Uva-DARE (Digital Academic Repository)

UvA-DARE (Digital Academic Repository)

In vitro and in vivo testing of conditionally replicating SIV and HIV-1 strains to study viral gene expression van der Velden, G.J.

Publication date 2013

Link to publication

Citation for published version (APA): van der Velden, G. J. (2013). In vitro and in vivo testing of conditionally replicating SIV and HIV-1 strains to study viral gene expression.

General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

Download date:30 Sep 2021

Chapter 2 Tat has a dual role in simian immunodeficiency virus transcription

Gisela J. van der Velden, Monique A. Vink, Ben Berkhout and Atze T. Das

Laboratory of Experimental Virology, Department of Medical Microbiology, Center for Infection and Immunity Amsterdam (CINIMA), Academic Medical Center, University of Amsterdam 2 Journal of General Virology, 2012

Abstract

Tat has a pivotal role in human and simian immunodeficiency virus (HIV and SIV) replication because it stimulates transcription by binding to the TAR hairpin. In addition, several other Tat functions have been proposed. Most studies focused on HIV-1 Tat and much less is known about SIV Tat. We previously constructed an SIVmac239 variant in which the Tat-TAR transcription mechanism is functionally replaced by the doxycycline-inducible Tet-On gene expression mechanism. We used this SIV-rtTA variant to study the functions of SIV Tat. We show that Tat-minus SIV-rtTA variants replicate efficiently in PM1 T cells, ruling out an additional essential Tat function. Nevertheless, replication was sub-optimal in other cells and we document evolutionary pressure to repair Tat expression. We demonstrate that SIV-rtTA requires Tat for optimal gene expression despite the absence of the Tat-TAR axis. This Tat effect was lost upon replacement of the LTR promoter region by a non-related promoter. Our results indicate that Tat can activate SIV transcription via TAR RNA and U3 DNA elements, but has no other essential function in replication in cultured cells. The experiments were limited to cell lines and PBMC, and do not exclude an accessory Tat function under specific condi- tions or in vivo.

26 Tat has a dual role in SIV transcription

Introduction

Transcription of HIV and SIV is initiated by the binding of cellular factors to the 5’ long terminal repeat (LTR)-promoter of the viral genome, which results in low levels of viral transcripts and allows production of the Tat trans-activator protein. Tat enhances transcription by binding to the TAR hairpin located at the 5’ end of the nascent RNA transcripts (reviewed in [1, 2]) and recruitment of the positive transcriptional elongation factor (pTEFb) to the transcription complex at the 5’ LTR-promoter [3, 4]. pTEFb subsequently phosphorylates RNA polymerase II, which enhances transcription processivity [5, 6]. pTEFb also stimulates the assembly of new transcription complexes by recruiting TATA-box binding protein [7]. Further- 2 more, Tat influences viral transcription by recruiting several chromatin modifying proteins to remodel the promoter region (reviewed in [8–10]).

Several non-transcriptional functions have also been suggested for Tat (reviewed in [10]). For instance, Tat has been shown to influence RNA splicing [11], capping [12–14], translation [15–18] and reverse transcription [19–22] of the viral RNA. It has also been proposed that Tat modulates the expression of multiple cellular genes (reviewed in [10]), interacts with a large number of cellular proteins ([23] and references therein) and inhibits the cellular RNA interference mechanism [24–27]. Thus, in addition to its undisputed role in transcription activation, a large array of other functions has been proposed for Tat, although some of these have been disputed [28, 29].

Analysis of the replication capacity of virus variants with a wild-type or mutated Tat gene in cell culture is one of the best experimental models available to study the Tat functions. Most Tat mutations severely impair viral replication because they inactivate the essential transcription function, making it difficult to study other processes that maybe affected by the mutations. We recently used an HIV-1 variant in which the Tat-TAR transcription-activation mechanism was functionally replaced by the doxycycline (dox)-inducible Tet- On system to probe the importance of other Tat functions in virus replication [30]. In the context of this HIV-rtTA variant, it was possible to inactivate Tat expression without abrogating virus replication, but replication in cultured T cells was nevertheless stimulated by Tat. Further analysis revealed a TAR-independent interaction of Tat with the LTR-promoter that stimulated viral gene expression and replication. These results indicated that Tat has a multi- faceted function in transcription but no other essential function in HIV-1 replication.

