Neuronal and Molecular mechanisms of thermonociception in Caenorhabditis elegans
INAUGURALDISSERTATION
Zur Erlangung der Doktorwürde der Fakultät für Biologie der Albert-Ludwigs-Universität Freiburg im Breisgau
vorgelegt von Shu Liu geboren in Henan, VR China
Freiburg im Breisgau, 2011
Die vorliegende Arbeit wurde in der Zeit von März 2007 bis Juni 2011 in der Biologie III der Albert-Ludwigs-Universität Freiburg unter Anleitung von Prof. Dr. Ralf Baumeister durchgeführt.
Hiermit erkläre ich an Eides Statt, dass die vorgelegte Arbeit ohne zulässige Hilfe Dritter und ohne Benutzung anderer als der angegebenen Hilfsmittel angefertigt wurde. Die aus anderen Quellen direkt oder indirekt übernommenen Daten und Konzepte sind unter Angabe der Quellen gekennzeichnet. Insbesondere habe ich hierfür nicht die entgeltliche Hilfe von Vermittlungs- beziehungsweise Beratungsdiensten (Promotionsberater oder anderer Personen) in Anspruch genommen. Niemand hat von mir unmittelbar oder mittelbar geldwerte Leistungen für Arbeiten erhalten, die im Zusammenhang mit dem Inhalt der vorgelegten Dissertation stehen. Die vorgelegte Arbeit wurde bisher weder im In- noch im Ausland in gleicher oder ähnlicher Form einer anderen Prüfungsbehörde vorgelegt. Die Bestimmung der Promotionsordnung der Fakultät für Biologie der Universität Freiburg ist mir bekannt, insbesondere weiß ich, dass ich vor Vollzug der Promotion zur Führung des Doktortitels nicht berechtigt bin.
Shu Liu Freiburg, den 09.06.2011
Dekan der Fakultät: Prof. Dr. Gunther Neuhaus Promotionsvorsitzender: Prof. Dr. Stefan Rotter
1. Prüfer/Referent (Betreuer der Arbeit): Prof. Dr. Ralf Baumeister 2. Prüfer/Korreferent: Prof. Dr. Bernd Fakler 3. Prüfer: Prof. Dr. Matthias Müller
Datum der Promotion: 26.09.2011
1 Summary______1
2 Introduction ______3
2.1 The pain system in mammals ______3 2.1.1 The primary afferent nociceptors ______3 2.1.2 Detectors of noxious stimuli ______4 2.1.3 Pain pathway neurotransmission______6
2.2 Model systems for heat pain research ______7
2.3 The model organism Caenorhabditis elegans______8 2.3.1 The nervous system of C. elegans______8 2.3.2 TRPV1 channel family ______10 2.3.3 CNG channel family ______11 2.3.4 Nociceptive behavior in C. elegans______12 2.3.5 Thermosensation (thermotaxis) in C. elegans ______14
2.4 Aim of the work ______15
3 Results______16
3.1 Differences among the Tav response and the heat shock response ______16
3.2 Differences among the Tav response and the light avoidance response ______17
3.3 Characterization of the neural circuits in noxious heat perception in the anterior and posterior part of C. elegans ______18 3.3.1 Identification of the candidate head sensory neurons involved in noxious heat perception ______18 3.3.2 Characterization of the roles of AFD and FLP as thermonociceptors by laser and genetic neuron ablation ______20 3.3.3 Dissection of the neural circuit involving the AFD sensory neurons in the head Tav response _____ 23 3.3.4 Identification of thermonociceptors in the posterior part of C. elegans ______24 3.3.5 Identification of the neural circuit of the tail Tav response______27 3.3.6 Calcium responses of the AFD, FLP and PHC sensory neurons to noxious heat stimuli ______28
3.4 Characterization of the roles of the TRPV1 channels in the Tav response in C. elegans 33 3.4.1 Contribution of the TRPV1 channels OCR-2 and OSM-9 in the head Tav response in the FLP sensory neurons ______33 3.4.2 Contribution of the TRPV1 channels OCR-2 and OSM-9 to the tail Tav response in the PHC sensory neurons ______36 3.4.3 Lacking of specific polyunsaturated fatty acids led to defective Tav response in C. elegans______38
3.5 Contribution of a cGMP signaling in AFD to the head Tav response______40
3.5.1 Mutations in tax-2 and tax-4 genes led to defective Tav response ______40 3.5.2 Cell-autonomous function of tax-2 and tax-4 in AFD in the head Tav response ______42 3.5.3 The gcy-12 mutant showed a severe defective head Tav response ______45
4 Materials ______47
4.1 Instruments______47
4.2 Chemicals and consumable supplies ______47
4.3 Buffers and Media ______48
4.4 Strains ______48 4.4.1 E. coli strains______48 4.4.2 C. elegans strains ______48
4.5 Plasmids ______52
4.6 Oligonucleotides ______53
5 Methods______56
5.1 C. elegans methods______56 5.1.1 Breeding of C. elegans ______56 5.1.2 Mating (Genetic crosses)______56 5.1.3 Worm lysis for Single worm PCR______56 5.1.4 Transformation of C. elegans ______56 5.1.5 RNAi (Interference) feeding ______57 5.1.6 Microscopy ______57 5.1.7 The thermal avoidance (Tav) assay______57 5.1.8 Heat stress assay with hsf-1(sy441) mutant______58 5.1.9 Dietary lipid supplementation ______58 5.1.10 2-photon neuron-laser-ablation______59 5.1.11 Calcium imaging and data analysis ______59
5.2 Molecular biology methods ______60 5.2.1 Polymerase chain reaction (PCR) ______60 5.2.2 Subcloning______61
6 Discussion______62
6.1 CNG channels are required in the AFD thermonociceptors, whereas FLP uses TRPV to sense noxious heat ______62
6.2 Thermonociception and thermotaxis use selective different cellular and molecular mechanisms to transduce sensory signals ______65
6.3 Different neuronal and molecular mechanisms are involved in the head Tav response and tail Tav response ______68
6.4 C. elegans model of noxious heat sensation ______71
7 Appendix ______73
7.1 List of Tables ______73
7.2 List of Figures______74
7.3 Abbreviations ______75
8 References______78
9 Acknowledgements ______91
10 Curriculum Vitae ______92
Summary 1
1 Summary
Noxious environmental stimuli, such as heat, trigger a survival response in animals resulting in reflexive escape reactions. The first molecular insight into the response to noxious heat came from the cloning and functional characterization of the rodent TRPV1 (transient receptor potential) channel protein, which is activated by capsaicin, the pungent ingredient in hot chili peppers (Caterina et al., 1999). In mice, TRPV1 is also activated by potentially cell-damaging, noxious temperatures exceeding ~43 °C (Caterina et al., 1999). However, TRPV1-deficient mice still show a remarkable behavioral response to noxious heat, suggesting the involvement of other heat-responsive proteins in these processes that are TRPV1-independent (Basbaum et al., 2009; Caterina et al., 2000; Woodbury et al., 2004). The nematode C. elegans responds to a wide variety of external stimuli, involving noxious chemicals, high osmolarities, acidic pH, noxious mechanical stimuli, harmful light (UV) and heat (Bargmann, 2006; Kaplan and Horvitz, 1993; Ward et al., 2008), but also temperature in the physiologically relevant range. C. elegans perceives temperatures in the range between 15 and 25 °C preferably by using a pair of sensory neurons AFD. These are connected to the AIY interneurons via chemical synapses (Kimura et al., 2004). This thermotaxis behavior is mediated by a cGMP signaling pathway activating the downstream tax-2 and tax-4 CNG channels (Inada et al., 2006). In vertebrate, the CNG (cGMP gated) channels have been implicated in the final step in the G-protein coupled transduction pathways in olfaction and vision (Wei et al., 1998). In C. elegans, tax-2 and tax-4 are required for different sensory sensation, such as the salt sensation in ASE, odorant sensation in AWC, CO2 avoidance in BAG and the temperature sensation in AFD, as well as in axon outgrowth in some sensory neurons (Bargmann and Mori, 1997). The C. elegans TRPV channels are also involved in many sensory transduction signaling. The osm-9 and five osm-9 / capsaicin receptor related genes ocr-1, ocr-2, ocr-3 and ocr-4 are coexpressed in sensory cilia and the distinct sensory functions arise from different combinations of osm-9 and related ocr proteins (Tobin et al., 2002). In AWA and ASH neurons, osm-9 and ocr-2 may form heteromeric channels in mediating the chemosensation and nociceptive behaviors, respectively (Bargmann, 2006). Our previous experiments established that C. elegans displays a pronounced acute withdrawal reaction when subjected to noxious temperatures (~35-38 °C) (Wittenburg and Baumeister, 1999). Using a local heat source provided by a red diode laser, we defined the head and tail of
Summary 2
C. elegans as responsive to thermonociception, indicating that the heat-receptive neurons are located in these regions (Wittenburg and Baumeister, 1999). However, due to the complexity of this nocifensive behavior, the neural circuits involved remain elusive, although from the study of mutants it was concluded that different neural circuits are required for thermotaxis and thermonociception (Glauser et al., 2011; Wittenburg and Baumeister, 1999). We now use laser microsurgery and genetic ablation of cells to identify sensory neurons and circuits in both head and tail that are involved in thermonociception. We find that the AFD thermosensory neurons not only sense temperatures between 15 and 25 °C, but also contribute to the perception of noxious heat above the threshold temperature 35 °C. Elimination of AFD, however, only resulted in a partial defect of the response, since a second pair of sensory neurons in the head, FLP, also function as nociceptors. Thermotaxis and thermonociception also differ in the neural circuits to which AFD couple, and use distinct sets of guanylyl cyclases functioning upstream of the CNG channels to mediate specific responses. The findings in this study also support a conserved function of the TRPV1 channels OCR-2 and OSM-9 in sensing noxious heat in both mammals and the C. elegans FLP and PHC neurons. Both channels act in parallel with the cGMP / CNG pathway in different types of nociceptors. Therefore, noxious temperatures are sensed by neurons in both head and tail involving circuits which use at least two separate signaling mechanisms. We suggest analogies to the vertebrate nociception, in which different types of C-fibers expressing TRPV1-dependent and -independent mechanisms, distinct repertoires of ion channels and receptors are involved in the sensation of painful heat (Woolf and Ma, 2007).
Introduction 3
2 Introduction
2.1 The pain system in mammals
2.1.1 The primary afferent nociceptors It is essential for the survival of animals and human beings to be able to sense and avoid stimuli capable of causing injury. This capability is gained during evolution through the development of a specialized apparatus, the nociceptor. It is a primary peripheral sensory neuron that is activated by noxious stimuli. The activation of nociceptors will elicit a pain sensation and thus protect the animals from potentially dangerous situations. The primary afferent fibers of nociceptors transmit the pain signal from the periphery into the dorsal horn of the spinal cord, and finally to the cortex via a relay in the thalamus. The peripheral terminals of nociceptors have been described as free nerve endings that dispersed over the body at all levels of the epithelium in numerous tissues and species. The cell bodies of nociceptors are located in peripheral ganglia (trigeminal for the face and dorsal root ganglia DRG for the body) (Julius and Basbaum, 2001). There are three main types of sensory fibers in the peripheral nervous system based on anatomical and functional criteria, Aβ-fibers, Aδ-fibers, and C-fibers. Aβ-fibers have large, highly myelinated cell bodies, but low activation threshold. Thus, most of the rapidly conducting Aβ-fibers detect innocuous stimuli, such as light touch, and do not contribute to pain sensation. On the contrary, medium-diameter, thinly myelinated Aδ-fibers possess higher activation threshold and respond to both thermal and mechanical noxious stimuli. The third class, the C-fibers, is also polymodal, responding to noxious thermal, chemical and mechanical stimuli. They are the smallest nociceptors and are unmyelinated, making them the slowest conducting, whereas, with the highest activation threshold. Thus, each nociceptor type is preferentially activated by high or low stimulating rates. Moreover, the Aδ nociceptors mediate the first, rapid, sharp pain and C nociceptors mediate the second, delayed, dull pain evoked by noxious stimuli (Dubin and Patapoutian, 2010), (Yeomans et al., 1996). Aδ-fibers are classified in two types on the basis of their temperature threshold, the type I nociceptors are activated by ~53 °C and the type II by ~43 °C. The temperature threshold for C-fibers is ~43 °C. Besides the normal C-fibers that are activated by noxious mechanical (M), heat (H) and cold (C) stimuli, there is a specialized class, the silent C-fibers. These C-fibers are normally heat-responsive, but mechanically insensitive and become sensitive only after being sensitized by inflammatory mediators (Basbaum et al., 2009).
Introduction 4
Figure 2.1-1 Different nociceptors detect different types of pain. (adapted from Julius and Basbaum, 2001). The peripheral nervous system is composed of medium- to large-diameter (Aα and Aβ) and small-diameter (Aδ) myelinated afferent fibers, as well as small-diameter unmyelinated C-fibers.
The heterogeneity of C-fibers is further demonstrated by means of the histochemical studies. Based on two distinct differentiation pathways in neurogenesis, the nociceptors are classified in three major classes. The different types express distinct repertoires of ion channels and receptors and innervate distinct peripheral and central targets. The so-called peptidergic nociceptors contain the peptide neurotransmitter substance P (SP) and calcitonin gene related peptide (CGRP). The persistence of the TrkA nerve growth factor receptor is essential for the differentiation of this type, thus, the peptidergic population is TrkA+. On the contrary, the nonpeptidergic nociceptors are negative for both TrkA and SP expression, but bind selectively + with the α-D-galactosyl-binding lectin IB4 (IB4 ), and express P2X3 receptors, a specific subtype of ATP-gated ion channel. In the nonpeptidergic nociceptors, instead of TrkA, the glial cell-derived growth factors (GDNF) function in controlling the cell fate (Woolf and Ma, 2007). The third subgroup of C-fibers is positive for both markers (TrkA+ / IB4+), and expresses SP, CGRP and also receptors for GDNF (Fang et al., 2006).
2.1.2 Detectors of noxious stimuli By analyzing the molecular targets of natural products which produce or modulate the pain sensation, more insights have been gained into the detectors in pain research. Among these natural products, capsaicin, the active ingredient of many hot and spicy foods, is well characterized in its function. In mammals, short exposure of the nociceptor terminals to capsaicin leads initially to excitation of the neurons, whereas prolonged exposure induces desensitization to capsaicin (Caterina and Julius, 2001). The screening for capsaicin receptor successfully detects the vanilloid receptor (TRPV1), a member of the transient receptor potential (TRP) channel family (Caterina et al., 1997). TRP proteins are non-selective cation
Introduction 5 channels with six membrane-spanning domains. They function in diverse cellular and physiological processes. On the basis of sequence homology and functional similarities, mammalian TRPs can be divided into seven subfamilies; TRPC (Canonical), TRPM (Melastatin), TRPV (Vanilloid), TRPA (Ankyrin), TRPP (Polycystin), TRPML (Mucolipin) and TRPN (no mechanoreceptor potential C) (Clapham et al., 2001). Among them, TRPV1-4, TRPM8 and TRPA1 are identified as six types of thermo-TRPs. While TRPV1 and TRPV2 are triggered by high noxious temperatures, TRPV3 and TRPV4 are activated by innocuous (>~30-33 °C and >24 °C) warm temperatures. On the contrary, TRPM8 and TRPA1 are sensitive to cool or cold temperature with threshold 25 °C and 18 °C, respectively (Clapham, 2007). The name vanilloid comes from the typical vanilloid structure of capsaicin. While capsaicin and the capsaicin analogue resiniferatoxin (RTX) activate TRPV1 channels, the capsaicin antagonist capsazepine and ruthenium red block its activation. TRPV1 can be directly activated by capsaicin and noxious heat (>43 °C) in isolated membrane patches without the involvement of cytoplasmic components. Furthermore, acidification generated during various forms of tissue injury can dramatically decrease the threshold for channel activity by both heat and capsaicin (Tominaga et al., 1998). Northern blot analysis confirmed the presence of TRPV1 transcripts in trigeminal and dorsal root sensory ganglia, predominantly in a subset of neurons with small diameters. This is reminiscent of the characters of the C-fibers, making the TRPV1 the main channel protein involved in noxious stimuli sensation (Caterina et al., 1997). Intriguingly, although several lines of evidence suggest the role of TRPV1 in noxious heat sensation, mice mutants for TRPV1 still show a marked behavioral response to noxious heat, suggesting the involvement of other channel proteins in this process (Caterina et al., 2000). One candidate channel, the TRPV2 shares ~50 % sequence identity with TRPV1. The temperature threshold of TRPV2 with 52 °C is higher than that of TRPV1. However, TRPV2 is expressed predominantly in myelinated mechanical nociceptors within the DRG, but not in the heat-responsive neurons, making it unlikely to be the channels involved in noxious temperature sensation (Lawson et al., 2008). Another likely candidate is a novel TRPV1 RNA splice variant TRPV1b, which is activated by temperature higher than 47 °C, but not by capsaicin or protons. Further evidence is required to analyze the function of TRPV1b in noxious heat sensation (Lu et al., 2005). A striking phenotype observed in the TRPV1 knockout mice is the absence in thermal hyperalgesia induced by inflammation, indicating the essential function of TRPV1 in inflammatory pain (Caterina et al., 2000). Furthermore, a unique type of IB4-positive but TRPV1 / TRPV2-negative small-diameter nociceptors with a
Introduction 6 high noxious heat threshold has been identified. Altogether, these observations suggest the existence of TRPV1 / TRPV2-dependent and TRPV1 / TRPV2-independent pain transduction mechanisms. While the former mechanism becomes important under pathophysiological conditions, the TRPV1 / TRPV2-independent mechanism functions under normal conditions (Woodbury et al., 2004).
Figure 2.1-2 Proposed transduction mechanisms in mammalian nociceptor peripheral terminals (adapted from Dubin and Patapoutian, 2001).
2.1.3 Pain pathway neurotransmission Glutamate, as the major excitatory neurotransmitter, is essential for pain signaling. Glutamate activates three distinct receptor subclasses, the α-amino-3-hydroxy 5-methyl-4-isoxazeloproprionic acid (AMPA) receptors, the N-methyl-D-aspartate (NMDA) receptors and the G-protein coupled metabotropic (mGluR) family of receptors. The role of ionotropic AMPA and NMDA receptors in pain has been very well described (D'Mello and Dickenson, 2008). Besides glutamate, nociceptors release other components as well, including variety of peptides, such as substance P, calcitonin gene related peptide (CGRP) and somatostatin. This co-release is responsible for a prolonged slow depolarization of the neurons. A positive-feedback network influencing the primary afferent terminal has been suggested, in which the activation of the presynaptic NMDA receptors promotes the release of substance P and glutamate. This may be one of the reasons for the exacerbated response to noxious stimuli (hyperalgesia) and a lowered pain threshold (allodynia) under inflammatory conditions (Liu et al., 1997). The hyperalgesia results mainly from the production and release of chemical mediators from the primary sensory terminal and from non-neuronal cells in the environment, like fibroblast, mast cells, neutrophils and platelets under pathophysiological
Introduction 7 conditions. Some of these inflammatory agents, such as protons, ATP, serotonin or lipids, can also directly activate primary afferents through ASICs (acid-sensing sodium ion channels) or
P2X3 receptors (purine ionotropic receptor subtype 3) (Julius and Basbaum, 2001). TRPV1, as the major integrator in inflammatory hyperalgesia, is also sensitized by multiple mechanisms: The phosphorylation of TRPV1 via protein kinase Cε (PKCε) is the major sensitizing mechanism by many inflammatory mediators (Bolcskei et al., 2005). The major role of TRPV1 under inflammatory condition correlates well with the reduced inflammatory thermal hyperalgesia observed in TRPV1 knockout mice (Caterina et al., 2000). Recently, the linoleic acid metabolites, which are polyunsaturated fatty acids (PUFAs), have been identified as novel endogenous TRPV1 ligands in inflammation (Patwardhan et al., 2010). Similar functions of PUFAs have also been suggested in C. elegans, acting upstream of TRPV channels in chemosensation and nociceptive behaviors (Kahn-Kirby et al., 2004).
2.2 Model systems for heat pain research
Pain has been defined as a complex constellation of unpleasant sensory, emotional and cognitive experiences provoked by real or perceived tissue damage and manifested by certain autonomic, psychological, and behavioral reactions (Terman GW, 2003). To study the signal transduction of pain perception, a diversity of animal models has been analyzed from rodents to invertebrates. However, invertebrates do not experience pain per se, but they do show nocifensive behaviors. Thus, pain cannot be monitored directly in animals but rather be estimated by examining their escape reactions to noxious stimuli (Le Bars et al., 2001). Rodents are the widely used mammal models in variety of pain studies including noxious electrical, thermal, mechanical and chemical stimulations. For the thermal pain studies with rodents, different heat sources have been utilized. Thermode, based on the Peltier principle, is the classical source for generating noxious heat. However, it has been rarely used because of several disadvantages, such as slow temperature increase and the dependence on the quality of the thermo-skin contact. The other method, the immersion of animal´s limb or tail in a thermostatic bath, allows a more rapid, but not instantaneous temperature increase. These disadvantages can be overcome to a large extent by using a CO2 laser thermal stimulator (Le Bars et al., 2001). In invertebrates; Drosophila has been shown to respond to noxious stimuli and serves as a powerful model organism for nociception studies. The TRPN channel PAINLESS has been identified for sensing both noxious temperature and mechanical stimuli by analyzing the rolling behaviors of Drosophila larvae in response to the
Introduction 8 touch of an over 38 °C heated probe (Tracey et al., 2003). Recently, a genome-wide RNAi screen identified hundreds of novel genes involved in heat nociception in the adult fly, including the α2δ family calcium channel subunit straightjacket (Neely et al., 2010). In C. elegans, a paradigm for thermonociception has been described in 1999 (Wittenburg and Baumeister, 1999). By analyzing the thermal avoidance behavior, this simple animal model can be used to understand the neuronal and molecular basis of thermonociception. To perform the thermal avoidance assay, initially, a pen with an electronically heated metal tip is used to generate noxious heat. With this method, the produced temperature is strictly dependent on the distance from the tip to the agar surface and is therefore not stable. This obvious disadvantage leads to the introduction of a monochromatic laser diode, which produces a local temperature at ~38 °C, considered as noxious for C. elegans, when it is focused at the agar plate (Wittenburg and Baumeister, 1999). This thermonocifensive response is decreased by opioid and these effects are reversed by opioid receptor antagonists (Nieto-Fernandez et al., 2009). The similar effect has also been shown in the parasitic nematode Ascaris suum (Pryor et al., 2007), the cricket Pteronemobius sp. (Zabala and Gomez, 1991) and the land snail Megalobulimus abbreviatus (Achaval et al., 2005). Recently, two new behavioral assays to enable high-throughput screening for mutants in thermonociception have been developed. These thermal barrier assay and thermogradient assay capitalized on the attraction of C. elegans to certain odorants, which actively forces the animals to overcome a local adversive temperature barrier or gradient (Glauser et al., 2011).
2.3 The model organism Caenorhabditis elegans
2.3.1 The nervous system of C. elegans The small soil-dwelling, free-living nematode C. elegans serves as a well-established, powerful genetic animal model. Its short life cycle contains six normal developmental stages from fertilized embryos to mature adults passing through four larval stages: L1, L2, L3 and L4. Under adverse conditions such as starvation, overcrowding or high temperature, instead of into the L3, the L2 larva can enter an alternative life stage termed the dauer larva. The dauer larva is highly resistant to stress situations. When it encounters favorable environmental conditions, the dauer larva reenters the life cycle at L4 and progresses into adulthood. The dauer larva is not only resistant to stress situations, but also shows a strongly decreased response to noxious heat stimuli (Wittenburg and Baumeister, 1999). These behavioral
Introduction 9 alterations may correlate with the structural changes in the dauer larvae, including alterations to the endings of some sensory neurons (White et al., 1986). The C. elegans hermaphrodite has only 302 neurons but shows sophisticated behaviors. These neurons form about 5000 chemical synapses, 600 gap junctions, and the full pattern of these connections is known. In addition, the microsurgery using a laser beam can specifically ablate individual neurons without damage to the remaining neuronal system and viability of the animals. This allows the elucidation of single neuron´s function (Bargmann and Avery, 1995). Moreover, the cell lineage that gives rise to each of these neurons has been described in its entirety. All the neurons evolve from invariant cell lineages and localized in reproducible positions. Several signaling pathways have been characterized in the cell fate determination. Some genes are required for the cell lineage decisions, whereas some function in the specification of neuron types. Thus, analyzing the mutants of these genes can give direct evidence for studying the function of the neurons. The POU homeo box gene unc-86 has a central role in generation of asymmetries within cell lineages and is expressed in one of two daughter cells in 27 lineage classes. It acts combinatorially with other genes to specify the neuron fates (Baumeister et al., 1996). Such as mec-3, a member of the LIM-homeodomain family of proteins, the expression of which is initiated by unc-86. Thus, both proteins are required in the maintenance of the cell fate of the six touch cells and also in FLP and PVD (Way and Chalfie, 1989). Another gene sem-4 also prevents touch cell differentiation in the PHC posterior neurons, which antagonize the unc-86 function (Basson and Horvitz, 1996). In the C. elegans nervous system, of the 118 classes of neurons, 24 classes are ciliated. Among them, eight classes of chemosensory neurons fill with fluorescein through their exposed sensory cilia when living animals are placed in a dye solution. Several studies have been done to isolate the dye filling defective (Dyf) mutants, and also a subset of behavioral mutants have been identified to be defective in sensory cilia or their support cells. They are the mutants defective in chemotaxis (Che), thermotaxis (Ttx), dauer larva formation (Daf), mechanosensation (Mec) and osmosensation (Osm), (Perkins et al., 1986; Starich et al., 1995). Analyzing the behaviors of these mutants may lead to the understanding of the function of the affected neurons. The DAF-19 protein is the only C. elegans member of the RFX-type transcription factor family, members of which activate or repress the expression of diverse genes in human, mice and yeast. As observed by electron microscopy and also using the green fluorescent protein (GFP), in daf-19 mutant almost all ciliated endings of sensory neurons are entirely missing. Several genes including che-2, osm-1, osm-5, osm-6 and che-13 have the X-box consensus in their promoters and are regulated by daf-19 in an X-box-dependent
Introduction 10 manner (Swoboda et al., 2000). osm-1 and osm-6 genes are homologs of intraflagellar transport (IFT) raft proteins, while che-3 and osm-3 encode the dynein heavy chain and a component of dimeric kinesin motor protein, respectively (Shakir et al., 1993; Signor et al., 1999a; Signor et al., 1999b). osm-5 and che-13 have also been suggested as components of the IFT system (Haycraft et al., 2003; Haycraft et al., 2001). Consistent with their functions, mutations in che-13, osm-1 and osm-5 shorten the axonemes of all classes of sensory cilia. On the other side, the mutations in osm-3, che-12 and che-14 affect only slightly the morphology of the cilia of the amphid neurons. Furthermore, in the che-10 mutant, the striated rootlets at the base of the cilia in the IL1, OLQ and BAG neurons are missing, and che-11 shows only slightly enlarged cilia in some neurons and reduced CEP cilia (Perkins et al., 1986). The AFD neurons are unique thermosensory neurons with a rudimentary cilium and many finger-like projections and are not affected in all these mentioned mutants. However, in the ttx-1 mutants, the fingers of AFD are entirely missing. The ttx-1, homolog of the OTD / OTX family of homeodomain proteins, regulates the differentiated characteristics of the AFD neurons (Satterlee et al., 2001).
