www.gradeup.co

1 www.gradeup.co

Daily Current Affairs for UPSC IAS Preparation

01.01.2019 2. Cabinet approves Coastal Regulation Zone (CRZ) 1. Kashmir Stag (Hangul) Notification 2018 • Recently The Union Cabinet has • Recently it is found that Kashmir Stag approved the Coastal Regulation Zone has begun using an old migratory (CRZ) Notification, 2018 which was route has given fresh hoped to last reviewed and issued in 2011. conservationists. • In 2014, Ministry of Environment Kashmir stag constituted a committee under the • The Kashmir stag, also called hangul, chairmanship of Dr. Shailesh Nayak to is a subspecies of elk native to . recommend changes in the CRZ • It is found in dense riverine forests in Notification, 2011 and submitted its the high valleys and mountains of the recommendation in 2015. Kashmir Valley and northern Chamba • CRZ 2018 notification includes many district in . recommendations of the committee. • In Kashmir, it's found in the Dachigam Benefits National Park where it receives • The proposed CRZ Notification, 2018 protection but elsewhere it is more at will lead to enhanced activities in the risk. coastal regions thereby promoting • Earlier believed to be a subspecies of economic growth while also red deer, a number of mitochondrial respecting the conservation principles DNA genetic studies have revealed of coastal regions. that the hangul is part of the Asian • It will not only result in significant clade of the elk. employment generation but also to a better life and add value to the • It is the state animal of and economy of India. The new Kashmir. notification is expected to rejuvenate Distribution and ecology the coastal areas while reducing their • This deer found in dense riverine vulnerabilities. forests, high valleys, and mountains Silent Features: of the Kashmir valley and northern 1. Allowing FSI as per current norms in Chamba in Himachal Pradesh. CRZ areas: • In Kashmir, it's found in the Dachigam 2. In the CRZ, 2018 Notification, ‘Floor National Park (at elevations of 3,035 Space Index (FSI)’ or ‘Floor Area Ratio meters), Rajparian Wildlife Sanctuary, (FAR)’ has been decided to de-freeze Overa Aru, Sind Valley, and in the for CRZ-II (Urban) areas. forests of Kishtwar&Bhaderwah. 3. Earlier, as per CRZ 2011, it was frozen. Dachigam National Park 4. CRZ 2018 permits FSI for construction • The Dachigam National Park (DNP) is projects. This will enable located at Umaria district in Jammu redevelopment of these areas to meet and Kashmir (J&K). the emerging needs. 5. Densely populated rural areas to be • The main animal species that afforded greater opportunity for Dachigam is known for is the hangul development: (or the Kashmir stag). For Rural areas, two separate categories • Other species include Musk deer, have been stipulated as below: Leopard, Himalayan serow, 1. CRZ-III A – Himalayan grey langur, Leopard cat, These are densely populated rural Himalayan black bear, etc. areas with a population density of Topic- GS Paper 3 – Environment 2161 per square kilometer as per Source- The Hindu 2011 Census. 2 www.gradeup.co

These areas will have a No 3. Digital Detox: An app to cure your Development Zone (NDZ) of 50 mobile addiction meters from the High Tide Line (HTL) • Doctors at the National Institute of as against 200 meters from HTL in the Mental Health and Neuro Sciences CRZ 2011. (NIMHANS) have come up with a 2. CRZ-III B – mobile app Digital Detox application These rural areas have a population that helps people reduce their mobile density of below 2161 per square usage. kilometer as per 2011 Census. Related Information Such areas will continue to have an • The app asks users to specify their NDZ of 200 meters from the HTL. addiction-related symptoms, such as • Tourism infrastructure for basic sleep disturbance, eye strain, amenities to be promoted: loneliness, boredom, or excess i) Temporary tourism facilities such as Facebook usage. shacks, toilet blocks, change rooms, • It asks users if their mobile usage drinking water facilities etc. have now affects their academics, work or been permitted in Beaches. interpersonal relationships, and has a ii) Such temporary tourism facilities feature where you also have the are also now permissible in the ‘No option of sharing your progress with Development Zone (NDZ)’ of the CRZ- friends. III areas as per the Notification. • The study found that 75.6% of the iii) However, a minimum distance of app’s users changed their mobile use 10 m from HTL should be maintained pattern and showed a significant for setting up of such facilities. reduction in the time spent on • CRZ Clearances in various zones have technology. been streamlined. Topic- GS Paper 2 – Health Issues • A No Development Zone (NDZ) of 20 Source- The Hindu meters has been stipulated for all Islands. 4. Centre extends AFSPA in • All Ecologically Sensitive Areas have been accorded special importance. • Recently, the entire State of Nagaland • Specific guidelines related to their has been declared ‘disturbed area’ for conservation and management plans six more months, till June 2019, have been drawn up as a part of the under the controversial AFSPA. CRZ Notification. • AFSPA empowers security forces to a) Ministry of Environment has been conduct operations anywhere and tasked to clear only those projects arrest anyone without any prior which are located in, i) CRZ-I notice. (Ecologically Sensitive Areas) ii) CRZ • Article 355 of the Constitution of India IV (area covered between Low Tide confers power to the Central Line and 12 Nautical Miles seaward). Government to protect every state b) The powers for clearances with from internal disturbance. respect to CRZ-II and III have been Related Information delegated at the State level with Armed Forces (Special Powers) Act necessary guidance. • Armed Forces (Special Powers) Acts Background (AFSPA), are Acts of the Parliament of • With the objective of conservation and India that grant special powers to the protection of the coastal environment, Indian Armed Forces in which each act Ministry of Environment and Forest terms "disturbed areas". and Climate Change notified the • According to The Disturbed Areas Coastal Regulation Zone Notification (Special Courts) Act, 1976 once in 1991, which was subsequently declared ‘disturbed’, the area has to revised in 2011. maintain the status quo for a Topic- GS Paper 2 – Governance minimum of 3 months. Source-PIB

3 www.gradeup.co

• One such Act passed on September 3. The ancient Neemrana Baori in 11, 1958, was applicable to the Naga 's Alwar district Hills, then part of . 4. The Group of Temples at • In the following decades it spread, RanipurJharail in 's Bolangir one by one, to the other Seven Sister district States in India's northeast(at present 5. The Vishnu Temple in Kotali, it is in force in Assam, Nagaland, district, . excluding municipal Related Information council area, Changlang, Longding, • In 2016 and 2017, no new monument and Tirap districts of Arunachal was included in the list of sites of Pradesh). national importance. • Another one passed in 1983 and • The last monument to be included in applicable to Punjab and the list, in 2015, was the Vishnu was withdrawn in 1997, roughly 14 Temple in Nadavayal in 's years after it came to force. Wayanad district. History Note: A "Monument of National Importance" • The Armed Forces Special Powers is designated by the Archaeological Survey of Ordinance of 1942 was promulgated India and includes the following. by the British on 15 August 1942 to 1. The remains of an ancient monument. suppress the Quit India Movement. 2. The site of an ancient monument. • Modeled on these lines, four 3. The land on which there are fences or ordinance- protective covering structures for o the Bengal Disturbed Areas preserving the monument. (Special Powers of Armed 4. Land by means of which people can Forces) Ordinance freely access the monument. o the Assam Disturbed Areas Topic- GS Paper 1 – Art and Culture (Special Powers of Armed Source- The Hindu Forces) Ordinance 6. Makaravilakku festival begins in o the East Bengal Disturbed Sabarimala Areas (Special Powers of Related Information Armed Forces) Ordinance • The festival includes the o the United provinces Disturbed Thiruvabharanam (sacred ornaments Areas (Special Powers of of Ayyappan) procession and a Armed Forces) Ordinance congregation at the hill shrine of • These ordinances were invoked by the Sabarimala. central government to deal with the • Makaravilakku is a part of a religious internal security situation in the ritual that is practiced in the past by country in 1947 which emerged due to the tribes in the forest of the Partition of India. Ponnambalamedu (the place where Topic- GS Paper 3 – Defence Makaravilakku appears) and then Source- The Hindu later secretly continued by The 5. ASI declared 6 monuments of Travancore Devaswom Board (TDB). national importance in 2018 • It has been practiced for more than • Recently six monuments declared hundreds of years by the tribes. protected and of national importance Sabarimala by the Archaeological Survey of India • Sabarimala is a temple complex (ASI) in 2018. located at the Periyar Tiger Reserve in These monuments are: the state of Kerala, India. 1. The 125-year-old Old High Court • The temple is dedicated to the Hindu Building in , deity Ayyappan also known as 2. Two Mughal-era monuments in Agra Dharma Sastha, who according to — Haveli of Agha Khan and Hathi belief is the son of Shiva and feminine Khana. incarnation of Vishnu.

4 www.gradeup.co

• The traditions of Sabarimala are a Island as Shaheed Dweep and the confluence of Shaivism, Shaktism, Havelock Island as Swaraj Dweep. Vaishnavism, and other Śramaṇa Related Information traditions. Andaman and Nicobar Islands Sabarimala Case Verdict • The Andaman and Nicobar Islands, • In response to a PIL filed in 1991, the one of the seven union territories of Kerala High Court had observed the India, are a group of islands at the restriction of entry of women (in the juncture of the Bay of Bengal and the 10-50 age groups) to the temple was Andaman Sea. in accordance with the usage prevalent from time immemorial. • The territory is about 150 km (93 mi) • In lieu of this, it had directed the north of Aceh in Indonesia and Devaswom Board to uphold the separated from Thailand and customary traditions of the temple. Myanmar by the Andaman Sea. • However, on 28th September 2018, • It comprises two island groups, the the Supreme Court of India Andaman Islands (partly) and the overturned the ban on the entry of Nicobar Islands, separated by the 150 women, declaring that the selective km wide Ten Degree Channel (on the ban on women was unconstitutional 10°N parallel), and discriminatory. • The Andaman Sea lies to the east and Topic- GS Paper 1 – Art and Culture the Bay of Bengal to the west. Source- The Hindu • The islands host the Andaman and 7. Center launches a sanitary pad- Nicobar Command, the only tri- making initiative service geographical command of the • Recently Ministry of Petroleum Indian Armed Forces. launched the Ujjwala Sanitary • The Andaman Islands are home to the Napkins initiative. Sentinelese people, an uncontacted • This initiative launched with the help people. of three oil marketing companies – • The Sentinelese are the only people IOCL, BPCL, and HPCL currently known to not have reached Related Information further than a Paleolithic level of • This mission is a part of the CSR technology. initiative of OMCs in Odisha. Topic- GS Paper 1 – Art and Culture • It is aimed to educate women on female hygiene and health, improve Source- The Hindu accessibility to low cost eco-friendly sanitary pads and boost rural 02.01.2019 employment and economy. • The Ujjwala pads will be made of 1. ISRO launches ‘Samwad with virgin wood pulp sheet, non-woven Students’ white sheet and a gel sheet which are • As part of the enhanced outreach all biodegradable in nature and will programme of ISRO, a platform leave a minimal carbon footprint. named “Samwad with Students” has Topic- GS Paper 2 – Governance been launched. Source- The Hindu • The Samwad with Students aims to 8. Ross Island is now Netaji Dweep constantly engage youngsters across • Recently Prime Minister announced India to capture their scientific the renaming of three islands of the temperament. Andaman and Nicobar archipelago as • The new conversation mission will a tribute to Netaji Subhas Chandra inspire students cutting across Bose. schools and colleges. • The Ross Island was renamed Netaji • The first SwS event saw 40 wards and Subhas Chandra Bose Dweep, Neil 10 teachers from selected schools. Related Information 5 www.gradeup.co

Indian Space Research Organisation 3. NASA’s New Horizons spacecraft (ISRO) became the first explorer to fly • Its headquartered in the city of past the "Ultima Thule" Bengaluru. • NASA’s New Horizons spacecraft • Its vision is to "harness space became the first explorer to fly past technology for national development the mysterious object called "Ultima while pursuing space science research Thule" which is located some 4 billion and planetary exploration." miles from Earth. • It is managed by the Department of Related Information Space, which reports to the Prime Ultima Thule Minister of India. • Ultima Thule is located in the Kuiper • Its Motto is - Space technology in the belt in the outermost regions of the service of humankind Solar System, beyond the orbit of Topic- GS Paper 2 –Governance Neptune. Source-PIB • Ultima Thule means ‘beyond Thule’, 2. Export Promotion Council Cell beyond the borders of the known Established for MSME Sector world, symbolizing the exploration of • Ministry of Micro, Small and Medium the distant Kuiper Belt and Kuiper Belt Enterprises (MSME) has established objects. an Export Promotion Cell. • It is the farthest and quite possibly the • It will: oldest, a cosmic body ever (i) create a sustainable ecosystem for photographed by humankind. entire MSME development. • It measures approximately 30 km in (ii) Evaluate readiness of MSMEs to diameter and is irregularly shaped. export their products and services. New Horizons (iii) Recognize areas where • It was launched in 2006 and has been improvements are required in order to traveling through space for the past be able to export effectively and nine years. efficiently • New Horizon’s core science mission is (iv) Integration of MSME into the to map the surfaces of Pluto and global value chain. Charon, to study Pluto’s atmosphere Composition and to take temperature readings. • It will be chaired by Secretary, M/o Topic-GS Paper 3–Science & Technology MSME and Co-chaired by Source- Indian Express Development Commissioner, M/o 4. SlDEAD35: Gene that helps tomato MSME. fight viral infection, heat stress • The council will comprise of senior • Scientists at New -based officials and members from M/o National Institute of Plant Genome MSME, Commerce, MSME Export Research (NIPGR) have deciphered Promotion Councils, Export the critical role of a single gene— Development Authorities, Commodity SlDEAD35—in tomato plant whose Boards, and other bodies. expression controls its response to Objectives both heat stress and viral infection. • Target of USD 100 billion of exports • Developing systems for tolerance or from India by 2020. resistance against combined stresses • Evaluate readiness of MSMEs to is important for future crop export their products and services. production. • Recognize areas where improvements Related Information are required in order to be able to • It has been known that RNA helicases, export effectively and efficiently. one of the largest gene families that • Integration of MSMEs into Global function in almost all aspects of RNA Value Chain. metabolism, play a role in growth, Topic- GS Paper 3 – Economics development and stress response of a Source- The Hindu species. 6 www.gradeup.co

• They are present in most of the • Ministry of Power said that India is organisms ranging from bacteria to likely to achieve 100 percent humans, as well as plants. household electrification before 2019 • However, its role in the tomato plant’s Republic Day. response to environmental stresses Recent Scenario was not known. • India has already provided electricity • Now team observed that two genes access to 2.39 crore out of the (SlDEAD23 and SlDEAD35) help targeted 2.49 crore households under plants withstand biotic and abiotic the Pradhan Mantri Sahaj Bijli Har stresses. Ghar Yojana, Saubhagya scheme. • Status of Electrification India has Topic- GS-3- Science and Technology achieved the hundred percent Source- Down to Earth electrification of the households in 25 5. Pakistan Cabinet approves the states by December 2018. issuance of panda Bond in • About 10.48 lakh households are left Chinese Currency to be electrified in 4 states of Assam, • The government of Pakistan has Rajasthan, , and decided to launch Panda Bonds to . raise loans from Chinese capital Related Information markets. SAUBHAGYA or 'Power for all' scheme • It will help Pakistan’s to move towards • Prime Minister launched 'Power for all' giving the Chinese currency, a status scheme to mark the birth anniversary at par with that enjoyed by the US of Pandit Deendayal Upadhyaya on dollar. September 25, 2017. • The Panda Bonds are part of its • The scheme is named as multipronged approach for bridging ‘Saubhagya’ and provide subsidy on the foreign financing needs and equipment like transformers, meters, building foreign exchange reserves. and wires. • The scheme also promises on-the- • Panda Bonds will help Pakistan to spot registration of applicants. diversify the investor base of capital • Rural Electrification Corporation market issuance and provide a source Limited (REC) is the nodal agency for of raising renminbi. coordinating the implementation of • China is Pakistan’s largest trading the scheme. partner. • The prospective beneficiary • The raising of capital in Chinese households for free electricity currency will aid Pakistan to bridge connections under the scheme the deficit. identify using Socio-Economic and Related Information Caste Census (SECC), 2011 data. Panda Bonds Topic- GS Paper 2 – Governance • These bonds are Chinese renminbi- Source- AIR denominated bonds from a non- 7. Robust GDP growth to continue: Chinese issuer, sold in the People’s CII Republic of China. • According to the Confederation of Indian Industry, India will continue to • The Philippines issued its inaugural be the fastest-growing major Panda bonds in 2018. It was the first economy, with robust GDP growth ASEAN member to issue Panda bonds. expected to continue through 2019. Topic- GS Paper 2 – International • The Confederation of Indian Industry Relations gave this statement based on strong Source- The Hindu drivers from the services sector, 6. Government to achieve 100% infrastructure activity, and better household electrification ahead of demand conditions. Republic Day 7 www.gradeup.co

The factor which contributes in sustain and administrative safeguards shall the robust GDP growth in the range of be provided to protect, preserve and 7.5% in 2019. promote the cultural, social, linguistic • “Better demand conditions identity and heritage of the Assamese • Settled GST implementation people. • Capacity expansion resulting from • The panel will also assess the growing investments in infrastructure requirement of measures to be taken • Continuing the positive effects of the to protect Assamese and other reform policies are undertaken and indigenous languages of the state, improved credit offtake especially in quantum of reservation in the services sector at 24% employment under the government of CII has identified seven key drivers of Assam and other measures to protect growth that need to be encouraged in Assamese heritage. 2019 • The composition and terms of • Lowering the number of GST rate reference of the committee will be slabs issued separately by the ministry of • Bolstering the insolvency home affairs. • Bankruptcy framework Related Information • Simplifying business procedures • The Cabinet also approved a number • Improving agricultural productivity, of measures to fulfill the outstanding among others. issues related to the Bodo community. Topic- GS Paper 3 – Economics • The Bodo Accord was signed in 2003 Source- The Hindu which resulted in the establishment of 8. Cinereous vulture a Bodoland Territorial. • Recently, Cinereous Vulture is spotted • The Cabinet approved the in Hazaribagh, . establishment of a Bodo Museum- Related Information cum-language and cultural study • The cinereous vulture is a large center, modernization of existing All raptorial bird that is distributed India Radio station and Doordarshan through much of Eurasia. Kendra. • It is also known as the black vulture, Topic- GS Paper 2 – Governance monk vulture, or Eurasian black Source- The Hindu vulture. 2. Exotic trees eating up Western • It is one of the two largest Old World Ghat’s grasslands vultures • In the latest studies, it has been found • IUCN status: Near threatened that the country lost almost one- Topic- GS Paper 3 – Environment fourth of high-altitude grasslands of Source- The Hindu the Western Ghats over four decades. • The exotic invasive trees are primarily 03.01.2019 responsible to it. Related Information 1. New Panel to protect Assam’s • Earlier, the satellite images revealed Heritage that 60% of the shola-grassland • The Union Cabinet decided to set up a landscape has changed; almost 40% high-level committee to recommend (516 km2) of native high-elevation how to provide constitutional, grasslands have disappeared. legislative and administrative • Most of this loss occurred on the safeguards to the indigenous people mountain tops of the Nilgiri, Palani of Assam, including by reserving seats and Annamalai hill ranges, which in the state assembly. comprise more than half of the Ghat’s • The decision has been taken shola-grassland ecosystems. according to the Assam Accord signed • It's primarily due to the expansion of in 1985 which envisaged that exotic trees (pine, acacia, and appropriate constitutional, legislative eucalyptus). 8 www.gradeup.co

• Later in 2018, scientists decided to Topic- GS Paper 3 – Economics study how shola-grasslands across Source-PIB the Ghats – from the Baba Budan Hills 4. RBI launches SRPHi in to 's • The Reserve Bank of India (RBI) has Ashambu Hills – changed in extent launched Survey on Retail Payment between 1972 and 2017. Habits of Individuals (SRPHi). • Broadly, shola-grassland ecosystems • The Survey will capture payment in Tamil Nadu showed the highest habits of individuals in cities of Delhi, rates of invasion. Mumbai, , , Bengaluru • The immediate reaction should be and . taken to remove all exotics including Related Information mature plantations from grasslands. • Sigma Research & Consulting Pvt Ltd Topic- GS Paper 3 – Environment has been engaged by RBI to conduct Source- The Hindu the fieldwork of the survey. 3. Agri Export Zones • Around 6000 individuals from various • The concept of Agri Export Zone (AEZ) socio-economic backgrounds across was introduced in 2001, through EXIM six cities would be covered under the Policy 1997-2001. survey. • It takes a comprehensive look at a • The survey seeks qualitative particular produce/product located in responses from individuals on their a contiguous area for the purpose of payment habits. developing and sourcing the raw • The findings of the survey will provide materials, their insights into awareness and usage processing/packaging, leading to final habits of digital payment products. exports. Topic- GS Paper 3 – Economics • The concept hinged primarily on: Source- Financial Express (a) the convergence of existing 5. Kerala women form ‘wall’ to Central and State Government uphold gender equality against schemes to take care of financial Sabrimala protests interventions required at various • Number’s of women from across stages of the value chain; Kerala formed a 620-km long (b) the partnership among various Women’s Wall, that stretched from stakeholders viz. Central Kasargod in northern Kerala to the Government, State Government, southernmost district of farmer, processor, exporter etc.; and , to uphold (c) focus on targeted products and gender equality and renaissance areas to identify required policy values. interventions. • This was a state-sponsored move • All these activities did take place in done in the backdrop of protests in certain respects in the notified Agri Sabarimala due to Supreme Court’s Export Zones. decision to all women to pray at the • In December 2004, an internal peer Ayyappa shrine. review conducted by the Department Topic- GS Paper 2 – Governance of Commerce concluded that the Source- The Hindu notified AEZs had not been able to 6. Krishak Bodhu Scheme achieve the intended objectives. • government announced • It was decided that there will be no Krishak Bondhu Scheme for the creation of new AEZs unless there welfare of Farmer. were strong and compelling reasons. • Under this scheme, if a farmer aged • No new AEZs have been set up after between 18 to 60 years dies a natural 2004. or unnatural death, the state • All the notified AEZs have completed government will pay his family Rs 2 their intended span of 5 years and lakh. have been discontinued. 9 www.gradeup.co

Related Information • It promotes the development of • Other initiative was taken by West technical education in India in a Bengal Government in which farmers coordinated and integrated manner. would get Rs 2,500 twice a year for • It grants approval for starting new growing a single crop on one acre of technical institutions, for the land. introduction of new courses and for • The West Bengal government has variation in intake capacity in already waived tax and cess on technical institutions. agricultural land to help farmers in • It is headquartered in New Delhi. distress. Topic-GS Paper 2–Important Committee • Recently, the Odisha government also Source- The Hindu approved financial aid to farmers 8. to get 'spiritual through ‘Krushak Assistance for department' Livelihood and Income Augmentation’ • The Madhya Pradesh Government is (KALIA) scheme. going to create an Adhyatmik Vibhag Topic- GS Paper 2 – Governance (spiritual department) by merging several existing departments. Source- Indian Express • The proposed Adhyatmik Vibhag 7. B V R Mohan Reddy committee on (Spiritual Department) going to be Technical Education submitted a formed by merging Dharmik Nyas report to AICTE Evam Dharmasv Department • A government committee on (Religious Trust and Endowment Technical Education submitted its Department), Anand Vibhag report to All India Council for (Happiness Department) in addition Technical Education (AICTE) which is to the Directorate of Religious Trust headed by BVR Mohan Reddy. and Endowment, Madhya Pradesh Recommendation of the Committee Teerth Evam Mela Pradhikaran and • The committee has advised the AICTE Rajya Anand Sansthan. not to permit the establishment of • The 'Anand Vibhag' (Department of new colleges from 2020. Happiness) set up by the government, • It has recommended AICTE to review a first in the country would be the creation of new capacity every two incorporated into this new years. department. • It recommends that institutes should Topic- GS Paper 2 – Governance be encouraged to convert current Source- The Hindu Business line capacity in traditional disciplines to 9. India records 377 mine deaths in emerging new technologies. three years (2015-2017) • The committee has urged the AICTE • Coal mines have accounted for the to introduce undergraduate highest number of casualties due to engineering programmes exclusively accidents in mines. Of the 377, more for following disciplines. than half, 210, were killed in coal 1. Artificial intelligence mines. 2. Blockchain • These figures were provided by the 3. Robotics Labour and Employment Ministry. 4. Quantum computing • Jharkhand, which recorded 69 deaths in the three years, has accounted for 5. Data sciences the highest death of coal mine AICTE workers in accidents inside mines. • It is a national level Apex Advisory • Goda in Jharkhand witnessed one of Body to conduct a survey on the the biggest open cast mine accidents facilities available for technical in 2016 when 23 workers died in education. December that year. • It has been given a statutory status Topic-GS-2- Social Issues by an Act of Parliament in 1987. Source- The Hindu 10 www.gradeup.co