27 Tat has a dual role in SIV transcription

Most studies focused on the function of HIV-1 Tat and much less is known about the role of SIV Tat. Remarkably, mutational inactivation of Tat in an SIV-rtTA variant was previously found to block viral replication [31], whereas HIV-rtTA tolerated a very similar Tat mutation [32, 33]. We therefore re-examined the role of Tat in SIV replication by constructing and testing new SIV-rtTA variants in which Tat expression was inactivated by different mutations.

Results

Construction of Tat-deficient SIV-rtTA variants

We previously described the construction of a dox-dependent SIVmac239 variant in which the Tat-TAR mechanism of transcription control was replaced by the dox-inducible Tet-On gene expression system [31] (Fig. 1A). In this SIV-rtTA variant, the bulge and loop sequences in TAR are mutated (TARm) to prevent Tat binding and subsequent activation of transcription [31]. Furthermore, the Nef gene was replaced by the gene encoding the rtTA transcriptional activator protein and tet operator (tetO) elements were inserted in the U3 promoter region. In the absence of dox, rtTA cannot bind to the tetO sites and viral gene expression is “off”. Dox induces a conformational change in rtTA that allows binding to the tetO sites and activation of transcription. Thus, viral gene expression and replication are switched “on” by dox administration.

We constructed SIV-rtTA variants in which Tat was inactivated to study additional roles for Tat in SIV replication. Since the Tat open reading frame (ORF) overlaps with other viral ORFs, we decided to minimally mutate the Tat sequence. For construction of the related HIV-rtTA variant, we previously introduced a tyrosine-to-alanine substitution at position 26 (Y26A) in the cysteine-rich domain of HIV-1 Tat, which inactivated its TAR-dependent transcription function [34]. HIV-1 and SIVmac239 Tat have a similar modular structure. The cysteine-rich domain is highly conserved and the tyrosine at position 26 in HIV-1 Tat corresponds to the tyrosine at position 55 in SIVmac239 Tat (Fig. 1B). We therefore introduced the equivalent Y55A mutation in SIV-rtTA, which did not affect any other ORF, but nevertheless abolished SIV-rtTA replication [31]. Because the Y55A mutation may have affected an unknown RNA sequence element that is critical for SIV replication, we constructed two

28 Tat has a dual role in SIV transcription new SIV-rtTA variants with different Tat-inactivating mutations. We mutated the translation start codon (AUG-to-ACG) to prevent Tat translation in the TatAUGmut variant. Since we previously observed that a similar mutation did not completely block Tat translation in the HIV-1 context [30], we also replaced the Leu codon at position 5 in the Tat ORF with a translation stop codon (UUG-to-UAG) so that residual translation would prematurely terminate (Fig. 1B). There are no alternative in-frame AUG codons in the Tat ORF. In the Tatstop variant, we replaced the Ser and Leu codons at position 10 and 11 with translation stop codons (UCA.UUA- to-UGA.UAA) so that only a 10-amino acid Tat peptide can be produced. These mutations were carefully chosen to be silent in the overlapping Vpr gene. 2 To confirm that these mutations abolish Tat expression, we co-transfected 293T cells with the SIV-rtTA DNA constructs and a reporter construct in which the luciferase gene is under control of a Tat-responsive LTR-promoter. Cells were cultured with dox for 48h and the intracellular luciferase level was measured to quantify Tat activity (Fig. 1C). A high luciferase

