Regulation of Rat Pancreatic CCKB Receptor and Somatostatin Expression by Insulin Sophie Julien, Jean Laine, and Jean Morisset

was targeted to the pancreas and stomach but not to the The cholecystokinin B receptor (CCKBR) is localized on pancreatic endocrine somatostatin ␦-cells. Pancreatic other somatostatin-producing tissues (15). somatostatin content was increased in diabetic rats. The role played by insulin in somatostatin release The mechanisms involved in this phenomenon are un- remains controversial. Indeed, insulin can stimulate soma- known, and we believe insulin is involved. In this study, tostatin release from perfused chicken pancreas-duode- four groups of rats were used: controls, streptozotocin- num (16); however, data from monolayer cultures of induced diabetic, streptozotocin-induced diabetic with neonatal rat pancreas (17) and isolated dog pancreas (18) insulin, and streptozotocin-induced diabetic with insu- clearly show that insulin fails to induce somatostatin lin and its cessation. Rats were killed after 7–28 days of release. In anesthetized normal and diabetic dogs, insulin treatment for diabetes, and somatostatin mRNA expres- infusion or injection was associated with an immediate sion and pancreatic somatostatin content, CCKBR mRNA and protein expression evaluation in total pan- reduction of the venous pancreaticoduodenal release of creas and purified islets, and the cellular localization of somatostatin (19). All of these differences could be ex- somatostatin and CCKBR in islets was measured. Data plained by the different models used to study somatostatin indicate that diabetes is established after 7 days, is release. controlled by insulin, and reappears after treatment Cholecystokinin (CCK), a duodenal hormone released cessation. Pancreatic somatostatin mRNA expression into the bloodstream after meal ingestion, is recognized as and somatostatin content were increased during diabe- the major hormonal factor involved in the regulation of tes, normalized during insulin treatment, and reaug- pancreatic exocrine secretion, gallbladder contraction, mented after treatment cessation. Gland and islet gastric emptying, and small bowel motility. CCK is also CCK R mRNA and protein almost disappeared during B involved in the regulation of the endocrine pancreas; diabetes; CCKB mRNA reappeared in response to insu- lin, but the protein did not. Confocal microscopy con- indeed, it can stimulate insulin secretion from an in vitro rat perfused pancreas (20) and in vivo in the rat (21), pig firmed data obtained on somatostatin and CCKBRas established biochemically in the course of the treat- (22), mouse (23), and human (24). In humans, the insuli- ments. In conclusion, these data strongly suggest that notropic effect of CCK was attenuated by the specific insulin can negatively control pancreatic somatostatin CCK-A receptor antagonist L-364718 (25). Finally, it was mRNA and hormone content and positively control recently observed (26,27) that a defect in the CCK-A CCKBR mRNA; the CCKBR protein appears to be de- receptor gene OLETF (Otsuka Long-Evans Tokushima layed. Diabetes 53:1526–1534, 2004 Fatty) rats led to obesity and diabetes. With regard to pancreatic somatostatin ␦-cells, we re- cently demonstrated (28,29) that these cells specifically bear the CCKB receptor (CCKBR) as established by RT- uring the 1970s, major changes were observed PCR, Western blotting, and confocal microscopy in rat, in the metabolism of pancreatic somatostatin mouse, dog, pig, horse, calf, and human. This new discov- during diabetes development in human and ery may indicate that the CCKBR could be involved in Dexperimental animals; these modifications in- somatostatin metabolism and/or control of ␦-cell growth. cluded increased secretion, tissue contents, and ␦-cell Therefore, knowing that diabetes causes modifications population (1–12). On the contrary, it was also reported in the pancreatic ␦-cell metabolism and that these cells (13,14) that in diabetic mice mutants (ob/ob and db/db), express the CCKBR, the objectives for this study are to pancreatic somatostatin content was decreased, along characterize the changes in somatostatin mRNA expres- with a reduction in somatostatin cells within the islet. It sion and contents along with those of the CCKBRin was later suggested that in streptozotocin (STZ)-induced normal and diabetic rats and to determine whether insulin diabetic rats, regulation of somatostatin gene transcription treatment can normalize the modifications observed dur- ing diabetes development.

From the Gastroenterology Service, Department of Medicine, Faculty of Medicine, Universite´ de Sherbrooke, Sherbrooke, Quebec, Canada. RESEARCH DESIGN AND METHODS Address correspondence and reprint requests to Jean Morisset, Gastroen- Male Sprague-Dawley rats, purchased from Charles River Laboratories (St. terology Service, Department of Medicine, Faculty of Medicine, Universite´de Constant, Canada), were housed in a light- and humidity-controlled room and Sherbrooke, Sherbrooke, Quebec, Canada, J1H 5N4. E-mail: jean.morisset@ given free access to food and water. usherbrooke.ca. Received for publication 11 November 2003 and accepted in revised form 19 After an overnight fast, rats (200–220 g) were rendered diabetic (group March 2004. STZ-D, n ϭ 160) by a single intraperitoneal injection of 65 mg/kg body wt STZ