04.01.2019 address global environmental issues while supporting national sustainable 1. Govt launches "Green-Ag", GEF- development initiatives. assisted project The GEF also serves as a financial • The Government of India launched a mechanism for the following GEF assisted project, namely Green– conventions: Ag: Transforming Indian agriculture • CBD Convention on Biological for global environment benefits and Diversity. the conservation of critical • United Nations Framework biodiversity and forest landscapes in Convention on Climate Change collaboration with the Food and (UNFCCC) Agriculture Organization (FAO). • UN Convention to Combat • It was launched in high-conservation- Desertification (UNCCD) value landscapes of five states, • Stockholm Convention on Persistent namely Madhya Pradesh (Chambal Organic Pollutants (POPs) landscape), (Dampa • Minamata Convention on Mercury landscape), Odisha (Similipal Topic- GS Paper 2 – Governance landscape), Rajasthan (Desert Source- The Hindu National Park landscape) and 2. Centre to introduce Commercial Uttarakhand (Corbett-Rajaji Space Activities Bill in Budget session landscape) in September 2018. Features of the Space Activities Bill, • The project seeks to mainstream 2017 biodiversity, climate change, and • The Space Activities Bill, 2017 is sustainable land management aimed at regulating space activities to objectives and practices into Indian ensure peaceful exploration and use agriculture. of outer space. • The overall objective of the project is • The important features of the bill are: to catalyze the transformative change (i) The bill provides for a non- of India’s agricultural sector to transferable license to be provided by support the achievement of national the Central Government to any person and global environmental benefits and carrying out commercial space conservation of critical biodiversity activity. and forest landscapes. (ii) The bill empowers the Central How this project benefit for India? Government to formulate the • The project will support appropriate mechanism for licensing, harmonization between India’s eligibility criteria, and fees for the agricultural and environmental sector license. priorities and investments so that the (iii) The Central Government would be achievement of national and global required to maintain a register of all environmental benefits can be fully space objects (any object launched or realized without compromising India’s intended to be launched around the ability to strengthen rural livelihoods earth) and develop space activity and meet its food and nutrition plans for the country. security. (iv) The Central Government would Related Information ensure safety requirements and Global Environment Facility (GEF) supervise the conduct of every space • It was established on the eve of the activity of India and investigate any 1992 Rio Earth Summit to help tackle incident or accident in connection with our planet’s most pressing the operation of space activity. environmental problems. (v) The bill provides for penal • The GEF unites 183 countries in provisions if any person undertakes partnership with international any commercial space activity without institutions, civil society organizations authorization they shall be punished (CSOs), and the private sector to with imprisonment up to 3 years or 11 www.gradeup.co

need more than Rs 1 crore or both. • The 1951 NRC as the basis for (vi) The bill requires licensed entities defining “Assamese people” was also to carry out operations in a manner recommended in a report prepared by that prevents the contamination of former Assembly Speaker Pranab outer space or damage to the earth’s Gogoi following consultation with 53 environment. organizations representing various Problems with the Bill communities. • The Bill does not address space-based Would that not be different from the activities separately. cutoff for the ongoing NRC update? • The definition puts every space object • The update is based on March 24, under its ambit, meaning even 1971, which defines citizenship. hardware that carries GPS receivers Clause 6 relates to “Assamese could require a license. people”. • The Bill could also affect navigation • Should 1951 be accepted as the services provided by companies such cutoff, it would imply that those who as Google Maps, Ola and Uber. migrated between 1951 and 1971 would be Indian citizens, but would Topic- GS Paper 2 – Governance not be eligible for safeguards meant Source- The Hindu for “Assamese people”. 3. Assam Accord: Fine line between What are these safeguards? ‘Indian citizen’ and ‘Assamese’ • The proposed committee would seek • The Union Cabinet cleared a proposal to define Mahanta views “safeguards” to set up a high-level committee to as reservation of electoral seats, and look into the implementation of land and political rights. Clause 6 of the Assam Accord of 1985. • It also includes rights over natural Why is Clause 6 significant, especially in resources and protection of culture of the context of the NRC and the the indigenous people. Citizenship (Amendment) Bill, 2016? What will the proposed committee do? What is Clause 6? • The committee would examine the • It is a part of the Assam Accord that effectiveness of actions since 1985 to came at the culmination of a implement Clause 6. movement against immigration from • It would hold discussions with all Bangladesh. stakeholders and assess the quantum • According to Clause 6 of reservation of seats in the - “Constitutional, legislative and Assembly and local bodies for administrative safeguards, as may be Assamese people. appropriate, shall be provided to • It will also assess the steps required protect, preserve and promote the to protect Assamese and other cultural, social, linguistic identity and indigenous languages of Assam, heritage of the Assamese people”. reservation in state government jobs, • For recognition as citizens, the Accord and other measures. sets March 24, 1971, as the cutoff. Topic- GS Paper 2 – Governance Who are the “indigenous people” as Source- Indian express described by Mahanta, or “Assamese 4. Parliament approves proclamation people” as mentioned in Clause 6? of Presidents' rule in J&K • Most stakeholders agree that the NRC • The Parliament approved the of 1951 should be taken as the cutoff proclamation of President's rule in for defining “Assamese people” Jammu and Kashmir, with the Rajya eligible for the proposed safeguards. Sabha giving its nod. • The committee included three AASU President Rule members including Bhattacharya and • In India, President's rule is the then president Sarbananda Sonowal, suspension of state government and now Assam Chief Minister. imposition of direct Central Government rule in a state. 12 www.gradeup.co

• Under Article 356 of the Constitution • The ‘probes’ used are antibodies that of India, in the event that a state specifically bind to ALP. When ALP government is unable to function comes into contact with the probe, it according to constitutional provisions, turns white paper disc into a coloured the Central government can take one. direct control of the state machinery. • The colour change on paper discs is • Subsequently, executive authority is then photographed by a smartphone exercised through the centrally camera and images processed to appointed governor, who has the obtain corresponding colour values. authority to appoint other • These values are then compared with administrators to assist them. standard data stored in the phone. Case of Jammu and Kashmir • Thus not only the presence of ALP • In the state of Jammu and Kashmir, could be detected but the amount of failure of governmental function it in milk could also be measured. results in Governor's rule, imposed by Topic- GS Paper 3 – Science and invoking Section 92 of the Technology Constitution of Jammu and Kashmir. Source- down to earth • The state's governor issues the proclamation, after obtaining the 6. Some Organisations Banned Under consent of the President of India. UAPA • If it is not possible to revoke • In exercise of the powers vested in Governor's rule within six months of the Central Government under imposition, the President's Rule under Section 3 of the Unlawful Activities Article 356 of the Indian Constitution (Prevention) Act, 1967 (UAPA), the is imposed. Government, on being satisfied that Note: In the 1994 Bommai case, the the organizations have become Supreme Court of India has restricted Unlawful, has declared the following arbitrary impositions of President's rule. Organizations as Unlawful Associations during the last three Topic- GS Paper 2 – Governance years: Source- Indian express (i) Islamic Research Foundation (IRF) 5. A paper sensor that can detect (ii) National Liberation Front in freshness of milk (NLFT) • Scientists at IIT, Guwahati, have (iii) Tripura Tiger Forum (ATTF) developed a simple paper kit that can test the freshness of milk and tell how • In exercise of powers vested in the well it has been pasteurized. Central Government under Section 35 of UAPA, the Government on being • Aided with a smartphone app, the kit satisfied that the organization is can help ensure that milk is consumed involved in terrorism, has added the before it turns too sour. following organizations to the First How does this sensor work? Schedule of UAPA during the last A milk enzyme, Alkaline Phosphatase • three years: is considered an indicator of milk (i) Al-Qaida in Indian Sub-continent quality because its presence even (AQIS) and all its manifestations after pasteurization indicates the (ii) Islamic State in Khorasan Province presence of microbes that may not (ISKP)/ ISIS Wilayat Khorasan/ have been rendered inactive with Islamic State of Iraq and the Sham- pasteurization. Khorasan (ISIS-K) and all its • Researchers used ordinary filter paper manifestations to prepare the detector. (ii) Khalistan Liberation Force and all The filter paper was cut into small • its manifestations discs and impregnated with chemical Topic- GS Paper 3- Internal security probes that preferentially react with ALP. Source-PIB 13 www.gradeup.co

7. First LNG import terminal of IOC • U.S. President Trump signed into law commissioned in Tamil Nadu the Asia Reassurance Initiative Act • Indian Oil Corp (IOC), the nation’s (ARIA). biggest oil firm, announced • The act “establishes a multifaceted commission of its first Liquefied U.S. strategy to increase U.S. Natural Gas (LNG) import terminal in security, economic interests, and Ennore, Tamil Nadu. values in the Indo-Pacific region. • This is the first LNG import terminal • Specifically, the ARIA will authorize IOC has built on its own and will $1.5 billion in spending for a range of become operational by the end of U.S. programs in East and Southeast January 2019. Asia and “develop a long-term • IOC holds 95 percent stake in the strategic vision and a comprehensive, Ennore LNG import terminal and Tamil multifaceted, and principled United Nadu Industrial Development States policy for the Indo-Pacific Corporation (TIDCO) has 5 percent. region, and for other purposes.” • The firm is also working on laying • ARIA draws attention to U.S. relations natural gas pipeline originating from with China, India, the ten member the Ennore terminal to Nagapattinam states of the Association of Southeast in Tamil Nadu via Puducherry. Asian Nations (ASEAN), and Northeast • Branch pipelines will be laid in Asian allies Japan and South Korea. Madurai, Tuticorin, and Bengaluru to • Additionally, the act addresses U.S. meet the LNG demand. policy toward North Korea. Topic- GS Paper 3- Economic • The law calls for the president to Source-PIB “develop a diplomatic strategy that 8. All the 640 districts of the country includes working with United States covered under Beti Bachao Beti Padhao allies and partners to conduct joint (BBBP) scheme maritime training and freedom of Beti Bachao Beti Padhao (BBBP) navigation operations in the Indo- • Launched by the PM on January 22, Pacific region, including the East 2015 at Panipat, . China Sea and the South China Sea, • Objective- Improve Child Sex Ratio, in support of a rules-based Protection, and education of girl child. international system benefiting all • Three ministries are involved which countries.” are -Ministries of Women and Child Topic- GS-3- International Relations Development, Health & Family Source- The Diplomat Welfare and Human Resource Development. 07.01.2019 • Initially, it was focussed on 100 districts with low Child Sex Ratio. 1. Panj Tirath: An Ancient Hindu • The key elements of the scheme Religious Site include nation-wide awareness and • The provincial government of Khyber advocacy campaign and multisectoral Pakhtunkhwa in Pakistan has declared action. the ancient Hindu religious site of Panj • Multi-sectoral action includes effective Tirath in Peshawar as national enforcement of Pre Conception & Pre- heritage. Natal Diagnostic Techniques • The site’s name has its origins in the (PC&PNDT) Act, Pre-Natal/ Post Natal five pools of water that are part of the care of the mother, improve property, which also has a temple. enrolment of girls in schools, Related Information community engagement/ training/ • It is believed that mythical king Pandu awareness generation etc. from the epic Mahabharata bathed in 9. Asia Reassurance Initiative Act the pools during the month of Kartik (ARIA) and worshipped under the date palm trees in the area for two days. 14 www.gradeup.co

• The site was allegedly damaged • The highway is expected to boost during the Afghan Durrani dynasty era trade and commerce in ASEAN–India in 1747 and was restored by local Free Trade Area, as well as with the Hindus during the Sikh era in 1834. rest of Southeast Asia. • The Khyber Pakhtunkhwa government National Highways Authority of India announced a fine of 2 million Pakistani (NHAI) rupees and five years’ imprisonment • It was established through the NHAI for anyone found guilty of damaging Act, 1988. the historic site. • In February 1995, it was formally Topic- GS Paper 1 – Art and Culture made an autonomous body. Source- The Hindu • It is a nodal agency of the Ministry of 2. India-Myanmar-Thailand Road Transport and Highways. Trilateral Highway: Boost To Act • It is responsible for the development, East management, operation and • Central government allocated fund for maintenance of National Highways the India-Myanmar-Thailand Trilateral Topic- GS Paper 2 – International Highway. Relation • The 1360 km long India-Myanmar- Source- PIB Thailand Trilateral Highway is an 3. Andhra unveils second largest initiative pertaining to India, rock art trove Myanmar, and Thailand. • ’s second largest • India is undertaking construction of Petroglyph site, containing about 80 two sections of the Trilateral Highway petroglyhs, has been discovered at in Myanmar namely. Mekala Benchi in Kurnool district. (i) construction of 120.74 km Kalewa- • These petroglyphs, or rock carvings, Yagyi road section underscore Kurnool’s importance as a (ii) construction of 69 bridges along major site of Neolithic settlements in with the approach road on the 149.70 south India. km Tamu-Kyigone-Kalewa (TKK) road Related Information section. • Kandanathi, with 200 petroglyphs, is • The above mentioned both the also in Kurnool district. projects are being funded by the • While Mekala Benchi has petroglyphs Government of India under grant dating back from the Neolithic to the assistance to the Government of Megalithic period, Kandanathi Myanmar. carvings range from the prehistoric to Related Information the historic period. • The highway is constructed with the Petroglyph help of NHAI (It is a first international • Petroglyphs are images created by project of NHAI). removing part of a rock surface by • The project aims to provide seamless incising, picking, carving, or abrading, vehicular movement for enhancing as a form of rock art. trade, business, health, education and • The term petroglyph should not be tourism between Indian, Myanmar confused with petrograph, which is an and Thailand. image drawn or painted on a rock • It is being funded by the Ministry of face. External Affairs, India. Topic- GS Paper 1 – Art and Culture India-Myanmar-Thailand (IMT) highway Source- The Hindu • The IMT Trilateral Highway is a 4. Scientists unearth Asia's first regional highway being constructed fossil Dioscorea yam leaf under India’s Act East policy to boost • A quaint fossilised leaf is one of the connectivity in the region. most recent finds throwing light on • It will connect Moreh in India with Mae India's past. Sot, Thailand via Myanmar.

15 www.gradeup.co

• The leaf fossil is the first of Dioscorea accord statutory status to the Staff yams from Asia and hints at a Selection Commission (SSC). Gondwanan origin to these plants. • SSC is one of the largest recruitment • These fossils are found when the agencies in the country. Scientist dig in the Eocene-era (38-56 Why this status ? million years ago) Gurha lignite mine • The Union Commission in Bikaner in western Rajasthan, they (UPSC) and all State Public Service obtained two well-preserved fossils of Commissions either have large leaves. constitutional or legal status. The SSC Related Information is the only such organisation that • The team named their new find performs similar functions on a much "Dioscorea eocenicus": the first ever larger scale, but does not enjoy Dioscorea fossil recorded from Asia. statutory status. • Currently, species of Dioscorea in Staff Selection Commission India are found in the humid, tropical • It is an organization under forests of the country. Government of India to recruit staff • Other fossil plants observed in the for various posts in the various mine also suggest this historical Ministries and Departments of the climate in the area, which is now dry Government of India and in and consists of desert vegetation. Subordinate Offices. Topic- GS Paper 1– Art and Culture • The commission is an attached office Source- The Hindu of the Department of Personnel and 5. Masked dance tradition rises from Training (DoPT) which consists of near extinction Chairman, two Members and a • Cambodia’s centuries-old tradition of Secretary-cum-Controller of masked dance was nearly wiped out Examinations. by the Khmer Rouge’s “Killing Fields” • Every year SSC conducts the SSC regime. Combined Graduate Level • Lakhon Khol, nearly wiped out by the Examination for recruiting non- Khmer Rouge regime. gazetted officers to various • Recently Lakhon Khol of Combodia government jobs. and Khon from Thailands listed by Topic- GS Paper 2 – Governance UNESCO as an intangible cultural Source- The Hindu heritage. 7. Swachh Sundar Shauchalaya Related Information • The Ministry of Drinking Water and • The all featuring dancers wearing Sanitation has launched a month-long elaborate painted masks depicting the campaign, “Swachh Sundar Ramayana. Shauchalaya” that commenced on 1st • In Cambodia, the art form is still January. struggling to recover from the Khmer • It is an effort to promote ownership Rouge, under whose genocidal 1975- and sustained usage of toilets and 79 rule at least 1.7 million people, also provide a facelift to the crores of including artists, dancers and writers, toilets built under the Swachh Bharat died, mostly from starvation, Mission. overwork, disease, execution or • The campaign comprises a unique torture. Contest, under which, households are Topic- GS Paper 1 – Art and Culture being mobilised to paint and decorate Source- The Hindu their toilets. 6. MPs’ panel proposes legal status • It will be spearheaded by Gram for SSC Panchayats and coordinated by • A Parliamentary Standing Committee district administrations. (PSC) headed by Bhupender Yadav • The campaign will involve rural has recommended that the Centre communities in Gram Panchayats across the country. 16 www.gradeup.co

• Individual households, Gram This scheme encompasses the following: Panchayats, and Districts will be • Increasing awareness among awarded on the basis of a number of adolescent girls on Menstrual Hygiene toilets painted and the quality and • Improving access to and use of high creativity of their work. quality sanitary napkins by adolescent Related Information girls in rural areas. • The sanitation coverage in rural India has • Ensuring safe disposal of Sanitary already crossed 98%, with over 9 crore Napkins in an environmentally toilets built under Swachh Bharat Mission friendly manner. (Grameen) since its launch. • Access to toilets is an important step • Provision of funds to ASHAs to hold a towards the adoption of safe monthly meeting with adolescents to sanitation practices and an Open discuss issues related to menstrual Defecation Free (ODF) nation. hygiene. About Swachh Bharat Mission Note: ASHAs across the country are trained • Swachh Bharat Mission (SBM) is a and play a significant role in the promotion of nation-wide campaign in India for the use and distribution of the sanitary napkins. period 2014 to 2019. Topic- GS Paper 2 – Women • The mission has two thrusts: Swachh Empowerment Bharat Abhiyan ("gramin" or 'rural'), Source- The Hindu which operates under the Ministry of 9. Smartphone interred in ‘Techno’ Drinking Water and Sanitation; and time Capsule Swachh Bharat Abhiyan ('urban'), • A Time Capsule with items which operates under the Ministry of representing today’s technology and Housing and Urban Affairs. India’s scientific prowess was buried • Its aims to clean up the streets, roads by Nobel Laureates Avram Hershko and infrastructure of India's cities, from Israel and F.Duncan M. Haldane towns, and rural areas. from the USA on the occasion of the • The objectives of Swachh Bharat on-going 106th Indian Science include eliminating open defecation Congress at Lovely Professional through the construction of University, Jalandhar. household-owned and community- • The Time Capsule contains 100 items owned toilets and establishing an that represent modern-day accountable mechanism of monitoring technology as experienced in India toilet use. which was buried at a depth of 10 feet • Its mission aims to achieve an "open- and will remain buried for the next defecation free" (ODF) India by 2 100 years October 2019, the 150th anniversary Related Information of the birth of Mahatma Gandhi. Indian Science Congress Association Note: The mission will also contribute to • Indian Science Congress Association India reaching Sustainable Development (ISCA) is a premier scientific Goal 6 (SDG 6), established by the UN in 2015. organization of India. Topic- GS Paper 2 – Governance • Its headquarters at Kolkata, West Source- The PIB Bengal. 8. Menstrual Hygiene Schemes • The Association was formed with the • Health Ministry addressed the need following objectives: for menstrual hygiene among (i) To advance and promote the cause adolescent girls residing primarily in of science in India. rural areasunder the Menstrual (ii) To hold an annual congress at a Hygiene Scheme. suitable place in India. • The funds are provided to States/UTs (iii) To publish such proceedings, through National Health Mission for journals, transactions and other decentralized procurement of sanitary publications as may be considered napkins packs. desirable. 17 www.gradeup.co

(iii) To secure and manage funds and • All the students up till Class 8 will endowments for the promotion of automatically be promoted to the next Science including the rights of class. disposing of or selling all or any • The essence of the policy is that portion of the properties of the children should not be ‘failed’ and Association. detained up to Class 8. Topic- GS Paper 3 – Science and Topic- GS Paper 2 – Governance Technology Source- The Hindu Source- The Hindu 11. Mission Shakti Scheme 10. Rajya Sabha passes a Bill to scrap No-Detention Policy for Children • Odisha Chief minister announced • The Bill, which was passed by the Lok interest-free loan up to Rs 3 lakh for Sabha in July 2018, seeks to amend the women self-help group members the Right to Education Act, 2009 to (SHGs), a move that would benefit abolish the no-detention policy in around 70 lakh women associated schools. with six lakh groups. • The earlier Right of Children to free • Mission Shakti is an initiative started and Compulsory Education Bill in 2001 aiming at economic prohibited schools to detain students empowerment of women by forming till they complete elementary SHGs and providing them with loans education even on account of under- through banks at a low-interest rate performance. to take up various livelihood activities. • The aim was to decrease the drop-out • It encouraged entrepreneurship rates in school and to reduce the through SHGs and is now empowering emphasis on year-end examinations. them digitally to grow and prosper. • This was replaced with continuous Topic- GS-2- Government Schemes evaluation of students’ progress Source- Times of India throughout the year.

Provision of the bill • States now have the power to decide 08.01.2019 to continue with the no-detention policy. 1. Andhra Pradesh unveils schemes • States can choose to conduct an for marginalized Brahmins examination either at the end of • Andhra Pradesh unveiled various classes 5 and 8, or both. welfare scheme for the marginalized • Students who are unable to clear the and economically backward Brahmins examinations will receive additional through AP Brahmin Welfare instructions and the opportunity to Corporation. appear for a re-examination within • Andhra Pradesh is the first state of the two months of the declaration of the country which has established a result. Brahmin Corporation. • If the students still do not manage to • The aims Brahmin Corporation to help clear the exam, the state may decide poor people of Brahmin families by to detain them. providing financial assistance for • No child shall be expelled from a education, coaching, schooltill the completion of entrepreneurship, skill development, elementary Education. and welfare and culture. No- Detention Policy • The scheme includes such as a • As per the No-Detention Policy under distribution of Cars to the the Right to Education Act, no student Unemployed Brahmin youths, loans, can be failed or expelled from school and subsidies. till the completion of elementary Topic- GS Paper 2 – Governance education covering classes 1 to 8. Source- The Time of India

18 www.gradeup.co

2. Regulation of Functions of MSMEs requirement of fulfilling KYC • Ministry of Micro, Small and Medium obligations. Enterprises has introduced a various • Two FASTag mobile apps were also initiative to promote the Ease of Doing launched. Business and also including the online The My FASTag Customer App has filing of Udyog Aadhaar Memorandum the distinction of real-time recharge of (UAM). any FASTag through UPI, it links • The Ministry has also taken the IHMCL FASTag with customer’s bank following steps: account and there is no need to install MSME SAMADHAAN Portal- for multiple banks applications. empowering micro and small In the FASTag Point of Sales App entrepreneurs across the country to - it is possible to create and manage directly register their cases relating to distribution partners, as also to allow delayed payments. sales via petrol pumps. MSME SAMBANDH Portal- to help in Related Information monitoring the implementation of FASTag public procurement policy for micro • FASTag is an electronic toll collection and small enterprises. system in India, operated by the MSME SAMPARK Portal – A digital National Highway Authority of India platform wherein jobseekers (passed (NHAI). out trainees/students of MSME • It employs Radio Frequency Technology Centres) and recruiters Identification (RFID) technology for get connected. making toll payments directly from Digital Payments- to pass on the the prepaid or savings account linked benefits of the schemes of Ministry of to it. MSME through the digital payment • It is affixed on the windscreen of the gateway. vehicle and enables to drive through Related Information toll plazas without stopping for • For regulating the functions of the transactions. MSMEs, the Government has enacted • The tag can be purchased from official the Micro, Small and Medium Tag issuers or participating Banks Enterprise Development (MSMED) Note:- National Electronic Toll Collection - Act, which is applicable to all the NETC programme, it is proposed to include all States and Union Territories. state/city toll plazas under one umbrella. Topic- GS Paper 2 – Governance Topic- GS Paper 3 – Science and Source-PIB Technology 3. FASTtag Source- The Hindu • A MoU for sale of FASTags through 4. Heritage and Culture of Particularly petrol pumps of leading Oil Marketing Vulnerable Tribes Groups Companies was signed between • The Ministry of Tribal Affairs is Indian Highways Management implementing a scheme namely Company Limited - IMHCL and leading “Development of Particularly Oil Marketing Companies (OMCs) like Vulnerable Tribes Groups (PVTG)” for BPCL, HPCL, and IOCL. the welfare of PVTGs. • This will help expand the FASTag • The scheme is flexible as it enables program’s distribution network which the States/Union Territory(UT) to is presently active at selected bank focus on areas that they consider is branches. relevant to PVTGs and their socio- • This is a bank-neutral FASTag which cultural environment while retaining can be linked to customers’ choice of the culture and heritage of the bank accounts. community by adopting habitat • This not only provides flexibility and development approach and convenience to the FASTag users but intervening in all spheres of their is also user-friendly as there will be no social and economic life. 19 www.gradeup.co