Figure 1: Inactivation of Tat (A) The SIV-rtTA proviral genome. In SIV-rtTA, tetO binding sites are present in the 5’ and 3’ LTR- promoter, TAR is inactivated through several mutations (TARm) and the Nef gene is replaced with the rtTA gene. (B) Mutations in Tat. In the TatAUGmut variant, the AUG start codon is replaced by the ACG (Thr) codon and the UUG (Leu) codon at position 5 is replaced by the UAG stop codon. In the Tatstop variant, the UCA (Ser) and UUA (Leu) codons at position 11 and 12 are replaced by UGA and UAA stop codons, respectively. The TatY55A variant contains a UAU (Tyr) to GCC (Ala) substitution at position 55. The cysteine -rich, core and basic region in Tat are underlined. (C) Activity of Tat mutants. 293T cells were transfected with the SIV-rtTA constructs and a Tat-responsive HIV-1 LTR- promoter-luciferase construct. Cells were cultured with dox for 48h and the intracellular luciferase level (relative light units, RLU) was measured to quantify Tat activity (mean±SEM; n=4). Mock, cells transfected with pBluescript instead of an SIV-rtTA construct.

29 Tat has a dual role in SIV transcription level was observed with the SIV-rtTA-Tatwt construct, reflecting high Tat expression and activity, while a background level of luciferase activity was observed with the TatAUGmut and Tatstop mutants, confirming that Tat expression was effectively blocked (Fig. 1C).

Tat deficiency reduces the replication capacity of SIV-rtTA

Replication of the SIV-rtTA variants was tested in PM1 T cells that were cultured with dox (Fig. 2A). The PM1 cell line is a clonal derivative of HUT78 that expresses CCR5 and allows replication of the parental SIVmac239 strain [35, 36]. In agreement with previous results [31], SIV-rtTA-Tatwt replicated efficiently in these cells, whereas SIV-rtTA-TatY55A did not replicate. In contrast, the new Tat-deficient variants SIV-rtTA-TatAUGmut and SIV-rtTA-Tatstop replicated efficiently, although slightly delayed compared to the Tatwt virus. The latter result demonstrates that SIV-rtTA can replicate without Tat but that the protein does have a stimulatory effect. It also indicates that the replication defect of SIV-rtTA-TatY55A is not due to the lack of active Tat protein, but is caused by another adverse effect.

We also introduced the TatAUGmut and Tatstop mutations in the genome of a novel SIV- rtTA variant with an optimized LTR-promoter and rtTA gene (SIV-rtTAopt). The optimized promoter configuration was obtained through SIV-rtTA evolution upon long-term in vitro culturing (to be published elsewhere). The promoter changes included additional mutations in TAR, triplication of the NFκB binding site and the adjacent tetO element, and a deletion in the upstream U3 region (Fig. 3). The novel rtTA variant exhibits increased transcriptional activity and dox-sensitivity and was obtained through in vitro evolution experiments with HIV- rtTA [37]. These promoter and rtTA modifications improve SIV-rtTA gene expression and replication but do not affect dox-control (data not shown). Replication of the SIV-rtTAopt variants with a Tatwt, TatAUGmut or Tatstop gene was first tested in PM1 cells (Fig. 2B). All viruses replicated well, suggesting that improved transcription renders Tat redundant in these cells.

However, when the SIV-rtTAopt variants were tested in 174xCEM cells (fusion of B and T cell line; Fig. 2C) and in peripheral blood mononuclear cells (PBMC) isolated from cynomolgus macaques (Fig. 2D), replication of the TatAUGmut and Tatstop viruses was found to be delayed compared to the Tatwt virus. This reduced replication capacity of the Tat-deficient viruses indicates that Tat remains important for optimal SIV-rtTAopt replication in these cell types.

30 Tat has a dual role in SIV transcription

Evolution of the Tat-deficient SIV-rtTA variants upon long-term culturing

Inactivation of Tat did not significantly

affect replication of the SIV-rtTAopt variants in PM1 cells (Fig. 2B). To evaluate the genetic stability of the introduced TatAUGmut and Tatstop mutations, we sequenced the Tat gene of these viruses upon long-term culturing in these cells. Both variants sta- 2 bly maintained the Tat-inactivating mutations and we did not observe any sequence changes in Tat after viral passage for up to 294 days (data not shown).

