objective lens. The indicated

19 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

470 fluorophores were excited with either a 405-nm, 488-nm, or 594-nm laser line. Images were analyzed by using

471 FIJI (https://imagej.net/Fiji). Colocalization analysis was performed by using the Coloc2 and JACoP plug-ins in

472 FIJI.

473

474 PuLSA analysis of HTT Q91-mCherry aggregates

475 U2OS-HTTQ91mCherry cells were trypsinized and reverse transfected with 20 nM siRNA by using

476 Lipofectamine 3000 (Thermo Scientific) according to the manufacturer’s protocol in 6 well plates. Expression of

477 HttQ91-mCherry was induced with 1 µg /ml dox 8 hours after siRNA transfection, and cells were incubated for

478 an additional 48 h before harvesting and analysis. For PulSA flow cytometric analysis, cells were analyzed on

479 a flow cytometer (LSR II; BD) equipped with 535-nm lasers. Measurements for mCherry peak width, peak

480 height, and total intensity was collected. Flow cytometry analysis software (Flow Jo; Tree Star) was used to

481 analyze the fraction of cells with Inclusion bodies (IBs) by PulSA. Cells with IBs were identified and gated using

482 a mCherry peak width versus peak height scatter plot. The percentage of cells was plotted against total

483 mCherry fluorescence intensity. 10,000 cells were analyzed for each of the three independent experiments.

484

485 Fluorescence microscopy and quantification of aggregates in C.elegans

486 The following strains were used in this study: N2 (Bristol), rmIs133 [unc-54p::Q40::YFP] (polyQ40::YFP

487 expressed under a muscle-specific promoter)43, cdc-48.1(tm544), ubxn-1(tm2759) and ubxn-4(ok3343). All

488 strains were maintained at 20 oC as described previously53.

489 Representative fluorescent images of polyQ40::YFP in L4 larval stage C. elegans were acquired using

490 a Carl Zeiss Axiovert M1 microscope equipped with a 5X objective and a YFP filter (Zeiss). Images were

491 collected with an Orca-ER charged coupled device (CCD) camera (Hamamatsu) and Metamorph (version 7.1)

492 software. Exposure settings and gain were adjusted to fill the 12-bit dynamic range without saturation and were

493 identical for all images. Larval-stage 4 (L4) animals were immobilized in a droplet of M9 containing 2.3mM

20 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

494 levamisole (Tetramisole, Sigma) and placed on a 2% agarose pad containing 3.4 mM levamisole. To quantify

495 fluorescent puncta, worms were precisely age-matched at the L4.4 vulva development stage based on vulva

496 morphologyusing a 100X objective. Then the number of polyQ40::YFP aggregates were visually counted on

497 the microscope using the 5X objective and recorded. All genotypes were blinded prior to the experiment. At

498 least 3-5 animals were measured for each genotype across 3 independent experiments and statistical

499 analyses were performed by ANOVA followed by Dunnett’s multiple comparisons test.

500 Aggresome Quantification

501 Aggresomes were quantified using AggreCount33, an ImageJ macro we developed for the unbiased

502 analysis of cellular aggregates. AggreCount can analyze hundreds of cells and images in a matter of minutes

503 and provides quantification of number of aggregates, size of aggregates, and their cellular distribution

504 (cytosolic, perinuclear, and nuclear) at single-cell resolution. We used a 2 µm2 minimum size cut-off for

505 aggresomes formed after 8 hours of Btz treatment and a 4 µm2 minimum size cut-off for aggresomes formed

506 after 18 hours of Btz treatment based on the mean size of the largest perinuclear aggregate from hundreds of

507 analyzed cells (see quantification in Supplementary Figure 1B)

508

509 Statistical Analysis

510 Several hundred cells (indicated in the figures) were counted for each of three biological replicates.

511 Means and standard deviations or standard error of the mean for triplicate measurements were calculated, and

512 statistical significance was calculated by using an unpaired Student t-test or One-Way ANOVA with the

513 indicated post-hoc testing.

514

515 Acknowledgments

516 We are grateful to Rakesh Ganji for creating the knock-out cell lines, members of the Raman lab, Shireen

517 Sarraf, and Karl Munger for critical reading of the manuscript. S.M and M.R conceived the study, performed the

518 experiments, and co-wrote the manuscript. J.K developed AggreCount and performed all image analysis, B.O

21 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

519 and P.J performed the C.elegans studies. B.O was supported in part by 2R25GM066567 as a Post-

520 Baccalaureate Research Program (PREP) trainee. This work is supported in part by the American Cancer

521 Society Research Scholar grant (RSG-19-022-01-CSM) to M.R., National Institutes of Health grant (R01-

522 GM127557) to M.R., (R21NS101534) to P.J., and Tufts Russo Family Award to M.R and P.J. We thank the

523 Caenorhabditis Genetics Center (funded by the National Institutes of Health Office of Research Infrastructure

524 Programs Grant P40ODD010440) and Shohei Mitani (National Bioresource Project) for C. elegans strains.

525

526 Figure Legends

527 Figure 1. p97 is required for aggresome formation and clearance

528 (A) Hela Flp-in T-Rex cells were treated with 1 µM Btz for 18 hrs. Cells were stained for p97, ubiquitin (FK2),

529 and nuclei (Hoechst dye). (B) Hela Flp-in T-Rex cells were treated with 1 µM Btz, 2 µM CB-5083, or both for 8

530 hrs. Cells were released into drug-free media or media containing 1 µM CB-5083 for 24 hours. Cell lysates

531 were probed for ubiquitin. (C) Cells were treated as in (B) and imaged for ubiquitin-positive aggregates and

532 aggresomes. (D) Total cellular aggregates (encompassing cytosolic and perinuclear aggregates) were

533 quantified using AggreCount for images in (C). (E) Perinuclear aggresomes (minimum size cutoff 2 µm2) were