2.3.2 TRPV1 channel family In the C. elegans genome osm-9 and five osm-9 / capsaicin receptor related genes ocr-1, ocr-2, ocr-3 and ocr-4 encode TRPV subfamily proteins. In the absence of any ocr gene product, OSM-9 alone is localized in the cell bodies of the neurons, while in the coexpressed neurons; OSM-9 and the OCR protein are coexpressed in sensory cilia. The distinct sensory functions mediated by TRPV proteins arise from different combinations of OSM-9 and related OCR proteins. (Tobin et al., 2002). In AWA and ASH neurons, osm-9 and ocr-2 depend on each other for localization to cilia rather than to the cell body. This is in accordance with the function of osm-9 and ocr-2 in responses to all odors sensed by AWA and nociceptive behaviors mediated by ASH. Furthermore, ectopic expression of ocr-2 in the neurons, where osm-9 is expressed in the cell body, is sufficient to drive osm-9 to the cilia, suggesting a physical interaction between osm-9 and ocr-2 subunits. The physical interaction and the similar mutant phenotypes of osm-9 and ocr-2 indicate that they may form heteromeric channels in ASH and AWA in mediating the signal transduction (Tobin et al., 2002). Furthermore, it has been suggested that the sensory G protein odr-3 may activate OSM-9 and OCR-2 by mobilizing specific polyunsaturated fatty acids (PUFAs). A subset of PUFAs with omega-3 and omega-6 acyl groups has been identified as endogenous modulators of TRPV
Introduction 11 signaling transduction by analyzing the different mutants in the lipid synthesis pathways (Kahn-Kirby et al., 2004). In addition to the function in sensory transduction, in the absence of ocr genes, osm-9 can also affect sensory adaptation after prolonged exposure to an odor or taste in AWC and ASE neurons. Moreover, osm-9 and ocr-2 stimulate expression of the serotonin biosynthetic gene tph-1 in the ADF neurons and odr-10 gene, the receptor for the odorant diacetyl in the AWA neurons. It has also been shown that ocr-1, ocr-2 and ocr-4 apparently form a complex mixture of functionally redundant heteromeric TRPV channels to control neurotransmitter release from neuroendocrine cells (Kahn-Kirby and Bargmann, 2006).
2.3.3 CNG channel family The cyclic nucleotide-gated (CNG) channels are involved in the final step in the G-protein coupled transduction pathways in vertebrate olfaction and vision. CNG channels have been first identified in rod cells and olfactory receptors. They are now known to be distributed throughout different cells of the body, indicating the involvement in different signaling transductions (Wei et al., 1998). CNG channels consist of two subunits, generally designated as α and β subunits. When expressed in the heterologous system, the α subunits reconstitute functional channels on their own, whereas the β subunits can only form heteromultimers with α subunits. The activation of CNG channels rely on the binding of cAMP or cGMP at the intracellular sites on the channel protein. This activation leads to a nonspecific cation conductance that also has a significant permeability to calcium ions. CNG channel activity is modulated by Ca2+ / calmodulin and by phosphorylation (Wei et al., 1998). The C. elegans tax-4 and tax-2 proteins are most similar to the α and β subunits of the cGMP-gated channels in mammalian rod photoreceptors by sequence analysis. When expressed in a heterologous system, tax-4 alone can reconstitute functional channels, whereas tax-2 can only form functional channels with tax-4 together. The heteromeric TAX-4 / TAX-2 channels are selectively activated by cGMP rather than cAMP (Komatsu et al., 1999). tax-2 and tax-4 are coexpressed in a set of neurons including the chemosensory neurons and the AFD thermosensory neurons. Consistent with the expression pattern, the mutations in both genes disrupt the salt sensation in ASE, odorant sensation in AWC, CO2 avoidance in BAG and the temperature sensation in AFD (Bargmann, 2006; Komatsu et al., 1996). In addition to their function in signal transduction, the tax-2 and tax-4 mutants also exhibit axon outgrowth defect in some sensory neurons (Coburn and Bargmann, 1996; Coburn et al., 1998).
Introduction 12
Similar as in the mammalian nervous system, the G-protein coupled signaling cascades are essential in the sensory signal transduction in C. elegans, especially in chemosensation. The C. elegans genome possesses 21 Gα, 2 Gβ and 2 Gγ genes, most of which are exclusively expressed in the chemosensory neurons, suggesting they are involved in chemosensation. The identification of over 500 predicted G-protein coupled chemoreceptors (GPCRs) confirmed the essential function of G protein coupled signaling in chemosensation in C. elegans (Jansen et al., 1999). It has been suggested that two distinct G-protein mediated signaling pathways initiated by the same Gα protein odr-3 are involved in the sensory signaling transduction. The signaling containing odr-3 and downstream TAX-4 / TAX-2 channels mediates repellent response to odorant in AWB and attractive response in AWC, whereas the odr-3 and osm-9 function in AWA for attractive response to odorant and in ASH for nociceptive behaviors (Bargmann, 2006). C. elegans genome encodes 34 guanylate cyclases generating the second messenger cGMP, 27 of which are transmembrane receptor-like guanylate cyclases (RGCs), and 7 are cytosolic soluble guanylate cyclases (sGCs) (Bargmann, 2006). In vertebrates, there are two classes of RGCs based on the different regulators: one class is activated by the G protein signaling pathways via binding to GPCRs, and the other class is directly regulated by extracellular ligands. In C. elegans, several GCs have been identified in mediating different behaviors: the RGCs daf-11 and odr-1 function in olfactory responses and dauer formation (Bargmann, 2006), and gcy-8, gcy-18, gcy-23 in thermotaxis (Inada et al., 2006), while the sGCs gcy-35 and gcy-36 bind directly to molecular oxygen and mediate the aerotaxis response (Gray et al., 2004).
2.3.4 Nociceptive behavior in C. elegans C. elegans shows avoidance response to a diversity of noxious stimuli including noxious mechanical, chemical, thermal stimuli and light. The avoidance response to harsh mechanical stimuli by prodding the body wall with a platinum wire is mediated by the PVD neurons (Way and Chalfie, 1989). PVD has the intensive branching pattern that forms a complex dendritic network blanketing the whole body surface. This morphologically resembles the mammalian nociceptors. Recently, PVD has also been found in mediating the nocifensive response to cold shock (Chatzigeorgiou et al., 2010). While the DEG / ENaC protein MEC-10 is required for the response to harsh body touch rather than to acute cold, TRPA-1 receptor is essential for the cold response but uninvolved in the harsh touch response, suggesting the involvement of distinct sets of
Introduction 13 molecules in one pair of sensory neurons in sensing two different stimuli (Chatzigeorgiou et al., 2010). Touch to the nose of C. elegans is another noxious mechanical stimulus which causes the initiated backward movement of the animal. Three classes of sensory neurons ASH, FLP and OLQ are required in this nose touch avoidance behavior, among which, ASH and FLP are polymodal nociceptors that can be activated by different noxious stimuli (Kaplan and Horvitz, 1993). The FLP neurons are multidendritic cells similar to the PVD neurons in morphology (Albeg et al., 2011). FLP has not only been shown in this work, but also in a recently published study as a sensor for noxious heat (Chatzigeorgiou et al., 2010). However, the best characterized mechanosensory behavior is the response to a gentle body touch by means of an eyelash hair attached onto a toothpick. This response is mediated by the six touch receptor neurons ALML / R, AVM, PLML / R, PVM (Goodman, 2006). Interestingly, these non-nociceptive neurons together with the PVD nociceptors are required in the withdrawal reflex to a tap to the side of the Petri dish which is considered as a noxious stimulus (O'Hagan and Chalfie, 2006). The chemosensory system of C. elegans contains 32 presumed chemosensory neurons in the amphid and phasmid chemosensory organs and detects a wide variety of attractants and repellents. The polymodal nociceptors ASH are required in the rapid withdrawal responses to high osmolarity, heavy metals, detergents, bitter alkaloids, acidic pH, and some organic odors
(Bargmann, 2006). C. elegans also avoids high CO2 >0.5 % and seeks O2 levels between 5 % and 10 %. These responses are mediated by different neural circuits. The CO2 avoidance requires the BAG sensory neurons (Hallem and Sternberg, 2008), whereas the normal aerotaxis responses to oxygen are mediated by URX, AQR and PQR sensory neurons (Bargmann, 2006). In the BAG neurons, a cGMP signaling containing the RGC daf-11 and the CNG channels tax-2 and tax-4 mediates the acute CO2 avoidance (Hallem and Sternberg, 2008), while the sGCs gcy-35 and gcy-36 serve as receptors for oxygen and locate upstream of tax-2 and tax-4 in aerotaxis (de Bono, 2003). Interestingly, both behaviors are regulated by a predicted GPCR npr-1, which encodes an NPY-like receptor protein. npr-1 is also involved in regulating social feeding, innate immunity, acute ethanol tolerance and thermogradient assay (Aballay, 2009; Davies et al., 2004). The laser-based thermal avoidance (Tav) assay to quantify the withdrawal response of C. elegans to noxious thermal stimuli has been developed ten years ago in our lab. It has been shown that glutamate and the FMRF-amide-related neuropeptides are the major neurotransmitters required in the Tav response. Strikingly, the avoidance response in wild-type animals is increased after incubation with capsaicin, and this hyperalgetic effect is
Introduction 14 blocked by capzazepine, a specific inhibitor of capsaicin (Wittenburg and Baumeister, 1999). Although wild-type C. elegans shows no acute response to capsaicin, the Tav response is modulated by capsaicin specifically, suggesting the presence of capsaicin-sensitive receptor in C. elegans. These results indicate the conserved signal transduction in noxious heat sensation between C. elegans and mammals. Interestingly, in the dauer larva, Tav response is almost absent, which is not due to the muscle defects and reduced heat dissipation in the dauer animals (Wittenburg and Baumeister, 1999). Recently, a new behavior assay, the so called noxious heat thermogradient assay, has been developed to enable the high-throughput screening for mutants involved in this behavior. In this assay, worms are placed on one side of an assay plate and migrate to the other side across a thermal barrier with temperature between 29 °C and 37 °C, motivated by an attractive chemical odorant cocktail. The noxious heat can induce a pronounced shift in the distribution away from the thermal barrier, which overcomes the chemical attraction. By using this behavior assay, OCR-2 and OSM-9 has been determined to be involved in the heat avoidance as well as shown in the Tav assay in this study. Furthermore, the neuropeptide FLP-21 and its receptor NPR-1 regulate this behavior in a TRPV-independent pathway (Glauser et al., 2011). Although live in darkness, C. elegans is able to sense light and escape the dangerous UV light. The photo avoidance response is mediated by a combination of seven amphid sensory neurons, four of which (ASJ, AWB, ASK, ASH) play the major roles (Ward et al., 2008). In the ASJ neurons, a G protein-dependent cGMP pathway including the TAX-2 and TAX-4 cGMP-gated channels is involved in the avoidance behavior to light and the LITE-1 putative photoreceptor protein functions upstream of this pathway (Edwards et al., 2008). The G proteins GOA-1, GPA-3 and the RGCs DAF-11, ODR-1 are also required in this process upstream of the CNG channels (Liu et al., 2010).
2.3.5 Thermosensation (thermotaxis) in C. elegans C. elegans can detect a wide range of environmental temperatures from physiological to noxious. Within the physiological range, the animals migrate towards the cultivation temperature on a thermal gradient and make an isothermical circle around this temperature. This thermotactic response can be disturbed by starvation and the animals migrate away from the temperature at which they were previously starved (Bargmann and Mori, 1997). The thermotaxis behavior is mainly mediated by the thermosensory neurons AFD, and the olfactory neurons AWC have a less critical role in thermotactic behavior. By measuring the calcium level in the neurons, AFD has been shown to be activated by temperature changes as
Introduction 15 small as 0.05°C above the cultivation temperature (Kimura et al., 2004), whereas AWC may directly respond to thermal stimuli above the threshold temperature (Kuhara et al., 2008). The downstream AIY interneurons are activated by AFD and inhibited by AWC. The neural information further stimulates AIZ and RIA interneurons. AIY is responsible for thermophilic movement and AIZ for cryophilic movement, indicating the counterbalancing regulation of AIY and AIZ activities in thermotaxis (Mohri et al., 2005; Mori and Ohshima, 1995). The AFD sensory neurons, unlike other amphid neurons, have degenerated cilia and microvillus-like projections in the sensory ending of the neurons. It is possible that the villus-like fingers of AFD ciliated ending could increase the cGMP concentration and contribute to signal amplification. In consistent with this notion, the ttx-1 mutant, in which the villus structure is altered, shows defected thermotaxis (Satterlee et al., 2001). Signal transduction in the AFD thermosensory neurons in thermotaxis behavior requires the cGMP signaling pathway. The guanylate cyclases GCY-8, GCY-18 and GCY-23 are expressed specifically in AFD and function redundantly in activating the downstream TAX-2 / TAX-4 channels. Although the thermoreceptors remain to be elucidated, it is possible that the RGCs or the GPCR could function as thermoreceptors similar as in C. elegans olfactory system (Bargmann and Mori, 1997).
2.4 Aim of the work
The ability of the animals to avoid noxious extremes of hot is critical for survival. However, the understanding of the molecular mechanisms in this avoidance behavior is greatly hindered by the complexity of the nervous system of the animals and the strongly redundant function of involved genes. Thus the use of the simple model organism C. elegans in thermonociception study is beneficial. The aim of this work is to elucidate the neural circuits and the genes involved in the thermal avoidance response in C. elegans. For this purpose, behavioral analyses, neuron-ablation and calcium imaging experiments were performed. The results shown in this work identify distinct sets of nociceptors and molecules involved in noxious heat sensation. Thus, it suggests that in C. elegans individual neurons may be involved in distinct sensations and the multi-sensory integration in the nervous system is very important for regulating the sophisticated behaviors of the animal.
Results 16
3 Results
3.1 Differences among the Tav response and the heat shock response
In the thermal avoidance (Tav) assay, the animal was stimulated by ~38 °C noxious heat. It is known that in C. elegans, temperature over 30 °C causes the heat shock response and activates the major heat shock transcription factor hsf-1. The heat shock response involves the rapid transcription of heat shock proteins (HSPs) downstream of hsf-1. HSPs protect the animals from heat shock stress induced cell damage via their chaperoning effects on proteins (Morimoto, 1998). To test whether heat shock proteins are involved in the noxious heat avoidance, the Tav response of mutant animals lacking hsf-1 was analyzed. Under normal conditions no significant differences in the head Tav responses were observed in hsf-1(sy441) mutant and wild-type animals. Although slight decreases in the Tav responses in both hsf-1(sy441) and wild-type were observed one hour after 15 minutes heat shock treatment at 34 °C, the Tav behavior in hsf-1(sy441) mutant was not significantly different from wild-type at individual time points after heat shock (Figure 3.1-1). Upon heat stress, large amounts of heat shock proteins accumulate, which is detrimental for cell growth and division (Morimoto, 1998). These could be the explanation for the slight decrease in the Tav response in both hsf-1(sy441) mutant and wild-type animals after heat shock. Altogether, these results suggest that the rapid noxious heat perception and avoidance response is different from the heat shock response.
100 Figure 3.1-1 The head Tav 90
80 response in hsf-1(sy441) and
70 wild-type animals at different
60 time points after heat shock. 50 Shown was the percentage of heat 40 shocked worms (15 min. at 34°C) 30 that responded to the noxious heat
Tav (%) Head in the response 20 one, two, four, and six hours after 10 heat shock. At least 67 animals were 0 tested for each dataset. Error bars indicate SD. before HS 1H after HS 2H after HS 4H after HS 6H after HS
Results 17
Table 3.1-1 The Tav response in hsf-1(sy441) and wild-type animals at different time points after heat shock
A B C Genotype Tav response in the head Tav response in the tail n p value p value wild-type 95.2 ± 2.0 68.1 ± 6.0 628 hsf-1(sy441) 90.4 ± 4.9 55.4 ± 6.7 132 >0.05 >0.05 1 hour after heat shock wild-type 86.3 ± 6.9 63.9 ± 12.6 119 hsf-1(sy441) 81.1 ± 3.5 49.8 ± 11.1 90 >0.05 >0.05 2 hours after heat shock wild-type 92.2 ± 7.0 60.9 ± 6.3 121 hsf-1(sy441) 84.0 ± 7.6 47.7 ± 3.6 115 >0.05 >0.05 4 hours after heat shock wild-type 94.7 ± 4.4 57.1 ± 3.4 97 hsf-1(sy441) 87.7 ± 3.1 49.7 ± 4.5 113 >0.05 >0.05 6 hours after heat shock wild-type 95.1 ± 1.4 61.8 ± 9.9 87 hsf-1(sy441) 92.4 ± 2.1 50 67 >0.05 >0.05 Values reported are mean % ± SD % ND: not determined nA denotes number of animals tested, 3-17 independent assays were performed. B p values are compared to wild-type animals for the Tav response in the head. C p values are compared to wild-type animals for the Tav response in the tail.
3.2 Differences among the Tav response and the light avoidance response
In this study, the noxious heat (~38 °C) used to induce the Tav response was generated with a laser diode emitting energy at a wavelength close to infrared (IR) light (685 ± 0.5 nm). This raised the question whether the animals respond to light rather than temperature. To test this hypothesis, the lite-1 mutant was analyzed for the Tav behavior. LITE-1 is an eight-transmembrane protein that is a member of the invertebrate family of gustatory receptors. It has been identified as the major light receptor required for proper avoidance response to short-wavelength light (Edwards et al., 2008). However, lite-1(ce314) showed a wild-type Tav response (Table 3.2-1), indicating the light receptor LITE-1 is not required in the noxious heat sensation. Thus, the Tav response and light avoidance response require different receptor proteins in the signal transduction. Table 3.2-1 Tav response of lite-1 mutant
A B C Genotype Tav response in the Tav response in the n p value p value head tail wild-type 95.1 ± 2.2 68.1 ± 6.0 628 lite-1(ce314) 90.4 ± 3.8 61.5 ± 10.3 146 >0.05 >0.05 Values reported are mean % ± SD %
Results 18
ND: not determined nA denotes number of animals tested, 3-17 independent assays were performed. B p values are compared to wild-type animals for the Tav response in the head. C p values are compared to wild-type animals for the Tav response in the tail.
3.3 Characterization of the neural circuits in noxious heat perception in the anterior and posterior part of C. elegans
3.3.1 Identification of the candidate head sensory neurons involved in noxious heat perception To identify neurons that could function as thermonociceptors, several characterized mutants with ultrastructural defects in sensory neurons were examined. Firstly, the Tav responses of mutant animals with abnormal endings of the ciliated neurons were tested. Most of the osm (osmosensation defective), che (chemosensation defective), and daf (dauer formation defective) mutants have been shown to have altered morphology of neuron cilia (Perkins et al., 1986) and were analyzed in details for their Tav responses. From these mutants, daf-19(m86) and osm-6(p811) mutant animals showed strongly reduced head Tav responses compared to 95.2 % in wild-type with 70.1 % and 78.2 %, respectively (Figure 3.3-1). The daf-19(m86) mutant is temperature sensitive and forms dauer larvae constitutively at 20 °C (dauer larvae show no Tav response), but this dauer phenotype is suppressed by crossing daf-12(sa204) into daf-19(m86) (Swoboda et al., 2000). Therefore, double mutant daf-19(m86);daf-12(sa204) was examined in the Tav assay. On the other hand, the mutants che-1, 2, 3, 10, 11, 12, 13, 14, daf-3, 6, 7, 11, 28, and osm-1, 3, 5, either behaved similar to wild-type or showed mild decrease in the Tav response (Table 3.3-1). daf-19(m86) mutant lacks all classes of cilia (Swoboda et al., 2000), whereas in osm-6(p811) mutant the cilia of a subset of neurons are destroyed (Collet et al., 1998). The strongly defective head Tav responses observed in daf-19(m86) and osm-6(p811) mutants suggest that selective ciliated sensory neurons mediate part of the head Tav response and the rest of the response may be sensed by non-ciliated sensory neurons. To further narrow down the numbers of neurons potentially involved in Tav response, mutants with defects in specific subsets of ciliated neurons were tested. With this strategy, the unc-86(n846), mec-3(e1338), egl-44(n1080) and egl-46(n1127) mutants were found to have reduced head Tav responses with 80.7 %, 82.4 %, 85.6 % and 85.5 % compared to wild-type
Results 19
95.2 %, respectively (Figure 3.3-1). The unc-86, mec-3, egl-44 and egl-46 genes are required together for the specification of the ciliated FLP neurons (Wu et al., 2001; Xue et al., 1992). In the searching for the non-ciliated thermonociceptors, ttx-1(p767) mutant was identified as defective in the head Tav response with 79.2 % vs. wild-type 95.2 %. ttx-1 is required for the development of the AFD sensory neurons (Satterlee et al., 2001). Altogether, these results lead to the hypothesis that the AFD and FLP sensory neurons are involved in sensing noxious thermal stimuli on the head of the animals.
100 ** * ** Figure 3.3-1 Head Tav responses of 90 ** **
80 ** mutants with developmental defects
70 in the AFD and FLP neurons. 60 Mutants defective in the ciliated FLP 50 neurons or the non-ciliated AFD 40 neurons were tested for their Tav 30 responses. *P<0.01; **P<0.001
Tav response in the Head (%) 20 compared to wild-type. Error bars 10
0 indicate SD. At least 100 animals were tested for each dataset.
Table 3.3-1 The head and tail Tav responses of mutant animals with developmental defects in the sensory neurons of C. elegans
A B C Genotype Tav response in the head Tav response in the tail n p value p value wild-type 95.2 ± 2.0 68.1 ± 6.0 628 che-1(p674) 89.5 ± 1.8 ND 140 >0.05 che-1(p679) 95.9 ± 1.7 ND 135 >0.05 che-2(e1033) 94.9 ± 0.8 54.7 ± 5.0 161 >0.05 >0.05 che-3(e1378) 94.2 ± 2.1 58.3 ± 5.5 164 >0.05 >0.05 che-10(e1809) 94.8 ± 3.4 37.7 ± 7.0 134 >0.05 <0.001 che-11(e1810) 96.0 ± 1.4 58.9 ± 3.3 265 >0.05 >0.05 che-12(e1812) 93.9 ± 3.0 50.4 ± 7.1 176 >0.05 >0.05 che-13(e1805) 91.0 ± 2.9 60.1 ± 7.1 238 >0.05 >0.05 che-14(e1960) 81.4 ± 4.1 25.6 ± 3.0 198 <0.001 <0.001 daf-3(e1376) 93.1 ± 2.4 ND 143 >0.05 daf-6(e1377) 97.3 ± 1.6 ND 160 >0.05 daf-7(e1372) 95.7 ± 2.2 ND 154 >0.05 daf-7(m62) 94.2 ± 2.4 ND 145 >0.05 daf-11(m84) 91.9 ± 2.6 ND 122 >0.05 daf-11(m47) 87.9 ± 1.9 ND 146 <0.01 daf-28(sa191) 89.6 ± 3.4 ND 135 <0.01 daf-19(m86);daf-12(sa204) 70.1 ± 8.7 47.8 ± 4.3 213 <0.001D >0.05D daf-12(sa204) 94.1 ± 4.6 54.4 ± 7.2 203 >0.05 >0.05
Results 20 osm-1(p808) 92.1 ± 2.9 56.4 ± 0.6 121 >0.05 >0.05 osm-3(n1540) 92.2 ± 1.3 34.2 ± 5.1 132 >0.05 <0.001 osm-3(p802) 91.5 ± 4.2 41.4 ± 7.6 154 >0.05 <0.001 osm-5(p813) 89.1 ± 3.1 56 ± 5.9 179 <0.01 >0.05 osm-6(p811) 78.2 ± 9.7 30.2 ± 4.6 181 <0.001 <0.001 osm-12(n1606) 89.3 ± 2.9 45.9 ± 3.2 165 <0.01 <0.001 ttx-1(p767) 79.2 ± 11.1 ND 148 <0.01 mec-3(e1338) 82.4 ± 7.4 ND 308 <0.001 egl-44(n1080) 85.6 ± 7.1 ND 219 <0.01 egl-46(n1127) 85.5 ± 7.0 ND 218 <0.01 unc-86(n846) 80.7 ± 13.9 13.8 ± 7.7 197 <0.01 <0.001 Values reported are mean % ± SD % ND: not determined nA denotes number of animals tested, 3-17 independent assays were performed. pB values are compared to wild-type animals for the Tav response in the head. pC values are compared to wild-type animals for the Tav response in the tail. pD value is compared to daf-12(sa204).
3.3.2 Characterization of the roles of AFD and FLP as thermonociceptors by laser and genetic neuron ablation To further examine the roles of the AFD and FLP neurons in thermonociception, these neurons were laser-ablated in wild-type animals and the neuron-ablated animals were subsequently tested for their ability to react to the noxious heat stimuli. For the neuron laser-ablation, instead of the typical dye cell pumped with a nitrogen laser, the 2-photon-laser was used. The best advantage of this laser system is eye safety through the ablation procedure with the laser system in a protective housing and the whole procedure can be followed on a monitor. Furthermore, it has also been shown that compared to UV laser, two-photon laser leads to less cell damage after microsurgery by using different mechanisms of ablation (Zeigler and Chiu, 2009). Individual neurons were identified by GFP-labeling. The success of ablation was visualized by the disappearance of the GFP label in these neurons both directly after the microsurgery and after the behavior test to exclude that the GFP in the neurons was bleached rather than the cells were killed. As control (mock-ablated) animals, the same worm strains from the same plate were treated in the same way as the neuron-ablated animals besides neuron-laser-ablation. Additionally, AFD neurons were also genetically ablated by expressing the coding sequence for the Diphtheria toxin A (DT-A) under the regulation of the AFD specific gcy-8 promoter (Inada et al., 2006). The DT-A has been successfully used before to kill the sheath glia cells in C. elegans (Bacaj et al., 2008). Two independent lines BR5634 and BR5635 carrying the extrachromosomal array of DT-A in AFD were obtained by microinjection of the plasmid pBY3118 together with
Results 21 the injection marker Pmyo-2::mCherry in the animal strain BR5256, in which the AFD, FLP and the six touch neurons are labeled. The success of the ablation was monitored by disappearance of the neuron specific GFP reporter in AFD (Figure 3.3-2). In both cases, the behaviors of the AFD-ablated animals were similar: animals with ablated AFD-neurons were severely defective in their head Tav responses with 40.2 % (laser-operated), 42.3 % (BR5634) and 36.6 % (BR5635) (Table 3.3-2). In contrast, the two transgenic lines BR5852 and BR5853 expressing DT-A in AWA, AWB, AWC, ADF and ASH under the control of the odr-3 promoter (Roayaie et al., 1998) responded normally to noxious heat (Figure 3.3-3b). Furthermore, only 61.1 % of animals lacking the FLP neurons showed avoidance of noxious heat compared with 88 % of mock-ablated animals, and co-ablation of both AFD and FLP together almost abrogated the head Tav response to 7.8 % (Figure 3.3-3a). Thus, the responses of animals lacking both AFD and FLP were significantly worse (P<0.01) than that of animals lacking only AFD or FLP neurons. As control, other ciliated neurons, such as AWA, AWB, ASH, ADF, ADL and BAG were laser-ablated. In no case a significantly defective Tav response was observable in these neuron-ablated animals (Figure 3.3-3a, Table 3.3-2). Altogether these data indicate that both AFD and FLP contribute to thermonociception. They act in parallel and are candidates for heat sensors.