We also started long-term cultures

of the Tat-deficient SIV-rtTAopt variants in 174xCEM cells. The virus was passaged onto fresh cells at the peak of infection when massive syncytia were observed. The period between infection and the appear- ance of syncytia decreased over time and we could reduce the volume of the virus inoculum needed to start a new infection, which indicated that the viral replication capacity had improved.

Sequence analysis of the viral Tat gene after long-term culturing revealed AUGmut Figure 2: Tat inactivation reduces SIV-rtTA replication. that the Tat virus acquired a C-to-U Replication of the SIV-rtTA variants was monitored in PM1 cells (A and B), 174xCEM cells (C) and PBMC (D). PM1 and mutation that restored the Tat AUG start 174xCEM cells were transfected with SIV-rtTA (A) or SIV- rtTAopt (B and C) plasmids with a wt or mutated Tat gene. codon in two independent cultures Macaque PBMC (D) were infected with 293T-produced (cultures 1 and 2, Fig. 4A). Moreover, in virus of the SIV-rtTAopt variants. Cells were cultured with 1 µg/ml dox. No virus replication was observed in the both cultures an additional mutation was absence of dox (data not shown).

31 Tat has a dual role in SIV transcription

Figure 3: Promoter configuration of the SIV variants. Schematic representation of the LTR-promoter configuration in

SIVmac239, SIV-rtTA, SIV-rtTAopt and SIV-rtTAtetO-CMV. In the U3 region of SIVmac239, one NFκB and four Sp1 sites are m present. In SIV-rtTA, TAR was mutated (TAR ) and two tetO binding sites were inserted. In SIV-rtTAopt, the NFκB and one tetO binding site were triplicated and 288 nucleotides in the U3 region were deleted (ΔU3). In the

SIV-rtTAtetO-CMV variant, the U3-TAR promoter region was replaced by three tetO elements coupled to the TATA box region from the cytomegalovirus immediate-early promoter and an unrelated stem-loop element [30]. The replication capacity of each virus is indicated. observed that removed the introduced stop codon (UAG-to-CAG in culture 1; UAG-to-UUG in culture 2) and in culture 2 a C-to-U mutation was found at position 6394, which was silent in the Tat ORF. The combined mutations in culture 1 restore the production of an L5Q-mutated Tat protein, whereas the mutations in culture 2 repair wild-type protein production (Fig. 4B). A different evolutionary path was observed in culture 3. This virus stably maintained the introduced mutations, but acquired a nucleotide insertion further downstream (G between positions 6314 and 6315, Fig. 4A). As a result, the out-of-frame AUG codon located at position 77 in the Tat gene (bold and underlined at position 6282, Fig. 4A) is placed in register with the Tat ORF. This frame-shift mutation allows the production of a truncated Tat protein in which the 35 N-terminal amino acids are replaced by 10 non-Tat residues (Fig. 4B). More- over, this virus acquired a single nucleotide substitution (U-to-C at position 6398) that resulted in an F65L change in the Tat protein. This mutation does not affect other ORFs.

In three independent Tatstop cultures we observed a deletion of 15 or 24 nucleotides in the Tat gene, which included the introduced stop codons (Fig. 4C). These in-frame deletions allow the production of Tat proteins lacking either amino acids 8-12 or 11-18 (Fig. 4D). In culture 3, a silent C-to-U mutation was observed at position 6308. In two of the three cultures, a point mutation at position 6444 that causes an R80Q substitution in the basic RNA binding domain of Tat was also observed. The repeated selection of this mutation argues for

32 Tat has a dual role in SIV transcription an important role, e.g. in boosting Tat activity. The combined results show that evolution of the Tat-deficient viruses in 174xCEM cells resulted in restoration of Tat production. These results confirm that Tat has a positive function in SIV-rtTA replication.