534 quantified using AggreCount for the images in (C). (F) Total cellular aggregates (encompassing cytosolic and

535 perinuclear aggregates) in the release samples were quantified using AggreCount for images in (C). (G)

536 Perinuclear aggresomes in release samples were quantified using AggreCount for the images in (C). The

537 indicated number of cells was analyzed from the three independent biological replicates indicated by the black

538 dot. Graphs show the mean +/- s.e.m. *: p<=0.1, **: p<=0.05, ***: p<=0.001 as determined by One-way

539 ANOVA with Bonferroni correction. Scale bar: 10µm.

540

541 Figure 2. The p97 adaptors UBXN1 and NPL4 are localized to aggresomes

542 (A) Hela Flp-in T-Rex cells were treated with 1 µM Btz for 18 hrs and cells were stained for UBXN1 and

543 ubiquitin. Colocalization was determined by the Mander’s overlap coefficient for 25 cells in 3 replicate

22 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

544 experiments. (B) NPL4, UFD1 and p47 localization to aggresomes labeled with ubiquitin. Colocalization was

545 determined by the Mander’s overlap coefficient for 25 cells in 3 replicate experiments. (C) GFP UBXN1 co-

546 localizes with aggresome markers: Proteostat, HDAC6, and 20S proteasomes in Btz treated cells. (D)

547 Microtubules are required for GFP-UBXN1 localization to aggresomes. Nocodazole co-incubation in Btz

548 treated cells prevents aggresome formation. Lower panel: The number of aggresomes was quantified. (E) Hela

549 Flp-in T-Rex cells were treated with 0.1 mM sodium arsenite for 2 h. Cells were stained for stress granule

550 marker G3BP1 and p97 adaptors (UBXN1 or p47, used here as a positive control. (F) Stable mCherry-Dcp1a

551 cells (labeling P bodies) were stained with UBXN1. The indicated number of cells was analyzed from the three

552 independent biological replicates. Graphs show the mean +/- s.e.m. ***: p<=0.001 as determined by unpaired

553 Students t-test. Scale bar: 10µm.

554

555 Figure 3. UBXN1 is required for the formation of aggresomes

556 (A) Immunoblot showing loss of UBXN1 in CRISPR-Cas9 generated knockout cells and re-expression of

557 wildtype GFP-UBXN1 by doxycycline induction. (B) Wildtype (WT) and UBXN1 knock-out (KO) HeLa Flp-in

558 TRex cell lines were treated with 1 µM Btz for 18 hrs. Cells were stained for ubiquitin. (C) Cell lysates from

559 wildtype and KO celss treated with 1 µM Btz for 18 hrs were probed for ubiquitin. (D) GFP-UBXN1 expression

560 in UBXN1 KO cells was induced by doxycycline. Cells were treated with Btz and stained for ubiquitin.

561 Expression of GFP-UBXN1 reinstated aggresome formation in UBXN1 KO cells. (E) Quantification of data in

562 panels (B and D). (F) WT and UBXN1 KO lines were treated with Btz for the indicated times and stained for

563 ubiquitin. The indicated number of cells was analyzed from the three independent biological replicates

564 indicated by the black dot. Graphs show the mean +/- s.e.m. *: p<=0.1, **: p<=0.05, as determined by One-way

565 ANOVA with Bonferroni correction. Scale bar: 10µm.

566

567 Figure 4. UBXN1 and NPL4 are required for aggresome formation and bind the same p97 molecule.

23 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

568 (A) Immunoblot validation of CRISPR-Cas9 gene-edited knockout (p47) or knockdown (NPL4) cell lines. (B)

569 Aggresome formation in CRISPR-Cas9 gene-edited knockout cell lines for the indicated UBXD adaptors. (C)

570 Quantification of data in (B). (D) HEK293T cells were transfected with the indicated FLAG or Myc-tagged

571 constructs. NPL4 was affinity purified using FLAG magnetic beads and associated proteins were eluted with

572 FLAG peptide. Endogenous p97 in the eluate was immunopurified and probed for UBXN1, NPL4, and

573 ubiquitin. UBXN1 associates with the same p97 hexamer associated with NPL4. The indicated number of cells

574 was analyzed from the three independent biological replicates indicated by the black dot. Graphs show the

575 mean +/- s.e.m. *: p<=0.1, **: p<=0.05 as determined by One-way ANOVA with Bonferroni correction. Scale

576 bar: 10µm.

577 Figure 5. Analysis of domains within UBXN1 that are necessary for aggresome formation

578 (A) Domain organization of UBXN1 showing N-terminal ubiquitin associated domain (UBA), coiled coil domain

579 (cc) and C-terminal ubiquitin X domain (UBX). (B) Expression of GFP-UBXN1, GFP-UBXN1-UBAmut, and GFP-

580 UBXN1-UBXmut in the UBXN1 KO cell line by the addition of doxycycline for 72 hrs. (C) UBXN1 KO cells

581 expressing GFP-UBXN1 wildtype, GFP-UBXN1-UBAmut, or GFP-UBXN1-UBXmut were treated with Btz for 18

582 hours and stained for ubiquitin. Re-expression of wildtype UBXN1 but not the UBXmut rescued aggresome

583 formation. The UBAmut has smaller aggresomes but did not reach significance (D) Total cellular aggregates

584 (encompassing cytosolic and perinuclear aggregates) were quantified for images in (C). (E) Perinuclear

585 aggresomes were quantified for the images in (C). (F) Wildtype, UBXN1 KO (and indicated rescue lines),

586 NPL4, and p97 depletion cell lines were plated in triplicate into 96-well plates and treated with 1µM bortezomib

587 for 18 hrs. Cell viability was measured and normalized to the value of untreated controls for each cell line. The

588 indicated number of cells was analyzed from the three independent biological replicates indicated by the black

589 dot. Graphs show the mean +/- s.e.m. *: p<=0.1, **: p<=0.05 as determined by One-way ANOVA with