Figure 3.3-2 Expression of DT-A under the control of AFD specific gcy-8 promoter successfully ablated the AFD neurons. (a) The fluorescence micrograph of an animal (strain BR5256) carrying GFP reporter in both AFD and FLP in the head. The AFD neurons are indicated by stars and the FLP neurons by arrowheads. (b) The elimination of GFP reporter in the AFD neurons in strain BR5634 carrying DT-A in AFD indicated the successful ablation of AFD. Residual GFP in the necrotic AFD neuron is indicated by a star. Images (40-fold magnification) are confocal Z series projected into a single plane. Scale bars represent 10 µm. The anterior part of the animal is oriented to the left.
Results 22
ab
100 100
90 90
80 80 ** 70 70
60 60 **
50 ** 50 ** ** 40 40
30 30
Tav (%) Head in the response 20 ** Tav response in the Head (%) 20
10 10
0 0
Figure 3.3-3 Head Tav responses of the neuron-ablated animals. (a) Laser-ablation of AFD and FLP led to severe defect in the head Tav response compared with the mock-ablated animals and the ablation of other sensory neurons. The different Tav responses observed in mock-ablated animals may be due to the different genetic backgrounds from the transgenes used for neuron GFP-labeling (Table 5.4-3). (**P<0.001 compared to the mock-ablated animals), at least 8 animals were analyzed for each dataset. (b) AFD-laser-ablated animals and two Diphtheria Toxin A (DT-A) -ablated transgenic lines, showed significant defects in the head Tav responses, while the control animals, expressing Podr-3::DT-A in 5 sensory neurons without AFD, displayed no differences compared to wild-type. (**P<0.001 compared to worm strain BR5410, wild-type carrying marker plasmid Pmyo-2::mCherry). Error bars indicate SD, at least 57 animals were tested for each dataset for genetically neuron ablation.
Table 3.3-2 Head Tav responses of animals lacking AFD, FLP or other amphid sensory neurons Tav Tav p p Neurons ablated response in response in nA valueB valueC the head the tail 1. AFD and FLP AFD-ablated animals 40.2 ± 7.1 ND 23 <0.001 mock-ablated (AFD) 88.5 ± 1.6 ND 44 byEx925[myo-2::mCherry] 89.9 ± 3.8 68.0 ± 10 96 BR5256;byEx851[Pgcy-8::DTA;myo-2::mCherry] 42.3 ± 16.3 61.2 ± 3.2 83 <0.001 >0.05 BR5256;byEx852[Pgcy-8::DTA;myo-2::mCherry] 36.6 ± 7.9 64.8 ± 4.9 108 <0.001 >0.05 byEx1025[Podr-3::DTA;Podr-4::GFP;myo-2::mCherry] 89.3 ± 5.7 64.2 ± 2.1 57 >0.05 >0.05 FLP-ablated animals 61.1 ± 9.6 ND 11 <0.01 mock-ablated (FLP) 87.8 ± 0.3 ND 17 AFD,FLP-ablated animals 7.8 ± 9.7 65.0 ± 35.0 19 <0.001 >0.05 mock-ablated (AFD,FLP) 100 88.9 ± 11.1 17 2. amphid ASH-ablated animals 87.5 ± 12.5 ND 21 >0.05 mock-ablated (ASH) 76.4 ± 1.4 ND 13 AWA-ablated animals 100 ND 9 >0.05
Results 23 mock-ablated (AWA) 88.9 ND 7 ADF-ablated animals 100 ND 6 >0.05 mock-ablated (ADF) 100 ND 7 ADL-ablated animals 100 ND 12 >0.05 mock-ablated (ADL) 100 ND 12 AWB-ablated animals 95.0 ± 7.1 ND 16 >0.05 mock-ablated (AWB) 100 ND 18 BAG-ablated animals 100 ND 9 >0.05 mock-ablated (BAG) 100 ND 7 Values reported are mean % ± SD % ND: not determined nA denotes number of animals tested, each animal was tested 4 times for the Tav response. pB values are compared to respective mock treated animals for the Tav response in the head. pC values are compared to respective mock treated animals for the Tav response in the tail.
3.3.3 Dissection of the neural circuit involving the AFD sensory neurons in the head Tav response The AFD neurons have previously been identified as the major sensory neurons required for the thermotaxis behavior in the perception of physiologically relevant temperatures (15 °C-25 °C) in C. elegans. In turn the thermosensory signal is transmitted via the postsynaptically connected interneurons AIY to effectors and motor neurons (Hobert et al., 1997; Kimura et al., 2004). Since AFD was identified in this study to be also involved in the sensation of non-physiological, noxious temperature, it was important to test whether a similar or different neural circuit is involved in the head Tav response. For this purpose, the AIY interneurons were laser-ablated and the treated animals were subsequently tested for their Tav responses. The animals lacking the AIY neurons responded as well as the control animals (Figure 3.3-4) to noxious heat stimuli. Moreover, ttx-3 mutant, in which the AIY neurons do not differentiate properly (Hobert et al., 1997), also had a head Tav response like wild-type (Table 3.3-3). These results suggest that the AIY interneurons are not required for thermonociception and AFD uses a distinct set of interneurons to transmit noxious heat signal. The AFD neurons have synaptic output only with the AIY interneurons. Besides AIY, the AIB interneurons are the other pair of interneurons connected via gap junctions with the AFD neurons (White et al., 1986). To test if these interneurons are required for the signal transduction in the neural circuit of thermonociception, the AIB interneurons were also ablated by two-photon laser. The AIB-ablated animals showed strongly reduced head Tav responses compared with the mock-ablated animals (33.3 % vs. 93.8 %), which is in the same range of responses of animals in which the AFD neurons were killed (Figure 3.3-4). Altogether, these results indicate that the
Results 24
AFD temperature sensory neurons innervate AIB interneurons upon noxious heat stimulation, and activate the AIY interneurons upon sensation of physiological temperatures.
**
100 ** 90 Figure 3.3-4 Laser-ablation of AFD and AIB led to
80 severe defect in the head Tav response. Laser 70 ablation of AFD and AIB impairs the head Tav 60 response, whereas animals lacking AIY showed no 50 defect compared to the mock-ablated animals. 40 (**P<0.001 compared to the mock-ablated animals). 30 Error bars indicate SD. At least 8 animals were tested Tav response in the Head (%) 20
10 for each dataset. 0
Table 3.3-3 The head Tav responses of animals lacking the AIB or AIY interneurons
Tav response in Tav response in p p A Neurons ablated / Genotype n B C the head the tail value value AIY and AIB AIY-ablated animals 100 ND 8 >0.05 mock-ablated (AIY) 100 ND 14 AIB-ablated animals 33.3 ND 13 <0.001 mock-ablated (AIB) 93.8 ± 8.8 ND 9 wild-type 95.2 ± 2.0 68.1 ± 6.0 628 ttx-3(ot22) 93.5 ± 4.6 65.1 ± 5.6 88 >0.05 >0.05 ttx-3(mg158) 92.7 ± 2.1 69.9 ± 6.1 146 >0.05 >0.05 Values reported are mean % ± SD % ND: not determined nA denotes number of animals tested, each animal was tested 4 times for the Tav response. pB values are compared to respective mock treated animals for the Tav response in the head. pC values are compared to respective mock treated animals for the Tav response in the tail.
3.3.4 Identification of thermonociceptors in the posterior part of C. elegans It has been previously shown that the anterior and posterior ends of the animals are the body regions most sensitive to noxious heat (Wittenburg and Baumeister, 1999). Heat perception at the tail of the animal is less robust than at the head, with only 68.1 % of the animals responded to laser stimulation at the posterior end in a reproducible manner, compared to 95.2 % response at the head. Animals in which both the AFD and the FLP neurons had been ablated did not respond to heat stimuli presented at the head, but responded normally to the posterior positioned heat
Results 25 stimuli (Table 3.3-2). This indicates that yet another set of neurons contributes to heat perception at the tail. To identify these neurons, the Tav response in the posterior part of the animals was analyzed in detail. For this purpose, mutants that display abnormal development in the tail sensory neurons were analyzed. The PHA and PHB neurons are two ciliated sensory neurons in the phasmid of C. elegans and detect several chemical cues. PQR is also ciliated posterior sensory neurons. All the cilia in these ciliated neurons are lacking in daf-19(m86) mutant (Swoboda et al., 2000). Although the tail Tav response in daf-19;daf-12 mutant was mildly defective with 47.8 %, the defect is not significant compared with daf-12 single mutant (Table 3.3-1), indicating that these three ciliated neurons are not the sensory neurons in thermonociception. Posterior to PHA and PHB in the phasmid, the PHC sensory neurons contain processes running into the extreme tip of the tail and are putatively mechanosensory neurons based on their physical location (Hall and Russell, 1991). SEM-4 and UNC-86 are both required for the normal development of the PHC neurons (Basson and Horvitz, 1996; Baumeister et al., 1996). Strikingly, the sem-4(n1378) and unc-86(n846) mutant animals showed almost no Tav response in the tail (17 % and 13 %, respectively, compared to 68 % of wild-type; Figure 3.3-5a and Table 3.3-4), raising the hypothesis that the PHC sensory neurons are the thermonociceptors relevant for the tail Tav response. Besides PHC, in the posterior part of unc-86(n846) null mutant animals, the six touch sensory neurons (2 ALMs, 2 PLMs, AVM and PVM), PVD harsh touch sensory neurons, and PQR sensory neurons are also defective (Baumeister et al., 1996). To test whether these neurons are also required for noxious heat perception, they were either ablated genetically or by laser beam microsurgery. In turn, these neuron-ablated animals were subsequently analyzed for their Tav responses. Only 10 % of PHC-laser-ablated animals showed Tav response to the noxious heat stimuli; whereas laser-ablation of PHA, PHB and PVD in pairs and the six touch sensory neurons together led to no significant decrease in the tail Tav response compared with the mock-ablated animals (Figure 3.3-5b and. Table 3.3-5). Furthermore, worms missing the other putative mechanosensors PQR by expression of the cell-death activator gene egl-1 under the control of the gcy-36 promoter were included in the analysis. The worm strain CX7456 with integrated plasmid Pgcy-36::egl-1 has been shown to successfully ablate the AQR, PQR and URX neurons (Chang et al., 2006). To exclude the ocr-2(ak47) mutant background in the CX7456 strain, the animals were backcrossed with wild-type and the generated worm strain BR4983 (quaIs2241[Pgcy-36::egl-1;Pgcy-35::gfp;lin-15(+)]) was analyzed for their Tav responses.
Results 26
Ablation of these three pairs of neurons had no influence in the Tav behavior (Table 3.3-5). Altogether, the PHC neurons are the major sensory neurons required in the Tav response in the posterior part of C. elegans.
Table 3.3-4 The Tav responses of mutant animals with developmental defects in the PHC neurons
A B C Genotype Tav response in the head Tav response in the tail n p value p value wild-type 95.2 ± 2.0 68.1 ± 6.0 628 sem-4(n1378) 95.0 ± 7.1 17.4 ± 12.4 179 >0.05 <0.001 unc-86(n846) 80.7 ± 13.9 13.8 ± 7.7 197 <0.01 <0.001 Values reported are mean % ± SD % ND: not determined nA denotes number of animals tested, 3-17 independent assays were performed. pB values are compared to wild-type animals for the Tav response in the head. pC values are compared to wild-type animals for the Tav response in the tail.
a b 100 100
90 90
80 80
70 70
60 60
50 50
40 40
30 ** 30 ** Tav response in in Tail the response Tav (%) Tav response in in Tail the response Tav (%) 20 20 **
10 10
0 0
Figure 3.3-5 Contribution of the PHC sensory neurons to the tail Tav response of C. elegans. (a) sem-4(n1378) and unc-86(n846) mutants were tested for the tail Tav responses. At least 100 animals were tested for each dataset. (b) Laser-ablation of the PHC neurons almost abrogated the tail Tav response, while ablation of other posterior sensory neurons led to no significant defect. **P<0.001 compared to the mock-ablated animals. At least 8 animals were tested for each dataset. Error bars indicate SD.
Results 27
Table 3.3-5 The Tav responses of animals lacking PHC or other candidate posterior thermonociceptors neurons ablated Tav response in Tav response in nA p p B C the head the tail value value 1. URX, AQR, PQR wild-type 95.2 ± 2.0 68.1 ± 6.0 628 BR4983 94.1 ± 1.7 62.2 ± 9.2 187 >0.05 >0.05 quaIs2241[Pgcy-36::egl-1;Pgcy-35::gfp;lin-15(+)] 2. ALM, AVM, PLM, PVM neuron-ablated animals 100 66.7 11 >0.05 >0.05 mock-ablated animals 100 70.9 ± 5.9 10 PVD-ablated animals 100 75 8 >0.05 >0.05 mock-ablated (PVD) 100 70 10 3. phasmid PHC-ablated animals 100 10 ± 11.6 21 >0.05 <0.001 mock-ablated (PHC) 100 63.4 ± 4.7 22 PHA,PHB-ablated animals 100 75 12 >0.05 >0.05 mock-ablated (PHA,PHB) 100 66.7 6 Values reported are mean % ± SD % ND: not determined nA denotes number of animals tested, each animal was tested 4 times for the Tav response. pB values are compared to respective mock treated animals for the Tav response in the head. pC values are compared to respective mock treated animals for the Tav response in the tail.
3.3.5 Identification of the neural circuit of the tail Tav response The main synaptic outputs of PHC are chemical synapses to the PVC and DVA interneurons (Hall and Russell, 1991). To test whether these interneurons are part of the neural circuit activated in the tail Tav response of C. elegans, these specific cells were ablated by using the 2-photon-laser. Since animals stimulated with noxious heat in the posterior part either react with a forward or a backward movement, the tail Tav response was analyzed more in detail. Ablation of either PVC or DVA affected the Tav response profoundly, since 8 / 19 (DVA) and 12 / 18 (PVC) animals did not respond at all to heat applied to the tail. However, none of the PVC-ablated animals but 11 of the DVA-ablated animals had maintained their ability to accelerate, and none of the DVA-ablated animals but 6 of the PVC-ablated animals showed backing responses (Table 3.3-6). These data are corroborated by the behavior of deg-1(u38) mutant, in which the PVC neurons are degenerated (Chalfie and Wolinsky, 1990). The occasional responses of these animals to heat at the tail were exclusively backward with 15.8 %, and no forward movement (Table 3.3-7). These results suggest that, in addition to PHC that are candidate sensory neurons, the interneurons PVC and DVA are part of the neural circuit
Results 28 responding to heat at the tail. PVC mediates accelerated forward response in the forward moving animals, whereas DVA triggers a reversal of the resting animals.
Table 3.3-6 The tail Tav responses of DVA or PVC-ablated animals Neurons ablated No. of animals showing forward No. of animals showing backward No. of animals tail Tav response tail Tav response tested mock-ablated 6 3 10 (DVA) DVA-ablated 11 0 19 animals mock-ablated 6 6 13 (PVC) PVC-ablated 0 6 18 animals
Table 3.3-7 The Tav response in the deg-1(u38) mutant
A B C Genotype Tav response in the head Tav response in the tail n p value p value wild-type 95.2 ± 2.0 68.1 ± 6.0 628 deg-1(u38) 98.2 ± 1.8 15.8 ± 2.3D 130 >0.05 Values reported are mean % ± SD % ND: not determined nA denotes number of animals tested, 3-17 independent assays were performed. pB values are compared to wild-type animals for the Tav response in the head. pC values are compared to wild-type animals for the Tav response in the tail. D deg-1(u38) mutant showed only initiated backward movement and no accelerated forward movement in the Tav response in the posterior part.
3.3.6 Calcium responses of the AFD, FLP and PHC sensory neurons to noxious heat stimuli The results obtained so far only suggest, but do not prove that AFD, FLP and PHC directly respond to heat as sensory neurons. To monitor the activity in these neurons upon exposure to noxious heat directly, the neuronal calcium influx were analyzed in vivo by using the calcium indicator protein cameleon. Cameleon comprises two fluorescent proteins and two calcium-responsive elements (a variant of camodulin and a camodulin-binding peptide). The binding of calcium to the calcium binding domain in camodulin increases the fluorescence resonance energy transfer (FRET) between CFP and YFP, thus the FRET signal change reflects intracellular calcium dynamics (Palmer and Tsien, 2006). Cameleon has been successfully used to measure the stimulus-induced activity in C. elegans neurons (Kahn-Kirby et al., 2004; Kimura et al., 2004).
Results 29
Previous results have suggested that a transient increase in the YFP / CFP fluorescence ratio in cameleon YC2.12 in the AFD neurons can be observed upon warming from 15 °C to 25 °C at a 1.5 °C / s ramp rate, indicating the response of AFD to a temperature change in the physiological range during thermotaxis (Kimura et al., 2004). Here, to simulate the noxious heat stimulus used in the Tav assay, we used an experimental setup allowing a very fast temperature change from ~22 °C to ~38 °C with a ramp rate of 8 °C / s that stimulated the Tav response, which is distinct from the setup used in thermotaxis.
a 40 b 40 40x water 190 mW 2s raise 8 °C / s 38 38 36 36 34 34 32 32 30 30 Temp.(°C) Temp.(°C) 28 28 26 26 24 24 22 22 0123456789101112 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2 Time (sec) Time (sec) c 37 40x water 190 mW 2s fall 4 °C / s 36 35 34 33 32 31
Temp.(°C) 30 29 28 27 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2 Time (sec)
Figure 3.3-6 Comparison of the temperature ramp rate in the Tav assay and the one simulated by the electrical-resistor system in the calcium imaging experiments. (a) The temperature generated by the laser point focused on the agar plate was measured every 0.1 second by a resistance thermometer. Temperature curves observed in ten stimulations were shown. The on slope is about 14 °C / s and the off slope is about 19 °C / s. (b) The temperature rising ramp rate generated by the electrical-resistor system is about 8 °C / s. (c) The temperature falling rate is about 4 °C / s.
In the Tav behavior assay, the diode laser was used to generate a local noxious heat on the agar plate. However, this experimental setup is not suitable for calcium imaging. For this purpose, an electrical-resistor system was established by Ekkehard Schulze (see 5.1.11) to produce a quick temperature ramp rate with about 8 °C / s rising slope from ~22°C to ~38°C, which simulated the Tav assay on plate (Figure 3.3-6). During calcium imaging recording, the noxious heat was
Results 30 initiated at the 5th second record time point and reached ~38 °C at the 7th second. The imaging recordings were performed by Ekkehard Schulze. Cameleon YC2.12 was expressed in different sets of neurons and the YFP / CFP fluorescence ratio was measured. As shown in figure 3.3-7a, large transient increases in the YFP / CFP ratio signal (corresponding transient changes in intracellular calcium level) were observed in the AFD, FLP and PHC cell bodies when temperature was around 38 °C at about the 7th second. The calcium dynamics were similar in all three neurons upon heat stimuli (Figure 3.3-7a). However, it remained unclear whether these three thermonociceptors shared a similar temperature threshold. To answer this question, the temperature was raised with a slower ramp rate: ~0.5 °C / s from 27 °C to 41 °C in 30 sec as shown in figure 3.3-7b. Similar calcium curves were observed in all the three neurons, indicating that they are activated in a similar way by the noxious heat. Although the response curves are gradually increased with this slow temperature gradient, the strong transient responses began at ~25 sec, which corresponds to a temperature of ~38 °C and is probably the threshold temperature of the neurons. However, this is not saturated; the intracellular calcium level increased further till the temperature reached the maximal value ~41 °C. In figure 3.3-8, box plot diagram shows the average values of maximal YFP / CFP ratio change in AFD, FLP and PHC from at least 9 animals and in ALM, PLM and PVD from at least 3 animals. In the AFD cell bodies, the noxious temperature evoked a large transient increase in the level of intracellular calcium with a 35 % ratio change, which is a significant increase compared to 4.5 %, 9.8 % and 1.9 % observed in the ALM, PLM and PVD neurons, respectively (Figure 3.3-8 and Table 3.3-8). Therefore, rapid temperature changes to 38 °C typical for thermal avoidance response induce calcium influx in AFD, but not in ALM, PLM, and PVD. YC4.12 is another cameleon protein with a lower affinity for calcium (Kimura et al., 2004). To exclude that the conformational change of cameleon itself resulted in altered YFP / CFP ratio upon heat, but not calcium binding, the animals expressing YC4.12 in AFD were used for FRET measurement. The resulting ratio change was less than half of the one observed with YC2.12 (Table 3.3-8), suggesting that the FRET signal we observed was indeed due to changes of the intracellular Ca2+ concentrations in AFD. In the FLP and PHC cell bodies, similar robust transient calcium increases were observed with 29 % and 30 % ratio changes, individually (Figure 3.3-8 and Table 3.3-8). Together the results
Results 31 indicate that the AFD, FLP and PHC sensory neurons are activated by rapid temperature shifts from 22 °C to 38 °C, the latter being considered noxious for C. elegans.
50 AFD a b 40 40
35 AFD (%) 30 0 30
R/R 20 Δ (%) heat
0 25 10 20
R/R 0 Δ 15 5 1015202530354045 10 -10 Time (sec) 5 70 60 0 FLP 12345678910 50 -5 40
Time (sec) (%) 40 2 sec heat 0 30
35 R/R 20 FLP Δ 30 10
(%) 0
0 25 5 1015202530354045 heat -10 20 Time (sec)
R/R 50
Δ 15 PHC 10 40 30
5 (%) 0 0 20 12345678910 R/R -5 Δ Time (sec) 10 40 2 sec heat 0 35 PHC 5 1015202530354045 -10 30 Time (sec) 45 (%) 25 43 0 heat 41 20 39 R/R 37
Δ 15 35 10 33 5 31 29 0 Temperature (°C) 27 12345678910 25 -5 Time (sec) 5 1015202530354045 2 sec heat Time (sec) Figure 3.3-7 Calcium responses in AFD, FLP and PHC upon noxious heat stimuli. (a) Four representative responses of the AFD, FLP and PHC neurons to the noxious heat stimuli are presented. Heating was started at the 5th second after experiment began and reached 38 °C at the 7th second. The response was plotted as fractional YFP / CFP ratio change over baseline. By mounting the animals, gluing the tip of the head was avoided to prevent damaging. The motion of the sample may be the reason for the noisy imaging data. (b) Plots of the AFD, FLP and PHC neuronal calcium responses to the positive linear temperature ramp from 27 °C to 41 °C, the temperature ramp is shown at the bottom.
Results 32
Table 3.3-8 YFP / CFP ratio change (calcium influx) after noxious heat stimuli in different sensory neurons Genotype AFD(yc2.12) FLP(yc2.12) PHC(yc2.12) AFD ALM(yc2.12) PLM(yc2.12) PVD(yc2.12) (yc4.12)
N2 35.8 ± 9.6 (26) 29.3 ± 13.0(12) 30.3 ± 8.4 (9) 15.3 ± 2.5 (4) 4.5 ± 1.6 (5) 9.8 ± 4.4 (12) 1.9 ± 2.6 (3) (wild-type) unc-13(e450) 35.8 ± 8.4 (10) 32.7 ± 11.0 (8) 27.0 ± 8.8 (8) ND ND ND ND unc-31(e928) 30.5 ± 4.8 (4) 27.9 ± 9.7 (4) 33.3 ± 7.4 (5) ND ND ND ND Values reported are mean % ± SD % (sample size) of the average maximal FRET ratio change amplitude in each population post stimuli. ND: not determined.
a 55 50 45 40 35 (%) 0 30 R/R
Δ 25 20 ** ** 15 maximal maximal 10 ** 5 ** 0
AFD PLM PVD ALM
b c 55 55 50 50 45 45 40 40 (%) (%) 35 35 0 0 30 30 R/R R/R Δ Δ 25 25 20 20 15 maximal maximal
maximal maximal 15 10 10 5 5 0 0
FLP PHC Figure 3.3-8 Calcium responses of the AFD, FLP and PHC neurons to noxious heat stimuli. (a), (b), (c) Average maximal calcium responses in wild-type, unc-13(e450) and unc-31(e928) animals in AFD, PLM, PVD, ALM or FLP, PHC upon noxious heat. **P<0.001 different from ratio changes in AFD in wild-type. Data were shown in box plot diagram. Error bars indicate SD. At least 3 animals were tested for each dataset.
Results 33
The results so far suggest, but do not prove, that AFD, FLP and PHC act as sensory rather than accessory neurons in the neural circuit of thermonociception. The hypothesis is that blocking neurotransmission should not affect calcium responses in primary sensory neurons, but should reduce or block heat-evoked calcium transients in these neurons, if they serve as secondary sensory neurons. To address this question, calcium dynamics after heat stimuli in these neurons were analyzed in the unc-13(e450) and unc-31(e928) mutant backgrounds. The gene unc-13 regulates exocytosis of synaptic vesicles, and, thus, neurotransmitter release, whereas unc-31 encodes the C. elegans CAPS homolog necessary for the exocytosis of dense core vesicles (Madison et al., 2005; Speese et al., 2007). Both mutants are too sluggish for a behavioral Tav assay, making it impossible to test whether these two types of neuronal transmission are involved in thermonociception or only electrical gap junctions are required. However, since no significant decrease in the calcium level of the AFD, FLP, or PHC neurons was detectable in both mutant backgrounds (Figure 3.3-8 and Table 3.3-8), this suggests that the AFD, FLP, and PHC do not depend on synaptic and dense core vesicle neuronal transmission for activation by noxious heat.
