www.gradeup.co
1 www.gradeup.co
Monthly Current Affairs for Defence Exam
six more months, till June 2019, Kashmir Stag (Hangul) under the controversial AFSPA. • Recently it is found that Kashmir Stag • AFSPA empowers security forces to has begun using an old migratory conduct operations anywhere and route has given fresh hoped to arrest anyone without any prior conservationists. notice. • Article 355 of the Constitution of India Kashmir stag confers power to the Central • The Kashmir stag, also called hangul, Government to protect every state is a subspecies of elk native to India. from internal disturbance. • It is found in dense riverine forests in Related Information the high valleys and mountains of the Armed Forces (Special Powers) Act Kashmir Valley and northern Chamba • Armed Forces (Special Powers) Acts district in Himachal Pradesh. (AFSPA), are Acts of the Parliament of • In Kashmir, it's found in the Dachigam India that grant special powers to the National Park where it receives Indian Armed Forces in which each act protection but elsewhere it is more at terms "disturbed areas". risk. • According to The Disturbed Areas • Earlier believed to be a subspecies of (Special Courts) Act, 1976 once red deer, a number of mitochondrial declared ‘disturbed’, the area has to DNA genetic studies have revealed maintain the status quo for a that the hangul is part of the Asian minimum of 3 months. clade of the elk. • One such Act passed on September • It is the state animal of Jammu and 11, 1958, was applicable to the Naga Kashmir. Hills, then part of Assam. • In the following decades it spread, Distribution and ecology one by one, to the other Seven Sister • This deer found in dense riverine States in India's northeast (at present forests, high valleys, and mountains it is in force in Assam, Nagaland, of the Kashmir valley and northern Manipur excluding Imphal municipal Chamba in Himachal Pradesh. council area, Changlang, Longding, • In Kashmir, it's found in the Dachigam and Tirap districts of Arunachal National Park (at elevations of 3,035 Pradesh). meters), Rajparian Wildlife Sanctuary, • Another one passed in 1983 and Overa Aru, Sind Valley, and in the applicable to Punjab and Chandigarh forests of Kishtwar&Bhaderwah. was withdrawn in 1997, roughly 14 Dachigam National Park years after it came to force. • The Dachigam National Park (DNP) is History located at Umaria district in Jammu • The Armed Forces Special Powers and Kashmir (J&K). Ordinance of 1942 was promulgated • The main animal species that by the British on 15 August 1942 to Dachigam is known for is the hangul suppress the Quit India Movement. (or the Kashmir stag). • Modeled on these lines, four ordinance- • Other species include Musk deer, o the Bengal Disturbed Areas Leopard, Himalayan serow, (Special Powers of Armed Himalayan grey langur, Leopard cat, Forces) Ordinance Himalayan black bear, etc. o the Assam Disturbed Areas Centre extends AFSPA in Nagaland (Special Powers of Armed • Recently, the entire State of Nagaland Forces) Ordinance has been declared ‘disturbed area’ for 2 www.gradeup.co
o the East Bengal Disturbed • The festival includes the Areas (Special Powers of Thiruvabharanam (sacred ornaments Armed Forces) Ordinance of Ayyappan) procession and a o the United provinces Disturbed congregation at the hill shrine of Areas (Special Powers of Sabarimala. Armed Forces) Ordinance • Makaravilakku is a part of a religious • These ordinances were invoked by the ritual that is practiced in the past by central government to deal with the the tribes in the forest of internal security situation in the Ponnambalamedu (the place where country in 1947 which emerged due to Makaravilakku appears) and then the Partition of India. later secretly continued by The ASI declared 6 monuments of national Travancore Devaswom Board (TDB). importance in 2018 • It has been practiced for more than • Recently six monuments declared hundreds of years by the tribes. protected and of national importance Sabarimala by the Archaeological Survey of India • Sabarimala is a temple complex (ASI) in 2018. located at the Periyar Tiger Reserve in These monuments are: the state of Kerala, India. 1. The 125-year-old Old High Court • The temple is dedicated to the Hindu Building in Nagpur, Maharashtra deity Ayyappan also known as 2. Two Mughal-era monuments in Agra Dharma Sastha, who according to — Haveli of Agha Khan and Hathi belief is the son of Shiva and feminine Khana. incarnation of Vishnu. 3. The ancient Neemrana Baori in • The traditions of Sabarimala are a Rajasthan's Alwar district confluence of Shaivism, Shaktism, 4. The Group of Temples at Vaishnavism, and other Śramaṇa RanipurJharail in Odisha's Bolangir traditions. district Sabarimala Case Verdict 5. The Vishnu Temple in Kotali, • In response to a PIL filed in 1991, the Pithoragarh district, Uttarakhand. Kerala High Court had observed the Related Information restriction of entry of women (in the • In 2016 and 2017, no new monument 10-50 age groups) to the temple was was included in the list of sites of in accordance with the usage national importance. prevalent from time immemorial. • The last monument to be included in • In lieu of this, it had directed the the list, in 2015, was the Vishnu Devaswom Board to uphold the Temple in Nadavayal in Kerala's customary traditions of the temple. Wayanad district. • However, on 28th September 2018, Note: A "Monument of National Importance" the Supreme Court of India is designated by the Archaeological Survey of overturned the ban on the entry of India and includes the following. women, declaring that the selective 1. The remains of an ancient monument. ban on women was unconstitutional 2. The site of an ancient monument. and discriminatory. 3. The land on which there are fences or Center launches a sanitary pad-making protective covering structures for initiative preserving the monument. • Recently Ministry of Petroleum 4. Land by means of which people can launched the Ujjwala Sanitary freely access the monument. Napkins initiative. • This initiative launched with the help Makaravilakku festival begins in of three oil marketing companies – Sabarimala IOCL, BPCL, and HPCL Related Information Related Information • This mission is a part of the CSR initiative of OMCs in Odisha. 3 www.gradeup.co
• It is aimed to educate women on named “Samwad with Students” has female hygiene and health, improve been launched. accessibility to low cost eco-friendly • The Samwad with Students aims to sanitary pads and boost rural constantly engage youngsters across employment and economy. India to capture their scientific • The Ujjwala pads will be made of temperament. virgin wood pulp sheet, non-woven • The new conversation mission will white sheet and a gel sheet which are inspire students cutting across all biodegradable in nature and will schools and colleges. leave a minimal carbon footprint. • The first SwS event saw 40 wards and Ross Island is now Netaji Dweep 10 teachers from selected schools. • Recently Prime Minister announced Related Information the renaming of three islands of the Indian Space Research Organisation Andaman and Nicobar archipelago as (ISRO) a tribute to Netaji Subhas Chandra • Its headquartered in the city of Bose. Bengaluru. • The Ross Island was renamed Netaji • Its vision is to "harness space Subhas Chandra Bose Dweep, Neil technology for national development Island as Shaheed Dweep and the while pursuing space science research Havelock Island as Swaraj Dweep. and planetary exploration." Related Information • It is managed by the Department of Andaman and Nicobar Islands Space, which reports to the Prime Minister of India. • The Andaman and Nicobar Islands, • Its Motto is - Space technology in the one of the seven union territories of service of humankind India, are a group of islands at the Export Promotion Council Cell juncture of the Bay of Bengal and the Established for MSME Sector Andaman Sea. • Ministry of Micro, Small and Medium • The territory is about 150 km (93 mi) Enterprises (MSME) has established north of Aceh in Indonesia and an Export Promotion Cell. separated from Thailand and • It will: Myanmar by the Andaman Sea. (i) create a sustainable ecosystem for • It comprises two island groups, the entire MSME development. Andaman Islands (partly) and the (ii) Evaluate readiness of MSMEs to Nicobar Islands, separated by the 150 export their products and services. km wide Ten Degree Channel (on the (iii) Recognize areas where 10°N parallel), improvements are required in order to • The Andaman Sea lies to the east and be able to export effectively and the Bay of Bengal to the west. efficiently • The islands host the Andaman and (iv) Integration of MSME into the Nicobar Command, the only tri- global value chain. service geographical command of the Composition Indian Armed Forces. • It will be chaired by Secretary, M/o • The Andaman Islands are home to the MSME and Co-chaired by Sentinelese people, an uncontacted Development Commissioner, M/o people. MSME. • The council will comprise of senior • The Sentinelese are the only people officials and members from M/o currently known to not have reached MSME, Commerce, MSME Export further than a Paleolithic level of Promotion Councils, Export technology. Development Authorities, Commodity Boards, and other bodies. ISRO launches ‘Samwad with Students’ Objectives • As part of the enhanced outreach programme of ISRO, a platform 4 www.gradeup.co
• Target of USD 100 billion of exports Related Information from India by 2020. • It has been known that RNA helicases, • Evaluate readiness of MSMEs to one of the largest gene families that export their products and services. function in almost all aspects of RNA • Recognize areas where improvements metabolism, play a role in growth, are required in order to be able to development and stress response of a export effectively and efficiently. species. • Integration of MSMEs into Global • They are present in most of the Value Chain. organisms ranging from bacteria to NASA’s New Horizons spacecraft humans, as well as plants. became the first explorer to fly past the • However, its role in the tomato plant’s "Ultima Thule" response to environmental stresses • NASA’s New Horizons spacecraft was not known. became the first explorer to fly past • Now team observed that two genes the mysterious object called "Ultima (SlDEAD23 and SlDEAD35) help Thule" which is located some 4 billion plants withstand biotic and abiotic miles from Earth. stresses. Related Information Ultima Thule Pakistan Cabinet approves the issuance • Ultima Thule is located in the Kuiper of panda Bond in Chinese Currency belt in the outermost regions of the • The government of Pakistan has Solar System, beyond the orbit of decided to launch Panda Bonds to Neptune. raise loans from Chinese capital • Ultima Thule means ‘beyond Thule’, markets. beyond the borders of the known • It will help Pakistan’s to move towards world, symbolizing the exploration of giving the Chinese currency, a status the distant Kuiper Belt and Kuiper Belt at par with that enjoyed by the US objects. dollar. • It is the farthest and quite possibly the • The Panda Bonds are part of its oldest, a cosmic body ever multipronged approach for bridging photographed by humankind. the foreign financing needs and • It measures approximately 30 km in building foreign exchange reserves. diameter and is irregularly shaped. • Panda Bonds will help Pakistan to New Horizons diversify the investor base of capital • It was launched in 2006 and has been market issuance and provide a source traveling through space for the past of raising renminbi. nine years. • China is Pakistan’s largest trading • New Horizon’s core science mission is partner. to map the surfaces of Pluto and Charon, to study Pluto’s atmosphere • The raising of capital in Chinese and to take temperature readings. currency will aid Pakistan to bridge SlDEAD35: Gene that helps tomato fight the deficit. viral infection, heat stress Related Information • Scientists at New Delhi-based Panda Bonds National Institute of Plant Genome • These bonds are Chinese renminbi- Research (NIPGR) have deciphered denominated bonds from a non- the critical role of a single gene— Chinese issuer, sold in the People’s SlDEAD35—in tomato plant whose Republic of China. expression controls its response to • The Philippines issued its inaugural both heat stress and viral infection. Panda bonds in 2018. It was the first • Developing systems for tolerance or ASEAN member to issue Panda bonds. resistance against combined stresses Government to achieve 100% household is important for future crop electrification ahead of Republic Day production. 5 www.gradeup.co
• Ministry of Power said that India is • Settled GST implementation likely to achieve 100 percent • Capacity expansion resulting from household electrification before 2019 growing investments in infrastructure Republic Day. • Continuing the positive effects of the Recent Scenario reform policies are undertaken and • India has already provided electricity improved credit offtake especially in access to 2.39 crore out of the the services sector at 24% targeted 2.49 crore households under CII has identified seven key drivers of the Pradhan Mantri Sahaj Bijli Har growth that need to be encouraged in Ghar Yojana, Saubhagya scheme. 2019 • Status of Electrification India has • Lowering the number of GST rate achieved the hundred percent slabs electrification of the households in 25 • Bolstering the insolvency states by December 2018. • Bankruptcy framework • About 10.48 lakh households are left • Simplifying business procedures to be electrified in 4 states of Assam, • Improving agricultural productivity, Rajasthan, Meghalaya, and among others. Chhattisgarh. Cinereous vulture Related Information • Recently, Cinereous Vulture is spotted SAUBHAGYA or 'Power for all' scheme in Hazaribagh, Jharkhand. • Prime Minister launched 'Power for all' Related Information scheme to mark the birth anniversary • The cinereous vulture is a large of Pandit Deendayal Upadhyaya on raptorial bird that is distributed September 25, 2017. through much of Eurasia. • The scheme is named as • It is also known as the black vulture, ‘Saubhagya’ and provide subsidy on monk vulture, or Eurasian black equipment like transformers, meters, vulture. and wires. • It is one of the two largest Old-World • The scheme also promises on-the- vultures. spot registration of applicants. • Rural Electrification Corporation New Panel to protect Assam’s Heritage Limited (REC) is the nodal agency for coordinating the implementation of • The Union Cabinet decided to set up a the scheme. high-level committee to recommend • The prospective beneficiary how to provide constitutional, households for free electricity legislative and administrative connections under the scheme safeguards to the indigenous people identify using Socio-Economic and of Assam, including by reserving seats Caste Census (SECC), 2011 data. in the state assembly. Robust GDP growth to continue CII • The decision has been taken • According to the Confederation of according to the Assam Accord signed Indian Industry, India will continue to in 1985 which envisaged that be the fastest-growing major appropriate constitutional, legislative economy, with robust GDP growth and administrative safeguards shall expected to continue through 2019. be provided to protect, preserve and • The Confederation of Indian Industry promote the cultural, social, linguistic gave this statement based on strong identity and heritage of the Assamese drivers from the services sector, people. infrastructure activity, and better • The panel will also assess the demand conditions. requirement of measures to be taken The factor which contributes in sustain to protect Assamese and other the robust GDP growth in the range of indigenous languages of the state, 7.5% in 2019. quantum of reservation in • “Better demand conditions employment under the government of 6 www.gradeup.co
Assam and other measures to protect • The concept of Agri Export Zone (AEZ) Assamese heritage. was introduced in 2001, through EXIM • The composition and terms of Policy 1997-2001. reference of the committee will be • It takes a comprehensive look at a issued separately by the ministry of particular produce/product located in home affairs. a contiguous area for the purpose of Related Information developing and sourcing the raw • The Cabinet also approved a number materials, their of measures to fulfill the outstanding processing/packaging, leading to final issues related to the Bodo community. exports. • The Bodo Accord was signed in 2003 • The concept hinged primarily on: which resulted in the establishment of (a) the convergence of existing a Bodoland Territorial. Central and State Government • The Cabinet approved the schemes to take care of financial establishment of a Bodo Museum- interventions required at various cum-language and cultural study stages of the value chain; center, modernization of existing All (b) the partnership among various India Radio station and Doordarshan stakeholders viz. Central Kendra. Government, State Government, Exotic trees eating up Western Ghat’s farmer, processor, exporter etc.; and grasslands (c) focus on targeted products and • In the latest studies, it has been found areas to identify required policy that the country lost almost one- interventions. fourth of high-altitude grasslands of • All these activities did take place in the Western Ghats over four decades. certain respects in the notified Agri • The exotic invasive trees are primarily Export Zones. responsible to it. • In December 2004, an internal peer Related Information review conducted by the Department • Earlier, the satellite images revealed of Commerce concluded that the that 60% of the shola-grassland notified AEZs had not been able to landscape has changed; almost 40% achieve the intended objectives. (516 km2) of native high-elevation • It was decided that there will be no grasslands have disappeared. creation of new AEZs unless there • Most of this loss occurred on the were strong and compelling reasons. mountain tops of the Nilgiri, Palani • No new AEZs have been set up after and Annamalai hill ranges, which 2004. comprise more than half of the Ghat’s • All the notified AEZs have completed shola-grassland ecosystems. their intended span of 5 years and • It's primarily due to the expansion of have been discontinued. exotic trees (pine, acacia, and RBI launches SRPHi eucalyptus). • The Reserve Bank of India (RBI) has • Later in 2018, scientists decided to launched Survey on Retail Payment study how shola-grasslands across Habits of Individuals (SRPHi). the Ghats – from the Baba Budan Hills • The Survey will capture payment in Karnataka to Tamil Nadu's habits of individuals in cities of Delhi, Ashambu Hills – changed in extent Mumbai, Kolkata, Chennai, Bengaluru between 1972 and 2017. and Guwahati. • Broadly, shola-grassland ecosystems Related Information in Tamil Nadu showed the highest • Sigma Research & Consulting Pvt Ltd rates of invasion. has been engaged by RBI to conduct • The immediate reaction should be the fieldwork of the survey. taken to remove all exotics including • Around 6000 individuals from various mature plantations from grasslands. socio-economic backgrounds across Agri Export Zones 7 www.gradeup.co
six cities would be covered under the report to All India Council for survey. Technical Education (AICTE) which is • The survey seeks qualitative headed by BVR Mohan Reddy. responses from individuals on their Recommendation of the Committee payment habits. • The committee has advised the AICTE • The findings of the survey will provide not to permit the establishment of insights into awareness and usage new colleges from 2020. habits of digital payment products. • It has recommended AICTE to review Kerala women form ‘wall’ to uphold the creation of new capacity every two gender equality against Sabrimala years. protests • It recommends that institutes should • Numbers of women from across be encouraged to convert current Kerala formed a 620-km long capacity in traditional disciplines to Women’s Wall, that stretched from emerging new technologies. Kasargod in northern Kerala to the • The committee has urged the AICTE southernmost district of to introduce undergraduate Thiruvananthapuram, to uphold engineering programmes exclusively gender equality and renaissance for following disciplines. values. 1. Artificial intelligence • This was a state-sponsored move 2. Blockchain done in the backdrop of protests in Sabarimala due to Supreme Court’s 3. Robotics decision to all women to pray at the 4. Quantum computing Ayyappa shrine. 5. Data sciences Krishak Bodhu Scheme AICTE • West Bengal government announced • It is a national level Apex Advisory Krishak Bondhu Scheme for the Body to conduct a survey on the welfare of Farmer. facilities available for technical • Under this scheme, if a farmer aged education. between 18 to 60 years dies a natural • It has been given a statutory status or unnatural death, the state by an Act of Parliament in 1987. government will pay his family Rs 2 • It promotes the development of lakh. technical education in India in a coordinated and integrated manner. Related Information • It grants approval for starting new • Other initiative was taken by West technical institutions, for the Bengal Government in which farmers introduction of new courses and for would get Rs 2,500 twice a year for variation in intake capacity in growing a single crop on one acre of technical institutions. land. • It is headquartered in New Delhi. • The West Bengal government has Madhya Pradesh to get 'spiritual already waived tax and cess on department' agricultural land to help farmers in • The Madhya Pradesh Government is distress. going to create an Adhyatmik Vibhag • Recently, the Odisha government also (spiritual department) by merging approved financial aid to farmers several existing departments. through ‘Krushak Assistance for • The proposed Adhyatmik Vibhag Livelihood and Income Augmentation’ (Spiritual Department) going to be (KALIA) scheme. formed by merging Dharmik Nyas B V R Mohan Reddy committee on Evam Dharmasv Department Technical Education submitted a (Religious Trust and Endowment report to AICTE Department), Anand Vibhag • A government committee on (Happiness Department) in addition Technical Education submitted its to the Directorate of Religious Trust 8 www.gradeup.co
and Endowment, Madhya Pradesh and global environmental benefits and Teerth Evam Mela Pradhikaran and conservation of critical biodiversity Rajya Anand Sansthan. and forest landscapes. • The 'Anand Vibhag' (Department of How this project benefit for India? Happiness) set up by the government, • The project will support a first in the country would be harmonization between India’s incorporated into this new agricultural and environmental sector department. priorities and investments so that the India records 377 mine deaths in three achievement of national and global years (2015-2017) environmental benefits can be fully • Coal mines have accounted for the realized without compromising India’s highest number of casualties due to ability to strengthen rural livelihoods accidents in mines. Of the 377, more and meet its food and nutrition than half, 210, were killed in coal security. mines. Related Information • These figures were provided by the Global Environment Facility (GEF) Labour and Employment Ministry. • It was established on the eve of the • Jharkhand, which recorded 69 deaths 1992 Rio Earth Summit to help tackle in the three years, has accounted for our planet’s most pressing the highest death of coal mine environmental problems. workers in accidents inside mines. • The GEF unites 183 countries in • Goda in Jharkhand witnessed one of partnership with international the biggest open cast mine accidents institutions, civil society organizations in 2016 when 23 workers died in (CSOs), and the private sector to December that year. address global environmental issues while supporting national sustainable Govt launches "Green-Ag", GEF-assisted development initiatives. project The GEF also serves as a financial • The Government of India launched a mechanism for the following GEF assisted project, namely Green– conventions: Ag: Transforming Indian agriculture • CBD Convention on Biological for global environment benefits and Diversity. the conservation of critical • United Nations Framework biodiversity and forest landscapes in Convention on Climate Change collaboration with the Food and (UNFCCC) Agriculture Organization (FAO). • UN Convention to Combat • It was launched in high-conservation- Desertification (UNCCD) value landscapes of five states, • Stockholm Convention on Persistent namely Madhya Pradesh (Chambal Organic Pollutants (POPs) landscape), Mizoram (Dampa • Minamata Convention on Mercury landscape), Odisha (Similipal Centre to introduce Commercial Space landscape), Rajasthan (Desert Activities Bill in Budget session National Park landscape) and Features of the Space Activities Bill, Uttarakhand (Corbett-Rajaji 2017 landscape) in September 2018. • The Space Activities Bill, 2017 is • The project seeks to mainstream aimed at regulating space activities to biodiversity, climate change, and ensure peaceful exploration and use sustainable land management of outer space. objectives and practices into Indian • The important features of the bill are: agriculture. (i) The bill provides for a non- • The overall objective of the project is transferable license to be provided by to catalyze the transformative change the Central Government to any person of India’s agricultural sector to carrying out commercial space support the achievement of national activity. 9 www.gradeup.co
(ii) The bill empowers the Central • According to Clause 6 Government to formulate the - “Constitutional, legislative and appropriate mechanism for licensing, administrative safeguards, as may be eligibility criteria, and fees for the appropriate, shall be provided to license. protect, preserve and promote the (iii) The Central Government would be cultural, social, linguistic identity and required to maintain a register of all heritage of the Assamese people”. space objects (any object launched or • For recognition as citizens, the Accord intended to be launched around the sets March 24, 1971, as the cutoff. earth) and develop space activity Who are the “indigenous people” as plans for the country. described by Mahanta, or “Assamese (iv) The Central Government would people” as mentioned in Clause 6? ensure safety requirements and • Most stakeholders agree that the NRC supervise the conduct of every space of 1951 should be taken as the cutoff activity of India and investigate any for defining “Assamese people” incident or accident in connection with eligible for the proposed safeguards. the operation of space activity. • The committee included three AASU (v) The bill provides for penal members including Bhattacharya and provisions if any person undertakes then president Sarbananda Sonowal, any commercial space activity without now Assam Chief Minister. authorization they shall be punished • The 1951 NRC as the basis for with imprisonment up to 3 years or defining “Assamese people” was also need more than Rs 1 crore or both. recommended in a report prepared by (vi) The bill requires licensed entities former Assembly Speaker Pranab to carry out operations in a manner Gogoi following consultation with 53 that prevents the contamination of organizations representing various outer space or damage to the earth’s communities. environment. Would that not be different from the Problems with the Bill cutoff for the ongoing NRC update? • The Bill does not address space-based • The update is based on March 24, activities separately. 1971, which defines citizenship. • The definition puts every space object Clause 6 relates to “Assamese under its ambit, meaning even people”. hardware that carries GPS receivers • Should 1951 be accepted as the could require a license. cutoff, it would imply that those who • The Bill could also affect navigation migrated between 1951 and 1971 services provided by companies such would be Indian citizens, but would as Google Maps, Ola and Uber. not be eligible for safeguards meant Assam Accord: Fine line between ‘Indian for “Assamese people”. citizen’ and ‘Assamese’ What are these safeguards? • The Union Cabinet cleared a proposal • The proposed committee would seek to set up a high-level committee to to define Mahanta views “safeguards” look into the implementation of as reservation of electoral seats, and Clause 6 of the Assam Accord of 1985. land and political rights. Why is Clause 6 significant, especially in • It also includes rights over natural the context of the NRC and the resources and protection of culture of Citizenship (Amendment) Bill, 2016? the indigenous people. What is Clause 6? What will the proposed committee do? • It is a part of the Assam Accord that • The committee would examine the came at the culmination of a effectiveness of actions since 1985 to movement against immigration from implement Clause 6. Bangladesh. • It would hold discussions with all stakeholders and assess the quantum of reservation of seats in the 10 www.gradeup.co
Assembly and local bodies for • Aided with a smartphone app, the kit Assamese people. can help ensure that milk is consumed • It will also assess the steps required before it turns too sour. to protect Assamese and other How does this sensor work? indigenous languages of Assam, • A milk enzyme, Alkaline Phosphatase reservation in state government jobs, is considered an indicator of milk and other measures. quality because its presence even Parliament approves proclamation of after pasteurization indicates the Presidents' rule in J&K presence of microbes that may not • The Parliament approved the have been rendered inactive with proclamation of President's rule in pasteurization. Jammu and Kashmir, with the Rajya • Researchers used ordinary filter paper Sabha giving its nod. to prepare the detector. President Rule • The filter paper was cut into small • In India, President's rule is the discs and impregnated with chemical suspension of state government and probes that preferentially react with imposition of direct Central ALP. Government rule in a state. • The ‘probes’ used are antibodies that Under Article 356 of the Constitution • specifically bind to ALP. When ALP of India, in the event that a state comes into contact with the probe, it government is unable to function turns white paper disc into a coloured according to constitutional provisions, one. the Central government can take • The colour change on paper discs is direct control of the state machinery. then photographed by a smartphone • Subsequently, executive authority is camera and images processed to exercised through the centrally obtain corresponding colour values. appointed governor, who has the authority to appoint other • These values are then compared with administrators to assist them. standard data stored in the phone. Case of Jammu and Kashmir • Thus not only the presence of ALP • In the state of Jammu and Kashmir, could be detected but the amount of failure of governmental function it in milk could also be measured. results in Governor's rule, imposed by Some Organisations Banned Under invoking Section 92 of the UAPA Constitution of Jammu and Kashmir. • In exercise of the powers vested in • The state's governor issues the the Central Government under proclamation, after obtaining the Section 3 of the Unlawful Activities consent of the President of India. (Prevention) Act, 1967 (UAPA), the • If it is not possible to revoke Government, on being satisfied that Governor's rule within six months of the organizations have become imposition, the President's Rule under Unlawful, has declared the following Article 356 of the Indian Constitution Organizations as Unlawful is imposed. Associations during the last three Note: In the 1994 Bommai case, the years: Supreme Court of India has restricted (i) Islamic Research Foundation (IRF) arbitrary impositions of President's rule. (ii) National Liberation Front in Tripura (NLFT) A paper sensor that can detect freshness (iii) Tripura Tiger Forum (ATTF) of milk • In exercise of powers vested in the • Scientists at IIT, Guwahati, have Central Government under Section 35 developed a simple paper kit that can of UAPA, the Government on being test the freshness of milk and tell how satisfied that the organization is well it has been pasteurized. involved in terrorism, has added the following organizations to the First 11 www.gradeup.co
