ASSESSMENT of Verticillium Dahliae Kleb. and SOIL FUNGAL COMMUNITIES ASSOCIATED with STRAWBERRY FIELDS

ASSESSMENT OF Verticillium dahliae Kleb. AND SOIL FUNGAL COMMUNITIES ASSOCIATED WITH STRAWBERRY FIELDS

MAASIKA PATOGEENI Verticillium dahliae Kleb. JA MULLA SEENEKOOSLUSTE ISELOOMUSTAMINE MAASIKAPÕLDUDEL

SEYED MAHYAR MIRMAJLESSI

A Thesis for applying for the degree of Doctor of Philosophy in Agriculture

Väitekiri filosoofiadoktori kraadi taotlemiseks põllumajanduse erialal

Tartu 2017

Eesti Maaülikooli doktoritööd Doctoral Theses of the Estonian University of Life Sciences

ASSESSMENT OF Verticillium dahliae Kleb. AND SOIL FUNGAL COMMUNITIES ASSOCIATED WITH STRAWBERRY FIELDS

MAASIKA PATOGEENI Verticillium dahliae Kleb. JA MULLA SEENEKOOSLUSTE ISELOOMUSTAMINE MAASIKAPÕLDUDEL

SEYED MAHYAR MIRMAJLESSI

A Thesis for applying for the degree of Doctor of Philosophy in Agriculture

Väitekiri filosoofiadoktori kraadi taotlemiseks põllumajanduse erialal

Tartu 2017 Institute of Agricultural and Environmental Sciences Estonian University of Life Sciences

According to the verdict No 6-14/5-8, the Doctoral Committee of the Agricul- tural Sciences of the Estonian University of Life Sciences has accepted this dissertation for the defense of the degree of Doctor of Philosophy in Agriculture.

Opponent: Professor Franco Nigro, PhD University of Bari, Department of Soil, Plant, and Food Sciences, Bari, Italy Reviewers: Professor Michael Starzycki, PhD Institute of Plant Breeding and Acclimatization-National Research, Department of Genetics and Plant Breeding, Poznan, Poland Professor Anders Kvarnheden, PhD Swedish University of Agricultural Sciences, Department of Plant Pathology, Uppsala, Sweden Supervisors: Professor Marika Mänd, PhD Estonian University of Life Sciences, Institute of Agricultural and Environmental Sciences. Department of Plant Protection, Tartu, Estonia Senior researcher Evelin Loit, PhD Estonian University of Life Sciences, Institute of Agricultural and Environmental Sciences, Department of Field Crops and Grass- land Husbandry, Tartu, Estonia

Defense of this dissertation: Estonian University of Life Sciences, room D239, Kreutzwaldi 5, Tartu on June 20, 2017 at 10:15am.

The English language in the current dissertation was edited by Dr. Ingrid H. Williams and the Estonian by Dr. Evelin Loit and Dr. Luule Metspalu.

Publication of this dissertation is supported by the Estonian University of Life Sciences, Ministry of Education and Research and the Doctoral School of Earth Sciences and Ecology.

LIST OF ORIGINAL PUBLICATIONS ...... 7 ABBREVIATIONS ...... 9 1. INTRODUCTION ...... 10 2. REVIEW OF THE LITERATURE ...... 14 2.1 Soil fungi ...... 14 2.1.1 Functional groups of soil fungi ...... 14 2.1.2 Taxonomic groups of soil fungi ...... 15 2.2 Soil-borne pathogens ...... 15 2.2.1 Strawberry and associated important diseases ...... 16 2.2.2 Verticillium wilt caused by Verticillium dahliae ...... 17 2.2.3 Life cycle of V. dahliae ...... 18 2.3 Pathogen detection ...... 18 2.3.1 Conventional methods ...... 19 2.3.2 Molecular technologies ...... 19 2.3.3 PCR-based techniques (I) ...... 20 2.3.4 Real-time PCR (II) ...... 20 2.4 Assessment of soil fungal diversity ...... 21 2.5 Assessment of soil fungi by next-generation sequencing ..... 22 2.6 Control of Verticillium wilt ...... 22 3. HYPOTHESES AND AIMS OF THE STUDY ...... 24 4. MATERIALS AND METHODS ...... 26 4.1 Systematic review of PCR-based techniques (I) ...... 26 4.2 Sample collecting ...... 27 4.2.1 Isolation of fungi − culture-based method ...... 29 4.2.2 Fungal cultures (III, IV) ...... 30 4.3 Pathogenicity test (VI) ...... 30 4.4 Detection of soil fungi − PCR-based methods (III, IV) ..... 30 4.4.1 DNA extraction ...... 30 4.4.2 Conventional PCR ...... 31 4.4.3 Primer design ...... 31 4.4.4 Real-time PCR ...... 32 4.4.5 Standard curve ...... 32 4.4.6 Spike test (IV) ...... 32 4.5 Characterization of soil fungal communities – Illumina sequencing (V) ...... 33

5 4.6 Biocontrol of Verticillium wilt (VI) ...... 33 4.6.1 Antagonistic ability of T. harzianum on V. dahliae – in vitro ...... 33 4.6.2 Antagonistic ability of T. harzianum on V. dahliae – in vivo ...... 34 4.6.3 Antagonistic ability of G. catenulatum on V. dahliae – in vitro ...... 34 4.7 Bioinformatics and statistical analyses ...... 34 5. RESULTS ...... 35 5.1 Soil fungi ...... 35 5.1.1 Isolation of pathogens and antagonist ...... 35 5.1.2 Detection and quantification of V. dahliae in field soils (III, IV) ...... 35 5.1.3 Validation of detection protocol by spike assay (IV) . 36 5.1.4 Characterization of fungal communities in soil − Illumina sequencing (V) ...... 36 5.2 Biological control of Verticillium wilt (VI) ...... 37 5.2.1 Pathogenicity test (VI) ...... 37 5.2.2 Antagonistic ability of T. harzianum on V. dahliae – in vitro ...... 37 5.2.3 Antagonistic ability of T. harzianum on V. dahliae – in vivo ...... 37 5.2.4 Antagonistic ability of G. catenulatum on V. dahliae – in vitro ...... 38 6. DISCUSSION ...... 39 6.1 Detection and quantification of V. dahliae in strawberry plants and field soils (III, IV) ...... 39 6.2 Characterization of fungal communities in soil (V) ...... 40 6.3 Biological control of Verticillium wilt (VI) ...... 42 7. CONCLUSIONS ...... 45 REFERENCES ...... 48 SUMMARY IN ESTONIAN ...... 63 ACKNOWLEDGEMENTS ...... 68 ORIGINAL PUBLICATIONS ...... 71 CURRICULUM VITAE ...... 145 ELULOOKIRJELDUS ...... 148 LIST OF PUBLICATIONS ...... 151

6 LIST OF ORIGINAL PUBLICATIONS

This dissertation is based on the following papers; the references to the papers are given in Roman numerals in the text. The papers are repro- duced by kind permission of the journals.

I Mirmajlessi SM, Destefanis M, Gottsberger RA, Mänd M, Loit E, 2015. PCR-based specific techniques used for detecting the most important pathogens on strawberry: a systematic review. Systematic Reviews 4, 9.

II Mirmajlessi SM, Loit E, Mänd M, Mansouripour SM, 2015. Real- time PCR applied to study on plant pathogens: potential applications in diagnosis. Plant Protection Science 51(4), 177–190.

III Mirmajlessi SM, Larena I, Mänd M, Loit E, 2016. First report on the detection and quantification of Verticillium dahliae from Esto- nian strawberry fields using quantitative real-time PCR. Zemdirbyste- Agriculture 103(1), 115–118.

IV Mirmajlessi SM, Larena I, Mänd M, Loit E, 2016. A rapid diagnostic assay for detection and quantification of the causal agent of strawberry wilt from field samples. Acta Agriculturae Scandinavica, Section B — Soil & Plant Science 66(7), 619–629.

V Mirmajlessi SM, Bahram M, Mänd M, Mansouripour SM, Loit E, 2017. Survey of soil fungal communities in strawberry fields by Illumina amplicon sequencing. European Journal of Plant Pathology, Under Review.

VI Mirmajlessi SM, Mänd M, Najdabbasi N, Larena I, Loit E, 2016. Screening of native Trichoderma harzianum isolates for their ability to control Verticillium wilt of strawberry. Zemdirbyste-Agriculture 103(4), 397–404.

7 The contributions from the authors to the papers are as follows: Idea and Sampling Laboratory Data Manuscript design work analysis preparation I SMM, EL, SMM - SMM SMM, EL, MD, MM RAG II SMM, EL SMM - SMM SMM, EL, MM, MM SMM III SMM, SMM, NN, SMM, IL, SMM, IL SMM, EL, IL MM, EL EL, MM NN IV SMM, EL SMM, NN, SMM, IL SMM, IL SMM, EL, MM MM EL, MM V SMM, MB, SMM, NN SMM, MB SMM, SMM, MB, EL EL, MM MB, SMM VI SMM, MM SMM, NN SMM, NN SMM, SMM, EL, MM, IL SMM SMM – Seyed Mahyar Mirmajlessi; EL – Evelin Loit; MM – Marika Mänd; NN – Neda Najdabbasi; SMM – Seyed Mojtaba Mansouripour; IL – Inmaculada Larena; MD – Marialaura Destefanis; RAG – Richard Alexander Gottsberger; MB – Mohammad Bahram;

8 ABBREVIATIONS

AM Arbuscular mycorrhizae APDA Acidified potato-dextrose agar ARISA Automated ribosomal intergenic spacer analysis BCA Biological control agent BLAST Basic local alignment search tool bp Base pair cPCR Conventional PCR Ct Threshold cycle DGGE Denaturing gradient gel electrophoresis DNA Deoxyribonucleic acid FAO Food and Agriculture Organization HTS High throughput sequencing ITS Internal transcribed spacer Mb Megabases mPCR Multiplex PCR MS Microsclerotia NCBI National Center for Biotechnology Information NGS Next generation sequencing nPCR Nested PCR OTU Operational taxonomic unit PCR Polymerase chain reaction PDA Potato dextrose agar pH Potential hydrogen rRNA Ribosomal ribonucleic acid rtPCR Real-time quantitative PCR SDW Sterile distilled water SRA Short-read archive SSR Simple sequence repeat T-RFLP Terminal restriction fragment length polymorphism UV Ultraviolet

9 1. INTRODUCTION

Strawberry (Fragaria × ananassa) is a high value crop grown for its berries in many countries. It is very popular for its high nutritive value being a rich source of health-promoting phytonutrients, minerals and vitamins, and different cultivars have been developed for commercial production. According to the Food and Agriculture Organization (FAO), it was estimated that world production of strawberry has exceeded 8.1 million tons per year since 2014. China is the world’s leading producer of strawberry, approximately 38.7% of the total production, followed by the United States (17.5%), Mexico (4.9%), Turkey (4.8%) and Spain (4%), which is also the largest exporter of strawberries in Europe (Faostat, 2016). The European Union’s strawberry production decreased by about 5.6%, falling from 1,119 million tons to 1,056 million tons during the years 2001-2011 (Faostat, 2014). The strawberry industry in Estonia has been oscillating, with the production area decreasing from 1095 to 605 hec- tares during 2004-2014 (Statistics Estonia, 2016). The major challenge is the limited selection of cultivars suitable for the Nordic climate that are also susceptible to several diseases (Redondo et al., 2009). New and previously non-significant diseases continue to emerge as the soil microbiome changes due to the use of chemicals and changing agricultural practices (Duniway, 2002).

Soil is a great reservoir of microorganisms, which are indirectly involved in determining the quality of crop yield (Reganold et al., 2010; Nal- lanchakravarthula et al., 2014). Also, due to the complexity of soil systems and the inadequacy of conventional techniques for describing microbial community composition, it is difficult to diagnose and forecast all ongoing diseases (Reeve et al., 2010). Soil community structure affects the epidemic dynamics of diseases, so plant disease is the result of the interactions between the host, the pathogen and the environment which are favorable to disease development (Kraft & Pfleger, 2001). Strawberry fields are often subjected to a disease complex involving different soil- borne pathogens inducing similar disease symptoms. These pathogens are usually damaging, reducing strawberry crop quality and yield, and are problematic especially when they remain alive in soil under unfavorable conditions for many years by producing resistant structures (Weller et al., 2002). In general, soil-borne fungal pathogens are causal agents of berry diseases such as damping-off, root rot, and vascular wilt (Lichtenzveig

10 et al., 2006). One of the most widespread and destructive diseases of strawberry is Verticillum wilt caused by Verticillium dahliae. Annual crop losses due to this pathogen are estimated to be in the billions of dollars worldwide on many crops (Wei et al., 2015).

Verticillium wilt has also been recognized as a serious soil-borne disease in Northern Europe, where the climate is humid and cold, and may cause significant strawberry crop loss even with low inoculum density (Pegg & Brady, 2002). The fungus survives without its proper host plant in the soil or in dead plant tissues for long periods (more than 25 years) by generating melanized microsclerotia (MS) (Pérez-Jiménez et al., 2012). Since inoculum densities of as few as two MS per gram of soil (MS g−1soil) can cause 100% wilt in strawberry (Harris & Yang, 1996), knowing about the presence and amount of V. dahliae in the soil can be a key factor in determining appropriate management strategies. So, there is a need for a quick and precise method to assess the inoculum densities of V. dahliae in fields as early diagnosis of the pathogen is extremely important for adop- tion of management strategies to minimize their spread into new areas. Conventional diagnostic methods such as plating-based methods can be used to determine the pathogen inoculum density in plant materials and soil. The probability of detection has largely relied on the symptoms and morphological characterizations of the pathogen, but these methods are often time-consuming (6-8 weeks) and laborious (Goud & Termorshu- izen, 2003). Polymerase chain reaction (PCR)-based techniques such as conventional PCR (cPCR) have provided a faster way compared with conventional methods. However, real-time quantitative PCR (rtPCR) systems provide a more accurate detection and quantification of the pathogen with a higher level of sensitivity and specificity (Bilodeau et al., 2012). Given the rapid nature of this technique, it is possible to estimate inoculum density of the pathogen in commercial crop production in real time, which is not achievable with other PCR-based methods. Though there is often a relationship between inoculum density in soil and incidence of Verticillium wilt, this relation usually depends on the suscepti- bility of the host plant in the field (Harris et al., 1996; Lopez-Escudero et al., 2007; Wei et al., 2016).

Management of Verticillium wilt is frequently challenging due to the broad host range of the pathogen and the longevity of its propagules (microsclerotia) in the soil (Goud et al., 2011). Several strategies such as host resistance, cultural, chemical and biological controls are gener-

11 ally used to control soil-borne diseases. Although host resistance is as an effective control method, full resistance is unavailable in most crops (Shaw et al., 2005). The breeding of new strawberry cultivars was mainly focused on high yield and good shelf life, so that other properties such as high-quality flavor and resistance to diseases have been partially neglected (Olbricht et al. 2008). Avoiding fields previously used for susceptible crops (eg. lettuce, tomato, cotton, eggplant and potato) and increasing crop diversity in rotations have been also proposed as useful cultural practices to decrease the severity of strawberry Verticillium wilt (Subbarao et al., 2007; Njoroge et al., 2009). Application of soil fumigants, such as methyl bromide or a mixture of methyl bromide and chloropicrin, has been effective in population of microsclerotia (De Cal et al., 2004), although this tactic has been phased out in recent years due to hazardous chemical residues in the environment. Likewise, since V. dahliae microsclerotia may persist in soil for many years without its susceptible host, chemical control is almost impossible (Maas, 1998). Biological control is an environmentally friendly alternative for controlling soil-borne diseases in agricultural systems where numerous species utilize common resources. The use of viable antagonistic organisms as biological control agents (BCAs) has been increasing worldwide. The major difference between biological control and other control methods is the use of living beneficial microorganisms which have various modes of action, preventing the risk of fast appearance of resistance in the target population. However, the success of BCAs depends not only on their interactions with host plants but also on their ecological fitness (Alabouvette et al., 2009).

The general goal of the present dissertation was to assess V. dahliae inoculum density and soil fungal communities associated with Estonian strawberry fields in order to provide a better understanding of their population dynamics with the aim of improving disease management strategies. In this respect, PCR-based methods used for detection and/or quantification of the most widespread strawberry pathogens over a 20-year period were systematically reviewed, intended to establish common diagnostic methods for routine testing by comparing their performances (I). In the second paper, a general description of different rtPCR chemistries applied in plant pathology for routine detection and quantification of phytopathogens was also illustrated (II). In other papers (III, IV), a SYBRGreen real-time PCR assay combined with a conventional soil plating technique was developed to detect and quantify V. dahliae directly from field-grown strawberries and soils as the first study in Estonia. Moreover, soil fungal

12 communities in several strawberry production areas in Estonia using Illu- mina-based sequencing were investigated as the first study, which may improve available management strategies against strawberry soil-borne diseases (V). Lastly, the antagonistic potential of a native BCA collected from Estonian fields toward V. dahliae was assessed in the greenhouse with the aim of restricting the use of chemical compounds and protecting biological resources as well (VI). In a similar study, the antagonistic ability of Gliocladium catenulatum isolated from a bifungicide (Prestop®Mix) was in vitro investigated to understand its possible activity as BCA against V. dahliae.

13 2. REVIEW OF THE LITERATURE

2.1 Soil fungi

Soil fungi are substantial components of microbial communities and play a fundamental role in terrestrial ecosystems. Many important soil-borne pathogens and plant growth promoting microorganisms are fungi. They are eukaryotic single-celled or multinucleate organisms that usually grow as long threads or strands called hyphae, which find their way between soil particles and roots. Hyphae occasionally generate a mass called the mycelium which absorbs nutrients from the root, organic matter or soil. However, a few fungi, such as yeasts, are single cells (Lin & Brookes, 1999).

2.1.1 Functional groups of soil fungi

According to the mode of nutrition, soil fungi can be classified into three general functional groups: decomposers, mutualists and pathogens. Decomposers or saprophytic fungi are the largest proportion of fungal species in soil and able to decompose plant polymers such as lignin, cellulose and hemicellulose, and so play a vital role in immobilizing and retaining nutrients in the soil (De Boer et al., 2005; Maron et al., 2011). Furthermore, saprotrophic fungi release nutrients that can be used by other microorganisms, making these fungi vital for the health of soil ecosystems. Mutualists or mycorrhizal fungi colonize plant roots where they help solubilize phosphorus and bring soil nutrients such as nitrogen and micronutrients to the plant, while the host plant reciprocally provides carbon assimilation (Smith & Read, 2008). Arbuscular mycorrhizae (AM), as the most common mycorrhizal type in agricultural plant asso- ciations, protect roots from pathogens and pests by producing a mass of hyphae (Whipps, 2004) and also increase the plant’s contact with soil, improving access to nutrients (Streitwolf-Engel et al., 1997). Pathogens or parasites, as the third group of fungi, cause reduced plant production or plant death when they colonize roots. The pathogenic fungi are usually in high abundance in the soil especially where disease symptoms are observed. Numerous soil fungal pathogens such as the genera Verticillium and Fusarium, cause vascular wilt diseases and so lead to major economic losses in production (Tarkka et al., 2008). Basically, the total number of species present and their distribution comprise components of soil fungal

14 diversity (Øvreås, 2000). This diversity fluctuates under various conditions such as plant species, soil type, pH and agricultural practices (Berg and Smalla 2009). For instance, difference in fungal community in two potato farming systems has been reviewed by Sugiyama et al., (2010) in which organic potato farms displayed a slightly higher fungal diversity compared with conventional potato farms.

2.1.2 Taxonomic groups of soil fungi

Fungi and fungus-like organisms are widely distributed in all ecosystems and contain all major phyla including Ascomycota, Basidiomycota, Chyt- ridiomycota, Zygomycota, Glomeromycota and Oomycota (non-true fungi) (Webster & Weber, 2007). Ascomycota, or sac fungi, constitute by far the largest and the most diverse phylum of fungi with approximately 65 % of all described fungi (Kirk et al., 2008). Basidiomycota are filamentous fungi which comprise hyphae (except for those forming yeasts) and include approximately 32% of the known species of true fungi (Kirk et al., 2008). Chytridiomycota, or chytrids, are one of the early diverg- ing fungal lineages with a total of around 1000 described species (James et al., 2006). The majority of chytrids are saprobic, degrading resistant materials such as cellulose, chitin and keratin (Barr, 2001). They are also parasitic on a wide variety of plants in soil. Glomeromycota encompasses approximately 230 described species which are mutualistic with a multi- tude of plants, forming arbuscular mycorrhizae in soil (Oehl et al., 2011). Although most of them live in soil, some are pathogens of plants, insects and small animals (Raven et al., 2005). Zygomycota with approximately 1% of the described species are a particularly ecologically diverse group of true fungi in terrestrial ecosystems (Kirk et al., 2008). Oomycota with more than 800 species form a distinct phylogenetic lineage of fungus-like eukaryotic microorganisms that may be saprobic or parasitic on terrestrial or aquatic plants and animals. With respect to morphological and physiological characteristics, these filamentous microorganisms resemble true fungi, but they are phylogenetically related to diatoms and other heterokonts (Dick et al., 1999).

2.2 Soil-borne pathogens

In most agricultural systems, soil-borne plant pathogens are frequently known as a major limiting factor in crop production. In comparison

15 with air-borne plant pathogens that attack the above-ground parts of plants, control of soil-borne pathogens are more challenging as they often persist in the soil for many years and also each crop plant may be susceptible to several of them (Fitt et al., 2006). Moreover, many soil-borne fungi and fungus-like organisms produce resilient structures such as chla- mydospores, sclerotia, melanized mycelia or oospores to survive in the soil under unfavorable conditions for prolonged periods (Kraft & Pfleger, 2001). Occasionally, complex diseases caused by simultaneous infections from several soil-borne pathogens can also result in more damage to the crop (Raaijmakers et al., 2009). Generally, since soil is a complex environment, it is always challenging to predict, detect and diagnose all the ongoing diseases caused by soil-borne pathogens before serious damage happens.

2.2.1 Strawberry and associated important diseases

Strawberry as one of the most adaptable fruit crops worldwide is grown from the Tropics to near the Arctic Circle. Commercially, strawberries are often grown in flat or raised beds. Although strawberries are highly adaptable, proper site selection is very important for production of high-quality fruit. Soil with a pH ranging from 5.5 to 7.0 provides the best growth (Barney, 1999). Plants have a short thickened stem (crown) with a growing point at the upper end and roots at its base (Fig. 1). Since roots are frequently shallow (~30 cm), they do not tolerate droughty soils. Strawberry plants can grow in a wide range of soil types, but the best performance as well as the lowest disease risk is obtained in well drained soils such as sandy loams (Barney, 1999). In contrast, poor drainage or heavy clay soils cause reduced plant growth and a higher incidence of soil-borne diseases (Raaijmakers et al., 2009).

Figure 1. Strawberry plant schematic structure (Michele Warmund, 2016).

16 Strawberry diseases can be severely devastating to plant agronomic performance. Most strawberry cultivars are highly susceptible to several destructive and economically important soil-borne pathogens, causing important diseases such as vascular wilts, crown and root rots (Mirmajlessi et al., 2015a). Such diseases are mainly caused by single/multiple soil-borne fungi or Oomycets such as Verticillium dahliae, Fusarium oxysporum f.sp. fragariae, Rhizoctonia solani, Colletotrichum acutatum, Macrophomina phaseolina, Phytophthora cactorum and Pythium ultimum.

2.2.2 Verticillium wilt caused by Verticillium dahliae

One of the most widespread and destructive diseases of strawberry is Verticillium wilt caused by Verticillium dahliae Kleb. in the division Asco- mycota, which occurs frequently in most strawberry plantation areas. The fungus has a wide host range and infects over 400 different host plants, including many fruit trees, vegetable plants and shrubs as well as numerous weeds and some cover crops (Berlanger & Powelson, 2005). Verticil- lium wilt is favored by cold weather particularly in poorly drained soils following a cool and rainy spring. Likewise, disease severity will increase when high levels of nitrogen are applied together with planting of susceptible cultivars. Due to varying environmental circumstances, symptoms of verticillium wilt differ in various host species (Berlanger & Powelson, 2005) that include stunting, brownish streaks in the vascular tissue of crown roots, premature defoliation, sudden wilting and yellowing of foli- age (Fig. 2). The disease symptoms may appear on only one branch or the entire host plant. Occasionally, there may be no symptoms of disease for many years, but the infection decreases plant strength (Agrios, 2005).

Figure 2. Strawberry plant affected by Verticillium wilt (Photo: Michael Ellis).

17 2.2.3 Life cycle of V. dahliae

Verticillium species are opportunistic fungi that remain in soils as sap- rophytes. Naturally, V. dahliae exists in superficial soil layers where the best growing temperature ranges between 20°C - 26°C. The pathogen overwinters by producing the tiny and black resting structures, known as microsclerotia (MS), in the soil and begins infection under favorable conditions, especially when root exudates of host or non-host plants stim- ulate MS to germinate and penetrate feeder roots (Berlanger & Powelson, 2005) (Fig. 3). By developing MS in the soil, the pathogen can persist for a long period (over 25 years) even in the absence of susceptible hosts. (Uppal et al., 2008). The pathogen invades the plant’s vascular system and so blocks vascular tissues by mycelia and conidia, preventing water and nutrients from reaching the upper parts of the host plant. Conse- quently, the infected plant tissues deprived of water reveal symptoms of foliar chlorosis and wilting, and then quickly die (Agrios, 2005).

Figure 3. Disease cycle of Verticillium wilt disease (Berlanger & Powelson, 2005).

2.3 Pathogen detection

Many fungal diseases such as Verticillium wilt gradually spread out into new plantation areas through infected soils or plant materials. So, having an early disease detection system can greatly help to avoid the spread of

18 diseases and to decrease such losses caused by plant pathogens (Sankaran et al., 2010). Indeed, successful disease management needs rapid and reliable detection and/or quantification of pathogens to ensure that control strategies address the specific aspects of the target pathogen(s) and improve productivity (Platt & Mahuku, 2000).

2.3.1 Conventional methods

Detection and quantification of the V. dahliae has traditionally depended on plating soil on semi-selective media and counting colonies after incubation. Soil assays for Verticillium are categorized by whether dry soil is plated (dry-sieving) or the soil is suspended in water prior to plating (wet-sieving) (Parks & Crowe, 2002). These methods require Verticil- lium to grow in the media and produce microsclerotia for identification (Pegg & Brady, 2002). Generally, traditional methods have often relied on culturing of the pathogen followed by morphological characterizations which can take several days and so are time consuming and laborious (Lievens et al., 2006). For instance, isolating V. dahliae using culture-based techniques can be challenging as Verticillium spp. grow slowly in culture media in comparison with other fungi which usually overgrow the plates before V. dahliae can be detected and identified morphologically (Ausher, 1975). Overall, in spite of the capability of these techniques, there is a need for a fast, accurate and sensitive method for the detection of pathogens.

2.3.2 Molecular technologies

In recent years, detection of plant pathogens using molecular techniques have been developed. Without accurate disease diagnosis, proper control measures cannot be used at the appropriate time. Molecular systems are able to identify non-culturable microorganisms and provide accurate, sensitive and reliable outcomes, facilitating early disease management decisions (Martin et al., 2000). The most common molecular technology applied in detecting plant diseases is based on specific deoxyribose nucleic acid (DNA) sequences of the pathogen(s) and the use of PCR-based techniques (Sankaran et al., 2010). Basically, the sensitivity of the molecular techniques is related to the minimum amount of microorganism DNA that can be detected in a sample (Schena et al., 2013).

19 2.3.3 PCR-based techniques (I)

PCR-based techniques are fast and sensitive methods that provide advantages over the traditional methods. Conventional PCR (cPCR) has become an important technique for diagnostic tests in plant pathology and has reduced the problems associated with detection of plant pathogens (Martin et al., 2000). In this technique, after extracting, purifying and amplifying the genomic DNA, the presence of the pathogen of interest approves in gel electrophoresis to analyze the amplified PCR products (Sankaran et al., 2010). Depending on the genomic region chosen to design PCR primers, highly specific diagnostic tests have been obtained, allowing detection of the specific pathogen (Schena et al., 2013). Gen- erally, these methods are more sensitive, accurate and faster than conventional methods. So far, PCR-based techniques using species-specific primers have been widely applied for the identification and detection of V. dahliae in different plant tissues and soils (Nazar et al., 1991; Hu et al., 1993; Li et al., 1999; Platt & Mahuku, 2000; Mahuku & Platt, 2002; Kageyama et al., 2003). Among them, cPCR and nested PCR (nPCR) are broadly described as potential assay for detection of V. dahliae in the strawberry plant and soil (Kuchta et al., 2008; Mirmajlessi et al., 2015a). Different genomic regions have been used for primer design. The rDNA operon has often been applied for highly sensitive detection (Schaad et al., 2003). An internal transcribed spacer (ITS) region within eukaryotic rDNA operons has been described as a stable genetic marker and it is the most widely sequenced to design primers in most studies. Conventional PCR can be used for qualitative studies, but not for quantitative analysis of phytopathogens (Schena et al., 2013).

2.3.4 Real-time PCR (II)

Access to fast and precise methods for quantifying pathogens is extremely important for the improvement of decision making in disease management. Quantitative real-time PCR (rtPCR) technology, using fluorogenic dyes or probes, allows accurate detection and/or quantification of pathogens that cannot be extracted or cultured easily from environmental samples, or are presented at low inoculum load in plant material and soil (Mirmajlessi et al., 2015b). Using this technique, PCR amplification can be monitored in real time by assessing the intensity of fluorescent signals which are comparative to the amount of product generated during the PCR amplification (Lang et al., 2012), providing a reliable estimation of

20 the pathogen load. It can even discriminate between closely related species and so is a high throughput technique for the reliable and accurate quantification of target DNA in various biological samples (Cooke et al., 2007; Schena et al., 2013). Real-time PCR commonly amplify very short DNA fragments (70–100 bp) which favors a higher level of sensitivity and efficiency compared with cPCR (Garrido et al., 2009). Primers designed for cPCR can be adapted for use in rtPCR assays, resulting also in a high level of sensitivity (Okubara et al., 2005). Real-time PCR is being increasingly used for the detection and quantification of V. dahliae on different hosts (Dan et al., 2001; Fradin & Thomma, 2006; Lievens et al., 2006; Atallah et al., 2007; Gayoso et al., 2007; Banno et al., 2011; Debode et al., 2011; Lang et al., 2012; Wang et al., 2013). It has been shown in many studies that rtPCR is more sensitive than cPCR and applied for routine detection and/or quantification of a wide range of plant pathogens in various environmental samples. Bilodeau et al., (2012) showed that rtPCR is specifically able to detect one to two microsclerotia/g of V. dahliae in soil of strawberry fields, which represents a higher sensitivity compared to other methods used.

2.4 Assessment of soil fungal diversity

Soil fungal communities are analyzed conventionally by culture-dependent techniques which only allow the isolation of fungal spores and/or hyphae, recovering a small subset of the community. Also, due to the presence of fast-growing species in the soil, and the fact that many fungi are unculturable and/or need specific growth requirements, this approach cannot provide a comprehensive understanding of the fungal community structures in soil (Aoki et al., 2015). To overcome these limitations, sequence-based studies using PCR have been performed to amplify target regions of fungal DNA extracted directly from different environmental samples followed by cloning and sequencing (Daniell et al., 2001; Buchan et al., 2002; Vandenkoornhuyse et al., 2002; Schadt et al., 2003; Kirk et al., 2004). Likewise, many studies have also been carried out on using culture-independent, PCR-based techniques such as terminal restriction fragment length polymorphism (T-RFLP) (Yu et al., 2009), automated ribosomal intergenic spacer analysis (ARISA) (Kovacs et al., 2010), denaturing gradient gel electrophoresis (DGGE) (Li et al., 2012) and Sanger sequencing (King et al., 2015). These techniques are restricted because of lack of information about the taxonomic affiliation of the phylotypes

21 and their ability to measure richness of species in complex communities (O’Brien et al., 2005).

2.5 Assessment of soil fungi by next-generation sequencing

Next-generation sequencing (NGS), also known as high throughput sequencing (HTS), is a new DNA sequencing method, which has revo- lutionized ecological studies of fungi at a much higher resolution than was previously possible by Sanger sequencing (Xu et al., 2012a). Com- pared to culture-independent techniques, they produce a higher number of sequences (thousands or millions) at the same time, allowing a deeper analysis of the microbial components of the ecosystems (Mayo et al., 2014). Though both 454 pyrosequencing and Illumina Miseq, as HTS platforms, are reliable for quantitatively assessing genetic diversity within natural communities (Hirsch et al., 2010), 454 pyrosequencing has been largely applied for sequencing of soil fungi (Öpik et al., 2009; Buée et al., 2009; Jumpponen et al., 2010; Dumbrell et al., 2011; Xu et al., 2012b). Illumina Miseq yields longer and more accurate sequence data despite the substantially shorter read length relatively to 454 pyrosequencing and the comparable average sequencing error in the raw reads (Chengwei et al., 2012). Commonly, fragments in the size range of ITS1 or ITS2 can be readily sequenced on the Illumina MiSeq platform (Schmidt et al., 2013). In comparison with 454 platform, this technology generates typical reads of 150-300 bp that can be increased to 300-600 bp via “paired-end” sequencing (i.e., sequencing both ends of the same DNA) and also provides sequencing at a great depth with a low price for the high output of sequences (Mayo et al., 2014). So, this technique is increasingly being used to assess the composition and diversity of soil microbial communities in various ecosystems (He et al., 2013; Huang et al., 2015; Miao et al., 2016).

2.6 Control of Verticillium wilt

Verticillium wilt disease cannot be treated once the pathogen has entered the plant, or even after removal of the plants when the pathogen is in the soil. The cultivation of resistant cultivars, as a relevant method, is unsuc- cessful to effectively control Verticillium wilt since host resistance is frequently not stable and durable (Ma, 2003). Also, conventional fungicides

22 are not very efficient as microsclerotia may persist in soil for many years (Berg et al., 2001). Besides, intensive use of broad-spectrum fumigants has caused drastic problems of chemical residues in the environment so that, the worldwide phase-out of these fumigants has intensified in recent years. In this respect, the European Commission has approved a legislative agreement (Directive 2009/128/EC), which regulates the use of plant protection products in order to establish integrated control and non-chemical means as an effective and sustainable alternative to fight against diseases, pests and weeds. Therefore, the use of synthetic pesticides is being progressively reduced, and it is supplemented by an increased reliance on the use of microorganisms as biocontrol agents (De Cal et al., 2012). However, cultural practices, removing plants that exhibit disease symptoms and also using cover crops as a form of green-manuring can be considered (Mattner et al., 2008; Witzel et al., 2013).

Biocontrol systems often use natural living microorganisms known as antagonists, which are able to decrease the effects of undesirable microorganisms. Amongst microorganisms as BCA, species of Trichoderma spp. are the most outstanding, in which T. harzianum Rifai is extensively employed against a wide range of phytopathogens such as V. dahliae, R. solani, Botrytis cinerea, F. oxysporum and P. ramorum (Agrios, 2005; Berg et al., 2005; Santamarina & Roselló, 2006; Naeimi et al., 2010; Cheng et al., 2012; Carvalho et al., 2014; Widmer, 2014; Ruano-Rosa et al., 2016). Basically, competition for space and nutrients, antibiosis through the production of inhibitory metabolites (volatiles/non-volatiles), induction of the plant’s systemic resistance and mycoparasitism have been described as antagonistic mechanisms of Trichoderma species (Harman et al., 2004), making them interesting candidates to investigate by sharing almost 50% of fungal BCAs market worldwide (Whipps & Lumsden, 2001; Verma et al., 2007). Recently, the use of biofungicides has been widely increased by organic growers to control soilborne diseases of vegetable crops. For instance, Prestop®Mix is a microorganism preparation based on the naturally occurring soil fungus Gliocladium catenulatum (strain J1446), affecting a wide range of pathogens including Rhizoctonia spp., Fusarium spp., Pythium spp. and Phytophthora spp. However, other soil fungi including G. virens, G. roseum, Aspergillus alutaceus, Talaromyces flavus, Paecilomyces lilacinus and T. viride are potentially able to reduce the incidence of Verticillium wilt caused by V. dahliae (Picman & Schneider, 1990; Keinath et al., 1991; Naraghi et al., 2010).

23 3. HYPOTHESES AND AIMS OF THE STUDY

In agricultural systems, good soil health is one of the fundamental requirements for plant production. The balance between beneficial and pathogenic microorganisms can be an indicator in the determination of soil health, highlighting the importance of studying soil fungal communities. Soil-borne pathogens frequently arise together, which can increasingly strengthen severity of disease. Nevertheless, it is always challenging to comprehend dynamics of all diseases due to the complexity of soil conditions. Verticillium wilt disease caused by V. dahliae is one of the destructive soil-borne diseases worldwide that leads to severe yield losses in strawberry fields. Although rapid identification and detection methods are becoming more available, quantifying pathogens such as V. dahliae remains one of the main challenges in the disease management. In this dissertation, we also aimed to unveil the association of soil fungal diversity with the occurrence of Verticillium wilt, which may help to provide baseline information for applying suitable management strategies against strawberry diseases and even choosing suitable strawberry cultivars. Indeed, the composition of fungal communities in different strawberry production sites is poorly known. Additionally, finding new potential biocontrol agents was also important in terms of their implica- tions for biological control.

The specific aims and hypotheses of the dissertation are:

1) to investigate the feasibility of PCR-based methods for specific and reliable detection and/or quantification of the most widespread strawberry pathogens in various environmental samples (I, II). Hypothesis: real-time PCR is a particularly promising technique for diagnosing and quantifying pathogen densities, whereas some other techniques are mostly suitable for the identification/detection of pathogens.

2) to develop a sensitive and specific rtPCR assay using SYBRGreen- based chemistry to quantitatively assess V. dahliae abundance directly from field-grown strawberries and soil in Estonia for the first time (III). Hypothesis: while comparing the used PCR-based methods in literature, rtPCR remains the ideal standard technique for detection and quantification of V. dahliae in strawberry fields.

24 3) to evaluate the abundance of V. dahliae microsclerotia in the soil of strawberry fields using the conventional soil plating technique and compare these estimates with data obtained from quantitative rtPCR (IV). Hypothesis: in comparison with soil plating technique, rtPCR allows rapid detection and quantification of the pathogen at a very low level in soils and even in symptomless plants.

4) to study the applicability of the NGS approach for Illumina-Miseq platform to improve understanding of the structure of fungal communities associated with soils of strawberry fields in Estonia where plants show different disease symptoms (V). Hypothesis: the high-throughput sequencing of samples using Illumina Miseq platform enables discovery of a large diversity of fungi and their co-occurrence patterns in the soil of different strawberry plantation areas.

5) to explore the possible role of antagonistic properties of G. catenulatum isolated from a biofungicide as well as native T. harzianum isolates obtained from soil of field-grown strawberries for controlling strawberry Verticillium wilt (VI). Hypothesis: native T. harzianum and G. catenulatum isolates reveal potential antagonistic effects toward strawberry pathogen V. dahliae.

25 4. MATERIALS AND METHODS

In this section, a brief overview of the methods used throughout the dissertation is provided. Detailed descriptions of the methods can be found in each specific paper.

4.1 Systematic review of PCR-based techniques (I)

A meta-synthesis (systematic review) based on published PCR protocols was provided for detection and quantification of the most widespread strawberry pathogens including F. oxysporum f.sp. fragariae, P. fragariae, C. acutatum, V. dahliae, B. cinerea, M. phaseolina and Xanthomonas fragariae to establish a common diagnostic PCR based-method for routine testing. Basically, review studies can be classified into two main catego- ries; the ‘traditional review’ (e.g. II) and the ‘systematic review’ (e.g. I). The following table (1) summarizes the major differences between them.

Table 1. Differences between systematic literature review and traditional review articles (Rother, 2007). Traditional review Systematic review Authors One or more authors usually ex- Two or more authors are involved in system- perts in the topic atic reviews Study No study protocol Includes details of the methods to be used protocol Research Broad to specific question; No Specific question with some components such question hypothesis as population, intervention, and Outcome; With hypothesis Search No detailed search strategy, search Includes detailed and comprehensive search strategy is conducted using keywords strategy Sources Not usually stated, usually well- List of databases, websites and other sources of litera- known articles. Prone to publica- of included studies are listed. Both published ture tion bias and unpublished literature are considered Selection No specific selection criteria. Specific inclusion and exclusion criteria criteria Prone to selection bias Critical Variable evaluation of study qual- Difficult appraisal of study quality appraisal ity Synthesis Often qualitative synthesis Narrative, quantitative or qualitative synthesis Conclu- Sometimes evidence based but Conclusions drawn are evidence based sion can be influenced by author’s per- sonal belief Update Cannot be continuously updated Can be periodically updated to include new evidence

26 Figure 4. Flow diagram of the study selection process for the systematic review.

Multiple research studies were critically analyzed according to the PCR protocol used, primer sets and target DNA, pathogen treatment and sensitivity of detection method as outlined (I). Using appropriate subject headings, multiple large databases including AGRIS, AGRICOLA, Bio- logical Abstracts, BASE, Google Scholar, CAB Abstracts, Scopus, Sprin- gerLink and Web of Knowledge were searched from their inception up to April 2014. A statistical meta-analysis was not justified due to the heterogeneity of the included studies. The original systematic search strategy identified 261 non-duplicate and potentially relevant publications from 1996 to 2013, of which 204 articles were removed based on the content of the title and/or abstract. Based on predefined inclusion criteria, 57 articles were read and evaluated. Besides, two studies were included by checking references. Finally, 37 publications were excluded because they did not meet the eligibility criteria, bringing the sum of selected articles to 22 (Fig. 4).

4.2 Sample collecting

Plant and soil samples were randomly collected from different strawberry fields located in major production areas of Estonia (Vasula, Rohu,

27 Figure 5. Map of sampling areas. Sampling sites are shown with numbers: 1 – Kaie-Mare (58°6’ N, 26°54’ E), 2 – Vasula (58°47’ N, 26°73’ E), 3 – Utsu (58°40’ N, 26°80’ E), 4 – Marjamaa (58°90’ N, 24°42’ E), 5 – Unipiha (58°26’ N, 26°58’ E), 6 – Rõhu (59°09’ N, 26°48’ E). (Google map)

Unipiha, Utsu, Kaie-Mare and Marjamaa) during 2014–2015 (Fig. 5) (III, IV). All production areas were using conventional systems with drip irrigation and black (or sometimes white) polyethylene mulch. The soil type of areas was mainly sandy loam, with pH ranging from 6.2 to 6.5. In fact, the dominant soil type of Unipiha, Vasula and Marjamaa fields was pseudopodzolic soil (IUSS Working Group WRB, 2014). The topsoil texture of this group was mainly sandy loam. Also, the dominant soil type of other areas was very similar to the first group and classified by Estonian Soil Classification as leached soils (by WRB Luvisols). Their topsoil texture was mainly sandy loam as well. The same strawberry cultivar (cv. ‘Sonata’) was planted across all sampling fields. Plant samples along with surrounding soils were collected from different areas so that in each field, at least 20 samples were taken. Plants were rated on an arbitrary scale from 0 to 3 with 0= no observable symptoms and 3= severe symptoms. Rating was mainly based on visible symptoms of Verticillium wilt such as drying or marginal and interveinal browning of outer leaves and sub-samples from those sites were then selected for further analysis. Strawberry plants in areas of Vasula and Marjamaa mostly exhibited visible wilt symptoms while plants in other areas showed less wilt symptoms

28 on initial inspection. To investigate the structure of soil fungal communities (V), soil samples (around 4 kg each) were collected by taking eight sub-samples between plants at the depth of 15-20 cm; this is where most fungal activity occurs (O’Brien et al. 2005). Generally, plant and soil samples were separated into two parts. The first part was used for isolation of pathogen(s) by culturing methods, and the second part was allocated to molecular experiments.

4.2.1 Isolation of fungi − culture-based method

One gram soil per sample was diluted and then spread on plates of potato dextrose agar (PDA)-rose-bengal medium containing tetracycline as previously described by Dhingra & Sinclair, (1985), and incubated at 25°C for 8 days (III, IV). To isolate fungal pathogen(s) from plants, cross-sections of strawberry roots were transferred onto acidified potato dextrose agar (APDA) and incubated at 25°C for two weeks. Morphologically dissimilar colonies were transferred to fresh PDA plates.

Isolation of V. dahliae from soil. Inoculum density of V. dahliae in the soil was measured using the wet-sieving plating method previously described by Harris et al., (1993), with some modifications (IV). The pathogen was identified based on the shape of culture, conidia morphology and production of dark MS without melanized mycelium. Hyphal tips grown out from each isolate were picked and transferred to fresh PDA plates until further use. Inoculum density in each soil sample was assessed by the number of MS g−1 soil.

Isolation of T. harzianum from soil (VI). To isolate the fungal antagonist, one gram of each soil sample, collected from the surface layer around roots of healthy plants, was diluted and spread on plates containing Trichoderma selective medium, and then incubated at 26°C under continuous fluorescent light. Monoconidial cultures were identified as T. harzianum using the identification key (Bissett, 1991) after 12 days of incubation. To confirm the existence of T. harzianum, genomic DNA of each isolate was extracted and amplified by cPCR using species-specific primers THITS-F2 and THITS-R3 (Miyazaki et al., 2009).

Isolation of G. catenulatum from biochemical fungicide. Gliocladium catenulatum was isolated from a biological fungicide, called Prestop®Mix, by transferring 1 gram of product granules into a conical flask containing

29 5 ml of sterile distilled water (SDW). The content was shaken and serially diluted. Aliquots of 1 ml from each dilution were spread onto plates of PDA supplemented with streptomycin (100 mg l-1) and incubated at 25°C for 7 days. Mycelia grown out from the small pieces were transferred to fresh PDA. The isolates were identified based on morphological characterization as previously described by Harman & Kubicek, (1998). Pure colonies were then preserved in slant at 4°C until further use.

4.2.2 Fungal cultures (III, IV)

To investigate the possibility that other common soil fungi interfere with the V. dahliae detection test, several pathogenic and saprobic soil fungi were used including V. dahliae, V. albo-atrum, V. longisporum, F. oxysporum f.sp. fragariae, F. solani, Rhizoctonia spp., Rhizopus spp. and Pythium spp., which cause similar wilt symptoms on strawberry. Among them, isolates of Pythium spp. and V. longisporum were obtained from North Dakota State University (Department of Plant Pathology), USA. Isolates of V. dahliae (VD9, VD12a and VD4), V. albo-atrum and F. oxysporum f.sp. fragariae were provided by the Agricultural National Research Insti- tute (INIA), Madrid, Spain.

4.3 Pathogenicity test (VI)

All isolates of V. dahliae collected from different strawberry fields were subjected to the pathogenicity test on the susceptible strawberry cultivar ‘Sonata’, using two separate inoculation methods including root dip inoculation and soil inoculation methods. Disease severity of each isolate was assessed based on the incidence of wilt symptoms 30 days after inoculation and measured by a five point (0-5) rating scale as previously described by Mirmajlessi et al. (2012).

4.4 Detection of soil fungi − PCR-based methods (III, IV)

4.4.1 DNA extraction

To extract DNA from strawberry plants, root pieces were homogenized in liquid nitrogen and then the total DNA was extracted using DNeasy Plant Mini Kit, according to the manufacturer’s instructions. Total DNA

30 directly from soil (2-4 g) was extracted by using a PowerSoil® DNA Isola- tion Kit, according to the manufacturer’s instructions. Quality of DNA was determined by agarose gel (1.5%) electrophoresis and its concentration was measured by NanoDrop 2000 Spectrophotometer at 260 nm. The extracted DNA was adjusted to a final concentration of 20 ng μl−1 and stored at −70°C until further use.

4.4.2 Conventional PCR

Total genomic DNA was initially used as template for amplification by cPCR with a primer pair (ITS1/ITS4) to confirm the existence of amplifiable DNA (III, IV). PCR experiments were conducted in 25 μl reaction volumes containing 10 ng of DNA template, 2U Taq DNA polymerase,

0.1 mM dNTP solution, 1.5 mM MgCl2, 1× PCR buffer, and 0.1 μM of each primer. PCR mixtures were run on a GeneAmp PCR System 9700 thermocycler using the following conditions: initially 95°C for 3 min to denature the DNA, followed by 40 cycles for 1 min and 30 s at 95°C, 1 min at 55°C, 2 min at 72°C, followed by 10 min at 72°C. Amplified DNA fragments were visualized on 1.5% agarose gel stained with GelRed™ under UV light.

4.4.3 Primer design

The ITS1 and ITS2 regions were used to design primer set for real-time PCR assays. So, the region between the small and large subunits of the rRNA gene of different Verticillium species was amplified and sequenced by Illumina MiSeq sequencer. Following sequence alignment, species-specific primer was designed using the web-based program Primer3. BLAST search of the GenBank database indicated that the primer pair VD-rtPCR-F and VD-rtPCR-R would be specific to amplify the region of 5.8S rDNA-ITS in V. dahliae. DNA sequences delineated by primer set were aligned in order to evaluate the degree of sequence identity in the primer-binding sites of V. dahliae isolates and other related Verticil- lium species. Subsequently, the specificity of the designed primer pair was confirmed against different isolates of the strawberry pathogens using cPCR (IV).

31 4.4.4 Real-time PCR

Real-time PCR assay was carried out (III, IV) on DNA extracted from soil and plant samples using SYBRGreen chemistry on an ABI PRISM 7500 Sequence Detection System in 25 μl reaction volume containing: 0.4 μl of each primer (VD-rtPCR-F and VD-rtPCR-R), 5 μl of template DNA (5 ng), 10 μl of 1× IQ SYBRGreen Master- Mix, and 4.6 μl of sterile RNase-free water. The amplification was performed under the following conditions: 95°C for 5 min; 40 cycles of 95°C for 10 s and 65°C for 35 s to calculate the threshold cycle (Ct) values; followed by 95°C for 15 s, 67°C for 1 min, and then heating to 97°C at a rate of 1°C/5 s. The Ct value was automatically calculated for each rtPCR using the ABI Prism sequence detection software. Genomic DNA of V. dahliae and plant were used as positive and negative controls, respectively.

4.4.5 Standard curve

To quantify unknown concentrations of pathogen DNA in heterogeneous samples, two standard curves were separately created and analyzed by plotting the logarithm of known DNA concentrations of standard V. dahliae isolates (VD12a and VD4) over at least five orders of magnitude (10-2–10-6) versus Ct values. The results were then combined together in order to generate a unique standard curve with more accuracy (III, IV). Amplification efficiency was calculated through E = (10(-1/slope) − 1) × 100 and also the assay sensitivity was measured according to the minimum amount of target DNA when the Ct reached up to 30 cycles. The standard curve obtained demonstrated that the designed primer set was highly accurate, in which the lowest amount of DNA amplified was 0.93 pg μl−1 with amplification efficiency of 95.67%, confirming a sensitive system for pathogen quantification.

4.4.6 Spike test (IV)

In order to verify the stability of the rtPCR assay to quantify pathogen DNA in biological samples, the possible interference of non-target DNA with accurate detection of target pathogen DNA was separately investigated using spike assay. For this purpose, different amounts of V. dahliae DNA (0.01, 0.1 and 1 ng) were spiked into constant amounts of plant DNA (1, 5 and 20 ng) as templates and then the correlation between the input amounts and the Ct values was generated. The rtPCR mixture and amplification conditions were the same as described above.