590 Bonferroni correction. Scale bar: 10µm.

591

24 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

592 Figure 6. Role of p97 and UBXN1 in Huntingtin polyQ aggregation

593 (A) U2OS cells were treated with doxycycline to induce the expression of HTT Q91-mCherry. Cells were fixed

594 and stained for ubiquitin and UBXN1 to demonstrate co-localization with HTT Q91-mCherry. (B) UBXN1 was

595 transiently depleted with siRNAs in U2OS HTT Q91-mCherry and imaged for inclusion body formation. The

596 number of HTT Q91-mCherry inclusion bodies was quantified. (C) PuLSA analysis of HTT Q91-mCherry

597 aggregates in UBXN1 and p97 depleted cells. (D and E) Representative fluorescent images of L4 larvae stage

598 wild type, cdc-48.1(tm544) (D), ubxn-1(tm2759) and ubxn-4(ok3343) (E) loss-of-function mutants expressing

599 polyQ40::YFP in body wall muscle. Images were taken of worms precisely age-matched at the L4.4 vulva

600 developmental stage. Bottom panels in each show quantification of visible fluorescent aggregates in L4 larvae

601 animals expressing polyQ40::YFP in either wildtype, cdc-48.1, ubxn-1 and ubxn-4 mutant animals.

602 Quantification was only performed on worms at the L4.4 vulva development stage based on vulva morphology.

603 The indicated number of cells was analyzed from the three independent biological replicates indicated by the

604 black dot. Graphs show mean +/- s.e.m. *: p<=0.1, **: p<=0.05, ***: p<=0.001 as determined by One-way

605 ANOVA with Tukey (B) or Dunnett’s Test (D and E). Scale bar: 10µm.

606 Supplementary Figure 1. p97 is required for aggresome clearance

607 (A) Hela Flp-in T-Rex cells were treated with 1 µM Btz for 0, 4, 6, 8, or 18 hrs. Cells were stained with UBXN1

608 and ubiquitin and imaged (B) Hela Flp-in T-Rex cells were treated with 1 µM Btz for 0, 8, or 18 hrs. Cells were

609 stained with ubiquitin and perinuclear aggregate size was quantified using AggreCount. The mean area of the

610 largest perinuclear aggregate for each time point (2µm2 or 4µm2 respectively) was used for all subsequent

611 analysis to quantify perinuclear aggresomes. (C) Levels of p97 depletion in doxycycline-inducible shRNA Hela

612 Flp-in T-Rex cell lines. Cells were treated with doxycycline for 72 hours. (D) sh-p97 cell lines were treated with

613 1 µM Btz for 18hrs and released into drug-free media for a further 24 hours in the presence or absence of p97

614 depletion. Cells were stained with ubiquitin and Hoechst. The number of cells containing ubiquitin-positive

615 aggresomes was quantified using AggreCount. (E) Quantification of data in (D). The indicated number of cells

25 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

616 was analyzed from the three independent biological replicates indicated by the black dot. Graphs show mean

617 +/- standard deviation. *: p<=0.1, **: p<=0.05, ***: p<=0.001 as determined by One-way ANOVA with

618 Bonferroni correction. Scale bar: 10µm.

619

620 Supplementary Figure 2. The p97 adaptors UBXN1 and NPL4 are localized to aggresomes

621 (A) HeLa Flp-in TRex cells were treated with 1 µM Btz for 18hrs. Cells were stained for p97 adaptors

622 (UBXD1, UBXD2, FAF1, UBXD8, and ASPSCR1) and ubiquitin. Note that UBXD2 and UBXD8 are known to be

623 ER-tethered adaptors and localize to both ER tubules at the cell periphery and ER sheets near the nuclear

624 envelope. They do not co-localize with aggresomes and can be seen to occupy a greater cellular area

625 (corresponding to ER sheets) than the aggresome. (B) Neuroblastoma cells SH-SY5Y were treated with 1 µM

626 Btz for 18 hrs. Cells were stained for UBXN1 and ubiquitin. (C) Multiple Myeloma cell line MM1.S was treated

627 with 1 µM Btz for 18 hrs. Cells were stained for UBXN1 and ubiquitin. (D) Hela Flp-in T-Rex cells were treated

628 with 5 µg/ml of puromycin for 4 hrs. Cells were stained for UBXN1 and ubiquitin. ALIS: Aggresome-like induced

629 structures. (E) Aggresomes formed by Btz treatment contain primarily newly synthesized ubiquitylated proteins.

630 Co-treatment with the translational inhibitor cycloheximide results in the loss of aggresomes in Btz treated

631 cells. Cells were stained for ubiquitin and nuclei (Hoechst dye). (F) Immunoblot of global ubiquitin conjugate

632 levels corresponding to samples in (E). Scale bar: 10µm.

633

634 Supplementary Figure 3. UBXN1 is required for the formation of aggresomes

635 (A) Parental or UBXN1 knock-out (KO) clone 6239 in HeLa Flp-in TRex cells were treated with 1 µM Btz for

636 18 hrs. Cells were stained for endogenous ubiquitin and nuclei. Bottom Panel: immunoblot showing loss of

637 UBXN1 in CRISPR-Cas9 generated knockout clonal cell lines (Clone 9 is 6239 in panel A). (B) Quantification

638 of aggresome formation upon transient depletion of UBXN1 with two separate siRNAs. Graphs show mean +/-

639 standard deviation. Bottom Panel: immunoblot of transient depletion of UBXN1. The indicated number of cells

26 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

640 was analyzed from the three independent biological replicates. *: p<=0.1, **: p<=0.05, as determined by

641 unpaired students t-test. Scale bar: 10µm

642 Supplementary Figure 4. Specificity of aggresome formation phenotype

643 (A) Aggresome formation in Hela Flp-in T-Rex cells upon transient depletion of the indicated p97 adaptors.