Schedule of UAPA during the last Natal Diagnostic Techniques three years: (PC&PNDT) Act, Pre-Natal/ Post Natal (i) Al-Qaida in Indian Sub-continent care of the mother, improve (AQIS) and all its manifestations enrolment of girls in schools, (ii) Islamic State in Khorasan Province community engagement/ training/ (ISKP)/ ISIS Wilayat Khorasan/ awareness generation etc. Islamic State of Iraq and the Sham- Asia Reassurance Initiative Act (ARIA) Khorasan (ISIS-K) and all its • U.S. President Trump signed into law manifestations the Asia Reassurance Initiative Act (ii) Khalistan Liberation Force and all (ARIA). its manifestations • The act “establishes a multifaceted First LNG import terminal of IOC U.S. strategy to increase U.S. commissioned in Tamil Nadu security, economic interests, and values in the Indo-Pacific region. • Indian Oil Corp (IOC), the nation’s • Specifically, the ARIA will authorize biggest oil firm, announced $1.5 billion in spending for a range of commission of its first Liquefied U.S. programs in East and Southeast Natural Gas (LNG) import terminal in Asia and “develop a long-term Ennore, Tamil Nadu. strategic vision and a comprehensive, • This is the first LNG import terminal multifaceted, and principled United IOC has built on its own and will States policy for the Indo-Pacific become operational by the end of region, and for other purposes.” January 2019. • ARIA draws attention to U.S. relations • IOC holds 95 percent stake in the with China, India, the ten-member Ennore LNG import terminal and Tamil states of the Association of Southeast Nadu Industrial Development Asian Nations (ASEAN), and Northeast Corporation (TIDCO) has 5 percent. Asian allies Japan and South Korea. • The firm is also working on laying • Additionally, the act addresses U.S. natural gas pipeline originating from policy toward North Korea. the Ennore terminal to Nagapattinam • The law calls for the president to in Tamil Nadu via Puducherry. “develop a diplomatic strategy that • Branch pipelines will be laid in includes working with United States Madurai, Tuticorin, and Bengaluru to allies and partners to conduct joint meet the LNG demand. maritime training and freedom of All the 640 districts of the country navigation operations in the Indo- covered under Beti Bachao Beti Padhao Pacific region, including the East (BBBP) scheme China Sea and the South China Sea, Beti Bachao Beti Padhao (BBBP) in support of a rules-based • Launched by the PM on January 22, international system benefiting all 2015 at Panipat, Haryana. countries.” • Objective- Improve Child Sex Ratio, Panj Tirath: An Ancient Hindu Religious Protection, and education of girl child. Site • Three ministries are involved which • The provincial government of Khyber are -Ministries of Women and Child Pakhtunkhwa in Pakistan has declared Development, Health & Family the ancient Hindu religious site of Panj Welfare and Human Resource Tirath in Peshawar as national Development. heritage. • Initially, it was focussed on 100 • The site’s name has its origins in the districts with low Child Sex Ratio. five pools of water that are part of the • The key elements of the scheme property, which also has a temple. include nation-wide awareness and Related Information advocacy campaign and multisectoral • It is believed that mythical king Pandu action. from the epic Mahabharata bathed in • Multi-sectoral action includes effective the pools during the month of Kartik enforcement of Pre-Conception & Pre- 12 www.gradeup.co
and worshipped under the date palm Free Trade Area, as well as with the trees in the area for two days. rest of Southeast Asia. • The site was allegedly damaged National Highways Authority of India during the Afghan Durrani dynasty era (NHAI) in 1747 and was restored by local • It was established through the NHAI Hindus during the Sikh era in 1834. Act, 1988. • The Khyber Pakhtunkhwa government • In February 1995, it was formally announced a fine of 2 million Pakistani made an autonomous body. rupees and five years’ imprisonment • It is a nodal agency of the Ministry of for anyone found guilty of damaging Road Transport and Highways. the historic site. • It is responsible for the development, India-Myanmar-Thailand Trilateral management, operation and Highway: Boost To Act East maintenance of National Highways • Central government allocated fund for Andhra unveils second largest rock art the India-Myanmar-Thailand Trilateral trove Highway. • Andhra Pradesh’s second largest • The 1360 km long India-Myanmar- Petroglyph site, containing about 80 Thailand Trilateral Highway is an petroglyhs, has been discovered at initiative pertaining to India, Mekala Benchi in Kurnool district. Myanmar, and Thailand. • These petroglyphs, or rock carvings, • India is undertaking construction of underscore Kurnool’s importance as a two sections of the Trilateral Highway major site of Neolithic settlements in in Myanmar namely. south India. (i) construction of 120.74 km Kalewa- Related Information Yagyi road section • Kandanathi, with 200 petroglyphs, is (ii) construction of 69 bridges along also in Kurnool district. with the approach road on the 149.70 • While Mekala Benchi has petroglyphs km Tamu-Kyigone-Kalewa (TKK) road dating back from the Neolithic to the section. Megalithic period, Kandanathi • The above mentioned both the carvings range from the prehistoric to projects are being funded by the the historic period. Government of India under grant Petroglyph assistance to the Government of • Petroglyphs are images created by Myanmar. removing part of a rock surface by Related Information incising, picking, carving, or abrading, • The highway is constructed with the as a form of rock art. help of NHAI (It is a first international • The term petroglyph should not be project of NHAI). confused with petrograph, which is an • The project aims to provide seamless image drawn or painted on a rock vehicular movement for enhancing face. trade, business, health, education and Scientists unearth Asia's first fossil tourism between Indian, Myanmar Dioscorea yam leaf and Thailand. • A quaint fossilised leaf is one of the • It is being funded by the Ministry of most recent finds throwing light on External Affairs, India. India's past. India-Myanmar-Thailand (IMT) highway • The leaf fossil is the first of Dioscorea • The IMT Trilateral Highway is a yams from Asia and hints at a regional highway being constructed Gondwanan origin to these plants. under India’s Act East policy to boost • These fossils are found when the connectivity in the region. Scientist dig in the Eocene-era (38-56 • It will connect Moreh in India with Mae million years ago) Gurha lignite mine Sot, Thailand via Myanmar. in Bikaner in western Rajasthan, they • The highway is expected to boost obtained two well-preserved fossils of trade and commerce in ASEAN–India large leaves. 13 www.gradeup.co
Related Information • It is an organization under • The team named their new find Government of India to recruit staff "Dioscorea eocenicus": the first ever for various posts in the various Dioscorea fossil recorded from Asia. Ministries and Departments of the • Currently, species of Dioscorea in Government of India and in India are found in the humid, tropical Subordinate Offices. forests of the country. • The commission is an attached office • Other fossil plants observed in the of the Department of Personnel and mine also suggest this historical Training (DoPT) which consists of climate in the area, which is now dry Chairman, two Members and a and consists of desert vegetation. Secretary-cum-Controller of Masked dance tradition rises from near Examinations. extinction • Every year SSC conducts the SSC • Cambodia’s centuries-old tradition of Combined Graduate Level masked dance was nearly wiped out Examination for recruiting non- by the Khmer Rouge’s “Killing Fields” gazetted officers to various regime. government jobs. • Lakhon Khol, nearly wiped out by the Swachh Sundar Shauchalaya Khmer Rouge regime. • The Ministry of Drinking Water and • Recently Lakhon Khol of Combodia Sanitation has launched a month-long and Khon from Thailands listed by campaign, “Swachh Sundar UNESCO as an intangible cultural Shauchalaya” that commenced on 1st heritage. January. Related Information • It is an effort to promote ownership • The all featuring dancers wearing and sustained usage of toilets and elaborate painted masks depicting the also provide a facelift to the crores of Ramayana. toilets built under the Swachh Bharat • In Cambodia, the art form is still Mission. struggling to recover from the Khmer • The campaign comprises a unique Rouge, under whose genocidal 1975- Contest, under which, households are 79 rule at least 1.7 million people, being mobilised to paint and decorate including artists, dancers and writers, their toilets. died, mostly from starvation, • It will be spearheaded by Gram overwork, disease, execution or Panchayats and coordinated by torture. district administrations. MPs’ panel proposes legal status for SSC • The campaign will involve rural • A Parliamentary Standing Committee communities in Gram Panchayats (PSC) headed by Bhupender Yadav across the country. has recommended that the Centre • Individual households, Gram accord statutory status to the Staff Panchayats, and Districts will be Selection Commission (SSC). awarded on the basis of a number of • SSC is one of the largest recruitment toilets painted and the quality and agencies in the country. creativity of their work. Why this status ? Related Information • The Union Public Service Commission • The sanitation coverage in rural India has (UPSC) and all State Public Service already crossed 98%, with over 9 crore Commissions either have toilets built under Swachh Bharat Mission constitutional or legal status. The SSC (Grameen) since its launch. is the only such organisation that • Access to toilets is an important step performs similar functions on a much towards the adoption of safe larger scale, but does not enjoy sanitation practices and an Open statutory status. Defecation Free (ODF) nation. Staff Selection Commission About Swachh Bharat Mission
14 www.gradeup.co
• Swachh Bharat Mission (SBM) is a Smartphone interred in ‘Techno’ time nation-wide campaign in India for the Capsule period 2014 to 2019. • A Time Capsule with items • The mission has two thrusts: Swachh representing today’s technology and Bharat Abhiyan ("gramin" or 'rural'), India’s scientific prowess was buried which operates under the Ministry of by Nobel Laureates Avram Hershko Drinking Water and Sanitation; and from Israel and F.Duncan M. Haldane Swachh Bharat Abhiyan ('urban'), from the USA on the occasion of the which operates under the Ministry of on-going 106th Indian Science Housing and Urban Affairs. Congress at Lovely Professional • Its aims to clean up the streets, roads University, Jalandhar. and infrastructure of India's cities, • The Time Capsule contains 100 items towns, and rural areas. that represent modern-day • The objectives of Swachh Bharat technology as experienced in India include eliminating open defecation which was buried at a depth of 10 feet through the construction of and will remain buried for the next household-owned and community- 100 years owned toilets and establishing an Related Information accountable mechanism of monitoring Indian Science Congress Association toilet use. • Indian Science Congress Association Its mission aims to achieve an "open- • (ISCA) is a premier scientific defecation free" (ODF) India by 2 organization of India. October 2019, the 150th anniversary • Its headquarters at Kolkata, West of the birth of Mahatma Gandhi. Bengal. Note: The mission will also contribute to India reaching Sustainable Development • The Association was formed with the Goal 6 (SDG 6), established by the UN in following objectives: 2015 (i) To advance and promote the cause Menstrual Hygiene Schemes of science in India. • Health Ministry addressed the need (ii) To hold an annual congress at a for menstrual hygiene among suitable place in India. adolescent girls residing primarily in (iii) To publish such proceedings, rural areasunder the Menstrual journals, transactions and other Hygiene Scheme. publications as may be considered • The funds are provided to States/UTs desirable. through National Health Mission for (iii) To secure and manage funds and decentralized procurement of sanitary endowments for the promotion of napkins packs. Science including the rights of This scheme encompasses the following: disposing of or selling all or any • Increasing awareness among portion of the properties of the adolescent girls on Menstrual Hygiene Association. • Improving access to and use of high Rajya Sabha passes a Bill to scrap No- quality sanitary napkins by adolescent Detention Policy for Children girls in rural areas. • The Bill, which was passed by the Lok • Ensuring safe disposal of Sanitary Sabha in July 2018, seeks to amend Napkins in an environmentally the Right to Education Act, 2009 to friendly manner. abolish the no-detention policy in • Provision of funds to ASHAs to hold a schools. monthly meeting with adolescents to • The earlier Right of Children to free discuss issues related to menstrual and Compulsory Education Bill hygiene. prohibited schools to detain students Note: ASHAs across the country are trained till they complete elementary and play a significant role in the promotion of education even on account of under- use and distribution of the sanitary napkins. performance. 15 www.gradeup.co
• The aim was to decrease the drop-out Andhra Pradesh unveils schemes for rates in school and to reduce the marginalized Brahmins emphasis on year-end examinations. • Andhra Pradesh unveiled various • This was replaced with continuous welfare scheme for the marginalized evaluation of students’ progress and economically backward Brahmins throughout the year. through AP Brahmin Welfare Provision of the bill Corporation. • States now have the power to decide • Andhra Pradesh is the first state of the to continue with the no-detention country which has established a policy. Brahmin Corporation. • States can choose to conduct an • The aims Brahmin Corporation to help examination either at the end of poor people of Brahmin families by classes 5 and 8, or both. providing financial assistance for • Students who are unable to clear the education, coaching, examinations will receive additional entrepreneurship, skill development, instructions and the opportunity to and welfare and culture. appear for a re-examination within • The scheme includes such as a two months of the declaration of the distribution of Cars to the result. Unemployed Brahmin youths, loans, • If the students still do not manage to and subsidies. clear the exam, the state may decide Regulation of Functions of MSMEs to detain them. • Ministry of Micro, Small and Medium No child shall be expelled from a • Enterprises has introduced a various schooltill the completion of initiative to promote the Ease of Doing elementary Education. Business and also including the online No- Detention Policy filing of Udyog Aadhaar Memorandum As per the No-Detention Policy under • (UAM). the Right to Education Act, no student • The Ministry has also taken the can be failed or expelled from school following steps: till the completion of elementary MSME SAMADHAAN Portal- for education covering classes 1 to 8. empowering micro and small • All the students up till Class 8 will entrepreneurs across the country to automatically be promoted to the next directly register their cases relating to class. delayed payments. • The essence of the policy is that MSME SAMBANDH Portal- to help in children should not be ‘failed’ and monitoring the implementation of detained up to Class 8. public procurement policy for micro Mission Shakti Scheme and small enterprises. • Odisha Chief minister announced MSME SAMPARK Portal – A digital interest-free loan up to Rs 3 lakh for platform wherein jobseekers (passed the women self-help group members out trainees/students of MSME (SHGs), a move that would benefit Technology Centres) and recruiters around 70 lakh women associated get connected. with six lakh groups. Digital Payments- to pass on the benefits of the schemes of Ministry of • Mission Shakti is an initiative started MSME through the digital payment in 2001 aiming at economic gateway. empowerment of women by forming SHGs and providing them with loans Related Information through banks at a low-interest rate • For regulating the functions of the MSMEs, the Government has enacted to take up various livelihood activities. the Micro, Small and Medium • It encouraged entrepreneurship Enterprise Development (MSMED) through SHGs and is now empowering Act, which is applicable to all the them digitally to grow and prosper. States and Union Territories. 16 www.gradeup.co
FASTtag • The Ministry of Tribal Affairs is • A MoU for sale of FASTags through implementing a scheme namely petrol pumps of leading Oil Marketing “Development of Particularly Companies was signed between Vulnerable Tribes Groups (PVTG)” for Indian Highways Management the welfare of PVTGs. Company Limited - IMHCL and leading • The scheme is flexible as it enables Oil Marketing Companies (OMCs) like the States/Union Territory(UT) to BPCL, HPCL, and IOCL. focus on areas that they consider is • This will help expand the FASTag relevant to PVTGs and their socio- program’s distribution network which cultural environment while retaining is presently active at selected bank the culture and heritage of the branches. community by adopting habitat • This is a bank-neutral FASTag which development approach and can be linked to customers’ choice of intervening in all spheres of their bank accounts. social and economic life. • This not only provides flexibility and • Housing, land distribution, land convenience to the FASTag users but development, agricultural is also user-friendly as there will be no development, animal husbandry, requirement of fulfilling KYC construction of link roads, culture, obligations. installation of non-conventional • Two FASTag mobile apps were also sources of energy for lighting launched. purpose, social security or any other The My FASTag Customer App has innovative activity meant for the the distinction of real-time recharge of comprehensive socio-economic any FASTag through UPI, it links development of PVTGs. IHMCL FASTag with customer’s bank PVTG account and there is no need to install • 75 tribal groups have been multiple banks applications. categorized by Ministry of Home In the FASTag Point of Sales App Affairs as Particularly Vulnerable - it is possible to create and manage Tribal Groups (PVTG)s. distribution partners, as also to allow • PVTGs reside in 18 States and UT of sales via petrol pumps. A&N Islands. Related Information Cabinet approves 10% reservation for FASTag the economically weaker section in • FASTag is an electronic toll collection general category system in India, operated by the • Central government approved percent National Highway Authority of India reservation for economically weaker (NHAI). people among the general category in • It employs Radio Frequency government jobs and educational Identification (RFID) technology for institutions. making toll payments directly from • The approved quota is intended for all the prepaid or savings account linked those communities/classes that do to it. not come under 50 per cent quota. • It is affixed on the windscreen of the • It will be for all communities - for the vehicle and enables to drive through economically backwards among toll plazas without stopping for Hindus, Muslims, Christians etc. transactions. • This will not affect the reservation for • The tag can be purchased from official SCs, STs and OBCs. Tag issuers or participating Banks Eligibility criteria for reservation: Note:- National Electronic Toll Collection - • To be eligible for general category NETC programme, it is proposed to include all reservation, the person can at max state/city toll plazas under one umbrella. possess: Heritage and Culture of Particularly (i) Annual income below 8 lakh Vulnerable Tribes Groups (ii) Agriculture land below 5 acre 17 www.gradeup.co
(iii) Residential house below 1000 sq Education and Literacy, which deals ft. with primary, secondary and higher (iv) Residential plot below 100 yards secondary education, adult education in the notified municipality and literacy, and (v) Residential plot below 200 yards in (ii) The Department of Higher non notified municipality area Education, which deals with a Related Information university education, technical • To implement the decision, the education, scholarship etc. government will require to push for a Rail Kumbh Seva’ mobile app Constitutional amendment to increase • North Central Railway launched a Rail the limit of quota from a maximum of Kumbh Seva Mobile App that will 50 per cent to 60 per cent. help those arriving in Allahabad for • Articles 15 and 16 of the Constitution the Kumbh Mela starting from January will have to be amended for 15 to navigate through the city and implementation of the decision. the mela grounds. • Articles 15, 16 falls under the • The ‘Rail Kumbh Seva Mobile App’ will category of Fundamental Rights in the also provide information regarding all Part III of the Indian Constitution. the ‘Mela special’ trains that will be • Article 15 states that the State shall run during the period. not discriminate against any citizen on • Through this app, the user will not grounds only of religion, race, caste, only get to know their current location sex, place of birth or any of them. but will also be able to reach to all Also, nothing in this article shall railway stations, the mela zone, major prevent the state from making any hotels, bus stations, and other special provisions for women, children facilities within Allahabad city. or any socially and educationally • It will also provide information about backward classes. passenger amenities available at the • Article 16 guarantees the Equality of stations -- parking lots, refreshment opportunity in matters of public rooms, waiting rooms, book stall, food employment with no discrimination plaza, ATMs and train inquiry. being done on basis of religion, race, Fugitive Offender caste, sex, place of birth. • A special court in Mumbai declared HRD introduces 70-point grading index absconding liquor baron Vijay Mallya to assess the quality of school education a fugitive economic offender (FEO). in states • Mallya has become the first businessman • The Ministry of Human Resource to be declared FEO under the provisions of Development has introduced a 70-point the new Fugitive Economic Offenders Act grading index to assess the quality of which came into existence in August 2018. school education offered by states. The Fugitive Economic Offender Bill 2018 • In this grading system, the states will • The Bill allows for a person to be be marked out of 1,000 scores on 70 declared as a fugitive economic parameters. offender (FEO) if: • It will help to get the correct picture (i) an arrest warrant has been issued of where every state stands. There against him for any specified offences will be a fair competition to improve where the value involved is over Rs each other's performances. 100 crore, and Related Information (ii) he has left the country and refuses Ministry of Human Resource Development to return to face prosecution. • The Ministry of Human Resource • To declare a person an FEO, an application Development, formerly the Ministry of will be filed in a Special Court (designated Education is responsible for the under the Prevention of Money- development of human resources in India. Laundering Act, 2002) containing details • The Ministry is divided into two of the properties to be confiscated, and departments: any information about the person’s (i) The Department of School whereabouts. 18 www.gradeup.co
• The Special Court will require the • Post-landfall outlook- Red person to appear at a specified place The DNA Technology (Use and at least six weeks from the issue of Application) Regulation Bill - 2019 notice. • The Lok Sabha passed “The DNA • Proceedings will be terminated if the Technology (Use and Application) person appears. Regulation Bill - 2019”. The Bill allows authorities to • The Bill has been formulated provisionally attach properties of an recognizing the need for regulation of accused, while the application is the use and application of pending before the Special Court. Deoxyribonucleic Acid (DNA) • Upon declaration as an FEO, technology, for establishing an properties of a person may be identity of missing persons, victims, confiscated and vested in the central offenders, under trials and unknown government, free of encumbrances deceased persons. (rights and claims in the property). • The purpose of this Bill is to expand • Further, the FEO or any company the application of DNA-based forensic associated with him may be barred technologies to support and from filing or defending civil claims. strengthen the justice delivery system Cyclone Pabuk of the country. • The India Meteorological Department The key components of this Bill include: (IMD) has issued an Orange alert for • establishment of a DNA Regulatory the Andaman Islands as cyclonic Board storm Pabuk is moving north- • accreditation of DNA laboratories northwestwards. undertaking DNA testing, analyzing, • It is originated over the Gulf of etc.; Thailand and neighbourhood. Related Information • Establishment of the National and • The cyclone warnings are issued to Regional DNA Data Banks, as state government officials in four envisaged in the Bill, will assist in stages. forensic investigations. • The First Stage warning known as Related Information "PRE-CYCLONE WATCH" issued 72 DNA Profiling (DNA fingerprinting, DNA hours in advance contains an early testing, or DNA typing) warning about the development of a • DNA profiling is the process where a cyclonic disturbance in the north Indian specific DNA pattern, called a profile, Ocean, its likely intensification into a is obtained from a person or a sample tropical cyclone and the coastal belt likely of bodily tissue. to experience adverse weather. • The Second Stage warning known • Even though we are all unique, most as "CYCLONE ALERT" is issued at of our DNA is actually identical to least 48 hrs. other people’s DNA. • The Third Stage warning known • However, specific regions vary highly as "CYCLONE WARNING" issued at among people. These regions are least 24 hours in advance of the called polymorphic. expected commencement of adverse • Differences in these variable regions weather over the coastal areas. between people are known as • The Fourth Stage of warning known polymorphisms. as "POST LANDFALL OUTLOOK" is issued • Each of us inherits a unique at least 12 hours in advance of the combination of polymorphisms from expected time of landfall. our parents. Different color codes used at the • DNA polymorphisms can be analyzed different stages of the cyclone warning to give a DNA profile. bulletins • Cyclone Alert- Yellow Short tandem repeats method for DNA • Cyclone Warning-Orange Profiling 19 www.gradeup.co
• One of the current techniques for DNA existing in environmental conditions profiling uses polymorphisms called favorable for hydrate formation. short tandem repeats. • CO2 hydrate is thermodynamically • Short tandem repeats (or STRs) are more stable than methane hydrate. regions of non-coding DNA that So if methane hydrate has remained contain repeats of the same stable for millions of years under the nucleotide sequence. sea bed, it would be possible to • For example, sequester gaseous CO2 as solid GATAGATAGATAGATAGATAGATA is hydrate under the sea bed. an STR where the nucleotide Related Information sequence GATA is repeated six times. Carbon sequestration • It is a process involved in carbon • STRs are found at different places or capture and the long-term storage of genetic loci in a person’s DNA. atmospheric carbon dioxide or other • To produce a DNA profile, scientists forms of carbon to mitigate or defer examine STRs at ten, or more, genetic global warming. loci. These genetic loci are usually on Government plans to rename Indian different chromosomes. Forest Service Application of DNA Profiling • The Centre has proposed another pro- • Identify the probable origin of a body tribal measure – renaming of the fluid sample associated with a crime Indian Forest Service as Indian or crime scene Forest and Tribal Service. • Reveal family relationships • The Department of Personnel and • Identify disaster victims Training (DoPT) has initiated an inter- ministerial consultation note to IIT Madras team produces gas hydrates rename the service and also train its under ‘space’ conditions cadre to be more receptive towards • Researchers at Indian IIT Madras tribals and forest dwellers. have experimentally shown that Related Information methane and carbon dioxide (CO2) • The recommendations to change the can exist as gas hydrates at name of Indian Forest Service were temperatures and pressures seen in made by the National Commission for the interstellar atmosphere. Scheduled Tribes (NCST) in its annual • Gas hydrates are formed when a gas report. such as methane gets trapped in well- The NCST had made the following defined cages of water molecules observations in this regard: forming crystalline solids. • The NCST highlights the close ties • In terrestrial conditions, gas hydrates between tribals, the forest and forest are formed naturally under the sea ecosystem as a resource base. bed and glaciers under high pressure, • NCST recommends the renaming of low-temperature conditions. the Indian Forest Service into Indian • Methane hydrate is a potential source Forest and Tribal Service in of natural gas. recognition of the close ties between • IIT Madras, in collaboration with GAIL, tribals, the forest and forest is working to recover methane from ecosystem. methane hydrate from the Krishna- • NCST argues that merging forest and Godavari Basin and sequester CO2 tribal welfare administrations will simultaneously. further the participation of ‘tribals’ in forest management.