32 4.5 Characterization of soil fungal communities – Illumina sequencing (V)

A barcoded HTS sequencing technique was used to describe the composition of the fungal communities in each area. Briefly, based on DNA extracted from soil samples, the ITS1 region of the fungal rRNA gene was amplified using the primer pair ITS1-F and ITS2. Afterwards, the PCR products were purified and pooled to obtain five amplicon libraries corresponding to the five different strawberry plantation sites. An equimolar mixture of all five amplicon libraries was independently sequenced using an Illumina MiSeq sequencer at the Genome Center of the Tartu University. Sequences from the five soils were clustered into operational taxonomic units (OTUs) at 97% sequence identity. To identify OTUs, a representative sequence from the most common sequence in each OTU was compared to the GenBank database using NCBI-BLASTn (Altschul et al., 1997) and nonfungal sequences were removed from the downstream analyses. Using the ITS database, taxonomy assignment was conducted with a confidence level of 0.5. Subsequently, all raw sequence data was submitted to the NCBI short-read archive (SRA) under accession number SRP091855.

4.6 Biocontrol of Verticillium wilt (VI)

The antagonistic ability of native T. harzianum isolates over Verticillium wilt in the greenhouse was investigated. Also, inhibitory effects of G. catenulatum, isolated from a biofungicide, on V. dahliae were studied under laboratory conditions.

4.6.1 Antagonistic ability of T. harzianum on V. dahliae – in vitro

Among all collected V. dahliae isolates, one isolate which exhibited the highest level of pathogenicity was used for the biocontrol test. All isolates of T. harzianum, as antagonist, were examined in vitro for their antagonistic ability over the selected isolate by dual culture, volatile and non-volatile metabolites. The experiments were evaluated based on the inhibitory effect of the antagonist on radial growth of V. dahliae. The details of the calculations are provided in Publication VI. Generally, the T. harzianum isolates that most highly inhibited pathogen growth (more than 50%) were selected for in vivo experiments.

33 4.6.2 Antagonistic ability of T. harzianum on V. dahliae – in vivo

The antagonist effect of T. harzianum isolates on V. dahliae in the greenhouse was examined (VI). The treatments comprised antagonist isolates with pathogen, pathogen alone and antagonist without pathogen applied on root, soil and root + soil. Treatments without pathogen and antagonist were considered as control. Plants were evaluated for Verticillium wilt symptoms two months after inoculation using the 0–5 point ranking scale previously described by Mirmajlessi et al., (2012).

4.6.3 Antagonistic ability of G. catenulatum on V. dahliae – in vitro

Inhibitory effect of G. catenulatum over mycelial growth of V. dahliae was studied by dual culture, volatile and non-volatile metabolites tests as described in 4.6.1. Also, G. catenulatum was tested against germination of V. dahliae MS by spraying spore suspension of pathogen on the surface of PDA medium and then transferring an agar disc of antagonist in the center of the same petri dish. Petri dishes inoculated only with pathogen served as control. The plates were incubated at 26°C for two weeks. The diameter of V. dahliae colonies affected by antagonist was measured, followed by calculating the percentage of inhibition growth.

4.7 Bioinformatics and statistical analyses

As described in publication V, the quality control and data filtering involved removal of singletons, low quality sequences, tags and primer missing sequences. To evaluate fungal diversity of each site, rarefaction curves and richness indexes (ACE and Chao1) were calculated using the R statistical program (packages vegan and phyloseq). Patterns of community structure were also characterized by constructing barplots and hierarchical dendrogram combined with heatmap using the R statistical program. Other statistical analyses were accomplished by variance (ANOVA) analysis using statistical software MSTATC (v. 1.42). Means were separated by Duncan’s multiple range test (P ≤ 0.05).

34 5. RESULTS

5.1 Soil fungi

5.1.1 Isolation of pathogens and antagonist

Totally, 106 isolates of V. dahliae were obtained from strawberry plants and soil samples from six investigated areas. Most isolates of V. dahliae were obtained from soil samples collected from Vasula district, whereas interestingly, most isolates of T. harzianum were detected from soil samples from Unipiha with only one isolate from Kaie-Mare area (TU76) (III, IV, VI). Since identification of V. dahliae was difficult in some culture media, its presence was confirmed by cPCR using the species-specific primer designed in our study. The existence of T. harzianum isolates was confirmed by generating PCR products using the species-specific primer (Fig. 6).

Figure 6. Agarose gel electrophoresis of PCR products amplified from the genomic DNA of T. harzianum using the primer pair THITS-F2/THITS-R3. Lane M – 100-bp DNA Ladder, lanes 1–11 –T. harzianum, lane 12 – distilled water as negative control.

In addition, many soil-borne pathogenic fungi such as F. solani, causing similar wilt symptoms, R. solani, Rhizopus spp., Penicillium sp. Botrytis sp., Alternaria spp. and several other unknown fungi were isolated from the soil of strawberry fields.

5.1.2 Detection and quantification of V. dahliae in field soils (III, IV)

Microsclerotia of V. dahliae were counted using the wet-sieving plating technique and these estimations were compared with data obtained from

35 rtPCR assay. The lowest amount of V. dahliae quantified in soil was 10.48 pg μl−1 of target DNA, corresponding to 1 MS g-1soil obtained from the soil plating technique. Totally, the amount of V. dahliae in different soils varied ranging from 1 to 13 MS g−1soil and also, results of corresponding rtPCR showed a diverse range of Ct values from 24.95 to 19.89 (IV, Table 3). Nevertheless, most soil samples from Unipiha district were negative, which means no MS g−1 soil was detected in the corresponding plate technique except in one isolate (S42). Generally, the presence of V. dahliae in strawberry production areas exhibited considerable variation, being high in samples from Vasula and Marjamaa, moderate in Rohu and Utsu, and low in Unipiha. No V. dahliae was detected from Kaie-Mare district. Our experiments approved the sensitivity and accuracy of the rtPCR for detection and quantification of V. dahliae at a very low density.

5.1.3 Validation of detection protocol by spike assay (IV)

This test provided a further step of quality control and confidence. As mentioned in the materials and methods section (4.4.6.), the plant DNA concentrations were 100, 500 and 2000 times larger than the lowest amount of spiked pathogen DNA (10-2 ng). With a regression coefficient of 0.96, a high degree of sensitivity of the designed primer in detecting V. dahliae among an overwhelming complex sample was achieved.

5.1.4 Characterization of fungal communities in soil − Illumina sequencing (V)

Soil samples collected from five strawberry production sites were analyzed using Illumina sequencing to assess the soil fungal communities. Using the nonspecific ITS1F/ITS2 primer set, the number of OTUs recovered from soils in each area ranged from a minimum of 990 (containing 303 non-singletons) at Rohu to a maximum of 1430 (containing 536 non-singletons) at Vasula (V, Fig. 1), which are considerably higher than results based on conventional culturing methods. All non-singletons were used to BLAST search against the non-redundant GenBank database in which a total of 749,586 sequences were identified as being fungal in origin. After amalgamation of OTUs at phylum level, Ascomycota was the dominant fungal phylum (~55.5%), followed by Basidiomy- cota (~25%), Zygomycota (~6.5%) and Glomeromycota (~2.5%) while other taxonomic lineages were assigned to the unclassified fungi category (~10.5%) (V, Fig. 2). According to cluster analysis of most abundant

36 OTUs, F. solani, V. dahliae, R. solani and C. truncatum, as well-known pathogens of strawberry, were abundant in the fields with disease symptoms. In this scenario, the fungus V. dahliae was extremely dominant in all soil samples particularly those from Vasula and Marjamaa while Rhizophagus irregularis and Glomus hoi, as well-known AM fungi, were considerably more abundant in the fields with healthy plants.

5.2 Biological control of Verticillium wilt (VI)

5.2.1 Pathogenicity test (VI)

By combining results of two inoculation methods, root dip and soil inoculation methods, disease severity of V. dahliae isolates obtained from different areas considerably varied greatly ranging from 6.8% to 79.5%, in which only one isolate (SV-19) collected from Vasula area showed the highest disease severity (79.5%) and therefore was selected for further experiments.

5.2.2 Antagonistic ability of T. harzianum on V. dahliae – in vitro

In the dual culture test, a considerable inhibition ability of T. harzianum isolates over V. dahliae (SV-19) was seen, the former covering the whole V. dahliae colony after four days. Assessment of the inhibitory effect of volatile and non-volatile metabolites of T. harzianum isolates showed a wide range of mycelial growth inhibition of V. dahliae (VI, Table 5). We finally selected seven isolates of T. harzianum for in vivo experiments.

5.2.3 Antagonistic ability of T. harzianum on V. dahliae – in vivo

Trichoderma isolates reduced disease severity of Verticillium wilt in comparison with the control so that their effects were statistically distinguish- able (P < 0.05) (VI). The cross-interaction between the antagonist isolates and different types of treatments (root, soil and root + soil) showed a varied range of disease severity from 14.2% to 75.6%. In this case, the minimum disease severity was observed when isolate TU79 was applied either to the soil or to root + soil (VI, Table 7).

37 5.2.4 Antagonistic ability of G. catenulatum on V. dahliae – in vitro

The results of dual culture indicated that G. catenulatum inhibited the growth of V. dahliae to varying degrees (up to 94.3%). A clear interaction zone without physical contact was formed in the antagonist-pathogen combination, after four days. The antagonist then grew very fast and finally covered the whole V. dahliae colony after 14 days. Effects of volatile and non-volatile metabolites of G. catenulatum on the mycelial growth of the pathogen showed different rates over time (Table 2). According to the results of dual culture, volatile and non-volatile metabolites tests, considerable inhibition ability of G. catenulatum isolate over V. dahliae (more than 50%) was revealed after two weeks. Furthermore, G. catenulatum inhibited developing of secondary V. dahliae MS so that, existing MS gradually lost their typical color in the culture medium.

Table 2. Evaluation of antagonistic ability of G. catenulatum on mycelial growth of V. dahliae by dual culture, volatile and non-volatile metabolites tests at different incubation times. Incu Mycelial inhibition (%) bation Volatile Non-volatile Dual culture Average time metabolites metabolites 4 days 22.8 11.4 58.2 30.8c 9 days 35.3 25.1 67.8 42.7b 14 days 39.7 28.6 94.3 54.2a Average 32.6b 21.7c 73.4a Values are average of three replicates. Means with different letters significantly (P ≤ 0.05) differ from each other (Duncan’s multiple range test).

38 6. DISCUSSION

6.1 Detection and quantification of V. dahliae in strawberry plants and field soils (III, IV)

In this dissertation, studies on V. dahliae population densities collected from different strawberry plantation areas in Estonia were performed using PCR-based techniques and conventional plating assays, and then the results were compared with the aim of sensitive, efficient and rapid detection of pathogen in the field (III, IV). Although choosing pathogen-free plants before planting is primarily essential, knowing about the minimum amount of V. dahliae in the soil is a substantial factor in the strawberry industry. So far, many studies have been reported for the detection and quantification of Verticillium species from various host plants and environments using rtPCR (Mercado-Blanco et al., 2003; Larsen et al., 2007; Cubero et al., 2009; Duressa et al., 2012).

A real-time detection based on SYBRGreen dye was developed to detect and quantify V. dahliae directly from field soils and strawberry plants with and without disease symptoms. The designed primer set (VD-rtPCRF/ VD-rtPCR-R) was highly specific when tested against a diverse range of soil-borne fungi obtained from different sites (III, IV). PCR primers developed based on ITS regions have spread as a useful strategy regarding diagnostic tests for many fungal pathogens (Heuser & Zimmer 2002; Lees et al. 2002; Luchi et al. 2005). For instance, Lievens et al., (2006) used a SYBRGreen rtPCR assay based on ITS region (ITS1-F/ITS4 rDNA) to quantitatively evaluate the presence of fungal and oomycete tomato pathogens including F. solani, R. solani, Verticillium sp., and P. ultimum in tomato plants and soil samples, where the number of microsclerotia in samples of two fields of which crops exhibited Verticillium wilt was estimated at 8 and 13 MS per gram of soil. To ensure the accuracy and reliability of the diagnostic system, a “spike” control was established when rtPCR was used (IV). The spike test successfully confirmed the specificity of the primer set in detecting V. dahliae among a variety of different genes. Our rtPCR assays allowed a precise detection and quantification of V. dahliae so that was strongly able to quantify 11.05 pg μl−1 of pathogen DNA even in symptomless plants (Table 3, IV), demonstrating the occurrence of latent infections without symptoms. Sometimes, wilting of strawberry plants may be due to root damage caused by pests or other

39 soil-borne pathogens such as Fusarium spp. which result in similar initial symptoms to Verticillium infections (Maurer et al., 2013). In fact, foliar disease symptoms are not a reliable indicator for Verticillium infections. Some common symptoms include yellowing of the older leaves, browning discoloration of the vascular tissues, stunting and leaf curl. Thus, identification of the particular wilt pathogen involved in individual samples is necessary (Pegg & Brady, 2002). By knowing that V. dahliae can persist in the soil for many years without a host plant by producing MS, the presence of 10.48 pg μl−1 of pathogen DNA or at least one (≥1) MS indicates a high level of quantification. A direct correlation between the development of the Verticillium wilt and the amount of MS in the soil was found (IV). Similarly, Bilodeau et al., (2012) developed a TaqMan rtPCR assay for specific detection of V. dahliae from strawberry fields. They observed an excellent correlation between rtPCR results and inoculum densities determined by soil plating in a range of field soils with pathogen densities as low as 1 to 2 MS g−1 soil. However, no pathogen was detected in some samples while using the plate technique compared with the corresponding rtPCR assay, representing the possibility of dead propagules. Based on the results of newly developed protocols, the rtPCR assay was able to identify and quantify the presence of V. dahliae in symptomless strawberry plant and soil samples with precision and without culturing. So, this technique may have a positive impact on epidemiological studies to prevent distribution of the pathogen into non-infected areas.

6.2 Characterization of fungal communities in soil (V)

A high-throughput sequencing was approached to characterize fungal communities of soil samples taken from strawberry fields containing plants with and without disease symptoms in order to study the asso- ciations of soil fungal diversity with Verticillium wilt (V). Although soil fungal communities are enormously diverse and complex, quantitative community comparisons require assignment of organisms into taxonomic units (Hibbett et al., 2011). A high diversity of fungi was detected in terms of taxa and pathogenicity in the soil of strawberry fields in five distinct regions. In terms of taxonomic abundance, Ascomycota and Basidiomycota were the most abundant phyla in the investigated soils (V); they dominate the communities of soil fungi in most terrestrial ecosystems worldwide (Gomes et al., 2003). According to their co-occurrence pattern, the most abundant OTUs found in the soils could be

40 clustered into three discrete groups: 1) omnipresent saprobes; 2) AM fungi, yeasts/saprobes and plant pathogens; and 3) strawberry plant pathogens (V). Although pathogenic fungi in soils are usually abundant, they are frequently suppressed by high fungal biodiversity (Lim et al., 2010). Interestingly, the phylum Glomeromycota including AM fungi was least abundant in areas with more diseased plants and much more abundant in the soils with healthy plants, indicating the possible role of these fungi in plant health or disease-suppressive soils. This may support our hypothesis that a higher percentage of AMFs leads to reduced colonization by pathogenic fungi, since low levels of Glomeromycota were found. It is evi- dent that, these fungi are able to reduce development of Verticillium wilt caused by V. dahliae (Nallanchakravarthula et al., 2014). The antagonistic ability of AM fungi against a broad range of root pathogens has been reported previously (Karagiannidis et al., 2002; Morandi et al., 2002; Filion et al., 2003; Whipps, 2004). However, the abundance of AMFs in soil is not always associated with plant disease severity (Wang et al., 2008; Xu et al., 2012b).

In our study, 66% of the DNA reads from all soils corresponded to only 24 fungal taxa whereas the five most abundant OTUs represented approximately 45% of total reads, indicating that certain species dominate the fungal communities in soils. It reveals that the majority of fungal biomass was derived from a few OTUs which were common in most soils. Also, the OTU richness and diversity between different areas disclosed uneven distribution of different amounts of OTUs (V). In a similar study, Xu et al., (2012) identified 40 OTUs (80.6% of all sequences) across all investigated pea fields, while 124 OTUs (2.6% of all sequences) were found only from one field. It has been shown that the stability of fungal species within the mycobiome, dispersal abilities of propagules and native plant species may cause the low richness of different taxa (Willger et al., 2014; Reininger et al., 2015). Conversely, high diversity of less abundant OTUs in the soils can act as a reservoir for subsequent diseases under favorable agro-ecological conditions. As shown in Table 1 (V), opportunistic fungi including Ceratobasidium sp., Paecilomyces sp., Pestalotiopsis sp. and Phoma spp. were the most abundant in almost all soil samples. Besides, V. dahliae was high in abundance with a high number of sequences and so might be the main causal agent of strawberry wilt in different fields. The high amount of V. dahliae was supported by our previous studies (III, IV) in which all investigated areas were shown to be infested with V. dahliae when measured using rtPCR. However, different soil fungi may infect

41 strawberry plants at different growth stages and under diverse environmental circumstances. For instance, poorly drained soils, winter injury, nutrient imbalances and herbicide damage are desirable conditions for development of other diseases such as strawberry black root rot caused by Rhizoctonia spp., Pythium spp. and Fusarium spp. (Pritts & Handley, 1991). Such data is missing about the fields analyzed in the current study and cannot be taken into account. Overall, the current dissertation has been, to date, the most comprehensive study on the structure of soil fungal communities in strawberry fields.

6.3 Biological control of Verticillium wilt (VI)

Due to the lack of proper agricultural practices for efficient disease control as well as phasing out of fumigants from practical usage, efforts to substitute chemical compounds with new biological treatments have been greatly increased (Meszka & Bielenin, 2009). Since Verticillium wilt is somehow associated with wet and cool soils especially in spring, it is also important to find a biocontrol agent capable of growth at relatively low temperatures. The effects of antagonistic properties of native endogenous T. harzianum isolates collected from soil of strawberry fields on V. dahliae were evaluated in the laboratory as well as in the greenhouse (VI). The results of the pathogenicity tests using two different inoculation methods revealed that V. dahliae isolates originated from the same strawberry plantation area differed in disease severity, reflecting genetic diversity in the pathogen population. Genetic diversity of V. dahliae is a usual phenomenon that has been shown in previous studies (Zeise et al., 2002; Chandelier et al., 2003; Qin et al., 2006). For instance, Berbegal et al., (2010) who characterized diversity in V. dahliae isolates using simple-sequence repeats (SSRs) marker and virulence tests demonstrated that differential virulence occurs among isolates from certain hosts and that these differences can be associated with genetic diversity among isolates. On the other hand, all tested T. harzianum isolates successfully inhibited growth of the V. dahliae in dual cultures through direct and indirect mechanisms. Direct mechanism, as one of the most general mechanisms, was applied by T. harzianum through the competition for space and nutrient by growing faster than the pathogen. Also, the production of fungal metabolites, as an indirect mechanism, was confirmed at the contact area of the growing colonies without overgrowth (clear zone) through lysis and deformation of V. dahliae mycelia (VI). Production of extracel-

42 lular enzymes, such as chitinase, cellulase and β-glucanase, which degrade the fungal cell walls, are utilized by Trichoderma spp. towards pathogens (Hassan, 2014). Both direct and indirect mechanisms may influence the biological control process involving the antagonist, the pathogen and environmental conditions (Benítez et al., 2004). Additionally, potential antifungal activity of T. harzianum isolates was demonstrated through inhibition of the mycelial growth of V. dahliae by production of volatile or nonvolatile metabolites in the culture medium (VI). A large variety of antifungal metabolites such as harzianolide, harzianopyridone, diterpenes, azaphilone, peptaibols, furanones, butenolides, pyrones and pyridones are generated by different strains of T. harzianum and these play an important role in the biological control of plant pathogens (Vinale et al., 2006; Siddiquee et al., 2012).

Besides, Verticillium wilt of strawberry was successfully controlled in the greenhouse using inoculation of soil and root of strawberry seedlings with spore suspensions of native T. harzianum isolates (VI). Similarly, Meszka and Bielenin (2009) considerably reduced the intensity of Verti- cillium wilt when roots of susceptible strawberry seedlings were soaked with T. harzianum and T. viride isolates, so that the outcomes were comparable with the fungicide Topsin M. As mentioned in the literature review section, many studies concerning the efficacy of T. harzianum in reducing disease severity of Verticillium wilt and other soil-borne diseases have been published, demonstrating that native Trichoderma may be a dominant bio-agent in disease management strategies. However, choosing a planting site with no history of wilt disease, avoiding land recently planted with tomatoes, potatoes, eggplants, peppers or raspberries and also planting verticillium-free plants in uninfested soils usually ensures many years of avoidance of this disease.

In another experiment, similar criteria were used in vitro to test the antagonistic ability of the indigenous G. catenulatum isolate obtained from a biological fungicide (Prestop®Mix) against V. dahliae. In fact, G. catenulatum (strain J1446) is the active ingredient of the biofungicide which has been used to control many plant diseases including damping-off, seed rot, root and stem rot and wilt diseases, according to the United States Environmental Protection Agency (2012). In our experiment, considerable variation was observed during incubation times with respect to the hyphal interactions to the inhibition of pathogen growth. In fact, evidence regarding the production of various toxic metabolites in the culture

43 medium was observed, indicating the potential biocontrol capability of the isolate. For instance, V. dahliae dual cultured with G. catenulatum became incapable of growing mycelia and some microsclerotia slowly turned to light brown. It has also been shown that Gliocladium spp. produce hydrolytic enzymes such as chitinases and β-1,3-glucanases (Mcquilken et al., 2001) as well as a mixture of volatile antimicrobial compounds (Stinson et al., 2003). Further in vivo experiments are under investigation in order to verify the efficacy of fungicide Prestop®Mix in biological control of Verticillium wilt of strawberry.

44 7. CONCLUSIONS

The investigated areas are all known as major strawberry production sites from which no data on soil fungal communities was available before this study and thus it was reasonable to investigate with the aim of providing information for application of appropriate management strategies for strawberry soil-borne diseases. The following conclusions can be drawn from this dissertation on assessment of V. dahliae population and soil fungal communities associated with strawberry plants in Estonian fields.

From a systematic review of the published literature (I) as well as a traditional review (II) on PCR-based specific techniques, rtPCR was shown to be extremely promising and powerful technique for early detection and quantification of the pathogen populations in various plant materials or even symptomless tissues where the pathogen may be present at a very low concentration.

The newly developed rtPCR protocol (III, IV), efficiently enabled detection and quantification of V. dahliae in strawberry plants that typically revealed different symptoms, indicating that symptomatology is not essentially associated with the amount of the pathogen present in plants.

There was a relationship between the concentration of V. dahliae DNA and the amount of MS in the soil so that, 10.48 pg μl−1 of pathogen DNA represents at least one MS g−1 of soil, showing a high level of quantification in comparison with other studies (IV).

It was the first study on the successful use of the rtPCR technique to assess V. dahliae populations with high specificity and sensitivity in Esto- nian strawberry fields (III, IV). So, the developed assay may function as a basis for diagnostic labs to adapt for detection of other important pathogens of strawberry.

According to Next generation sequencing of strawberry soils collected from five commercially production sites in Estonia (V), it was possible to simultaneously detect fungal communities with great resolution. A high number of sequences matched V. dahliae in most samples particularly from soils with diseased plants, demonstrating a predominant pathogen

45 in most strawberry soils and so interestingly proved the interpretation of earlier estimates using rtPCR.

Arbuscular mycorrhizal fungi were more abundant in areas with healthy plants (Rohu, Utsu and Unipiha), which may highlight their suppressive role against colonization of plants roots by fungal pathogens. It can be concluded that the health of plants might be related to the composition of fungal communities, so that pathogenic fungi may be suppressed by high fungal biodiversity.

As the first study in Estonia, a large diversity and co-occurrence patterns of fungi in the soils of strawberry fields with cv. Sonata was explicitly explored (V). These data may provide useful information for choosing management strategies by considering the whole fungal taxa.

The greenhouse experiments showed that native T. harzianum isolates have potential biocontrol ability against Verticillium wilt of strawberry (VI). The outcomes may have practical applications in fields naturally infested by V. dahliae with the aim of protecting biological resources as well as confining the use of chemical compounds.

The biocontrol ability of G. catenulatum isolated from biofungicide (Prestop®Mix) over the mycelial growth of V. dahliae was proven in vitro, indicating it as another useful candidate for biocontrol of one of the most common and economically important pathogens of strawberry. However, in vitro results do not necessarily demonstrate what happens in planta. So, in vivo tests of this biofungicide need to be conducted to validate the preliminary in vitro studies.

The current dissertation provided important insights into the rtPCR as a valuable quantitative technique for diagnosis of important pathogens such as V. dahliae with high accuracy, specificity and rapidity. It also presented a comprehensive study to date on soil fungal communities in Esto- nian strawberry fields using NGS technique, which may help to achieve better understanding of the biological characteristics of soil in development of diseases. However, future studies on combining multiplex rtPCR and monitoring of other plant pathogens using NGS are needed. Likewise, knowledge about the genetic diversity in local populations of V. dahliae associated with strawberry is a key component for the management of Verticillium wilt that should be considered in future studies.

46 The study also illustrated the biocontrol ability of the native antagonist T. harzianum as well as Gliocladium-based biofungicide against V. dahliae in the greenhouse and in the laboratory, respectively. Nevertheless, interaction of Trichoderma and Gliocladium with current agricultural practices of controlling Verticillium wilt needs further considerations. So, field experiments, efficient formulation and studies on the mechanism of interactions between biocontrol agents, pathogen and plant can be the main goals of future research. Consequently, the data and methods described within this dissertation may provide useful information for growers and agricultural organizations for application of suitable disease management strategies against plant pathogenic fungi and so may show a small but important milestone toward sustainable agriculture.

47 REFERENCES

Agriculture in figures, 2015. Statistical office of business and agricultural statistics department of the agriculture in figures. Available at: http:// www.ester.ee/record=b2871218*est. Agrios GN, 1990. Plant Pathology. 5th edition. Elsevier Academic Press, San Diego, USA. 803 p. Alabouvette C, Olivain C, Migheli Q, Steinberg C, 2009. Microbio- logical control of soil-borne phytopathogenic fungi with special emphasis on wilt-inducing Fusarium oxysporum. New Phytologist 184, 529–544. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ, 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25, 3389–3402. Aoki Y, Fujita K, Shima H, Suzuki S, 2015. Survey of annual and seasonal fungal communities in Japanese Prunus mume orchard soil by next-generation sequencing. Advances in Microbiology 5, 817–824. Atallah ZK, Bae J, Jansky SH, Rouse DI, Stevenson WR, 2007. Multiplex real-time quantitative PCR to detect and quantify Verticillium dahliae colonization in potato lines that differ in response to Verticillium wilt. Phytopathology 97, 865–872. Ausher R, 1975. An improved selective medium for the isolation of Ver- ticillium dahliae. Phytoparasitica 3, 133–137. Banno S, Saito H, Sakai H, Urushibara T, Ikeda K, Kabe T, Kemmochi I, Fujimura M, 2011. Quantitative nested real-time PCR detection of Verticillium longisporum and V. dahliae in the soil of cabbage fields. Journal of General Plant Pathology 77, 282–291. Barney DL, 1999. Growing strawberries in the inland northwest and inter- mountain west. University of Idaho’s Sandpoint Research and Exten- sion Center, Publication no. 83844, USA. 28 p. Barr DJS, 2001. Chytridiomycota. In: Mc Laughlin DJ, McLaughlin EG, and Lemke PA, (eds.) The Mycota VII Part A. Systematics and Evolution. Springer-Verlag, Berlin. pp. 93-112. Benítez T, Rincón AM, Limón MC, Codón AC, 2004. Biocontrol mechanisms of Trichoderma strains. International Microbiology 7, 249–260.

48 Berg G, Fritze A, Roskot N, Smalla K, 2001. Evaluation of potential biocontrol Rhizobacteria from different host plants of Verticillium dahliae Kleb. Journal of Applied Microbiology 91, 963–971. Berg G, Smalla K, 2009. Plant species and soil type cooperatively shape the structure and function of microbial communities in the rhizosphere. FEMS Microbiology Ecology 68, 1–13. Berg G, Zachow C, Lottmann J, Gotz M, Costa R, Smalla K, 2005. Impact of plant species and site on rhizosphere-associated fungi antagonistic to Verticillium dahliae Kleb. Applied and Environmental Microbiology 71, 4203–4213. Berbegal M, Ortega A, Jiménez-Gasco MM, Olivares-García C, Jimén- ez-Díaz RM, Armengol J, 2010. Genetic diversity and host range of Verticillium dahliae isolates from artichoke and other vegetable crops in Spain. Plant Disease 94, 396–404. Berlanger I, Powelson ML, 2005. Verticillium wilt. The Plant Health Instructor. DOI: 10.1094/PHI-I-PHI-I-2000-0801-01. The Ameri- can Phytopathological Society. www.apsnet.org. Bilodeau GJ, Koike ST, Uribe P, Martin FN, 2012. Development of an assay for rapid detection and quantification of Verticillium dahliae in soil. Phytopathology 102, 331–343. Bissett J, 1991. A revision of the genus Trichoderma. II. Infrageneric classification. Canadian Journal of Botany 69, 2357–2372 Buchan A, Newell SY, Moreta JIL, Moran MA, 2002. Analysis of internal transcribed spacer (ITS) regions of rRNA genes in fungal communities in a southeastern US salt marsh. Microbial Ecology 43, 329–340. Buée M, Reich M, Murat C, Morin E, Nilsson RH, Uroz S, Martin F, 2009. 454 pyrosequencing analyses of forest soils reveal an unexpect- edly high fungal diversity. New Phytologist 182, 449–456. Carvalho DDC, Junior ML, Martins I, Inglis PW, Mello SCM, 2014. Biological control of Fusarium oxysporum f. sp. phaseoli by Tricho- derma harzianum and its use of common bean seed treatment. Trop- ical Plant Pathology 39, 384–391. Chandelier A, Laurent F, Dantinne D, Mariage L, Etienne M, Cave- lier M, 2003. Genetic and molecular characterization of Verticillium dahliae isolates from woody ornamentals in Belgian nurseries. Euro- pean Journal of Plant Pathology 109, 943–952.

49 Cheng CH, Yang CA, Peng KC, 2012. Antagonism of Trichoderma harzianum ETS 323 on Botrytis cinerea mycelium in culture conditions. Phytopathology 102, 1054–1063 Chengwei L, Tsementzi D, Kyrpides N, Read T, Konstantinidis KT, 2012. Direct comparisons of Illumina vs. Roche 454 sequencing technologies on the same microbial community DNA sample. PLoS One 7, e30087. Cooke DEL, Schena L, Cacciola SO, 2007. Tools to detect, identify and monitor Phytophthora species in natural ecosystems. Journal of Plant Pathology 89, 13–28. Cubero J, Ayllón MA, Gell I, Melgarejo P, De-Cal A, Martín-Sánchez PM, Pérez-Jiménez RM, Soria C, Segundo E, Larena I, 2009. Detec- tion of strawberry pathogens by real-time PCR. Acta Horticulturae 843, 263–266. Dan H, Ali-Khan ST, Robb J, 2001. Use of quantitative PCR diagnostics to identify tolerance and resistance to Verticillium dahliae in potato. Plant Disease 85, 700–705. Daniell TJ, Husband R, Fitter AH, Young JPW, 2001. Molecular diversity of arbuscular mycorrhizal fungi colonizing arable crops. FEMS Microbiology Ecology 36, 203–209. De Boer W, Folman LB, Summerbell RC, Boddy L, 2005. Living in a fungal world: impact of fungi on soil bacterial niche development. FEMS Microbiology Reviews 29, 795–811. De Cal A, Martinez-Treceño A, Lopez-Aranda JM, Melgarejo P, 2004. Chemical alternatives to methyl bromide in Spanish strawberry nurseries. Plant Disease 88, 210–214. De Cal A, Larena I, Guijarro B, Melgarejo P, 2012. Use of biofungicides for controlling plant diseases to improve food availability. Agriculture 2, 109–124. Debode J, Van Poucke K, França SC, Maes M, Höfte M, Heungens K, 2011. Detection of multiple Verticillium species in soil using density flotation and real-time polymerase chain reaction. Plant Disease 95, 1571–1580. Dhingra OD, Sinclair JB, 1985. Basic plant pathology methods. CRC Press. Boca Raton, USA, pp. 44–45. Dick MW, Vick MC, Gibbings JG, Hedderson TA, Lastra CCL, 1999. 18S rDNA for species of Leptolegnia and other Peronosporomycetes: justification for the subclass taxa Saprolegniomycetidae and Perono-

50 sporomycetidae and division of the Saprolegniaceae sensu lato into the Leptolegniaceae and Saprolegniaceae. Mycological Research 103, 1119–1125. Directive 2009/128/EC of the European Parliament and of the Council of 21 October 2009, establishing a framework for community action to achieve the sustainable use of pesticides. Official Journal of Euro- pean Union 309, 71−85. Dumbrell AJ, Ashton PD, Aziz N, Feng G, Nelson M, Dytham C, Fitter AH, Helgason T, 2011. Distinct seasonal assemblages of arbuscular mycorrhizal fungi revealed by massively parallel pyrosequencing. New Phytologist 190, 794–804. Duniway JM, 2002. Status of chemical alternatives to methyl bromide for pre-plant fumigation of soil. Phytopathology 92, 1337–1343. Duressa D, Rauscher G, Koike ST, Mou B, Hayes RJ, Maruthachalam K, Subbarao KV, Klosterman SJ, 2012. A real-time PCR assay for detection and quantification of Verticillium dahliae in Spinach seed. Phytopathology 102, 443–451. Faostat (Food and Agriculture Organization Corporate Statistical Data- base), 2014. World strawberry production. http://faostat.fao.org/ site/567/DesktopDefault.aspx?PageID%20=%20567#ancor Faostat (Food and Agriculture Organization Corporate Statistical Data- base), 2016. World strawberry production. http://faostat.fao.org Filion M, St-Arnaud M, Jabaji-Hare SH, 2003. Quantification of Fusar- ium solani f.sp. phaseoli in mycorrhizal bean plants and surrounding mycorrhizosphere soil using real-time polymerase chain reaction and direct isolations on selective media. Phytopathology 93, 229–235. Fitt BDL, Huang YJ, van den Bosch F, West JS, 2006. Coexistence of related pathogen species on arable crops in space and time. Annual Review of Phytopathology 44, 163–182. Fradin EF, Thomma BP, 2006. Physiology and molecular aspects of Ver- ticillium wilt diseases caused by V. dahliae and V. albo-atrum. Molec- ular Plant Pathology 7, 71–86. Garbeva P, van Veen JA, van Elsas JD, 2004. Microbial diversity in soil: selection of microbial populations by plant and soil type and impli- cations for disease suppressiveness. Annual Review of Phytopathology 42, 243–270. Garrido C, Carbu M, Acreo FJ, Boonham N, Coyler A, Cantoral JM, Budge G. 2009. Development of protocols for detection of Colle-

51 totrichum acutatum and monitoring of strawberry anthracnose using real-time PCR. Plant Pathology 58, 43–51. Gayoso C, de la Ilarduya OM, Pomar F, 2007. Assessment of real-time PCR as a method for determining the presence of Verticillium dahliae in different Solanaceae cultivars. European Journal of Plant Pathology 118, 199–209. Gomes NCM, Fagbola O, Costa R, Rumjanek NG, Buchner A, Mendo- na-Hagler L, Smalla K, 2003. Dynamics of fungal communities in bulk and maize rhizosphere soil in the tropics. Applied and Environ- mental Microbiology 69, 3758–3766. Goud JC, Termorshuizen AJ, 2003. Quality of methods to quantify microsclerotia of Verticillium dahliae in soil. European Journal of Plant Pathology 109, 523–534. Goud JC, Termorshuizen AJ, Van Bruggen AHC, 2011. Verticillium wilt in nursery trees: damage thresholds, spatial and temporal aspects. European Journal of Plant Pathology 131, 451–465. Harman GE, Kubicek CP, 1998. Trichoderma and Gliocladium Vol 2. Enzymes, biological control and commercial applications. Taylor and Francis press. London, 393 p. Harman GE, Howell CR, Viterbo A, Chet I, Lorito M, 2004. Tricho- derma species opportunistic, avirulent plant symbionts. Nature Reviews Microbiology 2, 43–56. Harris DC, Yang JR, 1996. The relationship between the amount of Verticillium dahliae in soil and the incidence of strawberry wilt as a basis for disease risk prediction. Plant Pathology 45, 106–114. Harris DC, Yang JR, Ridout MS, 1993. The detection and estimation of Verticillium dahliae in naturally infested soil. Plant Pathology 42, 238–250. Hassan MM, 2014. Influence of protoplast fusion between two Tricho- derma spp. on extracellular enzymes production and antagonistic activity. Biotechnology and Biotechnological Equipment 28, 1014– 1023. He Y, Zhou BJ, Deng GH, Jiang XT, Zhang H, Zhou HW, 2013. Com- parison of microbial diversity determined with the same variable tag sequence extracted from two different PCR amplicons. BMC Micro- biology 13, 208.

52 Heuser T, Zimmer W, 2002. Quantitative analysis of phytopathogenic ascomycota on leaves of pedunculate oaks (Quercus robur L.) by real- time PCR. FEMS Microbiol Letters 209, 295–299. Hibbett DS, Ohman A, Glotzer D, Nuhn M, Kirk P, Nilsson R, 2011. Progress in molecular and morphological taxon discovery in Fungi and options for formal classification of environmental sequences. Fungal Biology Reviews 25, 38–47. Hirsch PR, Mauchline TH, Clark IM, 2010. Culture-independent molecular techniques for soil microbial ecology. Soil Biology and Biochemistry 42, 878–887. Hu X, Nazar RN, Robb J, 1993. Quantification of Verticillium biomass in wilt disease development. Physiological and Molecular Plant Pathol- ogy 42, 23–36. Huang X, Liu L, Wen T, Zhu R, Zhang J, Cai Z, 2015. Illumina MiSeq investigations on the changes of microbial community in the Fusar- ium oxysporum f.sp. cubense infected soil during and after reductive soil disinfestation. Microbiological Research 181, 33–42. IUSS Working Group WRB 2014. World reference base for soil resources 2014. International soil classification system for naming soils and creating legends for soil maps. World Soil Resources Reports No. 106. FAO, Rome. Jeffries P, Gianinazzi S, Perotto S, Turnau K, Barea JM, 2003. The contribution of arbuscular mycorrhizal fungi in sustainable maintenance of plant health and soil fertility. Biology and Fertility of Soils 37, 1–16. Jumpponen A, Jones KL, David-Mattox J, Yaege C, 2010. Massively parallel 454 sequencing of fungal communities in Quercus spp. ecto- mycorrhizas indicates seasonal dynamics in urban and rural sites. Molecular Ecology 19, 41–53. Kageyama K, Komatsu T, Suga H, 2003. Refined PCR protocol for detection of plant pathogens in soil. Journal of General Plant Pathol- ogy 69, 153–160. Karagiannidis N, Bletsos F, Stavropoulos N, 2002. Effect of Verticillium wilt (Verticillium dahliae Kleb.) and mycorrhiza (Glomus mosseae) on root colonization, growth and nutrient uptake in tomato and eggplant seedlings. Scientia Horticulturae 94, 145–156. Keinath AP, Fravel DR, Papavizas GC, 1991. Potential of Gliocladium roseum for biocontrol of Verticillium dahliae. Phytopathology 81, 644–648.

53 King R, Urban M, Hammond-Kosack MCU, Hassani-Pak K, Ham- mond-Kosack KE, 2015. The completed genome sequence of the pathogenic ascomycete fungus Fusarium graminearum. BMC Genom- ics 16, 544. Kirk JL, Beaudette LA, Hart M, Moutoglis P, Khironomos JN, Lee H, Trevors JT, 2004. Methods of studying soil microbial diversity. Jour- nal of Microbiological Methods 58, 169–188. Kirk PM, Cannon PF, Minter DW, Stalpers JA, 2008. Ainsworth and Bisby’s dictionary of the Fungi. 10th edition. CAB International, Wallingford, UK, 771 p. Kovacs A, Yacoby K, Gophna U, 2010. A systematic assessment of automated ribosomal intergenic spacer analysis (ARISA) as a tool for estimating bacterial richness. Research in Microbiology 161, 192–197. Kraft JM, Pfleger FL, 2001. Compendium of pea diseases and pests. American Phytopathological Society (APS) Press, St. Paul, Minne- sota, USA. 110 p. Kuchta P, Jecz T, Korbin M, 2008. The suitability of PCR-based techniques for detecting Verticillium dahliae in strawberry plants and soil. Journal of Fruit and Ornamental Plant Research 16, 295–304. Lang J, Hu J, Ran W, Xu Y, Shen Q, 2012. Control of cotton Verticillium wilt and fungal diversity of rhizosphere soils by bio-organic fertilizer. Biology and Fertility of Soils 48, 191–203. Larsen RC, Vandemark GJ, Hughes TJ, Grau CR, 2007. Development of a real-time polymerase chain reaction assay for quantifying Verti- cillium albo-atrum DNA in resistant and susceptible alfalfa. Phyto- pathology 97, 1519–1525. Lees AK, Cullen DW, Sullivan L, Nicolson MJ, 2002. Development of conventional and quantitative real-time PCR assays for the detection and identification of Rhizoctonia solani AG-3 in potato and soil. Plant Pathology 51, 293–302. Li A, Wei Y, Sun Z, Fan T, Zhang L, 2012. Analysis of bacterial and fungal community structure in replant strawberry rhizosphere soil with denaturing gradient gel electrophoresis. African Journal of Bio- technology 11, 10962–10969. Li KN, Rouse DI, Eyestone EJ, German TL, 1999. The generation of specific DNA primers using random amplified polymorphic DNA and its application to Verticillium dahliae. Mycological Research 103, 1361–1368.

54 Lim YW, Kim BK, Kim C, Jung HS, Kim BS, Lee JH, Chun J, 2010. Assessment of soil fungal communities using pyrosequencing. The Journal of Microbiology 48, 284–289. Lin Q, Brookes PC, 1999. An evaluation of the substrate-induced respi- ration method. Soil Biology and Biochemistry 31, 1969–1983. Lievens B, Brouwer M, Vanachter ACRC, Cammue BPA, Thomma BPHJ, 2006. Real-time PCR for detection and quantification of fungal and oomycete tomato pathogens in plant and soil samples. Plant Science 171, 155–165. Lopez-Escudero FJ, Blanco-Lopez MA, 2007. Relationship between the inoculum density of Verticillium dahliae and the progress of Verticil- lium wilt of olive. Plant Disease 91, 1372–1378. Luchi N, Capretti P, Pinzani P, Orlando C, Pazzagi M, 2005. Real-time PCR detection of Biscogniauxia mediterranea in symptomless oak tissue. Letters in Applied Microbiology 41, 61–68. Ma P, 2003. Biological control of cotton Verticillium wilt. Journal of Hebei Agricultural Sciences 7, 38–44. Maas JL, 1998. Compendium of Strawberry Diseases. American Phyto- pathological Society (APS) Press, St. Paul, Minnesota, USA. 128 p. Mahuku G, Platt H, 2002. Quantifying Verticillium dahliae in soils collected from potato fields using a competitive PCR assay. American Journal of Potato Research 79, 107–117. Maron JL, Marler M, Klironomos JN, Cleveland CC, 2011. Soil fungal pathogens and the relationship between plant diversity and productivity. Ecology Letters 14, 36–41. Martin RR, James D, Levesque CA, 2000. Impacts of molecular diagnostic technologies on plant disease management. Annual Review of Phytopathology 38, 207–239. Mattner SW, Porter IJ, Gounder RK, Shanks AL, Wren DJ, Allen D, 2008. Factors that impact on the ability of biofumigants to suppress fungal pathogens and weeds of strawberry. Crop Protection 27, 1165–1173. Maurer KA, Radišek S, Berg G, Seefelder S, 2013. Real-time PCR assay to detect Verticillium albo-atrum and V. dahliae in hops: development and comparison with a standard PCR method. Journal of Plant Dis- eases and Protection 120, 105–114.

55 Mayo B, Rachid CT, Alegría Á, Leite AM, Peixoto RS, Delgado S, 2014. Impact of next generation sequencing techniques in food microbiology. Current Genomics 15, 293–309. Mcquilken MP, Gemmell J, Lahdenpera ML, 2001. Gliocladium catenulatum as a potential biological control agent of damping-off in bed- ding plants. Journal of Phytopathology 149, 171–178. Mercado-Blanco J, Collado-Romero M, Parrilla-Araujo S, Rodríguez-Ju- rado D, Jiménez-Díaz RM, 2003. Quantitative monitoring of colonization of olive genotypes by Verticillium dahliae pathotypes with real-time polymerase chain reaction. Physiological and Molecular Plant Pathology 63, 91–105. Meszka B, Bielenin A, 2009. Bioproducts in control of strawberry Verti- cillium wilt. Phytopathology 52, 21–27. Mirmajlessi SM, Safaie N, Mostafavi HA, Mansouripour M, Mahmoudy SB, 2012. Genetic diversity among crown and root rot isolates of Rhizoctonia solani isolated from cucurbits using PCR based techniques. African Journal of Agricultural Research 7, 583–590. Mirmajlessi SM, Destefanis M, Gottsberger RA, Mänd M, Loit E, 2015a. PCR-based specific techniques used for detecting the most important pathogens on strawberry: a systematic review. Systematic Reviews 4, 9. Mirmajlessi SM, Mänd M, Loit E, Mansouripour SM, 2015b. Real-time PCR applied to study on plant pathogens: potential applications in diagnosis – a review. Plant Protection Science 51, 177–190. Mirmajlessi SM, Mänd M, Najdabbasi N, Larena I, Loit E, 2016. Screen- ing of native Trichoderma harzianum isolates for their ability to control Verticillium wilt of strawberry. Zemdirbyste-Agriculture 103, 397–404. Miyazaki K, Tsuchiya Y, Okuda T, 2009. Specific PCR assays for the detection of Trichoderma harzianum causing green mold disease during mushroom cultivation. Mycoscience 50, 94–99. Morandi D, Gollotte A, Camporota P, 2002. Influence of an arbuscular mycorrhizal fungus on the interaction of a binucleate Rhizoctonia species with Myc+ and Myc– pea roots. Mycorrhiza 12, 97–102. Naeimi S, Okhovvat SM, Javan-Nikkhah M, Vagvolgyi C, Khosravi V, Kredics L, 2010. Biological control of Rhizoctonia solani AG1-1A, the causal agent of rice sheath blight with Trichoderma strains. Phy- topathologia Mediterranea 49, 287−300.

56 Nallanchakravarthula S, Mahmood S, Alström S, Finlay RD, 2014. Influ- ence of soil type, cultivar and Verticillium dahliae on the structure of the root and rhizosphere soil fungal microbiome of strawberry. PLoS One 9, e111455. Naraghi L, Heydari A, Rezaee S, Razavi M, Afshari-Azad H, 2010. Biological control of Verticillium wilt of greenhouse cucumber by Talaromyces flavus. Phytopathologia Mediterranea 49, 321−329. Nazar RN, Hu X, Schmidt J, Culham D, Robb J, 1991. Potential use of PCR-amplified ribosomal intergenic sequences in the detection and differentiation of Verticillium wilt pathogens. Plant Pathology 39, 1–11. Njoroge SMC, Kabir Z, Martin FN, Koike ST, Subbarao KV, 2009. Comparison of crop rotation for Verticillium wilt management and effect on Pythium species in conventional and organic strawberry production. Plant Disease 93, 519–527. O’Brien HE, Parrent JL, Jackson JA, Moncalvo JM, Vilgalys R, 2005. Fungal community analysis by large-scale sequencing of environmental samples. Applied and Environmental Microbiology 71, 5544–5550. Oehl F, Sieverding E, Palenzuela J, Ineichen K, Alves da Silva G, 2011. Advances in Glomeromycota taxonomy and classification. IMA Fun- gus 2, 191–199. Okubara PA, Schroeder KL, Paulitz TC, 2005. Real-time polymerase chain reaction: applications to studies on soil borne pathogens. Canadian Journal of Plant Pathology 27, 300–313. Olbricht K, Grafe C, Weiss K, Ulrich D, 2008: Inheritance of aroma compounds in a model population of Fragaria ×ananassa Duch. Plant Breeding 127, 87–93. Öpik M, Metsis M, Daniell TJ, Zobel M, Moora M, 2009. Large-scale parallel 454 sequencing reveals host ecological group specificity of arbuscular mycorrhizal fungi in a boreonemoral forest. New Phytol- ogist 184, 424–437. Øvreås L, 2000. Population and community level approaches for ana- lyzing microbial diversity in natural environments. Ecology Letters 3, 236–251. Parks R, Crowe F, 2002. Comparison of Verticillium soil detection methods using genetically transformed green fluorescing isolates, 2001. In 2001 Research Reports of the Mint Industry Research Council. Section B, Report 2. 9 pp.

57 Pegg B, Brady G, 2002. Verticillium Wilts. CABI Publishing, New York, NY. USA. 552 p. Pérez-Jiménez RM, De-Cal A, Melgarejo P, Cubero J, Soria C, Zea-Bo- nilla T, Larena I, 2012. Resistance of several strawberry cultivars against three different pathogens. Spanish Journal of Agricultural Research 10, 502–512. Picman AK, Schneider EF, 1990. Antifungal activities of sunflower ter- penoids. Biochemical Systematics and Ecology 18, 325–328. Pritts M, Handley D, 1991. Bramble Production Guide. Northeast Regional Agricultural Engineering Service, Publication no. NRAES- 35. 189 p. Platt HW, Mahuku G, 2000. Detection methods for Verticillium species in naturally infested and inoculated soils. American Journal of Potato Research 77, 271–274. Qin QM, Vallad GE, Wu BM, Subbarao KV, 2006. Phylogenetic analyses of phytopathogenic isolates of Verticillium spp. Phytopathology 96:582–592. Raaijmakers JM, Paulitz TC, Steinberg C, Alabouvette C, Moënne-Loc- coz Y, 2009. The rhizosphere: a playground and battlefield for soil- borne pathogens and beneficial microorganisms. Plant and Soil 321, 341–361. Raven PH, Evert RF, Eichhorn SE, 2005. Biology of plants, 7th Edition, W.H. Freeman and Company Publishers. New York, USA, 268–269. Reeve JR, Schadt CW, Carpenter-Boggs L, Kang S, Zhou J, Reganold JP, 2010. Effects of soil type and farm management on soil ecological functional genes and microbial activities. ISME Journal 4, 1099–1107. Redondo C, De-Cal A, Martinez-Treceño A, Becerril M, López-Aranda JM, Melgarejo P, 2009. Evaluation of resistance of several strawberry selections against main fungal pathogens. Acta Horticulturae 842, 211–214. Reganold JP, Andrews PK, Reeve JR, Carpenter-Boggs L, Schadt CW, Alldredge JR, Ross CF, Davies NM, Zhou J, 2010. Fruit and soil quality of organic and conventional strawberry agroecosystems. PLoS One 5, e12346. Reininger V, Martinez-Garcia LB, Sanderson L, Antunes PM, 2015. Composition of fungal soil communities varies with plant abundance and geographic origin. AoB Plants 7, plv110.