CCK, cholecystokinin; CCKBR, CCK-B receptor; STZ, streptozotocin. (Sigma, St. Louis, MO) dissolved in 0.1 mol/l citrate buffer, pH 4.5. Controls © 2004 by the American Diabetes Association. received the same volume of citrate buffer alone (nondiabetic, group ND, n ϭ

1526 DIABETES, VOL. 53, JUNE 2004 S. JULIEN, J. LAINE, AND J. MORISSET

40). Animals were studied for 7 (group STZ-D7, n ϭ 20), 14 (group STZ-D14, TCAC, position 1516–1498, with a 478 bp cDNA fragment amplified. Reverse n ϭ 20), 21 (group STZ-D21, n ϭ 20), or 28 (group STZ-D28, n ϭ 20) days after transcription was performed for1hat50°C, and PCR amplifications were diabetes induction. Seven days after STZ injection, 80 diabetic rats received performed under the following conditions: somatostatin: 60 s 94°C, 45 s 60°C, twice daily subcutaneous injections of Novolin ge NPH insulin (Novo Nordisk, and 45 s 72°C (35 cycles); CCKBR: 30 s 94°C, 30 s 57°C, and 30 s 72°C (35 Bagsvaerd, Denmark; 3 units at 8:00 A.M., 5 units at 8:00 P.M.) (group STZ-I) and cycles); 18S: 60 s 94°C, 45 s 47°C, and 45 s 72°C (30 cycles). PCR samples were were killed 7 (group STZ-I7, n ϭ 20), 14 (group STZ-I14, n ϭ 20), or 21 (group electrophoresed on a 1% agarose gel, and DNA was visualized with ethidium STZ-I21, n ϭ 20) days after the initial insulin injection. Twenty other bromide. insulin-treated rats were denied insulin after 21 days and were killed 21 days Immunochemistry and image analysis by confocal microscopy. These later (group STZ-I21/D21). Before killing them, all animals were fasted except procedures were extensively described recently (29,39) with regard to the the group I rats. Under anesthesia, blood was collected from the inferior vena antibodies used, their dilution, and their specificity. Ϯ cava and the pancreas was excised. Plasma was separated by centrifugation at Statistical analysis. Results represent means SE. The statistical analysis Ͻ 4°C and stored at Ϫ20°C for measurement of glucose and triglycerides. These was done using a Student’s t test (two tailed). A P value of 0.05 was studies were performed according to our institutional animal care policies. considered significant. Tissue preparations. Once excised, pancreata were quickly frozen in liquid nitrogen and kept frozen at Ϫ80°C until they were processed for receptor RESULTS protein analysis by Western blotting or for total pancreas RNA extraction to determine CCK receptor and somatostatin expression by RT-PCR. Body weight, plasma glucose, triglycerides, and pan- Glycemia and lipidemia determinations. Plasma glucose and triglycerides creatic amylase. As shown in Fig. 1A, body weights of the were measured according to the Vitros GLU slide and Vitros TRIG slide test diabetic animals (STZ-D) exhibited significant early de- methodologies (Ortho-Clinical Diagnostics, Rochester, NY), respectively. Both creases of 18% at day 7, down to 29.6% at day 28 when analyses are based on enzymatic methods as described by Curme (30) and compared with their respective controls. Treatment of the Spayd (31). diabetic animals with insulin (STZ-I) immediately reversed Rat islet isolation. Islets were purified from diabetic and control rats according to the modified method of Lacy and Kosianovsky (32) as recently the losses in body weight; a 15% increase was observed described (33). Yields were ϳ350–400 islets from each diabetic pancreas and after 7 days, up to 28.4% after 3 weeks, thus indicating a ϳ650–800 islets from a normal pancreas. return to control values. Cessation of insulin for 21 days RIN-14B cells. The RIN-14B cells were obtained from American Type Culture caused a new drop of 14.2% in body weight when group Collection (ATCC). These cells are of a secondary clone derived from the STZ-I21/D21 is compared with group STZ-I21. RIN-m rat islet cell line (34), and they do not produce insulin. Cells were grown in RPMI 1640 medium according to ATCC specifications. The STZ-induced diabetic rats (STZ-D) presented severe Somatostatin and amylase content determinations. Tissue samples were hyperglycemia after 7 days (182%), up to 286% after 28 rapidly frozen in liquid nitrogen until used. For somatostatin determination, a days when compared with their respective controls (Fig. 10% homogenate was made in CH3COOH 2N, boiled for 15 min, and centri- 1B). Under insulin, a gradual recovery was observed and fuged for 20 min at 12,000g. The supernatants (3 ml) were extracted using glycemia reached control values after 14 days (ND-28 Waters Sep-Pak C18 cartridges (Waters Associates, Milford, MA) that were prewetted with 100% acetonitrile followed by 0.05% trifluoroacetic acid (15 versus STZ-I28). Cessation of insulin resulted in a signifi- ml). The cartridges were loaded with extract, washed with 0.05% trifluoroace- cant 173% increase in glycemia after 21 days (STZ-I21 tic acid (15 ml), and eluted with 80% acetonitrile in 0.05% trifluoroacetic acid versus STZ-I21/D21). Diabetes was also assessed by mea- (4 ml). The elutates were dried in a vacuum concentrator and stored at Ϫ80°C. surement of plasma triglycerides. As shown in Fig. 1C, Somatostatin immunoreactivity was determined by enzyme-linked immu- nosorbent assay (Peninsula Laboratories, San Carlos, CA). Amylase activity triglyceridemia was already increased by 332% 7 days after was determined directly from homogenates according to the procedure STZ injection, and these large increases remained until day described by Laine, Beattie, and Lebel (35), and the Western blot was 28. Insulin restored plasma triglycerides back to control performed with an amylase antibody (a gift from G. Grondin, Department of levels within 1 week. Contrary to glycemia, which returned Biology, Universite´ de Sherbrooke). to high values after cessation of the insulin treatment, Membrane preparation, gel electrophoresis, and immunoblotting. All procedures were carried out at 4°C. Freshly removed pancreata were minced triglycerides remained at control values (STZ-I21/D21 ver- and disrupted in a homogenization buffer (10 mmol/l HEPES, pH 7.5, 250 sus ND28). mmol/l sucrose, 1 mmol/l EGTA, 1 mmol/l EDTA, 0.5 mmol/l diisopropylflu- As previously observed (40), diabetes is also associated orophosphate, 20 ␮mol/l leupeptin, and 1.5 ␮mol/l aprotinin) with the use of with a complete loss of pancreatic amylase activity (Fig. five passes through a Potter-Elvehjem homogenizer. Unbroken cells and nuclei were removed by centrifugation at 500g for 5 min. Membranes were 1D) and content (Fig. 1E). A return to control values was collected by centrifugation at 100,000g for 1 h using a Beckman TLS-55 rotor observed after insulin treatment, and a new drop occurred (Buckinghamshire, U.K.). The supernatants were removed, and membranes upon cessation of the insulin treatment. It is important to were resuspended at a dilution of 15–30 mg/ml in the homogenization buffer notice that losses in activity also corresponded to losses in and stored at Ϫ80°C until used. A similar procedure was performed to prepare protein. membranes from the RIN-14B cells. The procedures for gel electrophoresis and immunoblotting were performed as previously described (29), with the Variations in pancreatic somatostatin mRNA and hor-