• Housing, land distribution, land • Articles 15 and 16 of the Constitution development, agricultural will have to be amended for development, animal husbandry, implementation of the decision. construction of link roads, culture, • Articles 15, 16 falls under the installation of non-conventional category of Fundamental Rights in the sources of energy for lighting Part III of the Indian Constitution. purpose, social security or any other • Article 15 states that the State shall innovative activity meant for the not discriminate against any citizen on comprehensive socio-economic grounds only of religion, race, caste, development of PVTGs. sex, place of birth or any of them. PVTG Also, nothing in this article shall • 75 tribal groups have been prevent the state from making any categorized by Ministry of Home special provisions for women, children Affairs as Particularly Vulnerable or any socially and educationally Tribal Groups (PVTG)s. backward classes. • PVTGs reside in 18 States and UT of • Article 16 guarantees the Equality of A&N Islands. opportunity in matters of public Topic- GS Paper 1 – Art and Culture employment with no discrimination Source-PIB being done on basis of religion, race, 5. Cabinet approves 10% caste, sex, place of birth. reservation for the economically Topic- GS Paper 2 – Governance weaker section in general Source- The Hindu category 6. HRD introduces 70-point grading • Central government approved percent index to assess the quality of reservation for economically weaker school education in states people among the general category in • The Ministry of Human Resource government jobs and educational Development has introduced a 70-point institutions. grading index to assess the quality of • The approved quota is intended for all school education offered by states. those communities/classes that do • In this grading system, the states will not come under 50 per cent quota. be marked out of 1,000 scores on 70 • It will be for all communities - for the parameters. economically backwards among • It will help to get the correct picture Hindus, Muslims, Christians etc. of where every state stands. There • This will not affect the reservation for will be a fair competition to improve SCs, STs and OBCs. each other's performances. Eligibility criteria for reservation: Related Information Ministry of Human Resource Development • To be eligible for general category The Ministry of Human Resource reservation, the person can at max • Development, formerly the Ministry of possess: Education is responsible for the (i) Annual income below 8 lakh development of human resources in India. (ii) Agriculture land below 5 acre • The Ministry is divided into two (iii) Residential house below 1000 sq departments: ft. (i) The Department of School (iv) Residential plot below 100 yards Education and Literacy, which deals in the notified municipality with primary, secondary and higher (v) Residential plot below 200 yards in secondary education, adult education non notified municipality area and literacy, and Related Information (ii) The Department of Higher • To implement the decision, the Education, which deals with a government will require to push for a university education, technical Constitutional amendment to increase education, scholarship etc. the limit of quota from a maximum of Topic- GS Paper 2 – Governance 50 per cent to 60 per cent. Source- The Hindu 20 www.gradeup.co

7. Rail Kumbh Seva’ mobile app The Bill allows authorities to • North Central Railway launched a Rail provisionally attach properties of an Kumbh Seva Mobile App that will accused, while the application is help those arriving in Allahabad for pending before the Special Court. the Kumbh Mela starting from January • Upon declaration as an FEO, 15 to navigate through the city and properties of a person may be the mela grounds. confiscated and vested in the central • The ‘Rail Kumbh Seva Mobile App’ will government, free of encumbrances also provide information regarding all (rights and claims in the property). the ‘Mela special’ trains that will be • Further, the FEO or any company run during the period. associated with him may be barred • Through this app, the user will not from filing or defending civil claims. only get to know their current location Topic- GS Paper 3 – Economics but will also be able to reach to all Source- The Hindu railway stations, the mela zone, major 9. Cyclone Pabuk hotels, bus stations, and other • The India Meteorological Department facilities within Allahabad city. (IMD) has issued an Orange alert for • It will also provide information about the Andaman Islands as cyclonic passenger amenities available at the storm Pabuk is moving north- stations -- parking lots, refreshment northwestwards. rooms, waiting rooms, book stall, food • It is originated over the Gulf of plaza, ATMs and train inquiry. Thailand and neighbourhood. Topic- GS Paper 2 – Governance Related Information Source- The Hindu Business line • The cyclone warnings are issued to 8. Fugitive Offender state government officials in four • A special court in Mumbai declared stages. absconding liquor baron Vijay Mallya • The First Stage warning known as a fugitive economic offender (FEO). "PRE CYCLONE WATCH" issued 72 • Mallya has become the first businessman hours in advance contains an early to be declared FEO under the provisions of warning about the development of a the new Fugitive Economic Offenders Act cyclonic disturbance in the north Indian which came into existence in August 2018. Ocean, its likely intensification into a The Fugitive Economic Offender Bill 2018 tropical cyclone and the coastal belt likely • The Bill allows for a person to be to experience adverse weather. declared as a fugitive economic • The Second Stage warning known offender (FEO) if: as "CYCLONE ALERT" is issued at (i) an arrest warrant has been issued least 48 hrs. against him for any specified offences • The Third Stage warning known where the value involved is over Rs as "CYCLONE WARNING" issued at 100 crore, and least 24 hours in advance of the (ii) he has left the country and refuses expected commencement of adverse to return to face prosecution. weather over the coastal areas. • To declare a person an FEO, an application • The Fourth Stage of warning known will be filed in a Special Court (designated as "POST LANDFALL OUTLOOK" is issued under the Prevention of Money- at least 12 hours in advance of the Laundering Act, 2002) containing details expected time of landfall. of the properties to be confiscated, and Different color codes used at the any information about the person’s different stages of the cyclone warning whereabouts. bulletins • The Special Court will require the • Cyclone Alert- Yellow person to appear at a specified place • Cyclone Warning-Orange at least six weeks from the issue of • Post-landfall outlook- Red notice. Topic-GS Paper 3–Disaster Management • Proceedings will be terminated if the Source- The Hindu person appears. 21 www.gradeup.co

09.01.2019 Short tandem repeats method for DNA Profiling 1. The DNA Technology (Use and • One of the current techniques for DNA Application) Regulation Bill - profiling uses polymorphisms called 2019 short tandem repeats. • The Lok Sabha passed “The DNA • Short tandem repeats (or STRs) are Technology (Use and Application) regions of non-coding DNA that Regulation Bill - 2019”. contain repeats of the same • The Bill has been formulated nucleotide sequence. recognizing the need for regulation of • For example, the use and application of GATAGATAGATAGATAGATAGATA is Deoxyribonucleic Acid (DNA) an STR where the nucleotide technology, for establishing an sequence GATA is repeated six times. identity of missing persons, victims, • STRs are found at different places or offenders, under trials and unknown genetic loci in a person’s DNA. deceased persons. • To produce a DNA profile, scientists • The purpose of this Bill is to expand examine STRs at ten, or more, genetic the application of DNA-based forensic loci. These genetic loci are usually on technologies to support and different chromosomes. strengthen the justice delivery system Application of DNA Profiling of the country. • Identify the probable origin of a body The key components of this Bill include: fluid sample associated with a crime • establishment of a DNA Regulatory or crime scene Board • Reveal family relationships • accreditation of DNA laboratories undertaking DNA testing, analyzing, • Identify disaster victims etc.; Topic-GS Paper 3–Science & Technology • Establishment of the National and Source-PIB Regional DNA Data Banks, as 2. IIT Madras team produces gas envisaged in the Bill, will assist in hydrates under ‘space’ conditions forensic investigations. • Researchers at Indian IIT Madras Related Information have experimentally shown that DNA Profiling (DNA fingerprinting, DNA methane and carbon dioxide (CO2) testing, or DNA typing) can exist as gas hydrates at • DNA profiling is the process where a temperatures and pressures seen in specific DNA pattern, called a profile, the interstellar atmosphere. is obtained from a person or a sample • Gas hydrates are formed when a gas of bodily tissue. such as methane gets trapped in well- • Even though we are all unique, most defined cages of water molecules of our DNA is actually identical to forming crystalline solids. other people’s DNA. • In terrestrial conditions, gas hydrates • However, specific regions vary highly are formed naturally under the sea among people. These regions are bed and glaciers under high pressure, called polymorphic. low-temperature conditions. • Differences in these variable regions • Methane hydrate is a potential source between people are known as of natural gas. polymorphisms. • IIT Madras, in collaboration with GAIL, • Each of us inherits a unique is working to recover methane from combination of polymorphisms from methane hydrate from the Krishna- our parents. Godavari Basin and sequester CO2 • DNA polymorphisms can be analyzed simultaneously. to give a DNA profile.

22 www.gradeup.co

Applications in Sequester of CO2 further the participation of ‘tribals’ in • The carbon dioxide hydrate produced forest management. in the lab raises the possibility of • The NCST states that renaming will sequestering or storing carbon dioxide also engender greater sensitivity on as hydrates by taking advantage of ice the forest department’s part towards existing in environmental conditions the needs of ‘tribal’ communities. favorable for hydrate formation. • CO2 hydrate is thermodynamically • Indian Forest Service (IFoS) is one of more stable than methane hydrate. the three of the So if methane hydrate has remained Government of India. stable for millions of years under the • The other two All India Services being sea bed, it would be possible to the Indian Administrative Service sequester gaseous CO2 as solid (IAS) and the hydrate under the sea bed. (IPS). Related Information • It was constituted in the year 1966 Carbon sequestration under the All India Services Act, 1951 • It is a process involved in carbon by the Government of India. capture and the long-term storage of • The British Government had atmospheric carbon dioxide or other constituted the Imperial Forest forms of carbon to mitigate or defer Service in 1867. global warming. • The main mandate of the service is Topic- GS Paper 3 –Environment the implementation of the National Source- The Hindu Forest Policy in order to ensure the 3. Government plans to rename ecological stability of the country Indian Forest Service through the protection and • The Centre has proposed another pro- participatory sustainable tribal measure – renaming of the management of natural resources. Indian Forest Service as Indian • The highest ranking IFS official in Forest and Tribal Service. each state is the Head of Forest Forces • The Department of Personnel and (HoFF). Training (DoPT) has initiated an inter- • Ministry of Environment, Forest and ministerial consultation note to Climate Change, (MoEFCC) under the rename the service and also train its Government of India, is the Cadre cadre to be more receptive towards Controlling Authority of the Indian tribals and forest dwellers. Forest Service. Related Information Topic- GS Paper 2 –Governance • The recommendations to change the Source- Economics times name of Indian Forest Service were 4. HD 21749b- New Planet made by the National Commission for • The National Aeronautics and Space Scheduled Tribes (NCST) in its annual Administration (NASA) of USA have report. discovered a new planet. The NCST had made the following • It is the third new planet discovered observations in this regard: by the NASA mission, Transiting • The NCST highlights the close ties Exoplanet Survey Satellite (TESS). between tribals, the forest and forest Salient features of the newly discovered ecosystem as a resource base. planet • NCST recommends the renaming of • The new planet HD 21749b is outside the Indian Forest Service into Indian our solar system and orbits a dwarf Forest and Tribal Service in star 53 light years away. recognition of the close ties between • HD 21749b orbits a bright star in the tribals, the forest and forest constellation Reticulum. It has the ecosystem. longest orbital period of all the three • NCST argues that merging forest and discoveries made by TESS. tribal welfare administrations will 23 www.gradeup.co

• HD 21749b orbits its star in a o To encourage the development of relatively leisurely 36 days. organic farming and organic • It is predicted that the surface of the processing. new planet is likely around 300 Note: APEDA is the implementation agency degrees Fahrenheit, which is for the NPOP. relatively cool, given its proximity to Agricultural & Processed Food Products its star, which is almost as bright as Export Development Authority (APEDA) the sun. • It is an export promotion organization Related Information under Ministry of Commerce & Other planet discovered by TESS: Pi Industries, Government of India. Mensae b and LHS 3844b. TEES Mission • It was established by the GOI under • TESS is a NASA Astrophysics Explorer the APEDA Act passed by the mission. Parliament in December 1985. • The objective of the mission is to • APEDA replaced the Processed Food discover planets smaller than Neptune Export Promotion Council (PFEPC). that transit stars bright enough to • It is mandated with the responsibility enable follow-up spectroscopic of promotion and development of the observations that can provide planet export of its scheduled products. masses and atmospheric Topic- GS Paper 2 – Government Policies compositions. Source-PIB Topic-GS Paper 3–Science & Technology 6. Animals begin to arrive at Source- The Hindu Wayanad Sanctuary 5. National programme for organic production • The seasonal migration of wild • The Ministry of Industries and animals from wildlife sanctuaries in Commerce had initiated the National Karnataka and Tamil Nadu to the Programme for Organic Production to Wayanad Wildlife Sanctuary (WWS) assist the organic producers to tap the has begun with the rise in market which is growing steadily in temperature in the Nilgiri Biosphere. the both in domestic and export • Mammals such as elephants and segments. gaurs migrate to the sanctuary from Related Information the adjacent Bandipur and Nagarhole National Programme for Organic national parks in Karnataka and the Production (NPOP) Mudumalai national park in Tamil • The Ministry of Industries and Nadu are arriving in WWS. Commerce is implementing the NPOP Related Information since 2001. Wayanad Wildlife Sanctuary • The Objectives of the Program are • Wayanad Wildlife Sanctuary is an o To provide the means of evaluation animal sanctuary in Wayanad, Kerala, of certification programme for India. organic agriculture and products as • Established in 1973, the sanctuary is per the approved criteria. now an integral part of the Nilgiri o To facilitate the certification of Biosphere Reserve. organic products in conformity with the prescribed standards. • It is bounded by protected area o To facilitate certification of organic network of Nagarhole and Bandipur of products in conformity with the Karnataka in the northeast, and on importing countries organic the southeast by Mudumalai of Tamil standards as per equivalence Nadu. agreement between the two Note: Wayanad district has the largest countries or as per importing population of Adivasi in Kerala. country requirements. Topic- GS Paper 3 –Biodiversity Source- The Hindu 24 www.gradeup.co

7. Government faces 8. Central government gives nod for heat from allies on OBC report Centre for Classical Language in • The sub-categorization of OBC quota Kerala in Uttar Pradesh makes allies of allies • The Union Government issued its nod turning on the heat over the issue for setting up the Centre for Classical amid a clash of interests. Language at the Thunchath • The Social Justice Committee report Ezhuthachan Malayalam University in suggests the panel has recommended Tirur. a split of the 27% OBC quota into • Its aim to study and research and three categories. other aspects of Malayalam language • The panel headed by retired Allahabad which will prove beneficial in High Court judge Raghavendra Kumar implementing various projects for has listed 79 sub-castes under the Malayalam language development. OBC category. • It was in August 2013 Malayalam was • Of these, nine falls under Backward declared a classical language. Class, 37 under More Backward and Related Information 33 under Most Backward categories. Official Language • Listed under the Backward Class — • According to Article 343, the official those who will be restricted to 7% language of India should be in quota — are castes like Yadav, Kurmi Devanagari script. and Jat. • As per Eight schedules of the Indian constitution, we have 22 Official • The panel says that these castes are social, economically and culturally languages. “strong” and have been recruited in Classical Language government jobs more than the ratio • In 2004 it was decided by the Indian of their population, while also Government to proclaim Indian enjoying political representation. Languages meeting certain requirements as “Classical Sub-categorisation of Other Backward Class Language”. • Languages so far declared to be • The Supreme Court in its order Classical are Tamil, , in Indra Sawhney and others vs. Kannada, Telugu, Malayalam, and Union of India observed that there is Odia. no constitutional or legal bar to State categorizing backward classes as Criteria to determine the eligibility of languages to be considered for backward or more backward and had further observed that if a State classification as a “Classical Language”: chooses to do it (sub-categorization), • High antiquity of its early it is not impermissible in law. texts/recorded history over a period of 1500–2000 years. • At present, there is a single Central A body of ancient literature/texts, OBC list, with entries from each State. • which is considered a valuable People belonging to all of these categories can seek reservation from heritage by generations of speakers. within the single 27% OBC • The literary tradition should be reservation pie for Central original and not borrowed from government jobs and Central another speech community. educational institutions. • The classical language and literature being distinct from modern, there • At present nine States, however, have may also be a discontinuity between already sub-categorized OBCs. the classical language and its later • These are Andhra Pradesh, forms or its offshoots. , Puducherry, Karnataka, Topic- GS Paper 2 –Governance Haryana, Jharkhand, West Bengal, , Maharashtra and Tamil Nadu. Source-PIB

25 www.gradeup.co

10.01.2019 and educational institutions to economically backward section in the 1. NCDC model for cooperatives as general category. Modern banking • The Bill amends Article 15 of the • Ministry of Agriculture launched the Constitution, by adding a clause which National Cooperative Development allows states to make "special Corporation (NCDC’s) model for provision for the advancement of any cooperatives as Modern banking Unit economically weaker sections of during the 2nd Governing Council citizens". meeting of National Council for • These "special provisions" would Cooperative Training (NCCT). relate to "their admission to Related Information educational institutions, including NCCT private educational institutions, • It is being responsible for training, whether aided or unaided by the awareness and evaluation state, other than the minority programmes of employees working in educational institutions". the cooperative sector. Related Information • The main objective of the NCCT is to CONSTITUTION AMENDMENT BILLS facilitate the human resource (Article 368) development in the cooperatives in • Bills seeking to amend the the country. Constitution are of three types:— NCDC (1) Bills that are passed by Parliament • It aims to strengthen cooperative by a simple majority; banks at various levels and bring (2) Bills that have to be passed by about financial inclusion of farmers in Parliament by the special majority the remote villages of the country. prescribed in article 368(2) of the • The model includes upgradation and Constitution; and new setup of IT and related (3) Bills that have to be passed by infrastructure such as Data Centre, Parliament by the special majority as Enterprise Network and Security, Core aforesaid and also to be ratified by not Banking Solutions (CBS), ATMs, POS, less than one-half of the State e-Lobby, etc. Legislatures. • It also includes assistance to • Bills seeking to amend all other cooperatives in capacity development provisions of the Constitution through its dedicated Laxmanrao including those enumerated in the Inamdar National Academy for Co- proviso to article 368(2) are called by operative Research & Development. the title ‘Constitution Amendment • The objective behind the Primary Bills’. Agricultural Credit Co-operative Societies (PACS) computerization • These Bills can be introduced in either project is to provide a robust IT House of Parliament. platform leading to automation of all • If sponsored by a Private Member activities of the PACS. Motions for the introduction of the • For this, NCDC has taken a Bills are decided by simple majority. comprehensive step for strengthening • In case of any disagreement between of cooperative as Modern Banking the two Houses of Parliament on a Units. Constitution Amendment Bill, there Topic- GS Paper 2 –Governance cannot be a joint sitting of the Houses Source-PIB of Parliament on the Bill as article 368 2. 124th Constitution Amendment Bill of the Constitution requires each • Lok Sabha passed the Constitution House to pass the Bill by the (124th Amendment) Bill 2019 to prescribed special majority. provide 10 percent reservation in jobs 26 www.gradeup.co

Special Majority • The funding of projects under this • Constitution Amendment Bills have to scheme varies from state to state. be passed in each House of Parliament • It is finalised on basis of detailed by a special majority i.e. by a majority project reports prepared by of the total membership of that House Programme Management Consultant and by a majority of not less than two- (PMC) which is national level thirds of the members of the House consultant for implementing the “present and voting”. scheme. • The expression “total membership” Topic- GS Paper 2 –Goverrnance means the total number of members Source-PIB comprising the House irrespective of 4. “Web- Wonder Women” Campaign whether there are vacancies or • The Ministry of Women and Child absentees on any account. Development, Government of India, Topic- GS Paper 2 –Governance has launched an online campaign, Source-PIB ‘#www : Web- WonderWomen’. 3. First Swadesh Darshan project in • The Campaign aims to discover and Meghalaya inaugurated celebrate the exceptional • Meghalaya inaugurated the project achievements of women, who have “Development of North East Circuit: been driving positive agenda of social Umiam (Lake View) - U Lum change via social media. Sohpetbneng- Mawdiangdiang - • This Campaign will recognize and Orchid Lake Resort” implemented acknowledge the efforts of these under Swadesh Darshan Scheme of meritorious Women. Ministry of Tourism, Government of • It is a campaign to specially honor and India. encourage such voices that have in • The project was sanctioned by the their own capacity driven a positive Ministry of Tourism in July 2016. impact on social media platforms. • Under this project, the Ministry has Related Information developed facilities like Traditional • The Campaign invites Entries via Healing Centre, Tribal Rejuvenation Nominations from across the world, as Centre, Tourist Information Centre, per the laid out criteria. Multipurpose Hall, Log Huts, • Indian-origin women, working or Cafeteria, Sound and Light show, settled anywhere in the world, are Souvenir Shops, Solid Waste eligible for nomination. Management etc. Topic-GS Paper 2–Women Empowerment Related Information Source-PIB Swadesh Darshan Scheme 5. Galápagos island gets its first • It was launched by Union Tourism iguanas since Darwin after mass- Ministry with objective to develop release theme-based tourist circuits in the • A group of more than 1,400 iguanas country. has been reintroduced to an island in • These tourist circuits will be the Galápagos archipelago nearly two developed on principles of high tourist centuries after they disappeared from value, competitiveness and there. sustainability in an integrated • This initiative is a part of an ecological manner. restoration programme. • It is 100% centrally funded scheme • The last recorded sighting of iguanas for project components undertaken in Santiago Island had been made by for public funding. British naturalist Charles Darwin in • It also has provision for leveraging 1835. voluntary funding under Corporate • Land iguana is an herbivore that helps Social Responsibility (CSR) initiatives ecosystems by dispersing seeds and of Central Undertakings maintaining open spaces devoid of and corporate sector. vegetation. 27 www.gradeup.co

• IUCN status: Vulnerable India in informed decision-making at Related Information the central level. Galápagos Islands • The magazine is also an effort to bring • The Galápagos Islands, part of the the best practices in the water sector Republic of Ecuador, are an to the national stage and move ahead archipelago of volcanic islands in the direction of creating water distributed on either side of the consciousness in the minds of the equator in the Pacific Ocean. people of the country • The Galapagos archipelago contains Topic- GS Paper 2 –Governance unique wildlife and vegetation and is Source-PIB a UNESCO World Heritage site and 8. Why some snakes are deadlier one of the most fragile ecosystems in than others? the world. • Scientists have uncovered why the Topic- GS Paper 3 –Biodiversity venom of some snakes makes them Source- The Guardian so much deadlier than others. 6. Nandan Nilekani to head five- • The study tackled this puzzle by member RBI panel on digital comparing records of venom potency payments and quantity for over 100 venomous • The Reserve Bank of India has snake species, ranging from appointed a five-member panel rattlesnakes, cobras and the tree- headed by Nandan Nilekani to suggest dwelling boomslangs of Africa to sea ways to improve digital payments. snakes and burrowing asps. • The panel would assess the current Evolutionary standpoint levels of digital payments in financial • The Scientist found strong evidence inclusion. that venoms have evolved to be more • The panels also suggest measures to potent against animals that are strengthen the safety and security of closely related to the species that the digital payments. snake commonly ate. • It provides a road map for increasing • These results make sense from an customer confidence to use digital evolutionary viewpoint as we expect transactions, and suggest a medium- that evolution will have shaped term strategy for deepening of digital venoms to be more efficient at killing payments. the prey. • The committee will submit its report • The research showed that the amount in 90 days from its first meeting. of venom a snake has depends on Related Information both its size and the environment it Digital Payment? lives in. • Digital payment is a way of payment Dosage-dependent which is made through digital modes. • The big terrestrial species have the • In digital payments, payer and payee most venom, while smaller tree- both use digital modes to send and dwelling or aquatic species had the receive money. least. • It is also called electronic payment. What is the Concern? Topic- GS Paper 3 –Economics • Snakebites are a major health Source- The Hindu concern worldwide, with 2.7 million 7. Jal Charcha cases each year. • Union Minister for Water Resources, • Understanding how venom evolves River Development and Ganga may help us better identify the risks Rejuvenation released the inaugural to humans from different snake issue of the monthly magazine of the groups, and also potentially from Ministry – Jal Charcha – in New Delhi. other venomous animals such as • The 25-page inaugural issue of Jal spiders, scorpions, centipedes, and Charcha is the start of a journey that jellyfish. aims to engage with the people of 28 www.gradeup.co

Related Information o Agenda of the forum should be to Venom connect people of various member • A poisonous substance secreted by countries cutting across all animals such as snakes, spiders, and traditional boundaries. scorpions and typically injected into o The member countries will have to prey or aggressors by biting or follow a set of confidence-building stinging. measures. Topic- GS Paper 3 –Environment o These measures could include Source- The Hindu freedom of navigation, assurance 9. India to become world's third of free flow of energy and largest consumer market by 2030: WEF protection of the fragile marine • World Economic Forum in its latest ecology of the Gulf. report said that India is set to become Related information the world's third largest consumer GULF COOPERATION COUNCIL (GCC) market behind only USA and China by • GCC is a regional intergovernmental 2030. political and economic union • The report said consumer spending in consisting of all Arab states of the India is expected to grow from 1.5 Persian Gulf except Iraq. trillion US dollar at present to six • Its member states are Bahrain, trillion US dollar by 2030. Kuwait, Oman, Qatar, Saudi Arabia, • India is currently the world's sixth and the United Arab Emirates. largest economy. • The Charter of the GCC was signed on • The report titled 'Future of 25 May 1981. Consumption in Fast-Growth RAISINA DIALOGUE: Consumer Market - India' also noted • The Raisina Dialogue is a multilateral that growth of the middle class will lift conference held annually in New nearly 25 million households out of Delhi. poverty. • It started in the year 2016. Topic- GS Paper 3 –Economic • It has emerged as India’s flagship Development conference on geopolitics and geo- Source- AIR economics. • The conference is hosted by the 11.01.2019 Observer Research Foundation, an independent think tank, in 1. Persian Gulf Regional Dialogue collaboration with the Ministry of Forum External Affairs of India. • Iran proposed the Persian Gulf Topic: GS Paper 2- International Dialogue forum at Raisina Dialogue relations conference held in New Delhi. Source: The Hindu • It aims to address the lingering 2. Research Advisory Committee conflicts and mistrust in the Gulf • Market regulator Security and region. Exchange Board of India (SEBI) has • In the backdrop of the continued constituted a ‘Research Advisory erosion of the Gulf Cooperation committee’. Council (GCC), it can bring peace and • It will assist in formulating policy to prosperity in the region. undertake research relevant for the • The proposed forum includes: development and regulation of capital o Admission to such a forum should markets. be based on accepting generally- • It will strengthen its research function recognized principles and shared and enhance its linkage to objectives. policymaking. o The forum should render • It will comprise of prominent financial international boundaries inviolable economists and market practitioners. and use of force impermissible. • It will be headed by Sankar De. 29 www.gradeup.co