58 Rother ET, 2007. Systematic literature review X narrative review. Acta Paulista de Enfermagem 20, 5–6. Ruano-Rosa D, Prieto P, Rincón AM, Gómez-Rodríguez MV, Valder- rama R, Barroso JB, Mercado-Blanco J, 2016. Fate of Trichoderma harzianum in the olive rhizosphere: time course of the root colonization process and interaction with the fungal pathogen Verticillium dahliae. Biological control 61, 269–282. Sankaran S, Mishra A, Ehsani R, Davis C, 2010. A review of advanced techniques for detecting plant diseases. Computers and Electronics in Agriculture 72, 1–13. Santamarina MP, Roselló J, 2006. Influence of temperature and water activity on the antagonism of Trichoderma harzianum to Verticillium and Rhizoctonia. Crop Protection 25, 1130–1134. Schaad NW, Frederick RD, Shaw J, Schneider WL, Hickson R, Petrillo MD, Luster DG, 2003. Advances in molecular-based diagnostics in meeting crop biosecurity and phytosanitary issues. Annual Review of Phytopathology 41, 305–24. Schadt CW, Martin AP, Lipson DA, Schmidt KS, 2003. Seasonal dynamics of previously unknown fungal lineages in tundra soils. Science 301, 1359–1361. Schena L, Li Destri Nicosia MG, Sanzani SM, Faedda R, Ippolito A, Cacciola SO, 2013. Development of quantitative PCR detection methods for phytopathogenic fungi and oomycets. Journal of Plant Pathology 95, 7–24. Schmidt PA, Bálint M, Greshake B, Bandow C, Römbke J, Schmitt I, 2013. Illumina metabarcoding of a soil fungal community. Soil Biol- ogy and Biochemistry 65, 128–132. Shaw DV, Gordon TR, Larson KD, Kirkpatrick SC, 2005. The effect of Verticillium infection in runner plant propagation nurseries on resistant and susceptible strawberry genotypes. Journal of the Ameri- can Society for Horticultural Science 130, 707–710. Siddiquee S, Cheong BE, Taslima K, Kausar H, Hasan MM, 2012. Sepa- ration and identification of volatile compounds from liquid cultures of Trichoderma harzianum by GCMS using three different capillary columns. Journal of Chromatographic Science 50, 358–367. Smith SE, Read DJ, 2008. Mycorrhizal Symbiosis, 3th Edition. Academic Press, New York, USA, 800 p.

59 Stinson M, Ezra D, Hess WM, Sears J, Strobel G, 2003. An endophytic Gliocladium sp. of Eucryphia cordifolia producing selective volatile antimicrobial compounds. Plant Science 165, 913–922. Subbarao KV, Kabir Z, Martin FN, Koike ST, 2007. Management of soil- borne diseases in strawberry using vegetable rotations. Plant Disease 91, 964–972. Sugiyama A, Vivanco JM, Jayanty SS, Manter DK, 2010. Pyrosequenc- ing assessment of soil microbial communities in organic and conventional potato farms. Plant Disease 94, 1329–1335. Streitwolf-Engel R, Boller T, Wiemken A, Sanders IR, 1997. Clonal growth traits of two Prunella species are determined by co-occurring arbuscular mycorrhizal fungi from a calcareous grassland. Journal of Ecology 85, 181–191. Tarkka M, Schrey S, Hampp R, 2008. Plant associated soil micro-organisms. In: Nautiyal CS, Dion P, (eds.) Molecular mechanisms of plant and microbe coexistence. Springer Press, New York, USA, pp. 3–51. Uppal AK, El Hadrami A, Adam LR, Tenuta M, Daayf F, 2008. Bio- logical control of potato verticillium wilt under controlled and field conditions using selected bacterial antagonists and plant extracts. Biological Control 44, 90–100. United States Environmental Protection Agency (US EPA), 2012. Office of Pesticide Programs. Biopesticides and pollution prevention division. Gliocladium catenulatum strain J1446, PC Code 021009. Vandenkoornhuyse P, Baldauf SL, Leyval C, Straczek J, Young JPW, 2002. Extensive fungal diversity in plant roots. Science 295, 2051. Verma M, Brar SK, Tyagi RD, Surampalli RY, Valéro JR, 2007. Antag- onistic fungi, Trichoderma spp.: panoply of biological control. Bio- chemical Engineering Journal 37, 1–20. Vinale F, Marra R, Scala F, Ghisalberti EL, Lorito M, Sivasithamparam K, 2006. Major secondary metabolites produced by two commercial Trichoderma strains active against different phytopathogens. Letters in Applied Microbiology 43, 143–148. Wang YY, Vestberg M, Walker C, Hurme T, Zhang XP, Lindstrom K, 2008. Diversity and infectivity of arbuscular mycorrhizal fungi in agricultural soils of the Sichuan Province of mainland China. Myc- orrhiza 18, 59–68.

60 Wang Y, Wang Y, Tian C, 2013. Quantitative detection of pathogen DNA of Verticillium wilt on smoke tree Cotinus coggygria. Plant Disease 97, 1645–1651. Webster J, Weber R, 2007. Introduction to fungi. 3rd edition, Cambridge University Press, London, UK, 841p. Wei F, Fan R, Dong H, Shang W, Xu X, Zhu H, Yang J, Hu X, 2015. Threshold microsclerotial inoculum for cotton verticillium wilt determined through wet-sieving and real-time quantitative PCR. Phytopathology 105, 220–229. Weller DM, Raaijmakers JM, Gardener BBM, Thomashow LS, 2002. Microbial populations responsible for specific soil suppressiveness to plant pathogens. Annual Review of Phytopathology 40, 309–348. Whipps JM, Lumsden RD, 2001. Commercial use of fungi as plant disease biological control agents: status and prospects. In: Butt T, Jackson C, Magan N, (Eds.), Fungal Biocontrol Agents: Progress, Prob- lems and Potential, CABI Publishing, Wallingford, UK, pp. 9–22. Whipps JM, 2004. Prospects and limitations for mycorrhizas in biocontrol of root pathogens. Canadian Journal of Botany 82, 1198-1227. Widmer TL, 2014. Screening Trichoderma species for biological control activity against Phytophthora ramorum in soil. Biological Control 79, 43–48. Willger SD, Grim SL, Dolben EL, Shipunova A, Hampton TH, Mor- rison HG, Filkins LM, O’Toole GA, Moulton LA, Ashare A, Sogin ML, Hogan DA, 2014. Characterization and quantification of the fungal microbiome in serial samples from individuals with cystic fibrosis. Microbiome, 2, 40. Witzel K, Hanschen FS, Schreiner M, Krumbein A, Ruppel S, Grosch R, 2013. Verticillium suppression is associated with the glucosinolate composition of Arabidopsis thaliana leaves. PLoS One 8, e71877. Xu L, Ravnskov S, Larsen J, Nicolaisen M, 2012a. Linking fungal communities in roots, rhizosphere, and soil to the health status of Pisum sativum. FEMS Microbiology and Ecology 82, 736e745. Xu L, Ravnskov S, Larsen J, Nilsson RH, Nicolaisen M, 2012b. Soil fungal community structure along a soil health gradient in pea fields examined using deep amplicon sequencing. Soil Biology and Bio- chemistry 46, 26–32. Yu M, Hodgetts J, Rossall S, Dickinson M, 2009. Using terminal restriction fragment length polymorphism (T-RFLP) to monitor changes

61 in fungal population associated with plants. Journal of Plant Pathol- ogy 91, 417–423. Zeise K, von Tiedemann A, 2002. Application of RAPD-PCR for virulence type analysis within Verticillium dahliae and V. longisporum. Journal of Phytopathology 150, 557–563.

62 SUMMARY IN ESTONIAN

MAASIKA PATOGEENI Verticillium dahliae Kleb. JA MULLA SEENEKOOSLUSTE ISELOOMUSTAMINE MAASIKAPÕLDUDEL

Kokkuvõte

Maasikas (Fragaria × ananassa) on hinnatud marjakultuur, mida kasva- tatakse paljudes riikides. Eestis on maasikakasvatuse maht aastate lõikes varieeruv, kuna kohalikule kliimale sobivate ja haiguskindlate sortide valik on piiratud. Paljud mullapatogeenid on maasikahaiguste põhjustajateks. Kõige levinum ja kõige suurema kahju tekitaja on Verticillium dahliae, mis põhjustab närbumistõbe. Maasikahaiguste määramine on keeruline, kuna mulla mikrobioom on kompleksne ja haigustekitajate määramiseks sobivate meetodite valik on piiratud. Parima agrotehnoloogia leidmiseks on kasulik teada V. dahliae kogust mullas.

Uurimistöö eesmärgid:

1) Analüüsida PCR-meetodite täpsust ja usaldusväärsust enamlevinud maasika patogeenide kvalitatiivsel ja kvantitatiivsel määramisel (I, II). Hüpotees: PCR-meetodid sobivad maasika patogeenide detektee- rimiseks ja identifitseerimiseks, kuid reaalaja kvantitatiivne PCR (rtPCR) on sobilikuim meetod patogeenide arvukuse määramiseks.

2) Koostada tundlik ja spetsiifiline rtPCR protokoll, et kvantitatiivselt määrata V.dahliae arvukus maasikatest ja mullast Eestis (III).

3) Hinnata V. dahliae mikrosklerootumite arvukust mullas kahe meetodiga, klassikaline plaatimistehnika ja kvantitatiivse rtPCR-iga ja võrrelda saadud tulemusi (IV). Hüpotees: rtPCR võimaldab kiiremat ja tundlikumat kvantifitseeri- mist, määrates patogeenid ka terve välimusega taimedes.

4) Iseloomustada Eesti maasikapõldude muldade seenekooslusi järgmise generatsiooni sekveneerimise abil (V). Hüpotees: Järgmise generatsiooni sekveneerimine võimaldab laia ulatuslikku seenekoosluste iseloomustamist.

63 5) Hinnata of G. catenulatum ja T. harzianum isolaatide võimekust kontrollida V. dahliae kasvu ja levikut (VI). Hüpotees: G. catenulatum ja T. harzianum on efektiivsed V. dahliae tagasitõrjumisel.

Metoodika

Maasika patogeenide määramiseks kasutatud ja avaldatud PCR protokol- lidest koostati süstemaatiline ülevaade, millega leiti 22 otsingukriteeriu- mitele vastavat artiklit (I).

Taime ja mullaproovid koguti aastatel 2014-2015 Vasula, Rõhu, Unipiha, Utsu, Kaie-Mare ja Marjamaa maasikapõldudelt. Kasvatatud maasika sort oli Sonata. V. dahliae arvukus määrati juure ristlõikest ja 1 grammist mullast morfoloogiliste tunnuste alusel (III, IV, V, VI).

G. catenulatum eraldati biopreparaadist Prestop®. Kõikide V. dahliae isolaatide patogeensus testiti kahe meetodiga: juurte ja mulla inokulatsioo- niga (VI).

DNA eraldati puhaskultuuridest, taimedest ja mullast ja DNA kvaliteet kontrolliti cPCR abil (ITS1/ITS4 praimerid). V. dahliae kvantifitseerimi- seks disainiti vastavad praimerid (VD-rtPCR-F/VD-rtPCR-R) (III, IV).

V. dahliae arvukust määrati rtPCR protokolliga (CYBRGreen reaktsiooni keemiaga). Patogeeni DNA kontsentratsiooni määramise standardkõvera amplifitseerimise efektiivsus oli 95.67% ja kõige madalam amplifitseeri- tud DNA kontsentratsioon 0.93 pg μl−1 (III, IV).

Uue põlvkonna sekveneerimise meetodit rakendati seenekoosluste iseloo- mustamiseks, amplifitseerides ja järjestades ITS1 regiooni seene rRNA geenis (V).

Mullast eraldatud T. harzianum ja biofungitsiidist eraldatud G. catenulatum isolaatide patogeeni allasurumisevõimet testiti in vitro ja in vivo (VI).

Statistilised analüüsid teostati R programmiga ja varieeruvusanalüüsid (ANOVA) programmiga MSTATC (v. 1.42).

64 Tulemused ja arutelu

Kõik maasika patogeenide määramiseks seni kasutatud PCR-põhised meetodid koguti ja analüüsiti süstemaatiliselt, täpsemalt iseloomustati rtPCR protokolle (I, II). Kogutud info alusel töötati välja rtPCR protokoll, millega määrati Eesti suuremate maasikatootjate põldudelt (Vasula, Rohu, Unipiha, Utsu, Kaie-Mare and Marjamaa) kogutud mulla ja taime proovidest V. dahliae sisaldus kvalitatiivselt ja kvantitatiivselt (III, IV). Kasutatud ITS regiooni spetsiifilised praimerid on laialt kasutusel patogeenide määramiseks (Lees et al., 2002; Luchi et al., 2005). ITS praimerite kõrge spetsiifilisus leidis tõestust ka V. dahliae määramisel väga heterog- eensest proovist. rtPCR võimaldas määrata isegi 11.05 pg μl−1 patogeeni DNA-d terve välimusega taimedes. See näitab, et paljud taimed võivad olla varjatud haigustekitaja kandjad (Markakis et al., 2009). V. dahliae arvukus mullas varieerus 1 kuni 13 mikrosklerootiani ühes grammis mullas kasutades klassikalist morfoloogiapõhist meetodit. rtPCR meetod oli väga kõrge tundlikkusega teiste meetoditega võrreldes, sest 10.48 pg μl−1 patogeeni DNA-d leiti proovidest, mis klassikalise meetodiga ühtegi tule- must ei andnud. V. dahliae kontsentratsioon maasika tootmispõldudel oli väga varieeruv. Väga kõrge haigustekitaja sisaldus oli Vasula ja Marjamaa proovides, keskmine Rõhu ja Utsu proovides ja madal Unipiha proovides. Kaie-Mare piirkonnast ei tuvastatud ühtegi V. dahliae patogeeni.

Lisaks iseloomustati mulla seenekooslusi uue põlvkonna sekveneerimise abil (V). Identifitseeriti palju erinevaid taksonoomiliselt erinvaid seene- rühmi. Kõige rohkem esines Ascomycota ja Basidiomycota (V), mis on ühtlasi ka kõige enamesindatud seened mullas üle maailma (Gomes et al., 2003). Tulemused kinnitasid rtPCR protokolliga saadud tulemusi ja kõige rohkem V. dahliae järjestusi leiti muldadest, kus oli palju haigustunnustega taimi (Vasula ja Marjamaa). Lisaks leiti teiste maasikapato- geen: F. solani, R. solani ja C. truncatum. Arbuskulaarsete mükoriisaseente (Rhizophagus irregularis ja Glomus hoi) sisaldus oli kõrgem seal, kus domi- neerisid terved taimed (Rõhu, Utsu ja Unipiha), mis ilmselt viitab müko- riisaseente võimele haigustekitajaid alla suruda (Nallanchakravarthula et al., 2014). On leitud ka vastupidi, et arbuskulaarsete mükoriisaseente arvukus ei pruugi alati taimede haigustele vastuvõtlikkust mõjutada (Xu et al., 2012b). Ka käesoleva töö eelnev analüüs rtPCR protokolliga näitas, et kõik testitud maasikapõldudel oli kõrge V. dahliae arvukus (III, IV), mis tähendab taime haigestumisel mängib rolli keskkond, alustades mulla mikrobioomiga ja lõpetades ilmastikuga.

65 Analüüsiti Eesti põllumullast eraldatud Trichoderma harzianum ja biofungitsiidist eraldatud Gliocladium catenulatum isolaatide potentsiaalset negatiivset mõju V. dahliae kasvule (VI). T. harzianum ja G. catenulatum olid võimelised V. dahliae kasvu pärssima in vitro ja in vivo, mis teeb neist head kandidaadid biokontrolli rakendamiseks maasika patogeenide vastu. Leiti, et mõlemad isolaadid sünteesisid erinevaid lenduvaid ja mittelendu- vaid metaboliite, mille negatiivne mõju takistas V. dahliae mütseelkasvu. Varasemalt on samuti näidatud, et T. harzianum toodab erinevaid anti- biootilise toimega metaboliite, mis inhibeerivad taime patogeenide kasvu (Siddiquee et al., 2012).

Järeldused

• PCR protokollid võimaldavad maasika patogeene tuvastada; neist rtPCR protokoll on kõige lubavam meetod, mis võimaldab enamlevinud maasika patogeene määrata kvalitatiivselt ja kvantitatiivselt (I, II).

• Välja töötatud rtPCR protokoll võimaldas efektiivselt ja täpselt määrata ja kvantifitseerida V. dahliae sisaldust maasika taimedes (nii haigussümptomite kui ka ilma sümptomita taimedes) ja mullas (III, IV).

• V. dahliae DNA kontsentratsioon 10.48 pg μl−1 vastab ühele mikrosk- lerootiale grammis mullas (IV).

• Uue põlvkonna sekveneerimise rakendamine võimaldas iseloomustada maasikapõldude mulla seenekooslusi (V). Mida rohkem oli haigustunnustega taimi, seda rohkem esines mullas V. dahliae järjes- tusi.

• Arbuskulaarsed mükoriisaseente sisaldus oli kõige kõrgem neis mul- laproovides, mis oli kogutud põldudelt, kus olid valdavalt terved taimed (Rõhu, Utsu ja Unipiha), viidates nende potentsiaalsele rollile haigustekitajate tagasitõrjumisel (V).

• Mullast eraldatud T. harzianum ja biofungitsiidist eraldatd G. catenulaum olid võimelised takistama V. dahliae kasvu nii in vitro, kui in vivo, mis tähendab nende potentsiaali biokontrollis (VI).

66 Käesolev doktoritöö näitas V. dahlia näitel, et rtPCR meetod on tundlik ja täpne maasika patogeenide kvantitatiivseks määramiseks. Samuti iseloomustati Eesti maasikapõldude seenekooslusi, mis on tähtis, et mõista paremini mulla bioloogia rolli haiguste tekkimisel ja arenemisel. T. harzianum ja G. catenulaum on head biofungitsiidid, mis võimalda- vad V. dahliae kasvu pidurdada. Töö tulemused aitavad maasikakasvatajal paremini määrata haigustekitajaid põllul, et kiiremini ja täpsemini valida sobivad võtted patogeenide kontrolli all hoidmiseks.

67 ACKNOWLEDGEMENTS

I would like to express my sincere gratitude to my supervisor, Dr. Evelin Loit, for her insightful guidance and encouragement throughout my PhD study. At many stages in the course, I benefited from her advice, particularly when exploring new ideas. Her positive outlook in my research inspired me and gave me confidence.

I would like to thank my supervisor, Prof. Marika Mänd, for her patient guidance, encouragement and valuable advice during my study as PhD student. I have been extremely lucky to have a supervisor who cared so much about my work, and who responded to my issues and questions so promptly. I will never forget your valuable support and motivation.

A great thanks go to my friends and the faculty members of EMÜ (Esto- nian University of Life Sciences) at both Department of Plant Production and Grassland Husbandry as well as Department of Plant Protection for creating a great working atmosphere. Also, I would like to specially thank Dr. Inmaculada Larena (INIA, Madrid, Spain) for her continued support and help. It would be remiss of me not to express my gratitude to Prof. Peter Harley (National Center for Atmospheric Research, Colorado, USA) for the critical reviewing of the manuscripts and giving valuable comments. Great thanks go to the co-authors of the articles presented in this dissertation for their criticism and friendly advice. I would thank Dr. Maarika Alaru and Erkki Mäeorg for the Estonian editing of the summary of my dissertation.

I express my deepest gratitude to Mahkameh (Neda), my dear wife, for her continued support, inspiration and encouragement. Thank you for being here, giving me lots of hope and energy to pursue my goals. I was continually amazed by the patience of my dear family: my parents and two sisters, because they have run with me all times. Thanks for their unconditional support.

Finally, many thanks to Eda Tursk and Lilian Ariva-Tiirmaa for their administrative help during my study years.

This study was financially supported by EUPHRESCO (European Phy- tosanitary Research Coordination) Phytosanitary ERA-Net project SPAT

68 (Strawberry Pathogens Assessment and Testing), the European Union through the European Regional Development Fund (Contract no. 10.1- 9/14/471), institutional research funding (IUT36-2) of the Estonian Ministry of Education, Estonian Science Foundation (Grant No. 9450) and Internationalization Programme DoRa.

At last, I wish to thank many other people whose names are not mentioned here but this does not mean that I have forgotten their kind help.

ORIGINAL PUBLICATIONS Mirmajlessi SM, Destefanis M, Gottsberger RA, Mänd M, Loit E, 2015. PCR-based specific techniques used for detecting the most important pathogens on strawberry: a systematic review. Systematic Reviews 4, 9.

72 Mirmajlessi et al. Systematic Reviews 2015, 4:9 http://www.systematicreviewsjournal.com/content/4/1/9

RESEARCH Open Access PCR-based specific techniques used for detecting the most important pathogens on strawberry: a systematic review Seyed Mahyar Mirmajlessi1*, Marialaura Destefanis2, Richard Alexander Gottsberger3, Marika Mänd4 and Evelin Loit1

Abstract Background: Strawberry diseases are a major limiting factor that severely impact plant agronomic performance. Regarding limitations of traditional techniques for detection of pathogens, researchers have developed specific DNA-based tests as sensitive and specific techniques. The aim of this review is to provide an overview of polymerase chain reaction (PCR)-based methods used for detection or quantification of the most widespread strawberry pathogens, such as Fusarium oxysporum f.sp. fragariae, Phytophthora fragariae, Colletotrichum acutatum, Verticillium dahliae, Botrytis cinerea, Macrophomina phaseolina, and Xanthomonas fragariae. An updated and detailed list of published PCR protocols is presented and discussed, aimed at facilitating access to information that could be particularly useful for diagnostic laboratories in order to develop a rapid, cost-effective, and reliable monitoring technique. Methods: The study design was a systematic review of PCR-based techniques used for detection and quantification of strawberry pathogens. Using appropriate subject headings, AGRICOLA, AGRIS, BASE, Biological Abstracts, CAB Abstracts, Google Scholar, Scopus, Web of Knowledge, and SpringerLink databases were searched from their inception up to April 2014. Two assessors independently reviewed the titles, abstracts, and full articles of all identified citations. Selected articles were included if one of the mentioned strawberry pathogens was investigated based on PCR methods, and a summary of pre-analytical requirements for PCR was provided. Results: A total of 259 titles and abstracts were reviewed, of which 22 full texts met all the inclusion criteria. Our systematic review identified ten different protocols for X. fragariae, eight for P. fragariae, four for B. cinerea, six for C. acutatum, three for V. dahlia, and only one for F. oxysporum. The accuracy and sensitivity of PCR diagnostic methods is the focus of most studies included in this review. However, a large proportion of errors in laboratories occur in the pre-analytical phase of the testing process. Due to heterogeneity, results could not be meta-analyzed. Conclusions: From a systematic review of the currently available published literature, effective detection assays to detect the major strawberry pathogens have been developed. These assays can function as a basis for clinical labs, regulatory personnel, and other diagnosticians to adapt or implement for detection of these six important strawberry pathogens. Keywords: Molecular diagnostic methods, PCR-based techniques, Strawberry pathogen detection, Systematic review

* Correspondence: [email protected] 1Department of Field Crops and Grassland Husbandry, Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences, Tartu, Estonia Full list of author information is available at the end of the article

© 2015 Mirmajlessi et al.; licensee BioMed Central. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

73 Mirmajlessi et al. Systematic Reviews 2015, 4:9 Page 2 of 11 http://www.systematicreviewsjournal.com/content/4/1/9

Background be detected and quantified by PCR-based methods in Strawberry (Fragaria × ananassa) is one of the world’s numerous hosts or environmental samples [11,15]. most commercially important fruit crops [1]. It was The necessity of fast, sensitive, and specific methods estimated that the global strawberry production in 2012 to detect pathogen is important to improve decision was 4,516,810 tons, according to Food and Agriculture making in disease control. So, the primary objective of Organization (FAO) statistics [2]. Strawberry diseases this review is to provide an exhaustive overview of the are a major limiting factor that severely impact the existing scientific literature available on PCR-based diag- plant agronomic performance and lead to economic nostic techniques that is restricted to the detection and losses. Moreover, most strawberry cultivars are highly quantification of the seven most abundant strawberry susceptible to several destructive and economically im- pathogens: F. oxysporum f.sp. fragariae, P. fragariae, C. portant pathogenic fungi and bacteria such as Fusarium acutatum, V. dahliae, B. cinerea, M. phaseolina, and X. oxysporum f.sp. fragariae, Phytophthora fragariae, fragariae. A secondary objective is to determine the pre- Colletotrichum acutatum, Verticillium dahliae, Botrytis analytical requirements of PCR assays (such as sample cinerea, Macrophomina phaseolina, and Xanthomonas preparation of target pathogens and treatments prior to fragariae [3,4]. amplification). Finally, this compilation intends to pro- Early, rapid, and specific detection and identification of vide an updated list of published PCR protocols for de- plant pathogens is essential for effective plant disease man- tection and quantification of strawberry pathogens with agement [5]. Without specific disease diagnosis, proper the aim of establishing a common diagnostic PCR based- control measures cannot be used at the appropriate time method for routine testing by looking at the factors that [6]. Conventional methods to detect and identify pathogens affect the efficiency of the different test formats and com- have often relied on isolating the pathogen onto selective paring their performance in pathogen detection in plant media or through biochemical, chemical, and immuno- material and soil. logical analyses [7]. These methods are fundamental to diagnose the presence of plant pathogens, but they rely on Methods time-consuming and labor-intensive lab techniques and on Search strategy skilled taxonomical expertise [8]. Molecular-based tech- In line with our experimental design, only relevant scien- niques can overcome many of the shortcomings of the tific papers published any time before 1 April 2014 and in conventional assays, especially if they rely on polymerase the English language in a peer-reviewed journal were chain reaction (PCR) assays. PCR-based assays are gener- taken into consideration. The search was extended to li- ally more specific and much faster than conventional braries, such as AGRICOLA, AGRIS, BASE, Biological techniques [5,9]. Moreover, these techniques can also Abstracts, CAB Abstracts, Google Scholar, Scopus, Web be applied on non-culturable microorganisms, as the or- of Knowledge, Science Direct, and SpringerLink, using the ganism does not need to be isolated to be identified by following identifiers: “PCR”, “molecular diagnostic”, “F. PCR [10]. An increasing amount of diagnostic methods oxysporum f.sp. fragariae”, “P. fragaria”, “C. acutatum”, recommended by the European and Mediterranean Plant “V. dahliae”, “B. cinerea”, “M. phaseolina”, and “X. fragar- Protection Organization (EPPO) are based on PCR assays iae”. All associated terms were combined using “OR” and [11,12]. This technique is nowadays considered a routine then “AND” to yield a total number of abstracts for each technique in molecular diagnosis. database (see Additional file 1). Two assessors (SMM, EL) Plant disease management necessitates the need to re- independently reviewed the titles and abstracts of all iden- duce the spread of the pathogen. The extent in the tified citations. Results were limited to strawberry patho- optimum implementation of control strategies depends gens. Searches were carried out in all fields by default, not only on the presence of a pathogen but also on the and, where possible, searches were not restricted to titles pathogen inoculum load. Thus, the capability of quantify- or abstracts, but extended to the full text of the article. ing the pathogen load represents an important aspect of Both reviewers independently evaluated each full-text art- plant disease management [13]. Quantification based on icle. Disagreements were resolved by consensus. Table 1 culturing techniques is considered relatively nonspecific, lists all selected references that were included in the sys- while quantification using PCR techniques, in particular tematic review. real-time PCR (rtPCR), provides a reliable estimation of the pathogen load. Unlike end-point PCRs, rtPCRs Selection criteria and data extraction allow the detection of amplification products while the Titles and abstracts of papers detected using the search reaction is taking place, i.e., during each PCR cycle. strategy described above were further examined in order Template quantification is highly specific because it as- to include only articles that investigate molecular diag- sesses during the exponential phase of the reaction nostic methods on strawberry pathogens. Thereafter, the [9,14]. Nowadays, a wide range of plant pathogens can articles were further selected if (1) the methods reported

74 Mirmajlessi et al. Systematic Reviews 2015, 4:9 Page 3 of 11 http://www.systematicreviewsjournal.com/content/4/1/9

Table 1 Studies included in the systematic review of PCR techniques used for detecting of strawberry pathogens Year First author Pathogen PCR method Sample preparation Origin of culture Reference (long-term storage) 1996 Sreenivasaprasad CA Conventional NG UK [73] 1996 Roberts XF Conventional + nested −70°C in 15% glycerol US [49] 1996 Pooler XF Multiplex NG US [47] 1997 Bonants PF Nested V8 oatmeal agar containing Scotland + Netherlands [45] 50 ppm vancomycin/French bean agar at 4°C 1997 Mahuku XF Nested −70°C in 25% glycerol Canada [50] 1997 Zhang XF Conventional NG US [74] 2002 Rigotti BC Conventional (Southern blot NG Switzerland [22] hybridization) 2004 Stöger XF Conventional NG Austria [16] 2004 Zimmermann XF Nested −20°C in 30% glycerol Germany [48] 2004 Bonants PF Nested + real-time (TaqMan, Mol. V8 agar at 11°C Netherlands [13] Beacon) + PCR-ELISA 2005 Suarez BC Real-time (TaqMan) Frozen plastic bag at −20°C UK [21] 2006 Ioos PF Conventional NG France [19] 2006 Drenth PF Conventional Freeze-dried at −70°C Australia [72] 2007 Weller XF Real-time (TaqMan) NG UK [51] 2008 Vandroemme XF Real-time (TaqMan) NG Belgium [18] 2008 Turechek XF Real-time (TaqMan) NG US [17] 2008 Pérez-Hernández CA Nested + conventional NG US [29] 2008 Kuchta VD Conventional Czapek-Dox Agar at 4°C Poland [46] 2009 Debode CA Real-time (TaqMan) NG Belgium [27] 2009 Garrido CA Conventional + real-time (TaqMan) Sterile water at 4°C Spain + UK [28] 2012 Bilodeau VD Multiplexed real-time (TaqMan) NG US [33] 2013 Suga FO Multiplex −80°C in 50% glycerol Japan [1] XF Xanthomonas fragariae, PF Phytophthora fragariae, BC Botrytis cinerea, VD Verticillium dahliae, FO Fusarium oxysporum, CA Colletotrichum acutatum, NG not given. a summary of pre-analytical requirements for PCR and abstracts and unpublished studies) and duplicate publica- (2) the investigation included PCR methods applied on tions of the same data were disregarded. either of the following pathogens: X. fragariae, P. fragariae, M. phaseolina, F. oxysporum, V. dahliae, B. cinerea, Study design and quality and C. acutatum. Studies that described PCR-based The full text of all selected articles was read, and rele- diagnostic methods but did not investigate strawberry vant information was extracted, summarized, and sche- pathogens were excluded from the systematic review. matically outlined in tables. All methods described in In addition to this, all references of the selected arti- the included articles were summarized in six tables (see cles were scanned if the title of the article mentioned the supplemental information: Additional file 2: Tables S1, use of molecular diagnostic methods on strawberry S2, S3, S4, S5, and S6) based on the aforementioned pathogens. The newly selected article underwent the pathogens. They were referred to in the text by number same selection criteria outlined above. Four experts on (S#). Moreover, each method included in the supplemen- the subject were identified from relevant publications tary tables was assessed for quality on the basis of three and were contacted by email in order to receive advice criteria that were defined a priori as essential to answer on relevant literature on the molecular diagnostic the research questions: used PCR-based methods for de- methods in strawberry pathogens. Two responses were tection and quantification of important pathogens on received. These included three articles, one was consid- strawberry and soil samples, compared available methods ered not relevant (based on the criteria outlined above) through detection sensitivity and specificity of each and the remaining two articles had been already identified method, and presented pre-analytical requirements (i.e., in the preliminary search. Gray literature (conference sample preparation) related to the accuracy of each

75 Mirmajlessi et al. Systematic Reviews 2015, 4:9 Page 4 of 11 http://www.systematicreviewsjournal.com/content/4/1/9

method. Studies were defined satisfactory if they met all Results three criteria. The articles originated from 1996 to 2013, with a rapid increase in the number of publications on the topic since Data analyses 2004. The original systematic search strategy identified The Results section focuses on important strawberry 259 unique citations, of which 200 articles were ex- pathogens found in this review. The molecular methods cluded based on the content of the title and/or abstract used and main outcomes in each study were investi- (Figure 1). gated. However, a statistical meta-analysis was not justi- The initial search resulted in 259 hits. Fifty-nine were fied because of the heterogeneity of the included studies selected based on the title and abstract. Full text was in detecting strawberry pathogens based on PCR-based read and references were checked for additional hits. assays. We synthesized the results (in the supplementary This resulted in ten additional hits. Twenty-two papers tables) according to PCR protocol, primer sets and target were included based on the full text. DNA employed in each study, pathogen treatment, and Fifty-nine articles were read and evaluated for inclu- sensitivity of detection. sion criteria. This resulted in the inclusion of 20 articles.

Figure 1 Flow diagram of the study selection process for the systematic review.

76 Mirmajlessi et al. Systematic Reviews 2015, 4:9 Page 5 of 11 http://www.systematicreviewsjournal.com/content/4/1/9

Ten articles were read based on references, of which other published single-round PCR tests. Real-time PCR two were included, bringing the sum of included rele- and nested rtPCR (nrtPCR) methods using fluorescent- vant articles to 22 (Table 1). Several PCR-based tech- labeled probes (TaqMan™ and Molecular Beacon™) have niques were investigated in the 22 selected articles: the necessary properties to fulfill the requirements of an Nested PCR (nPCR) was investigated in six studies, effective detection system and are the other studied proce- real-time PCR (rtPCR) was adopted in 12 articles, con- dures for P. fragariae diagnostic [S#13–15]. The nested ventional PCR (cPCR) was reported in ten articles, and PCR-based method is described to be 1,000–10,000 times four studies focused with other techniques. more sensitive compared to single-round PCR [13]. With The findings are reported as essential data in Table 1 Molecular Beacon™ probes, the pathogen is detected in a as well as Additional file 2: Tables S1 to S6, which com- quantitative order similarly to TaqMan™ probes, which prised the following information: name of the pathogen are able to detect 0.1 fg DNA of the pathogen. In a in the original article, name of the primer(s) and target comparative study, the sensitivity of Molecular Beacon™ DNA, variants utilized in the PCR protocol, type of sam- and TaqMan™ probes against a dilution series of P. fra- ple, and treatment prior to amplification, and summa- gariae genomic DNA was equivalent [13]. Nested PCR rized below according to each pathogen. is also reported to successfully detect P. fragariae [S#11] in naturally infected strawberry tissues. Another less in- Xanthomonas fragariae vestigated test, like PCR-ELISA [S#12], has been advised The bacterium X. fragariae Kennedy et King (Additional for use in pathogen detection. However, this test cannot file 2: Table S1), the causal agent of angular leaf spot, is be recommended for critical diagnosis, since the sensitiv- a pathogen that spreads in all major areas of strawberry ity is comparable to gel electrophoresis and ethidium cultivation [16]. It is a very slow-growing bacterium in bromide gel staining [13]. culture and is easily overgrown by saprophytic bacteria; selective media are not yet available. Therefore, isolation Botrytis cinerea plating is not recommended for the detection of low X. B. cinerea Pers. Fr. (Additional file 2: Table S3), the fragariae numbers in symptomless plants [11]. Several causal agent of gray mold or Botrytis blight, establishes PCR detection methods each targeting different loci in symptomless infections, where the pathogen remains la- the X. fragariae genome have been developed. Conven- tent until the strawberry ripens [20]. TaqMan chemistry tional PCR using species-specific primers is known to [S#20–22] based on primers and probes designed to the differentiate close species and used for detection of X. b-tubulin gene, the intergenic spacer (IGS) region of the fragariae [S#1,5,6]. Nested PCR [S#2,4,7] is also another rDNA, and the species-specific sequence-characterized main technique used for X. fragariae, while multiplex amplified region (SCAR) as the main genomic regions PCR (mPCR) [S#3] is found just in one study for detec- used to design rtPCR assay was applied for the detection tion of X. fragariae in plant tissue. Notably, rtPCR assays and quantification of the fungus in infected strawberry are used for many bacteria including the species on which plant tissue before and after symptom expression [20]. we focused in this review, although TaqMan chemistry is Based on Suarez et al. [21] results, the IGS assay gave a prominently used for detection and quantification of X. Ct value <40 of pure B. cinerea DNA that was 100 times fragariae [S#8–10] that could even detect ten bacterial more sensitive than the SCAR assay and 1,000 times cells in strawberry crown tissue. The detection of X. fra- more sensitive than the b-tubulin assay. Random ampli- gariae in crown tissue extract was possible with real-time fied polymorphic DNA (RAPD) with Southern blot PCR but not with standard PCR, which is a significant im- hybridization [S#19] is also an applicable and powerful provement over standard PCR [17]. The assay offers a tool for diagnosis of B. cinerea in symptomless straw- new tool for epidemiological research and for sanitary berry under field conditions [22]. In other words, control of plant material with low level or latent infections hybridization of southern blots with RAPD and EcoRI- of pathogen [18]. digested DNA confirmed the specificity of the marker for detection and quantification of the pathogen during Phytophthora fragariae the latency period. The procedure was able to amplify Conventional PCR [S#16–18] assays have been developed the 0.7-kb B. cinerea fragment from mixed samples of for P. fragariae (Additional file 2: Table S2) targeting dif- DNA as low as 2 pg B. cinerea genomic DNA and 1 μg ferent single-copy genes and rDNA spacer region, al- plant DNA. though studies show contradicting results on detection sensitivity. In this respect, species-specific polymorphisms Fusarium oxysporum were exploited in RAS-like and TRP1 genes to develop a F. oxysporum f.sp. fragariae Winks & Y.N. Williams set of two P. fragariae-specific PCR primer pairs [19]. (Additional file 2: Table S4) is a polyphagous soilborne Thus, it seems to be equally or even more sensitive than facultative pathogen causing strawberry wilt disease that

77 Mirmajlessi et al. Systematic Reviews 2015, 4:9 Page 6 of 11 http://www.systematicreviewsjournal.com/content/4/1/9

has dramatically decreased the commercial production for amplification improvement, are described as poten- of strawberry [23]. Multiplex PCR [S#23] was used as tial assays for detection of V. dahliae in the strawberry the main detection technique to determine the pathogen plant and soil. A multiplexed TaqMan rtPCR [S#32] based on DNA fragments. Although mPCR is becoming based on the rDNA IGS provides a more specific quanti- a rapid and convenient screening assay for most Fusar- fication of the pathogen at low inoculum densities with ium spp., it has been used for detection of F. oxysporum a higher level of sensitivity. According to Bilodeau et al. in strawberry in just one study. Suga et al. [1] charac- [33], the sensitivity of the method allows specific detec- terized and used some transposable elements (sequence- tion of one to two microsclerotia/g of V. dahliae in soil, characterized amplified regions) in the pathogen to design which represents a higher sensitivity compared to other a specific set of PCR primers, as shown in Additional methods for this pathogen. file 2: Table S4. The genomic region between Han and Skippy (as transposable elements) was amplified by an Macrophomina phaseolina inter-retrotransposon-amplified polymorphism technique M. phaseolina (Tassi) Goid., the cause of charcoal rot on (IRAP-PCR), and specific primers were designed from this strawberry, has a wide geographic distribution because it region. The developed PCR primers discriminated F. oxy- infects the roots and lower stem of over 500 plant spe- sporum f.sp. fragariae strains from nonpathogenic F. oxy- cies [34,35]. Many PCR-based detection methods are sporum strains and five other formae speciales [1]. Use of able to detect M. phaseolina on plant tissues and soil other PCR-based techniques could not be found for [36-38], but no study has been found for detection and strawberry fusarium wilt diagnosis, while the molecular quantification of the pathogen on strawberry. However, detection of F. oxysporum on other hosts has been published protocols may provide useful information about reported [24,25]. application of available detection methods on strawberry. Recently, a rtPCR using TaqMan and SYBR Green was Colletotrichum acutatum published which enables a specific quantification of M. C. acutatum (Additional file 2: Table S5) is one of the phaseolina abundance in rhizosphere and plant tissues most frequently reported species of the genus and causes [39]. Thus, this method seems to be a strong diagnostic anthracnose disease which is especially destructive on tool for M. phaseolina. strawberry [26]. For rapid and specific assessment of the pathogen in strawberry, TaqMan rtPCR [S#27,28] using Discussion primers designed to the rDNA ITS is used and strongly A variety of molecular methods have been described for recommended. Development of the b-tubulin-based specific detection and identification of phytopathogenic rtPCR primers is less complicated, but the single copy fungi and bacteria. However, the present compilation fo- nature of this target leads to primers that are less sensi- cused solely on the PCR-based protocols available for tive and therefore less suitable for detection of C. acuta- routine diagnosis including detection or quantification tum than the multi-copy ITS regions [27]. In a similar of strawberry pathogens. Our systematic review identi- study, Garrido et al. [28] demonstrated that TaqMan fied ten different protocols for X. fragariae, eight for P. rtPCR is 10–100 times more sensitive than cPCR [S#29] fragariae, four for B. cinerea, six for C. acutatum, three for diagnosis of the strawberry anthracnose agent. More- for V. dahliae, and only one for F. oxysporum. No PCR- over, nPCR [S#25] is another technique which can be based detection method for M. phaseolina in strawberry successfully used to detect C. acutatum on symptomless could be identified in the literature yet. The strawberry strawberry leaves. Because of strong detection sensitivity, pathogens included above were chosen due to their eco- this method can be applied as a powerful tool for a reli- nomic impact on crop losses, their distribution, and able diagnosis of the pathogen in the field [29]. Since their status as quarantine organisms. Specificity and sen- rtPCR is usually less affected by inhibitors such as sitivity of methods were identified by systematically chlorogenic acid than cPCR [30], detection of C. acuta- summarizing the available literature (Additional file 2: tum in necrotic leaf tissue may be more difficult with Tables S1 to S6). conventional or nested PCR than with rtPCR. Generally, the sequences and the genomic targets of conserved universal genes with enough sequence vari- Verticillium dahlia ation between species are the best choice for designing Verticillium wilt, caused by the soilborne fungus V. dah- PCR diagnostic assays. Depending on the genomic re- liae (Additional file 2: Table S6), is an economically im- gion chosen to design PCR primer sets, highly specific portant disease worldwide, which can cause significant diagnostic tests can be obtained, allowing detection of crop loss on strawberry even with low soil inoculum the specific pathogen species and strains from related densities [31,32]. Nested amplification [S#30] assay and species or within the same species, respectively [9,40]. cPCR [S#31], using modified DNA extraction methods Primer design requires knowledge of the target DNA

78 Mirmajlessi et al. Systematic Reviews 2015, 4:9 Page 7 of 11 http://www.systematicreviewsjournal.com/content/4/1/9

sequences, and multiple strategies are therefore being of commercial kits and DNA extraction protocols for developed to design primers for specific detection and DNA purification and removal of PCR inhibitors from disease diagnosis [41-44]. The rDNA operon has fre- plant materials and soils are available and reported in quently been used to design primers that allow highly Additional file 2: Tables S1 to S6. Also, in two included sensitive detection, but due to its universal nature, the studies [33,51], internal PCR controls were employed in level of discrimination lies at the species levels [15]. The order to improve sensitivity and avoid false negatives. ITS region within prokaryotic and eukaryotic rDNA op- Thirdly, some results were obtained from nucleic acids erons has been described as a stable genetic marker and present in the soil rather than living cells. Hence, there was used to design primers by Bonants et al. [13,45], is a risk of detecting target DNA from dead sources; Vandroemme et al. [18], Turechek et al. [17], Kuchta DNA can persist in soil for long periods of time by et al. [46], Debode et al. [27], and Garrido et al. [28], forming complexes with soil components and may lead among others. Thus, the ITS region is the most widely to positive PCR results [55,56]. Lastly, the majority of sequenced for strawberry pathogens. Another genomic the included studies in the literature review investigated portion of the rDNA cistron is the spacer between IGS PCR methods based on agarose gels for detection/identi- or the non-transcribed spacer (NTS) that was used to fication of strawberry pathogens. However, some studies design primers by Suarez et al. [21] and Bilodeau et al. focused on quantification of the pathogen using the [33]. IGS sequences are more difficult for amplification rtPCR technique, in which sensitivity was increased. and sequencing, but they can be more variable than the Conventional and real-time PCRs are difficult to com- ITS sequences. Thus, they are exploited to design diag- pare because of the different throughput, sensitivity, and nostic assays when there are not enough differences resolution levels [57]. available across the ITS [9]. Moreover, among conserved Several methods have been developed to improve sen- genes, the b-tubulin has been used to develop diagnostic sitivity of cPCR with regard to the goal of this study. PCR assay for B. cinerea and C. acutatum. The sequence Nested PCR with both internal and external primers to of this gene can be useful when the ITS sequence does the target sequence was reported to increase detection not allow to fulfill specificity requirements of a diagnos- sensitivity and reduce the effect of PCR inhibitors tic test [9]. A few loci suitable for the design of species- [46,48,50]. In fact, when the pathogen is present in very specific primers for X. fragariae have been identified: low levels, a higher level of specificity is needed, or the RAPD-specific regions [47,48], within the hrp [16,49,50] infestations need to be detected in complex environmen- and gyrB [18,51] genes. tal samples [50], affecting the reaction. However, the risk There is a discussion between results of studies that of false positives due to cross-contamination of reaction can be described by four variables. Firstly, in the primers mixtures in routine analysis of large numbers of samples reported here, sequences from pathogenicity-related is increased by the introduction of a second round of genes of different species have been employed, although amplification and the simultaneous manipulation of the pathogenicity genes are not known in most cases. But, previously amplified products [49]. To avoid these prob- there is an example of the need to design new primers lems, nPCR in a single closed tube has been developed after the discovery of forma specialis that lack some [58,59]. pathogenicity genes, previously considered universal. mPCR, a PCR variant which is designed to amplify mul- Many types of transposable elements such as Hop, Hor- tiple targets by using multiple primer sets in the same re- net1, Foxy, Fofra, and Skippy were considered as excel- action, was applied for detection of F. oxysporum in lent targets for F. oxysporum f.sp. fragariae detection, strawberry [1]. Although mPCR consists of a simultaneous and several sets of primers were designed on its se- screening method in a single reaction tube for the rapid quence [1,52-54]. However, the discovery of nonpatho- and sensitive detection of different DNA targets, it re- genic F. oxysporum showed that these primers were not quires a tedious and time-consuming optimization pro- as specific as expected [1]. Secondly, the frequent pres- cesses to keep up sensitivity of the single PCR due to ence of PCR inhibitors in the plant tissues or soil can competition between different amplification products in considerably reduce the sensitivity of the reaction. Thus, one tube [60]. Decrease in sensitivity and limited number a low copy number of initial target DNA sequences of targets that can be simultaneously detected are the makes the first amplification cycles critical, because it most significant drawbacks of mPCR [61]. rtPCR offers may result in false-negative results caused by PCR inhib- better multiplexing possibilities, but multiplexing is still itors [14]. This could have a major impact on the result limited by the availability of dyes emitting fluorescence at of diagnostic tests and therefore is a confounding, but different wavelengths [14]. A similar limitation to the use important, variable. In this context, sample preparation of multiplex rtPCR is the competition between different is critical, and target DNA should be made as available primers and probes which can result in lower sensitivity as possible for amplification. So, an increasing number and specificity [62,63]. However, Bilodeau et al. [33]

79 Mirmajlessi et al. Systematic Reviews 2015, 4:9 Page 8 of 11 http://www.systematicreviewsjournal.com/content/4/1/9

reported a rapid and specific determination of soil inocu- account. First of all, the TaqMan technique tends to be lum densities of V. dahliae in strawberry fields without re- more specific than SYBR Green due to the use of the se- duction of sensitivity against single amplifications using quence specific probe; however, this leads to higher initial multiplexed TaqMan rtPCR. Another powerful and prac- costs [70]. Secondly, the SYBR Green method is cheaper to tical technique for simultaneous detection of multiple establish since fluorescent-labeled probes are not used; plant pathogens in a wide range of environmental samples however, SYBR Green fluorophores can also associate with is the macro- and micro-array [8,64,65], but is not found non-specific reaction products such as primer-dimers for the aforementioned pathogens during our literature which may result in poor specificity and false-positive re- survey. sults [57]. Thirdly, availability of instrumentation, the de- In plant disease management, the assumption that gree of diversity among target and non-target sequences, rtPCR is more sensitive than cPCR is widely accepted. and the need for multiplexing are primary factors in the The higher sensitivity of rtPCR compared to cPCR is de- choice of real-time platforms [70,71]. In fact, SYBR Green™ termined by two main features: firstly, data are available in does not allow to multiplex different amplification prod- real time, are on-screen, do not require time-consuming ucts. In this scenario, no SYBR Green protocol has been post-PCR processing, and can be quantitative. Secondly, published for detection of studied strawberry pathogens rtPCR assays commonly amplify very short DNA frag- yet. In this review, we also included studies using PCR- ments (70–100 bp) which favors a higher level of PCR effi- ELISA [13] and cPCR using PCR kit [16] that allow detec- ciency and sensitivity compared to cPCR [28,66]. In this tion of P. fragariae and X. fragariae in strawberry plants, regard, many different systems have been developed, in- respectively. These techniques are not as powerful as cluding probe-based methods, such as TaqMan probes rtPCR in detecting and quantifying pathogens but were [9,13,15] and molecular beacons [13]. In general, the pro- nevertheless included in this review since they still did tocols developed are based on hybridization of the probe allow a reliable detection of strawberry pathogens. to the target amplicon, thus achieving maximum sensitivity and confirming the identity of the amplified product Limitations [14,15,28]. Only 12 kinds of rtPCR protocols are referred This review focuses mostly on sensitivity of PCR diag- to here for detection and quantification of strawberry nostic methods outlined in the selected articles. Sensitiv- pathogens. But one should bear in mind that their number ity of diagnostic methods is reported in Additional file 2: has increased from only one in 2004 [13] to six between Tables S1 to S6; however, most studies did not include 2007 and 2012 [17,18,27,28,33,51]. It seems that, since information on sensitivity levels of the investigated tech- amplicon detection through the specific fluorescent signal nique(s). Hence, accuracy of measurements based on removes the requirements for post-amplification phases their performance in pathogen detection was difficult to needed in cPCR, it reduces time and considerably pro- define because different studies employed different proce- motes the throughput of rtPCR assays, making it suitable dures for inoculum preparation, DNA extraction [72-74], for large-scale analyses of the mentioned pathogens. Be- and primer design (from different regions of the gene). sides, primers designed for cPCR can be utilized in rtPCR These will impede to define common pre-analytical re- assays if amplicon size criteria are met [57]. Hence, exist- quirements, DNA isolation, and amplification procedure ing cPCR protocols for the detection of plant pathogens (as the factors that affect the efficiency of the test formats) can be adapted to be used in real-time detection (rtPCR to be employed in routine analyses with the aim of estab- assays), which can result in a higher level of sensitivity. lishing a common diagnostic PCR-based method. There- In this compilation, all of the rtPCR protocols have uti- fore, it was impossible to make direct comparisons lized probe-based methods, which provide greater sensitiv- between studies. Also, PCR-based quantification of genes ity and specificity than other PCR techniques for detection amplified from nucleic acids isolated from environmental of strawberry pathogens. However, DNA-intercalating dyes samples is influenced by a number of confounding factors. can offer a valid alternative to probe-based methods that Firstly, nucleic acid extraction efficiencies are different be- bind to double-stranded DNA. SYBR Green is one of the tween different methods, and so the performance of the most widely used intercalating DNA dyes for rtPCR appli- final nucleic acid is dependent on both the method used cations because of cost efficiency, generic detection of and the type of environmental sample. Most included amplified DNA, and its ability to differentiate PCR prod- studies used commercial kits to extract DNA from straw- ucts by melting curve analysis [67]. Nevertheless, the draw- berry tissues, because of their simplicity and rapidity to- back of using SYBR Green for melting curve analysis is gether with the absence of harmful chemical compounds. that the melting temperature is highly dependent on the However, DNA isolation kits can be expensive and ineffi- concentration of the dye [68] and DNA [69]. TaqMan™ and cient when handling plants with high polyphenolic con- SYBR™ green techniques are most widely used for diagnos- tent. Secondly, many different extraction procedures are tic purposes, but several considerations must be taken into used for various samples and within different laboratories,

80 Mirmajlessi et al. Systematic Reviews 2015, 4:9 Page 9 of 11 http://www.systematicreviewsjournal.com/content/4/1/9

making direct comparison between studies extremely Authors’ contributions problematic. Therefore, in order to compare detection SMM conceptualized and designed the study and conducted the search strategy, drafted the initial manuscript, and approved the final manuscript as sensitivity from different environmental samples, it must submitted. EL supervised the search strategy and the methods, critically first be ensured that the same extraction procedure is used reviewed and revised the manuscript, and approved the final manuscript as for each sample. Indeed, the absence of common pre- submitted. MM contributed to the concept and design of the study, reviewed the manuscript, and approved the final manuscript as submitted. analytical procedures might affect final results. Generally, MD and RAG critically reviewed and revised the manuscript and approved real-time PCR was mostly used in the studies under inves- the final manuscript as submitted. All authors read and approved the final tigations but not with the same primer and probe, result- manuscript. ing in a restricted comparability. However, while keeping Acknowledgements the limitations of the used PCR-based methods in mind, This work was funded by EUPHRESCO (European Phytosanitary Research rtPCR remains the gold standard technique for detection Coordination) Phytosanitary ERA-Net project SPAT (Strawberry Pathogens and quantification of strawberry pathogens. Assessment and Testing). The authors especially thank Prof. Peter Harley (National Center for Atmospheric Research, Colorado, USA) for his critical reviewing of the manuscript. We also thank Inmaculada Larena (Agricultural National Research Institute, Department of Plant Protection, Madrid, Spain) and Conclusions Maria Bergsma-Vlami (National Reference Centre, Plant Protection Service, From a systematic review of the currently available pub- Wageningen, The Netherlands) for giving valuable comments and suggestions for improving the quality of this work. lished literature, rtPCR is shown to be a particularly promising technique for diagnosing and quantifying Author details pathogen populations in strawberry, whereas some other 1Department of Field Crops and Grassland Husbandry, Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences, techniques are suitable for the identification/detection of Tartu, Estonia. 2Pesticides, Plant Health and Seed Testing Laboratories, the aforementioned pathogens. The technique rtPCR al- Department of Agriculture, Food and the Marine, Backweston Campus, lows a specific, reliable, and high-throughput detection Celbridge, Co. Kildare, Ireland. 3Department for Molecular Diagnostics of Plant Diseases, Institute for Sustainable Plant Production, Austrian Agency for of target DNA in symptomless strawberry leaves and Health and Food Safety (AGES), Vienna, Austria. 4Department of Plant various environmental samples in real time. However, Protection, Institute of Agricultural and Environmental Sciences, Estonian we hypothesize that a large proportion, possibly a major- University of Life Sciences, Tartu, Estonia. ity, of errors in laboratories occurs in the pre-analytical Received: 8 July 2014 Accepted: 2 January 2015 phase of the testing process. Therefore, pre-analytical Published: 15 January 2015 factors need to be considered when applying a diagnostic test. As more PCR-based methods for detection of plant References 1. Suga H, Hirayama Y, Suzuki T, Kageyama K, Hyakumachi M. Development of pathogenic fungi and bacteria become available, their PCR primers to identify Fusarium oxysporum f. sp. fragariae. Plant Dis. use will progressively increase not only for identification 2013;97(5):619–25. purposes but also for different applications, such as 2. Faostat (Food and Agriculture Organization Corporate Statistical Database). World strawberry production. 2013. [http://faostat.fao.org/site/567/ studies on pathogen population in their ecosystem in DesktopDefault.aspx?PageID = 567#ancor. Accessed 9 Mar 2013. order to facilitate reliable detection. These studies are 3. Maas JL. Compendium of strawberry diseases. St Paul, MN: APS Press; 1998. fundamental to obtain a comprehensive understanding 4. Redondo C, De-Cal A, Martinez-Treceño A, Becerril M, López-Aranda JM, Melgarejo P. Evaluation of resistance of several strawberry selections against of the pathogen biology with the final intent of optimiz- main fungal pathogens. In: López-Medina J, editor. Proceedings of the VI ing plant disease management strategies. International Strawberry Symposium: 3–7 March 2009; Huelva (Spain). Acta Horticulturae 842. 2009. p. 211–4. 5. Sankarana S, Mishraa A, Ehsania R, Davis C. A review of advanced techniques for detecting plant diseases. Comput Electron Agr. 2010;72:1–13. Additional files 6. McCartney HA, Foster SJ, Fraaije BA, Ward E. Molecular diagnostics for fungal plant pathogens. Pest Manag Sci. 2003;59:129–42. Additional file 1:Search strategy. The file contains a sample search 7. Singleton LL, Mihail JD, Rush CM. Methods for research on soil-borne strategy. phytopathogenic fungi. St Paul, MN: APS Press; 1992. 8. Lievens B, Brouwer M, Vanachter ACRC, Levesque CA, Cammue BPA, Additional file 2: Supporting information. Summaries of the included Thomma BPHJ. Quantitative assessment of phytopathogenic fungi in studies are reported along with the quantitative measurements undertaken various substrates using a DNA macroarray. Environ Microbiol. by the original articles that assessed detection sensitivity in each protocol. 2005;7(11):1698–710. Table S1: PCR-based techniques applied for detection of X. fragariae in 9. Schena L, Nigro F, Ippolito A. Real-time PCR detection and quantification of strawberry. Table S2: PCR-based techniques applied for detection of P. soilborne fungal pathogens: the case of Rosellinia necatrix, Phytophthora fragariae in strawberry. Table S3: PCR-based techniques applied for nicotianae, P. citrophthora, and Verticillium dahliae. Phytopathol Mediterr. detection of B. cinerea in strawberry. Table S4: PCR-based techniques 2004;43:273–80. applied for detection of F. oxysporum f.sp. fragariae in strawberry. Table S5: 10. Lievens B, Grauwet TJMA, Thomma CBPA, BPHJ. Recent developments in PCR-based techniques applied for detection of C. acutatum in strawberry. diagnostics of plant pathogens: a review. Recent Res Develop Microbiol. Table S6: PCR-based techniques applied for detection of V. dahliae in 2005;9:57–79. strawberry. 11. OEPP/EPPO (European and Mediterranean Plant Protection Organization). Diagnostics; Xanthomonas fragariae. Bull OEPP/EPPO. 2006;36:135–44. 12. López MM, Llop P, Olmos A, Marco-Noales E, Cambra M, Bertolini E. Are Competing interests molecular tools solving the challenge posed by detection of plant The authors declare that they have no competing interests. pathogenic bacteria and viruses? Curr Issues Mol Biol. 2009;11:13–46.