• The NCST states that renaming will Applications in Sequester of CO2 also engender greater sensitivity on • The carbon dioxide hydrate produced the forest department’s part towards in the lab raises the possibility of the needs of ‘tribal’ communities. sequestering or storing carbon dioxide Indian Forest Service as hydrates by taking advantage of ice 20 www.gradeup.co
• Indian Forest Service (IFoS) is one of Other planet discovered by TESS: Pi the three All India Services of the Mensae b and LHS 3844b. Government of India. TEES Mission • The other two All India Services being • TESS is a NASA Astrophysics Explorer the Indian Administrative Service mission. (IAS) and the Indian Police Service • The objective of the mission is to (IPS). discover planets smaller than Neptune • It was constituted in the year 1966 that transit stars bright enough to under the All India Services Act, 1951 enable follow-up spectroscopic by the Government of India. observations that can provide planet • The British Government had masses and atmospheric constituted the Imperial Forest compositions. Service in 1867. National programme for organic • The main mandate of the service is production the implementation of the National • The Ministry of Industries and Forest Policy in order to ensure the Commerce had initiated the National ecological stability of the country Programme for Organic Production to through the protection and assist the organic producers to tap the participatory sustainable market which is growing steadily in management of natural resources. the both in domestic and export • The highest ranking IFS official in segments. each state is the Head of Forest Forces Related Information (HoFF). National Programme for Organic • Ministry of Environment, Forest and Production (NPOP) Climate Change, (MoEFCC) under the • The Ministry of Industries and Government of India, is the Cadre Commerce is implementing the NPOP Controlling Authority of the Indian since 2001. Forest Service. • The Objectives of the Program are HD 21749b- New Planet o To provide the means of evaluation • The National Aeronautics and Space of certification programme for Administration (NASA) of USA have organic agriculture and products as discovered a new planet. per the approved criteria. • It is the third new planet discovered o To facilitate the certification of by the NASA mission, Transiting organic products in conformity with Exoplanet Survey Satellite (TESS). the prescribed standards. Salient features of the newly discovered o To facilitate certification of organic planet products in conformity with the • The new planet HD 21749b is outside importing countries organic our solar system and orbits a dwarf standards as per equivalence star 53 light years away. agreement between the two • HD 21749b orbits a bright star in the countries or as per importing constellation Reticulum. It has the country requirements. longest orbital period of all the three o To encourage the development of discoveries made by TESS. organic farming and organic • HD 21749b orbits its star in a processing. relatively leisurely 36 days. Note: APEDA is the implementation agency • It is predicted that the surface of the for the NPOP. new planet is likely around 300 Agricultural & Processed Food Products degrees Fahrenheit, which is Export Development Authority (APEDA) relatively cool, given its proximity to • It is an export promotion organization its star, which is almost as bright as under Ministry of Commerce & the sun. Industries, Government of India. Related Information
21 www.gradeup.co
• It was established by the GOI under • Of these, nine falls under Backward the APEDA Act passed by the Class, 37 under More Backward and Parliament in December 1985. 33 under Most Backward categories. • APEDA replaced the Processed Food • Listed under the Backward Class — Export Promotion Council (PFEPC). those who will be restricted to 7% • It is mandated with the responsibility quota — are castes like Yadav, Kurmi of promotion and development of the and Jat. export of its scheduled products. • The panel says that these castes are Animals begin to arrive at Wayanad social, economically and culturally Sanctuary “strong” and have been recruited in • The seasonal migration of wild government jobs more than the ratio animals from wildlife sanctuaries in of their population, while also Karnataka and Tamil Nadu to the enjoying political representation. Wayanad Wildlife Sanctuary (WWS) Sub-categorisation of Other Backward has begun with the rise in Class temperature in the Nilgiri Biosphere. • The Supreme Court in its order • Mammals such as elephants and in Indra Sawhney and others vs. gaurs migrate to the sanctuary from Union of India observed that there is the adjacent Bandipur and Nagarhole no constitutional or legal bar to State national parks in Karnataka and the categorizing backward classes as Mudumalai national park in Tamil backward or more backward and had Nadu are arriving in WWS. further observed that if a State Related Information chooses to do it (sub-categorization), it is not impermissible in law. Wayanad Wildlife Sanctuary • At present, there is a single Central • Wayanad Wildlife Sanctuary is an OBC list, with entries from each State. animal sanctuary in Wayanad, Kerala, People belonging to all of these India. categories can seek reservation from • Established in 1973, the sanctuary is within the single 27% OBC now an integral part of the Nilgiri reservation pie for Central Biosphere Reserve. government jobs and Central • It is bounded by protected area educational institutions. network of Nagarhole and Bandipur of • At present nine States, however, have Karnataka in the northeast, and on already sub-categorized OBCs. the southeast by Mudumalai of Tamil • These are Andhra Pradesh, Nadu. Telangana, Puducherry, Karnataka, Note: Wayanad district has the largest Haryana, Jharkhand, West Bengal, population of Adivasi in Kerala. Bihar, Maharashtra and Tamil Nadu. Uttar Pradesh Government faces heat Central government gives nod for Centre from allies on OBC report for Classical Language in Kerala • The sub-categorization of OBC quota • The Union Government issued its nod in Uttar Pradesh makes allies of allies for setting up the Centre for Classical turning on the heat over the issue Language at the Thunchath amid a clash of interests. Ezhuthachan Malayalam University in • The Social Justice Committee report Tirur. suggests the panel has recommended • Its aim to study and research and a split of the 27% OBC quota into other aspects of Malayalam language three categories. which will prove beneficial in • The panel headed by retired Allahabad implementing various projects for High Court judge Raghavendra Kumar Malayalam language development. has listed 79 sub-castes under the • It was in August 2013 Malayalam was OBC category. declared a classical language. Related Information 22 www.gradeup.co
Official Language NCDC • According to Article 343, the official • It aims to strengthen cooperative language of India should be Hindi in banks at various levels and bring Devanagari script. about financial inclusion of farmers in • As per Eight schedules of the Indian the remote villages of the country. constitution, we have 22 Official • The model includes upgradation and languages. new setup of IT and related Classical Language infrastructure such as Data Centre, • In 2004 it was decided by the Indian Enterprise Network and Security, Core Government to proclaim Indian Banking Solutions (CBS), ATMs, POS, Languages meeting certain e-Lobby, etc. requirements as “Classical • It also includes assistance to Language”. cooperatives in capacity development • Languages so far declared to be through its dedicated Laxmanrao Classical are Tamil, Sanskrit, Inamdar National Academy for Co- Kannada, Telugu, Malayalam, and operative Research & Development. Odia. • The objective behind the Primary Criteria to determine the eligibility of Agricultural Credit Co-operative languages to be considered for Societies (PACS) computerization classification as a “Classical Language”: project is to provide a robust IT • High antiquity of its early platform leading to automation of all texts/recorded history over a period activities of the PACS. of 1500–2000 years. • For this, NCDC has taken a • A body of ancient literature/texts, comprehensive step for strengthening which is considered a valuable of cooperative as Modern Banking heritage by generations of speakers. Units. th • The literary tradition should be 124 Constitution Amendment Bill original and not borrowed from • Lok Sabha passed the Constitution another speech community. (124th Amendment) Bill 2019 to • The classical language and literature provide 10 percent reservation in jobs being distinct from modern, there and educational institutions to may also be a discontinuity between economically backward section in the the classical language and its later general category. forms or its offshoots. • The Bill amends Article 15 of the NCDC model for cooperatives as Modern Constitution, by adding a clause which banking allows states to make "special • Ministry of Agriculture launched the provision for the advancement of any National Cooperative Development economically weaker sections of Corporation (NCDC’s) model for citizens". cooperatives as Modern banking Unit • These "special provisions" would during the 2nd Governing Council relate to "their admission to meeting of National Council for educational institutions, including Cooperative Training (NCCT). private educational institutions, Related Information whether aided or unaided by the NCCT state, other than the minority • It is being responsible for training, educational institutions". awareness and evaluation Related Information programmes of employees working in CONSTITUTION AMENDMENT BILLS the cooperative sector. (Article 368) • The main objective of the NCCT is to • Bills seeking to amend the facilitate the human resource Constitution are of three types:— development in the cooperatives in (1) Bills that are passed by Parliament the country. 23 www.gradeup.co
by a simple majority; • The project was sanctioned by the (2) Bills that have to be passed by Ministry of Tourism in July 2016. Parliament by the special majority • Under this project, the Ministry has prescribed in article 368(2) of the developed facilities like Traditional Constitution; and Healing Centre, Tribal Rejuvenation (3) Bills that have to be passed by Centre, Tourist Information Centre, Parliament by the special majority as Multipurpose Hall, Log Huts, aforesaid and also to be ratified by not Cafeteria, Sound and Light show, less than one-half of the State Souvenir Shops, Solid Waste Legislatures. Management etc. • Bills seeking to amend all other Related Information provisions of the Constitution Swadesh Darshan Scheme including those enumerated in the • It was launched by Union Tourism proviso to article 368(2) are called by Ministry with objective to develop the title ‘Constitution Amendment theme-based tourist circuits in the Bills’. country. • These tourist circuits will be • These Bills can be introduced in either developed on principles of high tourist House of Parliament. value, competitiveness and • If sponsored by a Private Member sustainability in an integrated Motions for the introduction of the manner. Bills are decided by simple majority. • It is 100% centrally funded scheme • In case of any disagreement between for project components undertaken the two Houses of Parliament on a for public funding. Constitution Amendment Bill, there • It also has provision for leveraging cannot be a joint sitting of the Houses voluntary funding under Corporate of Parliament on the Bill as article 368 Social Responsibility (CSR) initiatives of the Constitution requires each of Central Public Sector Undertakings House to pass the Bill by the and corporate sector. prescribed special majority. • The funding of projects under this scheme varies from state to state. Special Majority • It is finalised on basis of detailed • Constitution Amendment Bills have to project reports prepared by be passed in each House of Parliament Programme Management Consultant by a special majority i.e. by a majority (PMC) which is national level of the total membership of that House consultant for implementing the and by a majority of not less than two- scheme. thirds of the members of the House “Web- Wonder Women” Campaign “present and voting”. • The Ministry of Women and Child • The expression “total membership” Development, Government of India, means the total number of members has launched an online campaign, comprising the House irrespective of ‘#www : Web- WonderWomen’. whether there are vacancies or • The Campaign aims to discover and absentees on any account. celebrate the exceptional First Swadesh Darshan project in achievements of women, who have Meghalaya inaugurated been driving positive agenda of social • Meghalaya inaugurated the project change via social media. “Development of North East Circuit: • This Campaign will recognize and Umiam (Lake View) - U Lum acknowledge the efforts of these Sohpetbneng- Mawdiangdiang - meritorious Women. Orchid Lake Resort” implemented • It is a campaign to specially honor and under Swadesh Darshan Scheme of encourage such voices that have in Ministry of Tourism, Government of their own capacity driven a positive India. impact on social media platforms. 24 www.gradeup.co
Related Information • The committee will submit its report • The Campaign invites Entries via in 90 days from its first meeting. Nominations from across the world, as Related Information per the laid out criteria. Digital Payment? • Indian-origin women, working or • Digital payment is a way of payment settled anywhere in the world, are which is made through digital modes. eligible for nomination. • In digital payments, payer and payee Galápagos island gets its first iguanas both use digital modes to send and since Darwin after mass-release receive money. • A group of more than 1,400 iguanas • It is also called electronic payment. has been reintroduced to an island in Jal Charcha the Galápagos archipelago nearly two • Union Minister for Water Resources, centuries after they disappeared from River Development and Ganga there. Rejuvenation released the inaugural • This initiative is a part of an ecological issue of the monthly magazine of the restoration programme. Ministry – Jal Charcha – in New Delhi. • The last recorded sighting of iguanas • The 25-page inaugural issue of Jal in Santiago Island had been made by Charcha is the start of a journey that British naturalist Charles Darwin in aims to engage with the people of 1835. India in informed decision-making at • Land iguana is an herbivore that helps the central level. ecosystems by dispersing seeds and • The magazine is also an effort to bring maintaining open spaces devoid of the best practices in the water sector vegetation. to the national stage and move ahead • IUCN status: Vulnerable in the direction of creating water Related Information consciousness in the minds of the Galápagos Islands people of the country • The Galápagos Islands, part of the Why some snakes are deadlier than Republic of Ecuador, are an others? archipelago of volcanic islands • Scientists have uncovered why the distributed on either side of the venom of some snakes makes them equator in the Pacific Ocean. so much deadlier than others. • The Galapagos archipelago contains • The study tackled this puzzle by unique wildlife and vegetation and is comparing records of venom potency a UNESCO World Heritage site and and quantity for over 100 venomous one of the most fragile ecosystems in snake species, ranging from the world. rattlesnakes, cobras and the tree- Nandan Nilekani to head five-member dwelling boomslangs of Africa to sea RBI panel on digital payments snakes and burrowing asps. • The Reserve Bank of India has Evolutionary standpoint appointed a five-member panel • The Scientist found strong evidence headed by Nandan Nilekani to suggest that venoms have evolved to be more ways to improve digital payments. potent against animals that are • The panel would assess the current closely related to the species that the levels of digital payments in financial snake commonly ate. inclusion. • These results make sense from an • The panels also suggest measures to evolutionary viewpoint as we expect strengthen the safety and security of that evolution will have shaped digital payments. venoms to be more efficient at killing • It provides a road map for increasing the prey. customer confidence to use digital • The research showed that the amount transactions, and suggest a medium- of venom a snake has depends on term strategy for deepening of digital both its size and the environment it payments. lives in. 25 www.gradeup.co
Dosage-dependent • The proposed forum includes: • The big terrestrial species have the o Admission to such a forum should most venom, while smaller tree- be based on accepting generally- dwelling or aquatic species had the recognized principles and shared least. objectives. What is the Concern? o The forum should render • Snakebites are a major health international boundaries inviolable concern worldwide, with 2.7 million and use of force impermissible. cases each year. o Agenda of the forum should be to • Understanding how venom evolves connect people of various member may help us better identify the risks countries cutting across all to humans from different snake traditional boundaries. groups, and also potentially from o The member countries will have to other venomous animals such as follow a set of confidence-building spiders, scorpions, centipedes, and measures. jellyfish. o These measures could include freedom of navigation, assurance Related Information of free flow of energy and Venom protection of the fragile marine • A poisonous substance secreted by ecology of the Gulf. animals such as snakes, spiders, and Related information scorpions and typically injected into GULF COOPERATION COUNCIL (GCC) prey or aggressors by biting or • GCC is a regional intergovernmental stinging. political and economic union India to become world's third largest consisting of all Arab states of the consumer market by 2030: WEF Persian Gulf except Iraq. • World Economic Forum in its latest • Its member states are Bahrain, report said that India is set to become Kuwait, Oman, Qatar, Saudi Arabia, the world's third largest consumer and the United Arab Emirates. market behind only USA and China by • The Charter of the GCC was signed on 2030. 25 May 1981. • The report said consumer spending in RAISINA DIALOGUE: India is expected to grow from 1.5 • The Raisina Dialogue is a multilateral trillion US dollar at present to six conference held annually in New trillion US dollar by 2030. Delhi. • India is currently the world's sixth • It started in the year 2016. largest economy. • It has emerged as India’s flagship • The report titled 'Future of conference on geopolitics and geo- Consumption in Fast-Growth economics. Consumer Market - India' also noted • The conference is hosted by the that growth of the middle class will lift Observer Research Foundation, an nearly 25 million households out of independent think tank, in poverty. collaboration with the Ministry of Persian Gulf Regional Dialogue Forum External Affairs of India. • Iran proposed the Persian Gulf Research Advisory Committee Dialogue forum at Raisina Dialogue • Market regulator Security and conference held in New Delhi. Exchange Board of India (SEBI) has • It aims to address the lingering constituted a ‘Research Advisory conflicts and mistrust in the Gulf committee’. region. • It will assist in formulating policy to • In the backdrop of the continued undertake research relevant for the erosion of the Gulf Cooperation development and regulation of capital Council (GCC), it can bring peace and markets. prosperity in the region. 26 www.gradeup.co
• It will strengthen its research function • State-wise distribution of health and enhance its linkage to expenditure: policymaking. o Mizoram's per capita health • It will comprise of prominent financial expenditure is Rs 5,862 (4.2% of economists and market practitioners. state GDP), almost five times the • It will be headed by Sankar De. Indian average. • In addition, it will maintain databases o Arunachal Pradesh (Rs 5,177) and relevant for capital market regulation Sikkim (Rs 5,126) followed at the top. research also. o At the other end of the spectrum, Related information Bihar spent Rs 491 per capita on SEBI health -less than half the Indian • It is a statutory body under SEBI Act, average- spending 1.33 percent 1992. of its GDP on health. • It regulates the securities and capital o Just above Bihar were Madhya market in India. Pradesh (Rs 716) and Uttar • It was established in 1988. Pradesh (Rs 733). Ganjajal project o While Delhi spends Rs 1,992 per • The Prime minister has launched the capita on health Gangajal project worth Rs 2,980 Related Information: crores in Agra city. National Health Profile (NHP) • It aims to provide better and more • The National Health Profile covers assured water supply. demographic, socio-economic, health • He also laid the foundation stone for status and health finance indicators, an Integrated Command and Control along with comprehensive information Centre for the Agra Smart City on health infrastructure and human project. resources in health. • It will give a push to develop and • CBHI has been publishing National enhance Tourism infrastructure in Health Profile every year since 2005. Agra. Central Bureau of Health Intelligence • It will benefit both the residents and (CBHI) the tourists. • It was established in 1961 by the Act India’s Health Crisis of Parliament on the recommendation • According to the latest National Health of the Mudaliar committee. Profile (NHP) 2018, India is among • It is the Health Intelligence Wing the countries with the least public under Directorate General of Health health spending. Services, Ministry of Health & Family • The government intends to invest only Welfare (MoHFW). 2.5 percent of the country's GDP into • Its mission is to strengthen Health health care by 2025, while the global Information System (HIS) in each of average is about 6 percent. the districts in the country. • Even lower-income countries like National Clean Air Programme Bhutan, Sri Lanka and Nepal spend • Union Environment Minister Harsh 2.5 percent, 1.6 percent and 1.1 Vardhan launched the National Clean percent of the GDP respectively on Air Programme (NCAP). their people’s health. • It is collaborative and participatory in • Households spent four times less in nature, not legally binding on government hospitals (7.5%) than states. private hospitals. • The scheme is termed as “war against • WHO's health financing profile for pollution” across the length and 2017 shows 67.78% of total breadth of the country. expenditure on health in India was • It has set a ‘tentative’ national level paid out of pocket. target of 20-30 percent reduction in • The world average out of pocket PM2.5 and PM10 concentration within expenditure is just 18.2%. the next five years. 27 www.gradeup.co
• 2017 is kept as the base year for the • Reserve of India (RBI) has allowed all comparison of concentration. card payment networks to offer • The target will be effective in 102 tokenization service. polluted cities across the country. • However, no charges should be • It will also use the Smart Cities recovered from the customer for programme to launch the NCAP in 43 availing this service. Smart cities in the list of 102 non- • Tokenization of debit, credit and attainment cities. prepaid card transactions is allowed. • It has provision for ‘mid-term policy • It aims to enhance the safety of the review’ also. digital payments ecosystem in the Related information country. PM2.5 and PM10: Related information: • 5 and PM10 refer to atmospheric TOKENISATION: particulate matter (PM) that have a • Tokenization involves a process in diameter of less than or equal to 2.5 which a unique token masks sensitive and 10 micrometers respectively. card details. • Particulates are microscopic solid or • The token is then used to perform liquid matter suspended in the card transactions in contact-less atmosphere of Earth. mode at Point Of Sale (POS) Universal Basic Income terminals, Quick Response (QR) code • Sikkim’s ruling party, the Sikkim payments, etc. Democratic Front (SDF), has decided • Thus, tokenization will replace card to include UBI in its manifesto ahead details with a code, called a “token”. of the Assembly elections. Pranav R Mehta became first Indian to • It aims to implement the scheme by 2022. Head Global Solar Council • It has already started the process to • Pranav R Mehta has taken over as the introduce the unconditional direct president of Global Solar Council cash transfers. (GSC) from January 1, 2019. • So, Sikkim is set to become the first • Today, India is placed amongst the state in India to roll out Universal Top 5 solar players in the world and is Basic Income (UBI). a third largest solar market. Related information: Global Solar Council (GSC) Universal Basic Income (UBI): • The Global Solar Council (GSC) was • UBI is a regular and periodic cash launched on December 6, 2015, payment delivered unconditionally to following the historic United Nations all citizens without the requirement of Climate Change Conference (UN COP work or willingness to work. 21). • The main idea behind UBI is to • The GSC came into being as prevent or reduce poverty and International Coalition of more than increase equality among citizens. 30 nations, utilizing maximum solar • The essential principle is the idea that energy, decided to harness the all citizens are entitled to a livable renewable energy for the greater income, irrespective of the good. circumstances they’re born in. • The GSC has its headquarters in Some facts about SIKKIM Washington D.C., USA. • World’s first fully organic state. ‘One Family, One Job’ scheme • Sikkim received the UN Future Policy • Sikkim CM launched the ‘One Family Gold Award in 2018 for paving the One Job’ scheme, under which for way for the rest of the world. every family one government job has • Sikkim became the 22nd State of the been allotted, in Gangtok. Indian Union after Constitution (36th • The Scheme was launched during Amendment) Act, 1975. "Rojgar Mela" at the Paljor Stadium in Tokenisation of card transactions Gangtok.