644 Cells were stained with anti-ubiquitin. (B) Levels of p97 adaptor depletion in Hela Flp-in TRex cell lines. Scale

645 bar: 10µm.

646

647 Supplementary Figure 5. Characterization of UBA and UBX domains in UBXN1

648 (A and B) HEK-293T cells were transfected with the indicated Myc-tagged UBXN1 constructs. Cells were

649 treated with Btz (A) and Myc affinity purifications were probed for endogenous ubiquitin (A) or p97 (B). (C)

650 Cumulative frequency distribution of largest perinuclear aggregate areas in UBXN1 KO cells expressing GFP-

651 UBXN1 wildtype, UBA, or UBX mutants. The left-ward shift of the curve indicates decrease in perinuclear

652 aggregate area in the mutants (D) Wildtype, UBXN1 KO, or NPL4 KD cells were treated with Btz for 18 hrs and

653 released into drug-free media to induce clearance of aggregates. The loss of UBXN1 or NPL4 did not impact

654 aggregate clearance. (E) p97 interacts with HDAC6. HEK-293T cells were transfected with the indicated

655 cDNAs and treated with Btz for 18 hrs, Myc affinity purifications were performed and probed for the indicated

656 tagged proteins. (F) The depletion of HDAC6 inhibits aggresome formation and clearance in HeLa Flp-in TRex

657 cells treated with Btz for 18 hrs. Scale bar: 10µm.

658

659 Supplementary Figure 6. Role of p97-UBXN1 in HTT polyQ inclusion body formation

660 (A) Hela Flp-in TRex cells were treated with the indicated concentration of the ubiquitin E1 inhibitor TAK273 or

661 Btz for 8 hours. Cell lysates were probed for endogenous ubiquitin. (B) U2OS cells were treated with

662 doxycycline to induce the expression of HTT Q91-mCherry. Cells were treated with 1 µM TAK273 for 8 hours,

27 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

663 fixed and stained for ubiquitin. Inclusion bodies still form but are devoid of ubiquitin staining. (C) Quantification

664 of inclusion bodies observed by imaging in cells treated with 1 µM TAK274, 1 µM Btz, and or 10 µM CB-5083

665 for 8 hours. (D) Depletion of UBXN1 leads to an increase in HTT Q91-mCherry inclusion bodies. Quantification

666 is provided in Figure 6B. (E) PuLSA analysis of HTT Q91-mCherry aggregates in UBXN1 and p97 depleted

667 cells. The gates show the distribution of polyQ aggregates of various sizes based on pulse height. The greater

668 the pulse height, the larger the inclusion body and vice versa. Note that this population represents only the

669 HTT aggregates and not the complete mCherry signal. Total mCherry signal is represented in Figure 6C. The

670 indicated number of cells was quantified in three biological replicates shown by the black dot. Graphs show the

671 mean and standard deviation. *: p<=0.1, **: p<=0.05, ***: p<=0.001 as determined by One-way ANOVA with

672 Bonferroni correction. Scale bar: 10µm.

673

28 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

674 References

675 1 Chen, B., Retzlaff, M., Roos, T. & Frydman, J. Cellular strategies of protein quality control. Cold Spring Harbor 676 perspectives in biology 3, a004374, doi:10.1101/cshperspect.a004374 (2011). 677 2 Wolff, S., Weissman, J. S. & Dillin, A. Differential scales of protein quality control. Cell 157, 52-64, 678 doi:10.1016/j.cell.2014.03.007 (2014). 679 3 Tyedmers, J., Mogk, A. & Bukau, B. Cellular strategies for controlling protein aggregation. Nat Rev Mol Cell Biol 680 11, 777-788, doi:10.1038/nrm2993 (2010). 681 4 Harper, J. W. & Bennett, E. J. Proteome complexity and the forces that drive proteome imbalance. Nature 537, 682 328-338, doi:10.1038/nature19947 (2016). 683 5 Kim, W. et al. Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell 44, 325-340, 684 doi:10.1016/j.molcel.2011.08.025 (2011). 685 6 Olzscha, H. et al. Amyloid-like aggregates sequester numerous metastable proteins with essential cellular 686 functions. Cell 144, 67-78, doi:10.1016/j.cell.2010.11.050 (2011). 687 7 Walther, D. M. et al. Widespread Proteome Remodeling and Aggregation in Aging C. elegans. Cell 161, 919-932, 688 doi:10.1016/j.cell.2015.03.032 (2015). 689 8 Johnston, J. A., Ward, C. L. & Kopito, R. R. Aggresomes: a cellular response to misfolded proteins. J Cell Biol 143, 690 1883-1898, doi:10.1083/jcb.143.7.1883 (1998). 691 9 Kaganovich, D., Kopito, R. & Frydman, J. Misfolded proteins partition between two distinct quality control 692 compartments. Nature 454, 1088-1095, doi:10.1038/nature07195 (2008). 693 10 Kopito, R. R. Aggresomes, inclusion bodies and protein aggregation. Trends in cell biology 10, 524-530 (2000). 694 11 Kawaguchi, Y. et al. The deacetylase HDAC6 regulates aggresome formation and cell viability in response to 695 misfolded protein stress. Cell 115, 727-738, doi:10.1016/s0092-8674(03)00939-5 (2003). 696 12 Fusco, C. et al. The E3-ubiquitin ligase TRIM50 interacts with HDAC6 and p62, and promotes the sequestration 697 and clearance of ubiquitinated proteins into the aggresome. PLoS One 7, e40440, 698 doi:10.1371/journal.pone.0040440 (2012). 699 13 Olzmann, J. A. et al. Parkin-mediated K63-linked polyubiquitination targets misfolded DJ-1 to aggresomes via 700 binding to HDAC6. J Cell Biol 178, 1025-1038, doi:10.1083/jcb.200611128 (2007). 701 14 Arrasate, M., Mitra, S., Schweitzer, E. S., Segal, M. R. & Finkbeiner, S. Inclusion body formation reduces levels of 702 mutant huntingtin and the risk of neuronal death. Nature 431, 805-810, doi:10.1038/nature02998 (2004). 703 15 Tiwari, A. et al. Caveolin-1 is an aggresome-inducing protein. Sci Rep 6, 38681, doi:10.1038/srep38681 (2016). 704 16 Song, C. et al. The heavy metal cadmium induces valosin-containing protein (VCP)-mediated aggresome 705 formation. Toxicol Appl Pharmacol 228, 351-363, doi:10.1016/j.taap.2007.12.026 (2008). 706 17 Boyault, C. et al. HDAC6-p97/VCP controlled polyubiquitin chain turnover. The EMBO journal 25, 3357-3366, 707 doi:10.1038/sj.emboj.7601210 (2006). 708 18 Ju, J. S., Miller, S. E., Hanson, P. I. & Weihl, C. C. Impaired protein aggregate handling and clearance underlie the 709 pathogenesis of p97/VCP-associated disease. J Biol Chem 283, 30289-30299, doi:10.1074/jbc.M805517200 710 (2008). 711 19 Meyer, H., Bug, M. & Bremer, S. Emerging functions of the VCP/p97 AAA-ATPase in the ubiquitin system. Nat 712 Cell Biol 14, 117-123, doi:10.1038/ncb2407 (2012). 713 20 Bodnar, N. O. & Rapoport, T. A. Molecular Mechanism of Substrate Processing by the Cdc48 ATPase Complex. 714 Cell 169, 722-735 e729, doi:10.1016/j.cell.2017.04.020 (2017). 715 21 Bodnar, N. & Rapoport, T. Toward an understanding of the Cdc48/p97 ATPase. F1000Research 6, 1318, 716 doi:10.12688/f1000research.11683.1 (2017). 717 22 Raman, M., Havens, C. G., Walter, J. C. & Harper, J. W. A genome-wide screen identifies p97 as an essential 718 regulator of DNA damage-dependent CDT1 destruction. Mol Cell 44, 72-84, doi:10.1016/j.molcel.2011.06.036 719 (2011).