CCKBR antibody 9262. The IGF-1 receptor antibody was a rabbit polyclonal mone content. As shown in Fig. 2A, somatostatin mRNA from Santa Cruz, a gift from Dr. M. Korc, Dartmouth Medical School, Lebanon, exhibited a significant increase of 23% over control values New Hampshire. It was used at a 1/1,000 dilution. 28 days after diabetes induction (STZ-D versus ND) when Islets and pancreas total RNA extraction and RT-PCR. Total RNAs from rat purified islets were extracted by the method of Chomczynski and Sacchi RNA from the total pancreas was used. Insulin given for 21 (36). Total RNAs from rat pancreata were isolated according to a modification days returned somatostatin mRNA to control values (STZ-I of the procedure of Chirwing et al. (37) as described by Calvo et al. (38). Total versus ND), whereas its cessation caused a new significant RNA concentration was determined by absorbance at 260 and 280 nm. RT-PCR increase of 10% in somatostatin mRNA (STZ-I21/D21 ver- was performed using the Titanium One-Step RT-PCR kit (Clontech Laborato- sus STZ-I21). Because pancreatic somatostatin is exclu- ries, Palo Alto, CA) from 500 ng of purified total RNA from total pancreas or ␦ purified islets. The PCR primers were designed from human somatostatin sively located in the -cells of the islet (28), we decided to (forward: CCCCAGACTCCGTCAGTTTC, position 144–163, and reverse: verify if alterations of somatostatin mRNA expression GCAGCCAGCTTTG-CGTTCTC, position 375–358) with a 231-bp cDNA frag- observed in whole pancreas were also present in RNA ment amplified. The PCR primers for the rat CCK R were: forward: CTTCATC B extracted from purified islets. RNAs were then extracted CCGGGTGTGGTTA-TTGCG, position 725–749, and reverse: CCCCAGTGTGC TGATG-GTGGTATAGC, position 13941–369, with a 669-bp cDNA fragment from pools of five to seven islet preparations as indicated amplified. PCR primers for the rat 18S were: forward: TCAAGAACGA in Fig. 2B. In control rats (ND), a constant expression of AAGTCGGAGG, position 1038–1057, and reverse, GGACATCTAAGGGCA somatostatin mRNA can be observed. Diabetes was asso-