81 Mirmajlessi et al. Systematic Reviews 2015, 4:9 Page 10 of 11 http://www.systematicreviewsjournal.com/content/4/1/9

13. Bonants P, van Gent-Pelzer MPE, Hooftman R, Cooke D, Guy DC, Duncan JM. A 37. Chakraborty BN, Chakraborty U, Dey PL, Rai K. rDNA sequence and combination of baiting and different PCR formats, including measurement of phylogenetic analysis of Macrophomina phaseolina, root rot pathogen of real-time quantitative fluorescence, for the detection of Phytophthora fragariae Citrus reticulata (Blanco). Global J Mol Sci. 2011;6:26–34. in strawberry plants. Eur J Plant Pathol. 2004;110:689–702. 38. Almomani F, Alhawatema M, Hameed K. Detection, identification and 14. Schena L, Li Destri Nicosia MG, Sanzani SM, Faedda R, Ippolito A, Cacciola morphological characteristic of Macrophomina phaseolina: the charcoal rot SO. Development of quantitative PCR detection methods for disease pathogens isolated from infected plants in Northern Jordan. Arch phytopathogenic fungi and oomycets. J Plant Pathol. 2013;95(1):7–24. Phytopathol Plant Protect. 2013;46(9):1005–14. 15. Schaad NW, Frederick RD, Shaw J, Schneider WL, Hickson R, Petrillo MD, 39. Babu BK, Mesapogu S, Sharma A, Somasani SR, Arora DK. Quantitative real- et al. Advances in molecular-based diagnostics in meeting crop biosecurity time PCR assay for rapid detection of plant and human pathogenic and phytosanitary issues. Annu Rev Phytopathol. 2003;41:305–24. Macrophomina phaseolina from field and environmental samples. 16. Stöger A, Ruppitsch W. A rapid and sensitive method for the detection of Mycologia. 2011;103(3):466–73. Xanthomonas fragariae, causal agent of angular leafspot disease in 40. Henson JM, French R. The polymerase chain reaction and plant disease strawberry plants. J Microbiol Meth. 2004;58:281–4. diagnosis. Annu Rev Phytopathol. 1993;31:81–109. 17. Turechek WW, Hartung JS, McCallister J. Development and optimization of a 41. Williams JGK, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV. DNA real-time detection assay for Xanthomonas fragariae in strawberry crown polymorphisms amplified by arbitrary primers are useful as genetic markers. tissue with receiver operating characteristic curve analysis. Phytopathol. Nucleic Acids Res. 1990;18:6531–5. 2008;98(3):359–68. 42. Fraaije BA, Lovell DJ, Coelho JM, Baldwin S, Hollomon DW. PCR-based assays to 18. Vandroemme J, Baeyen S, Van Vaerenbergh J, De Vos P, Maes M. Sensitive assess wheat varietal resistance to blotch (Septoria tritici and Stagonospora real-time PCR detection of Xanthomonas fragariae in strawberry plants. nodorum) and rust (Puccinia striiformis and Puccinia recondita) diseases. Eur J Plant Pathol. 2008;57:438–44. Plant Pathol. 2001;107:905–17. 19. Ioos R, Laugustin L, Schenck N, Rose S, Husson C, Frey P. Usefulness of 43. Schmittgen TD. Real-time quantitative PCR. Methods. 2001;25:383–5. single copy genes containing introns in Phytophthora for the development 44. Lees AK, Cullen DW, Sullivan L, Nicolson MJ. Development of conventional of detection tools for the regulated species P. ramorum and P. fragariae. and quantitative real-time PCR assays for the detection and identification of Eur J Plant Pathol. 2006;116:171–6. Rhizoctonia solani AG-3 in potato and soil. Plant Pathol. 2002;51:293–302. 20. Guinebretiere MH, Morrison C, Reich M, Nicot P. Isolation and characterization 45. Bonants P, Weerdt MH, van Gent-Pelzer M, Lacourt I, Cooke D, Duncan J. of antagonists for the biocontrol of the postharvest wound pathogen Botrytis Detection and identification of Phytophthora fragariae Hickman by the cinerea on strawberry fruits. J Food Protect. 2000;63:386–94. polymerase chain reaction. Eur J Plant Pathol. 1997;103:345–55. 21. Suarez MB, Walsh K, Boonham N, O’Neill T, Pearson S, Barker I. Development 46. Kuchta P, Jecz T, Korbin M. The suitability of PCR-based techniques for of real-time PCR (TaqMan®) assays for the detection and quantification of detecting Verticillium dahliae in strawberry plants and soil. J Fruit Botrytis cinerea in planta. Plant Physiol Bioch. 2005;43:890–9. Ornamental Plant Res. 2008;16:295–304. 22. Rigotti S, Gindro K, Richter H, Viret O. Characterization of molecular markers for 47. Pooler MR, Ritchie DF, Hartung JS. Genetic relationships among strains of specific and sensitive detection of Botrytis cinerea Pers.: Fr. in strawberry Xanthomonas fragariae based on random amplified polymorphic DNA PCR, (Fragaria × ananassa Duch.) using PCR. FEMS Microbiol Lett. 2002;209:169–74. repetitive extragenic palindromic PCR, and enterobacterial repetitive 23. Arroyo FT, Llergo Y, Aguado A, Romero F. First report of fusarium wilt intergenic consensus PCR data and generation of multiplexed PCR primers caused by Fusarium oxysporum on strawberry in Spain. Plant Dis. useful for the identification of this phytopathogen. Appl Environ Microbiol. 2009;93:323–3. 1996;62(9):3121–7. 24. Abd-Elsalam KA, Asran-Amal A, Schnieder F, Migheli Q, Verreet JA. Molecular 48. Zimmermann C, Hinrichs-Berger J, Moltmann E, Buchenauer H. Nested PCR detection of Fusarium oxysporum f. sp. vasinfectum in cotton roots by PCR (polymerase chain reaction) for detection of Xanthomonas fragariae in and real-time PCR assay. J Plant Dis Protect. 2006;113(1):14–9. symptomless strawberry plants. J Plant Dis Protect. 2004;111(1):39–51. 25. Li Y, Garibaldi A, Gullino ML. Molecular detection of Fusarium oxysporum f. 49. Roberts PD, Jones JB, Chandler CK, Stall RE, Roberts PD, Jones JB, et al. sp. chrysanthemi on three host plants: Gerbera jamesonii, Osteospermum sp. Survival of X. fragariae on strawberry in summer nurseries in Florida and Argyranthemum frutescens. J. Plant Pathol. 2010;92(2):525–30. detected by specific primers and nested PCR. Plant Dis. 1996;80(11):1283–8. 26. Damm U, Cannon PF, Woudenberg JHC, Crous PW. The Colletotrichum 50. Mahuku GS, Goodwin PH. Presence of Xanthomonas fragariae in acutatum species complex. Stud Mycol. 2012;73:37–113. symptomless strawberry crowns in Ontario detected using a nested 27. Debode J, Van Hemelrijck W, Baeyen S, Creemers P, Heungens K, Maes M. polymerase chain reaction (PCR). Can J Plant Pathol. 1997;19(4):366–70. Quantitative detection and monitoring of Colletotrichum acutatum in 51. Weller SA, Beresford-Jones NJ, Hall J, Thwaites R, Parkinson N, Elphinstone strawberry leaves using real-time PCR. Plant Pathol. 2009;58:504–14. JG. Detection of Xanthomonas fragariae and presumptive detection of 28. Garrido C, Carbú M, Fernández-Acero FJ, Boonham N, Colyer A, Cantoral JM, Xanthomonas arboricola pv. fragariae, from strawberry leaves, by real-time et al. Development of protocols for detection of Colletotrichum acutatum PCR. J Microbiol Methods. 2007;70:379–83. and monitoring of strawberry anthracnose using real-time PCR. Plant Pathol. 52. Hua-Van A, Daviere JM, Kaper F, Langin T, Daboussi MJ. Genome 2009;58:43–51. organization in Fusarium oxysporum: clusters of class II transposons. 29. Pérez-Hernández O, Nam MH, Gleason ML, Kim HG. Development of a Curr Genet. 2000;37:339–47. nested polymerase chain reaction assay for detection of Colletotrichum 53. Anaya N, Roncero MIG. Skippy, a retrotransposon from the fungal plant acutatum on symptomless strawberry leaves. Plant Dis. 2008;92(12):1655–61. pathogen Fusarium oxysporum. Mol Gen Genet. 1995;249:637–47. 30. Mumford RA, Walsh K, Barker I, Boonham N. Detection of potato mop top 54. Chalvet F, Grimaldi C, Kaper F, Langin T, Daboussi MJ. Hop, an active virus and tobacco rattle virus using a multiplex real-time fluorescent reverse mutator-like element in the genome of the fungus Fusarium oxysporum. transcription polymerase chain reaction assay. Phytopathol. 2000;90:448–53. Mol Biol Evol. 2003;20:1362–75. 31. Bhat RG, Subbarao KV. Host range specificity in Verticillium dahliae. 55. England LS, Lee H, Trevors JT. Persistence of Pseudomonas aureofaciens Phytopathol. 1999;89:1218–25. strains and DNA in soil. Soil Biol Biochem. 1997;29:1521–7. 32. Pegg B, Brady G. Verticillium wilts. New York: CABI Publishing; 2002. 56. Wolffs P, Norling B, Rådström P. Risk assessment of false-positive quantitative 33. Bilodeau GJ, Koike ST, Uribe P, Martin FN. Development of an assay for rapid real-time PCR results in food, due to detection of DNA originating from dead detection and quantification of Verticillium dahliae in soil. Phytopathol. cells. J Microbiol Methods. 2005;60:315–23. 2012;102(3):331–43. 57. Okubara PA, Schroeder KL, Paulitz TC. Real-time polymerase chain reaction: 34. Mihail JD, Taylor SJ. Interpreting variability among isolates of Macrophomina applications to studies on soil borne pathogens. Can J Plant Pathol. phaseolina in pathogenicity, pycnidium production and chlorate utilization. 2005;27:300–13. Can J Bot. 1995;10:1596–603. 58. Mercado-Blanco J, Rodríguez-Jurado D, Pérez-Artés E, Jiménez-Díaz RM. 35. Su G, Suh SO, Schneider RW, Russin JS. Host specialization in the charcoal Detection of the nondefoliating pathotype of Verticillium dahliae in infected rot fungus, Macrophomina phaseolina. Phytopathol. 2001;91:120–6. olive plants by nested PCR. Plant Pathol. 2001;50(5):609–19. 36. Babu BK, Saxena AK, Srivastava AK, Arora DK. Identification and detection of 59. Grote D, Olmos A, Kofoet JJ, Tuset E, Bertolini E, Cambra M. Specific and Macrophomina phaseolina by using species specific oligonucleotide primers sensitive detection of Phytophthora nicotianae by simple and nested-PCR. and probe. Mycologia. 2007;99(6):797–803. Eur J Plant Pathol. 2002;108(3):197–207.

82 Mirmajlessi et al. Systematic Reviews 2015, 4:9 Page 11 of 11 http://www.systematicreviewsjournal.com/content/4/1/9

60. Elnifro EM, Ashishi AM, Cooper RJ, Klapper PE, Multiplex PCR. Optimization and application in diagnostic virology. Clin Microbiol Rev. 2000;13:559–70. 61. Bamaga MS, Wright DJ, Zhang H. An assessment of multiplex PCR assays for differentiating clinically important mycobacteria based on pncA gene variation. Mol Cell Probes. 2003;17:69–75. 62. Tooley PW, Martin FN, Carras MM, Frederick RD. Real-time fluorescent polymerase chain reaction detection of Phytophthora ramorum and Phytophthora pseudosyringae using mitochondrial gene regions. Phytopathol. 2006;96:336–45. 63. Scauflaire J, Godet M, Gourgue M, Liénard C, Munaut F. A multiplex real- time PCR method using hybridization probes for the detection and the quantification of Fusarium proliferatum, F. subglutinans, F. temperatum, and F. verticillioides. Fungal Biol. 2012;10:1073–80. 64. Chen W, Seifert KA, Lévesque CA. A high density COX1 barcode oligonucleotide array for identification and detection of species of Penicillium subgenus Penicillium. Mol Ecol Resour. 2009;9:114–29. 65. Call DR. Challenges and opportunities for pathogen detection using DNA microarrays. Crit Rev Microbiol. 2005;31:91–9. 66. Garrido C, Carbú M, Fernández-Acero FJ, González-Rodríguez VE, Cantoral JM. New insight in the study of strawberry fungal pathogens. Genes Genomes Genomics. 2011;5(1):24–39. 67. Morrison TB, Weis JJ, Wittwer CT. Quantification of low-copy transcripts by continuous SYBR Green I monitoring during amplification. Biotechniques. 1998;24:954–8. 68. Ririe KM, Rasmussen RP, Wittwer CT. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Anal Biochem. 1997;245:154–60. 69. Xu HX, Kawamura Y, Li N, Zhao LC, Li TM, Li ZY, et al. A rapid method for determining the G + C content of bacterial chromosomes by monitoring fluorescence intensity during DNA denaturation in a capillary tube. Int J Syst Evol Micr. 2000;50:1463–9. 70. Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP. Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques. 1997;22(1):130–8. 71. Whitcombe D, Theaker J, Guy SP, Brown T, Little S. Detection of PCR products using self-probing amplicons and fluorescence. Nat Biotechnol. 1999;17:804–7. 72. Drenth A, Wagels G, Smith B, Sendall B, O’Dwyer C, Irvine G, et al. Development of a DNA-based method for detection and identification of Phytophthora species. Australas Plant Path. 2006;35:147–59. 73. Sreenivasaprasad S, Sharada K, Brown AE, Mills PR. PCR-based detection of Colletotrichum acutatum on strawberry. Plant Pathol. 1996;45(4):650–5. 74. Zhang S, Goodwin PH. Rapid and sensitive detection of Xanthomonas fragariae by simple alkaline DNA extraction and the polymerase chain reaction. J Phytopathol. 1997;145(5–6):267–70.

doi:10.1186/2046-4053-4-9 Cite this article as: Mirmajlessi et al.: PCR-based specific techniques used for detecting the most important pathogens on strawberry: a systematic review. Systematic Reviews 2015 4:9.

Submit your next manuscript to BioMed Central and take full advantage of:

• Convenient online submission • Thorough peer review • No space constraints or color ﬁgure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit

II Mirmajlessi SM, Loit E, Mänd M, Mansouripour SM, 2015. Real-time PCR applied to study on plant pathogens: potential applications in diagnosis. Plant Protection Science 51(4), 177–190.

86 Plant Protect. Sci. Vol. 51, 2015, No. 4: 177–190 doi: 10.17221/104/2014-PPS

Real-Time PCR Applied to Study on Plant Pathogens: Potential Applications in Diagnosis – a Review

Seyed Mahyar MIRMAJLESSI 1, Evelin LOIT 1, Marika MÄND 2 and Seyed Mojtaba MANSOURIPOUR 3

1Department of Field Crops and Grassland Husbandry, and 2Department of Plant Protection, Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences, Tartu, Estonia; 3Department of Plant Pathology, North Dakota State University, Fargo, USA

Abstract

Mirmajlessi S.M., Loit E., Mänd M., Mansouripour S.M. (2015): An overview of real-time PCR applied to study on plant pathogens: potential applications in diagnosis – a review. Plant Protect Sci., 51: 177–190.

Quantitative real-time PCR (qPCR) technique incorporates traditional polymerase chain reaction (PCR) efficiency with the production of a specific fluorescent signal, measuring the kinetics of the reaction in the early PCR phases and providing quantification of specific targets in various environmental samples. There are an increasing number of chemistries to detect PCR products, which are widely used in plant pathology as they cluster into the amplicon sequence non-specific and sequence-specific techniques. In this review, we illustrate a general description of major chemistries and discuss some considerations for assay development as it applies for a wide range of applications in epidemiological studies. The technique has become the gold standard for early detection of pathogens and a fundamental tool in the research laboratory.

Keywords: bacteria; fungi; oomycetes; phytoplasmas; viroids; viruses; plants; quantification; polymerase chain reaction; qPCR chemistries

One of the most important strategies for control- difficulty of culturing some species in vitro and the ling plant diseases is accurate and early detection inability for accurate quantification of the pathogen and identification of plant pathogens (Garrido et are other limitations (Goud & Termorshuizen al. 2012); actually, this is the basis of plant disease 2003). These limitations have led to the development management. Of particular importance is early de- of molecular approaches with improved accuracy and tection of pathogens in seeds and plant materials reliability. Molecular techniques are able to identify to avoid further spreading and introduction of new non-culturable microorganisms and so provide precise, pathogens into a growing area where it is not yet reliable, and reproducible results, facilitating early present (Acero et al. 2011). The accessibility of a disease management decisions (Martin et al. 2004). fast, sensitive, and accurate method for detection Polymerase chain reaction (PCR)-based technology of pathogens to improve disease control decision is a rapid and sensitive method that offers advan- making is therefore increasingly required. The tra- tages over the traditional diagnosis methods. First ditional detection methods based on morphological of all, micro-organisms do not need to be cultured; characteristics often require extensive knowledge of second, it possesses the potential to detect a single classical taxonomy and are frequently laborious and target molecule in a complex mixture; and third, time-consuming (Capote et al. 2012). Moreover, the these techniques can considerably reduce the time

Supported by the Estonian Ministry of Education and Science for the TERA contract IUT36-2 and 10.1-9/471 EUPHRESCO.

87 177 Vol. 51, 2015, No. 4: 177–190 Plant Protect. Sci. doi: 10.17221/104/2014-PPS needed for diagnosis compared with conventional reaction in real time. It is based on the detection of culturing methods. However, they still require further the fluorescence produced by a reporter molecule work to identify the PCR products when southern which increases as the reaction proceeds. These blot or sequencing are needed (Okubara et al. 2005). fluorescent reporter molecules include dyes that Conventional PCR (cPCR) has emerged as a main tool bind to the double-stranded DNA or sequence spe- for the diagnosis of plant pathogens and has contrib- cific probes (Garrido et al. 2012). The benefit of uted to reducing some problems related to the plant real-time PCR compared with cPCR is determined pathogens detection (Martin et al. 2000). On the by two main features. Firstly, data are available in other hand, because of different testing parameters in real time, on screen, do not require time consuming cPCR assays, optimisation of conditions is very chal- post-PCR processing (e.g. electrophoresis, colorimet- lenging and time consuming (Espy et al. 2006). As a ric reaction or hybridisation). Secondly, real-time result, cPCR techniques have never been extensively PCR commonly amplifies the short DNA fragments used for quantitative analysis of plant pathogens, (70–100 bp), which favours a higher level of efficiency since they are inaccurate and laborious (Schena et and sensitivity (Garrido et al. 2009). Generally, al. 2013). However, several cPCR methods have been the main advantage of real-time PCR over cPCR used for quantitative analysis of plant pathogenic is the increased sensitivity and the ability to per- fungi (Hadidi et al. 1995; Mahuku & Platt 2002). form quantitative measurements, making it suitable The necessity of fast, sensitive, and specific meth- for studying pathogen biology, epidemiology, and ods to detect pathogens is important to improve ecology. The advantages of the fluorescence based decision making in disease control (Lievens et al. real-time PCR have revolutionised the approach to 2005). Quantitative real-time PCR (qPCR) technology PCR-based quantification of nucleic acids (Wittwer allows accurate detection and/or quantification of et al. 2001; Okubara et al. 2005). Real-time PCR pathogens that cannot be extracted or cultured easily can successfully quantify the initial specific target from host tissue, or are presented at low inoculum by the measurement of the amplification products. load in samples. In fact, quantification based on This occurs due to the accumulation of the PCR culturing techniques is considered relatively inac- product with each cycle of amplification, and this is curate, while quantification using real-time PCR the reason why this method is called real-time PCR provides a reliable estimation of the pathogen load (McCartney et al. 2003). Basically, there are two (Garrido et al. 2009). Also, real-time PCR technol- common methods for the detection of products in ogy provides conclusive results as it can discriminate real-time PCR: first, non-specific fluorescent dyes between closely related organisms and is therefore a that intercalate with any double-stranded DNA; and versatile method for the accurate, reliable, and high second, sequence-specific DNA probes consisting throughput quantification of target DNA in various of oligonucleotides that are labelled with a fluores- biological fields such as botany and genetics (Cooke cent reporter which permits detection only after et al. 2007; Schena et al. 2013). Nowadays, a wide hybridisation of the probe with its complementary range of plant pathogens can be detected and quanti- sequence. Therefore, these alternative detection fied by real-time PCR methods in numerous hosts chemistries make real-time PCR more suitable for or environmental samples. The present compilation multiplexing detection purposes. Regardless of the illustrates a general description of four basic real- chemistry used, generated signals are frequently time PCR chemistries used in plant pathology and measured by accompanying software which gives examples of applicability of this important technique data normalisation and a number of automatic op- for routine detection and/or quantification of plant tions of analysis. At present, a variety of competing pathogens including viruses, viroids, bacteria, phyto- real-time PCR instruments with multiplexing and plasmas, fungi, and oomycetes. Some considerations high throughput applications have been proposed for assay development are discussed. through different companies.

Real-time PCR techniques Detection based on non-specific label method

As the name suggests, real-time PCR is a tech- SYBR Green dye. In real-time PCR assays, DNA nique used to screen the development of a PCR binding dyes are utilised as fluorescent reporters to

178

88 Plant Protect. Sci. Vol. 51, 2015, No. 4: 177–190 doi: 10.17221/104/2014-PPS

Detection based on sequence specific methods

TaqMan probe based detection. TaqMan probes are dual-labelled hydrolysis probes and utilise the 5' exonuclease activity of the Taq DNA polymerase for measuring the amount of target sequences. TaqMan probes consist of a sequence of 25–30 nucleotides in length which is labelled with a donor fluorophore Figure 1. Diagram of a SYBR Green dye. When SYBR (as reporter) at the 5' end, and an acceptor dye (as Green binds unspecifically to double-stranded DNA, it quencher) at the 3' end (Figure 2). Generally, a fluo- is able to emit green light as fluorescence. The amount rophore is a molecule that absorbs light energy and of fluorescence is directly proportional to the amount of is promoted to an excited state, and a quencher is a PCR products amplified (SG – SYBR Green dye) molecule that can receive energy from a fluorophore and disperse the energy by proximal quenching or monitor the reaction. As the PCR product accumu- by fluorescence resonance energy transfer (FRET) lates with each consecutive cycle of amplification, the (Didenko 2001). In FRET quenching, as a dynamic fluorescence of reporter dye is enhanced. Therefore, quenching mechanism, the fluorophore transfers its it is possible to monitor the PCR reaction during the energy to the quencher, and the energy is released exponential phase by recording the amount of fluo- as light of a longer wavelength (Schena et al. 2013). rescence emission at each cycle. So, during real-time So, until the time when the probe is not hydrolysed, PCR, if the increase in fluorescence of the reporter the quencher and the fluorophore remain in prox- dye is plotted against the log of the corresponding imity to each other, separated by the probe length. amount of template, a linear relationship is observed. However, this proximity does not entirely quench the SYBR Green is an intercalating dye which binds to fluorescence of the reporter dye and a background a minor groove of the double-stranded DNA and is fluorescence is detected (Didenko 2001). During the dye most widely used for real-time PCR assays. PCR, the probe hybridizes to the single-stranded DNA SYBR Green does not emit fluorescence in its free (ssDNA) template. In the extension step, the probe form, emitting the fluorescence signal only when cleaves by the 5'-nuclease activity of Taq DNA poly- binding to the dsDNA (Figure 1). merase when the enzyme reaches the probe, resulting Since unmodified oligonucleotide primers or no in the separation of the fluorescent reporter dye from labelled oligonucleotides can be used with SYBR the quencher, thus generating a fluorescent signal Green, its application is cheaper than other detection (Figure 2). The fluorescence intensity is therefore forms. However, the principal drawback to intercala- a direct consequence of the amplification process. tion based detection of product accumulation is that specific and nonspecific products produce signal. So, (A) the formation of non-specific amplicons can lead to false positive results in the quantification (Giulietti et al. 2001). To develop as much information from real-time PCR based on SYBR Green, the reaction (B) should be followed by melting curve analysis in which melting temperature (Tm) of generated product is determined. The shape of the melting curve and the determined melting temperature depend on the PCR Figure 2. Diagram of TaqMan probe. The TaqMan probe product concentration, its size and nucleotide base binds to the target DNA, and the primer binds as well. composition (Dreo et al. 2012). The SYBR Green Because the primer is bound, Taq DNA polymerase can sensitivity has been improved by the use of an anti- create a complementary strand (A). The reporter dye Taq antibody, which reduces the nonspecific product is released from the extending double-stranded DNA generation (Morrison et al. 1998). Besides, YO-PRO-1 created by the Taq DNA polymerase. Away from the (Ishiguro et al. 1995) and also ethidium bromide quenching dye, the light emitted from the reporter dye in can also be used as intercalating dye but carcinogenic an excited state can be observed (B) (Q – quencher dye; nature renders its use limiting (Schaad et al. 2003). R – fluorescent reporter dye)

179

89 Vol. 51, 2015, No. 4: 177–190 Plant Protect. Sci. doi: 10.17221/104/2014-PPS

Unlike FRET quenching, in proximal quenching, complementary nucleic acid target sequence, the stem while the probe is intact, the quencher absorbs the portion of the beacon separates out and hybridises energy from the reporter dye due to close proxim- to the target, resulting in the fluorescence emission. ity between them and dissipates as heat (Schena et Fluorophores such as FAM, TAMRA, TET, and ROX al. 2004). As a result, no fluorescence is discerned. and a quenching dye, typically DABCYL, are the most However, in TaqMan, the fluorophore is quenched by commonly used. In the absence of a complementary FRET. There are several fluorophores and quenchers target sequence, the beacon remains closed and there that can be paired; fluorophores such as TET, JOE, is no appreciable fluorescence (Figure 3). Fluores- HEX, FAM, ROX, and TAMRA and, quenchers such cence is screened during each annealing step when as Methyl Red, TAMRA, and DABCYL are commonly the beacon is attached to its complementary target. used for TaqMan assays (Wittwer et al. 2001). So, So, the amount of fluorescence at each cycle depends one advantage of the TaqMan probe over SYBR Green on the amount of specific product. dye is that specific hybridisation between probe and Unlike TaqMan probe, fluorescence quenching is target DNA sequence is required to produce fluores- proximal, due to the close contact of fluorophore cent signal. A TaqMan real-time PCR assay can be also and quencher that is more efficient than FRET-based multiplexed, because it can amplify and detect several quenching (Schena et al. 2004). Also, in comparison distinct sequences in a single PCR reaction tube due with linear probes, molecular beacons are especially to possibility of labelling of the fluorogenic probes suitable for identifying point mutations, because the with different detectable reporter dyes (Schena et hairpin-like structure makes mismatched hybrids al. 2004), avoiding cross similarities with primers and thermally less stable than hybrids between the cor- probes in multiplex reactions. However, the labelling responding linear probes and their mismatched target of TaqMan probe with double dyes and its designing (Giulietti et al. 2001). Furthermore, quenching of is more complicated than in SYBR Green primers, molecular beacons through a direct transfer of energy making this assay more expensive than SYBR Green from the fluorophore to quencher is possible. So, a assay (Okubara et al. 2005). common quencher molecule can be used, increasing Molecular beacon based detection. Molecular bea- the number of fluorophores that can simply be used cons are single-stranded oligonucleotide hybridization as reporters (Mhlanga & Malmberg 2001). These probes that form a stem and loop (hairpin) structure. properties of molecular beacons can be used to develop The loop of the probe is complementary to the target extremely specific assays that other types of probes sequence, and its two ends are also complementary could not achieve. However, the design of molecular to each other. A fluorophore is tagged at the 5' end beacon is more difficult than other types of probes. of the probe and a quencher at the 3' end (Figure 3). Scorpion probe based detection. Scorpion prim- When the probe sequence in the loop anneals to a ers are bi-functional molecules in which a primer is covalently linked to a specific probe sequence that is held in a hairpin–loop form with a fluorophore at one end and a quencher at the other. At the 5' end, the Scorpion primer sequence contains a non-target sequence as PCR blocker at the start of the hairpin loop that prevents polymerase read-through. This structure brings the fluorophore in close proximity (A) with the quencher and avoids fluorescence. Scorpion makes the molecular beacon technique more efficient (B) by combining the functions of the probe and the 5' PCR primer (Didenko 2001). In the absence of the Figure 3. Diagram of molecular beacon. Detection of PCR target, the quencher nearly absorbs the fluorescence product by molecular beacon. When the beacon binds to emitted by the fluorophore. As soon as annealing the PCR product, it is able to fluoresce when excited by between the primer–probe and the target occurs, the appropriate wavelength of light. The amount of fluo- scorpion primer combines to the PCR product and rescence is directly proportional to the amount of PCR then the probe sequence in the tail curls back to product amplified (Q – quencher dye; R – fluorescent hybridise with the sequence of target. As the tail of reporter dye) the scorpion and the amplicon are part of the same

180

90 Plant Protect. Sci. Vol. 51, 2015, No. 4: 177–190 doi: 10.17221/104/2014-PPS

extraction methods can result in DNA revealing different levels of purity and final yield, the quality of the final results can be significantly affected (Olexova et al. 2004). Therefore, the main purpose of DNA extraction is providing a good quality of DNA with a low concentration of substances inhibiting PCR reactions for subsequent analyses. Furthermore, (A) DNA extraction protocols should provide comparable results with samples differing widely in physical and chemical composition, organic content, microbial populations, etc. (Schena et al. 2013). Basically, substances such as polysaccharides, phenolic and (B) humic compounds in soil and plant must be removed Figure 4. Diagram of Scorpion probe. During annealing, (Tsai & Olson 1991). The inhibitory substances the hairpin primer binds to the template, and is then ex- can be removed using different columns and resins tended (A). During subsequent denaturation, the reporter such as gel filtration (also known as size exclusion) separates from the quencher, and the loop sequence binds resins, agarose gel electrophoresis, template dilu- to the internal target sequence (B) (Q – quencher dye; tion (Miller 2001), and commercial kits. Several R – fluorescent reporter dye; B – blocker) practical DNA extraction methods such as isopro- panol, silica-columns, magnetic beads, lyophilisation, strand of DNA, the interaction is intra-molecular freeze-grind and heat treatment have been used for (Giulietti et al. 2001; Arya et al. 2005). Hybridi- extraction of high-quality DNA from microorgan- sation reaction unties the hairpin loop, separating isms such as fungi and bacteria in order to minimise the fluorophore and the quencher, which leads to the influence of the extraction in the quantification an increase in the fluorescence emitted (Figure 4). of a low copy number of target (Cullen & Hirsch Similar to molecular beacons, in Scorpion-PCR 1998; Reeleder et al. 2003; Ippolito et al. 2004; fluorescence quenching is proximal, because of the Weller et al. 2007; Garrido et al. 2009; Williams close contact of fluorophore and quencher (Schena et al. 2009; Bilodeau et al. 2012). Also, to extract et al. 2004). Scorpion primers can also be used to DNA from soil samples, a variety of extraction kits identify point mutations by using multiple probes. are available. Unlike dilution plating method that Each probe can be tagged with a different fluorophore requires culturing of organisms for enumeration, a to produce different colours. In Scorpion primers, number of commercial kits are available to extract the probe is physically coupled to the primer which RNA or DNA from plant tissues. Totally, simplicity means that the reaction leading to signal generation and rapidity as well as the absence of harmful chemical is a unimolecular which is efficiently instantaneous compounds are the main advantages of commercial (Tomlinson et al. 2007). So, this leads to stronger kits. Combination of an efficient extraction method signals, more reliable probe design, enhanced dis- with a real-time PCR-based technique provides a crimination, and shorter reaction times compared useful and rapid tool for determining of pathogens with molecular beacons and TaqMan probes. Rela- populations and other organisms. tive sensitivities of the real-time PCR chemistries Target genes selection. Another crucial step in in increasing order are: SYBR Green I < TaqMan < real-time PCR assays is the identification of appro- Molecular beacons < Scorpion (Okubara et al. priate target DNA regions. Sequences of the target 2005). In fact, one should bear in mind that probe- primer must be unique to identify sequences of the based chemistries reveal a greater dynamic range target in the sample of interest with high specificity than SYBR Green chemistry. and efficiency so that to recognise virulence genes or a particular organism. The ribosomal DNA genes (rDNA) provide efficient targets because they have Real-time PCR considerations conserved and variable sequences that allow highly sensitive detection. But, due to its universal nature, DNA extraction. A critical pre-analysis step for the level of discrimination lies at the species levels real-time PCR assays is DNA extraction. Since many (Schaad et al. 2003). Among the variable regions, the

181

91 Vol. 51, 2015, No. 4: 177–190 Plant Protect. Sci. doi: 10.17221/104/2014-PPS kinternal transcribed spacer (ITS) within prokaryotic Express (PE Applied Biosystems, USA), Primer3 and eukaryotic rDNA operons is the most widely se- (Whitehead Institute, USA), Clustal X (Version 2.0 quenced in phytopathogens. Also, intergenic spacer or greater) and Beacon designer (PREMIER Biosoft (IGS) sequences are difficult for amplification and International, USA). After primers and probes are sequencing, but they can be more variable than the designed, their specificity should be checked by in ITS sequences. Thus, they are exploited to design silico analyses using the Basic Local Alignment Search diagnostic assays when there are not enough differ- Tool (BLAST) in GenBank to confirm the existence ences available across the ITS (Schena et al. 2004). of similar sequences. Typically, IGS regions of bacterial 16S ribosomal Further considerations. Real-time PCR assays may RNA genes, ITS regions of the fungal ribosomal give false negative results for environmental samples RNA genes and mitochondrial small subunit rDNA due to several reasons, including the low number of have been used most commonly for PCR-based iden- targets, degradation of the target DNA by nucleases tification of plant pathogens. These multicopy se- or reagent problems. Besides, as mentioned above, quences contain sufficient sequence diversity at the the problem with PCR inhibitors is frequent when species or subspecies levels (Okubara et al. 2005). environmental samples are assessed. For detecting Moreover, the β-tubulin gene has been used for di- inhibitor effects, causing false negative, an internal agnosis purposes of plant pathogens when variation positive control such as the amplification of a house- of ITS sequence is not appropriate for production keeping gene or a conserved DNA segment can be of a taxon-specific diagnostic (Schena et al. 2004). included in the assays (Schena et al. 2013). Another Generally, genotypic differences in elongation factor 1 problem is the risk of nucleic acids contamination alpha (EF1-α), random-amplified polymorphic DNA/ by external sources, such as exogenous DNA from sequence-characterised amplified region (RAPD/ cultures or from previous experiments while the PCR SCAR)-based targets, and other single- or low-copy amplification products accumulate by repeated am- sequences have proven suitable for real-time PCR plification of the same target sequence (Okubara et assays (Okubara et al. 2005). al. 2005). The risk of contamination can be reduced Primer and probe design. Primer design is aimed by precise activities such as using negative control, at obtaining a balance between two goals: efficiency positive control, and reagent control in each PCR run. and specificity of amplification. Efficiency can be viewed as the proportion of templates that are used to synthesise new strands with each round of PCR. Detection of plant pathogens So, the most important issue for designing efficient PCR primers is that they must bind to the target site The most influential characteristic of real-time PCR efficiently under PCR conditions. Specificity can is its suitability for quantitative analyses. In recent generally be defined as the tendency for a primer to years, real-time PCR as a valuable and versatile tool hybridise to its intended target and not to nonspecific has been used with accuracy and high throughput targets and so primers that only amplify one product quantification of specific target in most agricultural will provide the best assay sensitivity (Hyndman fields such as plant protection and plant biotech- & Mitsuhashi 2003). Typically, 2–3 bases are suf- nology. Also, simultaneous detection of more than ficient to produce highly specific primer and probe one organism provides significant benefits particu- using average stringent amplification conditions and larly for diagnostic programs dealing with a lot of should be preferentially localised close to the 3' end samples using real-time PCR (Cooke et al. 2007). of the sequence (Fredslund & Lange 2007; Schena Although in multiplex real-time PCR assays several et al. 2013). Primers designed for use in cPCR can target DNAs can be simultaneously detected from also be applied in real-time PCR tests if amplicon different microorganisms by differences in emission size criteria are met. However, amplicon sizes fre- wavelength or amplicon size, a major limitation of quently used for cPCR are very long to support the multiplexing is the competition between different design of efficient real-time PCR assays (Montes- primers and probes, resulting in lower specificity Borrego et al. 2011). Specific primers and probes and sensitivity (Okubara et al. 2005). However, the can be properly designed for SYBR Green, TaqMan detection of more than two targets without reduc- probes, Molecular beacons and Scorpion PCR as- tion of sensitivity has also been reported (Schena et says using primer design software such as Primer al. 2006). In order to obtain the best results, primer

182

92 Plant Protect. Sci. Vol. 51, 2015, No. 4: 177–190 doi: 10.17221/104/2014-PPS and probe design, amplification conditions, and amplification to generate the complementary DNA amplicon length should be optimised. As the first (cDNA). In fact, real-time RT-PCR has an additional available real-time chemistry, SYBR Green I can be cycle of reverse transcription that leads to forma- used in a wide range of plant pathogens, whereas tion of a DNA molecule from a RNA molecule. This the TaqMan chemistry has an inherently higher is done because RNA is less stable as compared to degree of specificity, reliability, and performance, DNA (Ingle & Kushner 1996). Real-time RT-PCR as discussed in the previous sections. The specific method based on TaqMan chemistry was reliably hybridization between probe and target DNA that is used to detect reproducibly of 1000 molecules of required to generate a fluorescent signal is the main the target transcript (as little as 500 fg total RNA) advantage of fluorogenic probes over DNA binding of Tomato spotted wilt virus (TSWV) in infected dyes (Okubara et al. 2005; Garrido et al. 2009). A tomato plants and was more sensitive (10-folds) than search of relevant published articles indicates that the conventional RT-PCR (Roberts et al. 2000). the relative frequency of chemistries applied in real- In another study, real-time RT-PCR method based time PCR technique to date is, in increasing order: on scorpion probe using specific primers designed Molecular beacons < Scorpion < SYBR Green I < to a highly conserved coat protein (CP) region was TaqMan (Schena et al. 2013). Generally, sequence effectively used to detect Grapevine fan leaf virus specific methods guarantee higher specificity lev- (GFLV) in the nematode vector Xiphinema index els which are particularly important when they are collected from the rhizosphere of grapevine plants used for detection and quantification of pathogens (Finetti-Sialer & Ciancio 2005). Altogether, the in natural samples or within symptomless tissues most widely used real-time RT-PCR protocols are (Schena et al. 2004). In the following sections, some based on two different chemistries including the uses of real-time PCR techniques applied for rou- fluorescent dye SYBR Green and TaqMan probe. tine detection/quantification of plant pathogens in These methods have proven successful in detect- agricultural systems are shown. ing and identifying different viruses on different Viruses and viroids. Detection of plant viruses hosts (Table 1). Since the viruses may be deactivated can be directly accomplished, although a reverse quickly when the infected plants dry up under field transcription (RT) step is essential prior to PCR conditions, few studies have been done to detect the

Table 1. Examples of real-time RT-PCR assays for detection of plant pathogenic viruses and viroids (last 6 years)

Variant Host plant/ Pathogen Reference of chemistry Specimen Citrus exocortis viroid (CEVd), Hop stunt viroid (HSVd) multiplex TaqMan citrus, plum Papayiannis (2014) Tobacco etch virus (TEV) SYBR Green irrigation water Chen et al. (2014) Apple chlorotic leaf spot virus (ACLSV), multiplex SYBR peach Zhao et al. (2013) Cherry green ring mottle virus (CGRMV) Green Grapevine fanleaf virus (GFLV), Arabis mosaic virus multiplex TaqMan grapevine Lopez-Fabuel et al. (ArMV), Grapevine ﬂeck virus (GFkV), (2013) Grapevine leafroll associated virus 1,3 (GLRaV-1,3)

Rice black streaked dwarf virus (RBSDV), multiplex TaqMan rice Zhang et al. (2013) Southern rice black streaked dwarf virus (SRBSDV) Tobacco etch virus (TEV), Potato virus Y (PVY), multiplex TaqMan tobacco Dai et al. (2013) Tobacco vein banding mosaic virus (TVBMV) Rice tungro bacilliform virus (RTBV), SYBR Green rice Sharma & Dasgupta Rice tungro spherical virus (RTSV) (2012) Tobacco mosaic virus (TMV) SYBR Green soil Yang et al. (2012) Peach latent mosaic viroid (PLMVd) SYBR Green peach Parisi et al. (2011) Peach latent mosaic viroid (PLMVd) TaqMan peach Luigi & Faggioli (2011) Wheat dwarf virus (WDV) TaqMan wheat, insect Zhang et al. (2010) vectors Citrus viroid III (CVd-III) SYBR Green citrus Rizza et al. (2009)

183

93 Vol. 51, 2015, No. 4: 177–190 Plant Protect. Sci. doi: 10.17221/104/2014-PPS plant viruses in soil and water (Boben et al. 2007; increasing fluorescence observed during the reac- Yang et al. 2012). tion. The evidence indicated that real-time RT-PCR Viroids represent a group of extremely primitive is to be a useful tool for fast and reliable diagnosis pathogenic entities consisting exclusively of nucleic of citrus viroids (Tessitori et al. 2005). A few num- acids that are capable of independent replication and ber of real-time RT-PCR procedures are available inducing diseases when introduced into susceptible for detection of a variety of plant viroids in plant plant cells (Narayanasamy 2011). Because of the materials (Table 1). absence of a protein component that is present in Bacteria and phytoplasmas. Control of diseases the viruses, diagnostic approaches based upon se- caused by plant pathogenic bacteria frequently needs rology have not been applicable for the detection of precise detection, followed by suitable identifica- viroids. So, PCR-based techniques such as RT-PCR tion of the causal organism (Palacio-Bielsa et al. and real-time RT-PCR are the most reliable and sen- 2011). Several real-time PCR systems have been sitive tests for detection of viroids in infected plants validated with significant improvements in speed, (Boonham et al. 2004). In this respect, a real-time specificity, and sensitivity for detection and direct RT-PCR assay based on TaqMan chemistry was de- quantification of plant pathogenic bacteria in dif- veloped by Boonham et al. (2004) in order to detect ferent environmental samples. For instance, a SYBR Potato spindle tuber viroid (PSTVd), a quarantine Green I real-time PCR assay was developed for spe- pathogen in Europe, which was 1000 times more cific detection and quantification of Xanthomonas sensitive compared with a chemiluminescent assay. axonopodis pv. citri, causing Type A citrus canker, Furthermore, real-time RT-PCR assay based on the and X. axonopodis pv. aurantifolii, causing Type B SYBR-Green I was developed for the quantitative and C citrus canker, based on primers designed to detection of Citrus exocortis viroid (CEVd) and Citrus short fragments from highly conserved regions (pthA viroid-IIb (CVd-IIb) causing citrus exocortis and gene), as it represents a diagnostic indicator for citrus citrus cachexia diseases in symptomless host citrus canker-causing xanthomonads. The assay enabled plants. Primer pairs designed from highly conserved reliable detection as low as 1 pg of total X. citri DNA regions of the genome of different variants of each isolated from diseased leaf lesions (Mavrodieva viroid amplified DNA fragments of 83-bp (CEVd) et al. 2004). Also, a TaqMan real-time PCR assay and 133-bp (CVd-II), which were detected by the was developed for the reliable detection of Xylella

Table 2. Examples of real-time PCR assays for detection of plant pathogenic bacteria and phytoplasmas (last 6 years)