29 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

720 23 Raman, M. et al. Systematic proteomics of the VCP-UBXD adaptor network identifies a role for UBXN10 in 721 regulating ciliogenesis. Nat Cell Biol 17, 1356-1369, doi:10.1038/ncb3238 (2015). 722 24 Hanzelmann, P. & Schindelin, H. The Interplay of Cofactor Interactions and Post-translational Modifications in 723 the Regulation of the AAA+ ATPase p97. Front Mol Biosci 4, 21, doi:10.3389/fmolb.2017.00021 (2017). 724 25 Hubbers, C. U. et al. Pathological consequences of VCP mutations on human striated muscle. Brain 130, 381-393, 725 doi:10.1093/brain/awl238 (2007). 726 26 Weihl, C. C., Miller, S. E., Hanson, P. I. & Pestronk, A. Transgenic expression of inclusion body myopathy 727 associated mutant p97/VCP causes weakness and ubiquitinated protein inclusions in mice. Hum Mol Genet 16, 728 919-928, doi:10.1093/hmg/ddm037 (2007). 729 27 Meyer, H. & Weihl, C. C. The VCP/p97 system at a glance: connecting cellular function to disease pathogenesis. J 730 Cell Sci 127, 3877-3883, doi:10.1242/jcs.093831 (2014). 731 28 Ritz, D. et al. Endolysosomal sorting of ubiquitylated caveolin-1 is regulated by VCP and UBXD1 and impaired by 732 VCP disease mutations. Nat Cell Biol 13, 1116-1123, doi:10.1038/ncb2301 (2011). 733 29 Zhang, X. et al. Altered cofactor regulation with disease-associated p97/VCP mutations. Proc Natl Acad Sci U S A 734 112, E1705-1714, doi:10.1073/pnas.1418820112 (2015). 735 30 Wojcik, C., Yano, M. & DeMartino, G. N. RNA interference of valosin-containing protein (VCP/p97) reveals 736 multiple cellular roles linked to ubiquitin/proteasome-dependent proteolysis. J Cell Sci 117, 281-292, 737 doi:10.1242/jcs.00841 (2004). 738 31 Kobayashi, T., Manno, A. & Kakizuka, A. Involvement of valosin-containing protein (VCP)/p97 in the formation 739 and clearance of abnormal protein aggregates. Genes Cells 12, 889-901, doi:10.1111/j.1365-2443.2007.01099.x 740 (2007). 741 32 Mattsson, K., Pokrovskaja, K., Kiss, C., Klein, G. & Szekely, L. Proteins associated with the promyelocytic leukemia 742 gene product (PML)-containing nuclear body move to the nucleolus upon inhibition of proteasome-dependent 743 protein degradation. Proc Natl Acad Sci U S A 98, 1012-1017, doi:10.1073/pnas.031566998 (2001). 744 33 Klickstein, J. A., Mukkavalli, S. & Raman, M. AggreCount: An unbiased image analysis tool for identifying and 745 quantifying cellular aggregates in a spatial manner. bioRxiv, 2020.2007.2025.221267, 746 doi:10.1101/2020.07.25.221267 (2020). 747 34 Nowis, D., McConnell, E. & Wojcik, C. Destabilization of the VCP-Ufd1-Npl4 complex is associated with decreased 748 levels of ERAD substrates. Exp Cell Res 312, 2921-2932, doi:10.1016/j.yexcr.2006.05.013 (2006). 749 35 Ganji, R., Mukkavalli, S., Somanji, F. & Raman, M. The VCP-UBXN1 complex mediates triage of ubiquitylated 750 cytosolic proteins bound to the BAG6 complex. Mol Cell Biol, doi:10.1128/MCB.00154-18 (2018). 751 36 Nawrocki, S. T. et al. Bortezomib inhibits PKR-like endoplasmic reticulum (ER) kinase and induces apoptosis via 752 ER stress in human pancreatic cancer cells. Cancer Res 65, 11510-11519, doi:10.1158/0008-5472.CAN-05-2394 753 (2005). 754 37 MacDonald, M. E. et al. Gametic but not somatic instability of CAG repeat length in Huntington's disease. J Med 755 Genet 30, 982-986, doi:10.1136/jmg.30.12.982 (1993). 756 38 Waelter, S. et al. Accumulation of mutant huntingtin fragments in aggresome-like inclusion bodies as a result of 757 insufficient protein degradation. Mol Biol Cell 12, 1393-1407, doi:10.1091/mbc.12.5.1393 (2001). 758 39 Scherzinger, E. et al. Huntingtin-encoded polyglutamine expansions form amyloid-like protein aggregates in vitro 759 and in vivo. Cell 90, 549-558, doi:10.1016/s0092-8674(00)80514-0 (1997). 760 40 Scherzinger, E. et al. Self-assembly of polyglutamine-containing huntingtin fragments into amyloid-like fibrils: 761 implications for Huntington's disease pathology. Proc Natl Acad Sci U S A 96, 4604-4609, 762 doi:10.1073/pnas.96.8.4604 (1999). 763 41 Bersuker, K., Brandeis, M. & Kopito, R. R. Protein misfolding specifies recruitment to cytoplasmic inclusion 764 bodies. J Cell Biol 213, 229-241, doi:10.1083/jcb.201511024 (2016). 765 42 Ramdzan, Y. M. et al. Tracking protein aggregation and mislocalization in cells with flow cytometry. Nat Methods 766 9, 467-470, doi:10.1038/nmeth.1930 (2012).