3.4 Characterization of the roles of the TRPV1 channels in the Tav response in C. elegans
3.4.1 Contribution of the TRPV1 channels OCR-2 and OSM-9 in the head Tav response in the FLP sensory neurons The human TRPV1 channel is known to be directly activated by noxious stimuli, such as heat or acidic pH (Caterina et al., 1999). However, in vertebrates it is typically activated at temperatures above 43 °C, whereas in C. elegans noxious heat more than 38 °C already evokes an avoidance response. To ask whether the function of TRPV1 in sensing noxious temperatures is conserved in C. elegans, the protein sequence for human TRPV1 was used for sequence alignments in the C. elegans protein database (Wormpep) to search for the TRPV homologues. Using a sequence analysis software based on a Hidden Markov model, we found ten homologues of TRPV channel genes in C. elegans (Figure 3.4-1a), including OSM-9 and four OCR proteins previously described, OCR-1, OCR-2, OCR-3 and OCR-4 (Tobin et al., 2002). Of these, unc-44 encodes a family member that only contains ankyrin repeats, but no ion channel domain. As a consequence, we excluded unc-44 but investigated the Tav response of mutants in all other TRPV channels.
Results 34
Three ocr-2 allele and two osm-9 allele were examined. They all showed mildly reduced head Tav response, and for further experiments, the dominant negative mutant ocr-2(vs29) (Jose et al., 2007) and null mutant osm-9(ky10) (Colbert et al., 1997), which showed the strongest defect in the head Tav behavior, were used. On the contrary, the other three ocr mutants ocr-1(ak46), ocr-3(ok1559), ocr-4(vs137) and four trp mutants trp-1(ok323), trp-2(gk298), trp-4(gk341), trpa-1(ok999) had normal head Tav responses (Figure 3.4-1b). Crossing the ocr-2(vs29) allele into an osm-9(ky10) background led to a further reduction of Tav response in the head of the double mutant (73 % vs 95 % in wild-type; Figure 3.4-1b, Table 3.4-1) indicating the redundant roles of ocr-2 and osm-9. These data support that the TRPV1 channels share a common function in the response to noxious temperatures in both C. elegans and mammals.
a b
100 unc-44-44 * trpa-1trpa 90 * trp-4trp- * 80 osm -9 70 ocr-4ocr 4 ocr-3 60 ocr-2ocr 2 50
ocr-1ocr- 40 TRPV3 30 TRPV2
TRPV4 Tav response in the Head (%) 20
TRPV1 10
trp-2- 0 trp-1trp-
Figure 3.4-1 Mutations in ocr-2 and osm-9 genes led to defective head Tav response. (a) The C. elegans gene family was identified by a Hidden Markov Model (HMM) search in WormPep, aligned by using ClustalX, and a neighbor joining tree was calculated with ClustalX. (b) Head Tav response of the mutants in the TRPV genes. (*P<0.01; **P<0.001 compared to the wild-type). Error bars indicate SD. At least 80 animals were tested for each dataset. Although all the mutants tested were backcrossed at least four times with the lab wild-type animals, there is also possibility that the Tav response defect observed in the ocr-2(vs29) osm-9(ky10) double mutant is caused by other background mutations other than mutations in ocr-2 and osm-9 genes. In order to exclude this possibility, rescue experiments with genomic DNAs of the two genes under the control of their respective original promoters were performed. For rescue experiments the ocr-2(vs29) osm-9(ky10) double mutants were used
Results 35 because these animals showed a much stronger defect in the Tav response than the single mutants. Two transgenic lines expressing ocr-2 and osm-9 genomic DNA (BR5187 and BR5195) and transgenic lines expressing only ocr-2 (BR6039) or osm-9 (BR6037) were generated. Fully rescue was observed in transgenic lines expressing both the ocr-2 and osm-9 genomic DNAs. Expressing only ocr-2 or osm-9 genomic DNA led to significant increase in the head Tav response from double mutant to single mutant level (Figure 3.4-2). These results strongly support the redundant roles of OCR-2 and OSM-9 in the head Tav response.
**
100 Figure 3.4-2 Contribution of OCR-2 and
90 OSM-9 in FLP in mediating the head Tav 80 response. The defective Tav response in the 70 head of ocr-2(vs29) osm-9(ky10) double 60 mutant was rescued by the expression of both 50 ocr-2 and / or osm-9 full length genomic DNAs 40 as well as by expression of their cDNAs under 30
20 the control of mec-3 promoter. (*P<0.01; Tav response in the Head (%)
10 **P<0.001 compared with 0 ocr-2(vs29) osm-9(ky10)). Error bars indicate
Transgene SD. At least 80 animals were tested for each dataset.
Genotype wild-type ocr-2(vs29)osm-9(ky10) OCR-2 and OSM-9 are expressed in several head and tail sensory neurons (Jose et al., 2007; Tobin et al., 2002). In the anterior part, besides FLP, no other neurons expressing osm-9 were identified as thermonociceptors in this study. Thus, we next asked whether ocr-2 and osm-9 are indeed required in FLP to mediate the Tav response. Since no promoters driving the specific expression in the FLP neurons were available, the mec-3 promoter, which is active in FLP, PVD and the six touch receptor neurons (Way and Chalfie, 1989), was used to express the wild-type ocr-2 and osm-9 cDNA in the FLP neurons. As shown before, animals in which the six touch receptor neurons or the PVD neurons were ablated had wild-type head Tav responses (Table 3.2-4). This served as an indicator that none of these neurons are involved in thermonociception. Three transgenic lines (BR5848, BR5849 and BR5850) expressing ocr-2 and osm-9 under the control of mec-3 promoter and transgenic lines containing only Pmec-3::ocr-2 (BR6035 and BR6036) or Pmec-3::osm-9 (BR6038) were generated. Expression of either ocr-2 or osm-9, or
Results 36 both together, under the control of mec-3 promoter was sufficient to yield at least partial rescue of the Tav defect. The level of rescue was comparable to that obtained with genomic copies of ocr-2 and / or osm-9 genomic DNA (Figure 3.4-2). The reason for only a partial rescue may be the mosaic expression pattern of the extrachromosomal arrays used in these experiments and low expression level of OCR-2 and OSM-9 proteins in FLP regulated by mec-3 promoter. It is noteworthy that, although a Pocr-2::gfp expression was not observed in FLP (Jose et al., 2007; Tobin et al., 2002), the genetic data support a function of ocr-2 in these neurons.
Table 3.4-1 Tav response of the mutants of TRPV family genes Genotype Tav response Tav response n A p p B C in the head in the tail value value wild-type 95.1 ± 2.2 68.1 ± 6.0 628 osm-9(y26) 79.8 ± 6.7 42.8 ± 7.4 205 <0.01 <0.001 osm-9(ky10) 81.8 ± 9.1 41.3 ± 11.7 389 <0.01 <0.001 ocr-2(ak47) 91.0 ± 1.5 39.7 ± 2.3 304 >0.05 <0.001 ocr-2(vs29) 86.5 ± 7.7 42.6 ± 18.7 276 <0.01 <0.001 ocr-2(yz5) 83.0 ± 9.9 41.8 ± 11.2 210 <0.01 <0.001 ocr-2(ak47)osm-9(ky10) 78.6 ± 6.7 20.5 ± 2.5 254 <0.01 <0.001 ocr-2(vs29)osm-9(ky10) 73.5 ± 6.1 14.5 ± 7.7 201 <0.01 <0.001 ocr-2osm-9;byEx772[Pocr-2::ocr-2;Posm-9::osm-9;myo-2::mCherry] 96.9 ± 3.8 51.8 ± 6.8 86 <0.001D <0.001E ocr-2osm-9;byEx773[Pocr-2::ocr-2;Posm-9::osm-9;myo-2::mCherry] 96.3 ± 5.0 59.8 ± 15.5 81 <0.001D <0.001E ocr-2osm-9;byEx1086[Posm-9::osm-9::gfp;unc-122::rfp] 87.7 ± 10.9 33.7 ± 5.4 225 <0.01D <0.05E ocr-2osm-9;byEx1088[Pocr-2::ocr-2::gfp;unc-122::rfp] 93.3 ± 6.3 41.3 ± 7.0 194 <0.001D <0.01E ocr-2osm-9;byEx1022[Pmec-3::ocr-2;Pmec-3::osm-9;unc-122::rfp] 89.7 ± 4.6 37.7 ± 7.5 192 <0.001D <0.01E ocr-2osm-9;byEx1023[Pmec-3::ocr-2;Pmec-3::osm-9;unc-122::rfp] 88.8 ± 1.5 36.2 ± 7.4 140 <0.001D <0.01E ocr-2osm-9;byEx1084[Pmec-3::ocr-2::gfp;unc-122::rfp] 91.1 ± 2.0 30.3 ± 7.7 210 <0.001D >0.05E ocr-2osm-9;byEx1085[Pmec-3::ocr-2::gfp;unc-122::rfp] 86.2 ± 4.5 18.8 ± 3.4 188 <0.01D >0.05E ocr-2osm-9;byEx1087[Pmec-3::osm-9::gfp;unc-122::rfp] 91.7 ± 4.0 24.9 ± 6.6 188 <0.001D >0.05E ocr-1(ak46) 96.1 ± 5.8 66.5 ± 11.9 374 >0.05 >0.05 ocr-3(ok1559) 96.1 ± 1.8 71.9 ± 10.2 416 >0.05 >0.05 ocr-4(vs137) 91.9 ± 4.9 64.1 ± 6.7 319 >0.05 >0.05 trp-1(ok323) 94.8 ± 2.7 65.1 ± 5.5 113 >0.05 >0.05 trp-2(gk298) 98.5 ± 1.0 74.4 ± 7.1 198 >0.05 >0.05 trp-4(gk341) 95.5 ± 2.4 70.1 ± 9.2 75 >0.05 >0.05 trpa-1(ok999) 96.2 ± 0.8 61.4 ± 1.2 107 >0.05 >0.05 Values reported are mean % ± SD % nA denotes number of animals tested, 3-17 independent assays were performed. pB values are compared to wild-type animals for the Tav response in the head. pC values are compared to wild-type animals for the Tav response in the tail. pD values are compared to ocr-2(vs29)osm-9(ky10) for the Tav response in the head. pE values are compared to ocr-2(vs29)osm-9(ky10) for the Tav response in the tail.
3.4.2 Contribution of the TRPV1 channels OCR-2 and OSM-9 to the tail Tav response in the PHC sensory neurons To address whether the TRPV1 channel proteins have a similar function in sensing noxious heat in the posterior part, the tail Tav responses in the mutants of the 9 TRPV family genes were analyzed. Significant decreases were observed in all three ocr-2 mutant allele and two osm-9 mutant allele (Table 3.4-1), whereas the other three ocr and four trp mutants behaved like
Results 37 wild-type. Moreover, the ocr-2(vs29) osm-9(ky10) double mutant showed a drastic 80 % reduction in the tail Tav response compared to wild-type (Figure 3.4-3a), indicating the redundant function of both in mediating the tail Tav response. Since the PHC neurons are the major primary thermonociceptors in the posterior part, and in the tail of C. elegans, ocr-2 and osm-9 are co-expressed in the PHA, PHB and PHC sensory neurons (Jose et al., 2007), the function of OCR-2 and OSM-9 in PHC was analyzed. Due to lack of the PHC neuron specific promoters, the ocr-2 and osm-9 genomic DNA, which are expressed exclusively in the PHA, PHB and PHC neurons in the posterior part, were used to rescue the defective tail Tav response in ocr-2(vs29) osm-9(ky10) double mutant. Two transgenic lines expressing ocr-2 and osm-9 genomic DNAs (BR5187 and BR5195) and transgenic lines expressing only ocr-2 (BR6039) or osm-9 (BR6037) were analyzed for the tail Tav response. Expressing either ocr-2 or osm-9 in the double mutant background rescued the defective tail Tav response partially to single mutant level. In contrast, expressing both ocr-2 and osm-9 genomic DNA fully rescued the defective tail Tav response (Figure 3.4-3b and Table 3.4-1). Based on the fact that ablation of PHA and PHB sensory neurons does not affect the Tav response (Figure 3.3-5b), the rescue data shown here support the redundant roles of ocr-2 and osm-9 in the PHC neurons.
a b 100 100
90 90 ** 80 80
70 70 ** 60 60 ** 50 50
40 40 *
30 30 ** Tav response in the Tail (%) 20 Tav response in the Tail (%) 20
10 10
0 0
Transgene
Genotype wild-type ocr-2(vs29)osm-9(ky10) Figure 3.4-3 Contribution of OCR-2 and OSM-9 in PHC in the tail Tav response. (a) Tail Tav response of the 9 mutants of the TRPV family genes. (b) The expression of both ocr-2 and / or osm-9 full-length genomic DNAs
Results 38 rescued the defective Tav response in the tail of the double mutant. (*P<0.01; **P<0.001 compared with wild-type in (a) and ocr-2 osm-9 in (b)). Error bars indicate SD. At least 80 animals were tested for each dataset.
3.4.3 Lacking of specific polyunsaturated fatty acids led to defective Tav response in C. elegans In the AWA and ASH sensory neurons, G proteins activate OSM-9 and OCR-2 by mobilizing specific polyunsaturated fatty acids (PUFAs) and lead to signal transduction of the sensory perception (Kahn-Kirby et al., 2004). To ask whether this mechanism also functions in thermonociception, mutant animals of most of the G proteins were examined. Mutations in all these genes led to no significant defect in the Tav response (Table 3.4-2), suggesting either none of these G proteins are involved in the thermonociception or they function highly redundantly in mediating the Tav behavior. To study the in vivo effects of PUFA depletion on heat perception, fat (lipid desaturase) mutants and the elo-1 (fatty acid elongation enzyme) mutant were tested for their Tav responses. FAT and ELO are enzymes involved in lipid synthesis, and loss of function mutations in these genes led to the depletion in specific PUFAs (Kahn-Kirby et al., 2004). fat-3(wa22) mutant had significantly defective Tav response both in the anterior and posterior part, whereas fat-1(wa9), fat-4(wa14) and elo-1(wa7) mutant animals were defective in the tail Tav response but unaffected in the head Tav response (Figure 3.4-4a and 3.4-5a), indicating the involvement of specific PUFAs in the transduction of thermonociception signal. To assess which PUFAs are involved in the Tav response, fat-3(wa22) animals were grown on plates supplemented with AA (arachidonic acid), EPA (eicosapentaenoic acid) and DGLA (dihomo-γ-linolenic acid) and analyzed for the Tav response. fat-3 defective head Tav response was fully rescued with supplementation of all three PUFAs, whereas only AA supplementation alleviated the defective Tav response in the posterior part of fat-3 mutant (Figure 3.4-4b and 3.4-5b).
Results 39
a b ** ** 100 100 **
90 90
80 ** 80
70 70
60 60
50 50
40 40
30 30
Tav response in the Head (%) 20 Tav response in the Head (%) 20
10 10
0 0
Figure 3.4-4 Specific PUFAs depletion led to defective head Tav response. (a) The head Tav responses of the fat mutants (**P<0.001 compared to wild-type).(b) Defective head Tav response of fat-3 mutant was fully rescued by feeding 80 mM AA, EPA and DGLA (**P<0.001 compared to the fat-3 mutant). At least 80 animals were tested for each dataset. Error bars indicate SD. ab 100 100
90 90
80 80
70 70 ** 60 60 ** ** 50 ** 50 ** 40 40 ** 30 30 Tav Tail (%) in the response 20 Tav in Tail response the (%) 20
10 10
0 0
Figure 3.4-5 Specific PUFAs depletion led to defective tail Tav response. (a) The tail Tav responses of the fat mutants (**P<0.001 compared to wild-type). (b) The defective tail Tav response in the fat-3 mutant was partially rescued by feeding 80 mM AA, whereas EPA and DGLA supplementation showed no rescue effect (**P<0.001 compared to the fat-3 mutant). Error bars indicate SD. At least 80 animals were tested for each dataset.
Table 3.4-2 Mutations in different G-proteins showed no significant reduced Tav responses Genotype Tav response in the Tav response in the n A p p head tail valueB valueC wild-type 95.1 ± 2.2 68.1 ± 6 628 gpa-1(pk15) 92.7 ± 3.8 55.5 ± 6.6 136 >0.05 >0.05 gpa-2(pk16) 92.2 ± 3.6 59.0 ± 7.2 150 >0.05 >0.05
Results 40 gpa-3(pk35) 90.5 ± 4.0 51.7 ± 8.2 164 >0.05 >0.05 gpa-4(pk381) 95.8 ± 3.7 67.8 ± 17.2 120 >0.05 >0.05 gpa-5(pk376) 96.3 ± 4.0 77.7 ± 8.6 101 >0.05 >0.05 gpa-7(pk610) 90.6 ± 2.8 54.2 ± 7 124 >0.05 >0.05 gpa-8(pk345) 91.8 ± 3.4 59.4 ± 8.2 170 >0.05 >0.05 gpa-9(pk438) 92.3 ± 4.4 59.0 ± 9.2 135 >0.05 >0.05 gpa-11(pk349) 96.7 ± 2.9 53.5 ± 2.3 123 >0.05 >0.05 gpa-15(pk477) 87 ± 0.7 56.4 ± 3.1 142 >0.05 >0.05 gpa-1(pk15);gpa-2(pk16);gpa-3(pk35) 94.8 ± 4.3 64.2 ± 20 120 >0.05 >0.05 gpc-1(pk298) 98.5 ± 1.4 74.4 ± 13.1 132 >0.05 >0.05 odr-3(n2150) 95.6 ± 3.1 68.6 ± 3.2 115 >0.05 >0.05 Values reported are mean % ± SD % nA denotes number of animals tested, 3-17 independent assays were performed. pB values are compared to wild-type animals for the Tav response in the head. pC values are compared to wild-type animals for the Tav response in the tail.
Table 3.4-3 PUFAs depletion led to Tav response defect Genotype Tav response in the Tav response in the n A p p head tail valueB valueC wild-type 95.1 ± 2.2 68.1 ± 6 628 fat-1(wa9) 94.7 ± 3.3 48.3 ± 10.7 131 >0.05 <0.001 fat-4(wa14) 95.6 ± 2.4 44.9 ± 9.2 101 >0.05 <0.001 fat-1(wa9)fat-4(wa14) 89.2 ± 2.1 36.4 ± 1.6 140 >0.05 <0.001 elo-1(wa7) 87.3 ± 2.7 36.1 ± 4.4 109 <0.01 <0.001 fat-3(wa22) 60.6 ± 5.2 24.0 ± 2.2 180 <0.001 <0.001 fat-3(wa22) rescued by AA80mM 96.8 ± 1.8 43.1 ± 4.6 201 <0.001D <0.01E fat-3(wa22) rescued by EPA80mM 97.8 ± 1.1 31.5 ± 1.1 191 <0.001D >0.05E fat-3(wa22) rescued by DGLA80mM 98.4 ± 1.1 30.7 ± 2.8 173 <0.001D >0.05E Values reported are mean % ± SD % nA denotes number of animals tested, 3-17 independent assays were performed. pB values are compared to wild-type animals for the Tav response in the head. pC values are compared to wild-type animals for the Tav response in the tail. pD values are compared to fat-3(wa22) for the Tav response in the head. pE values are compared to fat-3(wa22) for the Tav response in the tail.
3.5 Contribution of a cGMP signaling in AFD to the head Tav response
3.5.1 Mutations in tax-2 and tax-4 genes led to defective Tav response In search of candidate proteins sensing heat or transmitting heat-induced stimuli in the AFD neurons, we focused on the cGMP-gated channel (CNG) protein family that previously was implicated in a variety of neuronal sensation. There are six CNG channel protein homologues encoded in the C. elegans genome, mutants are available for four of them. The cng-1(jh111) and cng-3(jh113) single mutant alleles are predicted as null alleles (Cho et al., 2005; Cho et al., 2004), both of them and the cng-3(jh113);cng-1(jh111) double mutant were analyzed for their Tav responses. They all showed responses similar to wild-type (Figure 3.5-1), making it unlikely that
Results 41 they are involved in AFD in heat perception. The other two CNG subunits tax-2 and tax-4 are required in the signaling transduction in several behaviors including thermotaxis in AFD. Previous work from our lab reported that the tax-2(p694) weak allele showed wild-type head Tav response and that the null mutant tax-4(p678) only presented a slightly reduced head Tav phenotype (Wittenburg and Baumeister, 1999). The tax-2(p694) mutant disrupt the expression of tax-2 in only a subset of neurons (Coburn and Bargmann, 1996). The other three mutants tax-2(p671), tax-2(ks10), tax-2(ks31) contain missense mutations in the membrane spanning regions and cause loss of function. All these three strong loss of function alleles showed significantly reduced head Tav response compared to wild-type 95.2 % with 64.5 %, 70.6 % and 66 %, respectively (Table 3.5-1). Furthermore, a careful reexamination of the tax-4(p678) null mutant (Komatsu et al., 1996) after four additional backcrossings to wild-type revealed a more reduced head Tav response than previously reported (70.7 % compared to wild-type 95.2 %; Figure 3.5-1). Additionally, two loss of function mutant alleles tax-4(ks28) and tax-4(ks11) were analyzed and similarly defective head Tav responses were observed in these mutants as in tax-4(p678). Although there is no evidence shown that tax-2 and tax-4 are expressed in any tail neurons, mutations in both genes also significantly reduced the tail Tav response (Table 3.5-1), suggesting the possible function of these channel proteins in the posterior part in sensing noxious heat. Moreover, the double mutant tax-2(p671);tax-4(p678) reduced the Tav response in the head strongly to 42.8 % and in the tail to 36 %. Interestingly, crossing ocr-2 osm-9 into the tax-2;tax-4 mutant did not further enhance this defective head Tav response, and the tax-2;tax-4;ocr-2 osm-9 quadruple mutant showed defective tail Tav response similar as in ocr-2 osm-9 mutant (Table 3.5-1).
100
90 ** 80 ** 70
60 ** Figure 3.5-1 Mutations in tax-2 and tax-4 led to reduced head Tav responses. (a) The Tav response in 50 ** the anterior part of the mutants of CNG channels. 40 (**P<0.001 compared to wild-type). Error bars indicate 30 SD. At least 78 animals were tested for each dataset.
Tav responseHeadin (%) the 20 10 0
Results 42
Table 3.5-1 Mutations in tax-2 and tax-4 led to reduced Tav responses
Tav Tav response Genotype response in nA p valueB p valueC in the head the tail wild-type 95.2 ± 2.0 68.1 ± 6.0 628 tax-4(p678) 70.7 ± 8.1 42.3 ± 1.7 187 <0.001 <0.001 tax-4(ks28) 73.4 ± 3.0 61.2 ± 3.6 162 <0.001 >0.05 tax-4(ks11) 64.6 ± 4.5 49.2 ± 3.4 154 <0.001 <0.001 tax-2(p671) 64.5 ± 7.0 43.5 ± 9.7 235 <0.001 <0.001 tax-2(ks10) 70.6 ± 5.6 ND 136 <0.001 tax-2(ks31) 66.0 ± 2.6 ND 154 <0.001 cng-1(jh111) 97.4 ± 0.4 ND 78 >0.05 cng-3(jh113) 92.8 ± 4.4 ND 139 >0.05 cng-3(jh113);cng-1(jh111) 93.6 ± 2.1 ND 130 >0.05 tax-2(p671);tax-4(p678) 42.8 ± 16.3 36.0 ± 7.6 280 <0.001 <0.001 ocr-2(vs29)osm-9(ky10) 73.5 ± 6.1 14.5 ± 7.7 201 <0.01 <0.001 tax-2(p671);tax-4(p678);ocr-2(vs29)osm-9(ky10) 41.7 ± 4.8 15.6 ± 6.9 371 <0.001 <0.001 Values reported are mean % ± SD % ND: not determined nA denotes number of animals tested, 3-17 independent assays were performed. pB values are compared to wild-type for the Tav response in the head if it is not noted. pC values are compared to wild-type animals for the Tav response in the tail.
3.5.2 Cell-autonomous function of tax-2 and tax-4 in AFD in the head Tav response The tax-2 and tax-4 are co-expressed in twelve pairs of sensory neurons in the head of the animal: AWC, AFD, ASE, ASG, ASJ, ASI, AWB, ASK, BAG, AQR, PQR, and URX (Coburn and Bargmann, 1996). Notably, both genes are expressed in AFD but not in FLP, the second pairs of thermonociceptors in the head. To further support the critical roles of TAX-2 and TAX-4 in the AFD neurons for the sensation of noxious heat, cell-specific rescue experiments were performed. In order to exclude that background mutations other than tax-4 and tax-2 lead to the Tav response defect in tax-4(p678) and tax-2(p671) mutant animals, two transgenic lines (BR4875, BR4876 for tax-4 and BR5600, BR5601 for tax-2) containing the corresponding genomic DNAs were analyzed for the Tav responses. Defects in tax-2 and tax-4 mutants in both the head and tail Tav responses were rescued by reintroducing a wild-type copy of each gene into the respective mutant (Figure3.5-2a, b), confirming the specific roles of tax-2 and tax-4 genes in thermonociception. Then, the AFD-specific role was addressed by expressing tax-4 or tax-2 cDNAs under the control of the AFD neuronal specific gcy-8 promoter in the corresponding mutants. This generated the BR5394, BR5395 and BR5549, BR5550 transgenic animals, respectively. Analyzing these animals proved the expression of the cDNAs in AFD to be sufficient for rescuing the mutant defects. In contrast, in the transgenic lines BR5602 and BR5725, expression of the cDNAs under
Results 43 the control of the odr-3 promoter which is active in several other ciliate neurons (AWA, AWB, AWC, ADF, ASG, ASH, ASI, ASJ, ASK, ADL, PHA, PHB), but not in the AFD neurons (Dwyer et al., 1998), was not able to rescue the phenotype of the corresponding mutants (Figure3.5-2a, b). These data support the hypothesis that tax-2 and tax-4 are required cell-autonomously in the AFD sensory neurons to mediate thermonociception in the head of C. elegans.
100 100 **
90 ** 90
80 80
70 70
60 60
50 50
40 40
30 30 Tav response in the Head (%) 20 Tav Head in the (%) response 20
10 10
0 0
Transgene Transgene
Genotype wild-type* tax-2(p671) Genotype wild-type* tax-4(p678)
100
90
80
70
60 ** **
50 ** **
40
30
Tav Head in the (%) response 20
10
0
Figure 3.5-2 Contribution of tax-2 and tax-4 to AFD mediated head Tav response. (a), (b) The defective Tav responses of both tax-2 and tax-4 single mutant were rescued by the expression of a wild-type copy of the respective gene. Expression of tax-4 or tax-2 cDNAs under the control of the AFD-specific gcy-8 promoter rescued the
Results 44 respective mutant phenotype. However, no rescue was observed when the individual cDNA was expressed under the odr-3 promoter. (c) No further reduction in the head Tav response was observed when AFD was genetically ablated in tax-2(p671);tax-4(p678) mutant background. (**P<0.001). Error bars indicate SD. At least 50 animals were tested for each dataset.