• In addition, it will maintain databases o Mizoram's per capita health relevant for capital market regulation expenditure is Rs 5,862 (4.2% of research also. state GDP), almost five times the Related information Indian average. SEBI o (Rs 5,177) and • It is a statutory body under SEBI Act, (Rs 5,126) followed at the top. 1992. o At the other end of the spectrum, • It regulates the securities and capital Bihar spent Rs 491 per capita on market in India. health -less than half the Indian • It was established in 1988. average- spending 1.33 percent Topic: GS Paper 3 - Economy of its GDP on health. Source: Business standard news o Just above Bihar were Madhya 3. Ganjajal project Pradesh (Rs 716) and Uttar • The Prime minister has launched the Pradesh (Rs 733). Gangajal project worth Rs 2,980 o While Delhi spends Rs 1,992 per crores in Agra city. capita on health • It aims to provide better and more Related Information: assured water supply. National Health Profile (NHP) • He also laid the foundation stone for • The National Health Profile covers an Integrated Command and Control demographic, socio-economic, health Centre for the Agra Smart City status and health finance indicators, project. along with comprehensive information • It will give a push to develop and on health infrastructure and human enhance Tourism infrastructure in resources in health. Agra. • CBHI has been publishing National • It will benefit both the residents and Health Profile every year since 2005. the tourists. Central Bureau of Health Intelligence Topic: GS Paper 1 - Urbanisation (CBHI) Source: Indian Today • It was established in 1961 by the Act 4. India’s Health Crisis of Parliament on the recommendation • According to the latest National Health of the Mudaliar committee. Profile (NHP) 2018, India is among • It is the Health Intelligence Wing the countries with the least public under Directorate General of Health health spending. Services, Ministry of Health & Family • The government intends to invest only Welfare (MoHFW). 2.5 percent of the country's GDP into • Its mission is to strengthen Health health care by 2025, while the global Information System (HIS) in each of average is about 6 percent. the districts in the country. • Even lower-income countries like Topic: GS Paper 2 - Health Bhutan, Sri Lanka and Nepal spend Source: Down To Earth magazine 2.5 percent, 1.6 percent and 1.1 5. National Clean Air Programme percent of the GDP respectively on • Union Environment Minister Harsh their people’s health. Vardhan launched the National Clean • Households spent four times less in Air Programme (NCAP). government hospitals (7.5%) than • It is collaborative and participatory in private hospitals. nature, not legally binding on • WHO's health financing profile for states. 2017 shows 67.78% of total • The scheme is termed as “war against expenditure on health in India was pollution” across the length and paid out of pocket. breadth of the country. • The world average out of pocket • It has set a ‘tentative’ national level expenditure is just 18.2%. target of 20-30 percent reduction in • State-wise distribution of health PM2.5 and PM10 concentration within expenditure: the next five years. 30 www.gradeup.co

• 2017 is kept as the base year for the Topic: GS Paper 3 – Economy and comparison of concentration. inclusive growth. • The target will be effective in 102 Source: The Indian Express polluted cities across the country. 7. Tokenisation of card transactions • It will also use the Smart Cities • Reserve of India (RBI) has allowed all programme to launch the NCAP in 43 card payment networks to offer Smart cities in the list of 102 non- tokenization service. attainment cities. • However, no charges should be • It has provision for ‘mid-term policy recovered from the customer for review’ also. availing this service. Related information • Tokenization of debit, credit and PM2.5 and PM10: prepaid card transactions is allowed. • 5 and PM10 refer to atmospheric • It aims to enhance the safety of the particulate matter (PM) that have a digital payments ecosystem in the diameter of less than or equal to 2.5 country. and 10 micrometers respectively. Related information: • Particulates are microscopic solid or TOKENISATION: liquid matter suspended in the • Tokenization involves a process in atmosphere of Earth. which a unique token masks sensitive Topic: GS Paper 3: Environment card details. Source: The Indian Express • The token is then used to perform 6. Universal Basic Income card transactions in contact-less • Sikkim’s ruling party, the Sikkim mode at Point Of Sale (POS) Democratic Front (SDF), has decided terminals, Quick Response (QR) code to include UBI in its manifesto ahead payments, etc. of the Assembly elections. • Thus, tokenization will replace card • It aims to implement the scheme by 2022. details with a code, called a “token”. • It has already started the process to Topic: GS Paper 3- Economy introduce the unconditional direct Source: The Hindu cash transfers. 8. Pranav R Mehta became first Indian • So, Sikkim is set to become the first to Head Global Solar Council state in India to roll out Universal • Pranav R Mehta has taken over as the Basic Income (UBI). president of Global Solar Council Related information: (GSC) from January 1, 2019. Universal Basic Income (UBI): • Today, India is placed amongst the • UBI is a regular and periodic cash Top 5 solar players in the world and is payment delivered unconditionally to a third largest solar market. all citizens without the requirement of Global Solar Council (GSC) work or willingness to work. • The Global Solar Council (GSC) was • The main idea behind UBI is to launched on December 6, 2015, prevent or reduce poverty and following the historic United Nations increase equality among citizens. Climate Change Conference (UN COP • The essential principle is the idea that 21). all citizens are entitled to a livable • The GSC came into being as income, irrespective of the International Coalition of more than circumstances they’re born in. 30 nations, utilizing maximum solar Some facts about SIKKIM energy, decided to harness the • World’s first fully organic state. renewable energy for the greater • Sikkim received the UN Future Policy good. Gold Award in 2018 for paving the • The GSC has its headquarters in way for the rest of the world. Washington D.C., USA. • Sikkim became the 22nd State of the Topic: GS-3- Energy Indian Union after Constitution (36th Source: Business Standard Amendment) Act, 1975. 31 www.gradeup.co

14.01.2019 which 90% funding of the cost of irrigation & drinking water component 1. ‘One Family, One Job’ scheme will be provided by the Govt of India • Sikkim CM launched the ‘One Family as central assistance and the rest One Job’ scheme, under which for 10% cost of the irrigation and drinking every family one government job has water component will be borne by the been allotted, in . beneficiary states. • The Scheme was launched during • The project is proposed to be "Rojgar Mela" at the Paljor Stadium in executed by Himachal Pradesh Power Gangtok. Corporation Ltd. (HPPCL). • Sikkim became the first state in the • The project envisages construction of country to carry out such a 148 M high rock-filled dam for the programme for the people entitling supply of 23 cumec water to Delhi and them to state government employee other basin states. benefits. Impact of Dam Related Information • After the construction of the dam, the Proud Mother scheme flow of river Giri will increase by about • Sikkim Govt has implemented a Proud 110% which will meet the drinking Mother scheme to increase the water needs of Delhi & other basin decreasing fertility in the State. states up to some extent in a lean • Govt grants incentive to women period. delivering 1st & 2nd live Children. • Stored water of Renukaji Dam will be • The concerned Proud Mothers scheme used by UP, Haryana & NCT of Delhi will cover original Sikkimese including from Hathnikund Barrage, by NCT of Lepcha, Bhutia, and Nepali. Delhi from Wazirabad Barrage and by Topic- GS Paper 3 –Employment UP, Haryana, and Rajasthan from Source- Business Standard Okhla Barrage. 2. Renukaji Multipurpose Dam Topic- GS Paper 2 –Governance Project Source- The Hindu • The Union Minister for Water 3. Citizenship Bill issue: Muted Resources, Shipping, and Road Bhogali Bihu fete in Assam Transport & Highways signed a MoU • A contentious Bill to legitimize the with the Uttar Pradesh, Rajasthan, stay of non-Muslim migrants from Uttarakhand, Haryana and Himachal India’s neighborhood has made many Pradesh for the construction of in Assam decide to break an age-old Renukaji Multi-Purpose Dam project tradition — by fasting during an in the Upper Yamuna Basin. agrarian festival of feasting. Related Information Related Information Renukaji Dam Project Bhogali Bihu • Three storage projects are proposed • Magh Bihu (also called Bhogali Bihu) to be constructed on the river Yamuna is a harvest festival celebrated in and two of its tributaries - Tons and Assam. Giri in the hilly regions of Uttarakhand • It is the Assam celebration of Makar and Himachal Pradesh. Sankranti, with feasting lasting for a • These include week. (i) Lakhwar project on river Yamuna • Uruka is the precursor to Magh Bihu in Uttarakhand, to be celebrated. (ii) Kishau on river Tons in • Uruka is marked by lighting bonfires Uttarakhand and Himachal Pradesh and feasting at a Meji or Bhelaghar, a and temporary structure made with (iii) Renukaji on river Giri in bamboo, hay, and dried plantain Himachal Pradesh. leaves. • These three projects were identified Topic- GS Paper 1 –Art and Culture as National Projects in 2008 under Source- The Hindu 32 www.gradeup.co

4. Adultery, homosexuality not IPC that banned consensual unnatural acceptable in Army sex between adults. • Chief General Bipin Rawat said that • After this verdict, the LGBT stands for Adultery and homosexuality have lesbian, gay, bisexual, and been not be allowed in the army in transgender community enjoys the spite these are decriminalized in the same rights as other citizens under country by the Supreme Court. the Constitution. Related Information Topic- GS Paper 2 – Governance Adultery Sec. 497 of IPC Source- The Hindu • Recently the Supreme Court struck 5. States’ approval not needed for quota down as unconstitutional the 158- Bill year-old Section 497 of IPC+ that • Recently the Constitution (One punished a married man for the Hundred and Twenty Fourth offense of adultery if he had sexual Amendment) Bill of 2019 and 103 relations with a married woman amendment act, 2109 providing up to "without the consent or connivance of 10% reservation for economically her husband. weaker sections of the society. What is Adultery law in Indian? • became the first state to • Section 497 of the Indian Penal Code provide 10 percent reservation in jobs was a section dealing with adultery. and educational institutions to the • Under this law, a woman cannot be economically weaker sections in the punished for the offense of adultery. general category. • Only a man who has consensual Related Information sexual intercourse with the wife of • The provision to Article 368 (power of another man without his consent can Parliament to amend the Constitution be punished under this offense in and procedure thereof) holds that an India. amendment to a fundamental right • If someone "lives in adultery", the coming under Part III of the partner can file for divorce. Constitution need not be ratified by Reasons were given by Honorable SC the Legislatures of one-half of the • The Supreme Court called the law States. unconstitutional because it "treats a • So, this Bill may be notified by the husband as the master." Central government as soon as it gets • The Offence of adultery treats women the assent from the President. as chattel, dents their dignity. • Only Constitution amendments which • The court tested Section 497 on the affect the Centre-State relations or touchstone of constitutional division of powers in a federal provisions dealing with the right to structure require subsequent equality and guarantees against ratification by the States’ Legislatures arbitrariness and discrimination. before the Presidential assent. New Provisions Right to equality • Adultery could continue to be a • The Bill, passed by both the Houses of ground for aggrieved spouses to seek the Parliament, adds new clauses to a divorce from their adulterous Articles 15 and 16 of the Constitution. partners. • Both the Articles come under the part • If one of the spouses committed of ‘Fundamental Rights’ in the text of suicide because of the adulterous the Constitution. nature of her/his partner, then the • The new clause (6) to Article 15 allows culprit could be proceeded against for the government to carve reservation the criminal offense of abetting. for the economically weaker sections Homosexuality: Section 377 of IPC of the society in higher educational • This year the Supreme Court institutions, including private ones, unanimously decriminalized the whether they are aided or not by the colonial law under Section 377 of the State. 33 www.gradeup.co

• Minority educational institutions are speculative attacks on the domestic exempted. currency and greatly enhance the • Likewise, the new clause (6) to Article RBI’s ability to manage exchange rate 16 provides for quota for volatility. economically-deprived sections in the Note: The arrangement is another milestone initial appointment in government in mutual economic cooperation and special services. strategic and global partnership between Note: India and Japan. • The Indira Sawhney judgment has Topic- GS Paper 2 –International capped the reservation limit to 50%. Relation • Now, the new Bill increases Source-PIB reservation to 60%. 7. ISRO starts Human Space Flight Topic- GS Paper 2 –Governance center Source- The Hindu • Gaganyaan, the great Indian human 6. Cabinet approves Bilateral Swap leap to space by 2022, will soon get Arrangement between India and Japan cracking under a new Human Space • The Union Cabinet has approved the Flight Centre and a dedicated team. proposal for entering into an • ISRO named Unnikrishnan Nair, who Agreement for Bilateral Swap led its Advanced Space Transportation Arrangement (BSA) between India Programme at the Vikram Sarabhai and Japan and authorizing the Space Centre, as the man to steer it - Reserve Bank of India (RBI) to sign as also the director of the new Human the Agreement for Bilateral Swap pace Flight Centre. Arrangement between the RBI and Gaganyaan Project the Bank of Japan for a maximum • It is India’s first manned space amount of USD 75 billion. mission which carried out with the Salient Features: collaboration of ISRO and Russia’s • The swap arrangement is an federal space agency ROSCOSMOS. agreement between India and Japan • Under this programme India is to essentially exchange and re- planning to send three humans exchange a maximum amount of USD (Gaganyatris) into space i.e. in low 75 Billion for domestic currency, for earth orbit (LEO) by 2022 i.e. by 75th the purpose of maintaining an Independence Day for period of five to appropriate level of balance of seven days. payments for meeting short-term • The mission was announced by Prime deficiency in foreign exchange. Minister Narendra Modi during his Benefits: 72nd Independence Day speech. • The BSA is a very good example of • Under this mission, the crew of three mutual cooperation between India astronauts will conduct experiments and Japan for the strategic objective on microgravity in space. of assisting each other in times of • This mission will make India fourth difficulty and for restoring nation in the world after USA, Russia, international confidence. and China to launch a human • This facility will enable the agreed spaceflight mission. amount of Capital being available to Topic- GS Paper 3 –Science and India on tap for use. Also, with this Technology arrangement in place, prospects of Source- Indian Express Indian companies would improve in 8. Oceans are heating up at a quickening tapping foreign capital as there would pace: Report be greater confidence in the stability • Researchers said the world’s oceans of the country’s exchange rate. are heating up at an accelerating pace • Availability of such swap line to tide as global warming threatens a diverse over difficulties arising out of Balance range of marine life and a major food of Payment (BOP) would deter supply for the planet. 34 www.gradeup.co

Role of Ocean in Climate Change Related Information • Ocean heating is a very important Ministry of Women & Child Development indicator of climate change. • The Ministry has 6 autonomous • About 93% of excess heats are organizations working under its aegis trapped around the Earth by (i) National Institute of Public greenhouse gases that come from the Cooperation and Child Development burning of fossil fuels which (NIPCCD) accumulates in the world’s oceans. (ii) National Commission for Women Highlight of report (NCW) • The latest report relied on four (iii) National Commission for studies, published between 2014 and Protection of Child Rights (NCPCR) 2017, that gave more precise (iv) Central Adoption Resource estimates of past trends in ocean Agency (CARA) heat, allowing scientists to update (v) Central Social Welfare Board past research and hone predictions for (CSWB) the future. (vi) Rashtriya Mahila Kosh (RMK) • A key factor in the more accurate Topic-GS Paper 2–Women Empowerment numbers is an ocean monitoring fleet Source- TOI called Argo, which includes nearly 10. Democracy Index 2018 4,000 floating robots that “drift • Recently the Democracy Index 2018 throughout the world’s oceans, every is released annually by Economist few days diving to a depth of 2,000 m Intelligence Unit (EIU). and measuring the ocean’s • The index will provide a snapshot of temperature, pH, salinity and other the state of world democracy for 165 bits of information as they rise back independent states and two up. territories. • Argo “has provided consistent and • The Economist’s Democracy Index widespread data on ocean heat ranks nations on five parameters. content since the mid-2000s. (i) Electoral process and pluralism • The new analysis shows warming in (ii) Functioning of government the oceans is on pace with (iii) Political participation measurements of rising air (iv) Political culture temperature. (v) Civil liberties Note: The models predict that the India Position and Performance temperature of the top 2,000 meters of the • India is ranked at 41 which is notched world’s oceans will rise 0.78 degrees Celsius above last year. by the end of the century. • India achieved a score of 7.23 on the Topic- GS Paper 3 –Environment index to maintain its position which is Source- Down to Earth the same it did last year. 9. Women of India Organic Festival • India ranks below the US (ranked • The Ministry of Women and Child 25th in the index) and other so-called Development is organizing the three- ‘flawed democracies’ like Italy, day 6th ‘Women of India Organic France, Botswana, and South Africa. Festival’ in Chandigarh. • According to the index, this is the • The festival aims to encourage Indian lowest ever score attributed to India women entrepreneurs and farmers to in the index ever since its publication. connect with more buyers and thus, • India has been always classified empower them through financial as a flawed democracy. inclusion while promoting organic • The report defines a flawed culture in India. democracy as nations that “have free • It also aims to educate people about and fair elections and, even if there its various initiatives and schemes are problems (such as infringements relating to women and children. on media freedom), basic civil liberties are respected. 35 www.gradeup.co

• However, there are significant 2. Citizenship Bill: Chakma and weaknesses in other aspects of Hajong communities in a spot democracy, including problems in • The contentious Citizenship governance, an underdeveloped (Amendment) Bill, 2016 has put the political culture and low levels of spotlight on Bengali Hindus in Assam. political participation. • The Citizenship Bill would serve as a Topic- GS Paper 2 –Governance legal basis for legitimizing the claims Source- The Hindu of Chakma and Hajong refugees as the indigenous people of Assam State. 15.01.2019 Related Information • The Chakmas and Hajongs are ethnic 1. Devadasi custom people who lived in the Chittagong Hill • Recently, studies done on the Tracts, most of which are located in Devadasi practice by the National Law Bangladesh. School of India University (NLSIU), • Chakmas are predominantly Bengaluru, and the Tata Institute of Buddhists, while Hajongs are Hindus. Social Sciences (TISS) in Mumbai • They are found in , reveal that more than thirty-six years West Bengal, Bangladesh, and after the Karnataka Devadasis Myanmar. (Prohibition of Dedication) Act of 1982 • The Chakmas and Hajongs living in was passed, the State government is the Chittagong Hill Tracts fled yet to issue the rules for administering erstwhile East Pakistan in 1964-65 the law. since they lost their land to the Highlights of the studies development of the Kaptai Dam on • In the studies, it is found that special the River. children, with physical or mental Topic- GS Paper 2 – Governance disabilities, are more vulnerable to be Source- The Hindu dedicated as devadasis about 19%. 3. Chennai Traffic Police introduces • The girls from socio-economically robot "ROADEO" for traffic marginalized communities continued management to be victims of the custom and • The Chennai Traffic Police introduced thereafter were forced into the robot "ROADEO" which will help police commercial sex racket. in traffic management and assist • Law in IPC: The Protection of Children pedestrians in Chennai roads. from Sexual Offences (POCSO) Act • The robot will make the pedestrians, 2012, and Juvenile Justice (JJ) Act of especially children, feel safe while 2015 have not made any reference to crossing the roads. it as a form of sexual exploitation of Related Information children. • It will also ease the work of traffic Related Information police, as these robots can be Devadasi System integrated with the traffic signals, as • Devadasi system is a banned religious well as can be operated manually, practice in some parts of India through a Bluetooth app. whereby parents marry a daughter to • The robot has two hands to interact a deity or a temple. with the people and show traffic signs. • The marriage usually occurs before • It has highly expressive eyes to create the girl reaches puberty. a feel of a neighborhood helper and • The Union Home Ministry in December also a display to show important 2015 had asked all states to take messages. strong action against those involved Topic- GS Paper 3 – Science and in the heinous practice which is Technology against the dignity of women. Source- The Hindu Topic-GS Paper 2–Women Empowerment 3. Commerce Ministry launched Source- The Hindu “Womaniya on GeM” 36 www.gradeup.co

• This initiative will enable women content violating the 48-hour ban on entrepreneurs and women self-help campaigning prior to polling, instantly groups [WSHGs] to sell handicrafts and latest within 3 hours of EC issuing and handloom, accessories, etc such a direction. directly to various Government • Examine the type, category or growth ministries, departments, and of communication technology or institutions. media platform in the country and • The initiative aligns with difficulties in regulating these media Government’s initiatives for MSMEs, platforms during the multiphase especially to reserve 3 percent in election when prohibitory period of 48 government procurement from hours is in force. women entrepreneurs. • Impact of new media platforms and • This initiative will also address goals social media during the prohibitory and objectives under the United period of 48 hours before the close of Nations Sustainable poll and its implication in view of the Development Goal 5: Achieve provisions of section 126. gender equality and empower all • Examine the present provisions of women and girls. Model Code of Conduct (MCC) related Related Information to the above issues and suggest Government e-Marketplace (GeM) modification in this regard. • GeM is an Online Market platform to Way forward: facilitate the procurement of goods • The recommendations made by the and services by various Ministries and Committee, when implemented, will agencies of the Government. help in minimizing the possible • It has been envisaged as National interference of activities which aim at Procurement Portal of India which indirectly influencing voters during aims to enhance transparency, the valuable silence period of 48 hours efficiency, and speed in public provided to them. procurement of goods and services • The recommendations of the and eliminate corruption. Committee will be considered by the • It functions under Directorate General Commission in detail for follow up of Supplies and Disposals (DGS&D), action. Ministry of Commerce and Industries. Topic- GS Paper 2 – Governance • It is completely paperless, cashless Source-PIB and system driven e-marketplace that 5. Trishna Gas Project enables procurement of common use • The National Wildlife Board has given goods and services with a minimal its approval for the Trishna Gas human interface project of ONGC which falls in the Topic- GS Paper 2 – Women Trishna Wildlife Sanctuary in the Empowerment Gomati district of Tripura. Source- The Hindu • Trishna gas project ONGC has 4. Section 126 of the RP Act, 1951 discovered 10-12 gas bearing wells in • A Committee constituted under to the Trishna Wildlife sanctuary. review and suggest modifications and • The gas extracted from these wells changes in the provisions of Section would be supplied to the North 126 and other sections of the RP Act Eastern Electric Power Corporation Ltd 1951 and provisions of Model Code of (NEEPCO) owned 100 MW gas-based Conduct have submitted its report. thermal power project at Monarchak • it was headed by the senior deputy in Sonamura subdivision of Sipahijala election commissioner Umesh Sinha. district of Tripura. The Committee had the following scope National Wildlife Board of work: • It is a statutory organization • Internet service providers and social constituted under the Wildlife media companies should take down Protection Act, 1972. 37 www.gradeup.co

• It is an apex body to review all • It is an extinct species of colorful, wildlife-related matters and approves tropical, arboreal pulmonate land projects in and around national parks snail in the family Achatinellidae once and sanctuaries. present on Oahu, Hawaii. • National Wildlife Board consists of : • This species was endemic to forests of o It is chaired by the Prime Minister the island of Oahu in the Hawaiian o Union Minister of Environment, archipelago, United States, but is now Forest and Climate Change is the extinct in the wild. vice-chairman of the Board • In April 2011, it was reported that the o Other members include 15 non- species had been reduced to a single, government members, 19 ex- captive individual. officio members, 10 government • A major cause of its population decline officials such as secretaries. in the wild was predation by the rosy Trishna Wildlife Sanctuary wolf snail. • It is a Wildlife Sanctuary in Tripura, India. Note: In January 2019, it was reported that • The vegetations in the sanctuary fall the last member of the species, a 14-year- under four broad categories of tropical old snail named George, had died. semi-evergreen forest, the east Topic- GS Paper 3 – Environment Himalayan lower Bhanar sal, Moist Source- Down to Earth mixed deciduous forest, and the 8. Sino-Indian Digital Collaboration Savanah woodland. Plaza Topic- GS Paper 3 – Environment • The Sino-Indian Digital Collaboration Source- Indian Express Plaza (SIDCOP), an initiative to bring 6. ‘Ama Ghare LED’ scheme Indian IT companies and Chinese • Odisha government has launched the enterprises closer to each other on a ‘Ama Ghare LED’ scheme. single AI enabled platform was • Under this scheme, about 95 lakh launched in 2019. families in the State will each get four • This is a partnership by National LED bulbs free of cost. Association of Software and Services • Under the scheme, 9-watt LED bulbs Companies (NASSCOM) with will be distributed to the beneficiaries Municipal Governments of Guiyang registered under the National Food and Dalian. Security Act (NFSA) and the State Food Security Scheme (SFSC). Related Information • Odisha Power Transmission Sino-Indian Digital Collaboration Plaza Corporation Ltd (OPTCL) will (SIDCOP) implement the scheme and the bulbs • The initiative aims to bring Indian IT will be distributed through camps and companies and Chinese enterprises PDS outlets across the State. closer to each other on a single AI • The beneficiaries will have to produce enabled platform. biometric authentication to get the • This platform will be managed by a benefits of the scheme. joint venture comprising of one Indian Topic- GS Paper 2 – Governance and Chinese company. Source- Indian express • The initiative aims to encash the 7. First extinction of 2019: Hawaiian expertise of Indian IT enterprises in tree snail business transformation and • Recently in a report, it has found that operational optimization by using IT the last known Achatinella apexfulva tools in complex business has now been listed in the first environments. extinction species of 2019. NASSCOM Related Information Achatinella apexfulva • It is a not-for-profit industry association and is the apex body for the Indian IT-BPM industry. 38 www.gradeup.co