DIABETES, VOL. 53, JUNE 2004 1527 DIABETES, CCKBR, AND SOMATOSTATIN EXPRESSION

97% increase was observed 14 days later. A 21-day insulin treatment resulted in a significant decrease of 36% in somatostatin total contents below control values. Interest- ingly, cessation of this insulin treatment for a further 21 days resulted in a significant 140% increase in somatostatin content when compared with insulin treatment (STZ-I21/ D21 versus STZ-I21) as observed for its mRNA. Mode of insulin action: direct or indirect? To answer this question, we first investigated the effects of diabetes and insulin treatment on IGF-1 receptor protein expres- sion. Secondly, we determined the effects of insulin on somatostatin mRNA expression in RIN-14B cells. As shown in Fig. 3A, the IGF-1 receptor proteins are ex- pressed in control islets, in those of the diabetic rats, and in islets of insulin-treated rats. However, 14 days of diabetes resulted in an important reduction in IGF-1 receptors in the islet, which seems to be accentuated by 14-day insulin treatment. It is important that the IGF-1 receptors are present on the remaining islet cells and can thus still carry the insulin messages. The direct effect of insulin on somatostatin expression is unequivocally dem- onstrated by the observation that within 8 h insulin can repress somatostatin mRNA expression by 62% in RIN-14B cells, which synthesize somatostatin (Fig. 3B). These data clearly establish the direct inhibitory effect of insulin, probably through the IGF-1 receptor that is also present on these cells, as is shown in Fig. 3A. Variations in CCKBR mRNA and protein. Because the CCKBR was previously shown (29) to colocalize with somatostatin in pancreatic endocrine ␦-cells, we investi- gated the potential relationship that might exist between alterations in somatostatin expression and the behavior of the CCKBR in the course of diabetes development, during insulin treatment, and after its cessation. As shown in Fig. 4A, expression of the CCKBR mRNA evaluated from total pancreas RNA was dramatically and significantly reduced by 72% after 28 days of diabetes when compared with controls (STZ-D versus ND). By contrast, insulin given for 21 days significantly enhanced CCKBR mRNA by 60% when compared with diabetic animals (STZ-I21 versus STZ-D28) and with control levels (STZ-I21 versus ND). Cessation of FIG. 1. Effects of diabetes and insulin treatment on rat body weights, plasma glucose, triglycerides, and pancreatic amylase content. Control insulin resulted in another drop of 40.5% in CCKBR mRNA (ND), streptozotocin-induced diabetic (STZ-D), streptozotocin-in- when compared with the insulin-treated rats (STZ-21/D21 duced diabetic with insulin (STZ-I), and streptozotocin-induced dia- betic with insulin followed by cessation of insulin (STZ-I21/D21) rats versus STZ-I21). As shown in Fig. 4B, the CCKBR proteins were killed at different times after the beginning of each treatment. present in total pancreas membrane proteins followed a Before killing them, they were weighed (A) and blood was withdrawn pattern of expression comparable with its mRNA except in for glucose (B) and triglyceride (C) determinations. Pancreatic amy- lase was also estimated after organ excision (D and E). Results the diabetic group, which did not experience as dramatic represent the mean ؎ SE of the number of animals per group (data in a drop as its mRNA content. The receptor is visualized as parentheses). *P < 0.01; **P < 0.001; ‡P < 0.05. an 80-kDa protein. With RNA isolated from purified islets (Fig. 4C), we can ciated with a fourfold increment in somatostatin mRNA 7 appreciate the constancy over time in CCKBR mRNA days after its induction, an elevation that remained for 28 expression in the control rats (ND). In the diabetic ani- days. Insulin treatment caused a prompt return of soma- mals, a significant burst of the receptor mRNA was ob- tostatin mRNA to control values after 7 days, which served after 7 days of the initial STZ injection. Thereafter, remained throughout treatment. However, cessation of a progressive decline was observed over the next 14 days, insulin resulted in a new increase in somatostatin mRNA to a complete disappearance after 28 days. Insulin treat- to levels comparable with those in the initial diabetic ment brought CCKBR mRNA back to control values after 7 animals. These variations in somatostatin mRNA were days of treatment, and after 21 days, we observed an accompanied by comparable changes in total pancreatic eightfold increase in CCKBR mRNA. Cessation of the somatostatin content, as is shown in Fig. 2C. Indeed, insulin treatment for 21 days drove CCKBR mRNA back to although somatostatin content remained at control values the levels of the 21-day diabetic animals. after 14 days of diabetes (data not shown), a significant With proteins extracted from purified islets (Fig. 4D),

1528 DIABETES, VOL. 53, JUNE 2004 S. JULIEN, J. LAINE, AND J. MORISSET

FIG. 2. Effects of STZ and insulin treatment on somatostatin mRNA expression and hormone con- tents. Total RNA (500 ng) extracted from whole pancreas (A) and purified islets (B) were processed for RT-PCR analysis. The different groups are de- scribed in the legend of Fig. 1. A: The histogram represents the number of animals per group (data in parentheses). B: Values represent data from a pool of several purified rats islets. The experiment was repeated twice. C: Data represent somatostatin pan- creatic content of the different groups, with the number of rats per group shown in parentheses. Results are the means ؎ SE. Number of cell samples per group are shown in parentheses. *P < 0.01 compared with controls.