In further support of the roles of both tax-2 and tax-4 in AFD, the double mutant tax-2(p671);tax-4(p678) reduced the Tav response in the head to 42.8 % a level also observed after laser-ablating the AFD neurons, or genetically eliminating AFD via Diphtheria toxin A (DT-A) expression (Table 3.5-2). The role of tax-2 and tax-4 in thermonociception is probably limited to AFD, since genetic ablation of AFD in a tax-2;tax-4 mutant background did not further increase the Tav defect (Figure 3.5-2d). Although mutants in the additional genes of the CNG family were not available, their contribution to AFD function is less likely, given that tax-2;tax-4 already have defects as strong as those observed in AFD-ablated animals.
Table 3.5-2 Contribution of tax-2 and tax-4 to AFD mediated head Tav response Tav response in Tav response in p p Genotype nA the head the tail valueB valueC wild-type 95.2 ± 2.0 68.1 ± 6.0 628 tax-4(p678);byEx925[myo-2::mCherry] 51.6 ± 13.5 46.2 ± 4.8 143 <0.001 <0.001 tax-4(p678);byEx836[Podr-4::tax-4;,myo- 53.6 ± 10 46.8 ± 11 185 >0.05D >0.05D 2::mCherry] tax-4(p678);byEx774[Ptax-4::tax-4;,myo- 86.0 ± 1.6 62.2 ± 3.0 100 <0.001D <0.001D 2::mCherry] tax-4(p678);byEx876[Ptax-4::tax-4;myo- 88.6 ± 6.4 61.5 ± 2.1 67 <0.001D <0.001D 2::mCherry] tax-4(p678);byEx776[Pgcy-8::tax-4;myo- 85.8 ± 8.6 39.9 ± 8.8 50 <0.001D >0.05D 2::mCherry] tax-4(p678);byEx878[Pgcy-8::tax-4;myo- 82.1 ± 6.2 35.4 ± 2.9 52 <0.001D >0.05D 2::mCherry] tax-2(p671);byEx925[myo-2::mCherry] 44.4 ± 4.6 50.6 ± 2.4 154 <0.001 <0.001 tax-2(p671);byEx926[Podr-4::tax-2;myo- 45.4 ± 9.5 48.8 ± 8.2 147 >0.05E >0.05E 2::mCherry] tax-2(p671);byEx834[Ptax-2::tax-2;myo- 69.5 ± 3.8 60.3 ± 4.8 136 <0.001E >0.05E 2::mCherry] tax-2(p671);byEx835[Ptax-2::tax-2;myo- 75.2 ± 8.3 54.4 ± 7.3 68 <0.001E >0.05E 2::mCherry] tax-2(p671);byEx808[Pgcy-8::tax-2;myo- 76.2 ± 9.7 35.1 ± 8.5 161 <0.001E >0.05E 2::mCherry] tax-2(p671);byEx809[Pgcy-8::tax-2;myo- 76.3 ± 8.1 33.2 ± 3.2 137 <0.001E >0.05E 2::mCherry] tax-2(p671);tax-4(p678) 42.8 ± 16.3 36.0 ± 7.6 280 <0.001 <0.001 BR5256;byEx851[Pgcy-8::DTA;myo- 42.3 ± 16.3 61.2 ± 3.2 83 <0.001 >0.05 2::mCherry] tax-2(p671);tax-4(p678);byEx851 42.4 ± 7.4 37.1 ± 10.8 217 >0.05F <0.001G Values reported are mean % ± SD % ND: not determined nA denotes number of animals tested, 3-17 independent assays were performed. pB values are compared to wild-type for the Tav response in the head if it is not noted.
Results 45 pC values are compared to wild-type animals for the Tav response in the tail. pD values are compared to tax-4(p678);byEx925[myo-2::mCherry]. pE values are compared to tax-2(p671);byEx925[myo-2::mCherry]. pF values are compared to tax-2(p671);tax-4(p678) and BR5256;byEx851[Pgcy-8::DTA;myo-2::mCherry] for the Tav response in the head. pG values are compared to BR5256;byEx851[Pgcy-8::DTA;myo-2::mCherry] for the Tav response in the tail.
3.5.3 The gcy-12 mutant showed a severe defective head Tav response The TAX-2 / TAX-4 channels have been shown to be selectively activated by cGMP rather than cAMP under physiological conditions (Komatsu et al., 1999). Consistent with this notion, the three guanylyl cyclases gcy-8, gcy-18, and gcy-23, known as upstream components of TAX-2 / TAX-4 complex, are involved in sensing temperature within physiological range and are exclusively expressed in the AFD neurons (Inada et al., 2006). To elucidate whether these three guanylyl cyclases are also implicated in the Tav response, the mutants were examined for their Tav behavior. Tav responses in gcy single mutants were not affected, whereas, the gcy-8;gcy-18;gcy-23 triple mutant animals showed a mild reduction of head Tav response from 95.2 % in wild-type to 76 % (Table 3.5-3). However, this phenotype was not as severe as the one of the tax-2(p671);tax-4(p678) double mutant (33 %; Table 4.5-1), implicating the involvement of other guanylyl cyclases. Besides gcy-8, gcy-18, and gcy-23, gcy-12 is also expressed in the AFD neurons and several other sensory neurons (Inada et al., 2006). Interestingly, gcy-12 mutants showed a strongly decreased head Tav response (Figure 3.5-3). These results imply the involvement of guanylyl cyclases gcy-8, gcy-18, gcy-23 and gcy-12 in signaling upstream of the CNG channels in thermonociception, by which gcy-12 plays a major role and the other three gcy function redundantly and have minor effects.
100
90 * 80 70 ** Figure 3.5-3 Mutations in four guanyly cyclases led to 60 reduced head Tav responses. Head Tav responses of the gcy 50 mutants were shown. (*P<0.01; **P<0.001 compared to
40 wild-type). Error bars indicate SD. At least 98 animals were tested for each dataset. 30
Tav response in the Head (%) 20
10 0
Results 46
Table 3.5-3 Mutations in four guanyly cyclases led to reduced head Tav responses Genotype Tav response in the head Tav response in the tail nA p valueB p valueC wild-type 95.1 ± 2.2 68.1 ± 6.0 628 gcy-12(nj10) 68.5 ± 2.9 61.0 ± 4.3 193 <0.001 >0.05 gcy-8(oy44) 90.7 ± 8.8 ND 101 >0.05 gcy-18(nj38) 94.0 ± 2.6 ND 98 >0.05 gcy-23(nj37) 92.7 ± 5.0 ND 112 >0.05 gcy-8;gcy-18;gcy-23 76.0 ± 6.6 ND 116 <0.01 Values reported are mean % ± SD % ND: not determined nA denotes number of animals tested, 3-17 independent assays were performed. pB values are compared to wild-type for the Tav response in the head if it is not noted. pC values are compared to wild-type animals for the Tav response in the tail.
Materials 47
4 Materials
4.1 Instruments
The following instruments were used in addition to standard lab equipments: Table 4.1-1 Instruments
Laser diode Schaefter and Kirchhoff (Hamburg) LSM 510 Meta NLO (confocal microscope) Carl Zeiss AG (Oberkochen) Nikon A1 confocal laser scanning microscope Nikon Instruments Inc. Axioplan 2 (fluorescence microscope) Carl Zeiss AG (Oberkochen) Axio Cam MRm (camera) Carl Zeiss AG (Oberkochen) Microinjector 5242 Eppendorf (Hamburg) Micromanipulator 5171 Eppendorf (Hamburg) DMZ-Universal Puller Zeitz-Instrumente (Augsburg) Stereomicroscope SZX7 Olympus (Tokyo) Fluorescence-Stereomicroscope SZX12 Olympus (Tokyo)
4.2 Chemicals and consumable supplies
The following chemicals and consumable supplies were used besides standard lab equipments: Table 4.2-1 Chemicals
Fatty acid salts Nu-Chek Prep (Elysian, MN) Bacto-Pepton Difco (Detroit) Bacto-Trypton Difco (Detroit) Bacto-Yeast Extract Difco (Detroit) Nystatin Sigma (Deisenhofen) Platinum-wire Merck (Darmstadt) Qiagen Gel extraction Kit Qiagen (Hilden) QIAprep Spin Miniprep Kit Qiagen (Hilden) QIAquick PCR Purification Kit Qiagen (Hilden)
Table 4.2-2 Enzymes
Alkaline Phosphatase Roche (Mannheim) Taq Polymerase S Genaxxon, Bioscience (Biberach) Taq Polymerase for Expand long Template system Roche (Mannheim) Restrictions Enzymes Fermentas Proteinase K Invitrogen (Paisley) T4-DNA-Ligase MBI Fermentas (Vilnius)
Materials 48
4.3 Buffers and Media
Table 4.3-1 Buffers and media
10xTBE 1 M TRIS, 1 M Boric Acid, 50 mM EDTA DNA Loading Buffer (6x) 50 % (w / v) glycerol, 0.25 % (w / v) Bromphenol blue, 0.25 % (w / v) Xylenecyanole M9 Buffer 3 g / l KH2PO4, 6 g / l NaH2PO4, 5 g / l NaCl, add after autoclaving 1 ml / l 1 M MgSO4 solution Worm Lysis Buffer 10 mM Tris (pH 8.2), 50 mM KCl, 2.5 mM MgCl, 0.45 % NP40, 0.45 % Tween 20, 0.01 % gelatine, 0.5 mg / ml Proteinase K Nystatin Solution 4 g Nystatin, 200 ml Ethanol, 200 ml Ammoniumacetate Hypochlorit Solution 200 mM NaClO, 500 mM KOH Freezing Buffer 0.1 M NaCl, 50 mM KH2PO4 (pH 6.0), 30 % (w / v) glycerol, 1 M NaOH, add optional 0.1 M MgSO4 LB Medium 10 g / l Bacto-Trypton, 5 g / l Bacto-Yeast Extract, 10 g / l NaCl. For LB plates add 15 g / l agar DYT Medium 16 g / l Bacto-Trypton, 10 g / l Bacto-Yeast Extract, 5 g / l NaCl NGM-Agar for plates 3 g NaCl, 2.5 g Bacto-Pepton, 17 g Agar, ad 967 ml H2O, add after autoclaving:10 ml 0.1 M CaCl2,10 ml 0.1 M MgSO4, 25 ml 1 M KH2PO4 (pH 6.0), 1 ml Nystatin solution, 1 ml Cholesterol (5 mg / ml in Ethanol) For RNAi Plates, after autoclaving NGM-Agar added with 1 mM IPTG and 100 mg / l Ampicillin TFB I for chemical 30 mM KAc, 50 mM MnCl2, 100 mM RbCl2, 10 mM CaCl2, 15 % glycerin, adjust pH competent cells to 5.8 with HAc TFB II for chemical 10 mM NaMOPs (pH 7.0), 75 mM CaCl2, 10 mM RbCl2, 15 % glycerin competent cells All solutions and buffers were prepared with deionized water and were either autoclaved or sterile filtrated through a 0.22 µm vacuum driven bottle top filter (Millipore Corporation, Massachusetts).
4.4 Strains
4.4.1 E. coli strains
Table 4.4-1 Bacteria strains used in this study
OP50 ura- (Brenner, 1974) DH5α endA1, hsdR17(rκ-,mκ+), supE44, thi, recA1, gyrA96, relA1, (lacZYA-argF) U169, Φ80dlacZΔM15 (Hanahan, 1985) HT115(DE3) F-, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rnc14::Tn10(DE3 lysogen:lacUV5 promoter-T7polymerase, RNAse III(-) (Takiff et al., 1989)
4.4.2 C. elegans strains Laboratory N2 var. Bristol was used as the C. elegans wild-type strain. Most of the strains used in this study were provided by the ``C. elegans Genetics Center´´ (CGC; University of Minnesota, USA). tm knockout alleles were provided by Shohei Mitani (National Bioresource, Japan). The
Materials 49
animal strain BR4983 was obtained by crossing the CX7456 strain with N2. The CX7456 strain and plasmids osm-9::GFP5, ocr-2::GFP, tax-2::GFP and ocr-2, osm-9, tax-2 cDNA were kindly given by C.I. Bargmann (Rockefeller University, USA); ocr-2(vs29) osm-9(ky10), ocr-4(vs137); ocr-1(ok132), ocr-4(vs137) osm-9(ky10), ocr-2(ak47) ocr-4(vs137), ocr-4(vs137) are gift from M.R. Koelle (Yale University, USA); tax-4::GFP plasmids, tax-4 cDNA, strain IK699 for Ca2+ imaging experiment and gcy-8(oy44);gcy-18(nj38);gcy-23(nj37), gcy-12(nj10) were given by I. Mori (Nagoya University, Japan); lite-1(ce314) were from K.G. Miller (Oklahoma Center for Neuroscience, USA); fat-1(wa9);fat-4(wa14) were provided by J.L. Watts (University Pullman, USA); daf-19(sa232);daf-12(sa204), daf-19(m86ts);daf-12(sa204) were offered by P. Swoboda (Karolinska Institute, Sweden).
Table 4.4-2 C. elegans mutant strains used in this study Strains Genotype Reference KG1180 lite-1(ce314) (Edwards et al., 2008) OE3063 daf-19(m86ts) (Swoboda et al., 2000) BR5028 daf-19(m86ts);daf-12(sa204) (Swoboda et al., 2000) OE3031 daf-19(sa232) (Swoboda et al., 2000) BR5030 daf-19(sa232);daf-12(sa204) (Swoboda et al., 2000) JT204 daf-12(sa204) (Swoboda et al., 2000) PR767 ttx-1(p767) (Satterlee et al., 2001) CB1338 mec-3(e1338) (Way and Chalfie, 1989) MT1859 unc-86(n846) (Baumeister et al., 1996) MT2247 egl-44(n1080) (Wu et al., 2001) MT2316 egl-46(n1127) (Wu et al., 2001) MT3179 sem-4(n1378) (Basson and Horvitz, 1996) TU38 deg-1(u38) (Chalfie and Wolinsky, 1990) OH161 ttx-3(ot22) (Hobert et al., 1997) OH8 ttx-3(mg158) (Hobert et al., 1997) JY190 osm-9(yz6) (Zhang et al., 2004) CX2327 osm-9(ky10) (Colbert et al., 1997) LX671 ocr-2(vs29) (Jose et al., 2007) JY243 ocr-2(yz5) (Zhang et al., 2004) CX4544 ocr-2(ak47) (Tobin et al., 2002) BR4008 ocr-2(ak47) osm-9(ky10) this paper LX842 ocr-2(vs29) osm-9(ky10) (Jose et al., 2007) CX4534 ocr-1(ak46) (Tobin et al., 2002) RB1374(BR4176) ocr-3(ok1559) this paper LX950 ocr-4(vs137) (Jose et al., 2007) BR3955 ocr-4(tm2173) this paper BR3954 ocr-1(ok132);osm-9(ky10) this paper BR4149 ocr-1(ok132);ocr-2(ak47) this paper LX981 ocr-2(ak47) ocr-4(vs137) (Jose et al., 2007) LX984 ocr-4(vs137) osm-9(ky10) (Jose et al., 2007) LX980 ocr-4(vs137);ocr-1(ok132) (Jose et al., 2007) BR4442 ocr-2(ak47) osm-9(ky10);ocr-1(ok132) this paper LX982 ocr-2(ak47) ocr-4(vs137);ocr-1(ok132) (Jose et al., 2007) VC160(BR4024) trp-1(ok323) this paper
Materials 50
VC602 trp-2(gk298) this paper VC818(BR4025) trp-4(gk341) this paper BR4126 trp-4(gk341);trp-1(ok323) this paper RB1052 trpa-1(ok999) this paper GR1321 tph-1(mg280) (Zhang et al., 2004) PR678(BR5083) tax-4(p678) (Coburn et al., 1998) FK103 tax-4(ks28) (Komatsu et al., 1996) FK129 tax-4(ks11) (Komatsu et al., 1996) PR671(BR5459) tax-2(p671) (Coburn and Bargmann, 1996) FK100 tax-2(ks10) (Coburn and Bargmann, 1996) FK104 tax-2(ks31) (Coburn and Bargmann, 1996) KJ461 cng-1(jh111) (Cho et al., 2005) KJ462 cng-3(jh113) (Cho et al., 2004) BR5514 tax-2(p671);tax-4(p678) this paper BR5573 tax-2(p671);cng-1(jh111) this paper BR5574 tax-2(p671);cng-3(jh113) this paper BR5958 tax-2(p671);cng-3(jh113);cng-1(jh111) this paper KJ5559 tax-4(p678);cng-1(jh111) (Cho et al., 2005) KJ5561 tax-4(p678);cng-3(jh113) (Cho et al., 2004) KJ5562 tax-4(p678);cng-3(jh113);cng-1(jh111) (Cho et al., 2004) KJ5560 cng-3(jh113);cng-1(jh111) (Cho et al., 2005) BR5107 tax-4(p678);ocr-2(vs29) osm-9(ky10) this paper BR6044 tax-2(p671);tax-4(p678);ocr-2(vs29) osm-9(ky10) this paper IK800 gcy-8(oy44) (Inada et al., 2006) IK429 gcy-18(nj38) (Inada et al., 2006) IK427 gcy-23(nj37) (Inada et al., 2006) IK597 gcy-8(oy44);gcy-18(nj38);gcy-23(nj37) (Inada et al., 2006) IK212 gcy-12(nj10) (Inada et al., 2006) CB450 unc-13(e450) (Madison et al., 2005) DA509 unc-31(e928) (Speese et al., 2007)
Table 4.4-3 C. elegans Strains used for neuron labeling
Strains Genotype neurons PY1322 oyIs18[Pgcy-8::gfp] AFD TU2562 dpy-20(e1282);uIs22[Pmec-3::gfp+ dpy-20(+)] FLP,ALM,AVM,PVM,PLM BR5256 dpy-20(e1282);uIs22[Pmec-3::gfp+ dpy-20(+)];oyIs18[Pgcy-8:: AFD,FLP,ALM,AVM,PVM,PLM gfp] OH1098 otIs133[Pttx-3::rfp+unc-4(+)] AIY ZW281 lin-15B(n765);zwEx101[Pinx-1::gfp+lin-15(+)] AIB CX3465 lin-15B(n765);kyIs39[Psra-6:: gfp+lin-15(+)] ASH CX3260 lin-15B(n765);kyIs37[Podr-10:: gfp+lin-15(+)] AWA OH7253 zdIs13[Ptph-1::gfp];otEx3165[Punc-120::hif-1(p621A)+ttx-3::rfp] ADF BR5393 otIs24 [Psre-1::gfp] ADL (OH4770) CX3553 lin-15B(n765);kyIs104[Pstr-1::gfp] AWB NY2064 him-5(e1490);ynIs64[Pflp-17::gfp] BAG BL5752 inIs181;inIs182[ida-1::gfp] PHC CX3716 lin-15B(n765);kyIs141[osm-9::gfp5+lin-15(+)] PHA,PHB OH1422 otIs138[ser-2prom3::gfp+rol-6] PVD VM484 akIs3[Pnmr-1::gfp] PVC VM141 akEx32[Pglr-4::gfp] DVA IK699 Ex1518[Pnhr-38::yc2.12] AFD ZB1057 lin-15B(n765);bzIs18[Pmec-4::yc2.12+lin-15(+)] PVD,ALM,AVM,PVM,PLM
Materials 51
Table 4.4-4 C. elegans transgenic strains obtained by microinjection or crossing Strains Genotype Injected Plasmids BR5187 ocr-2(vs29)osm-9(ky10);byEx772[Pocr-2::ocr- 25 ng / µl pBY2968, pBY2969 and 2::gfp;Posm-9::osm-9::gfp;myo-2::mCherry] 20 ng / µl Pmyo-2::mcherry BR5195 ocr-2(vs29)osm-9(ky10);byEx773[Pocr-2::ocr- 25 ng / µl pBY2968, pBY2969 and 2::gfp;Posm-9::osm-9::gfp;Pmyo-2::mCherry] 20 ng / µl Pmyo-2::mcherry BR5848 ocr-2(vs29)osm-9(ky10);byEx1022[Pmec-3::ocr- 25 ng / µl pBY3279, pBY3280 and 2::gfp;Pmec-3::osm-9::gfp;Punc-122::rfp] 30 ng / µl Punc-122::rfp BR5849 ocr-2(vs29)osm-9(ky10);byEx1023[Pmec-3::ocr- 25 ng / µl pBY3279, pBY3280 and 2::gfp;Pmec-3::osm-9::gfp;Punc-122::rfp] 30 ng / µl Punc-122::rfp BR5850 ocr-2(vs29)osm-9(ky10);byEx1024[Pmec-3::ocr- 25 ng / µl pBY3279, pBY3280 and 2::gfp;Pmec-3::osm-9::gfp;unc-122::rfp] 30 ng / µl Punc-122::rfp BR6035 ocr-2(vs29)osm-9(ky10);byEx1084[Pmec-3::ocr- 25 ng / µl pBY3279 and 20 ng / µl 2::gfp;unc-122::rfp] Punc-122::rfp BR6036 ocr-2(vs29)osm-9(ky10);byEx1085[Pmec-3::ocr- 25 ng / µl pBY3279 and 20 ng / µl 2::gfp;unc-122::rfp Punc-122::rfp BR6037 ocr-2(vs29)osm-9(ky10);byEx1086[Posm-9::osm- 25 ng / µl pBY2968 and 20 ng / µl 9::gfp;unc-122::rfp] Punc-122::rfp BR6038 ocr-2(vs29)osm-9(ky10);byEx1087[Pmec-3::osm- 25 ng / µl pBY3280 and 20 ng / µl 9::gfp;unc-122::rfp] Punc-122::rfp BR6039 ocr-2(vs29)osm-9(ky10);byEx1088[Pocr-2::ocr- 25 ng / µl pBY2969 and 20 ng / µl 2::gfp;unc-122::rfp] Punc-122::rfp BR5723 tax-4(p678);byEx925[myo-2::mCherry] cross BR5083 with BR5410 BR5602 tax-4(p678);byEx836[Podr-4::tax-4::gfp;myo-2::mCherry] 25 ng / µl pBY3114 and 20 ng / µl myo-2::mcherry BR4875 tax-4(p678);byEx774[Ptax-4::tax-4::gfp;myo-2::mCherry] 25 ng / µl pBY2976 and 20 ng / µl myo-2::mcherry BR4876 tax-4(p678);byEx876[Ptax-4::tax-4::gfp;myo-2::mCherry] 25 ng / µl pBY2976 and 20 ng / µl myo-2::mcherry BR4876 tax-4(p678);byEx877[Ptax-4::tax-4::gfp;myo-2::mCherry] 25 ng / µl pBY2976 and 20 ng / µl myo-2::mcherry BR5394 tax-4(p678);byEx776[Pgcy-8::tax-4::gfp;myo-2::mCherry] 25 ng / µl pBY2974 and 20 ng / µl myo-2::mcherry BR5395 tax-4(p678);byEx878[Pgcy-8::tax-4::gfp;myo-2::mCherry] 25 ng / µl pBY2974 and 20 ng / µl myo-2::mcherry BR5722 tax-2(p671);byEx925[myo-2::mCherry] cross BR5459 with BR5410 BR5725 tax-2(p671);byEx926[Podr-4::tax-2::gfp;myo-2::mCherry] 25 ng / µl pBY3115 and 10 ng / µl myo-2::mcherry BR5725 tax-2(p671);byEx927[Podr-4::tax-2::gfp;myo-2::mCherry] 25 ng / µl pBY3115 and 10 ng / µl myo-2::mcherry BR5600 tax-2(p671);byEx834[Ptax-2::tax-2::gfp;myo-2::mCherry] 25 ng / µl pBY2970 and 20 ng / µl myo-2::mcherry BR5601 tax-2(p671);byEx835[Ptax-2::tax-2::gfp;myo-2::mCherry] 25 ng / µl pBY2970 and 20 ng / µl myo-2::mcherry BR5549 tax-2(p671);byEx808[Pgcy-8::tax-2::gfp;myo-2::mCherry] 25 ng / µl pBY3117 and 20 ng / µl myo-2::mcherry BR5550 tax-2(p671);byEx809[Pgcy-8::tax-2::gfp;myo-2::mCherry] 25 ng / µl pBY3117 and 20 ng / µl myo-2::mcherry BR5629 tax-4(p678);cng-1(jh111);byEx846[Ptax-4::tax- 25 ng / µl pBY2976 and 20 ng / µl 4::gfp;myo-2::mCherry] myo-2::mcherry BR5629 tax-4(p678);cng-1(jh111);byEx847[Ptax-4::tax- 25 ng / µl pBY2976 and 20 ng / µl 4::gfp;myo-2::mCherry] myo-2::mcherry BR5629 tax-4(p678);cng-1(jh111);byEx848[Ptax-4::tax- 25 ng / µl pBY2976 and 20 ng / µl 4::gfp;myo-2::mCherry] myo-2::mcherry BR5151 tax-4(p678);cng-3(jh113);byEx775[Ptax-4::tax- 25 ng / µl pBY2976 and 20 ng / µl 4::gfp;myo-2::mCherry] myo-2::mcherry
Materials 52
BR5151 tax-4(p678);cng-3(jh113);byEx775[Ptax-4::tax- 25 ng / µl pBY2976 and 20 ng / µl 4::gfp;myo-2::mCherry] myo-2::mcherry BR5151 tax-4(p678);cng-1(jh111);cng-3(jh113;)byEx849[Ptax- 25 ng / µl pBY2976 and 20 ng / µl 4::tax-4::gfp;myo-2::mCherry] myo-2::mcherry BR5633 tax-4(p678);cng-1(jh111);cng-3(jh113);byEx850[Ptax- 25 ng / µl pBY2976 and 20 ng / µl 4::tax-4::gfp;myo-2::mCherry] myo-2::mcherry BR5634 BR5256;byEx851[Pgcy-8::DT-A;myo-2::mCherry] 0.1 ng / µl pBY3118 and 20 ng / µl myo-2::mcherry BR5635 BR5256;byEx852[Pgcy-8::DT-A;myo-2::mCherry] 0.1 ng / µl pBY3118 and 20 ng / µl myo-2::mcherry BR5410 byEx925[myo-2::mCherry] 20 ng / µl myo-2::mcherry BR5852 byEx1025[Podr-3::DT-A;Podr-4::gfp;myo-2::mCherry] 0.1 ng / µl pBY3269, 30 ng / µl pBY3125 and 20ng / µl myo-2::mcherry BR5853 byEx1026[Podr-3::DT-A;Podr-4::gfp;myo-2::mCherry] 0.1 ng / µl pBY3269, 30 ng / µl pBY3125 and 20ng / µl myo-2::mcherry BR5854 byEx1027[Pmec-3::yc2.12;unc-122::rfp] 100 ng / µl pBY3270 and 30 ng / µl Punc-122::rfp BR5916 byEx1058[Pida-1::yc2.12;unc-122::rfp] 50 ng / µl pBY3278 and 30 ng / µl Punc-122::rfp BR6090 tax-2(p671);tax-4(p678);byEx851[Pgcy-8::DT-A;myo- cross BR5514 with BR5634 2::mCherry] BR4983 quaIs2241[Pgcy-36::egl-1;Pgcy-35::gfp;lin-15(+)] cross CX7456 with N2
4.5 Plasmids
Table 4.5-1 Plasmids from other labs
Plasmid Description Reference pPD95.75 promoterless gfp vector (ampicillin resistance) Fire Vector Kit 1995 pPD95.77 vector containing mec-3 promoter Fire Vector Kit 1995 pBY3275 Punc-122::RFP Fire Vector Kit 1995 pEGFP-N1 CMV promoter, gfp vector (kanamycin resistance) Clontech PKDK189(pBY2978) Pnhr-38::YC2.12 (Komatsu et al., 1996) PKDK153(pBY3272) vector containing YC4.12 (Komatsu et al., 1996) pBY3121 H13p::YC4.12 (Komatsu et al., 1996) pGF16(pBY2976) Ptax-4::tax-4::GFP (Komatsu et al., 1996) pBY2977 tax-4 cDNA in pcDNA1 vector (Komatsu et al., 1996) pBY2975 Psra-6::VR1 (Tobin et al., 2002) pBY2973 osm-9 cDNA in pcDNA3 vector (Colbert et al., 1997) pBY2970 Ptax-2::tax-2:: GFP (Coburn and Bargmann, 1996) pBY2969 Pocr-2::ocr-2:: GFP (Tobin et al., 2002) pBY2968 Posm-9::osm-9::GFP (Colbert et al., 1997) pBY2965 ocr-2 cDNA in pcDNA3 vector (Tobin et al., 2002) pBY3116 Podr-4::odr-4::GFP (Dwyer et al., 1998) pBY566 Pgcy-8::GFP (Yu et al., 1997) pEM-1(pBY3123) Pflp-21::LoxPSTOPLoxP::npr-1SL2GFP (Macosko et al., 2009)