• It aims to make sure that service • This project is supported by quality and enforcement of Maharashtra Remote Application Intellectual Property Rights have been Centre (MRSAC) and ISRO. properly implemented in the Indian • The main users of crop maps and yield software and BPM industry. forecasts are governments and Topic- GS Paper 2 – Governance agribusiness who use them to assess Source- The Hindu demand, anticipate prices and plan the use of resources. 16.01.2019 Related Information Other Programmes / Projects by 1. DD Science and India Science: Ministry of Agriculture and Farmers • Union Science & Technology Ministry Welfare inaugurated two National Level • Forecasting Agricultural output using initiatives launched by the Space, Agrometeorology and Land Department of Science and based observations (FASAL) Technology and Prasar Bharti in field • National Agricultural Drought of Science Communication. Assessment and Monitoring System • These two science communication (NADAMS) platforms are a part national-level • KISAN (Crop Insurance using Space initiatives to elevate science into a technology And geoinformatics) celebration and bring it close to • CHAMAN (Coordinated programme on everyday life. Horticulture Assessment and • The channels have been conceived Management using geoinformatics) and supported by the DST and are • Crop Intensification: Mapping and being implemented and managed by monitoring of post-Kharif rice fallow Vigyan Prasar, an autonomous lands using Satellite Remote Sensing organisation of DST. and GIS technologies for Rabi Crop • The two science channels which are Area Expansion. milestones in the history of science Topic- GS Paper 2 – Governance communication in India are the first Source- The Hindu step in creating a national science 3. IMBEX 2018-19 channel for the country. • It is the second edition of India- Related Information Myanmar bilateral army exercise. DD Science • The objectives are: • It will be a one-hour slot on (a) It provides opportunities to the Doordarshan National channel which army personnel of both the nations to will telecast Monday to Saturday from serve effectively in UN missions by 5 pm to 6 pm. providing understanding about each India Science other’s training, tactics, procedures • It is an Internet-based channel, which and best practices. will be available on any internet- (b) Train the Myanmar delegation for enabled device, and will offer live, participation in United Nations peacekeeping operations under the UN scheduled play and video-on-demand • India is one of the largest contributors services. to the UN peacekeeping force and has Topic-GS Paper 3–Science & Technology a rich experience of serving in UN Source-PIB peacekeeping operations. 2. Maha Agritech : An Initiative for Topic- GS Paper 3 – Defence doubling farmers’ income by 2022 Source- Indian Express • Maharashtra government launched 4. Philip Kotler Presidential Award ‘Maha Agritech,’ a project under which • Prime Minister of India, Narendra Modi area under cultivation from sowing to has been awarded first-ever Philip harvesting, climate, and diseases on Kotler Presidential Award by World crops will be monitored digitally using Marketing Summit India. satellite and drone technology. 39 www.gradeup.co

• The Award focuses on the triple- aimed at ensuring the availability of clean bottom-line of People, Profit, and water for current and future generations. Planet. Topic- GS Paper 3 – Environment • It will be offered annually to the Source- The Hindu leader of a Nation. 6. Special weather services for • Philip Kotler is a world-renowned Kumbh Mela Professor of Marketing at • Central Ministry has launched the Northwestern University, Kellogg special weather services for the School of Management, U.S. benefit of people visiting Prayagraj Topic- GS Paper 1 – Art and Culture during Kumbh Mela. Source- The Hindu • The service will provide information of 5. Desalination Plants Harm the prevailing weather and forecasts Environment: UN for next 3 days through four • According to a U.N. backed study, Automatic Weather stations (AWS) desalination plants across the world and a mobile van AWS that have been produce highly salty waste-water and installed and operationalized at toxic chemicals that are damaging the different locations at Prayagraj. environment. • It will cover all four directions within • This study was part of research into 5-10 km radius. how best to secure fresh water for a • It will be helpful for the local and state rising population without harming the authorities by providing the real-time environment. location-specific weather information • Desalination plants around the world for efficient management of the entire are pumping out far more salt laden event and also benefit the pilgrims by brine than previously believed. keeping them abreast of the latest • The brine raises the level of salinity weather information. and poses a major risk to ocean life Topic-GS Paper 3–Science & Technology and marine ecosystems. Source- The Hindu • Brine, water comprising about 5% 7. Odisha takes its first step towards salt, often includes toxins such as promoting turtle tourism chlorine and copper used in • Odisha’s beach witnessed its first desalination. By contrast, global turtle festival on January 13, 2019, seawater is about 3.5% salt. where tourists, researchers, and • More than half the brine comes from environmentalists gathered to four middle eastern countries. These promote eco-tourism, which in turn are Saudi Arabia, the United Arab could help conserve Olive Ridley Emirates, Kuwait and Qatar, with turtles. Saudi Arabia alone responsible for • It was organized by Cox & Kings 22% of the effluent. Foundation, a philanthropic arm the Related Information travel company, in partnership with Desalination Humane Society International–India • Desalination is the process of (HIS- India) and few local removing salts from water to produce organizations. water that meets the quality (salinity) • Odisha has half of the world’s Olive requirements of different human Ridley turtle population, 90 percent of uses. India’s turtle population lives in the • Seawater desalination can extend state. water supplies beyond what is Related Information available from the hydrological cycle, Olive Ridley Turtle providing an “unlimited”, climate- • The Olive ridley turtles are the independent and steady supply of smallest and most abundant of all sea high-quality water. turtles found in the world, inhabiting Note: This is in direct conflict with warm waters of the Pacific, Atlantic Sustainable Development Goal (SDG) 6, and Indian oceans. 40 www.gradeup.co

• These turtles, along with their cousin • An entity shall cease to be a startup the Kemps Ridley turtle, are best on completion of five years from the known for their unique mass nesting date of its incorporation/registration called Arribada, where thousands of or if its turnover for any previous year females come together on the same exceeds Rupees 25 crore. beach to lay eggs. • Entity means a private limited • The species is recognized company (as defined in the as Vulnerable by the IUCN Red Companies Act, 2013), or a registered list. partnership firm (registered under Topic- GS Paper 3 – Biodiversity section 59 of the Partnership Act, Source- The Hindu 1932) or a limited liability partnership (under the Limited Liability 8. India's largest startup ecosystem Partnership Act, 2002). inaugurated in Kerala Topic- GS Paper 3 – Economics • Kerala government got India largest startup ecosystem. Source- Livmint • The Integrated Startup Complex 9. 1st Annual Disarmament, under the Kerala Startup Mission International Security Affairs Fellowship (KSUM) includes the ultra-modern Programme facilities of Maker Village that promote • Foreign Secretary Vijay Gokhale hardware startups. inaugurated the First Annual Related Information Disarmament and International Security Affairs Fellowship What is a startup? Programme in New Delhi. As per the Ministry of Commerce and • Young Diplomats from 27 countries Industry has described an entity as a are participating in the Fellowship ‘startup’: Programme. 1. Up to five years from the date of its • The programme aims at equipping incorporation/registration, participants with knowledge and 2. If its turnover for any of the financial perspectives on various issues related years has not exceeded Rupees 25 to disarmament, non-proliferation, crore, and arms control and international 3. It is working towards innovation, security. development, deployment or Topic- GS-3- Government Policies commercialization of new products, Source- AIR processes or services driven by technology or intellectual property. 10. Crocodile Annual Census Startups: Points to note • The population of saltwater crocodiles in Bhitarkanika has increased with the • Any such entity formed by splitting up annual census, which concluded or reconstruction of a business recently, putting the head-count at already in existence shall not be 1,742. considered a ‘startup’. • Last year, the enumerators had • In order to obtain tax benefits a sighted 1,698 reptiles. startup so identified under the above definition shall be required to obtain a Bhitarkanika National Park certificate of an eligible business from • It is located in the north-east region the Inter-Ministerial Board of of Kendrapara district in the state of Certification consisting of: Odisha in eastern India. a) Joint Secretary, Department of • It is home to the largest population of Industrial Policy and Promotion, estuarine crocodiles. b) Representative of Department of • It was designated as a national park Science and Technology, on 16 September 1998 and as a c) Representative of Department of Ramsar site by UNESCO on 19 August Biotechnology. 2002. 41 www.gradeup.co

• It is inundated by the rivers • Recently in Meghalaya, coal mines Brahmani, Baitarani, Dhamra, mishap happened which was result Pathsala. into the death of no. of people. Related Information Topic- GS Paper 2 – International • In 1975, the Union Ministry of Forest Relation and Environment in collaboration with Source- PIB the UNDP had started a crocodile 2. ‘Jai Kisan Rin Mukti Yojana breeding and rearing project in • MP government launched ‘Jai Kisan Dangamala within the park. Rin Mukti Yojana” scheme. Topic- GS-3- Bio-Diversity • It is Rs 50,000 crore farm loan waiver Source- New Indian Express scheme for farmers. • Only those farmers who have not 17.01.2019 registered themselves to pay GST and income tax can avail benefits under 1. MoU between India and Australia this scheme. on the Safety in Mines, Testing Topic- GS Paper 2 – Agriculture Scheme and Research Station (SIMTARS) Source-PIB • The Union Cabinet has given its 3. 9th International Micro irrigation approval for signing a MoU between conference Directorate General of Mines Safety • Union Water Resources Minister (DGMS), Ministry of Labour and inaugurated 9th International Micro Employment, Government of India irrigation conference at Aurangabad, and Department of Natural Resource Maharashtra. Mines and Energy, Queensland • The aim of the conference was to Government, Australia through the share experiences in the use of new SIMTARS. technologies and best management • The MoU will help in establishing a practices in drip, micro-sprinkler, and partnership between DGMS and other localized irrigation systems. SIMTARS for: • The Theme of the conference (a) implementation of the risk-based was: “Micro Irrigation and Modern safety management system, Agriculture”. providing training, • The conference was organized by the (b) setting up occupations safety and Ministry of Water Resources and River health academy and national mine Development. disaster center, and modernizing R&D Related Information laboratory of DGMS. MICRO IRRIGATION • The MoU will become operative from • Micro-irrigation is a modern method of the date of signing and remain in irrigation through which water is effect for three years. irrigated through drippers, sprinklers, Background: foggers and by other emitters on the • Mining accident rates in Australia is surface or subsurface of the land. the lowest in the world. • Drip irrigation is most suitable for • Australia has pioneered in wider spacing crops. conceptualizing and implementing • The micro sprinkler irrigation system risk-based Safety Management Plans is mostly followed in sandy or loamy for the mining sector using the soils. technique of hazard identification and • This system is most suitable for risk assessment. horticultural crops and small grasses. • SIMTARS is known to have exclusive Advantages expertise in Mines Safety • Water saving and higher yield Management Systems. • High quality and increased fruit size Related Information • Suitable for all types of soil • Easy method of fertigation and chemigation 42 www.gradeup.co

• Saving in labor and field preparation cost • There are two routes by which India Disadvantage gets FDI. • High initial investment (1) Automatic route- By this route, FDI • Clogging of emitters is allowed without prior approval by • Possible damage to system Government or Reserve Bank of India. components due to animals, etc. (2) Government route- Prior Topic- GS Paper 2 – Agriculture approval by the government is Source- The Hindu needed via this route. Foreign 4. RBI eases ECB norms, lifts sector- Investment Promotion Board (FIPB) wise limits which was the responsible agency to • RBI has drawn up a new external oversee this route was abolished on commercial borrowing (ECB) May 24, 2017. framework allowing all eligible Topic- GS Paper 3 – Economics borrowers to raise up to $750 million Source- The Business line per financial year under the automatic 5. ASER 2018 route, replacing the existing sector- • As per the Annual Status of Education wise limits. Report (ASER) 2018, one out of every • The central bank has also expanded four Class 8 students in rural India is the list of eligible borrowers and unable to read. recognized lenders. • The report was made after the survey • To curb volatility in the forex market conducted by an autonomous unit of arising out of dollar demand for crude education-NGO Pratham. oil purchases, the framework provides • The survey covered around 3.5 lakh a special dispensation to public sector households and 546,527 children oil marketing companies. between the ages of three and 16 • It allows them to raise ECB, with an overall across 596 rural districts. ceiling of $10 billion, for working capital Highlights: purposes with a minimum average maturity period (MAMP) of three years • Moreover, over one in two, Class 8 under the automatic route without students cannot solve a problem that mandatory hedging & individual limit involves basic division. requirements. • Only a little more than half of all • The list of borrowers has been children enrolled in Class 5 can read a expanded to include all entities Class 2 level text. eligible to receive FDI. • This improvement can be seen due to Maturity period an improved performance by • While the minimum maturity period Himachal Pradesh, Uttar Pradesh, for the ECB will be three years, the Odisha, Chhattisgarh, Karnataka, framework allows manufacturing Kerala, Arunachal Pradesh, and companies to raise up to $50 million Mizoram. per financial year with a maturity • The proportion of children not enrolled period of one year. in school has fallen below 3% to 2.8% • Further, if the ECB is raised from a for the first time ever in India. foreign equity holder and utilized for • Also, the percentage of girls in the 15- working capital, general corporate 16 age group who were not enrolled purposes or repayment of rupee in school dropped from 20% in 2008 loans, the maturity period will be five to 13.5%. years. • The number of schools with a FDI (Foreign Direct Investment) serviceable girls’ toilet doubled • A foreign direct investment (FDI) is an between 2010 and 2018 with two- investment in the form of controlling thirds of all girls’ schools in rural India ownership in business in one having toilets. country by an entity based in Topic- GS Paper 2 – Important Report another country. Source- Indian express 43 www.gradeup.co

6. Global Aviation Summit 2019 Related Information • The Ministry of Civil Aviation in IOHR collaboration with Federation of • It is a non-profit NGO based in Indian Chambers of Commerce and London. Industry (FICCI) has organized Global • IOHR partners with local and Aviation Summit in Mumbai. international human rights group to • The theme of Global Aviation Summit drive and promote positive changes is “Flying for all - especially the and push for justice and the respect of next 6 Billion”. human rights worldwide. • It aims to provide a platform for the • IOHR aims to defend the dignity of stakeholders to brainstorm over the people stripped of their rights future of the aviation industry and including unjustly jailed journalists, identify the growth areas. human rights defenders, refugees, • It also gives the opportunity to and victims of oppression highlight the latest concepts like Topic- GS Paper 2 – Governance drones, air taxis, new jets, and ultra- Source- Indian Express light aerial electric vehicles etc. 8. Spiritual circuit in Kerala Related Information • The PM recently inaugurated a project • Vision 2040 for the aviation sector for the development of spiritual circuit was also launched during the summit. comprising three important • The vision document highlights the pilgrimage centers of Sree growth potential in different sub- Padmanabha Swamy Temple, sectors of Indian aviation and the key Aranmula and Sabarimala in Kerala. action steps which are required to be • The Sree Padmanabaswamy Temple taken to achieve the desired is one of the 108 divyadesams of Lord objective. Vishnu. Topic- GS Paper 3–Science & Technology • The project is being implemented Source-PIB under the Swadesh Darshan scheme 7. First human rights TV channel of the tourism ministry. • The world’s first television channel Related Information dedicated to human rights was Swadesh Darshan Scheme: launched in London by the • Swadesh Darshan scheme is one International Observatory of Human among the flagship schemes of the Rights (IOHR). Ministry of Tourism for development • It would be a web-based channel and of thematic circuits in the country in a would deliver human rights issues to planned and prioritized manner. audiences in over 20 countries across • The scheme was launched in 2014-15. Europe, Latin America, and the Middle • Under this scheme, the Government is East. focussing on the development of • The programmes are currently quality infrastructure in the country broadcasted in English and eventually with the objective of providing better hopes to broadcast in other languages experience and facilities to the visitors including Farsi, Turkish, Arabic and on one hand and on other hand Russian. fostering the economic growth. Objectives • A National Steering Committee (NSC) The Human Rights Channel aims to • will be constituted with Minister in deliver hidden stories ignored by charge of Ministry of Tourism as mainstream media into people’s living Chairman, to steer the mission rooms. objectives and vision of the scheme. The Channel would focus on issues • Topic- GS Paper 1 – Art and Culture like refugees, press freedom and the Source-PIB incarceration of journalists, 9. Congenital Central Hypoventilation extremism, women’s rights, LGBT+ Syndrome (CCHS) issues and the plight of the world’s stateless people. 44 www.gradeup.co

• Recently an infant under treatment in • To execute the project in a timebound New Delhi Hospital is suffering from a manner, a short, medium and long rare disease ‘Congenital Central term plan have been proposed for Hypoventilation Syndrome (CCHS)’. implementation in five years in close About the Disease coordination with ISRO and Ministry of • It is a very rare disease with less than Defence. 1,000 known cases all over the world. • Deployment of Central Armed Police • The person suffering from this disease Forces (CAPFs) in remote areas will be can lose their life if they fall into deep also coordinated by satellite sleep. communications. • It is a disorder of the nervous system • Indian Regional Navigation Satellite in which the cue to breathe is lost System (IRNSS) -based GPS will when the patient goes to sleep. provide navigation facilities for • This results in a lack of oxygen and a operational parties in high altitude, buildup of carbon dioxide in the body. remote and difficult borders, and • Lack of breathing turns the lips into Naxal areas. the blue. • BSF has been designated as lead • It is also known as Ondine’s Curse. agency for implementation of ground (Ondine is a French mythology segment and network infrastructure character.) including the establishment of Cause Archival Facility. • The mutation of a gene called PHOX2B Topic- GS Paper 3 – Defence can cause CCHS. Source-PIB • This gene is crucial for the maturation 2. Saksham 2019 of nerve cells in the body. • ‘Saksham’, an annual high-intensity Treatment mega campaign launched by • Treatment typically includes Petroleum Conservation Research mechanical ventilation or use of a Association (PCRA) under the aegis of diaphragm pacemaker. the Ministry of Petroleum and Natural • People who have been diagnosed as Gas. newborns should be ventilated • The campaign aims at promoting the throughout childhood so that they can citizens to participate in fuel live independently. conservation for health & Topic- GS Paper 3 – Science and Technology environment protection. Source- Indian Express • It simultaneously helps in reducing India’s dependency on import of crude oil. 18.01.2019 PCRA • It is a registered society set up under 1. Task Force report on Space the aegis of Ministry of Petroleum & Technology in Border Management Natural Gas, Government of India. • The Union Home Minister has • This non-profit organization is a approved the report of Task Force national engaged created by MHA to identify areas for in promoting energy efficiency in use of Space Technology in improving various sectors of the economy. Border Management. • It helps the government in proposing • Following areas have been identified policies and strategies for petroleum for use of space technology: conservation. (i) Island development Topic- GS Paper 2 – Governance (ii) Border Security Source-PIB (iii) Communication and Navigation 3. Jallikattu (iv) GIS and Operations Planning • Recently, a total of 29 people System sustained minor injuries at the (v) Border Infrastructure Jallikattu event held in Alanganallur Development Tamil Nadu. 45 www.gradeup.co

Related Information Highlights of the report • Jallikattu is a traditional spectacle in • The report has predicted the following which a bull, such or Kangayam major risks under five categories: breeds s released into a crowd of (a) Economic people, and multiple human • Asset bubbles in a major economy participants attempt to grab the large (b) Environmental hump on the bull's back with both • Extreme weather events arms and hang on to it while the bull • Failure of climate change mitigation attempts to escape. and adaptation • Jallikattu is typically practiced in the • Natural disasters Indian state of Tamil Nadu as a part • Man-made environmental disasters of Pongal celebrations on Mattu • Biodiversity loss and ecosystem Pongal day. collapse Note: The animal rights organizations have • Failure of climate change mitigation called for a ban on the sport, resulting in the and adaptation court banning it several times over the past (c) Geo-Political years. However, with protest from the people • Weapons of mass destruction against the ban, a new ordinance was made (d) Societal in 2017 to continue the sport. • Large-scale involuntary migration Topic- GS Paper 1 – Art and Culture • Water crises Source-PIB • A spread of infectious diseases 4. Global Risks Report (d) Technological • The Global Risks Report 2019 of the World • Data fraud or theft Economic Forum (WEF) describes changes • Cyber-attacks occurring in the global risks landscape • Critical information infrastructure breakdown from year to year and identifies global Note: The report warns about growth in catastrophic risks. 2019 getting held back by continuing geo- • The report also examines the interconnectedness of risks and considers economic tensions, with 88 percent of how the strategies for the mitigation of respondents expecting further erosion of global risks might be structured. multilateral trading rules and agreements.

Important reports published by Various organization

Name of the Reports International Organization World Economic Outlook International Monetary Fund (IMF) Global Financial Stability Report International Monetary Fund (IMF) Global Money Laundering Report Financial Action Task Force (FATF) Global Economic Prospects The World Bank World Development Report The World Bank Ease of Doing Business The World Bank Environmental Performance Index World Economic Forum Global Competitive Index World Economic Forum Global Gender Gap Report World Economic Forum The Global Risk Report World Economic Forum Human Capital Report World Economic Forum Human Development Index United Nations Development Programme (UNDP) Sustainable development Goals United Nations Development Programme (UNDP) Gender Inequality Index United Nations Development Programme (UNDP) Global Hunger Index International Food Policy Research Institute (IFPRI) World Happiness Report Sustainable Development Solution Network (SDSN)

Topic- GS Paper 3 – Important Report Source- Indian Express 46 www.gradeup.co

5. Common Pochard Exim Bank from Rs. 10,000 crore to • Delay in migratory birds like ‘Common Rs. 20,000 crore. Pochard’ visiting Delhi has worried the • The recapitalization bonds will be on environmentalists and bird-lovers etc. the lines issued to Public Sector Common Pochard Banks. • Common Pochard is a medium-sized Major Impact: duck. • Exim Bank is the principal export • It migrates to India from central Asia credit agency for India. in October. • The infusion of capital into Exim Bank • The number of the species is declining will enable it to augment capital globally because of climate and adequacy and support Indian exports anthropological reasons. with enhanced ability. • IUCN status- Vulnerable • The infusion will give an impetus to Topic- GS Paper 3 – Biodiversity anticipate new initiatives like Source- Indian Express supporting Indian textile industries, 6. Rupee pact with Iran to aid likely changes in Concessional Finance pharma exports Scheme (CFS), likelihood of new LoCs • The Indian pharma industry now has in future in view of India's active an opportunity to increase exports to foreign policy and strategic intent. Iran, following a rupee payment Exim Bank of India mechanism agreed upon recently by • It was established in 1982 under an India and the Persian Gulf nation. Act of Parliament as the apex financial • Under the agreement, Indian refiners institution for financing, facilitating make payments in rupee for oil and promoting India's international imports from Iran. trade. • It has designated accounts maintained with UCO Bank. • The Bank primarily lends for exports • A portion thus received is to be used from India including supporting by Iran to pay for imports from India, overseas buyers and Indian suppliers including pharmaceuticals. for export of developmental and Related Information infrastructure projects, equipment, • Iran has a well-established pharma goods, and services from India. industry that meets 80% of the • It is regulated by RBI. country’s requirement. Topic- GS Paper 3 – Indian Economy • Indian pharma exports to Iran were at Source-PIB $124.05 million last fiscal. 7. Sita Rama project gets Centre’s nod • The remaining 20% is met • The Union Ministry of Environment, predominantly through imports from Forest and Climate Change has given Europe. its approval for the Sita Rama Lift Topic- GS Paper 3 – Economics Irrigation Project of Telangana. Source- The Hindu • The project would be completed in 7. Cabinet approves recapitalization three years and would lead to of Export-Import Bank of India submergence of about 1,930-hectare • The Union Cabinet has approved the area and 157 villages. recapitalization of EXIM Bank. Sita Rama Lift Irrigation Project • The details are as follows: • The project aims to divert Godavari (i) Issuance of Recapitalization Bonds river water to irrigate 2.72 lakh by GOI to the tune of Rs.6,000 crore hectares in three districts of Bhadradri for capital infusion in Export-Import Kothagudem, Khammam and Bank of India (Exim Bank). Mahabubabad districts of Telangana. (ii) The equity will be infused • The water from River Godavari will be • The Cabinet also approved an diverted from the upstream of increase in the authorized capital of existing Dummugudem Anicut barrage. 47 www.gradeup.co