we can detect the CCKBR even if its concentration seems (red fluorescence) as a yellow signal (merged). In the to be less abundant than that in total pancreas (Fig 4B). diabetic animals, the loss of ␤-cells resulted in increased CCKBR expression remains quite constant with time in concentration of the CCKBR and somatostatin after a nondiabetic islets (ND), while it decreased dramatically week, followed by a reduction at 14 days and a loss after over 7 days of diabetes (STZ-D) to a complete loss of the 28 days of diabetes, a confirmation of the Western blot protein after 21 days of diabetes (STZ-D). As observed in data presented in Fig 4D. In response to insulin, the total pancreas membranes (Fig. 4B), insulin failed to CCKBR protein reappeared slightly during the hormonal replenish the CCKBR protein in the purified islets (Fig. treatment and remained at a low level thereafter, a behav- 4D), contrary to its effect on CCKBR mRNA expression ior totally different from its mRNA content (Fig. 4C). (Fig. 4C). Because the diabetic islets did not recover their normal Estimation of somatostatin, insulin, and CCKBR pro- size during insulin treatment, it is difficult to estimate their tein expression by confocal microscopy. As shown in somatostatin content. Indeed, the confocal images seem to Fig. 5, under transmission, diabetes dramatically reduced indicate that the red immunofluorescence is not as bright the size of pancreatic islets by at least 10-fold. Insulin during insulin treatment as it is in diabetic islets, a sign of treatment increased their size over time but never to that reduced somatostatin content, as is observed with total of a control islet, even after 21 days of treatment. The pancreas content evaluation (Fig. 2C). Cessation of insulin specificity of the CCKBR and somatostatin antibody sig- did not change the pattern of CCKBR expression but nals was demonstrated by the loss of immunofluorescence increased somatostatin content when compared with 21 when the peptide antigen (CCKBR) and the hormone days of insulin treatment. Recovery of somatostatin after somatostatin were incubated in the presence of their insulin cessation corresponds with the increased contents respective antibody. In normal islets, colocalization of the of the hormone observed in Fig. 2C. As shown in Fig. 5, CCKBR (green fluorescence) occurred with somatostatin diabetic animals lost their islet insulin early, and their

DIABETES, VOL. 53, JUNE 2004 1529 DIABETES, CCKBR, AND SOMATOSTATIN EXPRESSION

FIG. 3. A: IGF-1 receptor protein expression was ana- lyzed by Western blot from purified normal rat islet (ND), 14-day diabetic rats (STZ-D), 5-day diabetic rats treated for 14 days with insulin (STZ-I), and somatosta- tin RIN-14B cells. B: Effects of insulin on somatostatin mRNA expression in RIN-14B cells. Cells were treated with 100 nmol/l insulin for 8 h (I) or not (C). Results .are the means ؎ SE. *P < 0.01 compared with controls hormone content did not recover during insulin treatment. pancreas and purified islets, with return to control values The specificity of the insulin antibody is evident from the in mRNA but not in receptor protein during insulin treat- image obtained with preincubation of the antibody with ment, and 5) finally, the modifications observed at the insulin. biochemical level can be corroborated by our confocal microscopy analysis, which has never been done previously. DISCUSSION The validity of our data on somatostatin and CCKBR In this study, we show the importance of insulin as a variations observed in this study depends on the demon- regulator of pancreatic ␦-cell activity focused on soma- stration that diabetes occurred when induced, that it could tostatin and CCKBR metabolism. Our data confirm the be controlled by insulin treatment, and that it reappeared initial observations that pancreatic somatostatin mRNA upon cessation of treatment. Our results on body weight expression (15) and somatostatin content in STZ-induced decreases, hyperglycemia, and hypertriglyceridemia fol- diabetic animals (1,2,5) and in spontaneously diabetic lowing STZ injection clearly indicate that diabetes was mice (11,12) were significantly increased, with a return to established early and sustained for 28 days. Furthermore, control levels during insulin treatment (15). However, the observation that all of these parameters were normal- some spontaneous diabetic mice also exhibited decreased ized during insulin treatment and became abnormal again pancreatic somatostatin content (13,14), a finding that after insulin cessation stressed the diabetes status of these remains unexplained. Among our original data, it was animals (41). Finally, the disappearance of pancreatic demonstrated that 1) the major variations observed during amylase during diabetes, its return to normal values during the different treatments on somatostatin mRNA expres- insulin treatment, and its loss again after ending insulin sion in total pancreas samples were identical to those treatment support previous data on the effects of diabetes obtained in purified islets, 2) the increases and decreases on the pancreas (40), along with the microscopy data in somatostatin mRNA were comparable and in synchrony showing shrinking of the islets and loss of insulin. with those of total gland somatostatin content, 3) insulin Our data clearly indicate that pancreatic somatostatin negatively and directly modulated pancreatic somatostatin mRNA expression is strongly disturbed soon after diabetes mRNA expression and its hormone contents, possibly induction, and evident more so when RNA samples were through the IGF-1 receptor, 4) diabetes resulted in pro- extracted from purified islets. These increased contents gressive losses in CCKBR mRNA and protein in total were also rapidly normalized within a week of insulin

FIG. 4. Effects of diabetes insulin treatment on CCKBR mRNA and protein. Total RNA (500 ng) extracted from whole pancreas (A) and purified islets (C) were processed for RT-PCR analysis. Protein (30 ␮g) from whole pancreas membranes (B) and from purified islets (D) were subjected to electrophoresis. The different groups are described in Fig. 1. A and B: Values represent data collected from the number of rats per group (data in parentheses). C and D: Data represent CCKBR mRNA and protein expression from a pool of several purified rat islets; the experiment was .repeated twice. Results are the means ؎ SE. *P < 0.01