30 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

767 43 Morley, J. F., Brignull, H. R., Weyers, J. J. & Morimoto, R. I. The threshold for polyglutamine-expansion protein 768 aggregation and cellular toxicity is dynamic and influenced by aging in Caenorhabditis elegans. Proc Natl Acad Sci 769 U S A 99, 10417-10422, doi:10.1073/pnas.152161099 (2002). 770 44 Yamanaka, K., Okubo, Y., Suzaki, T. & Ogura, T. Analysis of the two p97/VCP/Cdc48p proteins of Caenorhabditis 771 elegans and their suppression of polyglutamine-induced protein aggregation. J Struct Biol 146, 242-250, 772 doi:10.1016/j.jsb.2003.11.017 (2004). 773 45 Bauerlein, F. J. B. et al. In Situ Architecture and Cellular Interactions of PolyQ Inclusions. Cell 171, 179-+, 774 doi:10.1016/j.cell.2017.08.009 (2017). 775 46 Takahashi, T. et al. Soluble polyglutamine oligomers formed prior to inclusion body formation are cytotoxic. 776 Hum Mol Genet 17, 345-356, doi:10.1093/hmg/ddm311 (2008). 777 47 Blythe, E. E., Olson, K. C., Chau, V. & Deshaies, R. J. Ubiquitin- and ATP-dependent unfoldase activity of 778 P97/VCP*NPLOC4*UFD1L is enhanced by a mutation that causes multisystem proteinopathy. Proc Natl Acad Sci 779 U S A 114, E4380-e4388, doi:10.1073/pnas.1706205114 (2017). 780 48 Hanzelmann, P., Buchberger, A. & Schindelin, H. Hierarchical binding of cofactors to the AAA ATPase p97. 781 Structure (London, England : 1993) 19, 833-843, doi:10.1016/j.str.2011.03.018 (2011). 782 49 Gendron, J. M. et al. Using the Ubiquitin-modified Proteome to Monitor Distinct and Spatially Restricted Protein 783 Homeostasis Dysfunction. Mol Cell Proteomics 15, 2576-2593, doi:10.1074/mcp.M116.058420 (2016). 784 50 Muchowski, P. J., Ning, K., D'Souza-Schorey, C. & Fields, S. Requirement of an intact microtubule cytoskeleton 785 for aggregation and inclusion body formation by a mutant huntingtin fragment. Proc Natl Acad Sci U S A 99, 727- 786 732, doi:10.1073/pnas.022628699 (2002). 787 51 van Well, E. M. et al. A protein quality control pathway regulated by linear ubiquitination. EMBO J 38, 788 doi:10.15252/embj.2018100730 (2019). 789 52 Morrow, C. S. et al. Vimentin Coordinates Protein Turnover at the Aggresome during Neural Stem Cell 790 Quiescence Exit. Cell Stem Cell 26, 558-568 e559, doi:10.1016/j.stem.2020.01.018 (2020). 791 53 Brenner, S. The genetics of Caenorhabditis elegans. Genetics 77, 71-94 (1974). 792

31 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 1

A. B. Release

p97 Ubiquitin Merge 1μ M Btz - - + + + + 2μ M CB-5083 - + - + - - 1μ M CB-5083 - - - - - + Control

100 kDa Ubiquitin

25 kDa

37 kDa GAPDH Btz (18 hrs) 1 2 3 4 5 6

C. D. E. Control Btz (8 hrs) ** ** 15 * Ubiquitin/Hoechst 100 * * * *

80 465=n 10

60 654=n 967=n

40 5 654=n

465=n

028=n 967=n 20 028=n % cells with aggresomes % cells with aggregates 0 0 Ctrl CB5083 Btz Btz + Ctrl CB5083 Btz Btz + CB5083 CB5083

F. G. p=0.4 80 8 2 μ M CB-5083 ** 6 60 Control 1μM CB-5083

245=n 40 4 Ubiquitin/DAPI

20 2

122=n 122=n

245=n % cells with aggregates % cells with aggresomes 0 0 Ctrl CB5083 Ctrl CB5083 Release (24 hrs) Release Release Figure 2

E. C. A.

Sodium arsenite (2 hrs) bioRxiv preprint Btz 18hrs Btz 18hrs Control (which wasnotcertifiedbypeerreview)istheauthor/funder.Allrightsreserved.Noreuseallowedwithoutpermission. GFP-UBXN1 GFP-UBXN1 UBXN1 UBXN1 doi: G3BP1 G3BP1 https://doi.org/10.1101/2020.09.03.281766 Stress Granules 20S proteasome Ubiquitin Proteostat HDAC6 UBXN1 p47 Merge Merge Merge Merge

;

780.0 +/- 9.0 9.0 +/- 780.0 this versionpostedSeptember3,2020. Merge Merge tneiciffeoc srednaM tneiciffeoc B. D.