28 www.gradeup.co
• Sikkim became the first state in the supply of 23 cumec water to Delhi and country to carry out such a other basin states. programme for the people entitling Impact of Dam them to state government employee • After the construction of the dam, the benefits. flow of river Giri will increase by about Related Information 110% which will meet the drinking Proud Mother scheme water needs of Delhi & other basin • Sikkim Govt has implemented a Proud states up to some extent in a lean Mother scheme to increase the period. decreasing fertility in the State. • Stored water of Renukaji Dam will be • Govt grants incentive to women used by UP, Haryana & NCT of Delhi delivering 1st & 2nd live Children. from Hathnikund Barrage, by NCT of • The concerned Proud Mothers scheme Delhi from Wazirabad Barrage and by will cover original Sikkimese including UP, Haryana, and Rajasthan from Lepcha, Bhutia, and Nepali. Okhla Barrage. Renukaji Multipurpose Dam Project Citizenship Bill issue: Muted Bhogali • The Union Minister for Water Bihu fete in Assam Resources, Shipping, and Road • A contentious Bill to legitimize the Transport & Highways signed a MoU stay of non-Muslim migrants from with the Uttar Pradesh, Rajasthan, India’s neighborhood has made many Uttarakhand, Haryana and Himachal in Assam decide to break an age-old Pradesh for the construction of tradition — by fasting during an Renukaji Multi-Purpose Dam project agrarian festival of feasting. in the Upper Yamuna Basin. Related Information Related Information Bhogali Bihu Renukaji Dam Project • Magh Bihu (also called Bhogali Bihu) • Three storage projects are proposed is a harvest festival celebrated in to be constructed on the river Yamuna Assam. and two of its tributaries - Tons and • It is the Assam celebration of Makar Giri in the hilly regions of Uttarakhand Sankranti, with feasting lasting for a and Himachal Pradesh. week. • These include • Uruka is the precursor to Magh Bihu (i) Lakhwar project on river Yamuna to be celebrated. in Uttarakhand, • Uruka is marked by lighting bonfires (ii) Kishau on river Tons in and feasting at a Meji or Bhelaghar, a Uttarakhand and Himachal Pradesh temporary structure made with and bamboo, hay, and dried plantain (iii) Renukaji on river Giri in Adultery, homosexuality not acceptable Himachal Pradesh. in Army • These three projects were identified • Chief General Bipin Rawat said that as National Projects in 2008 under Adultery and homosexuality have which 90% funding of the cost of been not be allowed in the army in irrigation & drinking water component spite these are decriminalized in the will be provided by the Govt of India country by the Supreme Court. as central assistance and the rest Related Information 10% cost of the irrigation and drinking Adultery Sec. 497 of IPC water component will be borne by the • Recently the Supreme Court struck beneficiary states. down as unconstitutional the 158- • The project is proposed to be year-old Section 497 of IPC+ that executed by Himachal Pradesh Power punished a married man for the Corporation Ltd. (HPPCL). offense of adultery if he had sexual • The project envisages construction of relations with a married woman 148 M high rock-filled dam for the "without the consent or connivance of her husband. 29 www.gradeup.co
What is Adultery law in Indian? and educational institutions to the • Section 497 of the Indian Penal Code economically weaker sections in the was a section dealing with adultery. general category. • Under this law, a woman cannot be Related Information punished for the offense of adultery. • The provision to Article 368 (power of • Only a man who has consensual Parliament to amend the Constitution sexual intercourse with the wife of and procedure thereof) holds that an another man without his consent can amendment to a fundamental right be punished under this offense in coming under Part III of the India. Constitution need not be ratified by • If someone "lives in adultery", the the Legislatures of one-half of the partner can file for divorce. States. Reasons were given by Honorable SC • So, this Bill may be notified by the • The Supreme Court called the law Central government as soon as it gets unconstitutional because it "treats a the assent from the President. husband as the master." • Only Constitution amendments which • The Offence of adultery treats women affect the Centre-State relations or as chattel, dents their dignity. division of powers in a federal • The court tested Section 497 on the structure require subsequent touchstone of constitutional ratification by the States’ Legislatures provisions dealing with the right to before the Presidential assent. equality and guarantees against Right to equality arbitrariness and discrimination. • The Bill, passed by both the Houses of New Provisions the Parliament, adds new clauses to • Adultery could continue to be a Articles 15 and 16 of the Constitution. ground for aggrieved spouses to seek • Both the Articles come under the part a divorce from their adulterous of ‘Fundamental Rights’ in the text of partners. the Constitution. • If one of the spouses committed • The new clause (6) to Article 15 allows suicide because of the adulterous the government to carve reservation nature of her/his partner, then the for the economically weaker sections culprit could be proceeded against for of the society in higher educational the criminal offense of abetting. institutions, including private ones, Homosexuality: Section 377 of IPC whether they are aided or not by the • This year the Supreme Court State. unanimously decriminalized the • Minority educational institutions are colonial law under Section 377 of the exempted. IPC that banned consensual unnatural • Likewise, the new clause (6) to Article sex between adults. 16 provides for quota for • After this verdict, the LGBT stands for economically-deprived sections in the lesbian, gay, bisexual, and initial appointment in government transgender community enjoys the services. same rights as other citizens under Note: the Constitution. • The Indira Sawhney judgment has States’ approval not needed for quota capped the reservation limit to 50%. Bill • Now, the new Bill increases • Recently the Constitution (One reservation to 60%. Hundred and Twenty Fourth Cabinet approves Bilateral Swap Amendment) Bill of 2019 and 103 Arrangement between India and Japan amendment act, 2109 providing up to • The Union Cabinet has approved the 10% reservation for economically proposal for entering into an weaker sections of the society. Agreement for Bilateral Swap • Gujarat became the first state to Arrangement (BSA) between India provide 10 percent reservation in jobs and Japan and authorizing the 30 www.gradeup.co
Reserve Bank of India (RBI) to sign • It is India’s first manned space the Agreement for Bilateral Swap mission which carried out with the Arrangement between the RBI and collaboration of ISRO and Russia’s the Bank of Japan for a maximum federal space agency ROSCOSMOS. amount of USD 75 billion. • Under this programme India is Salient Features: planning to send three humans • The swap arrangement is an (Gaganyatris) into space i.e. in low agreement between India and Japan earth orbit (LEO) by 2022 i.e. by 75th to essentially exchange and re- Independence Day for period of five to exchange a maximum amount of USD seven days. 75 Billion for domestic currency, for • The mission was announced by Prime the purpose of maintaining an Minister Narendra Modi during his appropriate level of balance of 72nd Independence Day speech. payments for meeting short-term • Under this mission, the crew of three deficiency in foreign exchange. astronauts will conduct experiments Benefits: on microgravity in space. • The BSA is a very good example of • This mission will make India fourth mutual cooperation between India nation in the world after USA, Russia, and Japan for the strategic objective and China to launch a human of assisting each other in times of spaceflight mission. difficulty and for restoring Oceans are heating up at a quickening international confidence. pace: Report • This facility will enable the agreed • Researchers said the world’s oceans amount of Capital being available to are heating up at an accelerating pace India on tap for use. Also, with this as global warming threatens a diverse arrangement in place, prospects of range of marine life and a major food Indian companies would improve in supply for the planet. tapping foreign capital as there would Role of Ocean in Climate Change be greater confidence in the stability • Ocean heating is a very important of the country’s exchange rate. indicator of climate change. • Availability of such swap line to tide • About 93% of excess heats are over difficulties arising out of Balance trapped around the Earth by of Payment (BOP) would deter greenhouse gases that come from the speculative attacks on the domestic burning of fossil fuels which currency and greatly enhance the accumulates in the world’s oceans. RBI’s ability to manage exchange rate Highlight of report volatility. • The latest report relied on four Note: The arrangement is another milestone studies, published between 2014 and in mutual economic cooperation and special 2017, that gave more precise strategic and global partnership between estimates of past trends in ocean India and Japan. heat, allowing scientists to update ISRO starts Human Space Flight center past research and hone predictions for • Gaganyaan, the great Indian human the future. leap to space by 2022, will soon get • A key factor in the more accurate cracking under a new Human Space numbers is an ocean monitoring fleet Flight Centre and a dedicated team. called Argo, which includes nearly • ISRO named Unnikrishnan Nair, who 4,000 floating robots that “drift led its Advanced Space Transportation throughout the world’s oceans, every Programme at the Vikram Sarabhai few days diving to a depth of 2,000 m Space Centre, as the man to steer it - and measuring the ocean’s as also the director of the new Human temperature, pH, salinity and other pace Flight Centre. bits of information as they rise back Gaganyaan Project up.
31 www.gradeup.co
• Argo “has provided consistent and (iii) Political participation widespread data on ocean heat (iv) Political culture content since the mid-2000s. (v) Civil liberties • The new analysis shows warming in India Position and Performance the oceans is on pace with • India is ranked at 41 which is notched measurements of rising air above last year. temperature. • India achieved a score of 7.23 on the Note: The models predict that the index to maintain its position which is temperature of the top 2,000 meters of the the same it did last year. world’s oceans will rise 0.78 degrees Celsius • India ranks below the US (ranked by the end of the century. 25th in the index) and other so-called Women of India Organic Festival ‘flawed democracies’ like Italy, • The Ministry of Women and Child France, Botswana, and South Africa. Development is organizing the three- • According to the index, this is the day 6th ‘Women of India Organic lowest ever score attributed to India Festival’ in Chandigarh. in the index ever since its publication. • The festival aims to encourage Indian • India has been always classified women entrepreneurs and farmers to as a flawed democracy. connect with more buyers and thus, • The report defines a flawed empower them through financial democracy as nations that “have free inclusion while promoting organic and fair elections and, even if there culture in India. are problems (such as infringements • It also aims to educate people about on media freedom), basic civil its various initiatives and schemes liberties are respected. relating to women and children. • However, there are significant weaknesses in other aspects of Related Information democracy, including problems in Ministry of Women & Child Development governance, an underdeveloped • The Ministry has 6 autonomous political culture and low levels of organizations working under its aegis political participation. (i) National Institute of Public Devadasi custom Cooperation and Child Development • Recently, studies done on the (NIPCCD) Devadasi practice by the National Law (ii) National Commission for Women School of India University (NLSIU), (NCW) Bengaluru, and the Tata Institute of (iii) National Commission for Social Sciences (TISS) in Mumbai Protection of Child Rights (NCPCR) reveal that more than thirty-six years (iv) Central Adoption Resource after the Karnataka Devadasis Agency (CARA) (Prohibition of Dedication) Act of 1982 (v) Central Social Welfare Board was passed, the State government is (CSWB) yet to issue the rules for administering (vi) Rashtriya Mahila Kosh (RMK) the law. Democracy Index 2018 Highlights of the studies • Recently the Democracy Index 2018 • In the studies, it is found that special is released annually by Economist children, with physical or mental Intelligence Unit (EIU). disabilities, are more vulnerable to be • The index will provide a snapshot of dedicated as devadasis about 19%. the state of world democracy for 165 • The girls from socio-economically independent states and two marginalized communities continued territories. to be victims of the custom and • The Economist’s Democracy Index thereafter were forced into the ranks nations on five parameters. commercial sex racket. (i) Electoral process and pluralism • Law in IPC: The Protection of Children (ii) Functioning of government from Sexual Offences (POCSO) Act 32 www.gradeup.co
2012, and Juvenile Justice (JJ) Act of integrated with the traffic signals, as 2015 have not made any reference to well as can be operated manually, it as a form of sexual exploitation of through a Bluetooth app. children. • The robot has two hands to interact Related Information with the people and show traffic signs. Devadasi System • It has highly expressive eyes to create • Devadasi system is a banned religious a feel of a neighborhood helper and practice in some parts of India also a display to show important whereby parents marry a daughter to messages. a deity or a temple. Commerce Ministry launched • The marriage usually occurs before “Womaniya on GeM” the girl reaches puberty. • This initiative will enable women • The Union Home Ministry in December entrepreneurs and women self-help 2015 had asked all states to take groups [WSHGs] to sell handicrafts strong action against those involved and handloom, accessories, etc in the heinous practice which is directly to various Government against the dignity of women. ministries, departments, and Citizenship Bill: Chakma and Hajong institutions. communities in a spot • The initiative aligns with • The contentious Citizenship Government’s initiatives for MSMEs, (Amendment) Bill, 2016 has put the especially to reserve 3 percent in spotlight on Bengali Hindus in Assam. government procurement from • The Citizenship Bill would serve as a women entrepreneurs. legal basis for legitimizing the claims • This initiative will also address goals of Chakma and Hajong refugees as and objectives under the United the indigenous people of Assam State. Nations Sustainable Related Information Development Goal 5: Achieve • The Chakmas and Hajongs are ethnic gender equality and empower all people who lived in the Chittagong Hill women and girls. Tracts, most of which are located in Related Information Bangladesh. Government e-Marketplace (GeM) • Chakmas are predominantly • GeM is an Online Market platform to Buddhists, while Hajongs are Hindus. facilitate the procurement of goods • They are found in northeast India, and services by various Ministries and West Bengal, Bangladesh, and agencies of the Government. Myanmar. • It has been envisaged as National • The Chakmas and Hajongs living in Procurement Portal of India which the Chittagong Hill Tracts fled aims to enhance transparency, erstwhile East Pakistan in 1964-65 efficiency, and speed in public since they lost their land to the procurement of goods and services development of the Kaptai Dam on and eliminate corruption. the Karnaphuli River. • It functions under Directorate General Chennai Traffic Police introduces robot of Supplies and Disposals (DGS&D), "ROADEO" for traffic management Ministry of Commerce and Industries. • The Chennai Traffic Police introduced • It is completely paperless, cashless robot "ROADEO" which will help police and system driven e-marketplace that in traffic management and assist enables procurement of common use pedestrians in Chennai roads. goods and services with a minimal • The robot will make the pedestrians, human interface especially children, feel safe while Section 126 of the RP Act, 1951 crossing the roads. • A Committee constituted under to Related Information review and suggest modifications and • It will also ease the work of traffic changes in the provisions of Section police, as these robots can be 126 and other sections of the RP Act 33 www.gradeup.co
1951 and provisions of Model Code of in Sonamura subdivision of Sipahijala Conduct have submitted its report. district of Tripura. • it was headed by the senior deputy National Wildlife Board election commissioner Umesh Sinha. • It is a statutory organization The Committee had the following scope constituted under the Wildlife of work: Protection Act, 1972. • Internet service providers and social • It is an apex body to review all media companies should take down wildlife-related matters and approves content violating the 48-hour ban on projects in and around national parks campaigning prior to polling, instantly and sanctuaries. and latest within 3 hours of EC issuing • National Wildlife Board consists of : such a direction. o It is chaired by the Prime Minister • Examine the type, category or growth o Union Minister of Environment, of communication technology or Forest and Climate Change is the media platform in the country and vice-chairman of the Board difficulties in regulating these media o Other members include 15 non- platforms during the multiphase government members, 19 ex- election when prohibitory period of 48 officio members, 10 government hours is in force. officials such as secretaries. • Impact of new media platforms and Trishna Wildlife Sanctuary social media during the prohibitory • It is a Wildlife Sanctuary in Tripura, period of 48 hours before the close of India. poll and its implication in view of the • The vegetations in the sanctuary fall provisions of section 126. under four broad categories of tropical • Examine the present provisions of semi-evergreen forest, the east Model Code of Conduct (MCC) related Himalayan lower Bhanar sal, Moist to the above issues and suggest mixed deciduous forest, and the modification in this regard. Savanah woodland. Way forward: ‘Ama Ghare LED’ scheme • The recommendations made by the • Odisha government has launched the Committee, when implemented, will ‘Ama Ghare LED’ scheme. help in minimizing the possible • Under this scheme, about 95 lakh interference of activities which aim at families in the State will each get four indirectly influencing voters during LED bulbs free of cost. the valuable silence period of 48 hours • Under the scheme, 9-watt LED bulbs provided to them. will be distributed to the beneficiaries • The recommendations of the registered under the National Food Committee will be considered by the Security Act (NFSA) and the State Commission in detail for follow up Food Security Scheme (SFSC). action. • Odisha Power Transmission Trishna Gas Project Corporation Ltd (OPTCL) will • The National Wildlife Board has given implement the scheme and the bulbs its approval for the Trishna Gas will be distributed through camps and project of ONGC which falls in the PDS outlets across the State. Trishna Wildlife Sanctuary in the • The beneficiaries will have to produce Gomati district of Tripura. biometric authentication to get the • Trishna gas project ONGC has benefits of the scheme. discovered 10-12 gas bearing wells in First extinction of 2019: Hawaiian tree the Trishna Wildlife sanctuary. snail • The gas extracted from these wells • Recently in a report, it has found that would be supplied to the North the last known Achatinella apexfulva Eastern Electric Power Corporation Ltd has now been listed in the first (NEEPCO) owned 100 MW gas-based extinction species of 2019. thermal power project at Monarchak Related Information 34 www.gradeup.co
Achatinella apexfulva Intellectual Property Rights have been • It is an extinct species of colorful, properly implemented in the Indian tropical, arboreal pulmonate land software and BPM industry. snail in the family Achatinellidae once DD Science and India Science: present on Oahu, Hawaii. • Union Science & Technology Ministry • This species was endemic to forests of inaugurated two National Level the island of Oahu in the Hawaiian initiatives launched by the archipelago, United States, but is now Department of Science and extinct in the wild. Technology and Prasar Bharti in field of Science Communication. • In April 2011, it was reported that the • These two science communication species had been reduced to a single, platforms are a part national-level captive individual. initiatives to elevate science into a • A major cause of its population decline celebration and bring it close to in the wild was predation by the rosy everyday life. wolf snail. • The channels have been conceived Note: In January 2019, it was reported that and supported by the DST and are the last member of the species, a 14-year- being implemented and managed by old snail named George, had died. Vigyan Prasar, an autonomous Sino-Indian Digital Collaboration Plaza organisation of DST. • The Sino-Indian Digital Collaboration • The two science channels which are Plaza (SIDCOP), an initiative to bring milestones in the history of science Indian IT companies and Chinese communication in India are the first enterprises closer to each other on a step in creating a national science single AI enabled platform was channel for the country. launched in 2019. Related Information • This is a partnership by National DD Science Association of Software and Services • It will be a one-hour slot on Companies (NASSCOM) with Doordarshan National channel which Municipal Governments of Guiyang will telecast Monday to Saturday from and Dalian. 5 pm to 6 pm. India Science Related Information • It is an Internet-based channel, which Sino-Indian Digital Collaboration Plaza will be available on any internet- (SIDCOP) enabled device, and will offer live, • The initiative aims to bring Indian IT scheduled play and video-on-demand companies and Chinese enterprises services. closer to each other on a single AI Maha Agritech : An Initiative for enabled platform. doubling farmers’ income by 2022 • This platform will be managed by a • Maharashtra government launched joint venture comprising of one Indian ‘Maha Agritech,’ a project under which and Chinese company. area under cultivation from sowing to • The initiative aims to encash the harvesting, climate, and diseases on expertise of Indian IT enterprises in crops will be monitored digitally using business transformation and satellite and drone technology. operational optimization by using IT • This project is supported by tools in complex business Maharashtra Remote Application environments. Centre (MRSAC) and ISRO. NASSCOM • The main users of crop maps and yield forecasts are governments and • It is a not-for-profit industry agribusiness who use them to assess association and is the apex body for demand, anticipate prices and plan the Indian IT-BPM industry. the use of resources. • It aims to make sure that service Related Information quality and enforcement of 35 www.gradeup.co