Some of the evolved SIV-rtTA variants encode a Tat protein with a deletion near the N-terminus. It was previously described that a truncated form of HIV-2 Tat lacking amino acids 8-33 can activate transcription from the viral LTR-promoter [38]. Since HIV-2 and SIVmac239 are closely related, it seems likely that the truncated Tat proteins selected during virus evolution (removal of amino acids 1-35, 8-12 or 11-18) are transcriptionally active.

Some mutations in the Tat region also affect the overlapping Vpr and Rev genes. The 2 UAG-to-CAG mutation in TatAUGmut culture 1 results in an L55P substitution in Vpr (CUA-to- CCA codon change). The G-nucleotide insertion between positions 6314 and 6315 in culture 3 causes a frame-shift in the Vpr ORF after codon 87, resulting in a truncated 97-amino acid Vpr protein in which 14 C-terminal Vpr amino acids are replaced by 10 non-Vpr residues. The 24-nucleotide deletion observed in the Tatstop cultures 1 and 2 causes deletion of Vpr amino acids 61-68, whereas the 15-nucleotide deletion observed in culture 3 causes an A58G substitution plus deletion of amino acids 59-63. Although these mutations do not change the important alpha-helical region and HxRxG motifs [39], it cannot be excluded that they affect Vpr activity. However, Vpr is an accessory SIV protein and Vpr deletion does not prohibit virus replication in vitro [40] and in vivo [41, 42]. The G-to-A substitution at position 6444 (observed in Tatstop cultures 1 and 3) causes an E5K substitution in Rev, which does not affect the critical Rev-responsive element (RRE) RNA binding domain or nuclear localization motif of the protein [43].

Tat affects SIV-rtTA gene expression

Transcription of SIV-rtTA is controlled by the inserted Tet-On system. To test whether or not Tat still contributes to SIV-rtTA gene expression, we analyzed the effect of the Tat mutations on virus production. 293T cells were transfected with the Tatwt, TatAUGmut and Tatstop SIV- rtTAopt constructs and cultured with dox for 48h. These cells do not express the CD4 receptor required for SIV infection, but their high transfection competence allows us to measure tran- sient virus production by quantifying the viral CA-p27 protein in the culture medium. Virus

33 Tat has a dual role in SIV transcription

34 Tat has a dual role in SIV transcription production was high for the Tatwt construct and reduced to approximately 70% and 50% of the wild-type level for the Tatstop and TatAUGmut variants, respectively (Fig. 5A). These results indicate that Tat indeed stimulates SIV-rtTA gene expression. We previously demonstrated that TAR deletion does not reduce SIV-rtTA-Tatwt gene expression and replication [44], which indicates that Tat does not stimulate SIV-rtTA gene expression by residual binding to the mutated TARm element.

To investigate whether Tat contributes to gene expression by enhancing SIV-rtTAopt promoter activity or by stimulating another gene expression step, the 5’LTR-promoter region was replaced by the tetO-CMV promoter, which previously allowed us to generate a truly 2 Tat-independent HIV-rtTA variant [30]. This dox-responsive promoter consists of three tetO elements coupled to a minimal TATA-box region from the cytomegalovirus immediate-early promoter and the transcript encodes an unrelated hairpin instead of TAR (Fig. 3). 293T cells wt stop AUGmut were transfected with SIV-rtTA5’tetO-CMV variants with a Tat , Tat or Tat gene and virus production was measured after 48h of culturing with dox. We measured a similar level of stop wt virus production for the SIV-rtTA5’tetO-CMV-Tat and Tat constructs (Fig. 5B). Thus, viral gene expression is no longer influenced by Tat when the SIV-rtTAopt U3-TAR region is replaced by an LTR-promoter that lacks SIV-derived sequences. Because – as mentioned above – Tat does not influence SIV-rtTA expression via the TARm element, this result indicates that Tat stimulates SIV-rtTA expression via the U3-promoter region. Moreover, this result indicates that Tat does not influence another gene expression step. The TatAUGmut variant, however, still demonstrated a reduced level of virus production. This mutation may exert another effect (possibly the inadvertent mutation of an underlying RNA element) but we did not analyze this further.