Materials 53
Table 4.5-2 Plasmids constructed in this study Plasmid Description Insert and Vector pBY2974 Pgcy-8::tax-4::GFP tax-4 cDNA cloned into pBY566 with KpnI/XmaI pBY3114 Podr-4::tax-4::GFP odr-4 promoter sequence 4.6kb upstream the coding region cloned into pBY2974 with SphI/XmaI pBY3117 Pgcy-8::tax-2::GFP tax-2 cDNA cloned into pBY566 with KpnI/XmaI pBY3115 Podr-4::tax-2::GFP odr-4 promoter sequence 4.6kb upstream the coding region cloned into pBY3117 with SphI/XmaI pBY3118 Pgcy-8::DT-A(WT) DT-A(WT) cloned into pBY566 with KpnI/XmaI pBY3119 Pgcy-8::DT-A(G128D) DT-A(G128D) cloned into pBY566 with KpnI/XmaI pBY3120 Pgcy-8::VR1 Pgcy-8 promoter sequence cloned into pBY2975 with SbfI/Acc65I pBY3125 Podr-4::GFP Podr-4 promoter sequence cloned into pBY566 with SphI/XmaI pBY3269 Podr-3::DT-A(WT) Podr-3 promoter sequence cloned into pBY3118 with SphI/XmaI pBY3270 Pmec-3::YC2.12 Pmec-3 promoter 2kb upstream and the coding region to 4aa of the 5 exon cloned into PKDK189 with XmaI/NheI pBY3276 Pgcy-8::YC4.12 Pgcy-8 promoter sequence cloned into PKDK153 with SbfI/Acc65I pBY3278 Pida-1::YC2.12 YC2.12 cut out of PKDK189 cloned into pEM-1 with SbfI/SpeI, then Pida-1 cloned with FseI/AscI, cut LoxPStopLoxP out with NheI pBY3279 Pmec-3::ocr-2::GFP ocr-2 cDNA cloned into pEGFP-N1 with XhoI/SmaI, Pmec-3 cloned upstream of it with Eco47II/XhoI pBY3280 Pmec-3::osm-9::GFP osm-9 cDNA cloned into pEGFP-N1 with XhoI/SacII, Pmec-3 cloned upstream of it with Eco47II/XhoI
4.6 Oligonucleotides
Table 4.6-1 Oligonucleotides used for cloning Oligonucleotide Sequence in 5´-3´ orientation Purpose RB4759 fwd CCC CCC GGG CCA TGT CAA CGG CGG AAC CTG CAC C Cloning of Pgcy-8tax-4cDNA pBY2974 RB4760 rev CCC GGT ACC TTT TTG AGC AAG GAT TCA GAT TCA GTT C Cloning of Pgcy-8tax-4GFP cDNA pBY2974 RB 4837 fwd CCG CGC CCC GGG ATA TGT ATC AAG TTC CAA AAC GAG Cloning of XmaIPgcy-8tax-2 CAA AAA C pBY3117 RB 4838 CGC CCC GGT ACC GAA TCG GCA TGT AGT TTC TGT GTT Cloning of Pgcy-8tax-2KpnI CCG G pBY3117 RB4943 fwd SphI CCC CGC ATG CAT GAG AAA CGG AAG GTG AG Cloning of Podr-4tax-2GFP pBY3114, pBY3115 RB4944 rev XmaI GGG GCC CGG GTG GAA TTG CAA GTG TTG Cloning of Podr-4tax-2GFP pBY3114, pBY3115 RB5001 fwd SphI CCC GCA TGC TAG TGT TTC CTT TGA CTG TAT TCC Cloning of Podr-3DTA pBY3269 RB5002 rev XmaI CCC CCC GGG ATC TAA AAA AAC AAT GAT CTA TGA G Cloning of Podr-3DTA pBY3269 RB4914 fwd XmaI CGG CCC GGG CCA TGG ATC CTG ATG ATG TTG TTG ATT C Cloning of Pgcy-8DTA pBY3118, pBY3119 RB4915 rev KpnI CGCGGTACCTCACAAAGATCGCCTGACACGATTTCC Cloning of Pgcy-8DTA pBY3118, pBY3119 RB4957 SbfI CCC CCT GCA GGA GCA AAG GGC GTC GAT TAT CTC GAA Cloning of Pgcy-8VR1 fwd C pBY3120,
Materials 54
pBY3276 RB4958 CCC GGT ACC TTT GAT GTG GAA AAG GTA GAA TCG Cloning of Acc65IPgcy-8VR1 rev pBY3120, pBY3276 RB5221XmaI mec-3 GGG CCC GGG CTA AAG TTC ATA CTA ATC TGT AAT TTT Cloning of fwd TTG GTG pBY3270 RB5222 NheI mec-3 rev CCC GCT AGC GAG CCC AGC CTG TAA AGT TCT TTG AG Cloning of pBY3270 RB4797 XhoIocr-2 CCC CTC GAG ATG GGT TCC TCA TCT TCA ACC C Cloning of pBY3279 RB4798 ocr-2SmaI CCC CCC GGG AGT GAG CAG CAC CAT TTC CAT TCT G Cloning of pBY3279 RB4799 XhoIosm-9 CGC CCC CTC GAG ATG GGC GGT GGA AGT TCG CGA AAC Cloning of AAA ACC GAA C pBY3280 RB4800 osm-9SacII CGC CCC CCG CGG TTC GCT TTT GTC ATT TGT CGG CGG Cloning of GAG TGG AGG pBY3280 RB5145 Eco47III fwd CCC AGC GCT TGC AGG TAC CCG GAG TAG TTG GCG Cloning of mec-3 pBY3279, pBY3280 RB5146 XhoI rev mec-3 GGG CTC GAG ATT TCC GTA GTT CAA ATG AAA TAA ATC Cloning of AG pBY3279, pBY3280 RB5111 FseI ida-1 CCC GGC CGG CCA AGC TTG AAT AAA GTT TGA AAA AGT Cloning of TTT GGG pBY3278 RB5112 AscI ida-1 CCC GGC GCG CCC GGA TGA CAC AGA GAT GCG GCC Cloning of pBY3278
Table 4.6-2 Oligonucleotides used for detection of mutations in C. elegans Oligonucleotide Sequence in 5´-3´ orientation Purpose RB 5208 fwd inner CAA CCA GCG GCC ACC GGT GTT C Detection of tax-4(p678) point tax-4(p678) mutation. Wild-type give 427bp RB5209 rev inner AAC CGC CAT CGG AAG ATG CCG GAT A and 254bp PCR fragments and tax-4(p678) homozygous animals show 427bp RB5210 fwd outer GGT GCA TAC GAC TAC GGC TCA GCA AAA CG and 220bp bands. tax-4(p678) RB5211 rev outer GGCACACATTCTTTTCCATTGAAAAATTCAACCG tax-4(p678) RB 4826 fwd inner CAT GAC ATG GCT CTC ACT AGT TAC TTG AC Detection of tax-2(p671) point tax-2(p671) mutation. Wild-type give 398bp RB 4827 rev inner GGA ATA CAA AAT GCA TTG AAT AAA AAC CA and 257bp PCR fragments and tax-2(p671) homozygous animals show 398bp RB 4828 fwd outer CTA ATG TAC CAA AAC AAA ATG AGC ATC G and 199bp bands. tax-2(p671) RB 4829 rev outer ACT TGA ATT CCT CCT CTC GTG AAT CTT A tax-2(p671) RB5214 fwd inn GAA GCT TCT GCA CTT TCA CTT GTG GTC TT Detection of ocr-2(vs29) point ocr-2(vs29) mutation. Wild-type give 227bp RB5215 rev inn CCC AGT AAA ATC GCC GCT TAC CCT AT and 115bp PCR fragments and ocr-2(vs29) homozygous animals show 227bp RB5216 fwd out ATC AAC AGC TTA CCC ACT GGC AAA GAT C and 167bp bands. ocr-2(vs29) RB5217 rev out CTT ACT TTC TTT TGG CAA ATG CTT CCC A ocr-2(vs29)
Materials 55
RB3057 fwd GCT GCC TGT TTG AAT CAA CC Detection of ocr-2(ak47) deletion. ocr-2(ak47) Wild-type show 500bp band and RB3058 rev TCG CTT CCA GCA ATG TAT CC homozygous animals give 850bp between band. ocr-2(ak47) RB3059 rev ACT CCA GTT GTG TCT GGA AG ocr-2(ak47) RB3112 fwd inner CGG CCT GAA ACA TTG TGT TAT CTT TAG TCC Detection of osm-9(ky10) point osm-9(ky10) mutation. Wild-type give 437bp RB3113 rev inner GTA CAA TGG CTA GGT GGA GGG CTG AGT A and 207bp PCR fragments and osm-9(ky10) homozygous animals show 437bp RB3115 rev outer GGG GTA CTC CCC GTA ATA GGC ATA ACC T and 288bp bands. osm-9(ky10) RB3384 fwd outer GCA CTT TGG AAA CTG AAC AAG AGA GGT G osm-9(ky10) RB4897 fwd CTT GAG CAC TGG ATA TTC TCC TAC G Detection of cng-1(jh111) primer deletion. Wild-type show 2.5kb cng-1(jh111) band and homozygous animals RB4899 rev primer CTA CAA GAC TGT AAC TCC ATC CGC give 1kb band. cng-1(jh111) RB5502 fwd GCA ATT GAC CTA TTA GCA ATC TTC CC Detection of cng-3(jh113) cng-3(jh113) deletion. Wild-type show 1.2kb RB5503 rev GTT TGC AAT CGC TCG TTG AGA TTT CTG band and homozygous animals cng-3(jh113) give 700bp PCR fragment. RB4904 fwd inn TCC AGT CAG CGG TAT GTT CAT AAC GA Detection of egl-46(n1127) point egl-46(n1127) mutation. Wild-type give 445bp RB4905 rev inn GCT TAG AAA GAG CCG ATA GCT TTA CTA AC and 287bp PCR fragments and egl-46(n1127) homozygous animals show 445bp Rb4906 fwd out ACT GCA AAT AAG GCG ATC ATA GTA TTC A and 213bp bands. egl-46(n1127) RB4907 rev out GTA ATT AAC CCA AGC TTT TGC TCC TTC T egl-46(n1127)
Methods 56
5 Methods
5.1 C. elegans methods
5.1.1 Breeding of C. elegans The animals were maintained on NGM plates seeded with E. coli OP50 as previously described (Brenner, 1974). Petri dishes with the diameters 3.5 cm, 5 cm and 9 cm were used in this work. Animals were kept in air permeable cardboard boxes at 15, 20 or 25 °C. The basic culture methods (handling of C. elegans, decontamination, freezing, preparation of synchronized cultures and specific stages) were performed as previously described (Lewis and Fleming, 1995).
5.1.2 Mating (Genetic crosses) L4 hermaphrodites and males were placed on a small (3.5 cm) NGM plate in a ratio of 1:3. After 24 hours, the adult hermaphrodites and males were transferred onto a fresh plate to discard the eggs laid within the first 24 hours by self-fertilization. A successful crossing was confirmed by the appearance of males among 50 % of the F1 progeny. Four larvae of F1 hermaphrodite progeny (younger than L4) were singled and their progeny (F2) were further analyzed for their genotype and phenotype.
5.1.3 Worm lysis for Single worm PCR To identify a mutant animal without an obvious phenotype, genotyping was the method of choice. For this purpose PCR using worm lysate as template and specific gene primers was performed. Mature singled F2 worms from a genetic cross were transferred into 5 µl worm lysis buffer by using a pipette tip after they laid several eggs. After at least 30 min incubation at -80 °C, the worm lysate was first incubated at 65 °C for 1 hour, then the proteinase K was destroyed at 95 °C for 15 min. Subsequently 2-5 µl of the worm lysate was used as a template for the following PCR.
5.1.4 Transformation of C. elegans DNA plasmids were transformed into the distal arm of the gonad of the animals by microinjection as previously described (Fire, 1986; Mello et al., 1991). All transgenic lines generated during this work are listed in Table 4.4-4.
Methods 57
5.1.5 RNAi (Interference) feeding Plasmids derived from the Ahringer RNAi library (Fraser et al., 2000) were transformed into E. coli HT115 (DE3). About 10 colonies were picked and inoculated in 10 ml LB/Amp culture. The next day, the overnight culture was diluted to 1:50 and shaken at 37 °C for 4 hours, from this subculture 100 µl were plated on each NGM plate with IPTG and ampicillin. L3 worms were placed on the RNAi plate at the corresponding incubation temperature. The worms of the second generation were analyzed.
5.1.6 Microscopy For phenotypic or expression studies animals were mounted on 2 % (in M9 buffer) agarose pads and paralyzed with 2 µl 20 mM sodium acid or 0.2 mM levamisole solution, then examined using either DIC or fluorescence microscopy as described elsewhere (Sulston and Horvitz, 1977). Images were taken by using a Nikon A1 confocal laser scanning microscope and a Nikon CFI Plan Apochromat 40 × oil N.A. 1.00 objective or a Zeiss AxioImager.Z1 Microscope, an AxioCam MRm camera, and the AxioVision software.
5.1.7 The thermal avoidance (Tav) assay A 50 mW laser diode that emits at a wavelength 685 ± 0.5 nm, close to IR light, was attached to a Leica MZ8 dissecting microscope. The Tav assay was performed in an air-conditioned room with a constant temperature of 20 °C and a humidity of at least 45 %. The laser beam was focused by collimator optics to a ~30 μm spot visible under the dissecting scope to obtain a local temperature on the agar surface of roughly 38 °C, which is a noxious thermal stimulus to the worms (Wittenburg and Baumeister, 1999). Before assaying, the lid of the assay plate was left open to give the animals 1 min to become accustomed to the environmental conditions of the room. The laser focus was presented for 10 seconds either at the tip of the nose for the head Tav response or the tip of the tail of the animals for the tail Tav response. The worm show a withdrawal reaction when the anterior end is innervated by the laser beam. Withdrawal reaction consists of three characteristic phases: the foraging worms first stop forward movement, then reverse for one to two and a half body lengths, reposition, and, finally, turn away from the heat source to resume forward movement in a new direction. By means of the three phases, the nociceptive reaction can be classified in four classes. Most of the wild-type worms belong to Class I which show the full behavior; Class II worms stop forward movement, but only
Methods 58 reverse for about one body length and do not perform a heading change; Class III worms response slowly to the heat stimulus; the worms that do not show any response is Class IV (Wittenburg and Baumeister, 1999). In this work, the worms showed Class I to Class III head Tav responses were all scored as positive, whereas the Class IV worms were recorded as negative. When the thermal stimulus encounters the posterior ends of the animals, the forward moving worms show an accelerated forward movement and the resting worms initiate a backward movement. Both are recorded as positive tail Tav responses. The NGM plates for the Tav assay were seeded with 100 µl fresh E. coli OP50 that were evenly spread. To prepare the synchronized worms for the Tav assay, 6 gravid hermaphrodites were transferred on each plate laying eggs for 8 hours. After that the adult animals were killed and in two days the synchronized progeny reached the adult stage that were tested for the Tav response. Statistical analysis was carried out by using the GraphPad Prism 4 software. P values were generated by one-way ANOVA using the Tukey-test.
5.1.8 Heat stress assay with hsf-1(sy441) mutant The hsf-1(sy441) mutant and wild-type young adults grown at 20 °C were put in 34 °C incubator for 15 min heat shock. Consequently, the head Tav responses of the animals were tested at 1 hour, 2 hours, 4 hours and 6 hours after the heat shock treatment.
5.1.9 Dietary lipid supplementation The dietary lipid supplementation was done as previously described (Kahn-Kirby et al., 2004).
PUFA stocks were prepared by diluting fatty acid salts to 100 mM in ddH2O immediately prior to making plates. NGM solution was cooled to ~50 °C; lipids were added slowly and dissolved by stirring. Plates were poured immediately, then dried in the dark at room temperature for 24 hours and seeded with OP50. For the PUFA rescue experiments, the effects of different concentrations (60 µM, 80 µM, 120 µM and 160 µM) were tested. Synchronized fat-3(wa22) mutant animals were prepared as described in section 5.1.7. Improved locomotion and body shape in the mutants are the criteria for the rescue effect. With 80 µM PUFAs (AA, EPA, DGLA) the improvement of these phenotypes is very obvious, thus, for further behavior test 80 µM PUFAs were used for rescue.
Methods 59
5.1.10 2-photon neuron-laser-ablation Individual neurons were identified by GFP-labeling (for strains see table 4.4-3). Neuron ablation was performed essentially as described (Bargmann and Avery, 1995). Animals were mounted and paralyzed on 4 % (in M9 buffer containing 0.6 mM levamisole) agarose pads within 2 µl M9 buffer. Neurons from L2-stage animals were ablated with a 2-photon laser (wavelength 730 nm, ~30 % energy and with 10 iteration) microbeam focused through the C-Apochromat 63 × / 1.2w corr objective of a confocal microscope Zeiss LSM 510 Meta NLO. Ablated animals were tested for their Tav response at young-adult stage, 2 days after recovery from ablation. Only the healthy adult animals were kept for further behavioral analyses, the animals which showed abnormal movement or morphology were discarded. Mock-ablated animals of the same genotype were exposed to the same treatment except for neuron-laser-ablation. The neuron-ablated and mock-ablated animals were singled on small agar plates labeled with number one day before behavioral analyses for blind test on the next day. The success of neuron ablation was monitored by the disappearance of GFP in the neurons after the behavioral assays.
5.1.11 Calcium imaging and data analysis Single young adult worms were mounted on a thin 2 % agar pad with small amounts of surgical N-butyl(2)-cyanoacrylate (Histoacryl) glue and a cover slip over them. The glue was delivered through a drawn glass capillary tube operated by mouth. Gluing the tip of the animal’s head was avoided because this abolishes transient calcium changes. The slight withdrawal response of the animal’s head was observed upon noxious heat. Regions of interest around the cell body of the neuron were defined by hand and adjusted for each image accordingly because of the motion of the sample. General room temperature was kept at ~22 °C during optical recording. The noxious temperature stimuli were generated using a standard chip sized ceramic SMD0805 electrical resistor (size 2 x 1.25 x 0.5 mm3) placed on top of the cover slip. 0.2 µl of mineral oil were used to displace the air between the resistor and the glass (Figure 5.1-1). An ATMEL AVR ATMEGA88 microcontroller served as a triggerable electronic timer to produce local heat pulses of 190 mW and adjustable duration. The conditions of the laser-based Tav assay on plate were reproduced by a typically 2 seconds long heating period, which generated a local temperature peak of ~38 °C with a temperature increase of 8 °C / s. A Nikon A1 confocal laser scanning microscope and a Nikon CFI Plan Apochromat VC 60 × WI N.A. 1.20 objective was used to record the calcium dynamics of a single neuron for 5 seconds before the stimulus and 5 seconds
Methods 60 after the beginning of the stimulus. A field of 64 x 64 pixel was recorded with 4 frames per second. Excitation wavelength was 458 nm, emission bands were collected at 464.5-499.55 nm (CFP) and 525-555 nm (YFP) respectively. The region of interest (ROI) was selected manually in the image stack, and regional YFP / CFP ratios were determined using Nikon NIS-Elements software version 3.10. The average of the 5 s pre-stimulus baseline ratio was set as R0. The percentage of the fluorescence ratios relative to R0 were calculated as [(Rt-R0)/R0]*100 %, where
Rt means a ratio at the time t. The average magnitude of the ratio change (maximum ratio- minimum ratio) from more than 4 animals was plotted as Box & Whisker Plots using the GraphPad Prism 4 software. P values were generated by one-way ANOVA using the Tukey-test. Ekkehard Schulze did the imaging set-up (Figure 5.1-1) and the FRET measurement.
Histoacryl ceramic body CyA glue metal layer = heat source egg salts 0.2 µl mineral oil = heat cond. 2% agarose 190 mW 2000 ms ~38°C in egg salts
worm immersion water 60xW
Figure 5.1-1 The set-up for the electrical-resistor system in the Ca2+ imaging experiments.
5.2 Molecular biology methods
5.2.1 Polymerase chain reaction (PCR) In this work, PCR was performed either to determine the genotype of single worm or to amplify insert for subcloning. The oligonucleotides shown in table 4.6-1, 2 were used as primers for PCR. Reaction mixture: a. PCR to determine deletion mutation Sterile deionized water 14.3 (13.05) µl 10× PCR buffer 2.5 µl 2 mM dNTPs 2.5 µl
Methods 61
25 mM MgCl2 2 µl 10pmol/µl forward primer 1.25 µl 10pmol/µl reverse primer 1.25 µl (10pmol/µl reverse primer in-between 1.25 µl) Taq Polymerase 0.2 µl b. PCR to determine point mutation with tetra primers Sterile deionized water 4.9 µl 10× PCR buffer 2 µl 2 mM dNTPs 2 µl
25 mM MgCl2 1.6 µl Forward inner primer (10pmol/µl) 2 µl Reverse inner primer (10pmol/µl) 2 µl Forward outer primer (1pmol/µl) 2 µl Reverse outer primer (1pmol/µl) 2 µl Taq Polymerase 0.5 µl c. PCR for subcloning Sterile deionized water 14.3 µl 10× PCR buffer 2.5 µl 2 mM dNTPs 2.5 µl
25 mM MgCl2 2 µl 10pmol/µl forward primer 1.25 µl 10pmol/µl reverse primer 1.25 µl Long PCR Enzyme Mix 0.25 µl
5.2.2 Subcloning Following methods were applied as previous described: Preparation of competent E. coli (DH5α, HT115) (Maniatis T., 1982) Transformation of E. coli (Hanahan, 1985) Plasmid preparation from E. coli (QIAgen, Hilden) Digestion of DNA with Restriction Endonucleases (Maniatis T., 1982) Gel-Electrophoresis (Agarose) (Maniatis T., 1982) Ligation of DNA fragments (Maniatis T., 1982)
Discussion 62
6 Discussion
Noxious environmental stimuli, such as heat, trigger a survival response in animals resulting in reflexive escape reactions. The nematode Caenorhabditis elegans shows a protective withdrawal-reflex after heat stimuli, termed the Tav (thermal avoidance) response. In previous experiments, the head and tail of C. elegans have been defined as responsive to thermonociception, indicating that the heat-receptive neurons are located in these regions (Wittenburg and Baumeister, 1999). However, due to the complexity of this nocifensive behavior, the neural circuits involved remain elusive. In this study, the analysis of various C. elegans mutants defective in neuronal development and sensory function and of animals in which candidate neurons are eliminated by microsurgery offers the opportunity to identify molecular and cellular pathways involved in this behavior.