F. .

Btz 18hrs Btz 18hrs Nocodazole UBXN1 % cells with single UFD1 UBXN1 UBXN1 NPL4

perinuclear aggresome p47 20 40 60 80 0 The copyrightholderforthispreprint P-bodies n=137 mCh-Dcp1a - Ubiquitin Btz 18hrs Ubiquitin Ubiquitin Ubiquitin Ubiquitin *** Nocodazole n=185 Merge Merge Merge Merge

Merge Merge

370.0 +/- 078.0 078.0 +/- 370.0 560.0 +/- 248.0 248.0 +/- 560.0 781.0 +/- 704.0 704.0 +/- 781.0 t iif rednaM a n d e sr c o eiciffe tn bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 3

B. C. 1 µM Btz - + - + A. HeLa Flp-in TRex Control Btz 18 hrs 100 kDa UBXN1 KO p97

Rescue WT KO KO UBXN1 37 kDa 75 Wildtype GFP-UBXN1 100 kDa

UBXN1 37 Ubiquitin GAPDH 37 UBXN1 KO 25 kDa 1 2 3 37 kDa Ubiquitin / Hoechst GAPDH

1 2 3 4

D. E. GFP-UBXN1 Ubiquitin Merge

100 * **

Control 80

60

40

023=n 864=n 20 171=n % cells with aggresomes

Btz 18 hrs 0 GFP WT Rescue WT KO KO

UBXN1 KO + GFP UBXN1 Rescue

F. Ubiquitin / Hoechst WT UBXN1 KO

Ctrl 2h 4h 6h 8h 18h

Btz bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 4

A. C. 100 * ** WT KD WT KO 80 75 kDa p47 50 kDa NPL4 60

102=n PCNA 25 kDa 37 kDa GAPDH 40

% cells with aggresomes 20

171=n 282=n 864=n B. 0 Control Btz 18 hrs WT p47 NPL4 UBXN1

Wildtype IP endogenous IP NPL4-FLAG IB Myc-UBXN1 D. p97 Elute FLAG peptide IP-FLAG Input (10 % Elution) IP-p97 p47 KO NPL4-HA/FLAG + + + + + + + + + + + + Myc-UBXN1 - - + + - - + + - - + + Myc - GFP + + - - + + - - + + - - 1 μM Btz 18h - + - + - + - + - + - +

UBXN1 37 NPL4 KD p97 100

NPL4 75 250 UBXN1 KO Ubiquitin

75 GFP Ubiquitin/Hoechst 25 1 2 3 4 B 5 6 7 8 B 9 10 11 12 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 5.

UBXN1 KO A. 3 41 206 289 B. mut mut UBXN1 1 UBA cc UBX 312 HFT WT UBA UBX

Binds ubiquitin Binds p97 Dox - - + - + - + 75 kDa 3 41 206 289 GFP mut 1 UBA cc UBX 312 UBA GAPDH 37 kDa 3 41 206 289 mut UBX 1 UBA cc UBX 312

D. E. C. UBXN1 KO 80 100 mut mut GFP-UBXN1 GFP-UBXN1-UBA GFP-UBXN1-UBX * 80 60

60 40 Untreated

40 20

8001=n

6521=n 20 2711=n

8001=n

6521=n

2711=n % cells with aggresomes % cells with aggregates

Btz 0 0 mut mut mut mut WT UBA UBX WT UBA UBX Cytosolic + perinuclear aggregates Perinuclear aggresomes Ubiquitin/ Hoechst

F.

** Untreated ** 100 Btz (18 hrs)

80

60

40 % cells viability 20

0 mut mut WT - WT UBA UBX NPL4 KD sh-p97 (D5)

UBXN1 KO bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint Figure 6 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. * A. B. ** Q91 Ubiquitin Merge 6

4

3824=n

Q91 UBXN1 Merge 2

7313=n 6245=n % cells with Q91 inclusion bodoes 0 siControl siUBXN1-2 siUBXN1-4

C. 100

51.0%

80 sip97-2

47.9% siUBXN1-2

60 siUBXN1-4 + Dox

47.4% siControl 40 Uninduced % of cells

20 22.4%

0 0%

2 3 4 5 0 102 103 104 105 0 10 10 10 10 httQ91-mCherry Fluorscence httQ91-mCherry Fluorscence D. E.

Wild type cdc-48.1 Wild type ubxn-1 ubxn-4

80 80 **** ****

60 **** 60

40 40

20 20 Number of polyQ40-YFP aggregates Number of polyQ40-YFP aggregates n=36 n=36 n=19 n=10 n=36 0 0

ubxn-1 ubxn-4 Wild type Wild type cdc-48.1 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint Supplementary Figure(which 1. was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

HFT sh-p97 A. C.. UBXN1 Ubiquitin Merge D1 D5 Dox - + - + p97 75

Control 37 GAPDH

1 2 3 4 D. 4 - Dox + Dox Btz Release Btz Release Clone D1 6 Btz (hrs) Clone D5

Ubiquitin/Hoechst 8 E.