Variant of Pathogen Host plant/Specimen Reference chemistry Gluconacetobacter diazotrophicus SYBR Green sugarcane Boa-Sorte et al. (2014) Leifsonia xyli subsp. xyli TaqMan sugarcane Pelosi et al. (2013) Erwinia amylovora SYBR Green, apple, pear Kaluzna et al. (2013) TaqMan Clavibacter michiganensis subsp. michiganensis TaqMan tomato Johnson & Wal c ot t (2012) Candidatus Phytoplasma mali, Ca. P. prunorum, TaqMan apple, pear Prunus Mehle et al. (2012) Ca. P. pyri species, insect vectors Candidatus Phytoplasma mali TaqMan apple, insect vectors Baric (2012) Xanthomonas arboricola pv. pruni TaqMan Prunus species Palacio-Bielsa et al. (2011) Pseudomonas syringae pathovars: syringae, TaqMan tomato, plum, crucifer, Xu & Tambong (2011) tomato, maculicola, tabaci, atropurpurea, tobacco, brome grass, phaseolicola, pisi, and glycinea bean, pea, soybean Pectobacterium carotovorum subsp. SYBR Green konnyaku potato, soil Wu et al. (2011) carotovorum, P. chrysanthemi Xylella fastidiosa subsp. fastidiosa, TaqMan grapevine, almond, apple, Harper et al. (2010) Xylella fastidiosa subsp. multiplex oak, insect vectors Pseudomonas syringae pv. phaseolicola TaqMan bean Cho et al. (2010) Candidatus Phytoplasma isolates TaqMan Catharanthus roseus, Hodgetts et al. (2009) coconut

184

94 Plant Protect. Sci. Vol. 51, 2015, No. 4: 177–190 doi: 10.17221/104/2014-PPS fastidiosa (Xf) strains at low concentrations of the tion of these pathogens. For instance, Phytophthora bacterium in almonds, grapes, and insect vectors fragariae var. fragariae causing root rot disease is a with a high degree of sensitivity and specificity us- quarantine organism and is present in most European ing primers designed to a unique region common to countries. So, a real-time PCR assay using TaqMan the sequenced genomes of four Xf strains associated probe and Molecular beacon was utilised as a sensitive with Pierce’s disease in grapes, oleander leaf scorch, and reliable detection test. With Molecular beacon almond leaf scorch, and citrus variegated chlorosis. the pathogen was detected in a quantitative order Actually, no amplicons were obtained with non-Xf similarly to TaqMan probe, which were able to de- bacterial strains (Francis et al. 2006). In addition, an tect levels as low as 1 fg DNA of the target pathogen increasing number of real-time PCR procedures are present in plant tissues. In this study, the sensitivity available for detection and quantification of bacteria of Molecular beacon and TaqMan probes against in plant materials, although TaqMan probes are the a dilution series of P. fragariae genomic DNA was most commonly used ones (Table 2). The lack of equivalent (Bonants et al. 2004). Also, Bilodeau growth in pure culture, uneven distribution in the et al. (2007) compared three different chemistries phloem of the infected plant, and low concentration including SYBR Green, TaqMan, and Molecular bea- (especially in woody hosts) are most important ob- cons using sequences of β-tubulin, ITS and elicitin stacles for efficient diagnosis of phytoplasmas, that gene regions for detection of P. ramorum causing means their quantification can only be achieved in sudden oak death. The results showed that all three the presence of high levels of host DNA (Galetto real-time PCR assays could separate the pathogen et al. 2005; Weintraub & Jones 2010). So, a few from 65 other species of Phytophthora in all infected studies have been done to detect the pathogenic samples. However, TaqMan real-time PCR assay phytoplasmas in plants (Table 2). based on ITS and elicitin regions was shown to be Fungi and oomycetes. Fungi and oomycetes include more sensitive than others in detecting and differ- the most important plant pathogens and their ac- entiating P. ramorum. curate detection is an important part of preventive Detection of seed-borne fungal pathogens is an disease management strategies. Among the PCR- imperative part of seed health testing programs. In based techniques, real-time PCR has been proven to this regard, the presence of Tilletia caries, causing be simple and reliable for detection and quantifica- common bunt disease, the most important seed-borne

Table 3. Examples of real-time PCR assays for detection of plant pathogenic fungi and oomycetes

Pathogen Variant of chemistry Host plant/Specimen Reference Ceratocystis coerulescens C. polonica, SYBR Green, TaqMan Pinaceae, Eucalyptus sp., Lamarche et al. C. laricicola, C. fujiensis insect vectors (2014) Phytophthora infestans SYBR Green potato Hussain et al. (2014) Pythium aphanidermatum, P. helicoides, TaqMan tomato Li et al. (2014) P. myriotylum Sclerotinia sclerotiorum SYBR Green carrot, bean, lettuce, Parker et al. (2014) onion, peach Magnaporthe oryzae TaqMan rice Su’udi et al. (2013) F. oxysporum f.sp. melonis SYBR Green melon Haegi et al. (2013) Phytophthora infestans TaqMan potato Clement et al. (2013) Verticillium dahliae TaqMan strawberry Bilodeau et al. (2012) Botrytis cinerea SYBR Green grape Diguta et al. (2010)

Fusarium virguliforme TaqMan soybean Mbofung et al. (2011) Colletotrichum acutatum, C. gloeosporioides TaqMan strawberry Garrido et al. (2009) Puccinia graminis, P. striiformis, P. triticina, TaqMan cereals and grasses Barnes & Szabo (2007) P. recondita f.sp. secalis Phytophthora nicotianae, P. citrophthora Scorpion citrus Ippolito et al. (2004) Rosellinia necatrix Scorpion fruit and forest tree Schena & Ippolito species (2003)

185

95 Vol. 51, 2015, No. 4: 177–190 Plant Protect. Sci. doi: 10.17221/104/2014-PPS disease of wheat, was detected and also the level of opening new research opportunities associated with contamination in apical meristems of different wheat a comprehensive understanding of ecology and popu- varieties was quantified using SYBR Green I real- lation dynamics of pathogens with the final intent time PCR procedure based on primers designed to of optimising plant disease management strategies. IGS region of the rDNA. The assay could quantify pathogen mycelium in wheat varieties in the range Acknowledgement. The authors thank Prof Peter from 0.34 ng to 15 µg per one growing tip. Therefore, Harley (National Center for Atmospheric Research, this method can be applied in the screening process Colorado, USA) for critical reading of the manuscript for bunt resistance in wheat as well as in certifica- and giving valuable comments for improving the quality tion and breeding processes at early stages of plant of this work. development (Zouhar et al. 2010). On the other hand, some plant pathogenic fungi are also vectors References of plant viruses like Polymyxa spp. Several viruses such as Beet necrotic yellow vein virus (BNYVV), Acero F.J., Carbu M., El-Akhal M.R., Garrido C., Gonzalez- Barley yellow mosaic virus (BaYMV), and Soil-borne Rodriguez V.E., Cantoral J.M. (2011): Development of wheat mosaic virus (SBWMV) are transmitted by proteomics-based fungicides: New strategies for envi- Polymyxa spp. Accordingly, P. betae and P. graminis ronmentally friendly control of fungal plant diseases. were directly detected and quantified from as little International Journal of Molecular Sciences, 12: 795–816. as 500 mg of infested soils using TaqMan real-time Arya M., Shergill I.S., Williamson M., Gommersal L., Arya PCR based on primers and probes designed to ITS N., Patel H.R. (2005): Basic principles of real-time quan- regions (Ward et al. 2004). Generally, a variety of titative PCR. Expert Review of Molecular Diagnostics, real-time PCR techniques for detection and quan- 5: 209–219. tification of numerous important plant pathogenic Baric S. (2012): Quantitative real-time PCR analysis of fungi and oomycetes has been described (Table 3). ‘Candidatus Phytoplasma mali’ without external standard curves. Erwerbs-Obstbau, 54: 147–153. Barnes C.W., Szabo L.J. (2007): Detection and identification CONCLUDING REMARKS of four common rust pathogens of cereals and grasses using real-time polymerase chain reaction. Phytopathol- Real-time PCR has a significant potential in quan- ogy, 97: 717–727. tifying low disease levels with high sensitivity and Bilodeau G.J., Levesque C.A., Decock A.W.A.M., Duchaine speed that was inconceivable in plant pathology a C., Briere S., Uribe P., Martin F.N., Hamelin R.C. (2007): few years ago. The technique is extremely promising Molecular detection of Phytophthora ramorum by real-time in order to quantify pathogen populations, whereas polymerase chain reaction using TaqMan, SYBR Green, and other PCR-based techniques qualify only for the Molecular beacons. Phytopathology, 97: 632–642. identification/detection of the microbial commu- Bilodeau G.J., Koike S.T., Uribe P., Martin F.N. (2012): De- nities. With accurate optimisation, real-time PCR velopment of an assay for rapid detection and quantifi- can provide specific, reliable, and high throughput cation of Verticillium dahliae in soil. Phytopathology, detection and quantification of target DNA in vari- 102: 331–343. ous environmental samples in real time, which is Boa-Sorte P.M.F., Simoes-Araujo J.L., de Melo L.H.V., de not achievable with other PCR-based methods. In Souza Galisa P., Leal L., Baldani J.I., Baldani V.L.D. (2014): fact, real-time PCR is an ideal technique to measure Development of a real-time PCR assay for the detection levels of inoculum threshold, which has a positive and quantification of Gluconacetobacter diazotrophicus impact on epidemiological studies, and for evaluat- in sugarcane grown under field conditions. African Jour- ing the efficacy of methodologies used to prevent nal of Microbiology Research, 8(31): 2937–2946. distribution of the pathogens into non-infected ag- Boben J., Kramberger P., Petrovic N., Cankar K., Peterka ricultural fields. As knowledge regarding individual M., Strancar A., Ravnikar M. (2007): Detection and quan- microorganisms’ genomes increases, the use of this tification of tomato mosaic virus in irrigation waters. technique for a broad range of microorganisms will European Journal of Plant Pathology, 118: 59–71. undoubtedly increase. In addition, this growing list Bonants P.J.M, van Gent-Pelzer M.P.E., Hooftman R., Cooke of applications suggests that real-time PCR will D., Guy D.C., Duncan J.M. (2004): A combination of bait- be an increasingly preferred method in the future, ing and different PCR formats, including measurement

186

96 Plant Protect. Sci. Vol. 51, 2015, No. 4: 177–190 doi: 10.17221/104/2014-PPS

of real-time quantitative fluorescence, for the detection Cockerill F.R., Smith T.F. (2006): Real-time PCR in clinical of Phytophthora fragariae in strawberry plants. European microbiology: applications for routine laboratory testing. Journal of Plant Pathology, 110: 689–702. Clinical Microbiology Reviews, 19: 165–256. Boonham N., Perez L.G., Mendez M.S., Peralta E.L., Block- Finetti-Sialer M.M., Ciancio A. (2005): Isolate-specific de- ley A., Walsh K., Barker I., Mumford R.A. (2004): Devel- tection of Grapevine fanleaf virus from Xiphinema index opment of a real-time RT-PCR assay for the detection of through DNA-based molecular probes. Phytopathology, Potato spindle tuber viroid. Journal of Virological Meth- 95: 262–268. ods, 116: 139–146. Francis M., Lin H., Rosa J.C, Doddapaneni H., Civerolo Capote N., Pastrana A.M., Aguado A., Torres P.S. (2012): E.L. (2006): Genome-based PCR primers for specific and Molecular tools for detection of plant pathogenic fungi sensitive detection and quantification of Xylella fastidi- and fungicide resistance. In: Cumagun C.J. (ed.): Ag- osa. European Journal of Plant Pathology, 115: 203–213. ricultural and Biological Sciences “Plant Pathology”. Fredslund J., Lange M. (2007): Primique: automatic design Rijeka, InTech: 151–202. of specific PCR primers for each sequence in a family. Cooke D.E.L., Schena L., Cacciola S.O. (2007): Tools to BMC Bioinformatics, 8: 369. detect, identify and monitor Phytophthora species in Galetto L., Bosco D., Marzachi C. (2005): Universal and natural ecosystems. Journal of Plant Pathology, 89: 13–28. group-specific real-time PCR diagnosis of flavescence Chen W., Dai J., Zhang H., Jiao H., Cheng J. Wu Y. (2014): dorée (16Sr-V), bois noir (16Sr-XII) and apple prolifera- Concentration and detection of tobacco etch virus from tion (16Sr-X) phytoplasmas from field-collected plant irrigation water using real-time PCR. Turkish Journal of hosts and insect vectors. Annals of Applied Biology, Agriculture and Forestry, 38: 471–477. 147: 191–201. Cho M.S., Jeon Y.H., Kang M.J., Ahn H.I., Baek H.J., Na Garrido C., Carbu M., Acreo F.J., Boonham N., Coyler A., Y.W., Choi Y.M., Kim T.S. Park D.S. (2010): Sensitive Cantoral J.M., Budge G. (2009): Development of protocols and specific detection of phaseolotoxigenic and nontoxi- for detection of Colletotrichum acutatum and monitoring genic strains of Pseudomonas syringae pv. phaseolicola by of strawberry anthracnose using real-time PCR. Plant TaqMan real-time PCR using site-specific recombinase Pathology, 58: 43–51. gene sequences. Microbiological Research, 165: 565–572. Garrido C., Acero F.G.F., Carbu M., Rodriguez V.E.G., Clement J.A.J., Baldwin T.K., Magalon H., Glais I., Gra- Liniero E., Cantoral J.M. (2012): Molecular microbiol- cianne C., Andrivon D., Jacquot E. (2013): Specific ogy applied to the study of phytopathogenic fungi. In: detection and quantification of virulent/avirulent Phy- Magdeldin S. (ed.): Biochemistry, Genetics and Molecular tophthora infestans isolates using a real-time PCR assay Biology. Rijeka, InTech: 139–156. that targets polymorphisms of the Avr3a gene. Letters in Giulietti A., Overbergh L., Valckx D., Decallone B., Bouillon Applied Microbiology, 56: 322–332. R., Mathieu C. (2001): An overview of real-time quantita- Cullen D.W., Hirsch, P.R. (1998): Simple and rapid method tive PCR: applications to quantify cytokine gene expres- for direct extraction of microbial DNA from soil for PCR. sion. Methods, 25: 386–401. Soil Biology and Biochemistry, 30: 983–993. Goud J.C., Termorshuizen A.J. (2003): Quality of methods Dai J., Peng H., Chen W., Cheng J., Wu Y. (2013): Devel- to quantify microsclerotia of Verticillium dahliae in soil. opment of multiplex real time PCR for simultaneous European Journal of Plant Pathology, 109: 523– 534. detection of three Potyviruses in tobacco plants. Journal Hadidi A., Levy L., Podleckis E.V. (1995): Polymerase chain of Applied Microbiology, 114: 502–508. reaction technology in plant pathology. In: Singh R.P., Didenko V.V. (2001): DNA probes using fluorescence reso- Singh U.S. (eds): Molecular Methods in Plant Pathology. nance energy transfer (FRET): designs and applications. London, CRC Press Inc.: 167–187. BioTechniques, 31: 1106–1121. Haegi A., Catalano V., Luongo L., Vitale S., Scotton M., Diguta C.F., Rousseaux S., Weidmann S., Bretin N., Vincent Ficcadenti N., Belisario A. (2013): A newly developed B., Benatier M.G., Alexander H. (2010): Development of a real-time PCR assay for detection and quantification qPCR assay for specific quantification of Botrytis cinerea of Fusarium oxysporum and its use in compatible and on grapes. FEMS Microbiology Letter, 313: 81–87. incompatible interactions with grafted melon genotypes. Dreo T., Pirc M., Ravnikar M. (2012): Real-time PCR, a Phytopathology, 103: 802–810. method fit for detection and quantification of Erwinia Harper S.J., Ward L.I., Clover G.R.G. (2010): Development amylovora. Trees, 26: 165–178. of LAMP and real-time PCR methods for the rapid detec- Espy M.J., Uhl J.R., Sloan L.M., Buckwalter S.P., Jones M.F., tion of Xylella fastidiosa for quarantine and field applica- Vetter E.A., Yao J.D.C., Wengenack N.L., Rosenblatt J.E., tions. Phytopathology, 100: 1282–1289.

187

97 Vol. 51, 2015, No. 4: 177–190 Plant Protect. Sci. doi: 10.17221/104/2014-PPS

Hassain T., Singh B.P., Anwar F. (2014): A quantitative Lopez-Fabuel I., Wetzel T., Bertolini E., Bassler A., Vidal real-time PCR based method for the detection of Phy- E., Torres L.B., Yuste A., Olmos A. (2013): Real-time tophthora infestans causing Late blight of potato, in multiplex RT-PCR for the simultaneous detection of infested soil. Saudi Journal of Biological Sciences, 21: the five main grapevine viruses. Journal of Virological 380–386. Methods, 188: 21–24. Hodgetts J., Boonham N., Mumford R., Dickinson M. Luigi M., Faggioli F. (2011): Development of quantitative (2009): Panel of 23S rRNA gene-based real-time PCR real-time RT-PCR for the detection and quantification assays for improved universal and group-specific detec- of Peach latent mosaic viroid. European Journal of Plant tion of phytoplasmas. Applied and Environmental Biol- Pathology, 130: 109–116. ogy, 75: 2945–2950. Mahuku G.S., Platt H.W. (2002): Quantifying Verticillium Hyndman D.L., Mitsuhashi M. (2003): PCR primer design. dahliae in soils collected from potato fields using a com- In: Bartlett M.S., Stirling D. (eds): PCR Protocols. Series: petitive PCR assay. American Journal of Potato Research, Methods in Molecular Biology, Vol. 226. 2nd Ed. New 79: 107–117. York, Humana Press: 81–88. Martin R.R., James D., Levesque C.A. (2000): Impacts of Ingle C.A., Kushner S.R. (1996): Development of an in vitro molecular diagnostic technologies on plant disease man- mRNA decay system for Escherichia coli: poly(A) poly- agement. Annual Review of Phytopathology, 38: 207–239. merase I is necessary to trigger degradation. Proceedings Martin F.N., Tooley P.W., Blomquist C. (2004): Molecular National Academy of Science USA, 93: 12926–12931. detection of Phytophthora ramorum, the causal agent of Ippolito A., Schena L., Nigro F., Ligorio V.S., Yaseen T. sudden oak death in California, and two additional spe- (2004): Real-time detection of Phytophthora nicotianae cies commonly recovered from diseased plant material. and P. citrophthora in citrus roots and soil. European Phytopathology, 94: 621–631. Journal of Plant Pathology, 110: 833–843. Mavrodieva V., Levy L., Gabriel D.W. (2004): Improved Ishiguro T., Saitoh J., Yawata H., Yamagishi H., Iwasaki sampling methods for real-time polymerase chain reac- S., Mitoma Y. (1995): Homogeneous qualitative assay tion diagnosis of citrus canker from field samples. Phy- of hepatitis C virus RNA by polymerase chain reaction topathology, 94: 61–68. in the presence of a fluorescent intercalater. Analytical Mbofung G.C.Y., Fessehaie A., Bhattacharyya M.K., Lean- Biochemistry, 229: 207–213. dro L.F.S. (2011): A new TaqMan real-time polymerase Johnson K.L., Walcott R.R. (2012): Progress towards a real- chain reaction assay for quantification of Fusarium vir- time PCR assay for the simultaneous detection of Clavi- guliforme in soil. Plant Disease, 95: 1420–1426. bacter michiganensis subsp. michiganensis and Pepino McCartney H.A., Foster S.J., Fraaije B.A., Ward, E. (2003): mosaic virus in tomato seed. Journal of Phytopathology, Molecular diagnostics for fungal plant pathogens. Pest 160: 353–363. Management Science, 59: 129–142. Kaluzna M., Pulawska J., Mikicinski A. (2013): Evaluation Mehle N., Nikolic P., Gruden K., Ravnikar M., Dermastia of methods for Erwinia amylovora detection. Journal of M. (2012): Real-time PCR for specific detection of three Horticultural Research, 21: 65–71. Phytoplasmas from the apple proliferation group. In: Lamarche J., Stewart D., Pelletier G., Hamelin R.C., Tanguay Dickinson M., Hodgetts J. (eds): Phytoplasma: Methods P. (2014): Real-time PCR detection and discrimination of and Protocols. Series: Methods in Molecular Biology, Vol. the Ceratocystis coerulescens complex and of the fungal 938. New York, Humana Press: 269–281. species from the Ceratocystis polonica complex validated Mhlanga M.M., Malmberg L. (2001): Using molecular bea- on pure cultures and bark beetle vectors. Canadian Jour- cons to detect single-nucleotide polymorphisms with nal of Forest Research, 44: 1103–1111. real-time PCR. Methods, 25: 463–471. Li M., Y. Ishiguro Y., Otsubo K., Suzuki H., Tsuji T., Miyake Miller D.N. (2001): Evaluation of gel filtration resins for the N., Nagai H., Suga H., Kageyama K. (2014): Monitoring by removal of PCR-inhibitory substances from soils and sed- real-time PCR of three water-borne zoosporic Pythium iments. Journal of Microbiological Methods, 44: 49–58. species in potted flower and tomato greenhouses under Montes-Borrego M., Munoz-Ledesma F.J., Jimenez-Diaz hydroponic culture systems. European Journal of Plant R.M., Landa B.B. (2011): Real-time PCR quantification Pathology, 140: 229–242. of Peronospora arborescens, the opium poppy downy mil- Lievens B., Grauwet T.J.M.A., Cammue B.P.A., Thomma dew pathogen, in seed stocks and symptomless infected B.P.H.J. (2005): Recent developments in diagnostics of plants. Plant Disease, 95: 143–152. plant pathogens: a review. Recent Research Develop- Morrison T.B., Weis J.J., Wittwer C.T. (1998): Quantifica- ments in Microbiology, 9: 57–79. tion of low-copy transcripts by continuous SYBR green I

188

98 Plant Protect. Sci. Vol. 51, 2015, No. 4: 177–190 doi: 10.17221/104/2014-PPS

monitoring during amplification. BioTechniques, 24: Schena L., Ippolito A. (2003): Rapid and sensitive detec- 954–962. tion of Rosellinia necatrix in roots and soils by real time Narayanasamy P. (2011): Detection of Virus and Viroid Scorpion-PCR. Journal of Plant Pathology, 85: 15–25. Pathogens in Plants. In: Microbial Plant Pathogens-De- Schena L., Nigro F., Ippolito A., Gallitelli, D. (2004): Real- tection and Disease Diagnosis. Viral and Viroid Patho- time quantitative PCR: a new technology to detect and gens, Vol. 3. Dordrecht, Springer: 7–220. study phytopathogenic and antagonistic fungi. European Okubara P.A., Schroeder K.L., Paulitz T.C. (2005): Real-time Journal of Plant Pathology, 110: 893–908. polymerase chain reaction: applications to studies on Schena L., Hughes K.J.D., Cooke D.E.L. (2006): Detection and soilborne pathogens. Canadian Journal of Plant Pathol- quantification ofPhytophthora ramorum, P. kernoviae, P. ogy, 27: 300–313. citricola and P. quercina in symptomatic leaves by multiplex Olexova L., Dovicovicova L., Kuchta T. (2004): Comparison real-time PCR. Molecular Plant Pathology, 7: 365–379. of three types of methods for the isolation of DNA from Schena L., Li Destri Nicosia M.G., Sanzani S.M., Faedda R., flours, biscuits and instant paps. European Food Research Ippolito A., Cacciola S.O. (2013): Development of quanti- and Technology, 218: 390–393. tative PCR detection methods for phytopathogenic fungi Palacio-Bielsa A., Cubero J., Cambra M.A., Collados R., and oomycetes. Journal of Plant Pathology, 95: 7–24. Berruete I.M., Lopez M.M. (2011): Development of an ef- Sharma S., Dasgupta I. (2012): Development of SYBR Green ficient real-time quantitative PCR protocol for detection I based real-time PCR assays for quantitative detection of Xanthomonas arboricola pv. pruni in Prunus species. of Rice tungro bacilliform virus and Rice tungro spherical Applied and Environmental Microbiology, 77: 89–97. virus. Journal of Virological Methods, 181: 86–92. Papayiannis L.C. (2014): Diagnostic real-time RT-PCR for the Su’udi M., Kim J., Park J.M., Bae S.C., Kim D., Kim Y.H., simultaneous detection of Citrus exocortis viroid and Hop Ahn I.P. (2013): Quantification of rice blast disease pro- stunt viroid. Journal of Virological Methods, 196: 93–9. gressions through TaqMan real-time PCR. Molecular Parisi O., Lepoivre P., Jijakli M.H. (2011): Development of a Biotechnology, 55: 43–48. quick quantitative real-time PCR for the in vivo detection Tessitori M., Rizza S., Reina A., Catara V. (2005): Real-time and quantification of Peach latent mosaic viroid. Plant RT-PCR based on Sybr-Green I for the detection of cit- Disease, 95: 137–142. rus exocortis and citrus cachexia disease. In: Hilf M.E., Parker M.L., McDonald M.R., Boland G.J. (2014): Evalua- Duran-Vila N., Rocha-Peña M.A. (eds): Proceedings 16th tion of air sampling and detection methods to quantify Conference of the International Organization of Citrus airborne ascospores of Sclerotinia sclerotiorum. Plant Virologists, Nov 3–6, 2004. Riverside, USA: 456–459. Disease, 98: 32–42. Tomlinson J.A., Baker I., Boonham N. (2007): Faster, sim- Pelosi C.S., Lourenco M.V., Silva M., Santos A.Z., Franca pler, more-specific methods for improved molecular S.C., Marins M. (2013): Development of a TaqMan real- detection of Phytophthora ramorum in the field. Applied time PCR assay for detection of Leifsonia xyli subsp xyli. and Environmental Microbiology, 73: 4040–4047. Tropical Plant Pathology, 38: 343–345. Tsai Y.L., Olson B.H. (1991): Rapid method for direct ex- Reeleder R.D., Capell B.B., Tomlinson L.D., Hickey W.J. traction of DNA from soil and sediments. Applied and (2003): The extraction of fungal DNA from multiple Environmental Microbiology, 57: 1070–1074. large soil samples. Canadian Journal of Plant Pathology, Ward L.I., Beales P.A., Barnes A.V., Lane C.R. (2004): A 25: 182–191. real-time PCR assay based method for routine diagnosis Rizza S., Nobile G., Tessitori M., Catara A., Conte E. (2009): of Spongospora subterranea on potato tubers. Journal of Real time RT-PCR assay for quantitative detection of Phytopathology, 152: 633–638. Citrus viroid III in plant tissues. Plant Pathology, 58: Weintraub P.G., Jones P. (2010): Phytoplasmas: genomes, 181–185. plant hosts and vectors. Plant Pathology, 59: 1177–1178. Roberts C.A., Dietzgen R.G., Heelan L.A., Maclean D.J. Weller S.A., Beresford-Jones N.J., Hall J., Thwaites R., Parkin- (2000): Real-time RT-PCR fluorescent detection of to- son N., Elphinstone J.G. (2007): Detection of Xanthomonas mato spotted wilt virus. Journal of Virology Methods, fragariae and presumptive detection of Xanthomonas ar- 88: 1–8. boricola pv. fragariae, from strawberry leaves, by real-time Schaad N.W., Frederick R.D., Shaw J., Schneider W.L., Hick- PCR. Journal of Microbiological Methods, 70: 379–383. son R., Petrillo M.D., Luster D.G. (2003): Advances in Williams N., Hardy G.E.St.J., O’Brien P.A. (2009): Analysis molecular-based diagnostics in meeting crop biosecurity of the distribution Phytophthora cinnamomi in soil at a and phytosanitary issues. Annual Review of Phytopathol- disease site in Western Australia using nested PCR. Forest ogy, 41: 305–324. Pathology, 39: 95–109.

189

99 Vol. 51, 2015, No. 4: 177–190 Plant Protect. Sci. doi: 10.17221/104/2014-PPS

Wittwer C.T., Herrman M.G., Gundry C.N., Elenitoba- (Psammotettix alienus Dahlb.) by real-time PCR. Journal Johnson K.S.J. (2001): Real-time multiplex PCR assays. of Virological Methods, 169: 416–419. Methods, 25: 430–442. Zhang P., Mar T.T., Liu W.W., Li L., Wang X.F. (2013): Simul- Wu J., Diao Y., Gu Y., Hu Z. (2011): Molecular detection of taneous detection and differentiation of Rice black streaked Pectobacterium species causing soft rot of Amorphophal- dwarf virus (RBSDV) and Southern rice black streaked dwarf lus konjac. World Journal of Microbiology and Biotech- virus (SRBSDV) by duplex real time RT-PCR. Virology nology, 27: 613–618. Journal, 10: 24. Xu R., Tambong J.T. (2011): A TaqMan real-time PCR assay Zhao Z., Yu Y., Zhang Z., Liang P., Ma Y., Li S., Wang H. targeting the cytochrome o ubiquinol oxidase subunit II (2013): A duplex, SYBR Green I-based RT-qPCR assay gene for detection of several pathovars of Pseudomonas sy- for the simultaneous detection of Apple chlorotic leaf ringae. Canadian Journal of Plant Pathology, 33: 318–331. spot virus and Cherry green ring mottle virus in peach. Yang J.G., Wang F.L., Chen D.X., Shen L.L., Qian Y.M., Virology Journal, 10: 255. Liang Z.Y., Zhou W.C., Yan T.H. (2012): Development Zouhar M., Mazáková J., Prokinová E., Váňová M., Ryšánek of a one-step immunocapture real-time RT-PCR assay P. (2010): Quantification of Tilletia caries and Tilletia for detection of Tobacco mosaic virus in soil. Sensors, controversa mycelium in wheat apical meristem by real- 12: 16685–16694. time PCR. Plant Protection Science, 46: 107–115. Zhang X., Zhou G., Wang X. (2010): Detection of Wheat Received December 16, 2014 dwarf virus (WDV) in wheat and vector leafhopper Accepted after corrections March 3, 2015

Corresponding author: Dr Seyed Mahyar Mirmajlessi, Estonian University of Life Sciences, Institute of Agricultural and Environmental Sciences Department of Field Crops and Grassland Husbandry, Kreutzwaldi 1, Tartu, Estonia; E-mail: [email protected]

190

100 III Mirmajlessi SM, Larena I, Mänd M, Loit E, 2016. First report on the detection and quantification of Verticillium dahliae from Estonian strawberry fields using quantitative real-time PCR. Zemdirbyste-Agriculture 103(1), 115–118.

102

ISSN 1392-3196 Zemdirbyste-Agriculture Vol. 103, No. 1 (2016) 115

SHORT COMMUNICATION

ISSN 1392-3196 / e-ISSN 2335-8947 Zemdirbyste-Agriculture, vol. 103, No. 1 (2016), p. 115–118 DOI 10.13080/z-a.2016.103.015

First report on the detection and quantification of Verticillium dahliae from Estonian strawberry fields using quantitative real-time PCR

1 2 1 1 Seyed Mahyar MIRMAJLESSI , Inmaculada LARENA , Marika MÄND , Evelin LOIT 1Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences Tartu, Estonia E-mail: [email protected] 2National Institute for Agricultural and Food Research and Technology Madrid, Spain

Abstract The main aim of this investigation was to develop a SYBRGreen real-time polymerase chain reaction (PCR) assay for detection and quantitation of Verticillium dahliae directly from affected strawberry roots and soils. The proposed assay utilizes a specifically designed primer pair on the basis of an internal transcribed spacer (ITS) sequence. During 2014–2015, plant and soil samples were randomly collected from different areas including Vasula, Rohu, Unipiha, Utsu and Marjamaa in Estonia and analyzed for V. dahliae. Real-time PCR technique using primers designed to the rDNA ITS1 was highly sensitive and accurate and so allowed reliable quantification of the pathogen DNA at low inoculation in soils (10.48 pg µl-1) and even in root of symptomless plants (11.05 pg µl- 1). This is the first study of using this technique to quantify the population of V. dahliae in strawberry fields from Estonia.

Key words: quantitative detection, real-time PCR.

Introduction Materials and methods Strawberry (Fragaria × ananassa Duch.) is one Sampling and fungal isolation. During 2014– of the most popular berry fruits in the world due to its 2015, a study was conducted in order to detect and high nutritional value (Rugienius et al., 2015). It is one quantify Verticillium dahliae directly from open ield of the most important fruits in European and Baltic grown strawberries and soil to estimate the incidence countries, and its cultivation in Estonia has increased of Verticillium wilt outbreak in different regions of over the past few years. Verticillium wilt, caused by Estonia. Sampling areas (Vasula, Rohu, Unipiha, Utsu Verticillium dahliae Kleb. is an economically important and Marjamaa) were suspected of being infected with disease that can cause extensive strawberry plant and wilt diseases. Strawberry plant (cv. ‘Sonata’) and soil fruit damage, even at low inoculum load (Pegg, Brady, samples were randomly collected from different points 2002). The pathogen can survive for long periods by in each field and culturing methods were used to isolate producing black microsclerotia that persist in the soil for fungi (Dhingra, Sinclair, 1985). Pure cultures of V. years (Klosterman et al., 2009). Moreover, Verticillium dahliae (VD12a and VD4), V. albo-atrum and F. wilt is difficult to completely control even with soil oxysporum f. sp. fragariae isolates were provided by fumigation. This disease was historically controlled by National Institute for Agricultural and Food Research and soil fumigation with methyl bromide but it was phased Technology (INIA), Madrid, Spain. Isolates from other out by 2005 (Pérez-Jiménez et al., 2012). In fact, early genera were isolated from plant roots and soil of detection of this pathogen on strawberry became more strawberry fields in Estonia (Table). important as well as considerable in recent years in order Extraction of DNA. Genomic DNA of pure to work with pathogen free plants. So, the aim of this fungal cultures and strawberry plants were extracted using study was to establish a sensitive real-time PCR (rtPCR) a DNeasy Plant Mini Kit (“Qiagen”, USA) according method for the detection and quantification of the to the manufacturer’s instructions. Also, soil genomic pathogen directly from strawberry root and soil. DNA was extracted using a PowerSoil DNA Isolation

103 First report on the detection and quantification of Verticillium dahliae from Estonian strawberry fields

116 using quantitative real-time PCR

Table. Isolates used for the primer pairs specificity

Polymerase chain reaction (PCR) Isolates Host ITS1 / ITS4 VD-rtPCR-F / VD-rtPCR-R

Verticillium sp.** soil + − V. dahliae, VD12a* tomato plant + + V. dahliae, VD4* strawberry plant + + V. albo-atrum strawberry plant + − V. dahliae** strawberry plant + + V. dahliae** soil + + Fusarium oxysporum f.sp. fragariae strawberry plant + − Fusarium solani** soil + − Rhizoctonia solani** soil + − Rhizopus sp.** soil + −

Notes. * – isolates obtained from National Institute for Agricultural and Food Research and Technology (INIA); ** – isolates were collected from strawberry ields of Vasula area. + amplification of expected PCR product; − no PCR band on electrophoretic gel.

Kit (“MoBio”, USA), according to the manufacturer’s (VD-rtPCR-F) and reverse (VD-rtPCR-R) primers at instructions. Then, DNA quality was determined by concentrations of 200 nM each, 5 μl of template DNA, 10 agarose gel electrophoresis and DNA was quantified by μl of 1 × IQ SYBRGreen MasterMix and 4.6 μl of sterile a spectrophotometer NanoDrop 2000 (Thermo Fisher RNase-free water. Reactions were performed under the Scientic, USA) at 260 nm. following conditions: 95°C for 5 min, 40 cycles of 95°C Conventional and real-time polymerase chain for 10 s and 65°C for 35 s to calculate the threshold reactions (PCRs). Extracts of genomic DNA were cycle (Ct) values; followed by 95°C for 15 s, 67°C for 1 initially amplified via conventional PCR (cPCR) using min, and then heating to 97°C at a rate of 1°C per 5 s to ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 obtain the melting curves. For assay validation, a unique (TCCTCCGCTTATTGATATGC) primers to confirm the standard curve was developed by plotting the logarithm presence of amplifiable DNA (Kernaghan et al., 2007). of known concentrations of serially diluted genomic DNA The web-based program Primer3 was applied to design the extracted from V. dahliae isolates (VD12a and VD4) primers VD-rtPCR-F (ACATCCGATGGATAATTCTC) over at least five orders of magnitude (10-2–10-6) against and VD-rtPCR-R (GATCTGGGCGCAAGGCAG). values of threshold cycle. Amplification efficiency was BLAST searches of the GenBank (http://www.ncbi.nlm. computed via E = (10(-1/slope) − 1) × 100 and the sensitivity nih.gov/nuccore/?term=Verticillium+dahliae) showed of assay was measured based on minimum quantity of that primer pair would be specific to amplify the target DNA when the threshold cycle was reached up to region of 5.8S rDNA-ITS in V. dahliae. Primer specificity 30 cycles. was assessed using cPCR against different isolates strawberry pathogens as shown in Table. Samples were then analysed by rtPCR assay using a specifically Results and discussions designed primer pair. Real-time PCR was performed Identification of V. dahliae from strawberry using SYBRGreen chemistry on ABI PRISM 7500 plants and soils was based on morphology of cultures such Sequence Detection System (Applied Biosystems, USA) as production of globose to elongate black microsclerotia in 25 μl reaction volume containing: 0.4 μl of forward with hyaline and septate mycelium (Fig. 1).

A B

Figure 1. Dark microsclerotia (A) and microscopic view of Verticillium dahliae with hyaline and septate mycelium (B)

104

ISSN 1392-3196 Zemdirbyste-Agriculture Vol. 103, No. 1 (2016) 117

The pathogens including F. solani and In fact, rtPCR is an ideal method, which allows accurate Verticillium sp. causing similar wilt symptoms along and sensitive detection and quantification of pathogens with Rhizopus sp. and R. solani were isolated from soil in various environmental samples that cannot be isolated of strawberry fields (Table). The specific primer pair easily or are present at low inoculum load (Bustin et al., was examined using cPCR against genomic DNA of 2009; Mirmajlessi et al., 2015 b). fungal pure cultures to confirm the specificity of the primer. The amplified specific DNA fragment was Conclusion approximately 100 bp. Blast analysis of the GenBank Many PCR-based detection methods are able to showed that the primer pair would be specific to detect Verticillium spp. on plant tissues and soil, but no amplify the region of 5.8S rDNA-ITS in V. dahliae. The study has been found to quantify populations of V. dahliae application of specific primers based on the ITS using real-time PCR technique in Estonia strawberry regions has been confirmed as a proper strategy ields. The developed assay was able to identify the regarding diagnostic tests for many pathogens (Lees et al., 2002; Luchi et al., 2005). presence of V. dahliae in symptomless strawberry plants Using standard curves analysis, the and soil samples without culturing, facilitating the amplification efficiency of assay was estimated screening of the pathogen in diverse areas in real time. 95.67% over at least f ive orders of magnitude based This is first report of using SYBRGreen-based real- on 100% efficiency (Fig. 2), in which the minimum time PCR in order to detect and quantify populations of detection limit of assay was 0.93 pg µl-1 DNA, V. dahliae with high sensitivity from strawberry fields in confirming sensitivity of method for V. dahliae Estonia. So, the results of this study may provide growers detection. a means to enhance available disease management strategies against Verticillium wilt.

Acknowledgements This work was supported by the European Union through the European Regional Development Fund (Contract #10.1-9/14/471), institutional research funding (IUT36-2) of the Estonian Science Foundation (Grant #9450).

Received 23 12 2015

Accepted 03 02 2016 Figure 2. Combined standard curve using specific primer pair from different dilutions of pure genomic DNA of two Verticillium dahliae isolates (VD12a and VD4) References

Bustin S. A., Benes V., Garson J. A., Hellemans J., Huggett J., Real-time PCR was established to detect and Kubista M., Mueller R., Nolan T., Pfafl M. W., quantify V. dahliae directly from strawberry plants and Shipley G. L., Vandesompele J. Wittwer C. T. 2009. The soil samples as described in materials and methods. MIQE guidelines: minimum information for publication Using SYBRGreen rtPCR assay, luorescent signals were of quantitative real-time PCR experiments. Clinical produced from all soil samples and suspicious plants Chemistry, 55: 611–622 collected from different sampling areas. The ITS region http://dx.doi.org/10.1373/clinchem.2008.112797 within prokaryotic and eukaryotic rDNA operons has Dhingra O. D., Sinclair J. B. 1985. Basic plant pathology been described as a stable genetic marker and actually methods. Boca Raton, USA, 355 p. this region is the most widely sequenced for strawberry Kernaghan G., Reeleder R. D., Hoke S. T. 2007. Quantification pathogens (Mirmajlessi et al., 2015 a). The mean of Cylindrocarpon destructans f. sp. panacis in soils by threshold cycle (Ct) values from V. dahliae-infected root/ real-time PCR. Plant Pathology, 56 (3): 508–516 soil varied from 24.95 ± 0.04 to 19.89 ± 0.44. But, five http://dx.doi.org/10.1111/j.1365-3059.2006.01559.x plants had no common V. dahliae symptoms, but Klosterman S. J., Atallah Z. K., Vallad G. E., Subbarao K. rtPCR results showed positive results with the lowest V. 2009. Diversity, pathogenicity, and management of Verticillium species. Annual Review of Phytopathology, DNA concentration (11.05 pg µl-1). Also, the lowest 47: 39–62 amount of V. dahliae DNA detected in soil was 10.48 pg http://dx.doi.org/10.1146/annurev-phyto-080508-081748 -1 µl . Overall, the presence of V. dahliae in strawberry Lees A. K., Cullen D. W., Sullivan L., Nicolson M. J. 2002. production areas showed wide variation, being high in Development of conventional and quantitative real- samples from Vasula and Marjamaa, moderate in Rohu time PCR assays for detection and identification of and Utsu, and low in Unipiha. Since there were differences Rhizoctonia solani AG-3 in potato and soil. Plant between amounts of V. dahliae with different symptoms, Pathology, 51 (3): 293–302 the assay was strongly able to detect V. dahliae DNA with http://dx.doi.org/10.1046/j.1365-3059.2002.00712.x high accuracy and specificity in symptomless plants.

105 First report on the detection and quantification of Verticillium dahliae from Estonian strawberry fields

118 using quantitative real-time PCR

Luchi N., Capretti P., Pinzani P., Orlando C., Pazzagi M. 2005. Pegg B., Brady G. 2002. Verticillium wilts. New York, USA Real-time PCR detection of Biscogniauxia mediterranea in http://dx.doi.org/10.1079/9780851995298.0000 symptomless oak tissue. Letters in Applied Microbiology, Pérez-Jiménez R. M., De Cal A., Melgarejo P., Cubero J., 41: 61–68 Soria C., Zea-Bonilla T., Larena I. 2012. Resistance of http://dx.doi.org/10.1111/j.1472-765X.2005.01701.x several strawberry cultivars against three different Mirmajlessi S. M., Destefanis M., Gottsberger R. A., Mänd M., pathogens. Spanish Journal of Agricultural Research, 10 Loit E. 2015 (a).PCR-based specific techniques used for (2): 502–512 detecting the most important pathogens on strawberry: a http://dx.doi.org/10.5424/sjar/2012102-345-11 systematic review. Systematic Reviews, 4: 9 Rugienius R., Šikšnianienė J. B., Frercks B., Stanienė G., http://dx.doi.org/10.1186/2046-4053-4-9 Stepulaitienė I., Haimi P., Stanys V. 2015. Characterization Mirmajlessi S. M., Loit E., Mänd M., Mansouripour S. M. 2015 of strawberry (Fragaria × ananassa Duch.) cultivars and (b). Real-time PCR applied to study on plant pathogens: hybrid clones using SSR and AFLP markers. Zemdirbyste- potential applications in diagnosis – a review. Plant Agriculture, 102 (2): 177–184 Protection Science, 51 (4): 177–190 http://dx.doi.org/10.13080/z-a.2015.102.023

ISSN 1392-3196 / e-ISSN 2335-8947 Zemdirbyste-Agriculture, vol. 103, No. 1 (2016), p. 115–118 DOI 10.13080/z-a.2016.103.015

Pirmasis pranešimas apie Verticillium dahliae identiikavimą ir nustatymą Estijos braškynuose, taikant kiekybinę realaus laiko polimerazės grandininę reakciją

1 2 1 1 S. M. Mirmajlessi , I. Larena , M. Mänd , E. Loit 1Estijos gyvybės mokslų universiteto Žemės ūkio ir aplinkos mokslų institutas 2Ispanijos nacionalinis žemės ūkio ir maisto tyrimų ir technologijos institutas

Santrauka Tyrimo tikslas – taikant SYBRGreen realaus laiko polimerazės grandininės reakcijos (PGR) metodą, identifikuoti Verticillium dahliae ir nustatyti jų kiekį tiesiogiai tiriant pažeistas braškių šaknis bei dirvožemį. Tyrimo metu naudota speciali pradmenų pora sukurta, remiantis vidinio transkribuojamo tarpiklio (ITS) seka. 2014–2015 m. dirvožemio ėminiai buvo surinkti iš įvairių Estijos regionų – Vasula, Rohu, Unipiha, Utsu bei Marjamaa – ir analizuoti siekiant nustatyti V. dahliae. Realaus laiko PGR metodas naudojant specifinius rDNA ITS pradmenis buvo tikslus, jautrus ir leido patikimai nustatyti patogeno DNR kiekį, esant nedideliam patogeno kiekiui dirvožemyje (10.48 pg µl-1) ir besimptomių augalų šaknyse (11.05 pg µl-1). Šis tyrimas yra pirmasis, kuriame taikytas šis metodas siekiant nustatyti V. dahliae populiacijos kiekį Estijos braškynuose.

Reikšminiai žodžiai: kiekio nustatymas, realaus laiko PGR.

Please use the following format when citing the article: Mirmajlessi S. M., Larena I., Mänd M., Loit E. 2016. First report on the detection and quantification of Verticillium dahliae from Estonian strawberry fields using quantitative real-time PCR. Zemdirbyste-Agriculture, 103 (1): 115–118 DOI 10.13080/z-a.2016.103.015

106 IV Mirmajlessi SM, Larena I, Mänd M, Loit E, 2016. A rapid diagnostic assay for detection and quantification of the causal agent of strawberry wilt from field samples. Acta Agriculturae Scandinavica, Section B – Soil & Plant Science 66(7), 619–629.

108 ACTA AGRICULTURAE SCANDINAVICA, SECTION B — SOIL & PLANT SCIENCE, 2016 VOL. 66, NO. 7, 619–629 http://dx.doi.org/10.1080/09064710.2016.1205656

ORIGINAL ARTICLE A rapid diagnostic assay for detection and quantiﬁcation of the causal agent of strawberry wilt from ﬁeld samples Seyed Mahyar Mirmajlessia, Inmaculada Larenab, Marika Mändc and Evelin Loita aDepartment of Field Crops and Grassland Husbandry, Estonian University of Life Sciences, Tartu, Estonia; bDepartment of Plant Protection, Agricultural National Research Institute, Madrid, Spain; cDepartment of Plant Protection, Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences, Tartu, Estonia

ABSTRACT ARTICLE HISTORY Verticillium dahliae Kleb, the cause of Verticillium wilt disease, is a destructive pathogen that Received 5 April 2016 leads to severe yield losses in strawberry fields and thus considerable economic damages. Accepted 21 June 2016 Although rapid identification and detection methods are becoming available more, pathogen quantification remains one of the main challenges in the disease management. In this study, KEYWORDS Microsclerotia; quantitative a real-time polymerase chain reaction (rtPCR) assay was developed to quantitatively assess detection; strawberry; SYBR V. dahliae abundance directly from affected roots and soil collected from different areas in Green-based assay; Estonia. A specific primer pair based on the ribosomal DNA (rDNA) internally transcribed Verticillium wilt spacer was designed for SYBR Green-based assay. Strawberry plant and soil samples were randomly collected from different areas in Estonia and analyzed for V. dahliae by soil plating technique and rtPCR assay. The assay was specific for V. dahliae so that the minimum detection limit was 0.93 pg µl−1 of pathogen DNA and the lowest amount of V. dahliae detected in soil was 10.48 pg µl−1 of target DNA corresponding to one microsclerotia per gram of soil. This technique allowed rapid detection and quantification of the pathogen DNA at the picogram level in soils and even in symptomless plants, facilitating the screening of the pathogen in diverse areas. This is the first study about the rtPCR technique being used successfully to assess populations of V. dahliae with high specificity and sensitivity in Estonia strawberry fields. Results of this research can be useful for growers and agricultural organizations to improve available disease management strategies against Verticillium wilt.