Other Programmes / Projects by • According to a U.N. backed study, Ministry of Agriculture and Farmers desalination plants across the world Welfare produce highly salty waste-water and • Forecasting Agricultural output using toxic chemicals that are damaging the Space, Agrometeorology and Land environment. based observations (FASAL) • This study was part of research into • National Agricultural Drought how best to secure fresh water for a Assessment and Monitoring System rising population without harming the (NADAMS) environment. • KISAN (Crop Insurance using Space • Desalination plants around the world technology And geoinformatics) are pumping out far more salt laden • CHAMAN (Coordinated programme on brine than previously believed. Horticulture Assessment and • The brine raises the level of salinity Management using geoinformatics) and poses a major risk to ocean life • Crop Intensification: Mapping and and marine ecosystems. monitoring of post-Kharif rice fallow • Brine, water comprising about 5% lands using Satellite Remote Sensing salt, often includes toxins such as and GIS technologies for Rabi Crop chlorine and copper used in Area Expansion. desalination. By contrast, global IMBEX 2018-19 seawater is about 3.5% salt. • It is the second edition of India- • More than half the brine comes from Myanmar bilateral army exercise. four middle eastern countries. These • The objectives are: are Saudi Arabia, the United Arab (a) It provides opportunities to the Emirates, Kuwait and Qatar, with army personnel of both the nations to Saudi Arabia alone responsible for serve effectively in UN missions by 22% of the effluent. providing understanding about each Related Information other’s training, tactics, procedures Desalination and best practices. • Desalination is the process of (b) Train the Myanmar delegation for removing salts from water to produce participation in United Nations water that meets the quality (salinity) peacekeeping operations under the UN requirements of different human • India is one of the largest contributors uses. to the UN peacekeeping force and has • Seawater desalination can extend a rich experience of serving in UN water supplies beyond what is peacekeeping operations. available from the hydrological cycle, Philip Kotler Presidential Award providing an “unlimited”, climate- • Prime Minister of India, Narendra Modi independent and steady supply of has been awarded first-ever Philip high-quality water. Kotler Presidential Award by World Note: This is in direct conflict with Marketing Summit India. Sustainable Development Goal (SDG) 6, • The Award focuses on the triple- aimed at ensuring the availability of clean bottom-line of People, Profit, and water for current and future generations. Planet. • It will be offered annually to the Special weather services for Kumbh leader of a Nation. Mela • Philip Kotler is a world-renowned • Central Ministry has launched the Professor of Marketing at special weather services for the Northwestern University, Kellogg benefit of people visiting Prayagraj School of Management, U.S. during Kumbh Mela. • The service will provide information of Desalination Plants Harm Environment: the prevailing weather and forecasts UN for next 3 days through four Automatic Weather stations (AWS) 36 www.gradeup.co
and a mobile van AWS that have been (KSUM) includes the ultra-modern installed and operationalized at facilities of Maker Village that promote different locations at Prayagraj. hardware startups. • It will cover all four directions within Related Information 5-10 km radius. What is a startup? • It will be helpful for the local and state As per the Ministry of Commerce and authorities by providing the real-time Industry has described an entity as a location-specific weather information ‘startup’: for efficient management of the entire event and also benefit the pilgrims by 1. Up to five years from the date of its keeping them abreast of the latest incorporation/registration, weather information. 2. If its turnover for any of the financial Odisha takes its first step towards years has not exceeded Rupees 25 promoting turtle tourism crore, and • Odisha’s beach witnessed its first 3. It is working towards innovation, turtle festival on January 13, 2019, development, deployment or where tourists, researchers, and commercialization of new products, environmentalists gathered to processes or services driven by promote eco-tourism, which in turn technology or intellectual property. could help conserve Olive Ridley Startups: Points to note turtles. • Any such entity formed by splitting up • It was organized by Cox & Kings or reconstruction of a business Foundation, a philanthropic arm the already in existence shall not be travel company, in partnership with considered a ‘startup’. Humane Society International–India • In order to obtain tax benefits a (HIS- India) and few local startup so identified under the above organizations. definition shall be required to obtain a • Odisha has half of the world’s Olive certificate of an eligible business from Ridley turtle population, 90 percent of the Inter-Ministerial Board of India’s turtle population lives in the Certification consisting of: state. a) Joint Secretary, Department of Related Information Industrial Policy and Promotion, Olive Ridley Turtle b) Representative of Department of • The Olive ridley turtles are the Science and Technology, smallest and most abundant of all sea c) Representative of Department of turtles found in the world, inhabiting Biotechnology. warm waters of the Pacific, Atlantic and Indian oceans. • An entity shall cease to be a startup on completion of five years from the • These turtles, along with their cousin date of its incorporation/registration the Kemps Ridley turtle, are best or if its turnover for any previous year known for their unique mass nesting exceeds Rupees 25 crore. called Arribada, where thousands of females come together on the same • Entity means a private limited beach to lay eggs. company (as defined in the Companies Act, 2013), or a registered • The species is recognized partnership firm (registered under as Vulnerable by the IUCN Red section 59 of the Partnership Act, list. 1932) or a limited liability partnership India's largest startup ecosystem (under the Limited Liability inaugurated in Kerala Partnership Act, 2002). • Kerala government got India largest 1st Annual Disarmament, International startup ecosystem. Security Affairs Fellowship Programme • The Integrated Startup Complex • Foreign Secretary Vijay Gokhale under the Kerala Startup Mission inaugurated the First Annual 37 www.gradeup.co
Disarmament and International annual census, which concluded Security Affairs Fellowship recently, putting the head-count at Programme in New Delhi. 1,742. • Young Diplomats from 27 countries • Last year, the enumerators had are participating in the Fellowship sighted 1,698 reptiles. Programme. Bhitarkanika National Park • The programme aims at equipping • It is located in the north-east region participants with knowledge and of Kendrapara district in the state of perspectives on various issues related Odisha in eastern India. to disarmament, non-proliferation, • It is home to the largest population of arms control and international estuarine crocodiles. security. • It was designated as a national park Crocodile Annual Census on 16 September 1998 and as a • The population of saltwater crocodiles Ramsar site by UNESCO on 19 August in Bhitarkanika has increased with the 2002. • It is inundated by the rivers • Australia has pioneered in Brahmani, Baitarani, Dhamra, conceptualizing and implementing Pathsala. risk-based Safety Management Plans Related Information for the mining sector using the • In 1975, the Union Ministry of Forest technique of hazard identification and and Environment in collaboration with risk assessment. the UNDP had started a crocodile • SIMTARS is known to have exclusive breeding and rearing project in expertise in Mines Safety Dangamala within the park. Management Systems. MoU between India and Australia on the Related Information Safety in Mines, Testing and Research • Recently in Meghalaya, coal mines Station (SIMTARS) mishap happened which was result • The Union Cabinet has given its into the death of no. of people. approval for signing a MoU between ‘Jai Kisan Rin Mukti Yojana Directorate General of Mines Safety • MP government launched ‘Jai Kisan (DGMS), Ministry of Labour and Rin Mukti Yojana” scheme. Employment, Government of India • It is Rs 50,000 crore farm loan waiver and Department of Natural Resource scheme for farmers. Mines and Energy, Queensland • Only those farmers who have not Government, Australia through the registered themselves to pay GST and SIMTARS. income tax can avail benefits under • The MoU will help in establishing a this scheme. partnership between DGMS and 9th International Micro irrigation SIMTARS for: conference (a) implementation of the risk-based • Union Water Resources Minister safety management system, inaugurated 9th International Micro providing training, irrigation conference at Aurangabad, (b) setting up occupations safety and Maharashtra. health academy and national mine • The aim of the conference was to disaster center, and modernizing R&D share experiences in the use of new laboratory of DGMS. technologies and best management • The MoU will become operative from practices in drip, micro-sprinkler, and the date of signing and remain in other localized irrigation systems. effect for three years. • The Theme of the conference Background: was: “Micro Irrigation and Modern • Mining accident rates in Australia is Agriculture”. the lowest in the world.
38 www.gradeup.co
• The conference was organized by the • The list of borrowers has been Ministry of Water Resources and River expanded to include all entities Development. eligible to receive FDI. Related Information Maturity period MICRO IRRIGATION • While the minimum maturity period • Micro-irrigation is a modern method of for the ECB will be three years, the irrigation through which water is framework allows manufacturing irrigated through drippers, sprinklers, companies to raise up to $50 million foggers and by other emitters on the per financial year with a maturity surface or subsurface of the land. period of one year. • Drip irrigation is most suitable for • Further, if the ECB is raised from a wider spacing crops. foreign equity holder and utilized for • The micro sprinkler irrigation system working capital, general corporate is mostly followed in sandy or loamy purposes or repayment of rupee soils. loans, the maturity period will be five • This system is most suitable for years. horticultural crops and small grasses. FDI (Foreign Direct Investment) Advantages • A foreign direct investment (FDI) is an • Water saving and higher yield investment in the form of controlling • High quality and increased fruit size ownership in business in one • Suitable for all types of soil country by an entity based in • Easy method of fertigation and another country. chemigation • There are two routes by which India • Saving in labor and field preparation cost gets FDI. Disadvantage (1) Automatic route- By this route, FDI • High initial investment is allowed without prior approval by • Clogging of emitters Government or Reserve Bank of India. • Possible damage to system (2) Government route- Prior components due to animals, etc. approval by the government is RBI eases ECB norms, lifts sector-wise needed via this route. Foreign limits Investment Promotion Board (FIPB) • RBI has drawn up a new external which was the responsible agency to commercial borrowing (ECB) oversee this route was abolished on framework allowing all eligible May 24, 2017. borrowers to raise up to $750 million ASER 2018 per financial year under the automatic • As per the Annual Status of Education route, replacing the existing sector- Report (ASER) 2018, one out of every wise limits. four Class 8 students in rural India is • The central bank has also expanded unable to read. the list of eligible borrowers and • The report was made after the survey recognized lenders. conducted by an autonomous unit of • To curb volatility in the forex market education-NGO Pratham. arising out of dollar demand for crude • The survey covered around 3.5 lakh oil purchases, the framework provides households and 546,527 children a special dispensation to public sector between the ages of three and 16 oil marketing companies. across 596 rural districts. • It allows them to raise ECB, with an overall Highlights: ceiling of $10 billion, for working capital • Moreover, over one in two, Class 8 purposes with a minimum average students cannot solve a problem that maturity period (MAMP) of three years under the automatic route without involves basic division. mandatory hedging & individual limit • Only a little more than half of all requirements. children enrolled in Class 5 can read a Class 2 level text.
39 www.gradeup.co
• This improvement can be seen due to Europe, Latin America, and the Middle an improved performance by East. Himachal Pradesh, Uttar Pradesh, • The programmes are currently Odisha, Chhattisgarh, Karnataka, broadcasted in English and eventually Kerala, Arunachal Pradesh, and hopes to broadcast in other languages Mizoram. including Farsi, Turkish, Arabic and • The proportion of children not enrolled Russian. in school has fallen below 3% to 2.8% Objectives for the first time ever in India. • The Human Rights Channel aims to • Also, the percentage of girls in the 15- deliver hidden stories ignored by 16 age group who were not enrolled mainstream media into people’s living in school dropped from 20% in 2008 rooms. to 13.5%. • The Channel would focus on issues like refugees, press freedom and the • The number of schools with a incarceration of journalists, serviceable girls’ toilet doubled extremism, women’s rights, LGBT+ between 2010 and 2018 with two- issues and the plight of the world’s thirds of all girls’ schools in rural India stateless people. having toilets. Related Information Global Aviation Summit 2019 IOHR • The Ministry of Civil Aviation in • It is a non-profit NGO based in collaboration with Federation of London. Indian Chambers of Commerce and • IOHR partners with local and Industry (FICCI) has organized Global international human rights group to Aviation Summit in Mumbai. drive and promote positive changes • The theme of Global Aviation Summit and push for justice and the respect of is “Flying for all - especially the human rights worldwide. next 6 Billion”. • IOHR aims to defend the dignity of • It aims to provide a platform for the people stripped of their rights stakeholders to brainstorm over the including unjustly jailed journalists, future of the aviation industry and human rights defenders, refugees, identify the growth areas. and victims of oppression • It also gives the opportunity to Spiritual circuit in Kerala highlight the latest concepts like • The PM recently inaugurated a project drones, air taxis, new jets, and ultra- for the development of spiritual circuit light aerial electric vehicles etc. comprising three important Related Information pilgrimage centers of Sree • Vision 2040 for the aviation sector Padmanabha Swamy Temple, was also launched during the summit. Aranmula and Sabarimala in Kerala. • The vision document highlights the • The Sree Padmanabaswamy Temple growth potential in different sub- is one of the 108 divyadesams of Lord sectors of Indian aviation and the key Vishnu. action steps which are required to be • The project is being implemented taken to achieve the desired under the Swadesh Darshan scheme objective. of the tourism ministry. First human rights TV channel Related Information • The world’s first television channel Swadesh Darshan Scheme: dedicated to human rights was • Swadesh Darshan scheme is one launched in London by the among the flagship schemes of the International Observatory of Human Ministry of Tourism for development Rights (IOHR). of thematic circuits in the country in a • It would be a web-based channel and planned and prioritized manner. would deliver human rights issues to audiences in over 20 countries across • The scheme was launched in 2014-15.
40 www.gradeup.co
• Under this scheme, the Government is use of Space Technology in improving focussing on the development of Border Management. quality infrastructure in the country • Following areas have been identified with the objective of providing better for use of space technology: experience and facilities to the visitors (i) Island development on one hand and on other hand (ii) Border Security fostering the economic growth. (iii) Communication and Navigation • A National Steering Committee (NSC) (iv) GIS and Operations Planning will be constituted with Minister in System charge of Ministry of Tourism as (v) Border Infrastructure Chairman, to steer the mission Development objectives and vision of the scheme. • To execute the project in a timebound Congenital Central Hypoventilation manner, a short, medium and long Syndrome (CCHS) term plan have been proposed for • Recently an infant under treatment in implementation in five years in close New Delhi Hospital is suffering from a coordination with ISRO and Ministry of rare disease ‘Congenital Central Defence. Hypoventilation Syndrome (CCHS)’. • Deployment of Central Armed Police About the Disease Forces (CAPFs) in remote areas will be • It is a very rare disease with less than also coordinated by satellite 1,000 known cases all over the world. communications. • The person suffering from this disease • Indian Regional Navigation Satellite can lose their life if they fall into deep System (IRNSS) -based GPS will sleep. provide navigation facilities for • It is a disorder of the nervous system operational parties in high altitude, in which the cue to breathe is lost remote and difficult borders, and when the patient goes to sleep. Naxal areas. • This results in a lack of oxygen and a • BSF has been designated as lead buildup of carbon dioxide in the body. agency for implementation of ground • Lack of breathing turns the lips into segment and network infrastructure the blue. including the establishment of • It is also known as Ondine’s Curse. Archival Facility. (Ondine is a French mythology Saksham 2019 character.) • ‘Saksham’, an annual high-intensity Cause mega campaign launched by • The mutation of a gene called PHOX2B Petroleum Conservation Research can cause CCHS. Association (PCRA) under the aegis of • This gene is crucial for the maturation the Ministry of Petroleum and Natural of nerve cells in the body. Gas. Treatment • The campaign aims at promoting the • Treatment typically includes citizens to participate in fuel mechanical ventilation or use of a conservation for health & diaphragm pacemaker. environment protection. • People who have been diagnosed as • It simultaneously helps in reducing India’s newborns should be ventilated dependency on import of crude oil. throughout childhood so that they can PCRA live independently. • It is a registered society set up under the aegis of Ministry of Petroleum & Task Force report on Space Technology Natural Gas, Government of India. in Border Management • This non-profit organization is a • The Union Home Minister has national government agency engaged approved the report of Task Force in promoting energy efficiency in created by MHA to identify areas for various sectors of the economy.
41 www.gradeup.co
• It helps the government in proposing • The report also examines the policies and strategies for petroleum interconnectedness of risks and considers conservation. how the strategies for the mitigation of Jallikattu global risks might be structured. • Recently, a total of 29 people Highlights of the report sustained minor injuries at the • The report has predicted the following Jallikattu event held in Alanganallur major risks under five categories: Tamil Nadu. (a) Economic Related Information • Asset bubbles in a major economy • Jallikattu is a traditional spectacle in (b) Environmental which a bull, such or Kangayam • Extreme weather events breeds s released into a crowd of • Failure of climate change mitigation people, and multiple human and adaptation participants attempt to grab the large • Natural disasters hump on the bull's back with both • Man-made environmental disasters arms and hang on to it while the bull • Biodiversity loss and ecosystem attempts to escape. collapse • Jallikattu is typically practiced in the • Failure of climate change mitigation Indian state of Tamil Nadu as a part and adaptation of Pongal celebrations on Mattu (c) Geo-Political Pongal day. • Weapons of mass destruction Note: The animal rights organizations have (d) Societal called for a ban on the sport, resulting in the • Large-scale involuntary migration court banning it several times over the past • Water crises years. However, with protest from the people • A spread of infectious diseases against the ban, a new ordinance was made (d) Technological in 2017 to continue the sport. • Data fraud or theft Global Risks Report • Cyber-attacks • The Global Risks Report 2019 of the World • Critical information infrastructure breakdown Economic Forum (WEF) describes changes Note: The report warns about growth in occurring in the global risks landscape 2019 getting held back by continuing geo- from year to year and identifies global economic tensions, with 88 percent of catastrophic risks. respondents expecting further erosion of multilateral trading rules and agreements.