100 15 ** *** ** ***

80 10 18 60

40 5

n = 250

n = 305

20 % cells with aggresomes % cells with aggresomes

n = 186

n = 251

n = 341 n = 375 n = 318 n = 373 0 0 - -+ + Dox - -+ + Dox B + ++ + Btz + ++ + Release D1 D5 D1 D5

25 ) 2

n = 171 ( µm 20

15

10

5 n = 171 Perinuclear Aggregate area

0 n = 171

Control Btz(8hours) Btz(18 hours) S upplementar Btz 18 hrs A. B.

Btz 18 hrs Control bioRxiv preprint ASPSCR1 y UBXD2 F UBXD8 UBXD1 igure 2 UBXN1 FAF1 (which wasnotcertifiedbypeerreview)istheauthor/funder.Allrightsreserved.Noreuseallowedwithoutpermission. doi: . https://doi.org/10.1101/2020.09.03.281766 Ubiquitin Ubiquitin Ubiquitin Ubiquitin Ubiquitin SH-SY5Y Ubiquitin Merge Merge Merge Merge Merge Merge ; this versionpostedSeptember3,2020. D. C. Btz 18 hrs Ctrl Puromycin 4hrs UBXN1 UBXN1 Ubiquitin E. 10μ F. GAPDH Ubiquitin g/ml CHX 1μ Control CHX M Btz The copyrightholderforthispreprint MM1.S Ubiquitin Ubiquitin ALIS −+ +− + − − + − 4 3 2 1 Ubiquitin / UBXN1 CHX /Btz Btz Hoechst 37 kDa 50 kDa 75 kDa Merge Merge Merge bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Supplementary Figure 3.

A. Ubiquitin/Hoechst B. * 120 ** 100

TW 80 n=109

60 n=127

40

20 % cells with aggresome n=108 Btz (18 hrs) 0 siRNA

Ctrl

9326 enolC 9326 OK 1NXBU OK UBXN1-3 UBXN1-2 50 KDa UBXN1 37 KDa

PCNA 25 KDa 1 2 3

UBXN KO1 Guide 1 Guide 2 Parental 20 41 1 9 12 50 KDa UBXN1 37 KDa

50 KDa βActin

1 2 3 4 5 6 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Supplementary Figure 4.

A siControl sip47 siUBXN1

.

srh 81 ztB 81 srh srh 81 ztB 81 srh

si UFD1 si NPL4 si FAF1

B. siRNA Ctrl p47 siRNA Ctrl UBXN1 Ctrl UFD1 siRNA Ctrl NPL4 siRNA Ctrl FAF1 37 kDa UFD1 75 kDa FAF1 75 kDa p47 50 kDa UBXN1 37 kDa 25 kDa NPL4 50 kDa * 50 kDa

PCNA 25 kDa PCNA 25 kDa PCNA 25 kDa PCNA 25 kDa PCNA 25 kDa bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Supplementary Figure 5.

B. A. 1 μM Btz 6hrs 1 μM Btz 6hrs UBXN1 t UBXN1 UBXN1 mu mut t t Myc-plasmids GFP UBX UBA WT mut mu mut mu 75 kDa Myc-plasmids GFP WT UBA UBX GFP WT UBA UBX p97 50 kDa IP Myc 50 kDa UBXN1 75 kDa Ubiquitin 75 kDa 50 kDa p97 50 kDa

50 kDa WCL 50 kDa UBXN1 MYC-UBXN1

* 25 kDa GFP 25 kDa MYC-GFP * WCL IP Myc *: Light Chain *: Light Chain

C. D. HeLa Flp-in TRex

Wildtype UBXN1 KO NPL4 KD 100

80

WT Btz 18h mut 60 UBA mut UBX 40

20 Release Cumulative Frequency (%)

0 Ubiquitin/Hoechst 0 5 10 15 20 Aggresome area (μm2)

FLAG-HDAC6 E. F. Btz - - + + siControl siHDAC6 Myc-GFP + - + - Myc-p97 - + - + HeLa Flp-in TRex FLAG-HDAC6 150 kDa siControl + - IP Myc siHDAC6 - Btz 18h Myc-p97 + 75 kDa IB FLAG HDAC6 Myc-GFP 25 kDa 150 kDa * 37 kDa FLAG-HDAC6 150 kDa GAPDH

Myc-p97 75 kDa WCL Release

Myc-GFP 25 kDa Ubiquitin/Hoechst GAPDH 37 kDa

*: Light chain bioRxiv preprint doi: https://doi.org/10.1101/2020.09.03.281766; this version posted September 3, 2020. The copyright holder for this preprint Supplementary Figure(which was 6 not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

TAK243 8h M TAK243 A. B. M M M Ubiquitin (FK2) HttQ91-mCherry Merge M M M Btz M Btz+1 μ DMSO0.125μ0.25μ 0.5 μ 1 μ 2 μ 1μ 1 μ

250 kDa Untreated

Ubiquitin 75 kDa

25 kDa TAK243

GAPDH 37 kDa

*** 8 ** C. E. * Uninduced siControl + Dox 104 6 104 0.0 0.8

103 103 4

2 10 102 % cells with IBs 2 1 101 10 n= 6914 mCherry- Pulse Height mCherry- Pulse Height n= 6987 n= 1528 n= 10,139 0 0 100 10 Ctrl TAK243 Btz CB5083 0 200 400 600 800 0 200 400 600 800 mCherry - Pulse Width mCherry - Pulse Width siUBXN1-4 + Dox siUBXN1-2 + Dox 104 D. 104 2.77 4.73 HttQ91-mCherry / Hoechst 103 103

102 102

101 101 mCherry- Pulse Height mCherry- Pulse Height 100 100

0 200 400 600 800 0 200 400 600 800 mCherry - Pulse Width siControl siUBXN1-4 mCherry - Pulse Width

sip97-2 + Dox 104 2.8

103

102

101 mCherry- Pulse Height

100 0 200 400 600 800 mCherry - Pulse Width