Introduction existence and amount of the pathogen in the soil can be an important factor in determining suitable Strawberry (Fragaria × ananassa) is one the most com- control strategies. So, there is a need for a quick and mercially important fruit crops in European and Scandi- navian countries, and its cultivation has been precise method to assess the inoculum densities of fi developed in Estonia in recent years. Strawberry dis- V. dahliae in the eld. eases caused by soil-borne fungi are a major limiting The conventional methods, which can take several factor that severely impacts plant performance and days, to identify the pathogen have often relied on leads to economic losses (De Cal et al. 2004). Verticillium the symptoms and culturing of pathogen followed by dahliae Kleb, the cause of Verticillium wilt disease, is an morphological observations, which are time consum- economically important soil-borne pathogen world- ing and laborious (Lievens et al. 2006). Polymerase fi wide that can cause significant strawberry crop chain reaction (PCR)-based technology using speci c losses, even at low inoculation densities (Bhat & primers have been described for the detection and fi Subbarao 1999; Mirmajlessi et al. 2015a). The fungus identi cation of V. dahliae in plant tissue (Hu et al. can survive independent of its proper host plant for 1993; Li et al. 1999; Dan et al. 2001) and soil (Nazar prolonged periods in the soil by producing multicellu- et al. 1991; Platt & Mahuku 2000; Mahuku & Platt lar and melanized structures (Perry & Evert 1982; 2002; Kageyama et al. 2003). Generally, these Pérez-Jiménez et al. 2012) known as microsclerotia methods are more sensitive, accurate, and faster than (MS). Since inoculum densities of as few as 2 MS g−1 conventional methods. In addition, ribosomal DNA soil can result in plant contamination with latent infec- (rDNA) internally transcribed spacer (ITS) regions tion (Harris & Yang 1996), information about the encompassing the 5.8S rDNA are the regions most

109 620 S. M. MIRMAJLESSI ET AL. targeted to design primers for PCR-based detection of plant samples were mostly collected based on visible many plant pathogens (Kappe et al. 1996; Li et al. 1999; symptoms of Verticillium wilt such as drying, and mar- Platt & Mahuku 2000; Salazar et al. 2000; Bonants et al. ginal and interveinal browning on outer leaves. Soil 2004; Andjic et al. 2005; Karajeh & Masoud 2006; samples (500 g each) were also collected at random Debode et al. 2009, 2011; Garrido et al. 2009; Schoch from different points (depth of 12–15 cm) in each et al. 2012; Wang et al. 2013). field and placed in plastic bags until use. Plant and Accurate quantification of the target DNA is not soil samples were then divided into two parts. The possible using conventional PCR (cPCR). However, tech- first part was used for pathogen isolation by culturing niques using real-time PCR (rtPCR) will provide a more methods, and the second part was subjected to mol- accurate quantification of pathogen with a higher level ecular experiments in order to detect and quantify of sensitivity (Bilodeau et al. 2012). rtPCR is an ideal the pathogen as described below. system that allows accurate and sensitive detection and quantification of targets that cannot be extracted Fungal cultures or cultured easily from tissue, or are present at low inoculum load in samples (Bustin et al. 2009). This tech- The fungal isolates used in this research were saprobic nology has even multipurpose applications in phyto- and pathogenic fungi that are usually found in soil and pathology and provides conclusive results as it can causing similar wilt symptoms on strawberry (i.e. even discriminate between closely related microorgan- V. dahliae, Verticillium albo-atrum, Verticillium longis- isms (Cooke et al. 2007; Schena et al. 2013; Mirmajlessi porum, Fusarium oxysporum f.sp. fragariae, Fusarium et al. 2015b). Increasingly, rtPCR is being used for the solani, Rhizoctonia spp., Rhizopus spp., and Pythium detection and/or quantification of V. dahliae on differ- spp.). Isolates of V. dahliae (VD9, VD12a, and VD4), ent hosts (Fradin & Thomma 2006; Lievens et al. V. albo-atrum, and F. oxysporum f.sp. fragariae were 2006; Atallah et al. 2007; Gayoso et al. 2007; Banno kindly provided by Agricultural National Research Insti- et al. 2011; Debode et al. 2011; Bilodeau et al. 2012; tute (INIA), Madrid, Spain. Isolates of Pythium spp. and Wang et al. 2013). V. longisporum were also obtained from North Dakota As the necessity for a fast, sensitive, and specific State University (Department of Plant Pathology), method to quantify V. dahliae is critical for disease USA. Isolates from other genera in this study were management, rtPCR has been considered the gold isolated from plant root and soil of strawberry fields standard technique for pathogen quantification in (Table 1). Various isolates were used to investigate recent years. To date, although several articles have the possibility that other common soil fungi interfere already been published on PCR-based methods for with the V. dahliae detection test. Isolates were the detection of this fungus, there are no data about grown on potato-dextrose agar (PDA) medium at 24° the accurate detection and quantification of C for routine culturing and then maintained at 4°C V. dahliae using rtPCR in Estonia strawberry fields. until use. Therefore, the main objectives of the current research were to (i) develop a sensitive and specific real-time Isolation of fungi PCR assay (based on SYBR Green chemistry) for the detection and quantification of V. dahliae directly To isolate fungi from strawberry fields, 1 g soil per each from field-grown strawberries and soil in Estonia and sample was diluted in 9 ml of sterile water and then six (ii) enumerate the abundance of V. dahliae MS in the 1:10 serial dilutions were prepared. Each dilution soil using the traditional soil plating technique and (200 μl) was spread on plates of PDA-rose-bengal compare these estimates with data from quantitative medium containing tetracycline (30 µg ml−1) as rtPCR. described by Dhingra and Sinclair (1985), and incubated at 26°C for 8 days. To isolate fungal pathogens from strawberry plants, parts of root were washed in Materials and methods 75% ethanol, disinfected superficially with sodium hypochlorite for 3 min, rinsed several times in sterile Sample collection water, and dried. Then, cross-sections were made Plant and soil samples were collected at random from under an aseptic condition and transferred onto acidi- several strawberry fields located in different production fied potato-dextrose agar (APDA). The APDA contained sites of Estonia (Vasula, Rohu, Unipiha, Utsu, and 1.5 ml of 25% lactic acid per liter. All plates were Marjamaa) during 2014–2015. Sampling areas were incubated at 26°C for two weeks. Totally, morphologi- suspected of being infested with wilt diseases and cally dissimilar colonies were removed to fresh PDA

110 ACTA AGRICULTURAE SCANDINAVICA, SECTION B — SOIL & PLANT SCIENCE 621

Table 1. Fungal isolates used in this study to evaluate primer Primer design specificity for the specific detection of V. dahliae. fi PCR amplification Total genomic DNA was initially ampli ed via cPCR VD-rtPCR- using ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 ITS1/ F/VD- (TCCTCCGCTTATTGATATGC) primers to confirm the Isolates Abundancea Source ITS4 rtPCR-R existence of amplifiable DNA (White et al. 1990; Kerna- F. oxysporum f.sp. 3 Strawberry + − fi fragariaeb plant ghan et al. 2007). Ampli cation was done in 25 μl reac- F. solanic 2 Tomato plant + − tion volume containing 10 ng of DNA template, 2U Taq d Pythium spp. 2 Unknown + − ® c DNA polymerase (Thermo Scientific, ABgene , UK), Rhizoctonia spp. 4 Soil + − Rhizopus spp.c 1 Soil + − 0.1 mM dNTP solution (Eurogentec, Germany), 1.5 mM c Unknown 6 Strawberry + ND MgCl , 1× PCR buffer, and 0.1 μM of each primer. PCR plant and 2 soil mixtures were run on a GeneAmp PCR System 9700 b V. dahliae, VD9 1 Tomato plant + + thermocycler (Applied Biosystems, USA) using the fol- V. dahliae, VD12ab 2 Tomato plant + + V. dahliae, VD4b 2 Strawberry ++ lowing conditions: initially 95°C for 3 min to denature plant the DNA, followed by 40 cycles of 1.30 min at 95°C, V. dahliaec 8 Strawberry ++ plant 1 min at 55°C, 2 min at 72°C, followed by 10 min at V. dahliaec 22 Soil ++ 72°C. Control reactions, in which no DNA template V. albo-atrumb 1 Strawberry + − plant was present, were performed with fungal DNA to test V. longisporumd 1 Canola plant + − for possible contamination of the reagents. rtPCR Notes: +, amplification of expected PCR product; −, no PCR band on the primer set was designed based on the ITS1 and ITS2 electrophoretic gel. ND, not done. aAbundance of isolates. regions. For this, the region between the small and bCodes proceeded by VD9, 12, and 4 are accession numbers of isolates large subunits of the rRNA gene of different Verticillium obtained from INIA, Madrid, Spain. spp. was amplified and sequenced by Illumina MiSeq cIsolates collected from strawberry fields in this study. dIsolates provided by Department of Plant Pathology, North Dakota State sequencer (Genome Center of Tartu University). Follow- University, USA. ing sequence alignment by the ClustalW algorithm with related ITS sequences found in GenBank, species- fi plates and incubated at room temperature for several speci c primer was designed using the web-based days. program Primer3 and checked to discover similar sequences for the amplicons using basic local alignment search tool (BLAST) analysis (Altschul et al. 1990). Speci- DNA extraction ficity of this primer pair was assessed using cPCR against different isolates of the strawberry pathogens as listed in Genomic DNA of fungal pure cultures shown in Table 1 Table 1. The PCR mixtures of 25 μl contained 2 mM was extracted from 50 mg of lyophilized fungal MgCl , 200 μM dNTP solution (Eurogentec, Germany), mycelium using DNeasy Plant Mini Kit (Qiagen) accord- 2 0.2 μM of each primer, 50 ng of DNA, and 1U Taq DNA ing to the manufacturer’s instructions. Double-distilled polymerase (Thermo Scientific, ABgene®, UK), with the water (40 μl) was added to dissolve extracted DNA and following amplification program: a denaturation step then stored at −20°C until use. To extract DNA from for 5 min at 95°C, followed by 35 amplification cycles strawberry plants, root pieces were placed in liquid nitro- consisting of 30 s at 95°C, 30 s at 63°C, and 30 s at 73° gen and severely pulverized with a mortar and pestle. C. A final extension step was added for 7 min at 72°C. The total DNA was then extracted using DNeasy Plant Amplified DNA fragments were visualized on 1.5% Mini Kit (Qiagen) according to the manufacturer’s agarose gel in 1× Tris/Borate/EDTA (Ethylene diamine instructions. To extract DNA directly from soil, 150 g tetra acetic acid) buffer stained with GelRed™ under soil per sample (depth of 12–15 cm) was taken from UV light. A 100-bp DNA ladder was used as a size selected points of each field and placed in plastic bags marker. All PCRs were repeated at least twice. before DNA extraction. Then, around 2 g soil was subjected to total DNA extraction using a PowerSoil® DNA Isolation Kit (MoBio), according to the manufacturer’s Real-time PCR assay instructions. DNA quality was determined by agarose gel electrophoresis and DNA quantity was measured Real-time PCR was carried out on DNA extracted from by NanoDrop 2000 Spectrophotometer (Thermo Scienti- soil and plant samples using SYBR Green chemistry fic) at 260 nm. The extracted DNA was adjusted to a final on an ABI PRISM 7500 Sequence Detection System concentration of 20 ng μl−1 with Tris-EDTA buffer and (Applied Biosystems, Foster City, CA, USA). Each rtPCR stored at −20°C until further use. was performed in triplicate in MicroAmp® optical

111 622 S. M. MIRMAJLESSI ET AL.

96-well reaction plates, which were sealed with a trans- was assessed as minimum amount of target DNA parent sticky cover (Applied Biosystems, Foster City, detected when the Ct was reached up to 30 cycles. In CA, USA) in 25 μl reaction mixture containing 0.4 μl of fact, Ct value is inversely related to the log of initial forward (VD-rtPCR-F ACAGTCCGATGGATAATTCTC) DNA concentration at which the higher initial concen- and reverse (VD-rtPCR-R GATCTGGGCGCAAGGCAG) tration has a lower Ct value. Each sample used to calcu- primers, with reference to the ITS sequences of late the standard curve was amplified three times and V. dahliae, at concentrations of 200 nM each, 5 μl of from at least two different DNA concentrations to template DNA (5 ng), 10 μl of 1× IQ SYBR Green Master- control the consistency of the curve. Mix (Bio-Rad), and 4.6 μl of sterile RNase-free water. The amplification was performed under the following con- Detection and quantification of V. dahliae in ditions: 95°C for 5 min; 40 cycles of 95°C for 10 s and strawberry field samples 65°C for 35 s to calculate the cycle threshold (Ct) values; followed by 95°C for 15 s, 67°C for 1 min, and Fifty-six samples from plant and soil were collected then heating to 97°C at a rate of 1°C/5 s to obtain the from different strawberry production areas as melting curves. The threshold cycle (Ct) value for described previously. Detection and quantification of each rtPCR was automatically calculated using the ABI V. dahliae were achieved by SYBR Green rtPCR using Prism sequence detection software (version 3.0). DNA extracted from each sample as unknown target. Each sample was analyzed in triplicate. Plant DNA and V. dahliae genomic DNA were used as negative Spike assay and positive controls, respectively. The efficiency of the pathogen-specific primer VD- rtPCR-F/VD-rtPCR-R to detect target DNA among high Enumeration of V. dahliae in field soil concentrations of nontarget DNA was also examined by a spiking test. Different amounts of V. dahliae DNA Inoculum density of V. dahliae in strawberry field soils (1 × 10−2, 1 × 10−1, and 1 ng) were spiked into stable was also measured using a wet-sieving plating plant DNA amounts (1, 5, and 20 ng) and utilized in method, as previously described by Harris et al. (1993) the SYBR Green rtPCR as templates. The reaction with some modifications. Soil samples were air-dried mixture and amplification conditions were the same for two weeks at room conditions, mixed, and ground as described previously, and fluorescence readings with a mortar and pestle. Then, the samples were were obtained at the end of each cycle. Afterward, sifted using a 20-mesh sieve to eliminate large and the correlation between the concentration of input unbreakable debris. Twenty gram of each sieved soil amounts and the Ct values was established. In order sample was shaken (at 250 rpm) and dispersed in dis- to assess whether SYBR Green dye has produced a tilled water for 1 h. Then, the soil was wet-sieved single and specific product, an analysis of the melting through 60- and 400-mesh sieves, respectively, and curve was accomplished by heating the PCR product the residue retained in the 400-mesh sieve was sus- from 65°C to 95°C, with monitoring by fluorescence pended in 100 ml distilled water. Aliquots of 1 ml from spectroscopy every 0.3°C (data not shown). each suspension after wet-sieving were scattered onto 90-mm petri plates of modified sodium polypectate agar medium (Butterfield & DeVay 1977) and incubated Standard curve and amplification efficiency in the dark at 26°C. After two weeks of incubation, the Two standard curves were created by means of plot- plates were gradually washed under running water in ting the logarithm of known initial DNA concentrations order to remove residual soils. Afterward, the drained of V. dahliae isolates VD12a (0.022 μg μl−1) and VD4 plates were scanned for the existence of typical star- (0.018 μg μl−1) over at least five orders of magnitude shaped colonies of V. dahliae by checking the plates (10−2–10−6) versus Ct values. The data were separately using a stereomicroscope (Olympus, SZX10). In fact, analyzed and described as the cycle number at which a identification of V. dahliae was based on the shape of significant increase in the reported fluorescence can be cultures, conidia morphology, and production of detected. Then, the results were combined together in globose to elongate dark MS without melanized order to establish a unique standard curve with more mycelium. Inoculum density in each soil sample was accuracy. Amplification efficiency was computed via assessed by the number of V. dahliae colonies and indi- E = (10(−1/slope) − 1) × 100, where E is the amplification cated as MS g−1 soil. To compare the results of MS efficiency and the slope is the log of template concen- counts with rtPCR assay, Pearson correlation coefficient trations versus Ct. Also, the minimum detection limit was calculated using R program (version 3.2.2). The

112 ACTA AGRICULTURAE SCANDINAVICA, SECTION B — SOIL & PLANT SCIENCE 623 null hypothesis (P < .05) rejection demonstrates a lack of amount of spiked genomic DNA of V. dahliae (1 × significant difference between quantities. 10−2 ng). The Ct values were significantly correlated with the target DNA concentration, with a regression Results coefficient of 0.96, demonstrating the suitability of the assay for quantitative and qualitative tests. In fact, Isolation of fungi the primer pair showed a high sensitivity in detecting In this study, eight isolates of V. dahliae were totally the target of interest among varying different genes obtained from strawberry plants from different investi- (Table 2). This confirms that strawberry DNA had no sig- gated districts, including four isolates from Vasula, nificant effect on quantifying V. dahliae in strawberry three from Marjamaa, and only one isolate from Utsu plants. area (Table 1). Twenty-two isolates of V. dahliae were identified from soil samples, including eight isolates Standard curve from Vasula, four from Rohu, seven from Marjamaa, and two from Utsu area. Only one V. dahliae was iso- A wide range of concentrations was subjected to rtPCR lated from Unipiha district. Some more pathogens analysis. Standard curves were initially developed by including F. solani causing similar wilt symptoms plotting the Ct values against known serial dilutions along with Rhizopus spp. and Rhizoctonia spp. were iso- of quantified DNA from V. dahliae isolates (VD12a and lated from the soil of strawberry fields (Table 1). VD4) (Figure 2(a)). Finally, a combined standard curve between the log of DNA concentration and Ct value was constructed, and then a linear relationship with a Primer design and testing slope of −3.43 and a strong correlation coefficient The primer pairs were examined using cPCR against 0.989 was obtained. The amplification efficiency of genomic DNA from pure fungal cultures in this study the assay was calculated as 95.67% over at least five (Table 1). PCR products were generated from all DNA orders of magnitude (Figure 2(b)) based on 100% effi- extracted using nonspecific primers, demonstrating ciency, corresponding to −3.32 as the ideal optimum the existence of amplifiable template (data not value (Selim et al. 2005; Taylor et al. 2010). The amplifi- shown). BLAST searches of the GenBank database cation was observed in the presence of V. dahliae as the showed that the primer pair would be specific to template, but no amplification was detected by using amplify the region of 5.8S rDNA-ITS in V. dahliae and sterile RNase-free water as the negative control. The this was practically confirmed using DNA of different lowest amount of DNA amplified was 0.93 pg µl−1, con- fungal isolates as shown in Table 1. The amplified firming that this procedure represents a rapid, sensitive specific DNA fragment from V. dahliae isolates was rtPCR procedure for V. dahliae detection. approximately 100 bp that confirmed the specificity of this primer set. No DNA fragment was amplified Detection and quantification of V. dahliae in from other isolates using these primers (Figure 1). field samples Based on the morphological characteristics of the cul- Spike assay tures, most strawberry plants had evidence of In this assay, the plant DNA concentration was, respect- V. dahliae colonization on their roots. Pathogen MS ively, 100, 500, and 2000 times larger than the lowest were also enumerated using the plate count technique

Figure 1. Specificity of primer pair. Agarose gel electrophoresis of PCR products amplified using the primer pair VD-rtPCR-F/VD- rtPCR-R. Lane M: 100-bp DNA ladder; lanes 1–5: DNA amplification from the genomic DNA of different V. dahliae isolates; lanes 6– 12: no DNA amplification from the DNA templates of V. albo-atrum, V. longisporum, F. oxysporum f.sp. fragariae, F. solani, Rhizoctonia spp., Rhizopus spp., and Pythium spp., respectively; lane 13: negative control without DNA template.

113 624 S. M. MIRMAJLESSI ET AL.

Table 2. Detection of V. dahliae in strawberry plants by the 313.05 pg µl−1 (Table 3). Indeed, the lowest amount spike test analysis. of V. dahliae population detected in soil was a b Strawberry DNA (ng) Verticillium DNA (ng) Mean Ct SD 10.48 pg µl−1, which was equal to 1 MS g−1 soil 2 11× 10− 28.36 0.01 obtained from the soil plating technique (Table 3). 1×10−1 24.89 0.11 1 21.56 0.21 Based on the Pearson correlation coefficient used, 5 1 × 10−2 28.23 0.16 there was a significant correlation (R2 = 0.92 and P −1 1×10 25.01 0.32 −1 1 21.15 0.25 < .0001) between the quantity of MS g soil and the 20 1 × 10−2 29.12 0.20 Ct value of the rtPCR assay (data not shown). Basically, −1 1×10 26.37 0.17 −1 1 22.35 0.44 an amount ≤1MSg soil indicated a mean Ct value of aMean cycle threshold (Ct) of three rtPCR replicates. approximately 30 in soil. bStandard deviation based on three replicates. Using the SYBR Green rtPCR assay, fluorescent signals were produced from most samples collected and then concentrations of target DNA were assessed from strawberry fields. The mean Ct values for the using rtPCR. In some plates, identification of DNA samples from V. dahliae-infected root/soil varied V. dahliae was difficult and so single cPCR experiments from 24.95 ± 0.04 to 19.89 ± 0.44. However, five plants using the specific primer VD-rtPCR-F/VD-rtPCR-R were had no V. dahliae symptoms but returned positive performed to confirm the presence of V. dahliae in results using rtPCR, in which the lowest target DNA the culture medium before counting. No false-nega- concentration (11.05 pg µl−1) was measured from tive/positive results were obtained in the experiments, sample S55 (Table 3). Overall, the presence of which indicates the specificity of the primer pair to V. dahliae in strawberry production areas showed con- detect V. dahliae with high sensitivity and accuracy. In siderable variation, being high in samples from Vasula line with our experimental design, rtPCR was devel- and Marjamaa, moderate in Rohu and Utsu, and low oped to detect and quantify V. dahliae directly from in Unipiha. These experiments verified the sensitivity strawberry plant and soil samples as described in the and accuracy of the rtPCR assay for the quantification section ‘Materials and Methods’. The target DNA con- of V. dahliae at a very low density. centration available in each reaction was measured by comparing known amounts of V. dahliae DNA with Discussion Ct values of the unknown samples. Generally, all sampling areas were shown to be infested with Early detection and identification of plant pathogens V. dahliae when assessed with the rtPCR technique. have extensively increased with the enhancement of However, most samples from Unipiha were negative, molecular methods to improve disease management which means no MS g−1 soil was obtained in the corre- decisions (Babu et al. 2011). Quantitative rtPCR technol- sponding plate technique except in one isolate (Table ogy allows the rapid screening of suspected samples 3). Amounts of V. dahliae varied in a range from 1 to for the detection of pathogens that cannot be 13 MS g−1 soil from different strawberry fields, and extracted easily from host tissue, or are present at results of corresponding rtPCR showed a diverse low inoculum loads in soils. The main objective of the range of DNA concentrations from 10.48 to current study was mainly on direct and real-time

−1 Figure 2. Real-time PCR standard curve using primer pair VD-rtPCR-F/VD-rtPCR-R in which the log10 DNA amount (pg µl ) is plotted against cycle threshold (Ct) for different dilutions of pure genomic DNA of two V. dahliae isolates (VD12a and VD4). (a) Standard curve of each isolate and (b) combined standard curve of both V. dahliae isolates. A linear relationship between the DNA amount and Ct with a strong correlation coefﬁcient (R2 = 0.989) was found.

114 ACTA AGRICULTURAE SCANDINAVICA, SECTION B — SOIL & PLANT SCIENCE 625

Table 3. Detection of V. dahliae in strawberry plants and field soils by using SYBR Green rtPCR assay and plating count method. Real-time PCR Plating method Isolate code Location Source Symptoms on field Mean Cta SDb DNA concentration (pg µl−1) V. dahliae (MS g−1)c S01 Vasula Soil – 22.22 0.15 65.51 9 S02 Soil – 19.89 0.04 313.05 13 S03 Soil – 21.79 0.11 87.43 10 S04 Soil – 23.35 0.05 30.68 8 S05 Soil – 22.05 0.07 73.43 9 S06 Soil – 23.55 0.12 26.82 8 S07 Soil – 23.27 0.15 32.37 7 S08 Soil – 21.42 0.11 112.08 9 S09 Plant Plant collapse and death 23.36 0.06 30.47 + S10 Plant Yellow wilt 24.42 0.05 14.95 + S11 Plant Plant collapse and death 21.75 0.08 89.81 + S12 Plant Poor growth and stunting 22.55 0.22 52.49 + S13 Plant Green dry necrotic 24.75 0.33 11.98 N S14 Rohu Soil – 24.46 0.15 14.56 4 S15 Soil – 24.35 0.15 15.67 1 S16 Soil – 24.27 0.07 16.54 5 S17 Soil – N/A –– 0 S18 Soil – N/A –– 0 S19 Soil – 23.53 0.45 27.18 4 S20 Plant Yellow wilt N/A –– N S21 Plant Wilting, initially older leaves only 24.25 0.38 16.76 N S22 Plant No symptom 24.77 0.12 11.82 N S23 Plant No symptom 24.25 0.2 16.76 N S24 Plant No symptom N/A –– N S25 Marjamaa Soil – 24.68 0.07 12.56 6 S26 Soil – 22.35 0.11 60.03 8 S27 Soil – 23.88 0.55 21.49 6 S28 Soil – 24.77 0.08 11.82 6 S29 Soil – 22.55 0.31 52.49 8 S30 Soil – 23.95 0.22 20.50 6 S31 Soil – 24.65 0.08 12.81 5 S32 Plant Plant collapse and death 23.33 0.46 31.09 + S33 Plant Wilting, initially older leaves only 23.45 0.15 28.68 + S34 Plant Poor growth and stunting 24.67 0.24 12.64 N S35 Plant Yellow wilt 24.57 0.07 13.52 N S36 Plant Green dry necrotic 21.87 0.33 82.86 + S37 Unipiha Soil – N/A –– 0 S38 Soil – N/A –– 0 S39 Soil – N/A –– 0 S40 Soil – N/A –– 0 S41 Soil – N/A –– 0 S42 Soil – 24.95 0.44 10.48 1 S43 Plant No symptom 24.57 0.15 13.52 N S44 Plant No symptom N/A –– N S45 Plant No symptom N/A –– N S46 Plant No symptom N/A –– N S47 Utsu Soil – 23.67 0.07 24.75 4 S48 Soil – N/A –– 0 S49 Soil – N/A –– 0 S50 Soil – 23.74 0.11 23.61 4 S51 Soil – N/A –– 0 S52 Plant No symptom 23.55 0.63 26.82 N S53 Plant No symptom N/A –– N S54 Plant Yellow wilt 24.11 0.35 18.42 + S55 Plant No symptom 24.87 0.22 11.05 N S56 Plant Yellow wilt 23.77 0.17 23.14 N Notes: N/A, high Ct > 25, was considered negative. +, identified as V. dahliae presence by the plate culture assay; N, not detected; -, no symptom on plant or no signal detected (rtPCR). aMean cycle threshold (Ct) based on three PCR replicates. bStandard deviation based on three replicates. cMicrosclerotia per gram of soil. detection and quantification of V. dahliae, the cause of samples, using commercial kits in this study, because Verticillium wilt disease, suited for field applications in direct extraction of DNA was more efficient than Estonia. former laborious and time-consuming cultivation- As a pre-analysis step, DNA was directly obtained based procedures in this study. Then, the real-time from different sources, such as mycelia, soil, and plant detection assay was developed to detect and quantify

115 626 S. M. MIRMAJLESSI ET AL.

V. dahliae in strawberry plants (with and without symp- pathogen-specific primer could specifically detect toms of infection) and field soils. However, many V. dahliae among a varying different genes. For assay studies have been reported for the detection and validation, a unique standard curve was then devel- quantification of Verticillium species in plant and soil oped with known concentrations of serially diluted using rtPCR from various hosts and geographical genomic DNA extracted from V. dahliae in which the areas (Li et al. 1994; Mercado-Blanco et al. 2003; minimum detection limit was 0.93 pg µl−1 DNA Larsen et al. 2007; Cubero et al. 2009; Markakis et al. (Figure 2). rtPCR allowed an accurate detection and 2009; Duressa et al. 2012). Finally, we compared the quantification of V. dahliae in strawberry plants that results of the plate assay regarding MS counts in straw- revealed typically different symptoms. Since there berry field soils with rtPCR data. were differences between amounts of V. dahliae with Since there may be a number of soil-borne fungi different symptoms, the assay was strongly capable along with Verticillium present in natural samples of quantifying 11.05 pg µl−1 of pathogen DNA even which will be isolated, a specific primer pair is in symptomless plants (Table 3). This shows that needed for a reliable and accurate assay. This study many strawberry plants in the fields may have latent established a species-specific primer set designed for infection without any symptoms. Result of our study the target sequence for the SYBR Green rtPCR assay. is almost in accordance with Markakis et al. (2009) From our results, the described primer pair (VD-rtPCR- who reported that symptomatology is associated with F/VD-rtPCR-R) was species specific when tested the amount of V. dahliae DNA in plant tissues. Hence, against a range of other Verticillium spp. as well as this assay should be able to identify all stages of other common soil-borne fungi that were collected V. dahliae infection in plant tissue prior to and during from different geographic regions. As shown in Table the appearance of disease symptoms. On the other 1, none of the fungal strains showed positive results hand, similar symptoms such as wilting and stunting with the primer pair used in cPCR. On the basis of Inder- might be due to root damage caused by pests or bitzin et al. (2011) studies, V. longisporum is a hybrid other soil-borne pathogens instead of Verticillium fungus containing a copy of V. dahliae DNA sequences infections (Maurer et al. 2013). Moreover, field diagno- which could limit the use of these primers for species- sis of V. dahliae is made somewhat difficult by the fact specific detection. But, since the pathogenicity of that F. oxysporum causes similar early symptoms on V. longisporum is restricted to cruciferous hosts, strawberry (Koike & Gordon 2015), and so foliar relationship of this species with strawberry plants is disease symptoms are not a reliable indicator of Verti- not anticipated (Steventon et al. 2002; Eynck et al. cillium infection (Pernezny et al. 2003). Overall, 2007; Duressa et al. 2012). Primers VD-rtPCR-F and knowing about the minimum amount of V. dahliae in VD-rtPCR-R indicated the best specific amplification the soil and plant is a very important factor in the for V. dahliae, and gel electrophoresis confirmed the strawberry industry as choosing pathogen-free plants amplification of a 100-bp target (Figure 1). In fact, before planting is fundamentally essential. specific primers developed based on the ITS regions In this study, we observed a relationship between have been deployed as a fruitful strategy regarding the concentration of V. dahliae DNA and the number diagnostic tests for many fungal pathogens (Bates of MS g−1 of soil, ranging from 1 up to 13 MS g−1 of et al. 2001; Heuser & Zimmer 2002; Lees et al. 2002; soil (Table 3). Also, DNA concentrations of V. dahliae Luchi et al. 2005). Nazar et al. (1991) demonstrated were found in most samples analyzed, whereas no the effective use of intergenic sequences for pathogen was detected in some corresponding V. dahliae detection and suggested that these samples using the plate technique, indicating the prob- sequences can be applied for the differentiation of ability of dead propagules. So, comparing these closely related species even when the mature rRNAs methods confirmed that rtPCR is not only more accu- are too homologous. In a similar study, Lievens et al. rate and specific, but also requires less time. Our (2006) used a SYBR Green assay based on ITS regions results explicitly showed that a mean Ct value of I and II to quantitatively assess the presence of a approximately 26 in the samples demonstrates the number of important fungal and oomycete tomato presence of 10.48 pg µl−1 of pathogen DNA and at pathogens including F. solani, R. solani, Verticillium least one (≥1) V. dahliae MS g−1 of soil, which shows species, and Pythium ultimum in biological samples. a high quantification level in comparison with other Spike assay, as the initial assay, was performed using studies. For instance, a detection limit of 6.7 MS g−1 SYBR Green rtPCR in order to evaluate the specificity of of soil for V. dahliae using the SYBR Green rtPCR the assay by considering nonspecific primer dimers at assay was reported by Lievens et al. (2006). More the end of thermocycling. As shown in Table 2, the recently, Bilodeau et al. (2012) demonstrated a

116 ACTA AGRICULTURAE SCANDINAVICA, SECTION B — SOIL & PLANT SCIENCE 627 significant correlation between the development of the References disease and the V. dahliae MS counts by the use of a Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. TaqMan rtPCR assay with an internal control probe Basic local alignment search tool. J Mol Biol. 215:403–410. for each amplification and could quantify the pathogen Andjic V, Cole AL, Klena JD. 2005. Taxonomic identity of the presence as low as 1–2 MS g−1 of soil with a high level sterile red fungus inferred using nuclear rDNA ITS 1 of sensitivity. sequences. Mycol Res. 109:200–204. In conclusion, the rtPCR assay described herein was Atallah ZK, Bae J, Jansky SH, Rouse DI, Stevenson WR. 2007. Multiplex real-time quantitative PCR to detect and quantify able to identify and quantify the presence of V. dahliae Verticillium dahliae colonization in potato lines that differ in in symptomless strawberry plants and soil samples response to Verticillium wilt. Phytopathology. 97:865–872. without culturing. Recently, advances in related tech- Babu BK, Mesapogu S, Sharma A, Somasani SR, Arora DK. 2011. nologies such as next-generation sequencing enable Quantitative real-time PCR assay for rapid detection of plant the simultaneous detection of microbial communities and human pathogenic Macrophomina phaseolina from field and environmental samples. Mycology. 103:466–473. at a much higher resolution and so may improve the Banno S, Saito H, Sakai H, Urushibara T, Ikeda K, Kabe T, interpretation of current estimates. Kemmochi I, Fujimura M. 2011. Quantitative nested real- time PCR detection of Verticillium longisporum and V. dahliae in the soil of cabbage fields. J Gen Plant Acknowledgements Pathol. 77:282–291. The authors specially thank Prof. Peter Harley (National Bates JA, Taylor EJA, Kenyon DM, Thomas JE. 2001. The appli- fi Center for Atmospheric Research, Colorado, USA) for the criti- cation of real-time PCR to the identi cation, detection and fi cal reviewing of this manuscript and giving valuable com- quanti cation of Pyrenophora species in barley seed. Mol ments. We also thank Raquel Castillo and Yolanda Herranz Plant Pathol. 2:49–57. fi (INIA, Madrid, Spain) for their great help regarding rtPCR Bhat RG, Subbarao KV. 1999. Host range speci city in assays. Verticillium dahliae. Phytopathology. 89:1218–1225. Bilodeau GJ, Koike ST, Uribe P, Martin FN. 2012. Development of an assay for rapid detection and quantification of Disclosure statement Verticillium dahliae in soil. Phytopathology. 102:331–343. Bonants P, van Gent-Pelzer MPE, Hooftman R, Cooke D, Guy DC, No potential conflict of interest was reported by the authors. Duncan JM. 2004. A combination of baiting and different PCR formats, including measurement of real-time quantitative fluorescence, for the detection of Phytophthora fragariae Funding in strawberry plants. Eur J Plant Pathol. 110:689–702. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista This work was supported by the European Union through the M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, et al. 2009. The European Regional Development Fund (Contract #10.1-9/14/ MIQE guidelines: minimum information for publication of 471), institutional research funding (IUT36-2) of the Estonian quantitative real-time PCR experiments. Clin Chem. Ministry of Education and Estonian Science Foundation 55:611–622. [grant number #9450]. Butterfield EJ, DeVay JE. 1977. Reassessment of soil assays for Verticillium dahliae. Phytopathology. 67:1073–1078. Notes on contributors Cooke DEL, Schena L, Cacciola SO. 2007. Tools to detect, identify and monitor Phytophthora species in natural eco- Seyed Mahyar Mirmajlessi is a Ph.D. student and researcher systems. J Plant Pathol. 89:13–28. at Estonian University of Life Sciences, Estonia. His research Cubero J, Ayllón MA, Gell I, Melgarejo P, De-Cal A, Martín- field is Molecular Plant Pathology. Sánchez PM, Pérez-Jiménez RM, Soria C, Segundo E, Inmaculada Larena is an assistant professor at National Insti- Larena I. 2009. Detection of strawberry pathogens by – tute for Agricultural and Food Research and Technology, real-time PCR. Acta Hortic. 843:263 266. Madrid, Spain. Her research field is plant pathology and bio- Dan H, Ali-Khan ST, Robb J. 2001. Use of quantitative PCR logical control. diagnostics to identify tolerance and resistance to Verticillium dahliae in potato. Plant Dis. 85:700–705. Marika Mänd is a full professor at Estonian University of Life Debode J, Van Hemelrijck W, Baeyen S, Creemers P, Heungens Sciences, Estonia. She is a professor in Horticulture and Crop K, Maes M. 2009. Quantitative detection and monitoring of Protection. Also, she is the head of the Department of Plant Colletotrichum acutatum in strawberry leaves using real- Protection and chairperson of the board of Estonian Plant time PCR. Plant Pathol. 58:504–514. Protection Society. Debode J, Van Poucke K, França SC, Maes M, Höfte M, Evelin Loit is an assistant professor at Estonian University of Heungens K. 2011. Detection of multiple Verticillium Life Sciences, Estonia. She is a senior researcher in Plant Gen- species in soil using density flotation and real-time poly- etics, and Biotechnology. She is the head of the Department merase chain reaction. Plant Dis. 95:1571–1580. of Plant Production and Grassland Husbandry and a member De Cal A, Martínez Treceno A, López Aranda JM, Melgarejo P. of the scientific council of the Agricultural and Environmental 2004. Chemical alternatives to methyl bromide in Spanish Sciences Institute. strawberry nurseries. Plant Dis. 88:210–214.

117 628 S. M. MIRMAJLESSI ET AL.

Dhingra OD, Sinclair JB. 1985. Basic plant pathology methods. detection and identification of Rhizoctonia solani AG-3 in Boca Raton, FL: CRC Press. p. 44–45. potato and soil. Plant Pathol. 51:293–302. Duressa D, Rauscher G, Koike ST, Mou B, Hayes RJ, Li KN, Rouse DI, Eyestone EJ, German TL. 1999. The generation Maruthachalam K, Subbarao KV, Klosterman SJ. 2012.A of specific DNA primers using random amplified poly- real-time PCR assay for detection and quantification of morphic DNA and its application to Verticillium dahliae. Verticillium dahliae in Spinach seed. Phytopathology. Mycol Res. 103:1361–1368. 102:443–451. Li KN, Rouse DI, German TL. 1994. PCR primers that allow Eynck C, Koopmann B, Grunewaldt-Stoecker G, Karlovsky P, intergeneric differentiation of ascomycetes and their appli- von Tiedemann A. 2007. Differential interactions of cation to Verticillium spp. Appl Environ Microbiol. 60:4324– Verticillium longisporum and Verticillium dahliae with 4331. Brassica napus detected with molecular and histological Lievens B, Brouwer M, Vanachter ACRC, Cammue BPA, techniques. Eur J Plant Pathol. 118:259–274. Thomma BPHJ. 2006. Real-time PCR for detection and Fradin EF, Thomma BP. 2006. Physiology and molecular quantification of fungal and oomycete tomato pathogens aspects of Verticillium wilt diseases caused by V. dahliae in plant and soil samples. Plant Sci. 171:155–165. and V. albo-atrum. Mol Plant Pathol. 7:71–86. Luchi N, Capretti P, Pinzani P, Orlando C, Pazzagi M. 2005. Garrido C, Carbú M, Fernández-Acero FJ, Boonham N, Colyer Real-time PCR detection of Biscogniauxia mediterranea in A, Cantoral JM, Budge G. 2009. Development of protocols symptomless oak tissue. Lett Appl Microbiol. 41:61–68. for detection of Colletotrichum acutatum and monitoring Mahuku G, Platt H. 2002. Quantifying Verticillium dahliae in of strawberry anthracnose using real-time PCR. Plant soils collected from potato fields using a competitive PCR Pathol. 58:43–51. assay. Am J Potato Res. 79:107–117. Gayoso C, de la Ilarduya OM, Pomar F. 2007. Assessment of Markakis E, Tjamos SE, Antoniou PP, Paplomatas EJ, Tjamos E. real-time PCR as a method for determining the presence 2009. Symptom development, pathogen isolation and of Verticillium dahliae in different Solanaceae cultivars. real-time QPCR quantification as factors for evaluating Eur J Plant Pathol. 118:199–209. the resistance of olive cultivars to Verticillium pathotypes. Harris DC, Yang JR. 1996. The relationship between the Eur J Plant Pathol. 124:603–611. amount of Verticillium dahliae in soil and the incidence of Maurer KA, Radišek S, Berg G, Seefelder S. 2013. Real-time PCR strawberry wilt as a basis for disease risk prediction. Plant assay to detect Verticillium albo-atrum and V. dahliae in Pathol. 45:106–114. hops: development and comparison with a standard PCR Harris DC, Yang JR, Ridout MS. 1993. The detection and esti- method. J Plant Dis Protect. 120:105–114. mation of Verticillium dahliae in naturally infested soil. Mercado-Blanco J, Collado-Romero M, Parrilla-Araujo S, Plant Pathol. 42:238–250. Rodríguez-Jurado D, Jiménez-Díaz RM. 2003. Quantitative Heuser T, Zimmer W. 2002. Quantitative analysis of phyto- monitoring of colonization of olive genotypes by pathogenic ascomycota on leaves of pedunculate oaks Verticillium dahliae pathotypes with real-time polymerase (Quercus robur L.) by real-time PCR. FEMS Microbiol Lett. chain reaction. Physiol Mol Plant Pathol. 63:91–105. 209:295–299. Mirmajlessi SM, Destefanis M, Gottsberger RA, Mänd M, Loit E. Hu X, Nazar RN, Robb J. 1993. Quantification of Verticillium 2015a. PCR-based specific techniques used for detecting biomass in wilt disease development. Physiol Mol Plant the most important pathogens on strawberry: a systematic Pathol. 42:23–36. review. Syst Rev. 4:9. doi:10.1186/2046-4053-4-9 Inderbitzin P, Davis RM, Bostock RM, Subbarao KV. 2011. The Mirmajlessi SM, Loit E, Mänd M, Mansouripour SM. 2015b. ascomycete Verticillium longisporum is a hybrid and a plant Real-time PCR applied to study on plant pathogens: poten- pathogen with an expanded host range. PLoS ONE. 6: tial applications in diagnosis – a review. Plant Protect Sci. e18260. doi:10.1371/journal.pone.0018260 51:177–190. Kageyama K, Komatsu T, Suga H. 2003. Refined PCR protocol Nazar RN, Hu X, Schmidt J, Culham D, Robb J. 1991. Potential for detection of plant pathogens in soil. J Gen Plant Pathol. use of PCR-amplified ribosomal intergenic sequences in 69:153–160. the detection and differentiation of Verticillium wilt patho- Kappe R, Fauser C, Okeke CN, Maiwald M. 1996. Universal gens. Plant Pathol. 39:1–11. fungus-specific primer systems and group-specific hybrid- Pérez-Jiménez RM, De-Cal A, Melgarejo P, Cubero J, Soria C, ization oligonucleotides for 18S rDNA. Mycoses. 39:25–30. Zea-Bonilla T, Larena I. 2012. Resistance of several straw- Karajeh MR, Masoud SA. 2006. Molecular detection of berry cultivars against three different pathogens. Span J Verticillium dahliae Kleb in asymptomatic olive trees. J Agric Res. 10:502–512. Phytopathol. 154:496–499. Pernezny K, Roberts PD, Goldberg N. 2003. Verticillium wilt. In: Kernaghan G, Reeleder RD, Hoke SMT. 2007. Quantification of Pernezny K, Roberts PD, Murphy JF, editors. Compendium Cylindrocarpon destructans f. sp. panacis in soils by real- of Pepper diseases. St. Paul (MN): The American time PCR. Plant Pathol. 56:508–516. Phytopathological Society; p. 21–22. Koike ST, Gordon TR. 2015. Management of Fusarium wilt of Perry JW, Evert RF. 1982. Structure of microsclerotia of strawberry. Crop Protect. 73:67–72. Verticillium dahliae in roots of ‘Russett Burbank’ potatoes. Larsen RC, Vandemark GJ, Hughes TJ, Grau CR. 2007. Can J Bot. 62:396–401. Development of a real-time polymerase chain reaction Platt H, Mahuku G. 2000. Detection methods for Verticillium assay for quantifying Verticillium albo-atrum DNA in resist- species in naturally infested and inoculated soils. Am J ant and susceptible alfalfa. Phytopathology. 97:1519–1525. Potato Res. 77:271–274. Lees AK, Cullen DW, Sullivan L, Nicolson MJ. 2002. Development Salazar O, Julian MC, Rubio V. 2000. Primers based on of conventional and quantitative real-time PCR assays for the specific rDNA-ITS sequences for PCR detection of

118 ACTA AGRICULTURAE SCANDINAVICA, SECTION B — SOIL & PLANT SCIENCE 629

Rhizoctonia solani, R. solani AG 2 subgroups and ecological Steventon LA, Fahleson J, Hu Q, Dixelius C. 2002. types, and binucleate Rhizoctonia. Mycol Res. 104:281– Identiﬁcation of the causal agent of Verticillium wilt of 285. winter oilseed rape in Sweden, V. longisporum. Mycol Res. Schena L, Li Destri Nicosia MG, Sanzani SM, Faedda R, Ippolito 106:570–578. A, Cacciola SO. 2013. Development of quantitative PCR Taylor JMG, Paterson LJ, Havis ND. 2010. A quantitative real- detection methods for phytopathogenic fungi and oomy- time PCR assay for the detection of Ramularia collo-cygni cets. J Plant Pathol. 95:7–24. from barley (Hordeum vulgare). Lett Appl Microbiol. Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, 50:493–499. Levesque CA, Chen W, Fungal Barcoding Consortium. Wang Y, Wang Y, Tian Ch. 2013. Quantitative detection of 2012. Nuclear ribosomal internal transcribed spacer (ITS) pathogen DNA of Verticillium wilt on smoke tree Cotinus region as a universal DNA barcode marker for fungi. Proc coggygria. Plant Dis. 97:1645–1651. Natl Acad Sci USA. 109:6241–6246. White TJ, Bruns T, Lee S, Taylor J. 1990. Ampliﬁcation and Selim AS, Boonkumllao P, Sone T, Assavanig A, Wada M, direct sequencing of fungal ribosomal RNA genes for phy- Yokota A. 2005. Development and assessment of a real- logenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, time PCR assay for Lactobacillus thermotolerans, in editors. PCR protocols: a guide to methods and appli- chicken faces. Appl Environ Microbiol. 71:4214–4219. cations. New York: Academic Press; p. 315–322.

119

122 Survey of soil fungal communities in strawberry fields by Illumina amplicon sequencing

Seyed Mahyar Mirmajlessia,d*, Mohammad Bahramb,c, Marika Mändd, Seyedmojtaba Mansouripoure, Evelin Loita aDepartment of Field Crops and Grassland Husbandry, Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences, Kreutzwaldi 5, 51014 Tartu, Estonia; bDepartment of Organismal Biology, Evolutionary Biology Centre, Uppsala University, Norbyvägen 18D, 75236 Uppsala, Sweden; cDepartment of Botany, Institute of Ecology and Earth Sciences, University of Tartu, 40 Lai St., 51005 Tartu, Estonia; dDepartment of Plant Protection, Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences, Kreutzwaldi 5, 51014 Tartu, Estonia eDepartment of Plant Pathology, North Dakota State University, Fargo, ND, USA *Corresponding E-mail address: [email protected] Contact number: +372 58184147

Abstract Soil fungal pathogens are the most common cause of diseases in commercial strawberry crops worldwide. Since simultaneous infections by combinations of pathogens can severely damage the crop, knowing about structure of fungal communities can be helpful to mitigate crop loss. Herein, we used Illumina metabarcoding to assess the fungal communities in five strawberry production areas in Es- tonia. Our analysis revealed 990 to 1430 operational taxonomic units (OTUs) per soil sample (pools of eight soil samples per production area). Based on taxonomic analyses, Ascomycota (55.5%) and Basidiomycota (25.0%) were the most OTUs-rich. Amongst the 24 most abundant OTUs, Geomy- ces, Rhodotorula, Verticillium and Microdochium were the most abundant genera. The most abundant OTUs were also clustered into three distinct groups, which reflected different functional guilds of fungi. In addition, Fusarium solani, V. dahliae, Rhizoctonia solani and Colletotrichum truncatum were enormously abundant in the fields with disease symptoms, whereas arbuscular mycorrhizal fungi especially Rhizophagus irregularis were considerably more abundant in the fields with healthy plants. These findings provide support that mycorrhizal fungi may play an important role in suppressing pathogens. Our study for the first time shows the usefulness of Illumina technology in surveying the communities of soil fungi in strawberry fields effectively, which may improve available disease management strategies against strawberry diseases.

Keywords Fungal communities; Illumina technology; soil borne pathogens; strawberry

Introduction their root exudations, understanding of such Strawberry (Fragaria × ananassa) is one of the communities is important to the prosperous most popular fruits worldwide and different application of disease management strategies. cultivars have been developed for commercial Most studies to date have focused on strawber- purposes. Crop yield is frequently reduced by a ry pathogens in strawberry cultivation (De-Cala wide variety of fungal diseases that directly affect et al. 2005; Costa et al. 2006; Li et al. 2012; strawberry fruit and lead to severe economic Nallanchakravarthula et al. 2014), whereas few losses. Also, numerous soil-borne pathogens can studies have considered about the co-existence colonize strawberry plants and indirectly affect patterns of fungi within communities. fruit quality (Reganold et al. 2010; Mirmajlessi Soil fungal communities are conventional- et al. 2015). Fungi as a diverse component of ly analyzed by culture-based methods that have soil microbial communities form both mutualis- clearly demonstrated plant-dependent diversity tic and pathogenic relation with plants (De-Cala of communities (Costa et al. 2006). However, et al. 2005). Since the structure of soil com- these approaches have several limitations as they munities is influenced by the plant species and only allow isolating fungal hyphae or spores

123 from soil and thus only a small fraction of soil most abundant fungal marker in public databas- fungi are recovered. Additionally, these are se- es (Schoch et al. 2012). verely biased due to the presence of fast-grow- In the current study, we aimed to charac- ing species, and the fact that many fungi are terize the structure of soil fungal communities unculturable and/or need specific growth re- associated with Estonian strawberry fields using quirements (O’Brien et al. 2005); they therefore Illumina-based sequencing. For this, we includ- provide relatively little information about the ed soils from plots containing diseased plants as fungal community structures in soil. Direct se- well as plots containing healthy plants. We hy- quencing of DNA from environmental samples pothesized that this method would significantly is an alternative technique that overcomes these reveal biodiversity and co-existence patterns of limitations (Daniell et al. 2001; Buchan et al. fungal species in different strawberry fields with 2002; Vandenkoornhuyse et al. 2002; Schadt et and without disease symptoms depending on al. 2003). However, it does not present viability their lifestyle in the soil. To our knowledge, this of soil fungi. Many earlier studies in plant pa- is the first study using HTS to effectively explore thology have focused on using techniques such fungal communities in strawberry fields. as terminal restriction fragment length polymorphism (T-RFLP) (Yu et al. 2009), automated Materials and methods ribosomal intergenic spacer analysis (ARISA) Sampling and DNA extraction (Kovacs et al. 2010), denaturing gradient gel Soil samples were collected during June and electrophoresis (DGGE) (Li et al. 2012) and July 2015 from five strawberry plantation areas Sanger sequencing (King et al. 2015) which have in Estonia: Vasula (58°47’ N, 26°73’ E), Rohu now been shown to underestimate diversity lev- (59°09’ N, 26°48’ E), Utsu (58°40’ N, 26°80’ el of target genes. These techniques are also re- E), Unipiha (58°26’ N, 26°58’ E) and Marjamaa stricted due to the lack of information about the (58°90’ N, 24°42’ E). The soil type was mainly taxonomic affiliation of the phylotypes and their sandy loam, with pH ranging from 6.2 to 6.5. ability to measure richness of species in complex The same strawberry cultivar (cv. ‘Sonata’) was communities (O’Brien et al. 2005). sown across all sampling fields. Plants in fields of The advent of High-Throughput Sequenc- two areas (Vasula and Marjamaa) showed visible ing (HTS) of environmental samples has revolu- wilt symptoms while plants in other areas exhib- tionized the studies of fungal diversity and ecol- ited no significant wilt symptoms on preliminary ogy. Although both 454 Pyrosequencing and inspection. Eight random sub-samples were col- Illumina Miseq, as HTS platforms, are applied lected from different points in each of the five to describe the structure of soil fungal commu- fields. Sampling was performed at 20 cm depth, nities (Hirsch et al. 2010), 454 pyrosequencing where most fungal activity occurs (O’Brien et al. has been applied primarily for sequencing of 2005). The 40 soil samples were transported to soil fungi (Öpik et al. 2009; Buée et al. 2009; the laboratory in an icebox where they were sifted Jumpponen et al. 2010; Dumbrell et al. 2011; using a 20-mesh sieve to eliminate large and un- Xu et al. 2012). Illumina Miseq platform has breakable debris. Afterwards, the eight sub-sam- been more often used since fragments in the size ples from each area were homogenized, and total range of ITS1 or ITS2 can be easily sequenced soil genomic DNA was extracted from 4 g of (Schmidt et al. 2013). Moreover, the Illumina mixed soil using a direct bead-beating extraction platform provides similar sequencing quality, method with PowerSoil® DNA Isolation Kit (Mo approximately 10-fold increase in read depth Bio Labs, USA) according to the manufacturer’s along with much lower price compared to 454 instructions. The extracted soil DNA quality was (Gołebiewski et al. 2014). Despite the technical determined by agarose gel electrophoresis and its feasibility of HTS, selection of marker and PCR quantity was measured with a NanoDrop 2000 primers to diversity exploration is still challeng- Spectrophotometer (Thermo Scientific) at 260 ing. However, the ITS rDNA region, accessible nm. The extracted DNA was adjusted to a final with universal primers, can appropriately distin- concentration of 20 ng μL-1 with TE buffer and guish between most fungal species and is also the stored at -70°C until further use.