• Head regulator would be constructed • Overall, the programme would be at Dummugudem Anicut on Godavari conducted for 3 years by U.R. Rao river and lined canal of about 372 km Satellite Centre of ISRO. would be constructed. • It has 3 batches and will target to Topic- GS Paper 2 – Governance benefit officials of 45 countries. Source- Indian Express Topic- GS Paper 3 – Science and 8. Humans are closer to setting up a Technology base on Moon’ Source- Indian express • China’s Chang’e-4 lander successfully 10. Manipur's new anti-lynching law grew a cotton plant on the Moon, but • Supreme Court issued a slew of it died soon after. directions to the Union and State This one is a first to grow a plant in a • governments to protect India’s controlled environment on the Moon. ‘pluralist social fabric’ from mob • The significance, of course, is that we violence six months before. now have positive confirmation that • SC described Mob lynching as ‘horrific we can grow food in controlled acts of mobocracy’. environments on the Moon. • The court felt compelled to act in the • In space, almost anything can be shadow of four years of surging hate grown there because we are speaking violence targeting religious and caste of controlled environments and hence minorities. It also urged Parliament to perhaps the only limiting factors are consider passing a law to combat mob the abiotic factors like water, light etc. hate crime. Note: India is yet to send a spacecraft which can do such experiments on the lunar surface • Manipur became the first to pass a or in space. remarkable law against lynching. Topic- GS Paper 3 – Science and • Its definition of lynching is Technology comprehensive, covering many forms Source- Down to Earth of hate crimes. 9. UNNATI programme • These are “any act or series of acts of • Minister of State in Department violence or aiding, abetting such inaugurated the 1st batch of UNNATI act/acts thereof, whether programme of Indian Space Research spontaneous or planned, by a mob on Organisation (ISRO) in Bengaluru, the grounds of religion, race, caste, Karnataka. sex, place of birth, language, dietary • UNNATI stands for Unispace practices, sexual orientation, political Nanosatellite Assembly and affiliation, ethnicity or any other Training programme. related grounds. • It has been launched by ISRO as part Topic- GS-3 Indian Polity of an initiative by United Nations Source- The Hindu Office for Outer Space Affairs to commemorate the 50th anniversary 21.01.2019 of the first United Nations Conference on the Exploration and Peaceful Uses 1. Nagaland can reject Citizenship Bill of Outer Space (UNISPACE-50). • Recently, Nagaland, along with other UNNATI northeastern States, has witnessed • Under the program, India will provide several protests following the passage 2 months training to 32 participants of the Citizenship bill 2016 Bill in the from 18 countries from Algeria, Lok Sabha. Argentina, Azerbaijan, Bhutan, Brazil, Related Information Chile, Egypt, Ethiopia, Indonesia, Article 371(A) Kazakhstan, Malaysia, Mexico, • Special provision with respect to the Mongolia, Morocco, Myanmar, Oman, State of Nagaland Panama and Portugal. (1) Notwithstanding anything in this Constitution,

48 www.gradeup.co

(a) no Act of Parliament in respect of • It was developed in response to the (i) religious or social practices of the operational needs of Indian Armed Nagas, Forces and its capabilities far exceed (ii) Naga customary law and that of contemporary attack procedure, helicopters of its class. (iii) administration of civil and criminal Features of the LCH justice involving decisions according • It is the only attack helicopter in the to Naga customary law, world which is capable of operating at (iv) ownership and transfer of land altitudes as high as the location of and its resources shall apply to the Siachen glacier. State of Nagaland unless the • It is mounted with a helmet mounted Legislative Assembly of Nagaland by a sight and a forward-looking infrared resolution so decides; sighting system. • (b) The Governor of Nagaland shall • This advance sighting system will have special responsibility with enable the pilot to launch a missile respect to law and order in the State onto any target without having to turn of Nagaland the helicopter. • Nagaland is also protected by the • The LCH is capable of operating from Bengal Eastern Frontier Regulation of dispersed locations and flying at ultra- 1873, whereby an Inner Line Permit is low levels. issued to outsiders for safeguarding • This provides a protective umbrella the citizenship, rights, and privileges from all aerial threats. of the Nagas. Topic- GS Paper 3 –Defence Why Assam and other NE states are Source- TOI opposing this bill? 3. Rajasthan’s State bird may be • The bill seeks to facilitate granting of extinct soon Indian citizenship for non-Muslim • Recently, the report revealed that migrants from Bangladesh, Pakistan, Rajasthan state bird “The Great and Afghanistan. Indian Bustard’ may be extinct soon Inner Line Permit only 50 Great Indian Bustards left in • Inner Line Permit (ILP) is an official the wild. travel document issued by the Initiatives are taken by the government Government of India to allow inward • The Rajasthan government proposed travel of an Indian citizen into a setting up of captive breeding centers protected area for a limited period. at Sorsan in Kota district and a • It is obligatory for Indian citizens from hatchery in Jaisalmer’s Mokhala outside those states to obtain a permit village for the conservation of the for entering into the protected state. State bird of Rajasthan almost two • Currently, there are 3 states have a years ago but failed to save these provision of Inner Line Permit. These critically endangered birds. states are- Arunachal Pradesh, • The Union Ministry of Environment, Mizoram, Nagaland. Forest and Climate Change facilitate Topic- GS Paper 2 –Governance the two centers and authorized the Source- The Hindu Wildlife Institute of India for the 2. Light Combat Helicopter Completes saving of this species. Weapon Trials Related Information • Light Combat Helicopter (LCH) Great Indian Bustard designed and developed by Rotary • It is a bustard found on the Indian Wing Research & Design Centre subcontinent. (RWRDC) of HAL has successfully • These birds are often found carried out an air-to-air missile test. associated in the same habitat as • It was for the first time in India that a blackbuck. helicopter had carried out air to air • It is protected under the Wildlife missile engagement. Protection Act 1972 of India. 49 www.gradeup.co

• Males have a well-developed gular 5. DD to start its own OTT platform pouch which is inflated when calling • Recently Doordarshan, India’s public during display and helps produce the service broadcaster, is working deep resonant calls. towards plans to launch its own OTT • IUCN status: Critically (over-the-top) platform to stream Endangered content to viewers over the Internet. Note: An incubation unit set up at Jaisalmer • Doordarshan is also planning to have district’s Sudasri — considered the sanctum its own digital platform where it can sanctorum of the Desert National Park — for put out its content which can be these Great Indian Bustard. available worldwide. Topic- GS Paper 3 –Biodiversity Related Information Source- The Hindu Doordarshan (DD) 4. India ranks third in research on • It is an autonomous public service artificial intelligence broadcaster funded by the GOI, • India ranks third in the world in terms owned by the Broadcasting Ministry of of high-quality research publications India and one of Prasar Bharati's two in artificial intelligence (AI). divisions. • India came third in the world with • It was established on 15 September 12,135 documents trailed behind 1959. China with 37, 918 documents and • It also broadcasts on digital terrestrial the United States with 32,421 transmitters, provides television, documents. radio, online and mobile service Related Information throughout metropolitan and regional India in Artificial Intelligence India and overseas through the Indian • India’s traditional strength in Network and Radio India. information technology and AI said to Topic- GS Paper 2 –Governance pose a transformation in industry and Source- The Hindu academic circles, the report was an 6. Satellite to deliver the world’s first attempt at mapping the state of AI- artificial meteor shower blasted into space based research in India. • A rocket carrying a satellite on a • There were only about 50 to 75 mission to deliver the world’s first principal researchers in the AI-space artificial meteor shower blasted into in India and they were tended to space. collaborate with each other. • A start-up based in Tokyo developed • The Indian Institutes of Technology the micro-satellite for the celestial and the Indian Institutes of show over Hiroshima early next year Information Technology were among as the initial experiment for what it the key centers for AI research. calls a “shooting stars on demand” • NITI Ayog in June 2018 released a service. discussion paper on the • The satellite is to release tiny balls transformative potential of AI in India that glow brightly as they hurtle that said the country could add $1 through the atmosphere, simulating a trillion to its economy by integrating meteor shower. AI into its economy. • It hitched a ride on the small-size • Healthcare, financial services, Epsilon-4 rocket that was launched monsoon forecasting, retail, and from the Uchinoura space center by education were the key fields likely to the Japan Aerospace Exploration benefit from AI and the field was Agency (JAXA). “unlikely to lead” to the destruction of • The rocket carried a total of seven jobs a key global concern regarding ultra-small satellites that will the field. demonstrate various “innovative” Topic- GS Paper 3 –Science and technologies. Technology Topic- GS Paper 3 –Science and technology Source- Business Standard Source- The Hindu 50 www.gradeup.co

7. District Mineral Fund Topic- GS Paper 3 –Science and • PMKKKY is aimed at providing welfare to Technology those affected by mining operations. Source-PIB • Under the programme, a portion of 9. Diffo Bridge inaugurated in revenues (10-30 percent of the Arunachal Pradesh royalty proceeds from the minerals) is • Defence Minister inaugurated the earmarked for development activities Diffo Bridge over Chipu River in Lower in mining regions. Dibang Valley District. • With just 24 percent of the ₹23,606- • The bridge is 426 meters in length and crore mopped up under the Pradhan its work started in 2011. Mantri Khanij Kshetra Kalyan Yojana • The project is completed by Border (PMKKKY) actually spent, the Centre Roads Organisation. has advised States to increase the Border Roads Organisation (BRO) spending under the District Mining • The Border Roads Organisation (BRO) Fund (DMF) programme while develops and maintains road ensuring that there is no fund networks in India's border areas and diversion or leakage. friendly neighboring countries. Related Information • The BRO was formed on 7 May 1960. Pradhan Mantri Khanij Kshetra Kalyan Topic- GS-1 Indian Geography Yojana (PMKKKY) Source- AIR • It is aimed at the welfare of areas and people affected by mining-related 22.01.2019 operations, using the funds generated by District Mineral Foundations (DMFs). 1. Kinnar Akhara • The scheme mandates that 60 % • Kinnar Akhara is a group of share of the funds be spent on high transgender saints pursuing religious priority areas like drinking water activities has emerged as a very supply, health care, sanitation, significant feature at Prayagraj education, skill development, women Kumbh. and child care, the welfare of aged Related Information and disabled people, skill • Transgenders have been part of development and environmental Sanatan Dharm and they have been conservation. given respectful status in religious • The funds accumulated in the District epics and books of Hindu mythology. Mineral Funds would be used for • Akhara has provided a forum to implementing PMKKKY. transgenders to pursue a dignified life Topic- GS Paper 2 –Governance with religious rituals. Source- Indian Express Topic- GS Paper 1 –Art and Culture 8. Young Scientist Programme Source-PIB • ISRO has announced the ‘Young 2. Protest against proposed bird Scientists Programme’ to encourage sanctuary in Manipur the scientific talent and increase • The Manipur government’s plan to set scientific pool in the country up a bird sanctuary at the • In this program, three students, in Bishnupur district has met with stiff eighth standard pass, will be selected opposition from the villagers in nearby from each of the 29 states and seven areas. Union Territories. Concern: • They will spend one month at ISRO • Thousands of migratory birds flock to during which they will be given the Loktak lake, the largest lectures, get access to research and freshwater lake in north-eastern development and will be given the India, every year but in the past few experience to build a satellite. years there has been a sharp decline • This programme is similar to NASA’s in the number of migratory birds student outreach. coming to the lake.

51 www.gradeup.co

• The Brow-antlered deer which are India) and SI (cartography) are key endangered is also facing the problem national survey organisations of India. of poaching. Topic- GS Paper 3- Biodiversity Related Information Source- The Hindu Loktak Lake 4. International Solar Alliance plans • Loktak Lake is the largest freshwater bank to fund energy access lake in Northeast India and is famous • The International Solar Alliance (ISA) for the phumdis (heterogeneous mass is going to propose a new bank of vegetation, soil and organic matter exclusively for financing energy at various stages of decomposition) access to billions. floating over it. • The bank is still at the ideation stage. • Keibul Lamjao National Park is the • ISA has asked the Asian Development only floating national park in the world Bank to prepare a concept note. on this Phumids. • A public-private partnership is being • The park is the last natural refuge of thought of for the proposed, which will the endangered Sangai (state work for 1.2 billion people who lack animal), one of three subspecies of access to energy as well as the 2.4 Eld's deer. billion who lack access to clean • It was also listed under the Montreux energy. Record on 16 June 1993, "a record of Related Information Ramsar sites where changes in • According to a recent World Bank ecological character have occurred, report, 600 million people would are occurring or are likely to occur. continue to have no access to energy Topic- GS Paper 3- Environment even in 2040. Source- Indian Express • Existing banks do not focus on 3. 19 amphibian species are universal energy access—those still critically endangered: ZSI list deprived are the poorest of the poor. • Recently an updated list of Indian • The bank should first target energy amphibians was released on the access and then focus on clean Zoological Survey of India (ZSI) in energy. which 19 species being treated as Indian Scenario critically endangered and 33 species • Renewable energy got a boost in 2015 as endangered. when India decided to install 175 • It highlights 19% of amphibians as gigawatt capacity of such energy by data deficient species and about 39% 2022. as not assessed by IUCN. International Solar Alliance (ISA) • The list is updated and launched by • The ISA is an Indian initiative, jointly ZSI from time to time as per the launched by the Prime Minister of International Union for Conservation India, Shri Narendra Modi and the of Nature (IUCN). President of France on 30th November Related Information 2015 in Paris, on the side-lines of Zoological Survey of India (ZSI) COP-21, the UN Climate Conference. • It is founded on 1 July 1916 by GOI, • The alliance's primary objective is- Ministry of Environment, Forest and (a) Work for the efficient exploitation Climate Change, as premier Indian of solar energy to reduce dependence organization in zoological research on fossil fuels. and studies to promote the survey, • (b) Mobilize $1 trillion in funds for exploration, and research of the fauna future solar generation, storage and in the country. technology across the world. • ZSI (zoology) as well as ASI • The ISA, headquartered in India, has (archaeology), BSI (botany), FSI its Secretariat located in the (forests), FiSI (fisheries), GSI Gwalpahari, Gurgaon, Haryana. (geology), IIEE (ecology), NIO (oceanography), RGCCI (Census of 52 www.gradeup.co

• India has offered to meet ISA 6. Operation Kabaddi’ Secretariat expenses for an initial five • Former army commanders have years. revealed the details of this operation Topic- GS Paper 3- Environment in the book, Line on Fire: Ceasefire Source- Indian Express Violations and India-Pakistan 5. Global Economy Watch by PwC Escalation Dynamics. • Global Economy Watch report has • It was to be the largest planned been released by London based operation by the Indian Army to end multinational professional services cross-LoC infiltration by capturing at network- PricewaterhouseCoopers least 25 selected Pakistani posts along (PwC). the Line of Control (LoC) in September 2001. But due to some • It is a short publication that looks at issues, it was not carried out. the trends and issues affecting the The objective of Operation Kabaddi global economy and details its latest • projections for the world’s leading was to change the geography of the LoC with access to tactical points economies. there, which would then help the • The report notes that the global Army tackle the infiltration of militants economy as a whole is expected to by the Pakistani side. slow in 2019 as G7 countries return to • Operation Kabaddi would include a long-run average growth rates. “wide spectrum of evolving punitive • The main focus of tensions is likely to operations such as the: remain US-China trade, but there will 1. execution of deliberate fire always be the risk of this escalating assaults to destroy military and into a wider trade conflict and terrorist points, businesses accordingly need to plan 2. area targets across the LoC for different scenarios. 3. ambushes and raids across the Highlights of Indian’s economy ranking 2019 LOC etc. • India is likely to surpass the United Topic- GS Paper 3- Defence Kingdom in the world’s largest Source- The Hindu economy rankings in 2019. 7. Rio de Janeiro recognized as • As per the report, while the UK and World Capital of Architecture France have regularly switched places 2020 owing to similar levels of development • Rio de Janeiro has been recognized as and roughly equal populations, India’s ‘World Capital of Architecture’ for climb up the rankings is likely to be 2020 by The United Nations permanent. Educational, Scientific and Cultural • The report projects real GDP growth Organisation (UNESCO). of 1.6% for the UK, 1.7% for France • Rio de Janeiro will be hosting the and 7.6% for India in 2019. World Congress of the International • India should return to a healthy Union of Architects (UIA) in July 2020. growth rate of 7.6% in 2019-20 if • The theme of the 2020 World there are no major headwinds in the Congress of the International Union of global economy such as enhanced Architects is “All the worlds. Just trade tensions or supply-side shocks one world. in oil. Related Information • The growth will be supported World Capital of Architecture through the further realization of • The World Capital of Architecture efficiency gains from the newly initiative underscores the common adopted GST and policy impetus commitment of UNESCO and the UIA expected in the first year of a new to preserve architectural heritage in government. the urban context. Topic- GS Paper 3- Economy Source- Economics Times 53 www.gradeup.co

• UNESCO designates the World Capital • The alliance has been working with of Architecture as per the partnership the World Business Council for agreement with the UIA. Sustainable Development as a • The World Capital of Architecture also founding strategic partner. hosts the UIA’s World Congress, an Topic- GS-3-Environment event that takes place every three Source- Economic Times years. 10. Africa and Asia come together to lead Topic- GS Paper 1- Art and Culture a global initiative "Smart Food Executive Source- The Hindu Council" to diversify staples 8. Madhu Babu Pension Yojana scheme • In a first, the largest agriculture • Odisha CM hiked Rs.200 per month associations in Africa and Asia met on under Madhu Babu Pension Yojana January 13, 2019, in to (MBPY). sign an agreement for diversifying major food staples. Related Information • Associations including Madhu Babu Pension Yojana (a) Asia-Pacific Association of Agricultural • Odisha government launched Madhu Research Institutions (APAARI), Babu Pension Yojana in 2008, by (b) Forum for Agricultural Research in merging two pension schemes – Old Africa (FARA), Age Pension and Odisha Disability (c) West and Central African Council Pension schemes for Agricultural Research and • It’s objective of providing financial Development (CORAF), assistance to the destitute elderly and (d) Food Agriculture and Natural destitute differently abled persons in Resources Policy Analysis Network the state. (FANRPAN), and Topic- GS Paper 2- Government Scheme (e) International Crops Research Institute Source- Indian Express for the Semi-Arid Tropics (ICRISAT) 9. "Alliance to End Plastic Waste" (AEPW) to got together to form the Smart Food eliminate plastic waste launched Executive Council. • Several organizations launched a new Smart Food Executive Council firm to improve ways to eliminate • It has been formed under the aegis of plastic waste in the environment, the Smart Food Initiative that was especially in the water bodies. launched in 2013 and stemmed from • The cross-value chain Alliance to End the strategic thinking around the need Plastic Waste (AEPW), currently made for food that fulfills the criteria of up of nearly 30 member companies, being good for the consumer, good for has committed over USD 1.0 billion the planet and good for the farmer. with the goal of investing USD 1.5 • This would contribute to the SDGs for billion over the next five years to help (a) Overcoming poverty and hunger end plastic waste in the environment. (SDG 1 and 2), (b) Responsible consumption and • The global companies alliance will develop production (SDG 12), along with and bring to scale solutions that will minimize and manage plastic waste and adaptation to climate change (Goal 13). promote solutions for used plastics by (c) The approach taken will include helping to enable a circular economy. gender equality (SDG 5) and action • The alliance is a not-for-profit through partnerships (SDG 17). organization that includes companies • This new partnership strengthens that make, use, sell, process, collect collaborations between Asia and and recycle plastics. Africa and can open up opportunities • This includes chemical and plastic to join forces at any point along the manufacturers, consumer goods value chain, from consumers through companies, retailers, converters, and to processors, chefs through to waste management companies, also farmers, researchers and others. known as the plastics value chain. Topic- GS-3-International Organisation Source- Down to Earth 54 www.gradeup.co

• According to the WHO, infection 23.01.2019 occurs when filarial parasites are transmitted to humans through 1. Arunachal government declares mosquitoes. Pakke Hornbill Fest as ‘state • The infection is usually acquired in festival’ childhood, causing hidden damage to • Pakke Paga Hornbill Festival (PPHF) is the lymphatic system. only conservation festival of • The parasites are transmitted by four Arunachal Pradesh. main types of mosquitoes: Culex, • PPHF festival is celebrated to the first time Mansonia, Anopheles and Aedes. in 2015 to recognize the role played by the Note: India has missed earlier deadlines to resident Nyishi tribe in conserving eradicate the disease by 2015 and 2017. The hornbills in the Pakke Tiger Reserve. global deadline now is 2020 and the three- Great Indian Hornbill drug approach may help the country get it. • It is predominantly fruit eating, but is Topic- GS Paper 2 –Health issue an opportunist and preys on small Source- The Hindu mammals, reptiles and birds. 3. Project ReWeave • IUCN status: Vulnerable (uplisted • Project Rewave is e-commerce from Near Threatened in 2018). platform “re-wev.in’ launched • It is also listed in Appendix I of CITES. by Microsoft in 2016 to help Topic- GS Paper 1 –Art and Culture handloom weavers. Source- Indian Express • It will help to connect artisans to the 2. Triple-drug therapy for lymphatic buyers directly enabling them to filariasis expand to newer customers and • Maharashtra is all set to roll out the WHO- markets. recommended triple-drug therapy for • It also provides a platform to lymphatic filariasis to speed up the showcase signature collections elimination of the disease. created by the weaver communities, • It is a pilot project which is rolled out showcase traditional designs and in Nagpur. products created from natural dyes to • Nagpur is one of the five districts in a broad set of customers. the country and only one in • It helps in increasing the waiver their Maharashtra where this triple-drug income and earning a sustainable therapy campaign is being launched. livelihood while also reviving Triple drug therapy traditional forgotten Indian art. • WHO is recommending three drug • Under the initiative, Microsoft is treatment to accelerate the global working closely with NGO partner, elimination of lymphatic filariasis. Chaitanya Bharathi to provide • The treatment, known as IDA, infrastructure, financing and involves a combination of ivermectin, marketing support to help weaver diethylcarbamazine citrate and families keep their weaving traditions albendazole. alive by sustaining livelihoods. • It is being recommended annually in Topic- GS Paper 3 –Economics settings where its use is expected to Source- Indian Express have the greatest impact. 4. National Social Assistance • The third drug is used in this therapy Programme (NSAP) will help control adult worms of • The Rural Development Ministry has lymphatic filariasis. proposed to bring in the following • Micro filariasis, which is produced by changes in monthly pensions under adult worms, is the cause of a swollen the National Social Assistance leg. Programme (NSAP): Related Information Lymphatic filariasis (elephantiasis) (a) For the elderly poor, disabled and widows pensions are to be increased • It is a neglected tropical disease. from the current ₹200 to ₹800. 55 www.gradeup.co

(b) For those above the age of 80, the fiscal balance of the countries around proposal is to increase the pension the globe. from ₹500 to ₹1,200 a month. • It also deals with major economic About Programme policy issues. • It is a Centrally Sponsored Scheme Topic- GS Paper 2 –Economics report under the Ministry of Rural Source- Indian Express Development. 6. Oxfam Annual Wealth Check report • It represents a significant step 2019 towards the fulfilment of the DPSP in • The Annual Wealth Check report 2019 Article 41 of the Constitution. released by Oxfam an international • In Article 41 of the Constitution of rights group. India directs the State to provide public assistance to its citizens in case • The release of the report marked the of unemployment, old age, sickness start of the annual Meeting World and disablement and in other cases of Economic Forum in Davos, undeserved want within the limit of its Switzerland. economic capacity and development. • The important features of the report • Presently NSAP comprises of five are: schemes, namely: (a) 26 richest billionaires own as o Indira Gandhi National Old Age many assets as the 3.8 billion people Pension Scheme (IGNOAPS). who make up the poorest half of the world. o Indira Gandhi National Widow (b) The 12 percent increase in the Pension Scheme (IGNWPS). wealth of the very richest contrasted o Indira Gandhi National Disability with a fall of 11 per cent in the wealth Pension Scheme (IGNDPS). of the poorest half of the world’s o National Family Benefit Scheme population NFBS). (c) The widening gap is hindering the o Annapurna fight against poverty. Topic- GS Paper 2 – Governance • The report estimates that a wealth tax Source- The Hindu of 1% would raise an estimated 5. World Economic Outlook Report $418bn (£325bn) a year. • The International Monetary Fund • This would be enough to educate (IMF) has released an update of its every child, not in school and provide biennial World Economic Outlook healthcare that would prevent 3 Report 2018. million deaths. Highlights of report Facts about India • India’s GDP is forecasted to expand • The top 1% of India’s richest lot got 7.5% in FY20 and 7.7% in FY21. richer by 39% as against just 3% China’s growth is seen at 6.2% in both • increase in the wealth for the bottom years. half of the population. The global economy is projected to • • 6 Crore Indians who make up the grow by 3.5% in 2019 and 3.6% in poorest 10 percent of the country, 2020. continued to remain in debt since About the report 2004. • It is a survey conducted and published • Top 10% of the richest population in by the International Monetary Fund. India holds 77.4% of the total national • It is published biannually and partly wealth. updated two times a year. • In many countries including India, a • WEO forecasts include key decent education or quality healthcare macroeconomic indicators such as has become a luxury only the rich can GDP, inflation, current account and afford.