6.1 CNG channels are required in the AFD thermonociceptors, whereas FLP uses TRPV to sense noxious heat
In this study, the anterior FLP and AFD neurons and the posterior PHC neurons of C. elegans are identified as thermonociceptive neurons. The AFD neurons have a complex anatomy with numerous finger-like cilia invaginating in the surrounding sheath cells (Perkins et al., 1986), a structure serving to enlarge its surface and to facilitate temperature sensation. The AFD neurons are polymodal, responding in addition also to temperature alterations in the physiological range (Kimura et al., 2004), and act as CO2 sensors (Bretscher et al., 2011). The second pair of thermonociceptor neurons, the FLP neurons, are also polymodal and respond in addition to noxious mechanical stimuli (Kaplan and Horvitz, 1993). Their neurites develop into a complex branched network of thin sensory processes, similar to the PVD nociceptors (Albeg et al., 2011). Branched, tree-like cilia are characteristics of certain types of nociceptors in vertebrates (Woolf and Ma, 2007), but also Drosophila polymodal nociceptors are attached to epidermal cells with multiple branched naked nerve endings (Hwang et al., 2007). In the Tav assay, only the FLP, but not the PVD neurons of C. elegans, responded to direct exposure by a local source of heat. The PVD neurons, in contrast, have been shown before to be stimulated by acute cold shock (Chatzigeorgiou et al., 2010). AFD receives synaptic inputs from AIN and AWA and has gap junctions to AIB and itself. FLP receives synaptic input from ADE and connects with RIH, AVD and itself via gap junctions
Discussion 63
(White et al., 1986). Based on the fact that the activation of AFD and FLP upon noxious heat is independent of neuronal transmission, the synaptic connection between AIN, AWA and AFD, ADE and FLP are not involved in the heat sensation. Besides AFD and FLP, there are no further sensory neurons identified as thermonociceptors in this study. Moreover, ablation of both neurons almost abrogates the head Tav response. Altogether, it is an attempt at assuming that AFD and FLP may be the primary sensory neurons in sensing noxious heat. Although, from the data shown here, the existence of a more complicated neural circuit, in which AFD and FLP serve as accessory neurons, accepting the neuronal information via gap junctions, could not be totally excluded. To address this question, noxious heat evoked calcium signaling in AIB in wild-type and AFD-ablated animals should be analyzed to approve the function of AIB downstream of AFD in heat perception. Furthermore, the interneurons connected with FLP in the thermonociceptive circuit should be identified. Recently, a hub-and-spoke gap junction network has been suggested in nose touch in which the RIH interneurons mediate the signal information from OLQ / CEP primary sensory neurons to FLP nociceptors (Chatzigeorgiou and Schafer, 2011). Is a similar gap junction network also involved in thermonociception? The identification of the interneurons in the FLP neural circuit in thermonociception and the calcium signal analysis in these interneurons in wild-type and FLP-ablated animals may help to elucidate the mechanism. The genetic data in this work strongly implicate that at least two channel protein families contribute to thermonociception in C. elegans in distinct neurons: the TRPV in FLP and PHC and the CNG channels in AFD. The vertebrate TRPV1 channel is activated by noxious heat, acids, and capsaicin (Caterina et al., 1999). The same properties are shared by two of the C. elegans TRPV channels, OSM-9 and OCR-2. The involvement of TRPV channels in thermonociception also supports the notion that wild-type animals show hyperalgetic Tav reaction after capsaicin treatment (Wittenburg and Baumeister, 1999). OSM-9 and OCR-2 have been characterized to assemble into a heteromultimeric channel complex in ASH and AWA, where they function in signal transduction in the neuron-mediated nociceptive and chemotaxis behaviors (Tobin et al., 2002). Here a similar model may be required for the sensation of noxious heat in FLP. However, although the defective Tav response in ocr-2 osm-9 is significant, the phenotype observed in FLP-ablated animals is more severe (Table 3.3-2 and Table 3.4-1), suggesting the involvement of other, so far undetected factors besides OCR-2 and OSM-9 in thermonociceptive signal transduction in the FLP neurons.
Discussion 64
In addition to the TRPV channels, C. elegans obviously uses also the two CNG channels TAX-2 and TAX-4 that function cell-autonomously in the sensation of noxious heat in the AFD neurons. tax-2 and tax-4 encode the β- and α-subunits of a CNG channel complex; α-subunits could either form channels on their own or form heteromultimeric channels with β-subunits (Coburn and Bargmann, 1996). The stronger defect in the tax-2;tax-4 double mutant compared with the single mutant (Figure 3.5-1) suggests that TAX-4 may function both alone and also in a complex with TAX-2 in AFD to mediate Tav response. TAX-2 and TAX-4 have been shown to be required in olfaction, thermosensation, and axon outgrowth (Bargmann, 2006). However, a developmental defect in the tax-2;tax-4 double mutant was not considered to be the cause of a reduced Tav response, since no defect in the AFD morphology was observed in the tax-2 and tax-4 mutants (Coburn and Bargmann, 1996). Numerous animal studies have shown that cGMP essentially contributes to the sensitization of both inflammatory and neuropathic pain (Schmidtko et al., 2009). Although the role of CNG channels in pain sensation as a downstream target of cGMP has not been elucidated yet, CNG channel subunits are expressed in vertebrate dorsal root ganglia (DRG), where the nociceptors locate (Schmidtko et al., 2009). To my knowledge, the study shown here provides the first evidence of CNG channels functioning in the sensation of noxious temperature. Given that CNG and TRPV channels are expressed in different cells and act in a cell-autonomous manner, it is an attempt to propose that both have distinct roles in the heat avoidance response. It is currently not possible to decide whether they function independently of one another, since the quadruple mutant tax-2;tax-4;ocr-2 osm-9 did not further decrease the Tav behavior in the head of the ocr-2 osm-9 mutant animals (Table 3.5-1). This may either indicate a redundant function of OCR-2 and OSM-9 in the FLP sensory neurons or a more complex interaction between these channels and their sensory neurons in the noxious heat response. To elucidate the detailed mechanisms and the molecular regulation of these two channel families, methods such as electrophysiological analysis in either the whole animals or heterologous cultured cells are the choices.
Discussion 65
6.2 Thermonociception and thermotaxis use selective different cellular and molecular mechanisms to transduce sensory signals
C. elegans exhibit negative thermotaxis above the cultivation temperature across a wide range of conditions, but only animals conditioned at 23 °C and exposed to shallow gradients (<0.5 °C/cm) exhibit positive thermotaxis (Jurado et al., 2010). Although grown at 23 °C, animals exposed to steep temperature gradients (>1 °C/cm) always avoid the warm temperature. This so called warm avoidance response uses different mechanisms than the avoidance to noxious heat, since the AFD-ablated animals showed wild-type warm avoidance response (Yamada and Ohshima, 2003) but strongly reduced head Tav response. C. elegans, with the entire nervous system composed of only 302 neurons, shows sophisticated behaviors. To perform these tasks, individual neurons may be involved in distinct sensations (Bargmann, 2006). AFD is a good example, which can sense temperature changes as small as 0.05 °C within the physiological range and also be activated by noxious heat (Clark et al., 2006). In humans, the ability of sensation of tiny temperature change arises from the summation across 400 human thermosensory neurons. Moreover, in mammals, the warm-fiber population has little role in eliciting the painful sensation by noxious heat, suggesting different neurons are involved in sensing noxious heat and warm temperatures (Darian-Smith et al., 1979). The AIB-ablated animals showed no detectable abnormality in thermotaxis when compared with the behavior of wild-type, but were severely defective in the Tav response. Almost all of the AIY-killed animals exhibited clear cryophilic movement, the AIZ-ablated animals are mostly thermophilic, sought a higher temperature than their cultivation temperature (Mori and Ohshima, 1995). Recently, an independent study reported by Glauser and colleagues also identified a minor contribution of single and double combinations of C. elegans TRPV channels to the avoidance in crossing the noxious temperature barriers, corroborating the findings in this work (Glauser et al., 2011). These experiments capitalized on the attraction of C. elegans to certain odorants, which actively forces the animals to overcome a local adversive temperature barrier or gradient. In these assays, ablation of the AFD neurons did not affect the response of C. elegans, suggesting that the response from this assay is distinct from the Tav response, or that the interference between heat avoidance and chemical attraction may be more difficult to dissect than anticipated. In addition, these assays require starving the animals six hours prior to analysis, which is not a typical
Discussion 66 prerequisite for a nociceptive response and may actually modulate heat avoidance behavior. In fact, the previous published results from our lab indicate that animals that have been starved in order to enter the dauer stage had lost their Tav response almost entirely (Wittenburg and Baumeister, 1999), and genetic modulation of the insulin signaling pathway that is affected by starvation showed altered Tav responses (Shu Liu, diploma thesis). Moreover, the laser ablation of ASH and AWA chemosensory neurons even slightly increased the head Tav response compared to the mock-ablated animals (Table 3.3-2), which may indicate a negative modulation of thermonociception through activation of chemosensory neurons. Finally, by using the Tav assay, it is possible to show that the Tav response differs in head and tail. The anterior and posterior parts can be dissected by using a local heat source rather than a temperature gradient. It is currently not known how C. elegans integrates noxious sensory inputs from both head and tail. In comparison, the tail sensory neurons PHA and PHB antagonize the ASH and ASK head sensory neurons to affect the SDS chemical avoidance response (Hilliard et al., 2002). Multi-sensory integration in the nervous system is necessary for organisms to discriminate different environmental stimuli and thus determine behavior. For instance, during simultaneous presentation of a radial temperature gradient and the chemoattractant sodium chloride C. elegans prefers the thermal cue in the early phase than the chemical cue, indicating the memory of the cultivation temperature is more effective than the attraction of the chemical cue (Adachi et al., 2008). This behavioral preference is the result of integration of thermosensory and chemosensory signals received by different sensory neurons. Thus, it is important to elucidate the complicated sensory integration. For this purpose, the combination of Tav assays described here and thermal barrier and thermogradient assays described elsewhere (Glauser et al., 2011) should be useful in understanding different aspects of heat avoidance responses. The genetic data in this work suggest that upon noxious heat, TAX-2 and TAX-4 were activated by cGMP generated in the AFD neurons probably through the activity of GCY-12. The role of GCY-12 upstream of TAX-2 / TAX-4 in AFD needs to be confirmed by cell specific rescue of the defective Tav response in the gcy-12 mutant in AFD and by analyzing the Tav behavior of the gcy-12;tax-2;tax-4 triple mutant. Although GCY-12 activity has been shown to be clearly dependent on temperature (Inada et al., 2006), it is non-relevant for the thermotaxis behavior (Inada et al., 2006). Thus, albeit the same sensory neurons (AFD) and the same CNG channel proteins (TAX-2, TAX-4) contribute to thermotaxis (Komatsu et al., 1996) and thermal avoidance, selective differences are employed in the sensation and response to physiological and
Discussion 67 non-physiological temperatures (Figure 6.2-1). Recently, it has been shown that the G-protein coupled receptor (GPCR) srtx-1 is required in thermotaxis (Biron et al., 2008), indicating that a similar G protein signaling pathway required in the odor detection in AWC (Bargmann, 2006) are involved in thermotaxis. However, srtx-1 mutant behaved like wild-type in the Tav assay (Table 3.5-3), indicating it is not involved in thermonociception. Whether the receptor like guanylate cyclases, such as gcy-12, are directly activated by noxious heat or indirectly by GPCR involved pathway? To answer these questions, a small scale screen should be done to search for the potential GPCR candidates and electrophysiological analysis with the potential receptor like guanylate cyclases should be performed to examine the properties of these channels in detail.
Noxious heat (>35 °C) a cGMP-gated channels Guanylate cyclases
TAX-4 TAX-2
AFD GTP GCY-12 cGMP Na+, Ca2+ depolarization
Physiological temperature (15-25 °C) b cGMP-gated channels Guanylate cyclases GPCRs
TAX-4 TAX-2
AFD GTP SRTX-1 GCY-8,18,23 cGMP Na+, Ca2+ depolarization
Figure 6.2-1 The potential signal transduction pathway in AFD in thermonociception and thermotaxis. (a) The likely model in thermonociception is that noxious heat over 35 °C activates gcy-12 either directly or indirectly and the generated cGMP activates the downstream CNG channels. (b) For the sensation of physiological temperatures, the GPCRs are probably first activated and this G-protein signaling pathway regulates the guanylate cyclases gcy-8, 18 and 23.
In conclusion, the data shown here strongly imply that the AFD neurons are thermoreceptors responding to distinct ranges of temperature. While small temperature changes that deviate from cultivation conditions transiently activate AFD and provoke a response involving the AIY interneurons to which they directly couple via synaptic connections (Kimura et al., 2004), the Tav response involves the AIB interneurons, suggesting a distinct neural circuit of thermal avoidance
Discussion 68 response. This is in agreement with our previous results, which suggests that different neural circuits are required for thermotaxis and thermonociception (Wittenburg and Baumeister, 1999). These conclusions were based on the observation of Tav responses of mutants affecting the connecting interneurons, AIY and AIZ, and of mutants affecting the thermotaxis behavior. Other than thermotaxis, the response to noxious heat requires a fast neurotransmission, in order to prevent tissue damage. This may be the reason why the AFD neurons couple to AIB via gap junctions. An obvious function of the gap junction is to mediate the electrotonic transmission in the tissues and thus propagate rapid impulses. Especially in cold-blooded animals, the electrical transmission is significantly faster than chemical transmission, and is found in the escape mechanisms of Aplysia (Bennett and Zukin, 2004). We therefore speculate that gap junctions might play a more prominent role in the thermoavoidance than in the thermotaxis response of C. elegans. It is interesting to further identify the interneurons downstream of the FLP thermonociceptors in the Tav response. FLP has gap junctions to two interneurons RIH and AVD and sends main synaptic outputs to AVA, AVD, AVB, AIB and ADE interneurons (White et al., 1986). Neuron-ablation of these interneurons and the subsequent Tav behavioral analysis may help to understand the role of gap junctions in thermal avoidance response.
6.3 Different neuronal and molecular mechanisms are involved in the head Tav response and tail Tav response
Compared with the head Tav response, by which the animals show accelerated forward movement, the tail Tav response is more complicated and needs to be dissected in detail. Animals in forward motion accelerate their speed to avoid a local heat source placed posteriorly, whereas resting animals typically move backwards (Wittenburg and Baumeister, 1999). The genetic and laser based neuron-ablation results shown here suggest that PHC, together with the two asymmetric interneurons DVA and PVC, executes the very complex response behavior. The posterior thermonociceptive neurons, PHC, is localized in the lumbar ganglia in the tail spike of the animals and extends a long, thin posterior process into the tail tip (Hall and Russell, 1991). Ablation of PHC almost eliminated the Tav response in the tail entirely, suggesting that PHC is the major posterior thermonociceptive neuron. The involvement of DVA and PVC is more complex. Both neurons have been implicated previously as interneurons in tail touch responses, PVC as a tail touch modulator, and DVA as a mediator of responses to harsh touch (Tap reflex)
Discussion 69
(Wicks and Rankin, 1995). Ablation of each neuron prevented any response in a considerable portion of animals, making a functional assessment difficult. However, since no animal in which DVA was ablated showed backward movement, and no animal in which PVC was eliminated displayed accelerated forward movement upon tail stimulation, these two neurons are proved to play opposite roles in mediating the responses to noxious heat stimulation at the tail. Similarly, ablation of PVC resulted in animals that had lost accelerated forward responses to harsh touch, but consistently responded to the tap stimulus with reversals (Wicks and Rankin, 1995). The wild-type tail Tav response with 68 % is not as strong as the head Tav response with 95 %. The less robustness observed in the tail Tav response correlates well with the findings in this work that the PHC neurons alone serve as the major posterior thermonociceptive neurons, whereas AFD and FLP function in the noxious heat sensation at the anterior part redundantly. Furthermore, the genetic data shown here strongly indicate that at least one of the identified two channel protein families, the TRPV channels, functions cell-autonomously in the thermonociceptive signal transduction in the posterior PHC neurons. In addition, the defective tail Tav response in the tax-2;tax-4 double mutants implicates the possible role of the CNG channels in noxious heat sensation in the tail of C. elegans. However, the mechanism is still unknown due to lack of information of the expression pattern of tax-2 and tax-4 in the posterior part. TAX-2 and TAX-4 activity in the tail may require OCR-2 and OSM-9 function, since the ocr-2 osm-9 double mutant showed a stronger defect in the tail Tav response than tax-2;tax-4, and the defective Tav response in ocr-2 osm-9 double mutant is not further enhanced in the tax-2;tax-4;ocr-2 osm-9 quadruple mutant (Table 4.5-1). A variety of lipid and lipid-derived molecules has been shown to modulate TRP channels (Chyb et al., 1999; Patwardhan et al., 2010). In C. elegans a subset of 20-carbon PUFAs has been identified to act upstream of TRPV channels in olfactory and nociceptive behaviors (Kahn-Kirby et al., 2004). In this work, the defective head and tail Tav response in the fat-3 mutant indicate the possible role of PUFAs in the thermonociceptive signal transduction and these defects were rescued with the supplementation of different sets of PUFAs. Based on the pattern of PUFA accumulation shown in Figure 6.3-1, these results suggest that the head and tail Tav response are sustained by overlapping but nonidentical sets of PUFAs. In the anterior part, AA, EPA and DGLA supplementation rescued the Tav response defect in fat-3 mutant and only fat-3 had a defective head Tav response, indicating the three PUFAs function redundantly in mediating the heat perception. On the other hand, in the posterior part, the AA supplementation had a
Discussion 70 significant rescue effect and all three fat mutants showed defective tail Tav responses. Comparing the pattern of PUFAs in these fat mutants and also the rescued fat-3 mutant, it is obvious that only AA fed animals had both AA and EPA. Thus, AA and EPA contribute together to mediate the tail Tav response. However, the FAT-3 protein is expressed in the intestine, body-wall muscles, pharynx and several neurons, the egg-laying and motility defect in the fat-3 mutant were rescued only by expressing fat-3 in the nervous system, indicating that fat-3 activity is required in neurons (Lesa et al., 2003). To determine the neurons in which PUFAs are required for thermonociception, rescue experiment by expressing the fat-3 cDNA under the control of different sets of neuronal promoters should be done. Furthermore, it has been shown that the PUFAs delpetion leads to decreased neurotransmitter release rather than neuronal developmental defect (Lesa et al., 2003; Watts et al., 2003). The subsequent analysis of noxious heat evoked calcium transients in the corresponding neurons in wild-type and fat-3 mutant background may help to further understand the mechanisms of the requirement of PUFAs in thermonociception.
Figure 6.3-1 Pattern of PUFA accumulation in fat mutants and in fat-3(wa22) supplemented with different PUFAs, as determined by GC analysis (adapted from Kahn-Kirby et al., 2004).
Altogether, the work presented here shows that different types of sensory neurons and different signal transduction mechanisms are involved in the tail Tav response than in the head Tav response.
Discussion 71
6.4 C. elegans model of noxious heat sensation
All organisms respond to a broad spectrum of physical, chemical or thermal noxious stimuli detected by nociceptors. The molecules involved in these escape responses remain largely unknown. The first success in the identification of the receptors came from the cloning of the TRPV1 receptor, which is activated by capsaicin, the ´´hot´´ chili peppers pungent. The TRPV1 can also be activated by noxious heat or protons when expressed heterologously in cultured cells (Caterina et al., 1999). Although the TRPV1-deficient mice exhibit no capsaicin- and proton-evoked pain response, these animals still show a remarkable behavioral response to noxious heat, suggesting the involvement of other heat-responsive proteins in these processes (Caterina et al., 2000). This, together with the data from other laboratories, delineates the involvement of TRPV1-independent mechanisms in the sensation of noxious heat (Basbaum et al., 2009; Caterina et al., 2000; Woodbury et al., 2004). Although the TRPV1-dependent mechanism has been studied in great detail, the TRPV1-independent mechanisms are still unknown (Basbaum et al., 2009; Caterina et al., 2000; Lawson et al., 2008; Woodbury et al., 2004). Similarly, we show that in C elegans two independent mechanisms are involved in the sensation of noxious heat (Figure 6.4-1). One of them uses the TRPV-channels OSM-9 / OCR-2 in the FLP and PHC thermonociceptors and the other the CNG-channel complex TAX-2 / TAX-4 in the AFD neurons. Therefore, the thermal avoidance response is mediated by a carefully backed-up system by using different cell types and at least two signaling mechanisms. This redundancy may be necessary for robust and reliable responses upon exposure to life-threatening stimuli like heat. It will be important to elucidate the crosstalk between sensory AFD, FLP and PHC sensory neurons and the channel proteins involved in thermonociception.
Discussion 72
a Noxious heat (>35 °C) b Noxious heat (>35 °C)
AFD FLP PHC
???
AIB PVC DVA
backward movement forward movement backward movement Head Tav response Tail Tav response Tail Tav response
Figure 6.4-1 The neural circuit involved in the noxious heat sensation. (a) In the anterior part of C. elegans, AFD and FLP sense the noxious heat and the neural information from AFD may further stimulate AIB. (b) The heat stimuli at the posterior part activate PHC and may further stimulate PVC or DVA for either forward or backward Tav response.
Appendix 73
7 Appendix
7.1 List of Tables
Table 3.1-1 The Tav response in hsf-1(sy441) and wild-type animals at different time points after heat shock...... 17 Table 3.2-1 Tav response of lite-1 mutant...... 17 Table 3.3-1 The head and tail Tav responses of mutant animals with developmental defects in the sensory neurons of C. elegans...... 19 Table 3.3-2 Head Tav responses of animals lacking AFD, FLP or other amphid sensory neurons ...... 22 Table 3.3-3 Head Tav responses of animals lacking the AIB or AIY interneurons...... 24 Table 3.3-4 The Tav responses of mutant animals with developmental defects in the PHC neurons ...... 26 Table 3.3-5 The Tav responses of animals lacking PHC or other candidate posterior thermonociceptors...... 27 Table 3.3-6 The tail Tav responses of DVA or PVC-ablated animals...... 28 Table 3.3-7 The Tav response in deg-1(u38) mutant ...... 28 Table 3.3-8 YFP / CFP ratio change (calcium influx) after noxious heat stimuli in different sensory neurons ...... 32 Table 3.4-1 Tav response of the mutants of TRPV family genes ...... 36 Table 3.4-2 Mutations in different G-proteins showed no significant reduced Tav responses ...... 39 Table 3.4-3 PUFAs depletion led to Tav response defect ...... 40 Table 3.5-1 Mutations in tax-2 and tax-4 led to reduced Tav responses ...... 42 Table 3.5-2 Contribution of tax-2 and tax-4 to AFD mediated head Tav response ...... 44 Table 3.5-3 Mutations in four guanyly cyclases led to reduced head Tav responses...... 46 Table 4.1-1 Instruments ...... 47 Table 4.2-1 Chemicals ...... 47 Table 4.2-2 Enzymes ...... 47 Table 4.3-1 Buffers and media...... 48 Table 4.4-1 Bacteria strains used in this study ...... 48 Table 4.4-2 C. elegans mutant strains used in this study ...... 49 Table 4.4-3 C. elegans Strains used for neuron labeling...... 50 Table 4.4-4 C. elegans transgenic strains obtained by microinjection or crossing ...... 51 Table 4.5-1 Plasmids from other labs ...... 52 Table 4.5-2 Plasmids constructed in this study...... 53 Table 4.6-1 Oligonucleotides used for cloning ...... 53 Table 4.6-2 Oligonucleotides used for detection of mutations in C. elegans...... 54
Appendix 74
7.2 List of Figures
Figure 2.1-1 Different nociceptors detect different types of pain. (adapted from Julius and Basbaum, 2001). The peripheral nervous system is composed of medium- to large-diameter (Aα and Aβ) and small-diameter (Aδ) myelinated afferent fibers, as well as small-diameter unmyelinated C-fibers.------4 Figure 2.1-2 Proposed transduction mechanisms in mammalian nociceptor peripheral terminals (adapted from Dubin and Patapoutian, 2001). ------6 Figure 3.1-1 The head Tav response in hsf-1(sy441) and wild-type animals at different time points after heat shock. ------16 Figure 3.3-1 Head Tav responses of mutants with developmental defects in the AFD and FLP neurons. ------19 Figure 3.3-2 Expression of DT-A under the control of AFD specific gcy-8 promoter successfully ablated the AFD neurons. ------21 Figure 3.3-3 Head Tav responses of the neuron-ablated animals. ------22 Figure 3.3-4 Laser-ablation of AFD and AIB led to severe defect in the head Tav response. ------24 Figure 3.3-5 Contribution of the PHC sensory neurons to the tail Tav response of C. elegans. ------26 Figure 3.3-6 Comparison of the temperature ramp rate in the Tav assay and the one simulated by the electrical- resistor system in the ------29 Figure 3.3-7 Calcium responses in AFD, FLP and PHC upon noxious heat stimuli.------31 Figure 3.3-8 Calcium responses of the AFD, FLP and PHC neurons to noxious heat stimuli.------32 Figure 3.4-1 Mutations in ocr-2 and osm-9 genes led to defective head Tav response. ------34 Figure 3.4-2 Contribution of OCR-2 and OSM-9 in FLP in mediating the head Tav response.------35 Figure 3.4-3 Contribution of OCR-2 and OSM-9 in PHC in the tail Tav response. ------37 Figure 3.4-4 Specific PUFAs depletion led to defective head Tav response. ------39 Figure 3.4-5 Specific PUFAs depletion led to defective tail Tav response. ------39 Figure 3.5-1 Mutations in tax-2 and tax-4 led to reduced head Tav responses.------41 Figure 3.5-2 Contribution of tax-2 and tax-4 to AFD mediated head Tav response. ------43 Figure 3.5-3 Mutations in four guanyly cyclases led to reduced head Tav responses. ------45 Figure 5.1-1 The set-up for the electrical-resistor system in the Ca2+ imaging experiments. ------60 Figure 6.2-1 The potential signal transduction pathway in AFD in thermonociception and thermotaxis.------67 Figure 6.3-1 Pattern of PUFA accumulation in fat mutants and in fat-3(wa22) supplemented with different PUFAs, as determined by GC analysis (adapted from Kahn-Kirby et al., 2004). ------70 Figure 6.4-1 The neural circuit involved in the noxious heat sensation ------72
Appendix 75
7.3 Abbreviations
AA arachidonic acid ANOVA analysis of variance AMPA α-amino-3-hydroxy 5-methyl-4-isoxazeloproprionic acid ASICs acid-sensing sodium ion channels ATP adenosine-5´-triphosphate °C degree Celcius CAPS calcium-dependent activator protein for secretion cAMP cyclic adenosine monophosphate C. elegans Caenorhabditis elegans cDNA complementary deoxyribonucleic acid CGC C. elegans Genetics Center Che chemotaxis defective cGMP cyclic guanosine monophosphate CGRP calcitonin gene related peptide CNG cyclic nucleotid-gated channel Daf dauer larva formation defective DEG / ENaC Degenerin / Epithelial Na+ channel DGLA dihomo-γ-linolenic acid DNA deoxyribonucleic acid DRG dorsal root ganglia DT-A diphtheria toxin A Dyf dye filling defective EPA eicosapentaenoic acid μg microgram μl microlitre μM micromolar IFT intraflagellar transport IR infrared light EPA eicosapentaenoic acid FRET fluorescence resonance energy transfer
Appendix 76
GDNF glial cell-derived growth factors GFP green fluorescence protein GPCR G-protein coupled receptor HSPs heat shock proteins HMM Hidden Markov Model IB4 α-D-galactosyl-binding lectin IR infrared light L(1-4) C. elegans larval stages (1-4) ml millilitre mM millimolar Mec mechanosensation defective mGluR G-protein coupled metabotropic mRNA messenger ribonucleic acid NGM nematode growth media NMDA N-methyl-D-aspartate OCR OSM-9 and capsaicin receptor-related Osm osmosensation defective PCR polymerase chain reaction PKCε protein kinase Cε PUFA polyunsaturated fatty acids
P2X3 purine ionotropic receptor subtype 3 RGC receptor-like guanylate cyclase RNA ribonucleic acid RNAi RNA interference ROI region of interest RTX resiniferatoxin sGC cytosolic soluble guanylate cyclase Tav thermal avoidance TRP transient receptor potential TRPC Canonical TRP TRPM Melastatin TRP TRPV Vanilloid TRP
Appendix 77
TRPA Ankyrin TRP TRPP Polycystin TRP TRPML Mucolipin TRP TRPN no mechanoreceptor potential C Ttx thermotaxis defective
References 78
8 References
Aballay, A. (2009). Neural regulation of immunity: role of NPR-1 in pathogen avoidance and regulation of innate immunity. Cell Cycle 8, 966-969.