124 PCR amplification and Illumina Sequencing plicon concentration was estimated by analysis To characterize the composition of the fungal on a Nanodrop ND 1000 spectrophotometer communities in each of the collected samples, (Thermo Scientific, Wilmington, DE, USA) we used a barcoded HTS sequencing technique. and an equimolar mixture of all five amplicon The ITS1 region of the fungal rRNA gene was libraries was independently sequenced using an amplified using the ITS1-F (Gardes & Bruns Illumina MiSeq sequencer at the Genome Cen- 1993) and ITS2 (White et al. 1990) primer pair ter of the University of Tartu, Estonia. containing the appropriate Illumina adapters for both the forward and reverse primers, 2 basepair Bioinformatics and statistical analyses “linker” sequences and a 12-bp error-correct- We used the Fastqc (http://www.bioinformatics. ing Golay barcode at 3’ end of reverse adapter babraham.ac.uk/projects/fastqc/, v0.11.2) for unique to each sample (Table 1). The PCR re- quality filtering, demultiplexing and sequence actions contained of 2.5 μl 10X reaction buffer processing of reads from each library originated (Roche), 17.1 μl of sterile RNase-free water, 2.5 from the five different soil samples. To assemble μl of dNTP solution (2.0 μM, Eurogentec, Ger- paired-end reads, we used PandaSeq (Masella many), 0.4 μl of Taq DNA polymerase (Ther- et al. 2012). Sequences from the five soils were mo Scientific, ABgene®, UK), 0.5 μl each of the clustered into operational taxonomic units forward and reverse primers (10 μM final con- (OTUs) at 97% sequence similarity using the centration) and 2 μl of DNA template in a final USEARCH algorithm (Edgar 2010). To identify volume of 25 μl. The DNA was amplified using OTUs, a representative sequence from the most a GeneAmp PCR System 9700 thermocycler common sequence in each OTU was compared (Perkin Elmer, Applied Biosystems, Norwalk, to GenBank database (http://www.ncbi.nlm. CT, USA) using the following program: a dena- nih.gov/genbank/) by NCBI-BLASTn (Altschul turation step for 3 min at 94°C followed by 35 et al. 1997). Based on results of the BLAST amplification cycles consisting of 35 s at 94°C, 1 search, nonfungal sequences were removed from min at 55°C and 90 s at 71°C. A final extension the downstream analyses. In addition, chimeric step was added for 9 min at 75°C. DNA quality OTUs were detected and removed based on de was determined by gel electrophoresis on 1.5% novo chimera checking using UCHIME (Edgar agarose gel and DNA quantity was measured by et al. 2011). Taxonomy assignment was conduct- NanoDrop 2000 Spectrophotometer (Thermo ed using the ITS database (Kõljalg et al. 2013) Scientific, Wilmington, DE, USA) at 260 nm. in MEGAN (Metagenome Analysis) with a con- The PCR products were then purified using the fidence level of 0.5. All raw sequence data have MinElute Gel Extraction Kit (Qiagen GmbH, been submitted to the NCBI short-read archive Hilden, Germany) and pooled to acquire five (SRA) under accession number SRP091855. amplicon libraries corresponding to the five To evaluate diversity of each site, we rarified different strawberry plantation areas. The am- the OTU table and calculated rarefaction curves

Table 1 Structure of primer-pairs used in this study for the amplification and sequencing of ITS1 Description Sequence (5´–3´) Forward Illumina adaptera TCGTCGGCAGCGTC/AGATGTGTATAAGAGACAG Forward primer linker GG ITS1-Fb CTTGGTCATTTAGAGGAAGTAA Reverse complement of 3’ Illumina adapter GTCTCGTGGGCTCGGCATACGGAT Golay barcodec TCCCTTGTCTCC Reverse primer linker CG ITS2d GCTGCGTTCTTCATCGATGC a Illumina adapter overhang sequences are attached to the 5´end of each primer sequence. b Forward primer c Golay barcodes described by Caporaso et al. (2012). d Reverse primer

125 and richness indexes (ACE and Chao1) using R approached a plateau (Fig. 1). Consequently, the statistical program (http://www.R-project.org, number of OTUs recovered from soils in each v2.15.2) with the packages vegan (Oksanen et field ranged from a minimum of 990 (contain- al. 2013) and phyloseq (McMurdie & Holmes ing 303 non-singletons) at Rohu to a maximum 2013). Additionally, based on relative abun- of 1430 (containing 536 non-singletons) at Va- dances of OTUs, microbial community barplots sula (Fig. 1). Moreover, the number of OTUs and hierarchical dendrogram combined with predicted with the nonparametric Chao1 (Chao heatmap (using the Bray-Curtis metric) were et al. 2005) and ACE indexes ranged from 1,820 constructed in R to visually identify patterns of to 3,400 depending on soil sample. community structure across the soil samples. Identification of fungi Results The taxonomic assignment of each OTU was In this study, 40 samples collected from soil of accomplished against the NCBI database using five strawberry production areas were analyzed. BLAST searches and the most abundant fungal The sequencing runs resulted in ~7 million taxa in the soils of Estonian strawberry fields paired end reads. We lost a considerable num- were identified. The 24 most frequent OTUs ber of reads (~5 million) by demultiplexing and comprised 65.7% of the total reads (Table 2). paired end assembly of the raw sequences during The dominant taxa includedGeomyces pan- the filtering process. Unexpected amalgama- norum, Uncultured Rhodotorula, Verticillium tions of forward and reverse primer tags caused dahliae, Microdochium bolleyi and Phialophora large losses of reads. At 97% sequence similarity, sp. (45.1% of all reads). Geomyces pannorum was 1,865,246 sequences were obtained after qual- the most abundant OTU in the entire dataset ity control, leaving the number of sequences (18.4% of all sequences), followed by Rhodoto- from each soil (eight soil sub-samples per pro- rula (OTU2, 7.3%), V. dahliae (OTU3, 6.9%), duction area) to range from 18,114 to 26,967. M. bolleyi (OTU4, 6.5%) and Phialophora sp. From these, we identified 990 to 1,430 OTUs (OTU5, 6%). These taxa come from two phyla per soil. All non-singletons were used to BLAST (Ascomycota and Basidiomycota) and five orders against the non-redundant GenBank database. (Helotiales, Sporidiales, Hypocreales, Xylariales In total, 749,586 sequences were recognized as and Chaetothyriales). Predictably, V. dahliae, the being of fungal origin, excluding 1,029,973 bac- cause of strawberry wilt disease was among the terial, plant and animal sequences. In addition, most abundant OTUs (Table 2). 85,687 sequences remained unidentified with Combining OTUs at the phylum level, As- no matches. Based on rarefaction curves, the comycota was the predominant fungal phylum number of OTUs increased with the number of in the study region (~55.5%), followed by Ba- sequences in each soil and none of the curves sidiomycota (~25%), Zygomycota (~6.5%) and

Fig. 1 Rarefaction curves of fungal communities in soil samples from five strawberry plantation sites at 97% sequence similarity, representing the effect of internal transcribed spacer (ITS) sequence number on the number of operational taxonomic units (OTUs). According to sampling area, between 18,114 and 26,967 sequences were generated, corresponding to 990–1,430 OTUs. Letter at the end of each curve shows the sampling area: M: Marjamaa; R: Rohu; U: Utsu; Un: Unipiha; V: Vasula.

126 Table 2 The 24 most abundant phylotypes identified in strawberry field soils from five regions of Estonia. OTU Blast ID Closest Similarity Number Phylum Sexual / asexual Disease on accession / Coverage of reads strawberry number (%) (NCBI) 1 Geomyces pannorum DQ189226.1 98/99 28618 Ascomycota Pseudogymnoascus / Non-pathogenic Geomyces 2 Uncultured HG936520.1 97/98 11363 Basidiomycota Unknown / Non-pathogenic Rhodotorula Rhodotorula 3 Verticillium dahliae GU461618.1 98/100 10835 Ascomycota Unknown / Wilt Verticillium 4 Microdochium AM502264.1 98/100 10169 Ascomycota Microdochium / Non pathogenic bolleyi Monographella 5 Phialophora sp. LC133864.1 97/98 9319 Ascomycota Mollisia, Pyrenopeziza, Non-pathogenic Coniochaeta/ Phialophora 6 Cryptococcus aerius AF145324.1 96/98 5024 Basidiomycota Filobasidiella/ Non-pathogenic Cryptococcus 7 Fusarium solani JN411814.1 98/100 4357 Ascomycota Nectria/ Fusarium Crown and root rot 8 Ceratobasidium sp. JF273484.1 98/100 4162 Basidiomycota Ceratobasidium / Non-pathogenic Rhizoctonia 9 Rhizophagus FR750117.1 99/100 4158 Glomeromycota Unknown / Non-pathogenic irregularis Rhizophagus 10 Torulaspora sp. D89599.1 95/100 2869 Ascomycota Torulaspora / Candida Non-pathogenic 11 Paecilomyces sp. JQ821350.1 95/98 2421 Ascomycota Byssochlamys / Non-pathogenic Paecilomyces 12 R. solani FJ492068.3 98/100 1245 Basidiomycota Thanatephorus / Black root rot Rhizoctonia 13 Penicillium sp. KM249070.1 97/100 1109 Ascomycota Eupenicillium, Fruit rots Talaromyces / Penicillium 14 Sistotrema coronilla AF506475.1 96/100 1021 Basidiomycota Sistotrema / Burgoa Non-pathogenic 15 Cryptococcus sp. AF444361.1 99/100 939 Basidiomycota Filobasidiella / Non-pathogenic Cryptococcus 16 Phoma sp. KT948362.1 98/100 927 Ascomycota Didymella, Root rot, leaf and Leptosphaeria, stalk rot Pleospora, Mycosphaerella/ Phoma 17 Uncultured HG935917.1 98/100 893 Ascomycota Pseudeurotium / Non-pathogenic Pseudeurotium Teberdinia 18 Uncultured KU141183.1 98/100 881 Zygomycota Unknown / Non-pathogenic Mortierella Mortierella 19 F. merismoides EU860057.1 97/100 832 Ascomycota Unknown / Fusarium Non-pathogenic 20 Leptosphaeria sp. DQ093683.1 98/98 796 Ascomycota Leptosphaeria / Phoma Non-pathogenic 21 Waitea circinata DQ356414.1 98/98 484 Basidiomycota Waitea / Rhizoctonia Non-pathogenic 22 Pestalotiopsis sp. KT963803.1 98/100 466 Ascomycota Pestalosphaeria / Root and crown Pestalotiopsis rot 23 Colletotrichum KX197400.1 98/100 455 Ascomycota Glomerella / Anthracnose truncatum Colletotrichum 24 F. tricinctum KT779291.1 100/100 423 Ascomycota Gibberella / Fusarium Non-pathogenic

127 Fig. 2 Distribution of Illumina MiSeq reads and 97% operational taxonomic units (OTUs) across various taxonomic phyla obtained from five strawberry fields in Estonia. From a total of 1,865,246 sequences (out of 6,986,577 million reads), 749,586 were assigned to Fungi. Taxonomic assignment was performed in MEGAN (Metagen- ome Analysis) with the lowest common ancestor (LCA) values (min. support: 1, min. score: 55, top percent: 5).

Glomeromycota (~2.5%) (Fig. 2). Unclassified and 21 (W. circinata) cause diseases on different Dikarya and other taxonomic lineages such as hosts, none are pathogenic on strawberry plants. Blastocladiomycota and Chytridiomycota were Based on comparative analysis of the fungal assigned to the unclassified fungi category amplicon libraries, there were clear differences in (~10.5%). the distribution of fungal phyla between the five study regions (Fig. 4). For instance, members of OTU co-occurrence patterns Ascomycota were most abundant in soil samples Cluster analysis of fungal abundances among of the Vasula area (60.6%), while they were rel- different soil samples showed that the 24 most atively rare in Rohu (11.9%). In contrast, mem- abundant OTUs clustered into three main bers of the phylum Glomeromycota comprised groups, characterized according to occurrence the largest percentage of taxa sampled at Rohu similarity: OTUs 1, 2, 6, 14, 17 and 18 as Group (33.8%), but were very rare at Vasula (1.0%) I; OTUs 4, 5, 9, 10, 13, 15, 16, 19, 20, 22 and and Marjamaa (2.8%). Since members of the 24 as Group II and OTUs 3, 7, 8, 11, 12, 21 and phylum Glomeromycota are predominantly 23 as Group III (Fig. 3). The OTUs in Groups arbuscular mycorrhizal fungi (AMF), they are II and III exhibited greater variety than Group I, assumed to be efficient against fungal patho- whose members were much more similar. Group gens of strawberry. Basidiomycota comprised II, consisted of 11 OTUs, could be subdivided between 12.1% and 22.9% of samples across into three Subgroups. Subgroup IIa contained sampling regions while members of Zygomycota two OTUs (13 and 24); Subgroup IIb contained comprised a relatively small fraction (4.2% to three OTUs (9, 10 and 15); and Subgroup IIc 14.2%) in all sampled areas. contained six OTUs (4, 5, 16, 19, 20 and 21). Also, as shown in Figure 5, the fungal com- Group III consisted of seven OTUs comprising munities in soils with wilted plants (samples two Subgroups. Subgroup IIIa contained four from Vasula and Marjamaa) and in soils without OTUs (8, 11, 12 and 23) and Subgroup IIb plants exhibiting wilt symptoms (samples from contained three OTUs (3, 7 and 22). As shown Rohu, Utsu and Unipiha) were different in com- in Fig. 3, OTUs belonging to Groups I and II position. Among yeasts and saprotrophic fungi, are a mixture of saprophytic and pathogenic the genera Rhodotorula, Cryptococcus, Torulaspo- fungi while OTUs in Group III, e.g. OTUs 3 ra and Mortierella were predominant across all (V. dahliae), 7 (F. solani), 8 (Ceratobasidium sp.), areas. However, G. pannorum (with 28.6%), a 11 (Paecilomyces sp.), 12 (R. solani), 22 (Pestalo- ubiquitous saprophytic fungus, was the most tiopsis sp.) and 23 (C. truncatum) are pathogenic abundant Ascomycota found in all sampled are- on strawberry. Although some OTUs in Group as. The strawberry pathogen V. dahlia, the cause II, such as OTUs 4 (M. bolleyi), 5 (Phialophora of Verticillium wilt, was also dominant in all soil sp.), 19 (F. merismoides), 20 (Leptosphaeria sp.) samples (more than 10,000 reads) particularly in

128 Fig. 3 Hierarchical dendrogram of OTU1 to OTU 24 across the five soil libraries. OTUs are identifified by combined with a heatmap constructed by the neigh- names placed at the terminal branches of the dendro- bor-joining method (based on Bray–Curtis dissimilarity gram. The green vertical line shows the cut point that among OTUs), showing fungal abundances of the 24 divides the OTUs into three groups (I, II and III). The most abundant operational taxonomic units (OTUs) x-axis represents the clustering distance rescaled.

Fig. 4 Relative abundance of fungal ITS1 sequences belonging to each fungal phylum in each soil library. Fun- gal phyla were classified based on the BLAST search results. Bar size shows the percentage of fungal operational taxonomic units (OTUs) in each phylum for soils in each of the five the investigated regions (X axis).

Fig. 5 The relative abundance of the top 24 genera of fungal ITS sequences classified from the five soil libraries. Bar size shows relative composition of fungal communities based on sequence counts for soils in each of the five the investigated regions (X axis).

129 soil samples collected from Vasula and Marjamaa was mainly due to the presence of rare OTUs where wilted plants were observed. In addition, (singletons). In our study, approximately, 66% F. solani, the cause of strawberry black root rot, of the DNA reads corresponded to only 24 fun- was abundant in most areas (except in Unipiha), gal taxa whereas the five most abundant OTUs whereas C. truncatum, the cause of Anthracnose, (from all five soils) comprised almost 45% of to- was found in soils collected from Utsu and Vasu- tal reads indicating that certain species dominate la. Overall, the relative abundance of other plant other fungal communities in soils. Also, Xu et al. pathogens considered as causal agents of disease (2012) identified 40 OTUs representing 80.6% on strawberry was low. of the all sequences across nine pea fields, while 124 OTUs representing 2.6% of the all sequenc- Discussion es were found only in one field. They demon- This study provides a comprehensive view to strated that the majority of fungal biomass de- date of fungal communities in strawberry fields. rived from a few OTUs which were common We found a high diversity of fungi in term of in most examined soils. The stability of fungal taxa. According to their co-occurrence pattern, species within the mycobiome, dispersal abilities the most abundant OTUs found in the soil of of propagules and native plant species may result strawberry fields in five distinct regions could in the low richness of diverse taxa (Willger et al. be classified into three separate groups. These 2014; Reininger et al. 2015). included 1) environmentally omnipresent sap- In terms of taxonomic abundance, Ascomy- robes which reside on plant debris, soil, decaying cota was the most abundant phylum in the soils leaves and other organic compounds; 2) arbus- (55.5% of the OTUs), followed by Basidiomy- cular mycorrhizal fungi (AMF), yeasts/saprobes cota (25.0%). Both phyla dominate the commu- and plant pathogens which are generally more nities of soil fungi in most terrestrial ecosystems pathogenic on other plants than on strawber- worldwide. In a similar study carried out by ry, indicating considerable diversity among all Schmidt et al. (2013), paired-end Illumina MiS- groups; and 3) strawberry plant pathogens V. eq data could recover many fungal lineages across dahlia, F. solani, Ceratobasidium sp., R. solani, soil samples. Accordingly, the largest percentage Pestalotiopsis sp., Paecilomyces sp. and C. trun- of OTUs was related to Ascomycota (78.1%) catum. Interestingly, AMF were least abundant followed by Basidiomycota (10.2%) from all in areas with more diseased plants (based on soil samples. Although we found low levels of read abundance of pathogenic fungi and visual Glomeromycota (2.6%) in our study, much inspection of plants), whereas they were present higher levels of this phylum (20%) were observed in much higher abundance in the soils where by McGuire et al. (2013) in soil from green roofs healthy plants were present. These data may re- planted with native plant communities. General- flect similar environmental requirements and/or ly, this provides more support for this hypothesis growth life styles of the organisms (Nicolaisen that a higher percentage of AMF leads to reduced et al. 2004) and also may represent biotic in- colonization by pathogenic fungi teraction or different resource requirements of In our study, a high number of sequence mycorrhizal, saprotrophic and pathogenic fungi. (10,835 reads) matched V. dahliae, the caus- The observed number of OTUs (from reads al agent of Verticillium wilt - an economically at 97% sequence similarity cut-off) was high important disease worldwide in various plant (more than 970 OTUs per soil) in samples from species (Klosterman et al. 2009). This species five strawberry plantation areas (Fig. 1). Howev- appears to be the predominant pathogen in er, the mean number of OTUs predicted using most strawberry soils. In our previous study the nonparametric Chao1 index at 97% simi- (Mirmajlessi et al. 2016), V. dahliae population larity was 2,604 OTUs (including singletons), was specifically quantified in the strawberry which was similar to results of Buée et al. (2009), plants and soils of the same areas using quan- who showed a mean estimated OTU richness titative real-time PCR and traditional soil plat- close to 2,240 in forest soils using ITS1F/ITS2 ing techniques. The lowest amount of V. dahli- primer set. However, this large number of OTUs ae detected in soils was 10.48 pg μl−1 of target

130 DNA corresponding to one microsclerotia per cies level, of fungal OTUs present in strawberry gram of soil. This pathogen can survive in soil fields can be implemented reliably from DNA without its proper host plant by producing black extracted from soil samples using Illumina tech- microsclerotia that persist in the soil for years nology. A variety of primer pairs, based on ITS (Klosterman et al. 2009). Along with V. dahli- regions of fungi, have been used for assessing ae, F. solani (cause of strawberry crown and root fungal diversity from soil (Anderson & Cairney rot) and R. solani (cause of black root rot) which 2004). We used the relatively unspecific prim- are extensively pathogenic on strawberry, some er set ITS1-F and ITS2 in order to amplify the opportunistic fungi such as Ceratobasidium sp., ITS1 region of fungal ribosomal RNA (rRNA) Paecilomyces sp., Pestalotiopsis sp. and Phoma sp., operon. Though primer pair ITS1-F/ITS4 has were also found among the most abundant fun- been applied in many studies to specifically am- gal taxa in almost all soil samples. These path- plify fungi from mixed templates (Mello et al. ogens have been also found in previous studies 2011; De Beeck et al. 2014; Nicolaisen et al. related to soil fungal communities due to the 2014), the efficiency of ITS1-F/ITS2 primer worldwide distributions of these fungi (Menkis per using paired-end sequencing is considera- et al. 2014; Miao et al. 2016). In contrast, F. bly greater. In this study, a total of 749,586 se- oxysporum, V. albo-atrum and Sclerotinia sclero- quences from 40 soil samples were characterized tiorum, as other pathogens of strawberry, were as fungi by sequencing. The maximum and min- rare in our samples. imum numbers of non-singletons OTUs recog- In general, pathogenic fungi are abundant nized from investigated areas were 536 OTUs in soils but are often suppressed by high fungal (in Vasula) and 303 OTUs (in Rohu), respec- biodiversity (Brussaard et al. 2007; Lim et al. tively, which are remarkably higher than results 2010). In our study, AMF species Rhizophagus based on conventional culturing methods. irregularis (previously known as Glomus intr- This study demonstrates the diversity of aradices) and G. hoi were highly abundant in the fungi and significant co-occurrence patterns in soils of Rohu, Utsu and Unipiha where plants soils of the five strawberry plantation areas. Our apparently showed no wilt symptoms. The role data suggest that the health of plants could be re- of AM symbioses in decreasing damages (root lated to the composition of fungal communities. rot or wilting) caused by soil-borne pathogens is Particularly, AMF were more abundant in areas broadly known. It has recently been shown that with healthy plants than diseased plants, which mycorrhizal fungi suppress the development of confirms their suppressive role against path- Verticillium wilt in strawberry plants (Sowik et ogenic colonization. Overall, discovering the al. 2016). Many studies discovered beneficial soil microbial communities in strawberry fields effects of AMF in reducing the disease severity may provide useful information for managing of pathogens such as Fusarium (Matsubara et al. soil-borne plant pathogenic fungi and choosing 2002; Filion et al. 2003), Rhizoctonia (Morandi new strawberry cultivars in the fields by consid- et al. 2002), Sclerotium (Torres-Barragán et al. ering the whole fungal taxa when designing dis- 1996), Verticillium (Karagianndis et al. 2002) ease control strategies. Further analyses of other and others (Whipps 2004; Jung et al. 2012). strawberry production sites may help to realize Clearly, the OTU richness and diversity between the biological characteristics of soils and specific the five different strawberry soils reveals uneven functions of taxa in development of pathogens. distribution of different amount of OTUs within areas. Though there was also a high diversi- Conflict of Interest ty of less abundant OTUs in the all soils, these The authors declare no conflict of interest. could serve as a reservoir for subsequent diseases under agro-ecological conditions. Acknowledgments Our study also demonstrates the effective- This work was funded by EUPHRESCO (Eu- ness of the HTS method in recovering patho- ropean Phytosanitary Research Coordination) gentic fungi colonizing the roots of strawberries. Phytosanitary ERA-Net project SPAT (Straw- Specifically, the identification, at the genus/spe- berry Pathogens Assessment and Testing), Eu-

131 ropean Union through the European Regional De Cal, A., Martinez-Treceno, A., Salto, T., Development Fund (Contract #10.1-9/14/471) López-Aranda, J. M., & Melgarejo, P. (2005). Effect and institutional research funding (IUT36-2) of of chemical fumigation on soil fungal communities the Estonian Ministry of Education and Estoni- in Spanish strawberry nurseries. Applied Soil Ecology, 28(1), 47-56. an Science Foundation (Grant #9450). We are Dumbrell, A. J., Ashton, P. D., Aziz, N., Feng, G., Nel- grateful to Prof. Peter Harley for proof reading son, M., Dytham, C., ... & Helgason, T. (2011). Dis- of the manuscript and giving valuable com- tinct seasonal assemblages of arbuscular mycorrhizal ments. Also, we thank farmers for assistance and fungi revealed by massively parallel pyrosequencing. providing access to the study sites. New Phytologist, 190(3), 794-804. Edgar, R. C. (2010). Search and clustering orders References of magnitude faster than BLAST. Bioinformatics, Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang 26(19), 2460-2461. Z, Miller W, Lipman DJ, Gapped BLAST and PSI- Edgar, R. C., Haas, B. J., Clemente, J. C., Quince, C., BLAST: a new generation of protein database search & Knight, R. (2011). UCHIME improves sensitiv- programs. Nucleic acids res. 25, 3389-402 (1997). ity and speed of chimera detection. Bioinformatics, Anderson, I. C., & Cairney, J. W. (2004). Diversity and 27(16), 2194-2200. ecology of soil fungal communities: increased under- Filion, M., St-Arnaud, M., & Jabaji-Hare, S. H. (2003). standing through the application of molecular tech- Quantification of Fusarium solani f. sp. phaseoli in niques. Environmental Microbiology, 6(8), 769-779. mycorrhizal bean plants and surrounding mycor- Bazzicalupo, A. L., Bálint, M., & Schmitt, I. (2013). rhizosphere soil using real-time polymerase chain Comparison of ITS1 and ITS2 rDNA in 454 se- reaction and direct isolations on selective media. quencing of hyperdiverse fungal communities. Fun- Phytopathology, 93(2), 229-235. gal Ecology, 6(1), 102-109. Gardes, M., & Bruns, T. D. (1993). ITS primers with Brussaard, L., De Ruiter, P. C., & Brown, G. G. (2007). enhanced specificity for basidiomycetes‐application Soil biodiversity for agricultural sustainability. Agri- to the identification of mycorrhizae and rusts. Mo- culture, ecosystems & environment, 121(3), 233-244. lecular ecology, 2(2), 113-118. Buchan, A., Newell, S. Y., Moreta, J. L., & Moran, Gołębiewski, M., Deja-Sikora, E., Cichosz, M., Tretyn, M. A. (2002). Analysis of internal transcribed spacer A., & Wróbel, B. (2014). 16S rDNA pyrosequenc- (ITS) regions of rRNA genes in fungal communities ing analysis of bacterial community in heavy metals in a southeastern US salt marsh. Microbial Ecology, polluted soils. Microbial ecology, 67(3), 635-647. . 43(3), 329-340. Hirsch, P. R., Mauchline, T. H., & Clark, I. M. (2010). Buee, M., Reich, M., Murat, C., Morin, E., Nilsson, Culture-independent molecular techniques for soil R. H., Uroz, S., & Martin, F. (2009). 454 Pyrose- microbial ecology. Soil Biology and Biochemistry, quencing analyses of forest soils reveal an unexpect- 42(6), 878-887. edly high fungal diversity. New Phytologist, 184(2), Jumpponen, A. R. I., Jones, K. L., David Mattox, J., & 449-456. Yaege, C. (2010). Massively parallel 454‐sequencing Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Ly- of fungal communities in Quercus spp. ectomycor- ons, D., Huntley, J., Fierer, N., ... & Gormley, N. rhizas indicates seasonal dynamics in urban and rural (2012). Ultra-high-throughput microbial communi- sites. Molecular Ecology, 19(s1), 41-53. ty analysis on the Illumina HiSeq and MiSeq plat- Jung, S. C., Martinez-Medina, A., Lopez-Raez, J. A., & forms. The ISME journal, 6(8), 1621-1624. Pozo, M. J. (2012). Mycorrhiza-induced resistance Chao, A., Chazdon, R. L., Colwell, R. K., & Shen, T. and priming of plant defenses. Journal of chemical J. (2005). A new statistical approach for assessing ecology, 38(6), 651-664. similarity of species composition with incidence and Karagiannidis, N., Bletsos, F., & Stavropoulos, N. abundance data. Ecology letters, 8(2), 148-159. (2002). Effect of Verticillium wilt Verticillium( dahl- Costa, R., Götz, M., Mrotzek, N., Lottmann, J., Berg, iae Kleb.) and mycorrhiza (Glomus mosseae) on root G., & Smalla, K. (2006). Effects of site and plant spe- colonization, growth and nutrient uptake in tomato cies on rhizosphere community structure as revealed and eggplant seedlings. Scientia Horticulturae, 94(1), by molecular analysis of microbial guilds. FEMS Mi- 145-156. crobiology Ecology, 56(2), 236-249. King, R., Urban, M., Hammond-Kosack, M. C., Has- Daniell, T. J., Husband, R., Fitter, A. H., & Young, sani-Pak, K., & Hammond-Kosack, K. E. (2015). J. P. W. (2001). Molecular diversity of arbuscular The completed genome sequence of the pathogenic mycorrhizal fungi colonising arable crops. FEMS ascomycete fungus Fusarium graminearum. BMC Microbiology Ecology, 36(2-3), 203-209. genomics, doi: 10.1186/s12864-015-1756-1

132 Klosterman, S. J., Atallah, Z. K., Vallad, G. E., & Sub- Mirmajlessi, S. M., Destefanis, M., Gottsberger, R. A., barao, K. V. (2009). Diversity, pathogenicity, and Mänd, M., & Loit, E. (2015). PCR-based specific management of Verticillium species. Annual review techniques used for detecting the most important of phytopathology, 47, 39-62. pathogens on strawberry: a systematic review. System- Kõljalg, U., Nilsson, R. H., Abarenkov, K., Tedersoo, atic reviews, doi: 10.1186/2046-4053-4-9. L., Taylor, A. F., Bahram, M., ... & Douglas, B. Mirmajlessi, S. M., Larena, I., Mänd, M., & Loit, E. (2013). Towards a unified paradigm for sequence‐ (2016). A rapid diagnostic assay for detection and based identification of fungi. Molecular ecology, quantification of the causal agent of strawberry wilt 22(21), 5271-5277. from field samples. Acta Agriculturae Scandinavica, Kovacs, A., Yacoby, K., & Gophna, U. (2010). A sys- Section B—Soil & Plant Science, 66(7), 619-629. tematic assessment of automated ribosomal inter- Morandi, D., Gollotte, A., & Camporota, P. (2002). genic spacer analysis (ARISA) as a tool for estimating Influence of an arbuscular mycorrhizal fungus on bacterial richness. Research in microbiology, 161(3), the interaction of a binucleate Rhizoctonia species 192-197. with Myc+ and Myc–pea roots. Mycorrhiza, 12(2), Li, A., Wei, Y., Sun, Z., Fan, T., & Zhang, L. (2012). 97-102. Analysis of bacterial and fungal community structure Nallanchakravarthula, S., Mahmood, S., Alström, S., & in replant strawberry rhizosphere soil with denatur- Finlay, R. D. (2014). Influence of soil type, cultivar ing gradient gel electrophoresis. African Journal of and Verticillium dahliae on the structure of the root Biotechnology, 11(49), 10962-10969. and rhizosphere soil fungal microbiome of straw- Lim, Y. W., Kim, B. K., Kim, C., Jung, H. S., Kim, berry. PloS one, doi:10.1371/journal.pone.0111455 B. S., Lee, J. H., & Chun, J. (2010). Assessment of Nicolaisen, M., Justesen, A. F., Knorr, K., Wang, J., & soil fungal communities using pyrosequencing. The Pinnschmidt, H. O. (2014). Fungal communities in Journal of Microbiology, 48(3), 284-289. wheat grain show significant co-existence patterns Masella, A. P., Bartram, A. K., Truszkowski, J. M., among species. Fungal Ecology, 11, 145-153. Brown, D. G., & Neufeld, J. D. (2012). PANDAseq: O’Brien, H. E., Parrent, J. L., Jackson, J. A., Moncalvo, paired-end assembler for illumina sequences. BMC J. M., & Vilgalys, R. (2005). Fungal community bioinformatics, doi: 10.1186/1471-2105-13-31. analysis by large-scale sequencing of environmental Matsubara, Y., Hasegawa, N., & Fukui, H. (2002). samples. Applied and environmental microbiology, Incidence of Fusarium root rot in asparagus seed- 71(9), 5544-5550. lings infected with arbuscular mycorrhizal fungus Oksanen, J., Blanchet, F. G., Kindt, R., Legendre, P., as affected by several soil amendments. Journal of Minchin, P. R., O’hara, R. B., Simpson, G. L., Soly- the Japanese Society for Horticultural Science, 71(3), mos, P., Henry, M., Stevens, H., Szoecs, E., & Wag- 370-374. ner H. (2013). Package ‘vegan’. Community ecology McGuire, K. L., Payne, S. G., Palmer, M. I., Gillikin, package, version, 2(9). C. M., Keefe, D., Kim, S. J., ... & Massmann, A. De Beeck, M. O., Lievens, B., Busschaert, P., Decler- L. (2013). Digging the New York City skyline: soil ck, S., Vangronsveld, J., & Colpaert, J. V. (2014). fungal communities in green roofs and city parks. Comparison and validation of some ITS primer pairs PloS one, doi:10.1371/journal.pone.0058020. useful for fungal metabarcoding studies. PLoS One, McMurdie, P. J., & Holmes, S. (2013). phyloseq: doi:10.1371/journal.pone.0097629. an R package for reproducible interactive analysis Öpik, M., Metsis, M., Daniell, T. J., Zobel, M., and graphics of microbiome census data. PloS one, & Moora, M. (2009). Large‐scale parallel 454 doi:10.1371/journal.pone.0061217. sequencing reveals host ecological group specificity Mello, A., Napoli, C., Murat, C., Morin, E., Marced- of arbuscular mycorrhizal fungi in a boreonemoral du, G., & Bonfante, P. (2011). ITS-1 versus ITS-2 forest. New Phytologist, 184(2), 424-437. pyrosequencing: a comparison of fungal populations Reganold, J. P., Andrews, P. K., Reeve, J. R., Carpen- in truffle grounds.Mycologia , 103(6), 1184-1193. ter-Boggs, L., Schadt, C. W., Alldredge, J. R., ... & Menkis, A., Ihrmark, K., Stenlid, J., & Vasaitis, R. Zhou, J. (2010). Fruit and soil quality of organic and (2014). Root-associated fungi of Rosa rugosa grown conventional strawberry agroecosystems. PLoS One, on the frontal dunes of the Baltic Sea coast in Lith- doi:10.1371/journal.pone.0012346 uania. Microbial ecology, 67(4), 769-774. Reininger, V., Martinez-Garcia, L. B., Sanderson, L., Miao, C. P., Mi, Q. L., Qiao, X. G., Zheng, Y. K., & Antunes, P. M. (2015). Composition of fungal Chen, Y. W., Xu, L. H., ... & Zhao, L. X. (2016). soil communities varies with plant abundance and Rhizospheric fungi of Panax notoginseng: diversity geographic origin. AoB Plants, doi:10.1093/aobpla/ and antagonism to host phytopathogens. Journal of plv110 ginseng research, 40(2), 127-134.

133 Schadt, C. W., Martin, A. P., Lipson, D. A., & Schmidt, fungal diversity in plant roots. Science, 295(5562), S. K. (2003). Seasonal dynamics of previously un- 2051-2051. known fungal lineages in tundra soils. Science, Whipps, J. M. (2004). Prospects and limitations for 301(5638), 1359-1361. mycorrhizas in biocontrol of root pathogens. Cana- Schmidt, P. A., Bálint, M., Greshake, B., Bandow, C., dian journal of botany, 82(8), 1198-1227. Römbke, J., & Schmitt, I. (2013). Illumina metabar- White, T. J., Bruns, T., Lee, S. J. W. T., & Taylor, J. coding of a soil fungal community. Soil Biology and W. (1990). Amplification and direct sequencing of Biochemistry, 65, 128-132. fungal ribosomal RNA genes for phylogenetics. PCR Schoch, C. L., Seifert, K. A., Huhndorf, S., Robert, V., protocols: a guide to methods and applications, 18(1), Spouge, J. L., Levesque, C. A., ... & Miller, A. N. 315-322. (2012). Nuclear ribosomal internal transcribed spac- Willger, S. D., Grim, S. L., Dolben, E. L., Shipunova, er (ITS) region as a universal DNA barcode marker A., Hampton, T. H., Morrison, H. G., ... & Sogin, for Fungi. Proceedings of the National Academy of M. L. (2014). Characterization and quantification Sciences, 109(16), 6241-6246. of the fungal microbiome in serial samples from Smith, S. E., & Read, D. J. (2010). Mycorrhizal symbi- individuals with cystic fibrosis. Microbiome, doi: osis. Academic press. 10.1186/2049-2618-2-40 Sowik, I., Borkowska, B., & Markiewicz, M. (2016). Xu, L., Ravnskov, S., Larsen, J., Nilsson, R. H., & The activity of mycorrhizal symbiosis in suppressing Nicolaisen, M. (2012). Soil fungal community Verticillium wilt in susceptible and tolerant strawber- structure along a soil health gradient in pea fields ry (Fragaria x ananassa Duch.) genotypes. Applied examined using deep amplicon sequencing. Soil Bi- Soil Ecology, 101, 152-164. ology and Biochemistry, 46, 26-32. Torres-Barragán, A., Zavaleta-Mejía, E., González- Yu, M., Hodgetts, J., Rossall, S., & Dickinson, M. Chávez, C., & Ferrera-Cerrato, R. (1996). The use (2009). Using terminal restriction fragment length of arbuscular mycorrhizae to control onion white rot polymorphism (T-RFLP) to monitor changes in (Sclerotium cepivorum Berk.) under field conditions. fungal populations associated with plants. Journal of Mycorrhiza, 6(4), 253-257. Plant Pathology, 417-423. Vandenkoornhuyse, P., Baldauf, S. L., Leyval, C., Straczek, J., & Young, J. P. W. (2002). Extensive

134 VI

135 Mirmajlessi SM, Mänd M, Najdabbasi N, Larena I, Loit E, 2016. Screening of native Trichoderma harzianum isolates for their ability to control Verticillium wilt of strawberry. Zemdirbyste-Agriculture 103(4), 397–404.

136 ISSN 1392-3196 Zemdirbyste-Agriculture Vol. 103, No. 4 (2016) 397

ISSN 1392-3196 / e-ISSN 2335-8947 Zemdirbyste-Agriculture, vol. 103, No. 4 (2016), p. 397‒404 DOI 10.13080/z-a.2016.103.051

Screening of native Trichoderma harzianum isolates for their ability to control Verticillium wilt of strawberry

Seyed Mahyar MIRMAJLESSI1, Marika MÄND1, Neda NAJDABBASI1, Inmaculada LARENA2, Evelin LOIT1 1Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences Kreutzwaldi 5, 51014 Tartu, Estonia E-mail: [email protected] 2National Institute for Agricultural Research and Technology (INIA) Ctra. de La Coruna km. 7, 28040 Madrid, Spain

Abstract In this research, the antagonistic potential of native Trichoderma harzianum isolates toward important strawberry pathogen Verticllium dahliae was studied. For this purpose, fungi were isolated from the rhizosphere and soil from five different strawberry production sites in Estonia over two growing seasons and were investigated under laboratory and greenhouse conditions. T. harzianum colonies were recovered using a selective medium after 12 days and confirmed through species-specific primers. In the laboratory, although all isolates of Trichoderma produced volatile and non-volatile metabolites, seven isolates which had the strongest inhibitory effects on mycelial growth of pathogen were selected for greenhouse assays. In the greenhouse, the disease severity was measured in a split plot treatment design with seven antagonist isolates applied to the two main treatment factors (soil and root), in which all levels of each factor were used in combination with all other factor levels. The result of greenhouse experiments showed that there was no significant difference among T. harzianum treatments but, among selected T. harzianum isolates, TU79 was the most effective isolate for inhibiting the effects of strawberry Verticillium wilt. In the cross-interaction between the antagonist isolates and their treatments, the minimum disease severity was significantly recorded when both soil and roots were treated with TU79 isolate. However, there was no statistically significant difference when this isolate was applied to the soil alone. The results of this study demonstrated that native T. harzianum isolates collected from Estonian fields have potential biocontrol ability so that they may be extensively used to control Verticillium wilt in strawberry nurseries. Key words: non-volatile metabolites, Trichoderma harzianum, Verticillium wilt, volatile metabolites. Introduction Strawberry (Fragaria × ananassa Duch.) is one et al., 2009). Because of long viability of microsclerotia, of the world’s most commercially important fruit crops the control of the pathogen is difficult even where non- (Suga et al., 2013). According to Food and Agriculture susceptible hosts have been grown, suggesting that non- Organization (FAO) statistics (FAOSTAT, 2013), global hosts may serve as a pathogen reservoir. strawberry production was 4,516,810 tons in 2012, and in Intensive use of fungicides has caused drastic Estonia, strawberry is grown for fruit and plant production problems of chemical residues in the environment. Due and it is developing into a promising horticultural crop to the change of attitude in the current European policy for small growers. Hence, a lot of effort has been made to regarding crop protection, the European Commission has uphold strawberry production in the different regions of approved a legislative agreement (Directive 2009/128/ the country. A considerable limiting factor is strawberry EC), which regulates the use of plant protection diseases that severely influence both fruit and plant products and establishing the integrated control and production and are frequently challenging to control. non-chemical means as a fundamental strategy to fight Most strawberry cultivars are susceptible to major fungal against diseases, pests and weeds. Therefore, the use of diseases. Verticillium wilt, caused by soil inhabiting synthetic pesticides is being progressively diminished, Verticillium dahliae Kleb, is one of the most important and it is supplemented by an increased reliance on the diseases worldwide, resulting in great economic losses use of microorganisms as biocontrol. In plant pathology, in many crops like strawberry and can be severe on some biological suppression of plant diseases has been cultivars, even at low inoculum densities (Mirmajlessi increasingly recognized as a promising alternative way et al., 2015). The fungus is distinguished from other to achieve sustainable agricultural systems as it is safe closely related fungi by producing multicellular and to use and environmentally friendly, preventing pollution melanized structures known as microsclerotia that persist and health hazards resulting from the conventional use in the soil, promoting survival between crops (Klosterman of chemicals (Zheng et al., 2011). Biocontrol systems

137 398 Screening of native Trichoderma harzianum isolates for their ability to control Verticillium wilt of strawberry frequently use natural living microorganisms known as distilled water. Aliquots of 1 ml from each suspension antagonists that are capable of reducing the effects of were scattered onto 90-mm Petri plates of Czapek’s Dox undesirable microorganisms. Antagonism implies direct agar supplemented with streptomycin (100 mg l-1) and interaction between two microorganisms that share the incubated in the dark at 26°C. After two weeks’ incubation, same ecological niche. Such antagonists can compete the plates were carefully washed with distilled water to with pathogens for nutrients, diminish pathogens by remove remaining soils. Afterwards, drained plates were parasitism, inhibit growth of pathogens through antibiosis scanned for the existence of typical star-shaped colonies or even induce systemic resistance in plants (Shishido of V. dahliae using a stereomicroscope Olympus SZX10 et al., 2005). Earlier studies demonstrated that the volatile (Japan). Hyphal tips grown out from each piece of tissue and non-volatile compounds of a variety of fungal were picked and transferred to fresh potato dextrose agar microorganisms inhibit the activity of pathogenic fungi. (PDA) plates until further use. For instance, Padder and Sharma (2011) showed the efficacy of some fungal isolates including Trichoderma Table 1. Detection of Verticillium dahliae in strawberry viride, T. harzianum, T. hamatum and Gliocladium virens in fields inhibiting the in vitro and in vivo growth of Colletotrichum Isolate Location Symptoms in field lindemuthianum, the causal agent of cowpea anthracnose code (coordinates) by using volatile and non-volatile extracts. Basically, the SV-05 plant collapse and death efficacy of biological control depends on the development SV-07 yellow wilt of the antagonist in the rhizosphere zone and colonizing SV-11 wilting, initially older leaves only the plants roots, and so the survival qualities of antagonists SV-14 poor growth and stunting Vasula can be intensely affected by environmental conditions SV-15 poor growth and stunting (58°47ʹ N, 26°73ʹ E) (Larkin, Fravel, 2002). SV-17 yellow wilt Trichoderma spp. have been used for many SV-19 plant collapse and death years as antagonists and have a great contribution to the SV-20 yellow wilt biological control of many fungal plant pathogens, e.g., SV-21 green dry necrosis SR-32 yellow wilt Rhizoctonia solani (Naeimi et al., 2010), Botrytis cinerea SR-36 wilting, initially older leaves only (Cheng et al., 2012), Verticllium dahliae (Xiaojun et al., SR-38 Rohu plant collapse and death 2014) and Phytophthora ramorum (Widmer, 2014). SR-39 (59°09ʹ N, 26°48ʹ E) no symptoms Basically, mycoparasitism, competition for space and SR-41 yellow wilt nutrients, antibiosis through the production of inhibitory SR-43 no symptoms metabolites and induction of the plant’s systemic resistance SM-46 plant collapse and death have been described as antagonistic mechanisms of SM-48 poor growth and stunting Trichoderma spp. (Harman et al., 2004). Each of these SM-49 Marjamaa poor growth and stunting mechanisms may play a key role during antagonism. SM-50 (58°90ʹ N, 24°42ʹ E) yellow wilt Among Trichoderma species, T. harzianum Rifai has been SM-53 green dry necrosis SM-55 plant collapse and death applied as an antagonist agent and it behaves efficiently SU-63 no symptoms under different environmental conditions to protect crops SU-65 yellow wilt Unipiha against diseases. Although some Trichoderma species are SU-67 yellow wilt (58°26ʹ N, 26°58ʹ E) among the most investigated fungal biocontrol agents SU-68 poor growth and stunting as biofungicide in plant disease management, full-scale SU-69 no symptom application of biological control has not been widespread. ST-76 Utsu no symptoms ST-78 no symptoms The objectives of the current study were (i) to (58°40ʹ N, 26°80ʹ E) obtain different Trichoderma harzianum isolates from ST-79 yellow wilt the rhizosphere of field-grown strawberries as a potential antagonists against Verticillium dahliae; (ii) to assess Trichoderma harzianum isolates. Soil samples the possible role of volatile and non-volatile compounds were collected from the surface (10–20 cm) layer around produced by T. harzianum isolates for control of Verticillium healthy plant roots and their rhizosphere zone from wilt of strawberry under greenhouse conditions. different sites of strawberry fields, placed in plastic bags and stored at 4°C until processing. The samples were air dried (at 27°C), sifted with 20-mesh sieve to Material and methods eliminate large debris. One gram of each sample was Verticllium dahliae isolates. During 2014–2015, added to 40 mL distilled water and shaken by hand for soil samples were collected from several strawberry one minute. The suspensions were diluted to 10-3 and fields, located in different production sites in Estonia, then 0.5 mL aliquots were removed and spread on plates that were suspected of being infected with Verticillium containing Trichoderma selective medium described wilt (Table 1). V. dahliae was isolated from the soil by previously by Elad et al. (1982). The medium consisted wet-sieving plating method as previously described by of a basal medium including 1.0 g K2HPO4, 0.3 g MgSO4 Harris et al. (1993) with some modifications. Briefly, soil (7H2O), 1.0 g NH4NO3, 3 g glucose, 0.18 g KCl, 20 g samples were air dried for two weeks at room conditions, agar and 0.18 g rose Bengal. Cultures were incubated at mixed and ground with a mortar and pestle. Samples were 27°C under continuous fluorescent light. Monoconidial then sifted using a 20-mesh sieve (Tyler equivalent) to cultures were identified 12 days after incubation by using eliminate large and unbreakable debris. Twenty g of each the identification key provided by Bissett (1991). To sieved soil sample was shaken at 250 rpm and dispersed in confirm the existence of T. harzianum, genomic DNA of distilled water for one hour. Then the soil was wet sieved each isolate was extracted and amplified by conventional through 60 and 400 mesh sieves, sequentially, and residue polymerase chain reaction (cPCR) using specific retained in the 400 mesh sieve was suspended in 100 ml primers THITS-F2 (CGGGTTTTTTATAATCTGAGCC)

138 ISSN 1392-3196 Zemdirbyste-Agriculture Vol. 103, No. 4 (2016) 399 and THITS-R3 (CATTCAGAAGTTGGGTG) to isolates, removed from the leading edge of cultures T. harzianum (Miyazaki et al., 2009). grown on PDA, were placed on fresh PDA medium Pathogenicity test. All isolates of V. dahliae before the interaction occurred. The lids of Petri dishes collected from different strawberry fields were subjected were removed when a plate containing V. dahliae was to the pathogenicity test on the susceptible strawberry placed over a plate containing T. harzianum and each pair cultivar ‘Sonata’, using the root dip and soil inoculation was sealed by adhesive tape. The plates were incubated at methods. 26°C for two weeks. The diameter of V. dahliae colonies Root dip inoculation. Nine-day-old cultures affected by antagonist metabolites was measured and of V. dahliae isolates were washed with sterile distilled the percentage growth inhibition was then calculated water from each plate. The inoculum concentration was as described above. The control set included cultures of adjusted to 106 conidia ml-1 by a spectrophotometer. V. dahliae paired with uninoculated PDA plates. The strawberry seedlings were uprooted, washed under Effects of secondary metabolites. To evaluate running tap water and submerged in a conidial suspension. effects of secondary metabolites (non-volatile) released After two hours, the inoculated seedlings were planted in by the T. harzianum isolates on V. dahliae, 5 mm 20 cm pots containing a mixture of perlite, peat moss and mycelial discs were removed from the leading edge of vermiculite (1:1:1 by volume) and kept on a greenhouse 10-day-old culture of T. harzianum and transferred to the bench at 24 ± 1°C with 12 hour day length provided by centre of PDA plates overlaid with sterilized cellophane fluorescent light. Then, appearance of wilt symptoms membranes (Courtauld films, 50-μm thickness). After was observed 30 days after inoculation. 72 hours, the cellophane and fungus were removed and Soil inoculation. Isolates of V. dahliae were a 5 mm disc of V. dahliae was then transferred on the applied after forming microsclerotia on PDA plates. centre of each plate. All plates were incubated at 26°C for Strawberry seedlings were inoculated with the whole two weeks and the percentage of growth inhibition was agar piece removed from the plate beneath the roots in calculated as described above. The plates with cellophane pots four weeks after planting. Three replications of four film but without antagonist were employed as controls. plants for each isolate were designed. The plants were The T. harzianum isolates that most highly inhibited kept under the same conditions as described above. Wilt V. dahliae growth were chosen for in vivo experiments. incidence was observed 30 days after inoculation and In vivo experiments. Plant inoculation. its severity was rated on an arbitrary 0–5 point ranking V. dahliae inoculum was prepared by growing the fungus scale, where 0 = healthy (no visual symptoms), 1 = 1% on PDA medium at 25°C. After eight days, colony spores to 20% diseased (marginal and interveinal browning of were washed from the plates with sterilized-distilled outer leaves), 2 = 21% to 40% diseased, 3 = 41% to 60% water and the resulting conidial suspension was adjusted diseased, 4 = 61% to 80% diseased and 5 = 81% to 100% to 105 conidia ml-1 using a spectrophotometer. Strawberry diseased (Mirmajlessi et al., 2012). Pathogenicity of each seedlings at the trifoliate leaf stage were uprooted, isolate was calculated as follows: cleaned from soil with running tap water and superficially wounded to ensure the entrance of the pathogen. Seedlings were root-dipped in fungal inoculum for one hour and then transplanted to a sterile soil and kept at 24 ± 1°C in Pathogenicity tests were repeated three times the greenhouse. Control plants were non-inoculated and using a randomized complete block design and virulence the inoculum was replaced with distilled water. was measured using disease severity. Trichoderma harzianum inoculums. For prepa- In vitro testing of antagonistic effects of ration of antagonist inoculum, each T. harzianum isolate T. harzianum isolates on V. dahlia. Inhibition of mycelial was individually prepared on PDA medium at 25°C by growth. T. harzianum isolates were tested in vitro for adding two mycelial plugs of Trichoderma isolates taken their antagonistic ability over V. dahliae in dual culture. from three-day old cultures into flasks containing water- Among all collected V. dahliae, one isolate was used as soaked wheat bran which was sterilized (121°C, 15 psi, it exhibited the highest level of pathogenicity towards 10 minutes) and cooled before inoculation. Inoculated strawberry plants. After colony diameter reached 1.5 cm, flasks were then incubated at 26°C for two weeks. The a mycelial disc (5 mm in diameter) of each T. harzianum number of T. harzianum in each gram of wheat bran was isolate and selected V. dahliae were placed together (5 then measured using a hemocytometer (Sigma, United cm apart) in a 9 cm Petri dish containing PDA medium Kingdom). One gram of inoculated wheat bran was and incubated at 26°C. Three replications were used then suspended in 12 ml sterile distilled water and the per each Trichoderma-Verticillium combination. The amount of conidia was measured by counting conidia in experiment was assessed based on the inhibitory effect one ml of this suspension. T. harzianum inoculum was of the antagonist on radial growth of V. dahliae four days added to the soil of each pot at 107 conidia per g soil. For after incubation using the following formula: root treatment, strawberry seedlings were soaked in this Growth inhibition (%) = (CDC − CD / CDC) × 100, inoculum for two hours. where CDC is the average diameter of the Antagonist ability of Trichoderma harzianum V. dahliae colony as control, CD – the average diameter on strawberry Verticillium wilt in the greenhouse. The of the V. dahliae colony in culture medium affected by antagonist effect of T. harzianum isolates for biological T. harzianum. control of V. dahliae was investigated in a greenhouse. Effects of volatile metabolites. To determine The experiment was performed by using antagonist the effects of volatile extracts released by T. harzianum treatments on root, soil and both root and soil, and isolates on the growth of V. dahliae, 5 mm diameter discs consisted of T. harzianum isolates with pathogen, removed from the leading edge of a 10-day-old culture pathogen alone and T. harzianum without pathogen. of selected V. dahliae were transferred into the centre Treatments without antagonist and pathogen were of PDA plates and incubated at 26°C for 7 days prior to considered as control to ensure the health of plants. the interaction test. Discs from each of the T. harzianum After approximately two months of inoculation, plants

139 400 Screening of native Trichoderma harzianum isolates for their ability to control Verticillium wilt of strawberry were assessed for Verticillium wilt symptoms using the Results 0–5 point ranking scale described above. The entire Isolation of Verticillium dahlia. In this study, experiment was repeated twice in a split plot treatment 29 isolates of V. dahliae were obtained from soil of trial in which each experiment consisted of a randomized strawberry fields from different areas of Estonia (Table 1). complete block design with three replications and four Identification of V. dahliae was based on morphological plants per replication. All pots were kept on a greenhouse structures such as production of dark microsclerotia bench at 24 ± 1°C. All statistical analyses were performed with hyaline and septate mycelium along with ovoid and by analysis of variance (ANOVA) using statistical single-celled conidia on PDA (Fig. 1). software MSTATC, version 1.42. Means were separated by Duncan’s multiple range test (P ≤ 0.05).