56 www.gradeup.co

• Children from poor families in India • According to the report, 12 of the 17 are three times more likely to die general category States grew faster before their first birthday than than the national growth rate. children from rich families. • The growth was not equitable, with • The calculations and interpolations in the gap between the per capita the report were based on the data incomes in low-income and high- from the latest comprehensive data income States widening over the last sources available publicly, including five years. from the Credit Suisse Wealth • In fiscal 2018: Databook and the annual Forbes (a) Bihar, Andhra Pradesh, and Billionaires Gujarat were top-rankers in terms Topic- GS Paper 2 –Economics of Gross State Domestic Product (GSDP) growth among the 17 non- Source- TOI special States considered in our 7. Sea Vigil 2019 analysis. • It is the first-of-its-kind exercise will (b) Jharkhand, Kerala, and Punjab be undertaken along the entire were at the bottom. coastline and Exclusive Economic • The analysis found that between the Zone (EEZ) of India. financial years 2012-13 and 2016-17, • The Navy in coordination with the Gujarat, Madhya Pradesh and Coast Guard and other stakeholders Karnataka were the fastest growing will conduct a two-day defence states, on average. exercise along the coastline. • West Bengal, Jharkhand and Bihar • The exercise is codenamed as "Sea had ranked at the bottom in the past Vigil 2019" and it is the first exercise five years. on such a large scale. • In Gujarat and Karnataka, • It will involve all the coastal States manufacturing was the main driver, and Union Territories, maritime while in Madhya Pradesh, agriculture stakeholders including the fishing and and allied activities drove growth on coastal communities. average. • On the fiscal front most veered off the • The exercise is a build-up towards the Fiscal Responsibility and Budget major ‘Theatre Level Readiness and Management Act (FRBM) line of Operational Exercise (TROPEX)’ that maintaining their fiscal deficits at 3% the Indian Navy conducts every two of their respective state GDPs. years. • Rajasthan, Jharkhand and Uttar • SEA VIGIL and TROPEX will together Pradesh topped the tally in the cover the entire spectrum of maritime proportion of capex in state spending security, including the transition from in the past three years. peace to conflict. • The combined fiscal deficit of States Topic- GS Paper 3 –Defence crossed the 3% of GSDP threshold, in Source- The Hindu both fiscals 2016 and 2017. 8. Bihar posted the highest rise in state • This improved in fiscal 2018 to 3.1%, but GDP in 2017-18 this was still higher than the FRBM limit. • Bihar and Andhra Pradesh led the Fiscal Responsibility and Budget pack among States in terms of GDP Management (FRBM) 20003 growth in financial year 2017-18, • It is an Act of the Parliament of India clocking 11.3% and 11.2% growth, to respectively, compared with the (a) institutionalize financial discipline, national GDP growth of 6.7% for the (b) reduce India's fiscal deficit, year, according to a report by Crisil. (c) improve macroeconomic Highlights of the Report management and (d) the overall management of the public funds by moving towards a

57 www.gradeup.co

balanced budget and strengthen fiscal therefore, in the implementation of prudence GST across the country. • The main purpose was to eliminate • Chapter XVIII of the CGST Act the revenue deficit of the country and provides for the Appeal and Review bring down the fiscal deficit to a Mechanism for dispute resolution manageable 3% of the GDP by March under the GST Regime. Section 109 of 2008. this Chapter under CGST Act • However, due to the 2007 empowers the Central Government to international financial crisis, the constitute, on the recommendation of deadlines for the implementation of Council. the targets in the act was initially Topic- GS Paper 3 –Economics postponed and subsequently Source-PIB suspended in many times in due to 2. e-NAM portal various reasons. • The first inter-State trade on e-Nam • Budget 2018-19 proposed amending between Andhra Pradesh and the FRBM Act again, which shifted the Telangana has been carried out target of 3% fiscal deficit-GDP ratio to recently between farmer from Gadwal end-March 2021. mandi in Telangana State. Topic- GS Paper 3 –Economics Related Information Source- Indian Express e-NAM • The e-NAM platform is pan-India 24.01.2019 electronic trading (e-trading) portal to network the existing physical 1. Cabinet approves the creation of the regulated wholesale market (known National Bench of the "GSTAT" as APMC market) through a virtual • The Union Cabinet has approved the platform to create a unified national creation of National Bench of the market for agricultural commodities. Goods and Services Tax Appellate • This portal is implemented by the Tribunal (GSTAT). Ministry of Agriculture & Farmers’ • The National Bench of the Appellate Welfare. Tribunal shall be situated at New Objective Delhi. • To provide competitive and • GSTAT shall be presided over by its remunerative price to farmers for President and shall consist of one their products through an online Technical Member (Centre) and one competitive and transparent bidding Technical Member (State). process. Relate Information • It integrates Central Farmer Database GSTAT to increase the efficiency and reduce • It is the form of the second appeal in queue time. GST laws and the first common forum • It seeks to increase the number of of dispute resolution between Centre traders and greater competition. It and States. will also ensure open price discovery • The appeals against the orders in first and better returns to farmers. appeals issued by the Appellate Topic- GS Paper 2 –Agriculture Authorities under the Central and Source-PIB State GST Acts lie before the GST 3. National Girl Child Day Appellate Tribunal, which is common • The Women & Child Development under the Central as well as State GST Ministry will celebrate National Girl Acts. Child Day (NGCD) in New Delhi. • Being a common forum, GST • The programme will also observe the Appellate Tribunal will ensure that anniversary of Beti Bachao Beti there is uniformity in redressal of Padhao (BBBP) Scheme. disputes arising under GST, and

58 www.gradeup.co

• The theme of this NGCD 5. Pravasi Bharatiya Divas is "Empowering Girls for a • The 15th Pravasi Bharatiya Divas Brighter Tomorrow” (PBD) was held in Varanasi (Uttar Objectives Pradesh). • Generating awareness on the issue of • Its theme was “Role of Indian declining Child Sex Ratio (CSR) Diaspora in building a New India”. • create a positive environment around valuing the girl child. • It was organized by the Ministry of Beti Bachao Beti Padhao (BBBP) Scheme External Affairs (MEA) in association • Beti Bachao Beti Padhao (BBBP) with the government of Uttar Pradesh. Scheme was launched by Hon’ble Pravasi Bharatiya Divas Prime Minister in 2015 at Panipat in • Pravasi Bharatiya Divas (PBD) is Haryana. celebrated once in every two years to • It is a tri-ministerial effort of Ministries strengthen the engagement of the of Women and Child Development, overseas Indian community with the Health & Family Welfare and Human Government of India and reconnect Resource Development. them with their roots. • BBBP Scheme is a Central Sector • It is celebrated on 9 January to mark Scheme with 100% financial the contribution of the Overseas assistance for District level Indian community in the development component and the fund are directly of India. But this time dates were released to the DC/DM’s account for shifted 21st January to allow the the smooth operation of the Scheme. guests attending the event to get an Topic- GS Paper 2 –Women opportunity to participate in the Empowerment 'Kumbh Mela' at Prayagraj and to Source-PIB attend the Republic Day parade. 4. Roshni: An app to help the visually • January 9 was chosen as the day to impaired celebrate this occasion since it was on • To assist visually impaired people to this day in 1915 that Mahatma Gandhi easily determine the denomination of returned to India from South Africa. currency notes, the Indian Institute of • During the event, individuals of Technology at Ropar in Punjab has exceptional merit are honoured with developed an app called “Roshni”, the prestigious Pravasi Bharatiya using image processing and analytics. Samman Award to appreciate their How does this app work? role in India’s growth. • This App utilises an adaptable deep Topic- GS Paper 2 –Governance learning framework, which further uses the patterns and features Source-PIB embedded on the notes to 6. Deen Dayal Hastkala Sankul differentiate and determine the • The Prime Minister inaugurated currency denomination. Centres of Excellence at Deen Dayal • The IPSA (Image processing, Security Hastkala Sankul in Varanasi, Uttar and Analytics) have a rich dataset of Pradesh recently. more than 13, 000 images of currency • It is a trade facilitation centre for notes under varied real-world handicrafts. conditions. • The Crafts Museum in the Sankul will • The user has to bring the currency preserve the traditional note in front of the phone camera and handloom/handicrafts products of the App would provide audio Varanasi. notification intimating the currency note denomination to the user. • It aims to facilitate weavers, artisans Topic- GS Paper 2 –Governance and exporters in promoting Source- The Hindu handlooms and handicrafts. 59 www.gradeup.co

Related Information (1) A northern Himalayan rivers inter- • The Finance Minister in the Budget link component 2014-15 had announced setting up of (2) A southern Peninsular component a Trade Facilitation Centre and a and starting 2005 Crafts Museum to develop and (3) An intrastate river linking component. promote handlooms, handicrafts and • The project is being managed by silk products of Varanasi. India's National Water Development Topic- GS Paper 2 –Scheme for Agency (NWDA), under its Ministry of Vulnerable section of Society Water Resources. Source-PIB • NWDA has studied and prepared 7. Godavari-Cauvery link project reports on 14 inter-link projects for • The Union Minister for Water the Himalayan component, 16 inter- Resources, River Development and link projects for Peninsular component Ganga Rejuvenation announced that and 37 intrastate river linking the Centre would soon take up a projects. major project to Link Rivers Godavari and Cauvery. • The Ken-Betwa, considered as Objectives: the first river inter-linking project, • The project aims to make good use of will help irrigate nearly 15 lakh acres about 1100 tmc ft of Godavari water of area. that is currently getting drained into Topic- GS Paper 2 –Governance the Bay of Bengal. Source- Indian express • The project would take the water from river 8. Study on the impact of unplanned Godavari to the tail end of Tamil Nadu. development on Ecology of Central • The government aims to raise Western Ghats finances for the project either from the World Bank or the Asian • The Indian Research team undertook Development Bank. a study to examine the possible • The government aims to address the impact of unplanned development on water deficit being faced and the Ecology of Central Western Ghats. resulting water dispute among the • The study focussed on River Kali that riparian states of Karnataka, Tamil originates in Uttara Kannada district in Karnataka and joins the Arabian Sea. Nadu, Kerala and Union Territory of Puducherry over sharing of the water • The river has six major dams, 325 from river Cauvery. species of flora, and 190 species of • The project would use low thickness fauna and the river is as old as the steel pipes with a special treatment Western Ghats. for linking the Godavari and -Cauvery Findings of the Study rather than canals as it results in • Unplanned developmental activities water loss due to evaporation losses. and land use patterns are reducing • The use of use low thickness steel the evergreen forest cover and pipes would also aid in reducing the perennial streams in the central project costs. region of the Western Ghats in India. River inter-linking Project • Researchers by studying the remote • The Indian Rivers Inter-link is a sensing data found that between the proposed large-scale civil engineering years 1973 and 2016, the forest cover project that aims to link Indian rivers has reduced from 85% to 55%. by a network of reservoirs and canals • The land use pattern in the region has and so reduce persistent floods in changed during 1980–2000 period some parts and water shortages in due to developmental projects such as other parts of India. dams built on the river Kali, Kaiga • The Inter-link project has been split nuclear plant and Dandeli paper mill into three parts which has led to large scale destruction of forests. 60 www.gradeup.co

• As a result, the evergreen forests Significances of using Bio-Jet Fuel have shrunk by from 62% to 38.5% • Bio-jet fuel is greenhouse gas (GHG) during 1980–2000 period and large neutral, carbon neutral, reduces air water reservoirs have been pollution. constructed at the expense of forest • The use of bio jet fuel will help in cover. reducing greenhouse gas (GHG) • The study citing Perennial streams emissions by about 15% and sulfur were found in regions that have oxides (SOx) emissions by over 99%. greater than 70% of forest cover links • It is expected to provide indigenous ecology and hydrology with land use. jet fuel supply security. Topic- GS Paper 3 –Environment • Its usage also offers superior engine performance and reduced Source- Down to Earth maintenance cost for the airline operators. 25.01.2019 Bureau of Indian Standards (BIS) • It is the National Standards Body of 1. INS Kohassa – a New Bird’s Nest India working under the aegis of the in the Andamans Ministry of Consumer Affairs, Food & • Naval Air Station Shibpur was Public Distribution, Government of commissioned as INS Kohassa. India. • NAS Shibpur was identified by NITI • It is established by the Bureau of Aayog as one of the ‘Early Bird’ Indian Standards Act, 1986. project as part of holistic island • Its headquarters are in New Delhi. development. • It also works as WTO-TBT (Technical • INS Kohassa has been named after a Barriers to Trade) enquiry point for White-Bellied Sea Eagle, which is a India. large bird of prey, endemic to Topic- GS Paper 3 – Environment Andaman and Nicobar Islands. Source-PIB Related Information 3. Successful Flight Test of LRSAM Naval Air Station Shibpur • Long Range Surface-to-Air Missile (LRSAM) has been successfully • It was established in 2001 as a testfired from INS Chennai against an Forward Operating Air Base (FOAB) incoming aerial target flying at low for enhanced surveillance in North altitude. Andaman. Related Information • The close proximity of Coco Islands Long Range Surface-to-Air Missile (Myanmar) and wide expanse of (LRSAM) Indian Exclusive Economic Zone (EEZ) • It has long-range engagement makes the base a very vital asset. capability to penetrate deep water Topic- GS Paper 3 – Defence and land to intercept all types of aerial Source-PIB targets like subsonic and supersonic 2. BIS in Collaboration with IAF missiles, fighter aircraft, maritime Releases New Standard for Bio- patrolling aircraft (MPA), helicopter Jet Fuel and sea-skimming missiles. • To use bio-jet fuel on all military and • It is capable of countering newest civilian aircraft, BIS has in generation anti-ship missiles. collaboration with IAF, research • Indian Navy has decided to equip its organisations and the industry all naval ships such as INS Kolkata, brought out a new standard for INS Kochi, and INS Chennai guided Aviation Turbine Fuels. missile destroyers with Barak 8 • These specifications will align Indian LRSAM for air and missile defence. standards with current international • Barak 8 LRSAM has been jointly standards. developed by DRDO and IAI, Israel to Related Information be launched from the ship. 61 www.gradeup.co

• It possesses a high degree of 5. Cabinet decides to strengthen manoeuvrability at target interception Northeast autonomous councils range. • The cabinet approves landmark • It has a maximum speed of Mach 2 with a amendment to Article 280 and Sixth maximum operational range of 70 km Schedule of the Constitution. (which has been increased to 100 km). • This amendment will significantly Topic- GS Paper 3- Defence improve the financial and executive Source- The Hindu powers of the 10 autonomous councils 4. 18 Indian institutions to study in the Sixth Schedule areas of the nitrogen pollution northeast. • Eighteen research institutions in India • The amendment would impact a are among a group of 50 institutions population of about 1 crore tribals called the South Asian Nitrogen Hub living in Assam, Meghalaya, Tripura (SANH) are selected with the financial and Mizoram, according to the Centre. assessment given by U.K government Highlights of the proposed amendment to study the impact of Nitrogen • As per the proposed amendment, at pollution, least one-third of the seats would be Related Information reserved for women in the village and How Nitrogen help in the greenhouse municipal councils in the Sixth effect? Schedule areas of Assam, Mizoram • Nitrogen is the dominant gas in the and Tripura. atmosphere, it is inert and doesn’t • The amendment also provides for the react. transfer of additional 30 subjects • However, when it is released as part including departments of Public of compounds from agriculture, Works, Forests, Public Health sewage and biological waste, nitrogen Engineering, Health and Family is considered “reactive”, and it may be Welfare, Urban Development and polluting and even exert a potent Food and Civil Supply to Karbi greenhouse gas (heat trapping) Anglong Autonomous Territorial effect. Council and Dima Hasao Autonomous • Nitrous oxide (N2O) is 300 times more Territorial Council in Assam. potent than carbon dioxide but isn’t as • Amendment in article 280 to mandate prevalent in the atmosphere. the Finance Commission to • Other than air pollution, nitrogen is recommend devolution of financial also linked to the loss of biodiversity, resources. This will significantly the pollution of rivers and seas, ozone improve the financial resources and depletion, health, economy, and powers of the autonomous districts livelihoods. councils. • Nitrogen pollution is caused by • Renaming of few existing autonomous emissions from chemical fertilisers, councils as the present jurisdiction of livestock manure and burning fossil these councils extend to more than fuels. one districts. • Gases such as ammonia (NH3) and • The proposed amendments provide nitrogen dioxide (NO2) contribute to for elected village municipal councils, poor air quality and can aggravate ensuring democracy at the grass- respiratory and heart conditions, roots level. leading to millions of premature • Elections to these village and deaths across the world. municipal councils will be conducted • Nitrate from chemical fertilisers, by the State Election Commission. manure and industry pollute the rivers There will be a provision for anti- and seas, posing a health risk for defection too. humans, fish, coral and plant life. • At least two nominated members in all Topic- GS Paper 3- Environment autonomous councils will be women. Source- The Hindu 62 www.gradeup.co

Sixth Schedule respect to weak gender equality and • The Sixth Schedule of the Constitution low tolerances towards minorities and deals with the administration of the immigrant. tribal areas in the four northeastern Topic- GS Paper 3 – Report and Index states of Assam, Meghalaya, Tripura Source- The Hindu and Mizoram as per article 244. 7. Indian Africa Field Training Exercise • The governor is empowered to IAFTX 2019 increase or decrease the areas or • Indian Africa Field Training Exercise change the names of the autonomous (IAFTX)-2019 was held in Pune. districts. Related Information • While executive powers of the Union IAFTX extend in Scheduled areas with • It is a joint training exercise between respect to their administration in the more than a dozen African countries & 5th schedule, the 6th schedule areas India. remain within executive authority of • The IAFTX-2019 is a positive step the state. towards growing political and military • The acts of Parliament or the state ties with the member nations of the legislature do not apply to African continent and will boost the autonomous districts and autonomous already strong strategic cooperation regions or apply with specified between the countries. modifications and exceptions. Topic- GS Paper 3 – Defence • The Councils have also been endowed Source- The Hindu with wide civil and criminal judicial 8. Pravasi Teerth Darshan Yojana powers, for example establishing • Prime Minister launched Pravasi village courts etc. However, the Teerth Darshan Yojana in New Delhi. jurisdiction of these councils is subject • Under this scheme, a group of Indian to the jurisdiction of the concerned origin currently in different nations High Court. will be taken to all religious places in Topic- GS Paper 2 – Social Justice and India twice a year. Empowerment Eligibility criteria for the scheme Source- The Hindu • The person should be Indian origin 6. Global Talent Competitive Index-2019 and aged between 45 to 65. The group will be selected out of them • India secured 80th rank in the Global • with first preference given to people Talent Competitive Index 2019. from ‘Girmitiya Countries’ such as Related Information Mauritius, Fiji, Suriname, Guyana, Global Talent Competitive Index Trinidad and Tobago and Jamaica. • This Index helps to measures the • Religious places of all major religions ability of countries to compete for in India are included in the scheme talent. and Government will bear all the • It is released by INSEAD business expenses including the airfare from school in partnership with Tata their country of residence. Communications and Adecco Group. Topic- GS Paper 1–Art and Culture • Its theme is "Entrepreneurial Source- Indian Express Talent & Global Competitiveness". 9. World's lightest satellite 'Kalamsat- • This Index takes into account V2' variables such as ease of hiring, • In its first mission of 2019, the ISRO gender earnings gap, and the successfully launched a students' prevalence of training in firms. satellite Kalamsat and an imaging India’s Context satellite Microsat-R from the Satish • India's biggest challenge is to improve Dhawan Space Centre in Sriharikota, its ability to attract and retain talent. Andhra Pradesh. • India needs to address its poor level • This is also the 46th flight of ISRO's of Internal Openness in particular with workhorse PSLV. 63 www.gradeup.co

Kalamsat 2. Ministry of Defence Launches ‘RDP • It is a payload developed by students INDIA 2019’ and Chennai based Space Kidz India • Ministry of Defence had launched a for the first time. mobile app 'RDP India 2019' on the • The Microsat-R satellite is meant for Republic Day as a new initiative in the Defence Research and sync with the Digital India campaign Development Organisation (DRDO) of the Government. purposes. • It helps to the intent of making • The Kalamsat is the first to use the available the highlights of the rocket`s fourth stage as an orbital Republic Day event, not only to the platform. spectators at Rajpath but also to the • ISRO is using the aluminium tank for general public all over the world. the first time in the fourth stage of the • This app contains information about launch of PSLV C 44. This is to reduce the Parade on Rajpath, New Delhi, the weight and increase the mass in including Order of the March, details the four-stage engine expendable of the tableaux presented by different rocket with alternating solid and liquid States and Ministries, children cultural fuel. performances, fly past and names of Related Information recipients of Pradhan Mantri Rashtriya Bal Puraskar 2019. • In its last mission, on November 29, It was extremely informative to the 2018, ISRO successfully injected • India's earth observation satellite spectators witnessing the Parade and was widely appreciated. HysIS onboard PSLV C43 into its • The app also had the provision for live designated orbit. streaming of the Parade. Topic- GS-3- Science & Technology Topic- GS Paper 2 –Governance Source- Economic Times Source-PIB 3. President of India Graces National 28.01.2019 Voters’ Day Celebrations

1. Jumbos to patrol Odisha’s Satkosia • The President of India graced and Tiger Reserve addressed the 9th National Voters’ • Patrolling in the Satkosia Tiger Day celebrations in New Delhi on 25 Reserve is set to be strengthened as January. two trained elephants would be • The theme of Voters’ Day 2019 is, No deployed there shortly. voter to be left behind. • The two elephants are being brought • The day is to mark the Foundation day from the Similipal Tiger Reserve. of the Election Commission of India, Related Information which was established on 25th Satkosia Tiger Reserve January 1950. • It is a tiger reserve located in the Topic- GS Paper 2 –Governance Angul district of Odisha. Source- The Hindu • It is located where the Mahanadi River 4. Pravasi Dividend Pension Scheme passes through a 22 km long gorge in • The government of Kerala has the Eastern Ghats mountains. launched ‘Pravasi Dividend Pension • The tiger reserve is located in the Scheme. Eastern Highlands moist deciduous Related Information forests ecoregion. About the Scheme • Saktosia Tiger Reserve was • The scheme has been introduced by the designated in 2007 and comprises the government of Kerala as part of welfare measures towards Pravasi Malayalis. Satkosia Gorge Wildlife Sanctuary and • Under the scheme, a regular pension the adjacent Baisipalli Wildlife would be provided to Non-Resident Sanctuary. Keralites on a one-time payment of Rs Topic- GS Paper 3 –Environment 5 lakh. Source- The Hindu 64 www.gradeup.co

• This onetime payment would be • Since Independence, the Indian deposited with KIIFB (Kerala defence forces have been playing Infrastructure Investment Fund ‘martial tune’ created by the Board) for financing infrastructure Britishers. `Sankhnaad’ is based on projects. Indian classical music. • The government had initiated Loka Related Information Kerala Sabha (LKS) with the aim of • The Constitution came into effect on using the expertise, talent, and January 26, 1950, a date specially resources of NRIs from Kerala for the chosen to coincide with the overall growth and development of anniversary of ‘Purna Swaraj Diwas’. the state. • January 26, 1930, was marked as Topic- GS Paper 2 –Important Scheme ‘Purna Swaraj Diwas’, or the day the Source- Indian Express nation would attain complete freedom 5. India celebrates 70th Republic Day from its colonizers by the Congress. • Republic day in India is celebrated Topic- GS Paper 2 –Governance every year on 26th of January to Source-PIB honor the Constitution of India as it 6. Pranab Mukherjee, Nanaji Deshmukh, came into force on the 26 January and Bhupen Hazarika awarded Bharat 1950. Ratna • The theme of this republic day is: • President of Indian conferred the ‘life of Gandhi’ which is a tribute to the Bharat Ratna, the nation’s highest father of the nation Mahatma Gandhi civilian honor, to former President on his 150th birth anniversary. Pranab Mukherjee, along with social • President Cyril Ramaphosa, President activist Nanaji Deshmukh of the Republic of South Africa is the (posthumous) & Assamese musician Chief Guest of this 70thRepublic day. Bhupen Hazarika (posthumous). • This is the second time a South African leader is Chief Guest at Bharat Ratna Republic Day — Nelson Mandela was • Bharat Ratna is the highest civilian the chief guest in 1995. award of the Republic of India. Unique about this Republic day. • The provision of Bharat Ratna was • The 70th Republic Day parade had the introduced in 1954. highest number of women officers • There is no written provision that participating in the celebrations with Bharat Ratna should be awarded to Lt. Bhavana Kasturi leading a Indian citizens only. contingent of 144 male personnel. • It is awarded in recognition of • This is the first time in the history of exceptional service/performance of Indian Army that a woman had led the the highest order in any field of Army services corps. human endeavor. • An all-women contingent of Assam • The award was originally limited to Rifles, India’s oldest paramilitary achievements in the arts, literature, force had participated for the first science and public services but the time. government expanded the criteria to • The weapons which showcased for the include “any field of human endeavor” first time in a Republic day parade are in December 2011. M777 and K-9 Vajra ultra-light Note: howitzers along with the Medium- (a) Article 18 (1) of the Constitution said that Range Surface-to-Air Missile (MRSAM) ‘the award cannot be used as a prefix or missile of the DRDO. suffix to the recipient’s name. • `Sankhnaad’, a martial tune created (b) However, should an award winner for the Indian armed forces, played consider it necessary, he/she may use the for the first time on the 70th Republic expression in their biodata/ Day parade. letterhead/visiting card etc. to indicate that he/she is a recipient of the award. 65 www.gradeup.co