Figure 4: Evolution of Tat-deficient SIV-rtTA viruses. Mutations observed in Tat upon long term culturing of AUGmut stop SIV-rtTAopt-Tat (A, B) and SIV-rtTAopt-Tat (C, D). In (A) and (C), the top line shows the nucleotide sequence of the 5’ part of the wt tat gene, with the nucleotide numbers referring to the position in SIV-rtTAopt. As shown in Fig. 1A, this part of the tat gene (translation start at position 6206) overlaps with the genes encoding Vpr (translation stop at position 6358) and Rev (translation start at position 6432). The codons that were mutated in the TatAUGmut and Tatstop variants to knock out Tat are underlined. Sequence changes observed in three independent cultures are shown, with the culture number and days of culturing indicated on the left. Reversions back to wild-type sequence are highlighted in grey, insertions are indicated in bold, deletions are indicated with Δ, Vpr stop and Rev start codon are boxed. In (B) and (D), the corresponding amino acid sequences are shown. The stop codons are indicated with *.

35 Tat has a dual role in SIV transcription

Tat stimulates the transcriptional activity of the SIV-rtTA promoter

To confirm that the LTR-promoter in SIV-rtTA was Tat-responsive, we constructed promoter- reporter plasmids in which expression of luciferase is controlled by the LTR-promoter as present in SIV-rtTA, SIV-rtTAopt and SIV-rtTAtetO-CMV. 293T cells were transfected with these LTR- luciferase constructs together with an rtTA-expressing plasmid and increasing amounts of an SIV Tat-expressing plasmid. The intracellular luciferase level, which reflects promoter activity, was measured after culturing the cells with 0 to 100 ng/ml dox for 48h (Fig. 6A-C). All LTR- promoters showed a low background activity in the absence of dox and the activity gradually increased upon dox titration, confirming their dox dependency. At every dox level, the activity of the SIV-rtTA promoter was indeed enhanced by Tat (up to 2.4-fold at 50 ng Tat; Fig. 6A). Simi- larly, the SIV-rtTAopt promoter was stimulated by Tat. However, this optimized promoter was more active than the original SIV-rtTA promoter at all dox levels and its activity was enhanced by Tat to a lesser extent (up to 1.3 fold; Fig. 6B). As expected, the activity of the tetO-CMV promoter was not influenced by Tat (Fig.

6C), confirming the effect of Tat via Figure 5: Tat mutations reduce SIV-rtTA gene expression. (A) 293T U3 sequences. For comparison, we cells were transfected with the SIV-rtTAopt plasmids with either a wt or mutated Tat gene and cultured for 48h with dox. The CA-p27 measured Tat-TAR mediated activa- level in the culture supernatant is shown (mean±SEM; n=20). Statis- tical analysis (using one-way ANOVA) demonstrated that the CA-p27 tion of transcription by transfecting wt levels differed significantly between Tat and Tat-deficient viruses cells with an LTR-luciferase construct (*, p<0.05). (B) Cells were transfected with the SIV-rtTA5’tetO-CMV plasmids and cultured for 48h with dox. The CA-p27 in the culture with a wild-type TAR element and an supernatant is shown (mean±SEM; n=22). Statistical analysis demonstrated that the CA-p27 production differed significantly increasing amount of Tat (Fig. 6D). between the Tatwt and TatAUGmut variants (*, p<0.05). (A, B) mock, Transcription from this promoter cells transfected with pBluescript.

36 Tat has a dual role in SIV transcription

Figure 6: The SIV-rtTA LTR-promoter is stimulated by Tat. (A-C) 293T cells were transfected with promoter-reporter plasmids in which expression of firefly luciferase is controlled by the LTR-promoter as present in SIV-rtTA (A), SIV-rtTAopt (B) and SIV- rtTAtetO-CMV (C; LTR-promoter configurations are shown in Fig. 3). The cells were co- transfected with an rtTA-expressing plasmid and 0-50 ng SIV Tat-expressing plasmid. After culturing the transfected cells with 0 to 100 ng/ml dox for 48h, the intracellular luciferase level (RLU) was measured (mean±SEM; n=3). (D) Cells were transfected with an SIV-rtTA LTR-luciferase construct with a wt TAR element and 0-50 ng Tat plasmid. After culturing the cells for 48h (no dox), the intracellular luciferase level was measured (mean±SEM; n=3).