A B Figure 1. Dark microsclerotia (A) and microscopic view of Verticillium dahliae with hyaline and septate mycelium (B)

Isolation of Trichoderma harzianum. Eleven Table 2. Pathogenic variability of Verticillium dahliae isolates of T. harzianum (TU62, TU63, TU67, TU68, isolates on strawberry plants (cv. ‘Sonata’) TU70, TU72, TU74, TU75, TU76, TU79 and TU80) were obtained from the rhizosphere of strawberry Isolate Disease severity % plants only from the Unipiha area. The species-specific code root dip inoculation soil inoculation primer (THITS-F2/THITS-R3) was examined using SV-05 31 bc 33.7 bcd cPCR against genomic DNA from pure culture of T. SV-07 56.6 ab 44.2 abcd harzianum isolates. PCR products were generated from SV-11 56.6 ab 68.1 ab SV-14 56.6 ab 44.2 abcd all DNA extracted using specific primers, demonstrating SV-15 56.6 ab 44.2 abcd the existence of amplifiable template. The specific DNA SV-17 11 d 4.3 ef fragments of the expected size were clearly observed by SV-19 76.6 a 86.3 a agarose gel electrophoresis for all isolates that confirmed SV-20 56.6 ab 20 de presence of T. harzianum in this study (Fig. 2). SV-21 56.6 ab 44.2 abcd SR-32 56.6 ab 54.3 abc SR-36 31 bc 20 de SR-38 56.6 ab 33.7 bcd SR-39 56.6 ab 68.1 ab SR-41 31.0 bc 54.3 abc SR-43 56.6 ab 26.6 cd SM-46 31 bc 54.3 abc SM-48 56.6 ab 54.3 abc SM-49 56.6 ab 26.6 cd Note. Lane M – 100-bp DNA Ladder, lanes 1–11 – specific DNA SM-50 31 bc 44.2 abcd fragment (approximately 830 bp) amplified from the genomic SM-53 56.6 ab 54.3 abc DNA of Trichoderma harzianum, lane 12 – distilled water as SM-55 31 bc 44.2 abcd SU-63 31 bc 20 de negative control; agarose gel electrophoresis of PCR products SU-65 56.6 ab 28.1 cd amplified using the primer pair THITS-F2/THITS-R3. SU-67 31 bc 44.2 abcd SU-68 31 bc 8.1 ef Figure 2. Primer pair specificity SU-69 31 bc 28.1 cd ST-76 31 bc 8.1 ef Pathogenicity test of Verticillium dahliae ST-78 31 bc 8.1 ef isolates. All isolates of V. dahliae were inoculated on ST-79 31 bc 8.1 ef Control 0 e 0 g strawberry seedlings using root dip and soil inoculation procedures and the percentage of disease severity was Note. Means in the same column followed by different letters differ from each other significantly at P ≤ 0.05 (Duncan’s recorded. All isolates were found to infect strawberry multiple range test); control – without V. dahliae. plants as shown in Table 2. Combining results of the two inoculation respectively. In summary, the disease severity was <20% in methods indicated that disease severity of isolates varied six isolates, between 20% and 80% in 22 isolates and only considerably from 6.8% to 79.5% (Table 3). The isolates one isolate revealed a disease severity of around 80%. SV-17 and SV-19 collected from Vasula area showed Moreover, a combined disease severity resulting the lowest (6.8%) and highest (79.5%) disease severity, from the use of two inoculation methods on strawberry

140 ISSN 1392-3196 Zemdirbyste-Agriculture Vol. 103, No. 4 (2016) 401

Table 3. Combined pathogenic variability of Verticillium Table 4. Combined disease severity of two inoculation dahliae isolates on strawberry plants (cv. ‘Sonata’) procedures inoculated by root dip and soil inoculation procedures Inoculation method Disease severity % Disease Disease Root dip 44.2 a Isolates severity Isolates severity Soil 37.1 b % % Note. Means in the same column followed by different letters SV-19 79.5 a SV-20 32.5 de differ from each other significantly at P ≤ 0.05 (Duncan’s SV-11 58.4 ab SV-05 32.4 de multiple range test). SR-39 58.2 ab SM-55 32.3 de SM-53 55.3 abc SR-43 32 de Antagonistic effects of T. harzianum isolates SR-32 52.5 abcd SM-50 32.1 de on V. dahlia. Dual culture. In this assay, 11 isolates of SV-21 52 abcd SU-67 31.4 de T. harzianum were tested against V. dahlia isolate SV-19 SM-48 51.1 abcd SU-69 25.3 def to evaluate mycelial growth inhibition. In dual culture, SV-15 47.9 abcd SU-63 23.5 def SV-07 43.6 bcd SR-36 17 ef most Trichoderma isolates grew very fast and showed SV-14 39.1 cde ST-78 16.2 ef significant inhibition ability over V. dahliae, covering SR-38 38.8 cde ST-76 16 ef the whole V. dahliae colony after four days (data not SM-49 38.6 cde SU-68 13.9 efg shown). In two cases (TU62 and TU76), however, an SM-46 38.4 cde ST-79 11.2 fg inhibition zone was observed at the contact area of the SR-41 37.3 cde SV-17 6.8 g SU-65 35.8 cde control 0 h growing colonies without overgrowth. The percentage of V. dahliae colony growth inhibition by all Trichoderma Note. Means in the columns followed by different letters differ isolates is shown in Table 5. from each other significantly at P ≤ 0.05 (Duncan’s multiple Volatile metabolites. Volatile metabolites range test); control – without V. dahliae. deriving from different T. harzianum isolates exhibited seedlings showed that the root dip inoculation method a wide range of inhibitory effect on V. dahliae, varying presented higher disease severity (44.2%) than the soil from 15.8% to 88.3%, with isolates TU76 and TU79 inoculation method (Table 4). As the most pathogenic showing minimum and maximum effect on the pathogen, isolate, SV-19 was chosen for further investigation. respectively (Table 5). Table 5. Evaluation of dual culture, volatile and non-volatile metabolites tests on mycelial growth inhibition of Verticillium dahliae SV-19

Trichoderma harzianum Mycelial inhibition % Average isolates volatile metabolites non-volatile metabolites dual culture TU62 24.1 cde 40.6 ab 30.1 cd 31.6 cd TU63 83.1 ab 35.1 abc 60.8 bcd 59.7 abc TU67 52.9 bcd 28.1 bcd 62.3 bcd 47.8 abcd TU68 67.5 bc 36.6 abc 75.5 bc 59.9 abc TU70 53.3 bcd 11.2 de 61.2 bcd 41.9 bcd TU72 79.8 abc 20.7 cd 88.1 ab 62.9 ab TU74 81.7 ab 22.2 cd 85.9 abc 63.3 ab TU75 55.2 bcd 30.4 abcd 93.1 a 59.6 abc TU76 15.8 de 50.5 a 17.9 de 28.1 cde TU79 88.3 a 18.2 cde 92.1 a 66.2 a TU80 80.3 abc 31.1 abcd 85.6 abc 65.7 a Control 0 f 0 f 0 f 0 f Note. Means in the same column followed by different letters differ from each other significantly at P ≤ 0.05 (Duncan’s multiple range test). Secondary metabolites. Evaluation of Table 6. The effects of different treatments and isolates the inhibitory effect of non-volatile metabolites of of Trichoderma harzianum on disease severity of T. harzianum isolates over V. dahliae indicated a wide Verticillium wilt in the greenhouse range of mycelial growth inhibition which varied from 11.2% to 50.5% (Table 5). Generally, based on the results Mean disease severity Treatments % of dual culture, volatile and non-volatile metabolites, Root 38.7 a seven isolates (TU63, TU68, TU72, TU74, TU75, TU79 Soil 38.4 a and TU80) which showed mycelial inhibition of more Root and soil 38.5 a than 50% were chosen for the greenhouse assays. V. dahliae* 75.6 a Antagonistic ability of T. harzianum isolates on TU63 + P 55.8 b strawberry V. wilt in the greenhouse. The seven selected TU68 + P 56.2 b isolates of T. harzianum that achieved suitable biocontrol TU72 + P 43.2 bc TU74 + P 42.5 bc efficacy in in vitro experiments were further evaluated TU75 + P 55.8 b for their antagonistic effects on strawberry Verticillium TU79 + P 26.8 cd wilt in greenhouse experiments. As shown in Table 6, TU80 + P 37.5 bcd treatments affected by different T. harzianum isolates Without pathogen 0 e resulted in a mean disease severity of ≈38%, locating in Note. * – fungal inoculum as positive control, P – V. dahliae one statistical group. However, the lowest mean disease isolate SV-19 as pathogen; means in the same column followed severity was related to the soil treatment (38.4%). On by different letters differ from each other significantly at the other hand, different Trichoderma isolates decreased P ≤ 0.05 (Duncan’s multiple range test).

141 402 Screening of native Trichoderma harzianum isolates for their ability to control Verticillium wilt of strawberry disease severity in comparison with the control (no characteristics but differed in disease severity. The results Trichoderma inoculation), but the effects of six of the of the pathogenicity tests showed that V. dahliae isolate Trichoderma isolates were statistically indistinguishable SV-19 was the most pathogenic, leading to the highest (P < 0.05). Only isolate TU79 showed a significantly disease severity (79.51%), while SV-17 showed the reduced disease severity (≈27%) by its treatment on root lowest severity (6.8%) when seedlings were inoculated or soil. by root dipping or soil inoculation methods. Both isolates The cross-interaction between the antagonist originated from the same (Vasula) area but generated isolates and the type of treatment (root, soil and both different wilt symptoms on strawberry plants, reflecting root and soil) showed a varied range of disease severity genetic diversity in the V. dahliae population. Significant from 14.2% to 75.6%. The maximum disease severity, genetic diversity among V. dahliae isolates is a common indistinguishable from the positive control, was found phenomenon that has been reported by Berbegal et al. when the root was treated with isolate TU75. Also, the (2010) who showed a degree of host specificity and minimum disease severity was observed when inoculate different virulence from certain hosts. Also, our results TU79 was applied either to the soil or to both soil and indicated that root inoculation using spore suspension root (Table 7). induced greater disease severity than infections initiated by microsclerotia in the soil. However, both inoculation Table 7. Interaction between all Trichoderma harzianum methods were efficacious on plants when analyzed isolates and their treatments regarding disease severity of separately. Gordon et al. (2005) illustrated that root dip Verticillium wilt in the greenhouse inoculation method was more consistent over time than soil inoculation method on different strawberry genotypes. T. harzianum Mean disease As in root dip inoculation the root system is directly Fungal isolates treatments severity % subjected to the pathogen propagules, systemic infections V. dahliae* – 75.6 a are more rapidly predictable than soil inoculations. So, TU75 + P root 75.6 a infection will not occur until growing roots encounter TU63 + P root 55.3 b microsclerotia in the soil, which may be affected by TU72 + P root 55.3 b annual temperatures. However, development of disease TU68 + P soil 55.3 b may vary between plants inoculated by different methods TU68 + P root, soil 55.3 b (Xiaojun et al., 2014). TU75 + P root, soil 55.3 b In the in vitro test, all T. harzianum isolates TU63 + P root, soil 51.4 bc TU63 + P soil 51.4 bc obtained from healthy strawberry rhizospheres TU68 + P root 51.4 bc successfully inhibited radial growth of the V. dahliae TU74 + P soil 46.3 bcd (SV-19) by growing faster than the pathogen on PDA TU72 + P soil 46.3 bcd in comparison with untreated controls. Competition TU72 + P root, soil 46.3 bcd for space and nutrients could be one of the most TU75 + P soil 46.3 bcd general mechanisms applied by biocontrol agent to TU80 + P root 31.5 cd inhibit mycelial growth of the pathogen. In a similar TU74 + P root 28.1 cde study, the antagonistic activity of Trichoderma species TU74 + P root, soil 28.1 cde against Fusarium oxysporum f. sp. pisi has been proved TU80 + P root, soil 23.3 de using competition as an effective mechanism where TU79 + P root 23.3 de TU80 + P soil 23.3 de Trichoderma and Fusarium showed varying degree of TU79 + P soil 14.2 ef inhibition on each other, indicating competitive ability of TU79 + P root, soil 14.2 ef Trichoderma isolates (Sharma, 2011). However, in our Without pathogen – 0 g study, an inhibition zone through lysis and deformation of V. dahliae mycelium was observed at the contact Note. * – fungal inoculum as positive control, P – V. dahliae area of the growing colonies without overgrowth only isolate SV-19 as pathogen; means in the same column followed by different letters differ from each other significantly at by two isolates of T. harzianum (TU62 and TU76), P ≤ 0.05 (Duncan’s multiple range test). demonstrating the attendance of diffusible inhibitory substances. Besides, production of extracellular enzymes such as chitinase, cellulase and β-glucanase is another Discussion biocontrol mechanism that apply by Trichoderma The use of microorganisms to control plant towards fungal pathogens, which degrade the fungal cell diseases is an exciting part of applied biology. Endogenous walls (Hassan, 2014). There was no correlation between agents including Trichoderma spp. have been considered antagonist capability to produce antifungal antibiosis as a favourable resource for biocontrol of soil-borne and growth percentage of V. dahliae. Overall, growth pathogens. Since they mostly live in the rhizosphere they inhibition occurred by either production of clear zone can affect the competitive ability of target pathogens between the two colonies or by direct overgrowth on like V. dahliae. Indeed, the efficacy of Trichoderma the pathogen in dual cultures. Indeed, the production spp. as biocontrol agents against phypathogens has of fungal metabolites as an indirect mechanism could been demonstrated in previous studies (Naeimi et al., not be the primary biocontrol mechanism and it might 2010; Cheng et al., 2012; Widmer, 2014). The present be through inhibition, competition or direct killing investigation examined multiple criteria to assess the of the pathogen mycelium. These direct and indirect antagonistic activity of several strains of T. harzianum mechanisms may have effect on the biocontrol process against V. dahliae, the causal agent of Verticillium wilt that depends on the Trichoderma strain, the pathogen of strawberry. and the environmental conditions such as pH, nutrient In this study, 29 isolates of V. dahliae were availability and temperature (Benítez et al., 2004). collected from various strawberry growing areas in In addition, antifungal activity of T. harzianum Estonia. The isolates were similar in morphological isolates by production of volatile and non-volatile

142 ISSN 1392-3196 Zemdirbyste-Agriculture Vol. 103, No. 4 (2016) 403 metabolites was also tested in our study. Previous Center for Atmospheric Research, Colorado, USA) for investigations showed that antimicrobial metabolites of critical reading of the manuscript and giving valuable Trichoderma spp. are able to inhibit growth of a wide comments. Also, we are very grateful to farmers for their range of plant pathogens such as Staphylococcus aureus, support in the fields. Bipolaris sorokiniana, Bacillus subtilis, Streptococcus Received 04 05 2016 faecalis, Clavibacter michiganensis, Rhizoctonia solani, Accepted 05 09 2016 Botrytis cinerea, Curvularia lunata, Colletotrichum lagenarium, C. gloeosporioides, C. falcatum and References C. acutatum (Xiao-Yan et al., 2006; Porras et al., 2009). Benítez T., Rincón A. M., Limón M. C., Codón A. C. It has also been found that there is a large variety 2004. Biocontrol mechanisms of Trichoderma strains. of antifungal compounds such as harzianopyridone, International Microbiology, 7 (4): 249–260 harzianolide, azaphilone, diterpenes, peptaibols, Berbegal M., Ortega A., Jiménez-Gasco M. M., Olivares- butenolides, furanones, pyrones and pyridones produced García C., Jiménez-Díaz R. M., Armengol J. 2010. Genetic by T. harzianum which play an important role in controlling diversity and host range of Verticillium dahliae isolates from artichoke and other vegetable crops in Spain. Plant phytopathogens (Vinale et al., 2006; Siddiquee et al., Disease, 94: 396–404 2012). In this study, it was observed that volatile or non- http://dx.doi.org/10.1094/PDIS-94-4-0396 volatile metabolites of T. harzianum isolates produced Bissett J. 1991. A revision of the genus Trichoderma. II. were effective in inhibiting the mycelial growth of tested Infrageneric classification. Canadian Journal of Botany, V. dahliae in the culture medium which is in agreement 69: 2357–2372 http://dx.doi.org/10.1139/b91-297 with the general definition of antibiosis as the mechanism Cheng C. H., Yang C. A., Peng K. C. 2012. Antagonism of Trichoderma harzianum ETS 323 on Botrytis cinerea mediated by metabolites. mycelium in culture conditions. Phytopathology, 102 (11): This study also demonstrated that Verticillium 1054–1063 http://dx.doi.org/10.1094/PHYTO-11-11-0315 wilt of strawberry is controlled efficiently by treating Elad Y., Chet I., Henis Y. 1982. Degradation of plant pathogenic the strawberry soil or root with spore suspensions of fungi by Trichoderma harzianum. Canadian Journal of T. harzianum under greenhouse conditions, whereas Microbiology, 28: 719–725 severity of disease was significantly reduced in http://dx.doi.org/10.1139/m82-110 comparison with control plants. In a similar study, Directive 2009/128/EC of the European Parliament and of the Council of 21 October 2009 establishing a framework intensity of Verticillium disease was reduced when roots for Community action to achieve the sustainable use of of susceptible strawberry seedlings were soaked with pesticides. Official Journal of European Union, 309: 71−85 T. harzianum and T. viride isolates, and the treatment was FAOSTAT. 2013. World strawberry production http://faostat.fao. even more effective than the standard fungicide Topsin org/site/567/DesktopDefault.aspx?PageID=567#ancor M (Meszka, Bielenin, 2009). Many studies regarding Gordon T. R., Shaw D. V., Larson K. D. 2005. Comparative the efficacy of Trichoderma spp. in reducing disease response of strawberries to conidial root-dip inoculations and infection by soilborne microsclerotia of Verticillium severity of Verticillium wilt on different hosts have been dahliae Kleb. HortScience, 40 (5): 1398–1400 published, indicating that Trichoderma can be a dominant Harman G. E., Howell C. R., Viterbo A., Chet I., Lorito M. bio-agent in management strategies. However, decreased 2004. Trichoderma species opportunistic, avirulent plant severity of Verticillium wilt was found when plants had symbionts. Nature Reviews Microbiology, 2: 43–56 been treated with other antagonists (Naraghi et al., 2010; http://dx.doi.org/10.1038/nrmicro797 Zheng et al., 2011). Harris D. C., Yang J. R., Ridout M. S. 1993. The detection and estimation of Verticillium dahliae in naturally infested soil. Plant Pathology, 42 (2): 238–250 Conclusion http://dx.doi.org/10.1111/j.1365-3059.1993.tb01496.x Hassan M. M. 2014. Influence of protoplast fusion between two The present study showed the capability of Trichoderma spp. on extracellular enzymes production and volatile and non-volatile metabolites of Trichoderma antagonistic activity. Biotechnology and Biotechnological harzianum, isolated from field-grown strawberries Equipment, 28 (6): 1014–1023 in the Unipiha area, Estonia in reducing the mycelial http://dx.doi.org/10.1080/13102818.2014.978206 growth of Verticillium dahliae. Both volatile and non- Klosterman S. J., Atallah Z. K., Vallad G. E., Subbarao K. V. 2009. Diversity, pathogenicity, and management of Verticillium volatile metabolites could be also involved in controlling species. Annual Review of Phytopathology, 47: 39–62 Verticillium wilt under greenhouse conditions. The http://dx.doi.org/10.1146/annurev-phyto-080508-081748 outcomes may have practical applications in fields Larkin R. P., Fravel D. R. 2002. Effects of varying environmental naturally infested by V. dahliae with the aim of conditions on biological control of Fusarium wilt of protecting biological resources as well as confining the tomato by nonpathogenic Fusarium spp. Phytopathology, use of chemical compounds. Field experiments, efficient 92 (11): 1160–1166 formulation and studies on the mechanism of interactions http://dx.doi.org/10.1094/PHYTO.2002.92.11.1160 Meszka B., Bielenin A. 2009. Bioproducts in control of between biocontrol agent, pathogen and plant should be strawberry Verticillium wilt. Phytopathology, 52: 21–27 the main goals of future research. Mirmajlessi S. M., Safaie N., Ahari H. M., Mansouripour S. M., Mahmoudy S. B. 2012. Genetic diversity among crown and root rot isolates of Rhizoctonia solani isolated from Acknowledgements cucurbits using PCR based techniques. African Journal of This work was supported by EUPHRESCO Agricultural Research, 7 (4): 583–590 (European Phytosanitary Research Coordination) Mirmajlessi S. M., Destefanis M., Gottsberger R. A., Mänd M., Phytosanitary ERA-Net project SPAT (Strawberry Loit E. 2015. PCR-based specific techniques used for Pathogens Assessment and Testing), European Union detecting the most important pathogens on strawberry: a through the European Regional Development Fund systematic review. Systematic Review, 4: 9 http://dx.doi.org/10.1186/2046-4053-4-9 (contract No. 10.1-9/14/471) and institutional research Miyazaki K., Tsuchiya Y., Okuda T. 2009. Specific PCR assays funding (IUT36-2) of the Estonian Ministry of Education for the detection of Trichoderma harzianum causing green and Estonian Science Foundation (Grant No. 9450). The mold disease during mushroom cultivation. Mycoscience, authors specially thank Prof. Peter Harley (National 50: 94–99 http://dx.doi.org/10.1007/S10267-008-0460-2

143 404 Screening of native Trichoderma harzianum isolates for their ability to control Verticillium wilt of strawberry

Naeimi S., Okhovvat S. M., Javan-Nikkhah M., Vagvolgyi Suga H., Hirayama Y., Suzuki T., Kageyama K., Hyakumachi M. C., Khosravi V., Kredics L. 2010. Biological control of 2013. Development of PCR primers to identify Fusarium Rhizoctonia solani AG1-1A, the causal agent of rice oxysporum f. sp. fragariae. Plant Disease, 97 (5): 619–625 sheath blight with Trichoderma strains. Phytopathologia http://dx.doi.org/10.1094/PDIS-07-12-0663-RE Mediterranea, 49: 287−300 Vinale F., Marra R., Scala F., Ghisalberti E. L., Lorito M., Naraghi L., Heydari A., Rezaee S., Razavi M., Afshari-Azad H. Sivasithamparam K. 2006. Major secondary metabolites 2010. Biological control of Verticillium wilt of greenhouse produced by two commercial Trichoderma strains active cucumber by Talaromyces flavus. Phytopathologia against different phytopathogens. Letters in Applied Mediterranea, 49: 321−329 Microbiology, 43: 143–148 Padder B. A., Sharma P. N. 2011. In vitro and in vivo http://dx.doi.org/10.1111/j.1472-765X.2006.01939.x antagonism of biocontrol agents against Colletotrichum Widmer T. L. 2014. Screening Trichoderma species for lindemuthianum causing bean anthracnose. Archives of biological control activity against Phytophthora ramorum Phytopathology and Plant Protection, 44 (10): 961–969 in soil. Biological Control, 79: 43–48 http://dx.doi.org/10.1080/03235400903460619 http://dx.doi.org/10.1016/j.biocontrol.2014.08.003 Porras M., Barrau C., Romero F. 2009. Biological control of Xiaojun Ch., Wongkaew S., Jie Y., Xuehui Y., Haiyong H., Anthraconse with Trichoderma in strawberry fields. Acta Shiping W., Qigqun T., Lishuang W., Athinuwat D., Horticulturae, 842: 351–354 Buensanteai N. 2014. In vitro inhibition of pathogenic http://dx.doi.org/10.17660/ActaHortic.2009.842.66 Verticillium dahliae, causal agent of potato wilt disease Sharma P. 2011. Complexity of Trichoderma-Fusarium in China by Trichoderma isolates. African Journal of interaction and manifestation of biological control. Biotechnology, 13 (33): 3402−3412 Australian Journal of Crop Science, 5 (8): 1027–1038 http://dx.doi.org/10.5897/AJB2013.12195 Shishido M., Miwa Ch., Usami T., Amemiya Y., Johnson K. B. Xiao-Yan S., Qing-Tao S., Shu-Tao X., Xiu-Lan C., Cai-Yun S., 2005. Biological control efficiency of Fusarium wilt Yu-Zhong Z. 2006. Broad-spectrum antimicrobial activity of tomato by nonpathogenic Fusarium oxysporum Fo- and high stability of Trichokonins from Trichoderma B2 in different environments. Phytopathology, 95 (9): koningii SMF2 against plant pathogens. FEMS 1072−1080 http://dx.doi.org/10.1094/PHYTO-95-1072 Microbiology Letters, 260 (1): 119–125 Siddiquee S., Cheong B. E., Taslima K., Kausar H., Hasan M. M. http://dx.doi.org/10.1111/j.1574-6968.2006.00316.x 2012. Separation and identification of volatile compounds Zheng Y., Xue Q. Y., Xu L. L., Xu Q., Lu S., Gu, C., Guo J. H. from liquid cultures of Trichoderma harzianum by GC- 2011. A screening strategy of fungal biocontrol agents MS using three different capillary columns. Journal of towards Verticillium wilt of cotton. Biological Control, Chromatographic Science, 50: 358–367 56: 209–216 http://dx.doi.org/10.1093/chromsci/bms012 http://dx.doi.org/10.1016/j.biocontrol.2010.11.010 ISSN 1392-3196 / e-ISSN 2335-8947 Zemdirbyste-Agriculture, vol. 103, No. 4 (2016), p. 397‒404 DOI 10.13080/z-a.2016.103.051

Trichoderma harzianum vietinių izoliatų tinkamumas kontroliuoti braškių verticiliozę

S. M. Mirmajlessi1, M. Mänd1, N. Najdabbasi1, I. Larena2, E. Loit1 1Estijos gyvybės mokslų universiteto Žemės ūkio ir aplinkos mokslų institutas 2Ispanijos žemės ūkio tyrimų ir technologijos institutas

Santrauka Tirtas Trichoderma harzianum vietinių izoliatų antagonizmas braškių patogenui Verticillium dahliae. Tuo tikslu Estijoje penkiose braškių auginimo vietose du vegetacijos laikotarpius grybai buvo išskirti iš rizosferos bei dirvožemio ir ištirti laboratorijoje bei lauko sąlygomis. T. harzianum kolonijos buvo išskirtos naudojant selektyvinę terpę po 12 dienų ir identifikuotos naudojant rūšiai būdingus pradmenis. Visi Trichoderma izoliatai gamino lakius ir nelakius metabolitus. Tyrimui šiltnamyje buvo pasirinkti septyni izoliatai, kurie pasižymėjo stipriausiu patogeną slopinančiu poveikiu. Šiltnamyje ligos pažeidimas matuotas skaidytų laukelių variantų metodu, naudojant septynis izoliatus dviem pagrindiniams variantų veiksniams (dirvožemiui ir šaknims). Šiltnamio tyrimo duomenys parodė, kad slopinant braškių verticiliozę nebuvo reikšmingo skirtumo tarp T. harzianum izoliatų, bet tarp pasirinktų T. harzianum izoliatų efektyviausias buvo TU79. Esant kryžminei sąveikai tarp antagonistinių izoliatų ir jų variantų minimalus ligos pažeidimas buvo esminis, kai dirvožemis ir šaknys buvo paveikti TU79 izoliatu. Tačiau esminis skirtumas nebuvo nustatytas, kai šis izoliatas buvo naudojamas vien tik dirvožemiui. Tyrimo rezultatai parodė, kad vietiniai T. harzianum izoliatai, surinkti Estijos laukuose, pasižymi antagonistiniu poveikiu V. dahliae ir todėl gali būti plačiai naudojami verticiliozės kontrolei braškių augynuose. Reikšminiai žodžiai: lakūs metabolitai, nelakūs metabolitai, Trichoderma harzianum, Verticillium dahliae.

Please use the following format when citing the article: Mirmajlessi S. M., Mänd M., Najdabbasi N., Larena I., Loit E. Screening of native Trichoderma harzianum isolates for their ability to control Verticillium wilt of strawberry. Zemdirbyste-Agriculture, 103 (4): 397–404 DOI 10.13080/z-a.2016.103.051

144 CURRICULUM VITAE

Name: Seyed Mahyar Mirmajlessi Date of birth: 04.07.1981 Address: Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences, Kreutzwaldi 1, Tartu, Estonia. Email: [email protected]; [email protected]

Education: 2013 – 2017 PhD studies in Plant Pathology, Institute of Agricul- tural and Environmental Sciences, Estonian Univer- sity of Life Sciences. 2005 – 2008 Master studies in Plant Pathology, Faculty of Agri- culture, Tarbiat Modares University, Tehran, Iran. 2001 – 2005 Bachelor studies in Plant Protection, Faculty of Agriculture, Shahid Bahonar University, Kerman, Iran.

Institution and position held: 2014 – 2017 Junior researcher, Institute of Agricultural and Envi- ronmental Sciences, Estonian University of Life Sciences, Estonia. 2008 – 2013 Researcher, Department of Plant Protection, Agri- cultural, Medical and Industrial Research Center, Iran. 2007 – 2008 Laboratory assistant, Department of Plant Pathol- ogy, Tarbiat Modares University, Iran.

Participation in research project: 2016 – Principle investigator at international IPMBlight2.0 project, “Sustainable control of potato late blight-exploiting pathogen population data for optimized decisions support systems”, Tartu, Estonia. 2016 – Research assistant at international cooperation research activity EUPHRESCO, “The biology and epidemiology of “Candidatus Liberibacter solanacearum” and potato phytoplasmas and their contribution to risk management in potato and other crops”, Tartu, Estonia. 145 2013 – 2016 Research assistant at international cooperation research activity EUPHRESCO II, “Assessment and testing of strawberry pathogens”, Tartu, Estonia. 2010 – 2013 Principle investigator, “Production of wheat resistance cultivars to new race of wheat black stem rust (ug99) using nuclear technology”, Tehran, Iran. 2010 – 2013 Principle investigator at international IAEA technical cooperation project, “Responding to the transboundary threat of wheat black stem rust (UG99)”, Tehran, Iran. 2009 – 2011 Principle investigator, “controlling postharvest disease in red and golden delicious apple (associated with Penicillium expansum) by irradiation technique combined with biological control”, Tehran, Iran. 2007 – 2011 Research assistant, “Application of avirulence mutant of Fusarium solani f.sp. phaseoli in biological control of Fusarium root rot of bean (Phaseolus vulgaris)”, Iran.

Training and special course: 01.05.–16.05. Training period on the preparation of mass produc- 2017 tion of conidia of biological control agent (project No. RTA2013-00060-C05-01), Madrid, Spain 15.04.- 01.07. Training period on the specific detection of the 2015 most important quarantine and emerging strawberry pathogens (project No. 266505 EUPHRESCO II-SPAT), Madrid, Spain. 2015 Workshop, “Quantitative real-time PCR”, Tartu, Estonia. 2015 Workshop, “Principles of real-time PCR, general description operating and maintenance procedures”, Tartu, Estonia. 2015 CEFO PhD course, “Natural Resource use”, Uppsala, Sweden. 2014 NOVA PhD course, “Molecular methods for detection of food-borne pathogens”, Helsinki, Finland. 2014 PhD course, “Presentation skills”, Tartu, Estonia. 2011 Workshop, “Principles and methods of scientific writing”, Tehran, Iran. 2010 Workshop, “Work safety with chemical materials”, Tehran, Iran. 146 2009 Workshop instructor, “Application of nuclear technology and molecular markers in agricultural and environmental sciences”, Tehran, Iran.

Membership: 2016 – EC Microbiology Editorial Board 2010 – 2014 Scientific member and technical manager of Sapemco Company (section of Pest Management). 2011 – Scientific and board member of Behgaman Toseye Novine Golestan Company (with agricultural engineering services).

147 ELULOOKIRJELDUS

Nimi: Seyed Mahyar Mirmajlessi Sünniaeg: 04.07.1981 Aadress: Eesti Maaülikool, põllumajandus Eesti E-post: [email protected]; [email protected]

Haridus: 2013 – 2017 Doktorantuur (taimepatoloogia eriala), Põllumajan- dus- ja keskkonnainstituut, Eesti Maaülikool. 2005 – 2008 Magistrantuur (taimepatoloogia eriala), põllumajan- duse teaduskond, Tarbiat Modares Ülikool (TMU), Teheran, Iraan. 2001 – 2005 Bakalaureuseõpe (taimekaitse eriala), põllumajan- duse teaduskond, Shahid Bahonar’i Ülikool, Ker- man, Iraan.

Töökogemus: 2014 – 2017 Nooremteadur, Põllumajandus- ja keskkonnainstituut, Eesti Maaülikool. 2008 – 2013 Teadur, taimekaitse osakond, Põllumajanduse, meditsiini ja tööstusuuringute instituut, Iraan. 2007 – 2008 Laboriassistent, taimepatoloogia osakond, Tarbiat Modares Ülikool (TMU), Iraan.

Osalemine teadusprojektides: 2016 – Põhitäitja rahvusvahelises projektis IPMBlight2.0, “Sustainable control of potato late blight-exploiting pathogen population data for optimized decisions support systems”, Tartu, Eesti. 2016 – Teadusassistent rahvusvahelises teadusalases koostöö- võrgustikus EUPHRESCO, “The biology and epidemiology of Candidatus Liberibacter solanacearum and potato phytoplasmas and their contribution to risk management in potato and other crops”, Tartu, Eesti. 2013 – 2016 Teadusassistent rahvusvahelises teadusalases koos- töövõrgustikus EUPHRESCO II, “Assessment and testing of strawberry pathogens”, Tartu, Eesti.

148 2010 – 2013 Põhitäitja projektis “Production of wheat resistance cultivars to new race of wheat black stem rust (ug99) using nuclear technology”, Teheran, Iraan. 2010 – 2013 Põhitäitja rahvusvahelises IAEA tehnilise koostöö projektis “Responding to the transboundary threat of wheat black stem rust (UG99)”, Teheran, Iraan. 2009 – 2011 Põhitäitja, “controlling postharvest disease in red and golden delicious apple (associated with Penicil- lium expansum) by irradiation technique combined with biological control”, Teheran, Iraan. 2007 – 2011 Teadusassistent, “Application of avirulence mutant of Fusarium solani f.sp. phaseoli in biological control of Fusarium root rot of bean (Phaseolus vulgaris)”, Iraan.

Täiendkoolitused: 01.05.- 16.05. Koolitus “The preparation of mass production of 2017 conidia of biological control agent” (project No. RTA2013-00060-C05-01), Madriid, Hispaania 15.04.- 01.07. Koolitus “The specific detection of the most impor- 2015 tant quarantine and emerging strawberry pathogens” (project No. 266505 EUPHRESCO II-SPAT), Madriid, Hispaania. 2015 Õppepäev, “Quantitative real-time PCR”, Tartu, Eesti. 2015 Õppepäev, “Principles of real-time PCR, general description operating and maintenance procedures”, Tartu, Eesti. 2015 CEFO kursus doktorantidele, “Natural Resource use”, Uppsala, Rootsi. 2014 NOVA kursus doktorantidele, “Molecular methods for detection of food-borne pathogens”, Helsingi, Soome. 2014 Kursus doktorantidele, “Presentation skills”, Tartu, Eesti. 2011 Õppepäev “Principles and methods of scientific writing”, Teheran, Iraan. 2010 Õppepäev “Work safety with chemical materials”, Teheran, Iraan.

149 2009 Õppepäeva juhendaja, “Application of nuclear technology and molecular markers in agricultural and environmental sciences”, Teheran, Iraan.

Liikmelisus: 2016 – EC Microbiology, ajakirja toimetuskolleegiumi liige 2010 – 2014 Sapemco Company (taimekaitse sektsioon), teadus- nõukogu liige ja tehniline korraldaja 2011 – Behgaman Toseye Novine Golestan Company, nõus- tamiskogu liige

150 LIST OF PUBLICATIONS

Publications indexed in the Thomson Reuters Web of Science database (1.1)

Mirmajlessi SM, Bahram M, Mänd M, Loit E, 2017. Assessment of soil fungal communities in strawberry fields using high-throughput sequencing. European Journal of Plant Pathology, (Under Review). Mirmajlessi SM, Mänd M, Najdabbasi N, Larena I, Loit E, 2016. Screening of native Trichoderma harzianum isolates for their ability to control Verticillium wilt of strawberry in Estonia. Zemdirbyste-Ag- riculture, 103(4), 397–404. Mirmajlessi SM, Larena I, Mänd M, Loit E, 2016. A rapid diagnostic assay for detection and quantification of the causal agent of strawberry wilt from field samples. Acta Agriculturae Scandinavica, Section B — Soil & Plant Science, 66(7), 619–629. Mirmajlessi SM, Larena I, Mänd M, Loit E, 2016. First report on the detection and quantification of Verticillium dahliae from Estonian strawberry fields using quantitative real-time PCR. Zemdirbyste-Ag- riculture, 103(1): 115–118. Mirmajlessi SM, Destefanis M, Gottsberger RA, Mänd M, Loit E, 2015. PCR-based specific techniques used for detecting the most important pathogens on strawberry: a systematic review. Systematic Reviews, 4:9. Mirmajlessi SM, Mänd M, Loit E, Mansouripour SM, 2015. An overview of real-time PCR applied to study on plant pathogens: potential applications in diagnosis. Plant Protection Science, 51(4): 177–190. Mostafavi HA, Mirmajlessi SM, Fathollahi H, Shahbazi S, Mirjalili SM, 2013. Integrated effect of gamma radiation and biocontrol agent on quality parameters of apple fruit; an innovative commercial preservation method. Radiation Physics and chemistry, 91: 193–199. Mostafavi HA, Mirmajlessi SM, Mirjalili SM, Fathollahi H, Askari H, 2012. Gamma radiation effects on physico-chemical parameters of apple fruit during commercial post-harvest preservation. Radiation Physics and chemistry, 81: 666-671. Mirmajlessi SM, Safaie N, Mostafavi HA, Mansouripour SM, Mahmoudy SB, 2012. Genetic diversity among crown and root rot isolates of

151 Rhizoctonia solani isolated from cucurbits using PCR-based techniques. African Journal of Agricultural Research, 7(4), 583-590. Mostafavi HA, Mirmajlessi SM, Safaie N, Minassyan V, Fathollahi H, Dorri HR, Mansouripour SM, 2012. The use of a gamma-irradiated mutant of Fusarium solani f.sp. phaseoli with reduced pathogenecity on the biological control of Fusarium root rot of bean (Phaseolus vulgaris) in field conditions. Journal of Agricultural Science and Tech- nology, 14: 1415-1423. Mostafavi HA, Mirmajlessi SM, Fathollahi H, Minassyan V, Mirjalili SM, 2011. Evaluation of gamma irradiation effect and Pseudomonas flourescens against Penicillium expansum. African Journal of Biotech- nology, 10(54): 11290-11293. Mostafavi HA, Fathollahi H, Motamedi F, Mirmajlessi SM, 2010. Food irradiation: applications, public acceptance and global trade. African Journal of Biotechnology, 9(20), 2826-2833.

Publications in other peer-reviewed research journals (1.2)

Mirmajlessi SM, Loit E, Mänd M, 2016. General Principles of real-time PCR: a technology for quantitative detection of phytopathogens. Journal of Medical and Bioengineering, 5(1): 49-52. Mostafavi HA, Mirmajlessi SM, Mirjalili SM, Fathollahi H, Mansouri- pour SM, Babaei M, 2012. Effect of gamma irradiation on spore germination and mycelial growth of Penicillium expansum, postharvest disease of apple fruit. Journal of Nuclear Science and Technology, 58: 49-54. Mirmajlessi SM, Safaie N, Mostafavi HA, Mahmoudi SB, 2011. Study of pathogenicity of Rhizoctonia solani, the causal agent of crown and root rot of cucurbits in Iran. Journal of Research in Plant Pathology, 1: 27-35.

Publications in books (3.1)

Mostafavi HA, Mirmajlessi SM, Fathollahi H, 2012. Trends in vital food and control engineering. In: The potential of food irradiation: benefits and limitations, Ayman Amer Eissa (Ed.), Intech Open Access Pub- lisher, Rijeka, Croatia, 43-69.

152 Publications in national and international conferences (5.1; 5.2)

Mirmajlessi SM, Mänd M, Bahram M, Loit E, 2017. Unravelling of soil fungal communities associated with strawberry fields in Estonia: application of Illumina amplicon sequencing. 12th Conference of the European Foundation for Plant Pathology, 29 May-2 Jun, Dunker- que-Malo-les-Bains, France. Mirmajlessi SM, Larena I, Mänd M, Loit E, 2017. A real-time PCR assay for detection and quantification of Verticillium dahliae from field samples. International Conference on Innovations in Science and Education. 22-24 March, Prague, Czech. (5.1) Mirmajlessi SM, Mänd M, Najdabbasi N, Loit E, 2016. Inhibitory effect of Trichoderma harzianum metabolites on strawberry verticillium wilt. The 68th International Symposium on Crop Protection. 17 May, Ghent, Belgium. (5.1) Mirmajlessi SM, Mostafavi HA, Mänd M, Loit E, 2015. Post-harvest preservation of apple fruits using integration of gamma irradiation and biocontrol agent. III International Symposium on Postharvest Pathology. 7-11 June, Bari, Italy. (5.1) Mirmajlessi SM, Destefanis M, Gottsberger RA, Mänd M, Loit E, 2015. A systematic review of PCR-based specific methods to detect the most important strawberry pathogens. XVIII International Plant Protection Congress. 24–27 August, Berlin, Germany. (5.1) Mirmajlessi SM, Loit E, Mänd M, 2015. General principles of real- time PCR. International Conference on Environmental Science and Development, 14-15 Feb., Amsterdam, Netherlands. Mirmajlessi SM, Loit E, Mänd M, Mansouripour SM, 2014. Develop- ment of quantitative PCR techniques for plant pathogens diagnostic research. 11th Conference of the European Foundation for Plant Pathology, 8-13 Sep., Kracow, Poland. (5.1) Mirmajlessi SM, 2014. 5th International Seed Health Conference. 12 September. Krakow, Poland. Mirmajlessi SM, Loit E, Mostafavi HA, Mänd M, 2014. A short review on application of radiation and genetic engineering techniques to improve biocontrol agents activity against plant pathogens. The 7th Annual International Symposium on Agriculture, 14-17 July, Ath- ens, Greece. (5.1)

153 Shahbazi S, Mostafavi HA, Ebrahimi MA, Askari H, Mirmajlessi SM, Karimi M, 2013. Enhancement of chitinase gene activity in mutated Trichoderma harzianum via gamma radiation. Crop Biotechnology, 3 (5), 33−40. (5.2) Moradi R. Shahbazi S, Mostafavi HA, Ebrahimi MA, Askari H, Mirma- jlessi SM, 2013. Investigation of gamma radiation effects on morphological and antagonistic characteristics of Trichoderma harzianum. Crop Biotechnology, 3 (4), 109−117. (5.2) Moradi R, Shahbazi S, Mostafavi HA, Askari H, Mirmajlessi SM, Ebra- himi MA, 2012. Effect of gamma irradiation on glucanase and chitinase genes of Trichoderma harizianum irradiated using STS marker. The 12th Genetic Conference, 20-22 May, Tehran, Iran. (5.2) Shahbazi S. Askari H. Mostafavi H.A, Mirmajlessi SM, 2012. Molecular and enzymatic study of mutant Trichoderma endochitinase using specific markers. The 3rd Iranian Agricultiral Biotechnology Confer- ence. 3-5 Sep., Mashhad, Iran. (5.2) Shahbazi S, Askari H, Mostafavi HA, Mirmajlessi SM, 2012. Increas- ing of antagonistic potential of Trichoderma using mutation in Glu- canase enzyme. The 3rd Iranian Agricultiral Biotechnology Confer- ence. 3-5 Sep., Mashhad, Iran. (5.2) Moradi R. Shahbazi S, Mostafavi HA, Askari H, Mirmajlessi SM, Ebra- himi MA, 2012. Determination of optimum dose of gamma irradiation in order to induce mutation in Trichoderma viride. The 18th Iranian’s Nuclear Conference, 22-23 Feb., Yazd, Iran. (5.2) Mohammadi E, Zabihi M, Shahbazi S, Mostafavi HA, Askari H, Moradi R, Mirmajlessi SM, Ebrahimi MA, 2012. Effect of gamma irradiation on endochitinase activities of Trichoderma spp. The 18th Iranian’s Nuclear Conference, 22-23 Feb., Yazd, Iran. (5.2) Shahbazi S, Moradi R, Mostafavi HA, Mirmajlessi SM, Askari H, Safaie N, Pirvali N, 2011. Detoxification of the Fusarium toxin deoxyni- valenol using glucosyltransferase enzyme. National Conference on Sustainable Agriculture, 1 Dec., Varamin, Iran. (5.2) Moradi R, Shahbazi S, Askari H, Mostafavi HA, Mirmajlessi SM, Ebra- himi MA, 2011. The increase of antagonistic effect of Trichoderma harzianum against Rhizoctonia solani using gamma irradiation. National Conference on Sustainable Agriculture, 1 Dec., Varamin, Iran. (5.2) Moradi R, Mostafavi HA, Mirmajlessi SM, Shahbazi S, Ebrahimi MA, Fathollahi H, Hallajian MT Babaei M, 2011. Determination of opti-

154 mum dose of radiation in order to induce the optimal mutation and evaluation of morphological effects in Trichoderma spp. species. The 1th National Conference on Modern Agricultural Sciences and Technologies, 10-12 Sep., Zanjan, Iran. (5.2) Mostafavi HA, Mirjalili SM, S Mirmajlessi SM, Fathollahi H, Man- souripour SM, Babaei M, 2011. The effective impact of Pseudomonas fluorescens and gamma irradiation on the development of Penicillium expansum. The 19th Plant Protection Congress, 31July-3Aug., Teh- ran, Iran. (5.2) Mostafavi HA, Mirjalili SM, Mirmajlessi SM, Fathollahi H, Mansouri- pour SM, Babaei M, 2010. Effect of gamma irradiation on spore germination and mycelial growth of Penicillium expansum, postharvest disease agent of apple fruit. The 3rd National Congress of Nuclear Technology Application in Agricultural and Natural Resource Sci- ence, 13-15 Aug., Karaj, Iran. (5.2) Mirmajlessi SM, Mansouripour SM, 2010. Application of nanotech- nology in agricultural science. The 3rd National Congress of Nuclear Technology Application in Agricultural and Natural Resource Sci- ence, 13-15 Aug., Karaj, Iran. (5.2) Mirmajlessi SM, Safaie N, Mahmoudi SB, 2008. Genetic diversity of Rhizoctonia solani, the causal agent of crown and root rot of cucurbits using RAPD and ISSR markers in Iran. The 18th Plant Protection Congress, 24-27 Aug., Hamedan, Iran. (5.2) Mirmajlessi SM, Safaie N. Mahmoudi SB, 2008. Genetic diversity of Rhizoctonia solani AG4, the causal agent of cucurbits root and crown rot using ISSR analysis in Iran. The 2th National Congress of Cellular and Molecular Biology, 29-30 Jan., Kerman, Iran. (5.2) Mirmajlessi SM, Safaie N. Mahmoudi SB, 2007. Genetic diversity of Rhizoctonia solani AG4, the causal agent of crown and root rot of cucurbits in Iran. The 5th National Biotechnology Congress, 24-26 Nov. Tehran, Iran. (5.2)

155

Viis viimast kaitsmist

MEELIS TEDER THE ROLE OF INSTITUTIONAL INNOVATION IN THE DEVELOPMENT OF THE ESTONIAN FOREST SECTOR INSTITUTSIONAALSE INNOVATSIOONI ROLL EESTI METSASEKTORI ARENGUS Dr. Paavo Kaimre, professor Peeter Muiste 13. veebruar 2017

KALEV ADAMSON Distribution and population genetic analyses of the agents of invasive needle and shoot diseases of conifers in northern Europe Invasiivsete okka- ja võrsEhaiguste levik ja nende tekitajate populatsioonide võrdlev analüüs okaspuudel Põhja-Euroopas Dotsent Rein Drenkhan 28. märts 2017

SANDRA METSLAID ASSESSMENT OF CLIMATE EFFECTS ON SCOTS PINE (PINUS SYLVESTRIS L.) GROWTH IN ESTONIA KLIIMA MÕJU HINDAMINE HARILIKU MÄNNI (PINUS SYLVESTRIS L.) KASVULE EESTIS Professor Andres Kiviste, dotsent Ahto Kangur 6. juuni 2017

NELE NUTT THE PERCEIVABLE LANDSCAPE A THEORETICAL-METHODOLOGICAL APPROACH TO LANDSCAPE TAJUTAV MAASTIK TEOREETILIS-METODOLOOGILINE KÄSITLUS MAASTIKUST Dr. Juhan Maiste (Tartu Ülikool), professor Zenia Kotval (Michigan State University, USA; Tallinna Tehnikaülikool) 15. juuni 2017

TIIA DRENKHAN INTERACTION BETWEEN LARGE PINE WEEVIL (HYLOBIUS ABIETIS L.) PATHOGENIC AND SAPROTROPHIC FUNGI AND VIRUSES HARILIKU MÄNNIKÄRSAKA (HYLOBIUS ABIETIS L.) SEOS PATOGEENSETE JA SAPROTROOFSETE SEENTE NING VIIRUSTEGA Dotsent Kaljo Voolma, dotsent Ivar Sibul, Risto Aarne Olavi Kasanen (Helsingi Ülikool, Soome) 19. juuni 2017

ISBN 978-9949-569-85-4 (trükis) ISBN 978-9949-569-86-1 (pdf) ISSN 2382-7076