1530 DIABETES, VOL. 53, JUNE 2004 S. JULIEN, J. LAINE, AND J. MORISSET

DIABETES, VOL. 53, JUNE 2004 1531 DIABETES, CCKBR, AND SOMATOSTATIN EXPRESSION

FIG. 5. Colocalization of the pancreatic CCKBR with somatostatin and insulin localization in diabetic rats and following insulin treatment. ␮ ؊1 Purified rat islets were incubated overnight at 4°C with the CCKBR antibody 9262 (1:1,000), with the somatostatin antibody (10 gml ), or with insulin (1:50). Colocalization and localization were established by confocal microscopy as described in 29. Calibration bars: ؊100 ␮m and ؊10 ␮m (see transmission panels). treatment and rebounded after insulin cessation. It is quite seems independent of blood glucose level because it interesting to observe that the variations observed in the occurred in both normal and hyperglycemic conditions course of this study on somatostatin mRNA were paral- and happened before any change in blood glucose level leled by similar changes in somatostatin total pancreatic (19,45). Interestingly, long-term insulin treatment was as- contents. This observation suggests that these modifica- sociated with decreased pancreatic somatostatin content tions in contents reflect changes in somatostatin synthesis and somatostatin mRNA expression (15 and this study) in more than in somatostatin accumulation due to inhibition conditions of normalized glycemia; these data thus suggest of secretion. This last possibility is doubtful because that insulin is involved in the regulation of somatostatin increased somatostatin secretion was previously observed gene transcription. Our data on the presence of IGF-1 (8) in alloxan-induced diabetic rats. Therefore, if controls receptors on normal and diabetic islets suggest that insulin occur at the somatostatin mRNA and protein synthesis may operate through this receptor. Its reduction during level, then what factors are responsible? Earlier studies diabetes can be explained by the major loss in ␤-cells suggested that glucose could be involved; indeed, high following STZ administration, confirmed by confocal mi- glucose stimulated somatostatin release from monolayer croscopy (Fig. 5). The presence of the IGF-1 receptor on cultures of neonatal rat pancreas (17) and from rat iso- the RIN-14B cells and the drastic and rapid inhibitory lated islets (42), observations not confirmed in another effect of insulin on somatostatin mRNA expression in study (43). Increased somatostatin secretion could trigger these cells strongly suggest a direct action of insulin. somatostatin synthesis, and glucose was shown (44) to Recently, it was shown for the first time that the regulate pancreatic preprosomatostatin I expression as it CCKBRs were present on the endocrine somatostatin increased somatostatin release from rainbow trout Brock- ␦-cells in six different species (28,29). In this study, we mann bodies. In normal and diabetic dogs, however, the present for the first time evidence that the CCKBR mRNA intravenous administration of exogenous insulin immedi- and protein expressions are modulated differently from ately reduced basal somatostatin release, an effect that somatostatin during diabetes, including receptors mea-