37 Tat has a dual role in SIV transcription was low in the absence of Tat and enhanced up to 25-fold by Tat co-transfection. Thus, the stimulatory effect of Tat on SIV-rtTA and SIV-rtTAopt promoter activity (up to 2.4-fold and 1.3- fold, respectively) is relatively small. Nevertheless, this TAR-independent Tat effect can explain the reduced virus production and replication of the SIV-rtTA variants upon Tat inactivation.

Discussion

We used the SIV-rtTA variant in which the Tat-TAR transcription activation mechanism is functionally replaced by the integrated rtTA-tetO components of the Tet-On system to study the role of Tat in SIV replication. First, we describe that new Tat-deficient SIV-rtTA variants (TatAUGmut and Tatstop mutants) are replication-competent and that a previously tested Tat- inactivation (Y55A) that yielded a non-replicating virus is not representative. This mutation may have affected a yet-unidentified underlying sequence element in the viral RNA and thus caused the replication defect, but this was not investigated further. Importantly, we show that SIV-rtTA can replicate without Tat, which demonstrates that Tat plays no essential role in SIV replication besides its transcription function. Second, by introducing an optimized LTR

-promoter and a more active rtTA, we obtained fast-replicating Tat-minus SIV-rtTAopt variants that nevertheless exhibited reduced replication capacity compared to the Tat-positive virus.

Third, evolution experiments with the Tat-deficient SIV-rtTAopt variants document significant pressure to restore Tat translation, which confirms that Tat stimulates SIV-rtTA replication. Fourth, we demonstrated that SIV-rtTA gene expression is enhanced by Tat. It seems unlikely that Tat exerts this function through the TAR motif, because this element is inactivated by multiple mutations that abrogate Tat binding [31]. In line with this idea, TAR deletion does not reduce SIV-rtTA gene expression and replication [44]. We previously succeeded in making a truly Tat-independent HIV-rtTA variant by substitution of the viral U3 sequences by non- related promoter elements [30]. Upon transplantation of the LTR-promoter from this HIV- rtTAtetO-CMV into SIV-rtTA, we reached the point where viral gene expression was no longer influenced by Tat. Unfortunately these SIV-rtTAtetO-CMV variants (with either a wild-type or mutated Tat gene) were not replication-competent, probably due to unrelated adverse effects of the insertion of HIV-optimized sequences into SIV (see below).

38 Tat has a dual role in SIV transcription

Promoter activity assays demonstrated that the activity of the SIV-rtTA and SIV-rtTAopt promoter was dependent on dox and further enhanced by Tat. This TAR-independent stimulatory effect of Tat (up to 2.4-fold and 1.3-fold on the SIV-rtTA and SIV-rtTAopt promoter, respectively; Fig. 6A-B) is relatively small when compared with the stimulatory effect of Tat on the activity of a TARwt-containing promoter (up to 25-fold; Fig. 6D). In fact, in the presence of a wild-type TAR element, the TAR-independent stimulatory effect may be further reduced due to the high affinity of the Tat-pTEFb complex for TAR (reviewed in [1]). Nevertheless, this TAR-independent Tat effect can explain the reduced virus production (Fig. 5A) and reduced replication (Fig. 2) of the SIV-rtTA variants upon Tat inactivation. The SIV-rtTAopt promoter 2 was more active and less influenced by Tat than the SIV-rtTA promoter, which is likely due to the presence of additional tetO and NFκB sites. This difference in activity and Tat stimulation explains why SIV-rtTAopt replication is less affected by Tat inactivation than SIV-rtTA replication (Fig. 2A-B). Substitution of the LTR-promoter by the tetO-CMV promoter that lacked SIV-derived U3 and TAR sequences allowed us to obtain truly Tat-independent gene expres- stop sion. This SIV-rtTAtetO-CMV variant subsequently allowed the introduction of the Tat mutation without a decrease in gene expression. We previously observed that TAR deletion does not reduce SIV-rtTA-Tatwt gene expression and replication [44], which indicates that Tat does not stimulate SIV-rtTA gene expression by residual binding to the mutated TAR element. These results therefore indicate that Tat stimulates SIV-rtTA gene expression through a direct or indirect interaction with U3 elements. It has previously been shown that U3 sequences influence Tat-mediated activation of transcription [45, 46], but because the constructs used in these studies contained a wild-type TAR element, it was not possible to discern whether this stimulation was TAR-dependent or independent. Our constructs lack a functional TAR element, suggesting that the Tat-U3 effect does not depend on the Tat-TAR interaction. In agreement with this, we recently showed that HIV-rtTA gene expression is also stimulated by Tat through a TAR-independent interaction with the U3-promoter region [30]. Detailed analysis demonstrated that HIV Tat required the Sp1 binding sites in the U3 region for this stimulatory effect. The SIV U3 region contains four Sp1 sites, which may similarly be involved in the Tat-U3 interaction, but a role of other U3 domains cannot be excluded.