Important reports published by Various organization
Name of the Reports International Organization World Economic Outlook International Monetary Fund (IMF) Global Financial Stability Report International Monetary Fund (IMF) Global Money Laundering Report Financial Action Task Force (FATF) Global Economic Prospects The World Bank World Development Report The World Bank Ease of Doing Business The World Bank Environmental Performance Index World Economic Forum Global Competitive Index World Economic Forum Global Gender Gap Report World Economic Forum The Global Risk Report World Economic Forum Human Capital Report World Economic Forum Human Development Index United Nations Development Programme (UNDP) Sustainable development Goals United Nations Development Programme (UNDP) Gender Inequality Index United Nations Development Programme (UNDP) Global Hunger Index International Food Policy Research Institute (IFPRI) 42 www.gradeup.co
World Happiness Report Sustainable Development Solution Network (SDSN)
Common Pochard • The recapitalization bonds will be on • Delay in migratory birds like ‘Common the lines issued to Public Sector Pochard’ visiting Delhi has worried the Banks. environmentalists and bird-lovers etc. Major Impact: Common Pochard • Exim Bank is the principal export • Common Pochard is a medium-sized credit agency for India. duck. • The infusion of capital into Exim Bank • It migrates to India from central Asia will enable it to augment capital in October. adequacy and support Indian exports • The number of the species is declining with enhanced ability. globally because of climate and • The infusion will give an impetus to anthropological reasons. anticipate new initiatives like • IUCN status- Vulnerable supporting Indian textile industries, Rupee pact with Iran to aid pharma likely changes in Concessional Finance exports Scheme (CFS), likelihood of new LoCs • The Indian pharma industry now has in future in view of India's active an opportunity to increase exports to foreign policy and strategic intent. Iran, following a rupee payment Exim Bank of India mechanism agreed upon recently by • It was established in 1982 under an India and the Persian Gulf nation. Act of Parliament as the apex financial • Under the agreement, Indian refiners institution for financing, facilitating make payments in rupee for oil and promoting India's international imports from Iran. trade. • It has designated accounts • The Bank primarily lends for exports maintained with UCO Bank. from India including supporting • A portion thus received is to be used overseas buyers and Indian suppliers by Iran to pay for imports from India, for export of developmental and including pharmaceuticals. infrastructure projects, equipment, Related Information goods, and services from India. • Iran has a well-established pharma industry that meets 80% of the • It is regulated by RBI. country’s requirement. Sita Rama project gets Centre’s nod • Indian pharma exports to Iran were at • The Union Ministry of Environment, $124.05 million last fiscal. Forest and Climate Change has given • The remaining 20% is met its approval for the Sita Rama Lift predominantly through imports from Irrigation Project of Telangana. Europe. • The project would be completed in Cabinet approves recapitalization of three years and would lead to Export-Import Bank of India submergence of about 1,930-hectare • The Union Cabinet has approved the area and 157 villages. recapitalization of EXIM Bank. Sita Rama Lift Irrigation Project • The details are as follows: • The project aims to divert Godavari (i) Issuance of Recapitalization Bonds river water to irrigate 2.72 lakh by GOI to the tune of Rs.6,000 crore hectares in three districts of Bhadradri for capital infusion in Export-Import Kothagudem, Khammam and Bank of India (Exim Bank). Mahabubabad districts of Telangana. (ii) The equity will be infused • The water from River Godavari will be • The Cabinet also approved an diverted from the upstream of increase in the authorized capital of existing Dummugudem Anicut Exim Bank from Rs. 10,000 crore to barrage. Rs. 20,000 crore. • Head regulator would be constructed at Dummugudem Anicut on Godavari 43 www.gradeup.co
river and lined canal of about 372 km governments to protect India’s would be constructed. ‘pluralist social fabric’ from mob Humans are closer to setting up a base violence six months before. on Moon’ • SC described Mob lynching as ‘horrific • China’s Chang’e-4 lander successfully acts of mobocracy’. grew a cotton plant on the Moon, but • The court felt compelled to act in the it died soon after. shadow of four years of surging hate • This one is a first to grow a plant in a violence targeting religious and caste controlled environment on the Moon. minorities. It also urged Parliament to • The significance, of course, is that we consider passing a law to combat mob now have positive confirmation that hate crime. we can grow food in controlled • Manipur became the first to pass a environments on the Moon. remarkable law against lynching. • In space, almost anything can be • Its definition of lynching is grown there because we are speaking comprehensive, covering many forms of controlled environments and hence of hate crimes. perhaps the only limiting factors are • These are “any act or series of acts of the abiotic factors like water, light etc. violence or aiding, abetting such Note: India is yet to send a spacecraft which act/acts thereof, whether can do such experiments on the lunar surface spontaneous or planned, by a mob on or in space. the grounds of religion, race, caste, UNNATI programme sex, place of birth, language, dietary Minister of State in Department • practices, sexual orientation, political inaugurated the 1st batch of UNNATI affiliation, ethnicity or any other programme of Indian Space Research related grounds. Organisation (ISRO) in Bengaluru, Karnataka. Nagaland can reject Citizenship Bill • UNNATI stands for Unispace • Recently, Nagaland, along with other Nanosatellite Assembly and northeastern States, has witnessed Training programme. several protests following the passage • It has been launched by ISRO as part of the Citizenship bill 2016 Bill in the of an initiative by United Nations Lok Sabha. Office for Outer Space Affairs to Related Information commemorate the 50th anniversary Article 371(A) of the first United Nations Conference • Special provision with respect to the on the Exploration and Peaceful Uses State of Nagaland of Outer Space (UNISPACE-50). (1) Notwithstanding anything in this UNNATI Constitution, • Under the program, India will provide (a) no Act of Parliament in respect of 2 months training to 32 participants (i) religious or social practices of the from 18 countries from Algeria, Nagas, Argentina, Azerbaijan, Bhutan, Brazil, (ii) Naga customary law and Chile, Egypt, Ethiopia, Indonesia, procedure, Kazakhstan, Malaysia, Mexico, (iii) administration of civil and criminal Mongolia, Morocco, Myanmar, Oman, justice involving decisions according Panama and Portugal. to Naga customary law, • Overall, the programme would be (iv) ownership and transfer of land conducted for 3 years by U.R. Rao and its resources shall apply to the Satellite Centre of ISRO. State of Nagaland unless the • It has 3 batches and will target to Legislative Assembly of Nagaland by a benefit officials of 45 countries. resolution so decides; Manipur's new anti-lynching law • (b) The Governor of Nagaland shall • Supreme Court issued a slew of have special responsibility with directions to the Union and State 44 www.gradeup.co
respect to law and order in the State • The LCH is capable of operating from of Nagaland dispersed locations and flying at ultra- • Nagaland is also protected by the low levels. Bengal Eastern Frontier Regulation of • This provides a protective umbrella 1873, whereby an Inner Line Permit is from all aerial threats. issued to outsiders for safeguarding Rajasthan’s State bird may be extinct the citizenship, rights, and privileges soon of the Nagas. • Recently, the report revealed that Why Assam and other NE states are Rajasthan state bird “The Great opposing this bill? Indian Bustard’ may be extinct soon • The bill seeks to facilitate granting of only 50 Great Indian Bustards left in Indian citizenship for non-Muslim the wild. migrants from Bangladesh, Pakistan, Initiatives are taken by the government and Afghanistan. • The Rajasthan government proposed Inner Line Permit setting up of captive breeding centers • Inner Line Permit (ILP) is an official at Sorsan in Kota district and a travel document issued by the hatchery in Jaisalmer’s Mokhala Government of India to allow inward village for the conservation of the travel of an Indian citizen into a State bird of Rajasthan almost two protected area for a limited period. years ago but failed to save these • It is obligatory for Indian citizens from critically endangered birds. outside those states to obtain a permit • The Union Ministry of Environment, for entering into the protected state. Forest and Climate Change facilitate • Currently, there are 3 states have a the two centers and authorized the provision of Inner Line Permit. These Wildlife Institute of India for the states are- Arunachal Pradesh, saving of this species. Mizoram, Nagaland. Related Information Light Combat Helicopter Completes Great Indian Bustard Weapon Trials • It is a bustard found on the Indian • Light Combat Helicopter (LCH) subcontinent. designed and developed by Rotary • These birds are often found Wing Research & Design Centre associated in the same habitat as (RWRDC) of HAL has successfully blackbuck. carried out an air-to-air missile test. • It is protected under the Wildlife • It was for the first time in India that a Protection Act 1972 of India. helicopter had carried out air to air • Males have a well-developed gular missile engagement. pouch which is inflated when calling • It was developed in response to the during display and helps produce the operational needs of Indian Armed deep resonant calls. Forces and its capabilities far exceed • IUCN status: Critically that of contemporary attack Endangered helicopters of its class. Note: An incubation unit set up at Jaisalmer Features of the LCH district’s Sudasri — considered the sanctum • It is the only attack helicopter in the sanctorum of the Desert National Park — for world which is capable of operating at these Great Indian Bustard. altitudes as high as the location of India ranks third in research on artificial Siachen glacier. intelligence • It is mounted with a helmet mounted • India ranks third in the world in terms sight and a forward-looking infrared of high-quality research publications sighting system. in artificial intelligence (AI). • This advance sighting system will • India came third in the world with enable the pilot to launch a missile 12,135 documents trailed behind onto any target without having to turn China with 37, 918 documents and the helicopter. 45 www.gradeup.co
the United States with 32,421 India and overseas through the Indian documents. Network and Radio India. Related Information Satellite to deliver the world’s first artificial India in Artificial Intelligence meteor shower blasted into space • India’s traditional strength in • A rocket carrying a satellite on a information technology and AI said to mission to deliver the world’s first pose a transformation in industry and artificial meteor shower blasted into academic circles, the report was an space. attempt at mapping the state of AI- • A start-up based in Tokyo developed based research in India. the micro-satellite for the celestial • There were only about 50 to 75 show over Hiroshima early next year principal researchers in the AI-space as the initial experiment for what it in India and they were tended to calls a “shooting stars on demand” collaborate with each other. service. • The Indian Institutes of Technology • The satellite is to release tiny balls and the Indian Institutes of that glow brightly as they hurtle Information Technology were among through the atmosphere, simulating a the key centers for AI research. meteor shower. • NITI Ayog in June 2018 released a • It hitched a ride on the small-size discussion paper on the Epsilon-4 rocket that was launched transformative potential of AI in India from the Uchinoura space center by that said the country could add $1 the Japan Aerospace Exploration trillion to its economy by integrating Agency (JAXA). AI into its economy. • The rocket carried a total of seven • Healthcare, financial services, ultra-small satellites that will monsoon forecasting, retail, and demonstrate various “innovative” education were the key fields likely to technologies. benefit from AI and the field was District Mineral Fund “unlikely to lead” to the destruction of • PMKKKY is aimed at providing welfare to jobs a key global concern regarding those affected by mining operations. the field. • Under the programme, a portion of DD to start its own OTT platform revenues (10-30 percent of the • Recently Doordarshan, India’s public royalty proceeds from the minerals) is service broadcaster, is working earmarked for development activities towards plans to launch its own OTT in mining regions. (over-the-top) platform to stream • With just 24 percent of the ₹23,606- content to viewers over the Internet. crore mopped up under the Pradhan • Doordarshan is also planning to have Mantri Khanij Kshetra Kalyan Yojana its own digital platform where it can (PMKKKY) actually spent, the Centre put out its content which can be has advised States to increase the available worldwide. spending under the District Mining Related Information Fund (DMF) programme while Doordarshan (DD) ensuring that there is no fund • It is an autonomous public service diversion or leakage. broadcaster funded by the GOI, Related Information owned by the Broadcasting Ministry of Pradhan Mantri Khanij Kshetra Kalyan India and one of Prasar Bharati's two Yojana (PMKKKY) divisions. • It is aimed at the welfare of areas and • It was established on 15 September people affected by mining-related operations, using the funds generated by 1959. District Mineral Foundations (DMFs). • It also broadcasts on digital terrestrial • The scheme mandates that 60 % transmitters, provides television, share of the funds be spent on high radio, online and mobile service priority areas like drinking water throughout metropolitan and regional supply, health care, sanitation, 46 www.gradeup.co
education, skill development, women • The Brow-antlered deer which are and child care, the welfare of aged endangered is also facing the problem and disabled people, skill of poaching. development and environmental Related Information conservation. Loktak Lake • The funds accumulated in the District • Loktak Lake is the largest freshwater Mineral Funds would be used for lake in Northeast India and is famous implementing PMKKKY. for the phumdis (heterogeneous mass Young Scientist Programme of vegetation, soil and organic matter • ISRO has announced the ‘Young at various stages of decomposition) Scientists Programme’ to encourage floating over it. the scientific talent and increase • Keibul Lamjao National Park is the scientific pool in the country only floating national park in the world • In this program, three students, on this Phumids. eighth standard pass, will be selected • The park is the last natural refuge of from each of the 29 states and seven the endangered Sangai (state Union Territories. animal), one of three subspecies of • They will spend one month at ISRO Eld's deer. during which they will be given • It was also listed under the Montreux lectures, get access to research and Record on 16 June 1993, "a record of development and will be given the Ramsar sites where changes in experience to build a satellite. ecological character have occurred, • This programme is similar to NASA’s are occurring or are likely to occur. student outreach. 19 amphibian species are critically Diffo Bridge inaugurated in Arunachal endangered: ZSI list Pradesh • Recently an updated list of Indian • Defence Minister inaugurated the amphibians was released on the Diffo Bridge over Chipu River in Lower Zoological Survey of India (ZSI) in Dibang Valley District. which 19 species being treated as • The bridge is 426 meters in length and critically endangered and 33 species its work started in 2011. as endangered. • The project is completed by Border • It highlights 19% of amphibians as Roads Organisation. data deficient species and about 39% Border Roads Organisation (BRO) as not assessed by IUCN. • The Border Roads Organisation (BRO) • The list is updated and launched by develops and maintains road ZSI from time to time as per the networks in India's border areas and International Union for Conservation friendly neighboring countries. of Nature (IUCN). • The BRO was formed on 7 May 1960. Related Information Protest against proposed bird sanctuary Zoological Survey of India (ZSI) in Manipur • It is founded on 1 July 1916 by GOI, • The Manipur government’s plan to set Ministry of Environment, Forest and up a bird sanctuary at the Loktak lake Climate Change, as premier Indian in Bishnupur district has met with stiff organization in zoological research opposition from the villagers in nearby and studies to promote the survey, areas. exploration, and research of the fauna Concern: in the country. • Thousands of migratory birds flock to • ZSI (zoology) as well as ASI the Loktak lake, the largest (archaeology), BSI (botany), FSI freshwater lake in north-eastern (forests), FiSI (fisheries), GSI India, every year but in the past few (geology), IIEE (ecology), NIO years there has been a sharp decline (oceanography), RGCCI (Census of in the number of migratory birds India) and SI (cartography) are key coming to the lake. national survey organisations of India. 47 www.gradeup.co
International Solar Alliance plans bank multinational professional services to fund energy access network- PricewaterhouseCoopers • The International Solar Alliance (ISA) (PwC). is going to propose a new bank • It is a short publication that looks at exclusively for financing energy the trends and issues affecting the access to billions. global economy and details its latest • The bank is still at the ideation stage. projections for the world’s leading • ISA has asked the Asian Development economies. Bank to prepare a concept note. • The report notes that the global • A public-private partnership is being economy as a whole is expected to thought of for the proposed, which will slow in 2019 as G7 countries return to work for 1.2 billion people who lack long-run average growth rates. access to energy as well as the 2.4 • The main focus of tensions is likely to billion who lack access to clean remain US-China trade, but there will energy. always be the risk of this escalating Related Information into a wider trade conflict and • According to a recent World Bank businesses accordingly need to plan report, 600 million people would for different scenarios. continue to have no access to energy Highlights of Indian’s economy ranking 2019 even in 2040. • India is likely to surpass the United • Existing banks do not focus on Kingdom in the world’s largest universal energy access—those still economy rankings in 2019. deprived are the poorest of the poor. • As per the report, while the UK and • The bank should first target energy France have regularly switched places access and then focus on clean owing to similar levels of development energy. and roughly equal populations, India’s Indian Scenario climb up the rankings is likely to be • Renewable energy got a boost in 2015 permanent. when India decided to install 175 • The report projects real GDP growth gigawatt capacity of such energy by of 1.6% for the UK, 1.7% for France 2022. and 7.6% for India in 2019. International Solar Alliance (ISA) • India should return to a healthy • The ISA is an Indian initiative, jointly growth rate of 7.6% in 2019-20 if launched by the Prime Minister of there are no major headwinds in the India, Shri Narendra Modi and the global economy such as enhanced President of France on 30th November trade tensions or supply-side shocks 2015 in Paris, on the side-lines of in oil. COP-21, the UN Climate Conference. • The alliance's primary objective is- • The growth will be supported (a) Work for the efficient exploitation through the further realization of of solar energy to reduce dependence efficiency gains from the newly on fossil fuels. adopted GST and policy impetus expected in the first year of a new • (b) Mobilize $1 trillion in funds for government. future solar generation, storage and Operation Kabaddi’ technology across the world. • Former army commanders have • The ISA, headquartered in India, has revealed the details of this operation its Secretariat located in the in the book, Line on Fire: Ceasefire Gwalpahari, Gurgaon, Haryana. Violations and India-Pakistan • India has offered to meet ISA Escalation Dynamics. Secretariat expenses for an initial five • It was to be the largest planned years. operation by the Indian Army to end Global Economy Watch by PwC cross-LoC infiltration by capturing at • Global Economy Watch report has least 25 selected Pakistani posts along been released by London based the Line of Control (LoC) in 48 www.gradeup.co
September 2001. But due to some Age Pension and Odisha Disability issues, it was not carried out. Pension schemes • The objective of Operation Kabaddi • It’s objective of providing financial was to change the geography of the assistance to the destitute elderly and LoC with access to tactical points destitute differently abled persons in there, which would then help the the state. Army tackle the infiltration of militants "Alliance to End Plastic Waste" (AEPW) to by the Pakistani side. eliminate plastic waste launched • Operation Kabaddi would include a • Several organizations launched a new “wide spectrum of evolving punitive firm to improve ways to eliminate operations such as the: plastic waste in the environment, 1. execution of deliberate fire especially in the water bodies. assaults to destroy military and • The cross-value chain Alliance to End terrorist points, Plastic Waste (AEPW), currently made 2. area targets across the LoC up of nearly 30 member companies, 3. ambushes and raids across the has committed over USD 1.0 billion LOC etc. with the goal of investing USD 1.5 Rio de Janeiro recognized as World billion over the next five years to help Capital of Architecture 2020 end plastic waste in the environment. • Rio de Janeiro has been recognized as • The global companies alliance will develop ‘World Capital of Architecture’ for and bring to scale solutions that will 2020 by The United Nations minimize and manage plastic waste and Educational, Scientific and Cultural promote solutions for used plastics by Organisation (UNESCO). helping to enable a circular economy. • Rio de Janeiro will be hosting the • The alliance is a not-for-profit World Congress of the International organization that includes companies Union of Architects (UIA) in July 2020. that make, use, sell, process, collect • The theme of the 2020 World and recycle plastics. Congress of the International Union of • This includes chemical and plastic Architects is “All the worlds. Just manufacturers, consumer goods one world. companies, retailers, converters, and Related Information waste management companies, also World Capital of Architecture known as the plastics value chain. • The World Capital of Architecture • The alliance has been working with initiative underscores the common the World Business Council for commitment of UNESCO and the UIA Sustainable Development as a to preserve architectural heritage in founding strategic partner. the urban context. Africa and Asia come together to lead a • UNESCO designates the World Capital global initiative "Smart Food Executive of Architecture as per the partnership Council" to diversify staples agreement with the UIA. • In a first, the largest agriculture associations in Africa and Asia met on • The World Capital of Architecture also January 13, 2019, in Hyderabad to hosts the UIA’s World Congress, an sign an agreement for diversifying event that takes place every three major food staples. years. • Associations including Madhu Babu Pension Yojana scheme (a) Asia-Pacific Association of Agricultural • Odisha CM hiked Rs.200 per month Research Institutions (APAARI), under Madhu Babu Pension Yojana (b) Forum for Agricultural Research in (MBPY). Africa (FARA), Related Information (c) West and Central African Council Madhu Babu Pension Yojana for Agricultural Research and • Odisha government launched Madhu Development (CORAF), Babu Pension Yojana in 2008, by merging two pension schemes – Old 49 www.gradeup.co
(d) Food Agriculture and Natural • Nagpur is one of the five districts in Resources Policy Analysis Network the country and only one in (FANRPAN), and Maharashtra where this triple-drug (e) International Crops Research Institute therapy campaign is being launched. for the Semi-Arid Tropics (ICRISAT) Triple drug therapy got together to form the Smart Food • WHO is recommending three drug Executive Council. treatment to accelerate the global Smart Food Executive Council elimination of lymphatic filariasis. • It has been formed under the aegis of • The treatment, known as IDA, the Smart Food Initiative that was involves a combination of ivermectin, launched in 2013 and stemmed from diethylcarbamazine citrate and the strategic thinking around the need albendazole. for food that fulfills the criteria of • It is being recommended annually in being good for the consumer, good for settings where its use is expected to the planet and good for the farmer. have the greatest impact. • This would contribute to the SDGs for • The third drug is used in this therapy (a) Overcoming poverty and hunger will help control adult worms of (SDG 1 and 2), lymphatic filariasis. (b) Responsible consumption and • Micro filariasis, which is produced by production (SDG 12), along with adult worms, is the cause of a swollen adaptation to climate change (Goal 13). leg. (c) The approach taken will include Related Information gender equality (SDG 5) and action Lymphatic filariasis (elephantiasis) through partnerships (SDG 17). • It is a neglected tropical disease. • This new partnership strengthens • According to the WHO, infection collaborations between Asia and occurs when filarial parasites are Africa and can open up opportunities transmitted to humans through to join forces at any point along the mosquitoes. value chain, from consumers through • The infection is usually acquired in to processors, chefs through to childhood, causing hidden damage to farmers, researchers and others. the lymphatic system. Arunachal government declares Pakke • The parasites are transmitted by four Hornbill Fest as ‘state festival’ main types of mosquitoes: Culex, • Pakke Paga Hornbill Festival (PPHF) is Mansonia, Anopheles and Aedes. only conservation festival of Note: India has missed earlier deadlines to Arunachal Pradesh. eradicate the disease by 2015 and 2017. The • PPHF festival is celebrated to the first time global deadline now is 2020 and the three- in 2015 to recognize the role played by the drug approach may help the country get it. resident Nyishi tribe in conserving
hornbills in the Pakke Tiger Reserve. Great Indian Hornbill Project ReWeave • It is predominantly fruit eating, but is • Project Rewave is e-commerce an opportunist and preys on small platform “re-wev.in’ launched mammals, reptiles and birds. by Microsoft in 2016 to help • IUCN status: Vulnerable (uplisted handloom weavers. from Near Threatened in 2018). • It will help to connect artisans to the • It is also listed in Appendix I of CITES. buyers directly enabling them to Triple-drug therapy for lymphatic expand to newer customers and filariasis markets. It also provides a platform to • Maharashtra is all set to roll out the WHO- • recommended triple-drug therapy for showcase signature collections lymphatic filariasis to speed up the created by the weaver communities, elimination of the disease. showcase traditional designs and • It is a pilot project which is rolled out products created from natural dyes to in Nagpur. a broad set of customers. 50 www.gradeup.co
• It helps in increasing the waiver their biennial World Economic Outlook income and earning a sustainable Report 2018. livelihood while also reviving Highlights of report traditional forgotten Indian art. • India’s GDP is forecasted to expand • Under the initiative, Microsoft is 7.5% in FY20 and 7.7% in FY21. working closely with NGO partner, • China’s growth is seen at 6.2% in both Chaitanya Bharathi to provide years. infrastructure, financing and • The global economy is projected to marketing support to help weaver grow by 3.5% in 2019 and 3.6% in families keep their weaving traditions 2020. alive by sustaining livelihoods. About the report National Social Assistance Programme (NSAP) • It is a survey conducted and published • The Rural Development Ministry has by the International Monetary Fund. proposed to bring in the following • It is published biannually and partly changes in monthly pensions under updated two times a year. the National Social Assistance • WEO forecasts include key Programme (NSAP): macroeconomic indicators such as (a) For the elderly poor, disabled and GDP, inflation, current account and widows pensions are to be increased fiscal balance of the countries around from the current ₹200 to ₹800. the globe. (b) For those above the age of 80, the • It also deals with major economic proposal is to increase the pension policy issues. from ₹500 to ₹1,200 a month. Oxfam Annual Wealth Check report 2019 About Programme • The Annual Wealth Check report 2019 • It is a Centrally Sponsored Scheme released by Oxfam an international under the Ministry of Rural rights group. Development. • The release of the report marked the • It represents a significant step start of the annual Meeting World towards the fulfilment of the DPSP in Economic Forum in Davos, Article 41 of the Constitution. Switzerland. In Article 41 of the Constitution of • • The important features of the report India directs the State to provide are: public assistance to its citizens in case (a) 26 richest billionaires own as of unemployment, old age, sickness many assets as the 3.8 billion people and disablement and in other cases of who make up the poorest half of the undeserved want within the limit of its world. economic capacity and development. (b) The 12 percent increase in the • Presently NSAP comprises of five wealth of the very richest contrasted schemes, namely: with a fall of 11 per cent in the wealth o Indira Gandhi National Old Age of the poorest half of the world’s Pension Scheme (IGNOAPS). population o Indira Gandhi National Widow (c) The widening gap is hindering the Pension Scheme (IGNWPS). fight against poverty. o Indira Gandhi National Disability • The report estimates that a wealth tax Pension Scheme (IGNDPS). of 1% would raise an estimated o National Family Benefit Scheme $418bn (£325bn) a year. NFBS). • This would be enough to educate o Annapurna every child, not in school and provide World Economic Outlook Report healthcare that would prevent 3 • The International Monetary Fund million deaths. (IMF) has released an update of its Facts about India
51 www.gradeup.co
• The top 1% of India’s richest lot got Bihar posted the highest rise in state richer by 39% as against just 3% GDP in 2017-18 increase in the wealth for the bottom • Bihar and Andhra Pradesh led the half of the population. pack among States in terms of GDP • 6 Crore Indians who make up the growth in financial year 2017-18, poorest 10 percent of the country, clocking 11.3% and 11.2% growth, continued to remain in debt since respectively, compared with the 2004. national GDP growth of 6.7% for the • Top 10% of the richest population in year, according to a report by Crisil. India holds 77.4% of the total national Highlights of the Report wealth. • According to the report, 12 of the 17 general category States grew faster • In many countries including India, a than the national growth rate. decent education or quality healthcare • The growth was not equitable, with has become a luxury only the rich can the gap between the per capita afford. incomes in low-income and high- • Children from poor families in India income States widening over the last are three times more likely to die five years. before their first birthday than • In fiscal 2018: children from rich families. (a) Bihar, Andhra Pradesh, and • The calculations and interpolations in Gujarat were top-rankers in terms the report were based on the data of Gross State Domestic Product from the latest comprehensive data (GSDP) growth among the 17 non- sources available publicly, including special States considered in our from the Credit Suisse Wealth analysis. Databook and the annual Forbes (b) Jharkhand, Kerala, and Punjab Billionaires were at the bottom. Sea Vigil 2019 • The analysis found that between the • It is the first-of-its-kind exercise will financial years 2012-13 and 2016-17, be undertaken along the entire Gujarat, Madhya Pradesh and coastline and Exclusive Economic Karnataka were the fastest growing Zone (EEZ) of India. states, on average. • The Navy in coordination with the • West Bengal, Jharkhand and Bihar Coast Guard and other stakeholders had ranked at the bottom in the past will conduct a two-day defence five years. exercise along the coastline. • In Gujarat and Karnataka, manufacturing was the main driver, • The exercise is codenamed as "Sea while in Madhya Pradesh, agriculture Vigil 2019" and it is the first exercise and allied activities drove growth on on such a large scale. average. • It will involve all the coastal States • On the fiscal front most veered off the and Union Territories, maritime Fiscal Responsibility and Budget stakeholders including the fishing and Management Act (FRBM) line of coastal communities. maintaining their fiscal deficits at 3% • The exercise is a build-up towards the of their respective state GDPs. major ‘Theatre Level Readiness and • Rajasthan, Jharkhand and Uttar Operational Exercise (TROPEX)’ that Pradesh topped the tally in the the Indian Navy conducts every two proportion of capex in state spending years. in the past three years. • SEA VIGIL and TROPEX will together • The combined fiscal deficit of States cover the entire spectrum of maritime crossed the 3% of GSDP threshold, in security, including the transition from both fiscals 2016 and 2017. peace to conflict. • This improved in fiscal 2018 to 3.1%, but this was still higher than the FRBM limit.