1532 DIABETES, VOL. 53, JUNE 2004 S. JULIEN, J. LAINE, AND J. MORISSET sured in total gland and in purified islets. The observations nohistochemical changes of somatostatin cells in the pancreatic islets of that the receptor protein remained in total pancreas mem- rats after streptozotocin administration. Endocrinol Jpn 25:111–115, 1978 5. Patel YC, Cameron DP, Bankier A, Malaisse-Lagae F, Ravazzola M, Studer brane during insulin treatment while disappearing from P, Orci L: Changes in somatostatin concentration in pancreas and other purified islets strongly suggest that they are not uniquely tissues of streptozotocin diabetic rats. Endocrinology 103:917–923, 1978 localized on the ␦-cells. Indeed, our most recent data 6. McEvoy RC, Hegre OD: Morphometric quantitation of the pancreatic indicate its presence on the rat pancreatic acinar cells insulin-, glucagon-, and somatostatin-positive cell populations in normal (46); this receptor population could also be affected by and alloxan-diabetic rats. Diabetes 26:1140–1146, 1977 diabetes. This needs to be verified on purified acinar cells 7. Patel YC, Wheatley T, Zingg HH: Increased blood somatostatin concentra- tion in streptozotocin diabetic rats. Life Sci 27:1563–1570, 1980 that are free of islets. The loss of islet CCKBR protein 8. Hara M, Patton G, Gerich J: Increased somatostatin release from pancre- during diabetes and its failure to reappear during insulin ases of alloxan diabetic rats perfused in vitro. Life Sci 24:625–628, 1979 treatment could be explained according to the following 9. Petersson B, Hellerstrom C, Gunnarsson R: Structure and metabolism of two possibilities, which at the moment remain speculative. the pancreatic islets in streptozotocin treated guinea pigs. Horm Metab Res First, convertase enzymes could be activated during dia- 2:313–317, 1970 10. Makino H, Kanatsuka A, Matsushima Y, Yamamoto M, Kumagai A: Effect of betes development and then digest the external NH2- streptozotocin administration on somatostatin content of pancreas and terminal section of the receptor protein. If so, antibody hypothalamus in rats. Endocrinol Jpn 24:295–299, 1977 9262, which specifically recognizes this part of the protein, 11. Makino H, Matsushima Y, Kanatsuka A, Yamamoto M, Kumagai A, Nish- would fail to detect the receptor. Second, diabetes would imura M: Changes in pancreatic somatostatin content in spontaneously destabilize the CCK R mRNA due to defects in chaperone diabetic mice, as determined by radioimmunoassay and immunohisto- B chemical methods. Endocrinology 104:243–247, 1979 proteins. This could result in the translation of a CCKBR 12. Baetens D, Stefan Y, Ravazzola M, Malaisse-Lagae F, Coleman DL, Orci L: truncated protein. Such modifications in chaperone pro- Alteration of islet cell populations in spontaneously diabetic mice. Diabe- teins have been previously observed (47) during diabetes tes 27:1–7, 1978 and resulted in disturbed translation processes involving 13. Patel YC, Orci L, Bankier A, Cameron DP: Decreased pancreatic soma- large mRNA. tostatin (SRIF) concentration in spontaneously diabetic mice. Endocrinol- ogy 99:1415–1418, 1976 If somatostatin secretion is stimulated by the CCK 14. Patel YC, Cameron DP, Stefan Y, Malaisse-Lagae F, Orci L: Somatostatin: agonists gastrin and its analogs (48), accumulation of widespread abnormality in tissues of spontaneously diabetic mice. Science pancreatic somatostatin content in the diabetic animals 198:930–931, 1977 (Fig. 2) could be partially explained by the drastic reduc- 15. Papachristou DN, Pham K, Zingg HH, Patel YC: Tissue-specific alterations tion in islet CCK R protein, as is observed in Fig. 4. The in somatostatin mRNA accumulation in streptozocin-induced diabetes. B Diabetes 38:752–757, 1989 observation that somatostatin content continued to be 16. Honey RN, Weir GC: Insulin stimulates somatostatin and inhibits glucagon modulated under insulin treatment and its subsequent secretion from the perfused chicken pancreas-duodenum. Life Sci 24: cessation in the absence of CCKBR proteins in islets 1747–1750, 1979 strongly suggests that this receptor might not be directly 17. Patel YC, Amherdt M, Orci L: Somatostatin secretion from monolayer involved in somatostatin synthesis and secretion, although cultures of neonatal rat pancreas. Endocrinology 104:676–679, 1979 18. Patton GS, Ipp E, Dobbs RE, Orci L, Vale W, Unger RH: Pancreatic this assumption remains to be investigated. immunoreactive somatostatin release. Proc Natl Acad SciUSA74:2140– In conclusion, this study clearly demonstrated that the 2143, 1977 expression of pancreatic somatostatin and the CCKBR 19. Ribes G, Gross R, Chenon D, Loubatieres-Mariani MM: Effect of insulin on associated with islet ␦-cells are closely regulated by insulin basal pancreaticoduodenal output of somatostatin in normal and diabetic dogs. Acta Endocrinol 119:43–50, 1988 in diabetes. Insulin can at least negatively control soma- 20. Sandberg E, Ahren B, Tendler D, Efendic S: Cholecystokinin (CCK)-33 tostatin expression with positive action on CCKBR mRNA. stimulates insulin secretion from the perfused rat pancreas: studies on the Preliminary data presented in Fig. 3 on RIN-14B cells structure-activity relationship. Pharmacol Toxicol 63:42–45, 1988 clearly establish a rapid and direct negative control of 21. Szecowka J, Lins PE, Efendic S: Effects of cholecystokinin, gastric insulin on somatostatin mRNA expression in these soma- inhibitory polypeptide, and secretin on insulin and glucagon secretion in rats. Endocrinology 110:1268–1272, 1982 tostatin cells. An insulin-responsive element was also 22. Ahren B, Martensson H, Nobin A: Cholecystokinin (CCK)-4 and CCK-8 found on the rat somatostatin gene, and studies are stimulate islet hormone secretion in vivo in the pig. Pancreas 3:279–284, underway to determine the effects of its deletion on 1988 somatostatin mRNA expression. The physiological impor- 23. Ahren B, Lundquist I: Effects of two cholecystokinin variants, CCK-39 and CCK-8, on basal and stimulated insulin secretion. Acta Diabetol Lat tance of our data are the demonstration that insulin can 18:345–356, 1981 control the expression and synthesis of one of its most 24. Ahren B, Pettersson M, Uvnas-Moberg K, Gutniak M, Efendic S: Effects of potent inhibitors. Although we do not have any evidence cholecystokinin (CCK)-8, CCK-33, and gastric inhibitory polypeptide (GIP) yet, it remains possible that high pancreatic somatostatin on basal and meal-stimulated pancreatic hormone secretion in man. levels are involved in the course of type 2 diabetes Diabetes Res Clin Pract 13:153–161, 1991 25. Rossetti L, Shulman GI, Zawalich WS: Physiological role of cholecystoki- development as insulin becomes less and less efficient. nin in meal-induced insulin secretion in conscious rats: studies with L364718, a specific inhibitor of CCK-receptor binding. Diabetes 36:1212– 1215, 1987 REFERENCES 26. Kawano K, Hirashima T, Mori S, Saitoh Y, Kurosumi M, Natori T: 1. Patel YC, Weir GC: Increased somatostatin content of islets from strepto- Spontaneous long-term hyperglycemic rat with diabetic complications: zotocin-diabetic rats. Clin Endocrinol 5:191–194, 1976 Otsuka Long-Evans Tokushima Fatty (OLETF) strain. Diabetes 41:1422– 2. Orci L, Baetens D, Rufener C, Amherdt M, Ravazzola M, Studer P, 1428, 1992 Malaisse-Lagae F, Unger RH: Hypertrophy and hyperplasia of somatosta- 27. Takiguchi S, Takata Y, Funakoshi A, Miyasaka K, Kataoka K, Fujimura Y, tin-containing D-cells in diabetes. Proc Natl Acad SciUSA73:1338–1342, Goto T, Kono A: Disrupted cholecystokinin type-A receptor (CCKAR) gene 1976 in OLETF rats. Gene 197:169–175, 1997 3. Hellman B, Petersson B: Long-term changes of the alpha1 and alpha2 cells 28. Morisset J, Wong H, Walsh JH, Laine J, Bourassa J: Pancreatic CCK(B) in the islets of Langerhans of rats with alloxan diabetes. Endocrinology receptors: their potential roles in somatostatin release and delta-cell 72:238–242, 1963 proliferation. Am J Physiol Gastrointest Liver Physiol 279:G148–G156, 4. Matsushima Y, Makino H, Kanatsuka A, Yamamoto M, Kumagai A: Immu- 2000