Topic- GS Paper 2 –Important awards • Crocodiles from the Vishwamitri river, Source- India Express where they number around 300, often 7. “Yuva Swabhiman Yojana” for urban enter people’s homes, giving rise to youth conflict and capture. • Madhya Pradesh government • Most of these crocodiles are thereafter launched ‘Yuva Swabhiman Yojana’ released in the Narmada dam waters, for youths of the weaker section in away from human habitats. urban areas of Madhya Pradesh Importance of crocodiles About the scheme • Crocodiles are valued for their skin & flesh. • The scheme was launched in • In some cases, they are also Chhindwara Madhya Pradesh. worshipped, including in the • It aims to provide employment to the Narmada. In idols of the Narmada youth belonging to the weaker section Goddess, a crocodile is her vehicle; of the society mainly in urban areas of there is an idol on the premises of the the state. Narmada Dam. • 100 days of employment will be • Goddess Khodiyar Maa, who is provided under this scheme. worshipped by a section of Gujaratis, Topic- GS Paper 2 –Important Scheme is also seen riding a crocodile as a Source- TOI symbol of her supremacy over land 8. Crocodylus palustris, a crocodile and water. species that is being removed from the Topic-GS-3- Biodiversity Narmada Source- Indian Express • The mugger crocodile also called 9. Indian Railways’ fastest "Train 18" marsh crocodile or broad-snouted named "Vande Bharat Express" crocodile is a species (Crocodylus • India’s first indigenously built palustris) native to freshwater engineless semi-high speed train, habitats from southern Iran and Train 18, has been named Vande Pakistan to the Indian subcontinent Bharat Express. and Sri Lanka. • The train is set to run between Delhi & • Gujarat Forest Department has Varanasi at a maximum speed of 160 started evacuating muggers from two kmph. ponds on the Sardar Sarovar Dam • The 16-coach train, built in 18 months premises on the Narmada, to facilitate at a cost of Rs 97 crore by the Modern a seaplane service at the Statue of Coach Factory, Rae Bareli. Unity. • It’s also the first locomotive-less train • Already extinct in Bhutan and in the country. Myanmar, the mugger has been listed • It is a fully air-conditioned train. as vulnerable on the IUCN Red List Topic- Important for PCS Exam since 1982. Source- Indian Express • In India, it is protected under Schedule I of the Wildlife Protection 29.01.2019

Act, 1972. 1. Odisha govt launched "DAMaN" • Among the six schedules in the Act, initiative to control malaria Schedule I and part II of Schedule II • Odisha Government had launched a provide the highest degrees of malaria control programme – protection to listed species, with the "Durgama Anchalare Malaria most stringent penalties for offenders. Nirakaran (DAMaN)" initiative. So its relocation or capture is • This programme involves mass definitely illegal without permission. screening for malaria with the Habitats treatment of positive cases along with • Vadodara, 90 km from the Narmada intensified surveillance, mosquito dam, is the only city in the country control measures and regular health where crocodiles live in their natural education activities throughout the habitat amidst human population. year. 66 www.gradeup.co

• District Health Information System 2 Chilika Lake (DHIS2), open-source web-based • Chilika lake, located in the coastal surveillance for malaria is used for Odisha is Asia's largest brackish water mass screening and treatment of lagoon. patients in inaccessible areas. • Chilika Lake with its rich bio-diversity Status of Odisha in Malaria and socio-economic importance has • Odisha, which accounts for over 40% been a designated Ramsar site (a per cent malaria burden of the entire wetland of international importance) country, has reported about a 85% since 1981. decline in average monthly malaria • It lies in the Central Asian Flyway for cases in the State. birds, is a major stopover for Related Information migratory birds from the Arctic and the Sub-Arctic regions in the course of Malaria their onward and return migration • It is caused by the protozoan parasite along the east coast. Plasmodium. Topic- GS Paper 3 –Environment • Malaria is typically found in tropical Source- Indian Express and subtropical climates where the 3. Odisha govt launched Project parasites can live. "Jiban Sampark" • According to The World Health • Odisha has launched Jiban Sampark Organization’s World Malaria project for the welfare of the Report of 2018 Particularly Vulnerable Tribal Groups (a) India is the only country among (PVTG). the 11 highest-burden countries that Jiban Sampark Project saw substantial progress in reducing • The Project is being undertaken in disease burden. association with UNICEF. (b) India had pledged to eliminate the • It aims to generate awareness among disease by 2030 at the East Asia PVTGs in Odisha on various Summit, 2015. development and welfare initiatives of (c) India has launched the five-year State Government, especially on National Strategic Plan for Malaria women and child welfare. Elimination (NSPME) (2017-2022) • The focus areas of the Project are skill which focused on malaria “control” to development, empowering “elimination”. communities, cooperation and (d) NSPME includes the target of innovation among the tribal groups. ending malaria in 571 districts out of Particularly Vulnerable Tribal Groups India’s 678 districts by 2022. (PVTGs) Topic- GS Paper 2 –Governance • The PVTGs are the marginalized section of the Scheduled tribes of Source- The Hindu India. 2. National Chilika Bird Festival • This section who are relatively • The second National Chilika Bird isolated, educationally and socio- Festival started at Mangalajodi in economically backwards, living in a Chilika. habitat far away from amenities. • The festival is organised to promote • PVTG is not a Constitutional category, eco-tourism and preservation of birds nor are these constitutionally in Odisha. recognized communities. • It is jointly organized by Odisha • It is a government of India Tourism and Chilika Development classification, created with the Authority. purpose of enabling improvement in • The National Chilika Bird Festival the conditions of certain communities Award was awarded to Mangalajodi with, particularly low development. Ecotourism Group for their active • The criteria followed for determination involvement in bird protection. of PVTGs are as under: 67 www.gradeup.co

(a) A pre-agriculture level of (c) insufficient physical activity technology (d) harmful use of alcohol (b) A stagnant or declining population • Non-communicable diseases such as (c) Extremely low literacy diabetes, cancer and heart disease, (d) A subsistence level of the are collectively responsible for over economy 70% of all deaths worldwide, or 41 Topic- GS Paper 2 –Governance million people. Source- The Hindu • These include 15 million people dying 4. Zearalenone Toxin prematurely, aged between 30 & 69. • Zearalenone is a fungal toxin infesting How this can be reduced? cereals such as wheat, maize and • A study conducted worldwide has barley. noted that consuming fibre and whole • The recent numerous studies detected grains can reduce health risks from zearalenone in wheat, rice, corn and non-communicable diseases such as oats from markets in Uttar Pradesh. heart disease. • It attacks crops while they are • The eating fibre-rich foods reduce the growing, but can also develop when incidence of coronary heart disease, cereals are stored without being dried stroke, type 2 diabetes and colorectal fully. cancer by 16% to 24%. What is the issue? • Higher fibre intake is also associated • Fungal toxins are commonly found in with lower body weight, systolic blood food and can be a public health pressure and total cholesterol when concern. compared with lower intake. • India regulates the levels of some of Topic- GS Paper 3 –Important Report these, including aflatoxin, Source- The Hindu deoxynivalenol, ergot and patulin. 6. Project Cosmic Microwave • The first three infest cereals, while Background (CMB)-Bharat patulin is found in apples. • The scientific space project CMB- • Each of these toxins has been Bharat has been presented as a associated with disease outbreaks. proposal to the ISRO. • Chronic aflatoxin consumption has • The project is developed by the Inter- been shown to cause liver cancer. University Centre for Astronomy and • The International Agency for Research Astrophysics (IUCAA), Pune. on Cancer (IARC) classifies aflatoxin • The project is expected to reveal the as a Group 1 carcinogen, meaning first clear sign of quantum gravity and there is enough evidence for its ultrahigh energy physics in the very carcinogenicity. early universe. Topic- GS Paper 3 –Science and • It proposes near-ultimate survey Technology polarisation that would exhaust the Source- Down to Earth primordial information in the Gold- 5. Non-communicable diseases top mine for cosmology. killers in South-East Asia: WHO • The project aims to map all dark • According to WHO, Non- matter and most baryons in the communicable diseases (NCDs)- observable universe. mainly cardiovascular diseases, Topic- GS Paper 3 –Science and chronic respiratory diseases, diabetes Technology and cancer — continue to be the top Source- The Hindu killers in the South-East Asia Region. 7. Atal Setu of Outcomes of the Report • Goa Chief Minister inaugurated the • The four ‘major’ NCDs are caused, to “Atal Setu” on the Mandovi river in a large extent, by four modifiable Goa. behavioural risk factors: • It is a four-lane 5.1-km long cable- (a) tobacco use stayed bridge connects state capital (b) unhealthy diet with north Goa. 68 www.gradeup.co

Related Information • The remains date back to later Mandovi River Satavahana period--1st to 2nd • Mandovi, also known as the Mahadayi century A.D. river is regarded as the lifeline of Goa. Topic- GS-1- Indian History • The river originates from Bhimgad in Source- THe Hindu the Western Ghats in the Belagavi 10. Former Finance Commission district of Karnataka. chairman Vijay Kelkar pitches for setting • The catchment area in Goa, up 'Niti Aayog 2.0' Karnataka and Maharashtra • Former Finance Commission chairman respectively. Vijay Kelkar has pitched for setting up of a 'new Niti Aayog' or Niti Aayog 2.0. • Owing to the differences over the • Socialist-era Planning Commission sharing of the river water among the was replaced by think-tank Niti Aayog states of Goa, Karnataka and on January 1, 2015, by the Modi Maharashtra, the union government government. has constituted Mahadayi Water Why does India need Niti Aayog 2.0? Disputes Tribunal to examine the • Kelkar, in a paper titled 'Towards claims made by the states. India's New Fiscal Federalism', argued Topic- GS Paper 2 –Governance that replacing the Planning Source- Indian express Commission by the Niti Aayog, a think 8. J&K Governor grants quota for tank, has reduced the government's J&K’s Pahari community policy reach. • Governor of Jammu and Kashmir has • It is desirable that a functionally given his approval for the Kashmir distinct entity such as the new Niti Reservation (Amendment) Bill, 2014, Aayog or Niti Aayog 2.0 be put to use providing reservation to the persons to do the job at hand related to the belonging to Pahari community of the structural issues including removal of State. regional imbalances in the economy. • The legislation is aimed at providing • The Niti Aayog 2.0 will be responsible job opportunities to the Pahari people for allocating development or residing in backward areas of the transformational capital or revenue State. grants to the states. Pahari Community • In order to make the new Niti Aayog • Pahari is a linguistic group, comprising more effective, it is essential to both Muslims and Hindus, and is ensure that the institution is at the mainly located in Poonch, Rajouri, 'High Table' of decision making of the Kupwara and Baramulla districts. government. This means the vice- • Because of the remoteness and chairman of the new Niti Aayog will inaccessibility of the areas of their need to be a permanent invitee of the residence, the Pahari community has Cabinet Committee on Economic historically faced considerable Affairs (CCEA). economic distress leading to overall • The new Niti Aayog need not be socio-economic backwardness. involved with the approval of the Topic- GS Paper 2 –Governance state's annual expenditure Source- The Hindu programmes. It should rather strive to be a think-tank with 'praxis' 9. Kondaveedu Buddhist remains date possessing considerable financial back to Satavahana period muscle and devote its energies to • The Department of Archaeology and outline coherent medium and long Museums has found Buddhist remains term strategy and corresponding under the ‘garbhagriha’ (sanctum investment resources for sanctorum) of Sivalayam at transforming India," he suggested. Kondaveedu fort (Guntur, Andhra Topic- GS-2- Governance Pradesh). Source- Economic Time

69 www.gradeup.co

• The golden langur conservation 30.01.2019 project was undertaken at the Assam State Zoo in Guwahati during the 1. First Swadesh Darshan project in 2011-12 fiscal which is funded by the Sikkim Central Zoo Authority. • Union Minister for Tourism Related Information inaugurated the first Swadesh Golden langur Darshan project in Sikkim. • It is an Old World monkey found in a • The project “Development of North small region of western Assam, India East Circuit: Rangpo– Rorathang- and in the neighbouring foothills of Aritar- Phadamchen- Nathang- the Black Mountains of Bhutan. Sherathang- Tsongmo- Gangtok- • It is one of the most endangered Phodong- Mangan- Lachung- primate species in India. Yumthang- Lachen- Thangu- • Its IUCN status is endangered. Gurudongmer- Mangan- Gangtok- Topic-GS Paper 3–Environment Tuminlingee- Singtam” implemented &Biodiversity under Swadesh Darshan Scheme of Source- The Hindu Ministry of Tourism, Government of 3. ICAR launches National India. Agricultural Higher Education Project (NAHEP) Related Information • ICAR has launched an ambitious Swadesh Darshan Scheme National Agricultural Higher Education • Launched by the Ministry of Tourism. Project (NAHEP). • Launched in 2014-15. • This project will be funded by the • For the integrated development of World Bank and the Indian theme-based tourist circuits in the Government on a 50:50 basis. country. • The aim of the project to attract talent • It also has a provision for voluntary and strengthen higher agricultural funding under Corporate Social education in the country. Responsibility (CSR). Related Information • The scheme has identified 13 • Student READY (Rural Entrepreneurship thematic circuits for development: Awareness Development Yojana) 1. Buddhist Circuit scheme is being run in order to 2. North-East India Circuit promote the participation of students 3. Coastal Circuit in agricultural business. 4. Himalayan Circuit • Under the scheme, practical 5. Krishna Circuit experience of agriculture and entrepreneurship is provided to 6. Desert Circuit undergraduate students. 7. Eco Circuit • Recently, the second Indian 8. Wildlife Circuit Agricultural Research Institute (IARI) 9. Tribal Circuit of the country was -also established in 10. Rural Circuit Barahi, Jharkhand. 11. Spiritual Circuit Topic- GS Paper 2 –Governance 12. Ramayana Circuit Source- Business Standard 13. Heritage Circuit 4. Jewellery gets a ‘council’ Topic- GS Paper 1 –Art and Culture • The Commerce Ministry announced Source-PIB the formation of a Domestic Council 2. Success for golden langur for Gems & Jewellery. breeding project in Assam • It will help to bring the industry’s • Assam Environment and Forest domestic business stakeholders under Minister announced the success of the one umbrella so that they could Golden Langur Conservation Breeding evolve a unified approach to promote Programme in the State. growth in the sector. 70 www.gradeup.co

• This Council will help in tapping new What are the key features of PISA? opportunities in the already existing • PISA is a triennial international survey large domestic market. (every three years) which aims to • The first priority of the Domestic evaluate the education system Council should be to uplift the living worldwide by testing the skills and standards of artisans. knowledge of 15-year-old students. Topic- GS Paper 2 –Governance • Students are assessed in reading, Source- The Hindu mathematics, science and 5. Indian students to participate in collaborative problem-solving. PISA 2021 • Participation in PISA allows • The HRD Ministry signed a pact with benchmarking performance against a the Organisation for Economic wide range of countries. Cooperation and Development Topic-GS Paper 2–Education & employment (OECD) for the participation in Programme for International Student Source- Indian Express Assessment- PISA 2021. 6. Tata veterans join hands with • PISA-2021 is a competency-based Quantum for $1Bn ESG fund test, which tests the learning levels of • Three former Tata Group executives 15-year-old students in reading, in partnership with Quantum Advisors mathematics and science. will launch a $1 billion Environment, • With the signing of the pact, Indian Social and Governance (ESG) Fund. students aged 15 will be able to take About the Fund the Programme for International • The fund will invest mainly in listed Student Assessment or PISA, which is mid-cap companies that are doing conducted every three years. well on the environment, social and India’s participation in PISA governance (ESG). • Schools run by Kendriya Vidyalaya • The proposed equal joint venture (JV) Sangathan (KVS), Navodaya would mobilise funds from long-term Vidyalaya Samiti (NVS) and schools in foreign investors such as pension the UT of Chandigarh will participate. funds, sovereign wealth funds and • Within the country, PISA covers a family offices of high net-worth sample of 15-year-old students individuals (HNIs) who value ESG. representing all forms of schooling i.e. public, private, private aided etc. • The fund will aim to drive higher ESG • PISA is a competency-based performance in Indian corporates and assessment which unlike content- it will adopt an engaged, private based assessment, measures the equity approach to public markets extent to which students have investing, with a focus on working acquired key competencies that are with companies willing to recognize essential for full participation in the long-term advantages of actively modern societies. adopting ESG standards of excellence. • It would lead to recognition and Topic- GS Paper 2 –Governance acceptability of Indian students and Source- Indian Express prepare them for the global economy 7. Ganga Expressway: World’s in the 21st century. longest expressway • India had taken part in Programme for • The government of Uttar Pradesh has International Student Assessment approved the construction of the (PISA) in 2009 and bagged the 72nd Ganga Expressway. rank among 74 participating About the Expressway countries. • Then UPA government had boycotted • The expressway will provide for better PISA, blaming “out of context” connectivity of the Prayagraj questions for India’s dismal (Allahabad) to Western Pradesh. performance. 71 www.gradeup.co

• National Expressways Authority of • India’s crude steel production in 2018 India under the Ministry of Road was at 106.5 MT, up by 4.9 Percent Transport and Highways is from 101.5 MT in 2017. responsible for the construction and • Japan produced 104.3 MT in 2018, maintenance of expressways. down 0.3 per cent compared to 2017. • The expressway starting from Meerut • The United States is at the 4th will pass through Amroha, position as the country produced 86.7 Bulandshahr, Badaun, Shahjahanpur, MT of crude steel in 2018. Farrukhabad, Hardoi, Kannauj, Related Information Unnao, Rae Bareli, Pratapgarh before World Steel Association reaching Prayagraj. • It is one of the industry associations Topic- GS Paper 2 –Governance in the world. Source- TOI • Its members represent around 85 8. New Delhi superbug gene reaches Percent of the world’s steel the Arctic production, including over 160 steel producers with 9 of the 10 largest • Recently the Scientists have found a steel companies, national and superbug gene ‘blaNDM-1’ in the regional steel industry associations, Arctic region. and steel research institutes. • blaNDM-1 stands for ‘New Delhi • It is a non-profit organisation with its Metallo-beta-lactamase-1’. headquarters in Brussels, Belgium. • It was first detected in New Delhi over Topic- GS-3- Economic Development a decade back. Source- The Hindu Business Line • Soil samples taken in Svalbard region have confirmed the spread of blaNDM- 31.01.2019 1 into the High Arctic.

• Svalbard region is located in a 1. The IEA’s Report - “The Future of Rail” Norwegian archipelago between • Ministry of Railways & Coal launched mainland Norway and the North Pole. “The Future of Rail” report of • This Antibiotic-Resistant Gene (ARG) International Energy Agency (IEA). is originally found in Indian clinical About the Report settings. • It is the first-of-a-kind report analyses • The superbug provides multi-drug the current and future importance of resistance (MDR) in microorganisms. rail around the world through the Topic- GS Paper 3 –Science and perspective of its energy and Technology environmental implications. Source- The Hindu • The report reviews the impact of 9. India replaced Japan as second top existing plans and regulations on the steel producer future of rail and explores the key • India has replaced Japan as the policies that could help to realise an world’s second-largest steel enhanced future rail. producing country, while China is the • The report has a focus on India, largest producer of crude steel elaborating on the unique social and accounting for more than 51 Percent economic role of rail in India, together of production. with its great enduring potential, to • It was stated by the World Steel show how India can extend and Association (worldsteel) in its latest update its networks to harness rail at report. a scope and scale that is unparalleled. • The global steel body in its latest International Energy Agency report noted that China’s crude steel • It is an inter-governmental output jumped 6.6 Percent to 928.3 organisation that works to ensure million tonnes (MT) in 2018 from reliable, affordable and clean energy 870.9 MT in 2017. for its 30 member countries and 8 association countries. 72 www.gradeup.co

• Its secretariat is in Paris. • Currently, the infection is treated • It was established in the framework of either with clarithromycin-based the Organisation for Economic Co- therapy or by a mix of this therapy operation and Development (OECD) in and antibiotics. 1974 in the wake of the 1973 oil crisis. Topic- GS Paper 3 –Science and • Its mission is guided by four main Technology areas of focus: Source- Down to Earth o Energy security 3. Corruption Perceptions Index 2018 o Economic development • The 2018 Corruption Perceptions Index (CPI) released by Transparency o Environmental awareness International. o Engagement worldwide. • It reveals that the continued failure of Note: India has been the focus of many most countries to significantly control recent IEA analyses and reports for instance corruption is contributing to a crisis of through the special focus chapter on the democracy around the world. Indian Power sector of the Energy • More than two-thirds of countries Technology Perspectives (ETP) publication score below 50, with an average score and the World Energy Outlook (WEO). of only 43. Topic- GS Paper 2 –Government Policies • Denmark and New Zealand top the Source-PIB Index with 88 and 87 points, 2. Inosine-5′-monophosphate respectively. dehydrogenase (IMPDH): new • Somalia, South Sudan, and Syria are compound to fight stomach at the bottom of the index, with 10, infections 13 and 13 points, respectively. • Scientists at the IIT, • The highest scoring region is Western have synthesized a new compound Europe and the European Union, with "IMPDH" that may help treat an average score of 66, while the stomach infections caused by lowest scoring regions are Sub- common bacteria, Helicobacter pylori. Saharan Africa (average score 32) • The inhibitor is based on an aromatic and Eastern Europe and Central Asia chemical compound, indole. (average score 35). • It may help in treating H. pylori India Position infection which is a cause for gastritis, • India has been ranked at 78th place peptic ulcers and stomach cancers. out of 180 countries in ‘Corruption Related Information Perception Index’ (CPI) released by • For the study, scientists isolated Transparency International in 2018 IMPDH gene from H. Pylori and against 81st in the Year 2017. express edits protein. • India marginally improved its score to • The study also showed that the 41 (from 40 in 2017). inhibitor specifically targets the About Index Inosine-5′-monophosphate • The index ranks the countries by their dehydrogenase protein of the perceived levels of public sector bacterium and not humans making it corruption according to experts and safe for human use. business people. • It is estimated that about of half of the • It uses a scale of 0 to 100, where 0 is global population may be infected highly corrupt and 100 is very clean. with H. pylori. Topic- GS Paper 2 –Important Index Source- Indian express • While the symptoms of this infection 4. ISRO sets up Human Space Flight mostly go unnoticed, it is a cause of Centre in Bengaluru for manned diseases like gastritis and ulcers. • ISRO unveiled its Human Space Flight • In India, the burden of this infection is Centre in where astronauts almost 80% in rural areas due to poor get their training. hygiene and healthcare facilities.

73 www.gradeup.co

Related Information countries through Blockchains and Human Space Flight Centre (HDFC) Distributed Ledgers technologies. • HSFC shall be responsible for • Digital Currency is part of the efforts implementation of Gaganyaan project to adopt new technologies like which involves end-to-end mission Blockchain, Artificial Intelligence, planning, development of engineering Internet of Things, in line with the systems for crew survival in space, Fourth Industrial Revolution that is crew selection and training and also reshaping governments and pursue activities for sustained human corporations around the world. space flight missions. Topic- GS Paper 3 –Economics • It will take the support of existing Source- Economics Times ISRO centres to implement the first 7. Africa Centre for Climate and development flight of Gaganyaan Sustainable Development under the human spaceflight • The Africa Centre for Climate and programme. Sustainable Development was The space agency is gearing up for the • inaugurated by the Italian Prime human spaceflight programme by Minister at Rome. 2021-end that is likely to include a • The centre has been opened by the woman astronaut. Italian government in association with • The plan is to have the first unmanned the United Nations Development mission in December 2020 and second Programme (UNDP) and the Food and for July 2021. Agricultural Organisation (FAO). Topic- GS Paper 3 –Science and Related Information Technology Source- The Hindu About the Centre 5. DDA to launch an online portal for • The centre’s origin can be traced to a land pooling policy on Feb 5 declaration endorsed by the G7 • The Delhi Development Authority meeting of the Environment Ministers (DDA) will launch an online portal for in 2017. the land pooling policy. • The centre would facilitate Land Pooling Policy coordination among the G7 and • The policy will cover “urbanisable African countries on common areas of urban extensions in 95 initiatives in Africa to achieve the villages. goals set by the Paris Agreement and • Under the policy, the Floor Area Ratio the 2030 Agenda. (FAR) has been reduced to 200 as • It will provide a fast-track, demand opposed to initially proposed FAR of driven mechanism for African 400. countries to access grant resources • A landowner must have at least two that support policies, initiatives, and hectares of land to be eligible to best practices on climate change, food participate in the policy, which aims to security, access to water, clean accommodate 76 lakh people. energy. • The urban body will act as a • And also accelerating progress on the “facilitator and planner” under the Sustainable Development Goals policy and transfer of land to the DDA. (SDGs) in Africa. Topic- GS Paper 2 –Governance Topic- GS Paper 3 –Environment Source- The Hindu Source- TOI 6. Aber: Digital currency 8. Implementation Models under the • Aber is a digital currency which is Pradhan Mantri Jan Arogya recently launched by the central Yojana banks of the UAE and Saudi Arabia. • The Pradhan Mantri Jan Arogya • It will be used for financial Yojana (PM JAY) proposes three settlements between the two models through which the states can implement the scheme. 74 www.gradeup.co

These are: to reduce the financial burden on poor 1. Insurance Model: Under this Model, and vulnerable groups arising out of the premiums are paid to the the catastrophic hospital. insurance company, which • Under the PM-JAY scheme, about administers and pays the claim. 10.74 crores poor, deprived rural 2. Trust-based model: Under this families and identified occupational Model, each State forms its own trust categories of urban workers’ families to manage the scheme and claims will as per the latest Socio-Economic be disbursed from a corpus created Caste Census (SECC) data will have from central and State government health benefits cover of Rs Five Lakhs contributions. per family per year at free of cost. 3. Hybrid model: Under this Model, a • PM-JAY seeks to accelerate India’s part of the claim comes under the progress towards the achievement of insurance model while the balance Universal Health Coverage (UHC) and gets processed under the trust. Sustainable Development Goal 3 Related Information which calls for ensuring healthy lives and promote well-being for all at all About Pradhan Mantri Jan Arogya age. Yojana Topic- GS Paper 2 –Governance • PMJAY is a scheme of the government under Ayushman Bharat which aims Source- TOI

75 www.gradeup.co

76