52 www.gradeup.co
Fiscal Responsibility and Budget under the Central as well as State GST Management (FRBM) 2003 Acts. • It is an Act of the Parliament of India • Being a common forum, GST to Appellate Tribunal will ensure that (a) institutionalize financial discipline, there is uniformity in redressal of (b) reduce India's fiscal deficit, disputes arising under GST, and (c) improve macroeconomic therefore, in the implementation of management and GST across the country. (d) the overall management of the • Chapter XVIII of the CGST Act public funds by moving towards a provides for the Appeal and Review balanced budget and strengthen fiscal Mechanism for dispute resolution prudence under the GST Regime. Section 109 of • The main purpose was to eliminate this Chapter under CGST Act the revenue deficit of the country and empowers the Central Government to bring down the fiscal deficit to a constitute, on the recommendation of manageable 3% of the GDP by March Council. 2008. e-NAM portal • However, due to the 2007 • The first inter-State trade on e-Nam international financial crisis, the between Andhra Pradesh and deadlines for the implementation of Telangana has been carried out the targets in the act was initially recently between farmer from Gadwal postponed and subsequently mandi in Telangana State. suspended in many times in due to Related Information various reasons. e-NAM • Budget 2018-19 proposed amending • The e-NAM platform is pan-India the FRBM Act again, which shifted the electronic trading (e-trading) portal to target of 3% fiscal deficit-GDP ratio to network the existing physical end-March 2021. regulated wholesale market (known as APMC market) through a virtual Cabinet approves the creation of the platform to create a unified national National Bench of the "GSTAT" market for agricultural commodities. • The Union Cabinet has approved the • This portal is implemented by the creation of National Bench of the Ministry of Agriculture & Farmers’ Goods and Services Tax Appellate Welfare. Tribunal (GSTAT). Objective • The National Bench of the Appellate • To provide competitive and Tribunal shall be situated at New remunerative price to farmers for Delhi. their products through an online • GSTAT shall be presided over by its competitive and transparent bidding President and shall consist of one process. Technical Member (Centre) and one • It integrates Central Farmer Database Technical Member (State). to increase the efficiency and reduce Relate Information queue time. GSTAT • It seeks to increase the number of • It is the form of the second appeal in traders and greater competition. It GST laws and the first common forum will also ensure open price discovery of dispute resolution between Centre and better returns to farmers. and States. National Girl Child Day • The appeals against the orders in first • The Women & Child Development appeals issued by the Appellate Ministry will celebrate National Girl Authorities under the Central and Child Day (NGCD) in New Delhi. State GST Acts lie before the GST • The programme will also observe the Appellate Tribunal, which is common anniversary of Beti Bachao Beti Padhao (BBBP) Scheme. 53 www.gradeup.co
• The theme of this NGCD • Its theme was “Role of Indian is "Empowering Girls for a Diaspora in building a New India”. Brighter Tomorrow” • It was organized by the Ministry of Objectives External Affairs (MEA) in association • Generating awareness on the issue of with the government of Uttar Pradesh. declining Child Sex Ratio (CSR) Pravasi Bharatiya Divas • create a positive environment around valuing the girl child. • Pravasi Bharatiya Divas (PBD) is Beti Bachao Beti Padhao (BBBP) Scheme celebrated once in every two years to • Beti Bachao Beti Padhao (BBBP) strengthen the engagement of the Scheme was launched by Hon’ble overseas Indian community with the Prime Minister in 2015 at Panipat in Government of India and reconnect Haryana. them with their roots. • It is a tri-ministerial effort of Ministries • It is celebrated on 9 January to mark of Women and Child Development, the contribution of the Overseas Health & Family Welfare and Human Indian community in the development Resource Development. of India. But this time dates were st • BBBP Scheme is a Central Sector shifted 21 January to allow the Scheme with 100% financial guests attending the event to get an assistance for District level opportunity to participate in the component and the fund are directly 'Kumbh Mela' at Prayagraj and to released to the DC/DM’s account for attend the Republic Day parade. the smooth operation of the Scheme. • January 9 was chosen as the day to Roshni: An app to help the visually celebrate this occasion since it was on impaired this day in 1915 that Mahatma Gandhi • To assist visually impaired people to returned to India from South Africa. easily determine the denomination of • During the event, individuals of currency notes, the Indian Institute of exceptional merit are honoured with Technology at Ropar in Punjab has the prestigious Pravasi Bharatiya developed an app called “Roshni”, Samman Award to appreciate their using image processing and analytics. role in India’s growth. How does this app work? Deen Dayal Hastkala Sankul • This App utilises an adaptable deep • The Prime Minister inaugurated learning framework, which further Centres of Excellence at Deen Dayal uses the patterns and features Hastkala Sankul in Varanasi, Uttar embedded on the notes to Pradesh recently. differentiate and determine the currency denomination. • It is a trade facilitation centre for handicrafts. • The IPSA (Image processing, Security and Analytics) have a rich dataset of • The Crafts Museum in the Sankul will more than 13, 000 images of currency preserve the traditional notes under varied real-world handloom/handicrafts products of conditions. Varanasi. • The user has to bring the currency • It aims to facilitate weavers, artisans note in front of the phone camera and and exporters in promoting the App would provide audio handlooms and handicrafts. notification intimating the currency Related Information note denomination to the user. • The Finance Minister in the Budget Pravasi Bharatiya Divas 2014-15 had announced setting up of • The 15th Pravasi Bharatiya Divas a Trade Facilitation Centre and a (PBD) was held in Varanasi (Uttar Crafts Museum to develop and Pradesh). promote handlooms, handicrafts and silk products of Varanasi. 54 www.gradeup.co
Godavari-Cauvery link project the Himalayan component, 16 inter- • The Union Minister for Water link projects for Peninsular component Resources, River Development and and 37 intrastate river linking Ganga Rejuvenation announced that projects. the Centre would soon take up a • The Ken-Betwa, considered as major project to Link Rivers Godavari the first river inter-linking project, and Cauvery. will help irrigate nearly 15 lakh acres Objectives: of area. • The project aims to make good use of Study on the impact of unplanned about 1100 tmc ft of Godavari water development on Ecology of Central that is currently getting drained into Western Ghats the Bay of Bengal. • The Indian Research team undertook • The project would take the water from river Godavari to the tail end of Tamil Nadu. a study to examine the possible • The government aims to raise impact of unplanned development on finances for the project either from Ecology of Central Western Ghats. the World Bank or the Asian • The study focussed on River Kali that Development Bank. originates in Uttara Kannada district in • The government aims to address the Karnataka and joins the Arabian Sea. water deficit being faced and the • The river has six major dams, 325 resulting water dispute among the species of flora, and 190 species of riparian states of Karnataka, Tamil fauna and the river is as old as the Nadu, Kerala and Union Territory of Western Ghats. Puducherry over sharing of the water Findings of the Study from river Cauvery. • Unplanned developmental activities • The project would use low thickness and land use patterns are reducing steel pipes with a special treatment the evergreen forest cover and for linking the Godavari and -Cauvery perennial streams in the central rather than canals as it results in region of the Western Ghats in India. water loss due to evaporation losses. • Researchers by studying the remote • The use of use low thickness steel sensing data found that between the pipes would also aid in reducing the years 1973 and 2016, the forest cover project costs. has reduced from 85% to 55%. River inter-linking Project • The land use pattern in the region has • The Indian Rivers Inter-link is a changed during 1980–2000 period proposed large-scale civil engineering due to developmental projects such as project that aims to link Indian rivers dams built on the river Kali, Kaiga by a network of reservoirs and canals nuclear plant and Dandeli paper mill and so reduce persistent floods in which has led to large scale some parts and water shortages in destruction of forests. other parts of India. • The Inter-link project has been split • As a result, the evergreen forests into three parts have shrunk by from 62% to 38.5% (1) A northern Himalayan rivers inter- during 1980–2000 period and large link component water reservoirs have been constructed at the expense of forest (2) A southern Peninsular component cover. and starting 2005 (3) An intrastate river linking component. • The study citing Perennial streams were found in regions that have • The project is being managed by India's National Water Development greater than 70% of forest cover links Agency (NWDA), under its Ministry of ecology and hydrology with land use. Water Resources. • NWDA has studied and prepared INS Kohassa – a New Bird’s Nest in the reports on 14 inter-link projects for Andamans 55 www.gradeup.co
• Naval Air Station Shibpur was • It is established by the Bureau of commissioned as INS Kohassa. Indian Standards Act, 1986. • NAS Shibpur was identified by NITI • Its headquarters are in New Delhi. Aayog as one of the ‘Early Bird’ • It also works as WTO-TBT (Technical project as part of holistic island Barriers to Trade) enquiry point for development. India. • INS Kohassa has been named after a Successful Flight Test of LRSAM White-Bellied Sea Eagle, which is a • Long Range Surface-to-Air Missile large bird of prey, endemic to (LRSAM) has been successfully Andaman and Nicobar Islands. testfired from INS Chennai against an Related Information incoming aerial target flying at low Naval Air Station Shibpur altitude. Related Information • It was established in 2001 as a Long Range Surface-to-Air Missile Forward Operating Air Base (FOAB) for enhanced surveillance in North (LRSAM) • It has long-range engagement Andaman. capability to penetrate deep water • The close proximity of Coco Islands and land to intercept all types of aerial (Myanmar) and wide expanse of targets like subsonic and supersonic Indian Exclusive Economic Zone (EEZ) missiles, fighter aircraft, maritime makes the base a very vital asset. patrolling aircraft (MPA), helicopter BIS in Collaboration with IAF Releases and sea-skimming missiles. New Standard for Bio-Jet Fuel • It is capable of countering newest • To use bio-jet fuel on all military and generation anti-ship missiles. civilian aircraft, BIS has in • Indian Navy has decided to equip its collaboration with IAF, research all naval ships such as INS Kolkata, organisations and the industry INS Kochi, and INS Chennai guided brought out a new standard for missile destroyers with Barak 8 Aviation Turbine Fuels. LRSAM for air and missile defence. • These specifications will align Indian • Barak 8 LRSAM has been jointly standards with current international developed by DRDO and IAI, Israel to standards. be launched from the ship. Related Information • It possesses a high degree of Significances of using Bio-Jet Fuel manoeuvrability at target interception • Bio-jet fuel is greenhouse gas (GHG) range. neutral, carbon neutral, reduces air • It has a maximum speed of Mach 2 with a pollution. maximum operational range of 70 km • The use of bio jet fuel will help in (which has been increased to 100 km). reducing greenhouse gas (GHG) 18 Indian institutions to study nitrogen emissions by about 15% and sulfur pollution oxides (SOx) emissions by over 99%. • Eighteen research institutions in India • It is expected to provide indigenous are among a group of 50 institutions jet fuel supply security. called the South Asian Nitrogen Hub (SANH) are selected with the financial • Its usage also offers superior engine assessment given by U.K government performance and reduced to study the impact of Nitrogen maintenance cost for the airline pollution, operators. Related Information Bureau of Indian Standards (BIS) How Nitrogen help in the greenhouse • It is the National Standards Body of effect? India working under the aegis of the • Nitrogen is the dominant gas in the Ministry of Consumer Affairs, Food & atmosphere, it is inert and doesn’t Public Distribution, Government of react. India.
56 www.gradeup.co
• However, when it is released as part Engineering, Health and Family of compounds from agriculture, Welfare, Urban Development and sewage and biological waste, nitrogen Food and Civil Supply to Karbi is considered “reactive”, and it may be Anglong Autonomous Territorial polluting and even exert a potent Council and Dima Hasao Autonomous greenhouse gas (heat trapping) Territorial Council in Assam. effect. • Amendment in article 280 to mandate • Nitrous oxide (N2O) is 300 times more the Finance Commission to potent than carbon dioxide but isn’t as recommend devolution of financial prevalent in the atmosphere. resources. This will significantly • Other than air pollution, nitrogen is improve the financial resources and also linked to the loss of biodiversity, powers of the autonomous districts the pollution of rivers and seas, ozone councils. depletion, health, economy, and • Renaming of few existing autonomous livelihoods. councils as the present jurisdiction of • Nitrogen pollution is caused by these councils extend to more than emissions from chemical fertilisers, one districts. livestock manure and burning fossil • The proposed amendments provide fuels. for elected village municipal councils, • Gases such as ammonia (NH3) and ensuring democracy at the grass- nitrogen dioxide (NO2) contribute to roots level. poor air quality and can aggravate • Elections to these village and respiratory and heart conditions, municipal councils will be conducted leading to millions of premature by the State Election Commission. deaths across the world. There will be a provision for anti- • Nitrate from chemical fertilisers, defection too. manure and industry pollute the rivers • At least two nominated members in all and seas, posing a health risk for autonomous councils will be women. humans, fish, coral and plant life. Cabinet decides to strengthen Northeast Sixth Schedule autonomous councils • The Sixth Schedule of the Constitution • The cabinet approves landmark deals with the administration of the amendment to Article 280 and Sixth tribal areas in the four northeastern Schedule of the Constitution. states of Assam, Meghalaya, Tripura • This amendment will significantly and Mizoram as per article 244. improve the financial and executive • The governor is empowered to powers of the 10 autonomous councils increase or decrease the areas or in the Sixth Schedule areas of the change the names of the autonomous northeast. districts. • The amendment would impact a • While executive powers of the Union population of about 1 crore tribals extend in Scheduled areas with living in Assam, Meghalaya, Tripura respect to their administration in the and Mizoram, according to the Centre. 5th schedule, the 6th schedule areas Highlights of the proposed amendment remain within executive authority of • As per the proposed amendment, at the state. least one-third of the seats would be • The acts of Parliament or the state reserved for women in the village and legislature do not apply to municipal councils in the Sixth autonomous districts and autonomous Schedule areas of Assam, Mizoram regions or apply with specified and Tripura. modifications and exceptions. • The amendment also provides for the • The Councils have also been endowed transfer of additional 30 subjects with wide civil and criminal judicial including departments of Public powers, for example establishing Works, Forests, Public Health village courts etc. However, the 57 www.gradeup.co
jurisdiction of these councils is subject • The group will be selected out of them to the jurisdiction of the concerned with first preference given to people High Court. from ‘Girmitiya Countries’ such as Global Talent Competitive Index-2019 Mauritius, Fiji, Suriname, Guyana, • India secured 80th rank in the Global Trinidad and Tobago and Jamaica. Talent Competitive Index 2019. • Religious places of all major religions Related Information in India are included in the scheme Global Talent Competitive Index and Government will bear all the expenses including the airfare from • This Index helps to measures the their country of residence. ability of countries to compete for World's lightest satellite 'Kalamsat-V2' talent. • In its first mission of 2019, the ISRO • It is released by INSEAD business successfully launched a students' school in partnership with Tata satellite Kalamsat and an imaging Communications and Adecco Group. satellite Microsat-R from the Satish • Its theme is "Entrepreneurial Dhawan Space Centre in Sriharikota, Talent & Global Competitiveness". Andhra Pradesh. • This Index takes into account • This is also the 46th flight of ISRO's variables such as ease of hiring, workhorse PSLV. gender earnings gap, and the Kalamsat prevalence of training in firms. • It is a payload developed by students India’s Context and Chennai based Space Kidz India • India's biggest challenge is to improve for the first time. its ability to attract and retain talent. • The Microsat-R satellite is meant for • India needs to address its poor level the Defence Research and of Internal Openness in particular with Development Organisation (DRDO) respect to weak gender equality and purposes. low tolerances towards minorities and • The Kalamsat is the first to use the immigrant. rocket`s fourth stage as an orbital Indian Africa Field Training Exercise platform. IAFTX 2019 • ISRO is using the aluminium tank for • Indian Africa Field Training Exercise the first time in the fourth stage of the (IAFTX)-2019 was held in Pune. launch of PSLV C 44. This is to reduce Related Information the weight and increase the mass in IAFTX the four-stage engine expendable • It is a joint training exercise between rocket with alternating solid and liquid more than a dozen African countries & fuel. India. Related Information • The IAFTX-2019 is a positive step • In its last mission, on November 29, towards growing political and military 2018, ISRO successfully injected ties with the member nations of the India's earth observation satellite African continent and will boost the HysIS onboard PSLV C43 into its already strong strategic cooperation designated orbit. between the countries. Pravasi Teerth Darshan Yojana Jumbos to patrol Odisha’s Satkosia Tiger • Prime Minister launched Pravasi Reserve Teerth Darshan Yojana in New Delhi. • Patrolling in the Satkosia Tiger • Under this scheme, a group of Indian Reserve is set to be strengthened as origin currently in different nations two trained elephants would be will be taken to all religious places in deployed there shortly. India twice a year. • The two elephants are being brought Eligibility criteria for the scheme from the Similipal Tiger Reserve. • The person should be Indian origin Related Information and aged between 45 to 65. Satkosia Tiger Reserve 58 www.gradeup.co
• It is a tiger reserve located in the Related Information Angul district of Odisha. About the Scheme • It is located where the Mahanadi River • The scheme has been introduced by the passes through a 22 km long gorge in government of Kerala as part of welfare the Eastern Ghats mountains. measures towards Pravasi Malayalis. • The tiger reserve is located in the • Under the scheme, a regular pension Eastern Highlands moist deciduous would be provided to Non-Resident forests ecoregion. Keralites on a one-time payment of Rs • Saktosia Tiger Reserve was 5 lakh. designated in 2007 and comprises the • This onetime payment would be Satkosia Gorge Wildlife Sanctuary and deposited with KIIFB (Kerala the adjacent Baisipalli Wildlife Infrastructure Investment Fund Sanctuary. Board) for financing infrastructure Ministry of Defence Launches ‘RDP projects. INDIA 2019’ • The government had initiated Loka • Ministry of Defence had launched a Kerala Sabha (LKS) with the aim of mobile app 'RDP India 2019' on the using the expertise, talent, and Republic Day as a new initiative in resources of NRIs from Kerala for the sync with the Digital India campaign overall growth and development of of the Government. the state. • It helps to the intent of making India celebrates 70th Republic Day available the highlights of the • Republic day in India is celebrated Republic Day event, not only to the every year on 26th of January to spectators at Rajpath but also to the honor the Constitution of India as it general public all over the world. came into force on the 26 January • This app contains information about 1950. the Parade on Rajpath, New Delhi, • The theme of this republic day is: including Order of the March, details ‘life of Gandhi’ which is a tribute to the of the tableaux presented by different father of the nation Mahatma Gandhi States and Ministries, children cultural on his 150th birth anniversary. performances, fly past and names of • President Cyril Ramaphosa, President recipients of Pradhan Mantri Rashtriya of the Republic of South Africa is the th Bal Puraskar 2019. Chief Guest of this 70 Republic day. • It was extremely informative to the • This is the second time a South spectators witnessing the Parade and African leader is Chief Guest at was widely appreciated. Republic Day — Nelson Mandela was • The app also had the provision for live the chief guest in 1995. streaming of the Parade. Unique about this Republic day. President of India Graces National • The 70th Republic Day parade had the Voters’ Day Celebrations highest number of women officers • The President of India graced and participating in the celebrations with addressed the 9th National Voters’ Lt. Bhavana Kasturi leading a Day celebrations in New Delhi on 25 contingent of 144 male personnel. January. • This is the first time in the history of • The theme of Voters’ Day 2019 is, No Indian Army that a woman had led the voter to be left behind. Army services corps. • The day is to mark the Foundation day • An all-women contingent of Assam of the Election Commission of India, Rifles, India’s oldest paramilitary which was established on 25th force had participated for the first January 1950. time. Pravasi Dividend Pension Scheme • The weapons which showcased for the • The government of Kerala has first time in a Republic day parade are launched ‘Pravasi Dividend Pension M777 and K-9 Vajra ultra-light Scheme. howitzers along with the Medium- 59 www.gradeup.co
Range Surface-to-Air Missile (MRSAM) (b) However, should an award winner missile of the DRDO. consider it necessary, he/she may use the • `Sankhnaad’, a martial tune created expression in their biodata/ for the Indian armed forces, played letterhead/visiting card etc. to indicate that for the first time on the 70th Republic he/she is a recipient of the award. Day parade. “Yuva Swabhiman Yojana” for urban • Since Independence, the Indian youth defence forces have been playing • Madhya Pradesh government ‘martial tune’ created by the launched ‘Yuva Swabhiman Yojana’ Britishers. `Sankhnaad’ is based on for youths of the weaker section in Indian classical music. urban areas of Madhya Pradesh Related Information About the scheme • The Constitution came into effect on • The scheme was launched in January 26, 1950, a date specially Chhindwara Madhya Pradesh. chosen to coincide with the • It aims to provide employment to the anniversary of ‘Purna Swaraj Diwas’. youth belonging to the weaker section • January 26, 1930, was marked as of the society mainly in urban areas of ‘Purna Swaraj Diwas’, or the day the the state. nation would attain complete freedom • 100 days of employment will be from its colonizers by the Congress. provided under this scheme. Pranab Mukherjee, Nanaji Deshmukh, Crocodylus palustris, a crocodile species and Bhupen Hazarika awarded Bharat that is being removed from the Narmada Ratna • The mugger crocodile also called • President of Indian conferred the marsh crocodile or broad-snouted Bharat Ratna, the nation’s highest crocodile is a species (Crocodylus civilian honor, to former President palustris) native to freshwater Pranab Mukherjee, along with social habitats from southern Iran and activist Nanaji Deshmukh Pakistan to the Indian subcontinent (posthumous) & Assamese musician and Sri Lanka. Bhupen Hazarika (posthumous). • Gujarat Forest Department has started evacuating muggers from two Bharat Ratna ponds on the Sardar Sarovar Dam • Bharat Ratna is the highest civilian premises on the Narmada, to facilitate award of the Republic of India. a seaplane service at the Statue of • The provision of Bharat Ratna was Unity. introduced in 1954. • Already extinct in Bhutan and • There is no written provision that Myanmar, the mugger has been listed Bharat Ratna should be awarded to as vulnerable on the IUCN Red List Indian citizens only. since 1982. • It is awarded in recognition of • In India, it is protected under exceptional service/performance of Schedule I of the Wildlife Protection the highest order in any field of Act, 1972. human endeavor. • Among the six schedules in the Act, • The award was originally limited to Schedule I and part II of Schedule II achievements in the arts, literature, provide the highest degrees of science and public services but the protection to listed species, with the government expanded the criteria to most stringent penalties for offenders. include “any field of human endeavor” So its relocation or capture is in December 2011. definitely illegal without permission. Note: Habitats (a) Article 18 (1) of the Constitution said that • Vadodara, 90 km from the Narmada ‘the award cannot be used as a prefix or dam, is the only city in the country suffix to the recipient’s name. where crocodiles live in their natural habitat amidst human population. 60 www.gradeup.co