Achaval, M., Penha, M.A., Swarowsky, A., Rigon, P., Xavier, L.L., Viola, G.G., and Zancan, D.M. (2005). The terrestrial Gastropoda Megalobulimus abbreviatus as a useful model for nociceptive experiments: effects of morphine and naloxone on thermal avoidance behavior. Braz J Med Biol Res 38, 73-80.
Adachi, R., Osada, H., and Shingai, R. (2008). Phase-dependent preference of thermosensation and chemosensation during simultaneous presentation assay in Caenorhabditis elegans. BMC Neurosci 9, 106.
Albeg, A., Smith, C.J., Chatzigeorgiou, M., Feitelson, D.G., Hall, D.H., Schafer, W.R., Miller, D.M., 3rd, and Treinin, M. (2011). C. elegans multi-dendritic sensory neurons: morphology and function. Mol Cell Neurosci 46, 308-317.
Bacaj, T., Tevlin, M., Lu, Y., and Shaham, S. (2008). Glia are essential for sensory organ function in C. elegans. Science 322, 744-747.
Bargmann, C.I. (2006). Chemosensation in C. elegans. WormBook, 1-29.
Bargmann, C.I., and Avery, L. (1995). Laser killing of cells in Caenorhabditis elegans. Methods Cell Biol 48, 225-250.
Bargmann, C.I., and Mori, I. (1997). Chemotaxis and Thermotaxis.
Basbaum, A.I., Bautista, D.M., Scherrer, G., and Julius, D. (2009). Cellular and molecular mechanisms of pain. Cell 139, 267-284.
Basson, M., and Horvitz, H.R. (1996). The Caenorhabditis elegans gene sem-4 controls neuronal and mesodermal cell development and encodes a zinc finger protein. Genes Dev 10, 1953-1965.
References 79
Baumeister, R., Liu, Y., and Ruvkun, G. (1996). Lineage-specific regulators couple cell lineage asymmetry to the transcription of the Caenorhabditis elegans POU gene unc-86 during neurogenesis. Genes Dev 10, 1395-1410.
Bennett, M.V., and Zukin, R.S. (2004). Electrical coupling and neuronal synchronization in the Mammalian brain. Neuron 41, 495-511.
Biron, D., Wasserman, S., Thomas, J.H., Samuel, A.D., and Sengupta, P. (2008). An olfactory neuron responds stochastically to temperature and modulates Caenorhabditis elegans thermotactic behavior. Proc Natl Acad Sci U S A 105, 11002-11007.
Bolcskei, K., Helyes, Z., Szabo, A., Sandor, K., Elekes, K., Nemeth, J., Almasi, R., Pinter, E., Petho, G., and Szolcsanyi, J. (2005). Investigation of the role of TRPV1 receptors in acute and chronic nociceptive processes using gene-deficient mice. Pain 117, 368-376.
Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71-94.
Bretscher, A.J., Kodama-Namba, E., Busch, K.E., Murphy, R.J., Soltesz, Z., Laurent, P., and de Bono, M. (2011). Temperature, Oxygen, and Salt-Sensing Neurons in C. elegans Are Carbon Dioxide Sensors that Control Avoidance Behavior. Neuron 69, 1099-1113.
Caterina, M.J., and Julius, D. (2001). The vanilloid receptor: a molecular gateway to the pain pathway. Annu Rev Neurosci 24, 487-517.
Caterina, M.J., Leffler, A., Malmberg, A.B., Martin, W.J., Trafton, J., Petersen-Zeitz, K.R., Koltzenburg, M., Basbaum, A.I., and Julius, D. (2000). Impaired nociception and pain sensation in mice lacking the capsaicin receptor. Science 288, 306-313.
Caterina, M.J., Rosen, T.A., Tominaga, M., Brake, A.J., and Julius, D. (1999). A capsaicin- receptor homologue with a high threshold for noxious heat. Nature 398, 436-441.
References 80
Caterina, M.J., Schumacher, M.A., Tominaga, M., Rosen, T.A., Levine, J.D., and Julius, D. (1997). The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature 389, 816-824.
Chalfie, M., and Wolinsky, E. (1990). The identification and suppression of inherited neurodegeneration in Caenorhabditis elegans. Nature 345, 410-416.
Chang, A.J., Chronis, N., Karow, D.S., Marletta, M.A., and Bargmann, C.I. (2006). A distributed chemosensory circuit for oxygen preference in C. elegans. PLoS Biol 4, e274.
Chatzigeorgiou, M., and Schafer, W.R. (2011). Lateral Facilitation between Primary Mechanosensory Neurons Controls Nose Touch Perception in C. elegans. Neuron 70, 299-309.
Chatzigeorgiou, M., Yoo, S., Watson, J.D., Lee, W.H., Spencer, W.C., Kindt, K.S., Hwang, S.W., Miller, D.M., 3rd, Treinin, M., Driscoll, M., et al. (2010). Specific roles for DEG/ENaC and TRP channels in touch and thermosensation in C. elegans nociceptors. Nat Neurosci 13, 861-868.
Cho, S.W., Cho, J.H., Song, H.O., and Park, C.S. (2005). Identification and characterization of a putative cyclic nucleotide-gated channel, CNG-1, in C. elegans. Mol Cells 19, 149-154.
Cho, S.W., Choi, K.Y., and Park, C.S. (2004). A new putative cyclic nucleotide-gated channel gene, cng-3, is critical for thermotolerance in Caenorhabditis elegans. Biochem Biophys Res Commun 325, 525-531.
Chyb, S., Raghu, P., and Hardie, R.C. (1999). Polyunsaturated fatty acids activate the Drosophila light-sensitive channels TRP and TRPL. Nature 397, 255-259.
Clapham, D.E. (2007). SnapShot: mammalian TRP channels. Cell 129, 220.
Clapham, D.E., Runnels, L.W., and Strubing, C. (2001). The TRP ion channel family. Nat Rev Neurosci 2, 387-396.
References 81
Clark, D.A., Biron, D., Sengupta, P., and Samuel, A.D. (2006). The AFD sensory neurons encode multiple functions underlying thermotactic behavior in Caenorhabditis elegans. J Neurosci 26, 7444-7451.
Coburn, C.M., and Bargmann, C.I. (1996). A putative cyclic nucleotide-gated channel is required for sensory development and function in C. elegans. Neuron 17, 695-706.
Coburn, C.M., Mori, I., Ohshima, Y., and Bargmann, C.I. (1998). A cyclic nucleotide-gated channel inhibits sensory axon outgrowth in larval and adult Caenorhabditis elegans: a distinct pathway for maintenance of sensory axon structure. Development 125, 249-258.
Colbert, H.A., Smith, T.L., and Bargmann, C.I. (1997). OSM-9, a novel protein with structural similarity to channels, is required for olfaction, mechanosensation, and olfactory adaptation in Caenorhabditis elegans. J Neurosci 17, 8259-8269.
Collet, J., Spike, C.A., Lundquist, E.A., Shaw, J.E., and Herman, R.K. (1998). Analysis of osm-6, a gene that affects sensory cilium structure and sensory neuron function in Caenorhabditis elegans. Genetics 148, 187-200.
D'Mello, R., and Dickenson, A.H. (2008). Spinal cord mechanisms of pain. Br J Anaesth 101, 8- 16.
Darian-Smith, I., Johnson, K.O., LaMotte, C., Shigenaga, Y., Kenins, P., and Champness, P. (1979). Warm fibers innervating palmar and digital skin of the monkey: responses to thermal stimuli. J Neurophysiol 42, 1297-1315.
Davies, A.G., Bettinger, J.C., Thiele, T.R., Judy, M.E., and McIntire, S.L. (2004). Natural variation in the npr-1 gene modifies ethanol responses of wild strains of C. elegans. Neuron 42, 731-743. de Bono, M. (2003). Molecular approaches to aggregation behavior and social attachment. J Neurobiol 54, 78-92.
References 82
Dubin, A.E., and Patapoutian, A. (2010). Nociceptors: the sensors of the pain pathway. J Clin Invest 120, 3760-3772.
Dwyer, N.D., Troemel, E.R., Sengupta, P., and Bargmann, C.I. (1998). Odorant receptor localization to olfactory cilia is mediated by ODR-4, a novel membrane-associated protein. Cell 93, 455-466.
Edwards, S.L., Charlie, N.K., Milfort, M.C., Brown, B.S., Gravlin, C.N., Knecht, J.E., and Miller, K.G. (2008). A novel molecular solution for ultraviolet light detection in Caenorhabditis elegans. PLoS Biol 6, e198.
Fang, X., Djouhri, L., McMullan, S., Berry, C., Waxman, S.G., Okuse, K., and Lawson, S.N. (2006). Intense isolectin-B4 binding in rat dorsal root ganglion neurons distinguishes C-fiber nociceptors with broad action potentials and high Nav1.9 expression. J Neurosci 26, 7281-7292.
Fire, A. (1986). Integrative transformation of Caenorhabditis elegans. EMBO J 5, 2673-2680.
Glauser, D.A., Chen, W.C., Agin, R., Macinnis, B.L., Hellman, A.B., Garrity, P.A., Tan, M.W., and Goodman, M.B. (2011). Heat Avoidance is Regulated by Transient Receptor Potential (TRP) Channels and a Neuropeptide Signaling Pathway in Caenorhabditis elegans. Genetics.
Goodman, M.B. (2006). Mechanosensation. WormBook, 1-14.
Gray, J.M., Karow, D.S., Lu, H., Chang, A.J., Chang, J.S., Ellis, R.E., Marletta, M.A., and Bargmann, C.I. (2004). Oxygen sensation and social feeding mediated by a C. elegans guanylate cyclase homologue. Nature 430, 317-322.
Hall, D.H., and Russell, R.L. (1991). The posterior nervous system of the nematode Caenorhabditis elegans: serial reconstruction of identified neurons and complete pattern of synaptic interactions. J Neurosci 11, 1-22.
Hallem, E.A., and Sternberg, P.W. (2008). Acute carbon dioxide avoidance in Caenorhabditis elegans. Proc Natl Acad Sci U S A 105, 8038-8043.
References 83
Hanahan (1985). Techniques for transformation in Escherichia coli, in DNA Cloning, a practical approach. Oxford Vol. 1 (Glover D. M., ed.), pp 109-135.
Haycraft, C.J., Schafer, J.C., Zhang, Q., Taulman, P.D., and Yoder, B.K. (2003). Identification of CHE-13, a novel intraflagellar transport protein required for cilia formation. Exp Cell Res 284, 251-263.
Haycraft, C.J., Swoboda, P., Taulman, P.D., Thomas, J.H., and Yoder, B.K. (2001). The C. elegans homolog of the murine cystic kidney disease gene Tg737 functions in a ciliogenic pathway and is disrupted in osm-5 mutant worms. Development 128, 1493-1505.
Hilliard, M.A., Bargmann, C.I., and Bazzicalupo, P. (2002). C. elegans responds to chemical repellents by integrating sensory inputs from the head and the tail. Curr Biol 12, 730-734.
Hobert, O., Mori, I., Yamashita, Y., Honda, H., Ohshima, Y., Liu, Y., and Ruvkun, G. (1997). Regulation of interneuron function in the C. elegans thermoregulatory pathway by the ttx-3 LIM homeobox gene. Neuron 19, 345-357.
Hwang, R.Y., Zhong, L., Xu, Y., Johnson, T., Zhang, F., Deisseroth, K., and Tracey, W.D. (2007). Nociceptive neurons protect Drosophila larvae from parasitoid wasps. Curr Biol 17, 2105-2116.
Inada, H., Ito, H., Satterlee, J., Sengupta, P., Matsumoto, K., and Mori, I. (2006). Identification of guanylyl cyclases that function in thermosensory neurons of Caenorhabditis elegans. Genetics 172, 2239-2252.
Jansen, G., Thijssen, K.L., Werner, P., van der Horst, M., Hazendonk, E., and Plasterk, R.H. (1999). The complete family of genes encoding G proteins of Caenorhabditis elegans. Nat Genet 21, 414-419.
Jose, A.M., Bany, I.A., Chase, D.L., and Koelle, M.R. (2007). A specific subset of transient receptor potential vanilloid-type channel subunits in Caenorhabditis elegans endocrine cells function as mixed heteromers to promote neurotransmitter release. Genetics 175, 93-105.
References 84
Julius, D., and Basbaum, A.I. (2001). Molecular mechanisms of nociception. Nature 413, 203- 210.
Jurado, P., Kodama, E., Tanizawa, Y., and Mori, I. (2010). Distinct thermal migration behaviors in response to different thermal gradients in Caenorhabditis elegans. Genes Brain Behav 9, 120- 127.
Kahn-Kirby, A.H., and Bargmann, C.I. (2006). TRP channels in C. elegans. Annu Rev Physiol 68, 719-736.
Kahn-Kirby, A.H., Dantzker, J.L., Apicella, A.J., Schafer, W.R., Browse, J., Bargmann, C.I., and Watts, J.L. (2004). Specific polyunsaturated fatty acids drive TRPV-dependent sensory signaling in vivo. Cell 119, 889-900.
Kaplan, J.M., and Horvitz, H.R. (1993). A dual mechanosensory and chemosensory neuron in Caenorhabditis elegans. Proc Natl Acad Sci U S A 90, 2227-2231.
Kimura, K.D., Miyawaki, A., Matsumoto, K., and Mori, I. (2004). The C. elegans thermosensory neuron AFD responds to warming. Curr Biol 14, 1291-1295.
Komatsu, H., Jin, Y.H., L'Etoile, N., Mori, I., Bargmann, C.I., Akaike, N., and Ohshima, Y. (1999). Functional reconstitution of a heteromeric cyclic nucleotide-gated channel of Caenorhabditis elegans in cultured cells. Brain Res 821, 160-168.
Komatsu, H., Mori, I., Rhee, J.S., Akaike, N., and Ohshima, Y. (1996). Mutations in a cyclic nucleotide-gated channel lead to abnormal thermosensation and chemosensation in C. elegans. Neuron 17, 707-718.
Kuhara, A., Okumura, M., Kimata, T., Tanizawa, Y., Takano, R., Kimura, K.D., Inada, H., Matsumoto, K., and Mori, I. (2008). Temperature sensing by an olfactory neuron in a circuit controlling behavior of C. elegans. Science 320, 803-807.
References 85
Lawson, J.J., McIlwrath, S.L., Woodbury, C.J., Davis, B.M., and Koerber, H.R. (2008). TRPV1 unlike TRPV2 is restricted to a subset of mechanically insensitive cutaneous nociceptors responding to heat. J Pain 9, 298-308.
Le Bars, D., Gozariu, M., and Cadden, S.W. (2001). Animal models of nociception. Pharmacol Rev 53, 597-652.
Lesa, G.M., Palfreyman, M., Hall, D.H., Clandinin, M.T., Rudolph, C., Jorgensen, E.M., and Schiavo, G. (2003). Long chain polyunsaturated fatty acids are required for efficient neurotransmission in C. elegans. J Cell Sci 116, 4965-4975.
Lewis, J.A., and Fleming, J.T. (1995). Basic culture methods. Methods Cell Biol 48, 3-29.
Liu, H., Mantyh, P.W., and Basbaum, A.I. (1997). NMDA-receptor regulation of substance P release from primary afferent nociceptors. Nature 386, 721-724.
Liu, J., Ward, A., Gao, J., Dong, Y., Nishio, N., Inada, H., Kang, L., Yu, Y., Ma, D., Xu, T., et al. (2010). C. elegans phototransduction requires a G protein-dependent cGMP pathway and a taste receptor homolog. Nat Neurosci 13, 715-722.
Lu, G., Henderson, D., Liu, L., Reinhart, P.H., and Simon, S.A. (2005). TRPV1b, a functional human vanilloid receptor splice variant. Mol Pharmacol 67, 1119-1127.
Macosko, E.Z., Pokala, N., Feinberg, E.H., Chalasani, S.H., Butcher, R.A., Clardy, J., and Bargmann, C.I. (2009). A hub-and-spoke circuit drives pheromone attraction and social behaviour in C. elegans. Nature 458, 1171-1175.
Madison, J.M., Nurrish, S., and Kaplan, J.M. (2005). UNC-13 interaction with syntaxin is required for synaptic transmission. Curr Biol 15, 2236-2242.
Maniatis T., F.E.F.a.S.J. (1982). Molecular Cloning: A Laboratory Manual. Cod Spring Harbor, New York.
References 86
Mello, C.C., Kramer, J.M., Stinchcomb, D., and Ambros, V. (1991). Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J 10, 3959-3970.
Mohri, A., Kodama, E., Kimura, K.D., Koike, M., Mizuno, T., and Mori, I. (2005). Genetic control of temperature preference in the nematode Caenorhabditis elegans. Genetics 169, 1437- 1450.
Mori, I., and Ohshima, Y. (1995). Neural regulation of thermotaxis in Caenorhabditis elegans. Nature 376, 344-348.
Morimoto, R.I. (1998). Regulation of the heat shock transcriptional response: cross talk between a family of heat shock factors, molecular chaperones, and negative regulators. Genes Dev 12, 3788-3796.
Neely, G.G., Hess, A., Costigan, M., Keene, A.C., Goulas, S., Langeslag, M., Griffin, R.S., Belfer, I., Dai, F., Smith, S.B., et al. (2010). A genome-wide Drosophila screen for heat nociception identifies alpha2delta3 as an evolutionarily conserved pain gene. Cell 143, 628-638.
Nieto-Fernandez, F., Andrieux, S., Idrees, S., Bagnall, C., Pryor, S.C., and Sood, R. (2009). The effect of opioids and their antagonists on the nocifensive response of Caenorhabditis elegans to noxious thermal stimuli. Invert Neurosci 9, 195-200.
O'Hagan, R., and Chalfie, M. (2006). Mechanosensation in Caenorhabditis elegans. Int Rev Neurobiol 69, 169-203.
Palmer, A.E., and Tsien, R.Y. (2006). Measuring calcium signaling using genetically targetable fluorescent indicators. Nat Protoc 1, 1057-1065.
Patwardhan, A.M., Akopian, A.N., Ruparel, N.B., Diogenes, A., Weintraub, S.T., Uhlson, C., Murphy, R.C., and Hargreaves, K.M. (2010). Heat generates oxidized linoleic acid metabolites that activate TRPV1 and produce pain in rodents. J Clin Invest 120, 1617-1626.
References 87
Perkins, L.A., Hedgecock, E.M., Thomson, J.N., and Culotti, J.G. (1986). Mutant sensory cilia in the nematode Caenorhabditis elegans. Dev Biol 117, 456-487.
Pryor, S.C., Nieto, F., Henry, S., and Sarfo, J. (2007). The effect of opiates and opiate antagonists on heat latency response in the parasitic nematode Ascaris suum. Life Sci 80, 1650-1655.
Roayaie, K., Crump, J.G., Sagasti, A., and Bargmann, C.I. (1998). The G alpha protein ODR-3 mediates olfactory and nociceptive function and controls cilium morphogenesis in C. elegans olfactory neurons. Neuron 20, 55-67.
Satterlee, J.S., Sasakura, H., Kuhara, A., Berkeley, M., Mori, I., and Sengupta, P. (2001). Specification of thermosensory neuron fate in C. elegans requires ttx-1, a homolog of otd/Otx. Neuron 31, 943-956.
Schmidtko, A., Tegeder, I., and Geisslinger, G. (2009). No NO, no pain? The role of nitric oxide and cGMP in spinal pain processing. Trends Neurosci 32, 339-346.
Shakir, M.A., Fukushige, T., Yasuda, H., Miwa, J., and Siddiqui, S.S. (1993). C. elegans osm-3 gene mediating osmotic avoidance behaviour encodes a kinesin-like protein. Neuroreport 4, 891- 894.
Signor, D., Wedaman, K.P., Orozco, J.T., Dwyer, N.D., Bargmann, C.I., Rose, L.S., and Scholey, J.M. (1999a). Role of a class DHC1b dynein in retrograde transport of IFT motors and IFT raft particles along cilia, but not dendrites, in chemosensory neurons of living Caenorhabditis elegans. J Cell Biol 147, 519-530.
Signor, D., Wedaman, K.P., Rose, L.S., and Scholey, J.M. (1999b). Two heteromeric kinesin complexes in chemosensory neurons and sensory cilia of Caenorhabditis elegans. Mol Biol Cell 10, 345-360.
Speese, S., Petrie, M., Schuske, K., Ailion, M., Ann, K., Iwasaki, K., Jorgensen, E.M., and Martin, T.F. (2007). UNC-31 (CAPS) is required for dense-core vesicle but not synaptic vesicle exocytosis in Caenorhabditis elegans. J Neurosci 27, 6150-6162.
References 88
Starich, T.A., Herman, R.K., Kari, C.K., Yeh, W.H., Schackwitz, W.S., Schuyler, M.W., Collet, J., Thomas, J.H., and Riddle, D.L. (1995). Mutations affecting the chemosensory neurons of Caenorhabditis elegans. Genetics 139, 171-188.
Sulston, J.E., and Horvitz, H.R. (1977). Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev Biol 56, 110-156.
Swoboda, P., Adler, H.T., and Thomas, J.H. (2000). The RFX-type transcription factor DAF-19 regulates sensory neuron cilium formation in C. elegans. Mol Cell 5, 411-421.
Takiff, H.E., Chen, S.M., and Court, D.L. (1989). Genetic analysis of the rnc operon of Escherichia coli. J Bacteriol 171, 2581-2590.
Terman GW, B.J., ed. (2003). Spinal mechanisms and their modulation.
Tobin, D., Madsen, D., Kahn-Kirby, A., Peckol, E., Moulder, G., Barstead, R., Maricq, A., and Bargmann, C. (2002). Combinatorial expression of TRPV channel proteins defines their sensory functions and subcellular localization in C. elegans neurons. Neuron 35, 307-318.
Tominaga, M., Caterina, M.J., Malmberg, A.B., Rosen, T.A., Gilbert, H., Skinner, K., Raumann, B.E., Basbaum, A.I., and Julius, D. (1998). The cloned capsaicin receptor integrates multiple pain-producing stimuli. Neuron 21, 531-543.
Tracey, W.D., Jr., Wilson, R.I., Laurent, G., and Benzer, S. (2003). painless, a Drosophila gene essential for nociception. Cell 113, 261-273.
Ward, A., Liu, J., Feng, Z., and Xu, X.Z. (2008). Light-sensitive neurons and channels mediate phototaxis in C. elegans. Nat Neurosci 11, 916-922.
Watts, J.L., Phillips, E., Griffing, K.R., and Browse, J. (2003). Deficiencies in C20 polyunsaturated fatty acids cause behavioral and developmental defects in Caenorhabditis elegans fat-3 mutants. Genetics 163, 581-589.
References 89
Way, J.C., and Chalfie, M. (1989). The mec-3 gene of Caenorhabditis elegans requires its own product for maintained expression and is expressed in three neuronal cell types. Genes Dev 3, 1823-1833.
Wei, J.Y., Roy, D.S., Leconte, L., and Barnstable, C.J. (1998). Molecular and pharmacological analysis of cyclic nucleotide-gated channel function in the central nervous system. Prog Neurobiol 56, 37-64.
White, J.G., Southgate, E., Thomson, J.N., and Brenner, S. (1986). The Structure of the Nervous System of the Nematode Caenorhabditis elegans. Philosophical Transactions of the Royal Society of London Series B, Biological Sciences 314, 1-340.
Wicks, S.R., and Rankin, C.H. (1995). Integration of mechanosensory stimuli in Caenorhabditis elegans. J Neurosci 15, 2434-2444.
Wittenburg, N., and Baumeister, R. (1999). Thermal avoidance in Caenorhabditis elegans: an approach to the study of nociception. Proc Natl Acad Sci U S A 96, 10477-10482.
Woodbury, C.J., Zwick, M., Wang, S., Lawson, J.J., Caterina, M.J., Koltzenburg, M., Albers, K.M., Koerber, H.R., and Davis, B.M. (2004). Nociceptors lacking TRPV1 and TRPV2 have normal heat responses. J Neurosci 24, 6410-6415.
Woolf, C.J., and Ma, Q. (2007). Nociceptors--noxious stimulus detectors. Neuron 55, 353-364.
Wu, J., Duggan, A., and Chalfie, M. (2001). Inhibition of touch cell fate by egl-44 and egl-46 in C. elegans. Genes Dev 15, 789-802.
Xue, D., Finney, M., Ruvkun, G., and Chalfie, M. (1992). Regulation of the mec-3 gene by the C.elegans homeoproteins UNC-86 and MEC-3. EMBO J 11, 4969-4979.
Yamada, Y., and Ohshima, Y. (2003). Distribution and movement of Caenorhabditis elegans on a thermal gradient. J Exp Biol 206, 2581-2593.
References 90
Yeomans, D.C., Pirec, V., and Proudfit, H.K. (1996). Nociceptive responses to high and low rates of noxious cutaneous heating are mediated by different nociceptors in the rat: behavioral evidence. Pain 68, 133-140.
Yu, S., Avery, L., Baude, E., and Garbers, D.L. (1997). Guanylyl cyclase expression in specific sensory neurons: a new family of chemosensory receptors. Proc Natl Acad Sci U S A 94, 3384- 3387.
Zabala, N.A., and Gomez, M.A. (1991). Morphine analgesia, tolerance and addiction in the cricket Pteronemobius sp. (Orthoptera, Insecta). Pharmacol Biochem Behav 40, 887-891.
Zeigler, M.B., and Chiu, D.T. (2009). Laser selection significantly affects cell viability following single-cell nanosurgery. Photochem Photobiol 85, 1218-1224.
Zhang, S., Sokolchik, I., Blanco, G., and Sze, J.Y. (2004). Caenorhabditis elegans TRPV ion channel regulates 5HT biosynthesis in chemosensory neurons. Development 131, 1629-1638.
Acknowledgements 91
9 Acknowledgements
There are so many people who have given me a great help in completing this work.
Most importantly, I want to thank Professor Dr. Ralf Baumeister for giving me the chance to enter this interesting C. elegans world. His passion for science has always been a constant source of inspiration to me. His preciseness for science is and will ever be an exemplary model for me.
I also want to give my thanks to all the members of our group. It has been a pleasure to be working with them. I appreciate the support in helping me to go through with this work. I especially thank Dr. Ekkerhard Schulze for the excellent Calcium imaging experiments in this work and Dr. Andreas Eizinger for his advice and corrections on this work.
Thanks to Ursula, Julia, Wenjing, Davide and Xu for corrections on this work.
Finally, I want to thank my family, without whom I can not go this far.
Acknowledgements 92
10 Curriculum Vitae
Die Seiten 92-93 Lebenslauf) enthalten persönliche Daten. Sie sind deshalb nicht Bestandteil der Online-Veröffentlichung.