DIABETES, VOL. 53, JUNE 2004 1533 DIABETES, CCKBR, AND SOMATOSTATIN EXPRESSION

29. Morisset J, Julien S, Laine´ J: Localization of cholecystokinin receptor and localization of CCK receptor subtype in calf pancreas. Regul Peptides subtypes in the endocrine pancreas. J Histochem Cytochem 51:1501–1513, 111:103–109, 2003 2003 40. Soling HD, Unger KO: The role of insulin in the regulation of alpha-amylase 30. Curme HG: Multilayer film elements for clinical analysis. Clin Chem 24: synthesis in the rat pancreas. Eur J Clin Invest 2:199–212, 1972 1335–1342, 1978 41. Szkudelski T: The mechanism of alloxan and streptozotocin action in B 31. Spayd R: Multilayer film elements for clinical analysis. Clin Chem 24:1348– cells of the rat pancreas. Physiol Res 50:537–546, 2001 1350, 1978 42. Kanatsuka A, Makino H, Matsushima Y, Osegawa M, Kasanuki J, Miyahira 32. Lacy PE, Kostianovsky M: Method for the isolation of intact islets of M, Yamamoto M, Kumagai A: Effect of glucose on somatostatin secretion Langerhans from the rat pancreas. Diabetes 16:35–39, 1967 from isolated pancreatic islets of normal and streptozotocin-diabetic rats. 33. Julien S, Laine J, Morrisset J: Langerhans islets purification in diabetic rats Endocrinology 109:652–657, 1981 (Letter). Pancreas 27:206–207, 2003 43. Barden N, Alvarado-Urbina G, Cote JP, Dupont A: Cyclic AMP-dependent 34. Bhathena SJ, Awoke S, Voyles NR, Wilkins SD, Recant L, Oie HK, Gazdar AF: Insulin, glucagon, and somatostatin secretion by cultured rat islets cell stimulation of somatostatin secretion by isolated rat islets of Langerhans. tumor and its clones. Proc Soc Exp Biol Med 175:35–38, 1984 Biochem Biophys Res Commun 71:840–844, 1976 35. Laine J, Beattie M, Lebel D: Kinetic determination of amylase on microtiter 44. Melroe GT, Ehrman MM, Kittilson JD, Sheridan MA: Glucose regulates plates: an improved substrate (Letter). Pancreas 13:217, 1996 pancreatic preprosomatostatin I expression. FEBS Lett 465:115–118, 2000 36. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid 45. Schusdziarra V, Lenz N, Schick R, Maier V: Modulatory effect of glucose, guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem amino acids, and secretin on CCK-8–induced somatostatin and pancreatic 162:156–159, 1987 polypeptide release in dogs. Diabetes 35:523–529, 1986 37. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ: Isolation of biolog- 46. Biernat M, Julien S, Laine J, Morisset J: Evidence for CCKB receptors on ically active ribonucleic acid from sources enriched in ribonuclease. rat pancreatic acinar cells: a role in enzyme secretion? (Abstract). Pan- Biochemistry 18:5294–5299, 1979 creas 27:372, 2003 38. Calvo EL, Bernatchez G, Pelletier G, Iovanna JL, Morisset J: Downregula- 47. Shi Y, Taylor SI, Sonenberg N: When translation meets metabolism: tion of IGF-I mRNA expression during postnatal pancreatic development multiple links to diabetes. Endocr Rev 24:91–101, 2003 and overexpression after subtotal pancreatectomy and acute pancreatitis 48. Rehfeld JF, Larsson LI, Goltermann NR, Schwartz TW, Holst JJ, Jensen SL, in the rat pancreas. J Mol Endocrinol 18:233–242, 1997 Morley JS: Neural regulation of pancreatic hormone secretion by the 39. Morisset J, Laine J, Bourassa J, Lessard M, Rome V, Guilloteau P: Presence C-terminal tetrapeptide of CCK. Nature 284:33–38, 1980

1534 DIABETES, VOL. 53, JUNE 2004