• Crocodiles from the Vishwamitri river, • Odisha, which accounts for over 40% where they number around 300, often per cent malaria burden of the entire enter people’s homes, giving rise to country, has reported about a 85% conflict and capture. decline in average monthly malaria • Most of these crocodiles are thereafter cases in the State. released in the Narmada dam waters, Related Information away from human habitats. Malaria Importance of crocodiles • It is caused by the protozoan parasite • Crocodiles are valued for their skin & flesh. Plasmodium. • In some cases, they are also • Malaria is typically found in tropical worshipped, including in the and subtropical climates where the Narmada. In idols of the Narmada parasites can live. Goddess, a crocodile is her vehicle; there is an idol on the premises of the • According to The World Health Narmada Dam. Organization’s World Malaria • Goddess Khodiyar Maa, who is Report of 2018 worshipped by a section of Gujaratis, (a) India is the only country among is also seen riding a crocodile as a the 11 highest-burden countries that symbol of her supremacy over land saw substantial progress in reducing and water. disease burden. Indian Railways’ fastest "Train 18" (b) India had pledged to eliminate the named "Vande Bharat Express" disease by 2030 at the East Asia • India’s first indigenously built Summit, 2015. engineless semi-high speed train, (c) India has launched the five-year Train 18, has been named Vande National Strategic Plan for Malaria Bharat Express. Elimination (NSPME) (2017-2022) • The train is set to run between Delhi & which focused on malaria “control” to Varanasi at a maximum speed of 160 “elimination”. kmph. (d) NSPME includes the target of • The 16-coach train, built in 18 months ending malaria in 571 districts out of at a cost of Rs 97 crore by the Modern India’s 678 districts by 2022. Coach Factory, Rae Bareli. National Chilika Bird Festival • It’s also the first locomotive-less train • The second National Chilika Bird in the country. Festival started at Mangalajodi in • It is a fully air-conditioned train. Chilika. Odisha govt launched "DAMaN" • The festival is organised to promote initiative to control malaria eco-tourism and preservation of birds • Odisha Government had launched a in Odisha. malaria control programme – • It is jointly organized by Odisha "Durgama Anchalare Malaria Tourism and Chilika Development Nirakaran (DAMaN)" initiative. Authority. • This programme involves mass • The National Chilika Bird Festival screening for malaria with the Award was awarded to Mangalajodi treatment of positive cases along with Ecotourism Group for their active intensified surveillance, mosquito involvement in bird protection. control measures and regular health education activities throughout the Chilika Lake year. • Chilika lake, located in the coastal Odisha is Asia's largest brackish water • District Health Information System 2 lagoon. (DHIS2), open-source web-based • Chilika Lake with its rich bio-diversity surveillance for malaria is used for and socio-economic importance has mass screening and treatment of been a designated Ramsar site (a patients in inaccessible areas. Status of Odisha in Malaria 61 www.gradeup.co
wetland of international importance) • Zearalenone is a fungal toxin infesting since 1981. cereals such as wheat, maize and • It lies in the Central Asian Flyway for barley. birds, is a major stopover for • The recent numerous studies detected migratory birds from the Arctic and zearalenone in wheat, rice, corn and the Sub-Arctic regions in the course of oats from markets in Uttar Pradesh. their onward and return migration • It attacks crops while they are along the east coast. growing, but can also develop when Odisha govt launched Project "Jiban cereals are stored without being dried Sampark" fully. • Odisha has launched Jiban Sampark What is the issue? project for the welfare of the • Fungal toxins are commonly found in Particularly Vulnerable Tribal Groups food and can be a public health (PVTG). concern. Jiban Sampark Project • India regulates the levels of some of • The Project is being undertaken in these, including aflatoxin, association with UNICEF. deoxynivalenol, ergot and patulin. • It aims to generate awareness among • The first three infest cereals, while PVTGs in Odisha on various patulin is found in apples. development and welfare initiatives of • Each of these toxins has been State Government, especially on associated with disease outbreaks. women and child welfare. • Chronic aflatoxin consumption has • The focus areas of the Project are skill been shown to cause liver cancer. development, empowering • The International Agency for Research communities, cooperation and on Cancer (IARC) classifies aflatoxin innovation among the tribal groups. as a Group 1 carcinogen, meaning Particularly Vulnerable Tribal Groups there is enough evidence for its (PVTGs) carcinogenicity. • The PVTGs are the marginalized Non-communicable diseases top killers section of the Scheduled tribes of in South-East Asia: WHO India. • According to WHO, Non- • This section who are relatively communicable diseases (NCDs)- isolated, educationally and socio- mainly cardiovascular diseases, economically backwards, living in a chronic respiratory diseases, diabetes habitat far away from amenities. and cancer — continue to be the top • PVTG is not a Constitutional category, killers in the South-East Asia Region. nor are these constitutionally Outcomes of the Report recognized communities. • The four ‘major’ NCDs are caused, to • It is a government of India a large extent, by four modifiable classification, created with the behavioural risk factors: purpose of enabling improvement in (a) tobacco use the conditions of certain communities (b) unhealthy diet with, particularly low development. (c) insufficient physical activity • The criteria followed for determination (d) harmful use of alcohol of PVTGs are as under: • Non-communicable diseases such as (a) A pre-agriculture level of diabetes, cancer and heart disease, technology are collectively responsible for over (b) A stagnant or declining population 70% of all deaths worldwide, or 41 (c) Extremely low literacy million people. (d) A subsistence level of the • These include 15 million people dying economy prematurely, aged between 30 & 69. Zearalenone Toxin How this can be reduced? • A study conducted worldwide has noted that consuming fibre and whole 62 www.gradeup.co
grains can reduce health risks from J&K Governor grants quota for J&K’s non-communicable diseases such as Pahari community heart disease. • Governor of Jammu and Kashmir has • The eating fibre-rich foods reduce the given his approval for the Kashmir incidence of coronary heart disease, Reservation (Amendment) Bill, 2014, stroke, type 2 diabetes and colorectal providing reservation to the persons cancer by 16% to 24%. belonging to Pahari community of the • Higher fibre intake is also associated State. with lower body weight, systolic blood • The legislation is aimed at providing pressure and total cholesterol when job opportunities to the Pahari people compared with lower intake. residing in backward areas of the Project Cosmic Microwave Background State. (CMB)-Bharat Pahari Community • The scientific space project CMB- • Pahari is a linguistic group, comprising Bharat has been presented as a both Muslims and Hindus, and is proposal to the ISRO. mainly located in Poonch, Rajouri, • The project is developed by the Inter- Kupwara and Baramulla districts. University Centre for Astronomy and • Because of the remoteness and Astrophysics (IUCAA), Pune. inaccessibility of the areas of their The project is expected to reveal the • residence, the Pahari community has first clear sign of quantum gravity and historically faced considerable ultrahigh energy physics in the very economic distress leading to overall early universe. socio-economic backwardness. • It proposes near-ultimate survey Kondaveedu Buddhist remains date back polarisation that would exhaust the to Satavahana period primordial information in the Gold- • The Department of Archaeology and mine for cosmology. Museums has found Buddhist remains • The project aims to map all dark under the ‘garbhagriha’ (sanctum matter and most baryons in the sanctorum) of Sivalayam at observable universe. Kondaveedu fort (Guntur, Andhra Atal Setu of Goa Pradesh). • Goa Chief Minister inaugurated the “Atal Setu” on the Mandovi river in • The remains date back to later Goa. Satavahana period--1st to 2nd • It is a four-lane 5.1-km long cable- century A.D. stayed bridge connects state capital Former Finance Commission chairman Panaji with north Goa. Vijay Kelkar pitches for setting up 'Niti Related Information Aayog 2.0' Mandovi River • Former Finance Commission chairman Vijay Kelkar has pitched for setting up of • Mandovi, also known as the Mahadayi a 'new Niti Aayog' or Niti Aayog 2.0. river is regarded as the lifeline of Goa. • Socialist-era Planning Commission • The river originates from Bhimgad in was replaced by think-tank Niti Aayog the Western Ghats in the Belagavi on January 1, 2015, by the Modi district of Karnataka. government. • The catchment area in Goa, Why does India need Niti Aayog 2.0? Karnataka and Maharashtra • Kelkar, in a paper titled 'Towards respectively. India's New Fiscal Federalism', argued • Owing to the differences over the that replacing the Planning sharing of the river water among the Commission by the Niti Aayog, a think states of Goa, Karnataka and tank, has reduced the government's Maharashtra, the union government policy reach. has constituted Mahadayi Water • It is desirable that a functionally Disputes Tribunal to examine the distinct entity such as the new Niti claims made by the states. Aayog or Niti Aayog 2.0 be put to use 63 www.gradeup.co
to do the job at hand related to the • The scheme has identified 13 structural issues including removal of thematic circuits for development: regional imbalances in the economy. 1. Buddhist Circuit • The Niti Aayog 2.0 will be responsible 2. North-East India Circuit for allocating development or 3. Coastal Circuit transformational capital or revenue 4. Himalayan Circuit grants to the states. 5. Krishna Circuit • In order to make the new Niti Aayog 6. Desert Circuit more effective, it is essential to 7. Eco Circuit ensure that the institution is at the 'High Table' of decision making of the 8. Wildlife Circuit government. This means the vice- 9. Tribal Circuit chairman of the new Niti Aayog will 10. Rural Circuit need to be a permanent invitee of the 11. Spiritual Circuit Cabinet Committee on Economic 12. Ramayana Circuit Affairs (CCEA). 13. Heritage Circuit • The new Niti Aayog need not be Success for golden langur breeding involved with the approval of the project in Assam state's annual expenditure • Assam Environment and Forest programmes. It should rather strive Minister announced the success of the to be a think-tank with 'praxis' Golden Langur Conservation Breeding possessing considerable financial Programme in the State. muscle and devote its energies to • The golden langur conservation outline coherent medium- and long- project was undertaken at the Assam term strategy and corresponding State Zoo in Guwahati during the investment resources for 2011-12 fiscal which is funded by the transforming India," he suggested. Central Zoo Authority. Related Information First Swadesh Darshan project in Sikkim Golden langur • Union Minister for Tourism • It is an Old-World monkey found in a inaugurated the first Swadesh small region of western Assam, India Darshan project in Sikkim. and in the neighbouring foothills of • The project “Development of North the Black Mountains of Bhutan. East Circuit: Rangpo– Rorathang- • It is one of the most endangered Aritar- Phadamchen- Nathang- primate species in India. Sherathang- Tsongmo- Gangtok- • Its IUCN status is endangered. Phodong- Mangan- Lachung- ICAR launches National Agricultural Yumthang- Lachen- Thangu- Higher Education Project (NAHEP) Gurudongmer- Mangan- Gangtok- • ICAR has launched an ambitious Tuminlingee- Singtam” implemented National Agricultural Higher Education under Swadesh Darshan Scheme of Project (NAHEP). Ministry of Tourism, Government of • This project will be funded by the India. World Bank and the Indian Related Information Government on a 50:50 basis. Swadesh Darshan Scheme • The aim of the project to attract talent • Launched by the Ministry of Tourism. and strengthen higher agricultural • Launched in 2014-15. education in the country. • For the integrated development of Related Information theme-based tourist circuits in the • Student READY (Rural Entrepreneurship country. Awareness Development Yojana) • It also has a provision for voluntary scheme is being run in order to funding under Corporate Social promote the participation of students Responsibility (CSR). in agricultural business.
64 www.gradeup.co
• Under the scheme, practical essential for full participation in experience of agriculture and modern societies. entrepreneurship is provided to • It would lead to recognition and undergraduate students. acceptability of Indian students and • Recently, the second Indian prepare them for the global economy Agricultural Research Institute (IARI) in the 21st century. of the country was -also established in • India had taken part in Programme for Barahi, Jharkhand. International Student Assessment Jewellery gets a ‘council’ (PISA) in 2009 and bagged the 72nd • The Commerce Ministry announced rank among 74 participating the formation of a Domestic Council countries. for Gems & Jewellery. • Then UPA government had boycotted • It will help to bring the industry’s PISA, blaming “out of context” domestic business stakeholders under questions for India’s dismal one umbrella so that they could performance. evolve a unified approach to promote What are the key features of PISA? growth in the sector. • PISA is a triennial international survey • This Council will help in tapping new (every three years) which aims to opportunities in the already existing evaluate the education system large domestic market. worldwide by testing the skills and • The first priority of the Domestic knowledge of 15-year-old students. Council should be to uplift the living • Students are assessed in reading, standards of artisans. mathematics, science and Indian students to participate in PISA collaborative problem-solving. 2021 • The HRD Ministry signed a pact with • Participation in PISA allows the Organisation for Economic benchmarking performance against a Cooperation and Development wide range of countries. (OECD) for the participation in Tata veterans join hands with Quantum Programme for International Student for $1Bn ESG fund Assessment- PISA 2021. • Three former Tata Group executives • PISA-2021 is a competency-based in partnership with Quantum Advisors test, which tests the learning levels of will launch a $1 billion Environment, 15-year-old students in reading, Social and Governance (ESG) Fund. mathematics and science. About the Fund • With the signing of the pact, Indian • The fund will invest mainly in listed students aged 15 will be able to take mid-cap companies that are doing the Programme for International well on the environment, social and Student Assessment or PISA, which is governance (ESG). conducted every three years. • The proposed equal joint venture (JV) India’s participation in PISA would mobilise funds from long-term • Schools run by Kendriya Vidyalaya foreign investors such as pension Sangathan (KVS), Navodaya funds, sovereign wealth funds and Vidyalaya Samiti (NVS) and schools in family offices of high net-worth the UT of Chandigarh will participate. individuals (HNIs) who value ESG. • Within the country, PISA covers a sample of 15-year-old students • The fund will aim to drive higher ESG representing all forms of schooling i.e. performance in Indian corporates and public, private, private aided etc. it will adopt an engaged, private • PISA is a competency-based equity approach to public markets assessment which unlike content- investing, with a focus on working based assessment, measures the with companies willing to recognize extent to which students have the long-term advantages of actively acquired key competencies that are adopting ESG standards of excellence. 65 www.gradeup.co
Ganga Expressway: World’s longest • The global steel body in its latest expressway report noted that China’s crude steel • The government of Uttar Pradesh has output jumped 6.6 Percent to 928.3 approved the construction of the million tonnes (MT) in 2018 from Ganga Expressway. 870.9 MT in 2017. About the Expressway • India’s crude steel production in 2018 was at 106.5 MT, up by 4.9 Percent • The expressway will provide for better from 101.5 MT in 2017. connectivity of the Prayagraj Japan produced 104.3 MT in 2018, (Allahabad) to Western Pradesh. • down 0.3 per cent compared to 2017. • National Expressways Authority of • The United States is at the 4th India under the Ministry of Road position as the country produced 86.7 Transport and Highways is MT of crude steel in 2018. responsible for the construction and Related Information maintenance of expressways. World Steel Association • The expressway starting from Meerut • It is one of the industry associations will pass through Amroha, in the world. Bulandshahr, Badaun, Shahjahanpur, • Its members represent around 85 Farrukhabad, Hardoi, Kannauj, Percent of the world’s steel Unnao, Rae Bareli, Pratapgarh before production, including over 160 steel reaching Prayagraj. producers with 9 of the 10 largest New Delhi superbug gene reaches the steel companies, national and Arctic regional steel industry associations, • Recently the Scientists have found a and steel research institutes. superbug gene ‘blaNDM-1’ in the • It is a non-profit organisation with its Arctic region. headquarters in Brussels, Belgium. • blaNDM-1 stands for ‘New Delhi The IEA’s Report - “The Future of Rail” Metallo-beta-lactamase-1’. • Ministry of Railways & Coal launched • It was first detected in New Delhi over “The Future of Rail” report of a decade back. International Energy Agency (IEA). • Soil samples taken in Svalbard region About the Report have confirmed the spread of blaNDM- • It is the first-of-a-kind report analyses 1 into the High Arctic. the current and future importance of • Svalbard region is located in a rail around the world through the Norwegian archipelago between perspective of its energy and mainland Norway and the North Pole. environmental implications. • This Antibiotic-Resistant Gene (ARG) • The report reviews the impact of is originally found in Indian clinical existing plans and regulations on the settings. future of rail and explores the key • The superbug provides multi-drug policies that could help to realise an resistance (MDR) in microorganisms. enhanced future rail. India replaced Japan as second top steel • The report has a focus on India, producer elaborating on the unique social and economic role of rail in India, together • India has replaced Japan as the with its great enduring potential, to world’s second-largest steel show how India can extend and producing country, while China is the update its networks to harness rail at largest producer of crude steel a scope and scale that is unparalleled. accounting for more than 51 Percent International Energy Agency of production. • It is an inter-governmental • It was stated by the World Steel organisation that works to ensure Association (worldsteel) in its latest reliable, affordable and clean energy report. for its 30-member countries and 8 association countries. 66 www.gradeup.co
• Its secretariat is in Paris. Corruption Perceptions Index 2018 • It was established in the framework of • The 2018 Corruption Perceptions the Organisation for Economic Co- Index (CPI) released by Transparency operation and Development (OECD) in International. 1974 in the wake of the 1973 oil crisis. • It reveals that the continued failure of • Its mission is guided by four main most countries to significantly control areas of focus: corruption is contributing to a crisis of o Energy security democracy around the world. o Economic development • More than two-thirds of countries score below 50, with an average score o Environmental awareness of only 43. o Engagement worldwide. • Denmark and New Zealand top the Note: India has been the focus of many Index with 88 and 87 points, recent IEA analyses and reports for instance respectively. through the special focus chapter on the • Somalia, South Sudan, and Syria are Indian Power sector of the Energy at the bottom of the index, with 10, Technology Perspectives (ETP) publication 13 and 13 points, respectively. and the World Energy Outlook (WEO). • The highest scoring region is Western Inosine-5′-monophosphate Europe and the European Union, with dehydrogenase (IMPDH): new an average score of 66, while the compound to fight stomach infections lowest scoring regions are Sub- • Scientists at the IIT, Gandhinagar Saharan Africa (average score 32) have synthesized a new compound and Eastern Europe and Central Asia "IMPDH" that may help treat (average score 35). stomach infections caused by India Position common bacteria, Helicobacter pylori. • India has been ranked at 78th place • The inhibitor is based on an aromatic out of 180 countries in ‘Corruption chemical compound, indole. Perception Index’ (CPI) released by • It may help in treating H. pylori Transparency International in 2018 infection which is a cause for gastritis, against 81st in the Year 2017. peptic ulcers and stomach cancers. • India marginally improved its score to Related Information 41 (from 40 in 2017). • For the study, scientists isolated About Index IMPDH gene from H. Pylori and • The index ranks the countries by their express edits protein. perceived levels of public sector • The study also showed that the corruption according to experts and inhibitor specifically targets the business people. Inosine-5′-monophosphate • It uses a scale of 0 to 100, where 0 is dehydrogenase protein of the highly corrupt and 100 is very clean. bacterium and not humans making it ISRO sets up Human Space Flight Centre safe for human use. in Bengaluru for manned • It is estimated that about of half of the • ISRO unveiled its Human Space Flight global population may be infected Centre in Bangalore where astronauts with H. pylori. get their training. • While the symptoms of this infection mostly go unnoticed, it is a cause of Related Information diseases like gastritis and ulcers. Human Space Flight Centre (HDFC) • In India, the burden of this infection is • HSFC shall be responsible for almost 80% in rural areas due to poor implementation of Gaganyaan project which involves end-to-end mission hygiene and healthcare facilities. planning, development of engineering • Currently, the infection is treated systems for crew survival in space, either with clarithromycin-based crew selection and training and also therapy or by a mix of this therapy and antibiotics. 67 www.gradeup.co
pursue activities for sustained human inaugurated by the Italian Prime space flight missions. Minister at Rome. • It will take the support of existing • The centre has been opened by the ISRO centres to implement the first Italian government in association with development flight of Gaganyaan the United Nations Development under the human spaceflight Programme (UNDP) and the Food and programme. Agricultural Organisation (FAO). • The space agency is gearing up for the Related Information human spaceflight programme by About the Centre 2021-end that is likely to include a • The centre’s origin can be traced to a woman astronaut. declaration endorsed by the G7 • The plan is to have the first unmanned meeting of the Environment Ministers mission in December 2020 and second in 2017. for July 2021. • The centre would facilitate DDA to launch an online portal for land coordination among the G7 and pooling policy on Feb 5 African countries on common The Delhi Development Authority • initiatives in Africa to achieve the (DDA) will launch an online portal for goals set by the Paris Agreement and the land pooling policy. the 2030 Agenda. Land Pooling Policy • It will provide a fast-track, demand • The policy will cover “urbanisable driven mechanism for African areas of urban extensions in 95 countries to access grant resources villages. that support policies, initiatives, and • Under the policy, the Floor Area Ratio best practices on climate change, food (FAR) has been reduced to 200 as security, access to water, clean opposed to initially proposed FAR of energy. 400. • And also accelerating progress on the • A landowner must have at least two Sustainable Development Goals hectares of land to be eligible to (SDGs) in Africa. participate in the policy, which aims to accommodate 76 lakh people. Implementation Models under the • The urban body will act as a Pradhan Mantri Jan Arogya Yojana “facilitator and planner” under the • The Pradhan Mantri Jan Arogya policy and transfer of land to the DDA. Yojana (PM JAY) proposes three Aber: Digital currency models through which the states can • Aber is a digital currency which is implement the scheme. recently launched by the central These are: banks of the UAE and Saudi Arabia. 1. Insurance Model: Under this Model, • It will be used for financial the premiums are paid to the settlements between the two insurance company, which countries through Blockchains and administers and pays the claim. Distributed Ledgers technologies. 2. Trust-based model: Under this • Digital Currency is part of the efforts Model, each State forms its own trust to adopt new technologies like to manage the scheme and claims will Blockchain, Artificial Intelligence, be disbursed from a corpus created Internet of Things, in line with the from central and State government Fourth Industrial Revolution that is contributions. reshaping governments and 3. Hybrid model: Under this Model, a corporations around the world. part of the claim comes under the Africa Centre for Climate and insurance model while the balance Sustainable Development gets processed under the trust. • The Africa Centre for Climate and Related Information Sustainable Development was
68 www.gradeup.co
About Pradhan Mantri Jan Arogya Caste Census (SECC) data will have Yojana health benefits cover of Rs Five Lakhs • PMJAY is a scheme of the government per family per year at free of cost. under Ayushman Bharat which aims • PM-JAY seeks to accelerate India’s to reduce the financial burden on poor progress towards the achievement of and vulnerable groups arising out of Universal Health Coverage (UHC) and the catastrophic hospital. Sustainable Development Goal 3 • Under the PM-JAY scheme, about which calls for ensuring healthy lives 10.74 crores poor, deprived rural and promote well-being for all at all families and identified occupational age. categories of urban workers’ families as per the latest Socio-Economic
69