We also tested replication of the new SIV-rtTA variants with the tetO-CMV promoter configuration in PM1 and 174xCEM cells. In these viruses, the U3-TAR region in both the 5’ and 3’ LTR region was replaced by the tetO-CMV sequences to avoid strand-transfer

39 Tat has a dual role in SIV transcription difficulties during reverse transcription of the viral genome. Unfortunately, none of the

SIV-rtTAtetO-CMV variants showed any replication in multiple independent experiments and we were unable to obtain replication-competent variants by spontaneous virus evolution (data not shown). The tetO-CMV promoter configuration was obtained through evolution of an

HIV-rtTAtetO-CMV variant in SupT1 T cells [30]. This configuration may be optimal for HIV-rtTA replication in SupT1 cells, but insufficient for SIV-rtTA replication in PM1 and 174xCEM cells. The tetO-CMV promoter may, for example, require a transcription factor that is present only in SupT1 cells. We also tested SIV-rtTAtetO-CMV replication on SupT1 cells (data not shown), but were repeatedly unable to detect replicating virus, which is most likely due to the absence of the CCR5 co-receptor on SupT1 cells.

Here we demonstrate that Tat can not only activate SIV LTR transcription via TAR, but also via elements in the U3-promoter region. Besides this dual role in transcription, Tat seems to have no other essential function in SIV replication. These results were obtained in several cell types (293T, PM1, 174xCEM, macaque PBMC), but we cannot exclude that Tat may exhibit another important function in other cell types or in vivo.

Methods

Construction of SIV-rtTA variants. The SIV-rtTA plasmids with a wild-type Tat gene (pSIV-rtTA-Tatwt) or Y55A- mutated Tat gene (pSIV-rtTA-TatY55A) were previously described [31]. The plasmid pSIV-rtTA-TatAUGmut was constructed by mutagenesis PCR [47] on the pKP-5’SIV template [31]. PCRs were performed with primers SIV-Tat- AUGmut (CTATAATAGACACGGAGACACCCTAGAGGGAGCA; mismatching nucleotides underlined) plus pLAI3’Seq (TGTCTCATGAGCGGATACATA) and with SIV-Tat-2 (GGGAACCATGGGATGAATG) plus pKP-3’mut (AGACGCGTTAGGGGTTCCGCGCACA). The fragments were purified, mixed and PCR-amplified with SIV-Tat-2 and pLAI3’Seq. The product was digested with HindIII and XhoI and ligated into the corresponding sites of pKP-5’SIV, producing pKP-5’SIV-TatAUGmut. The NarI-SphI fragment from this plasmid was used to replace the corresponding fragment of pSIV-rtTA to construct pSIV-rtTA-TatAUGmut. pSIV-rtTA-TatStop was constructed as described for pSIV-rtTA- TatAUGmut, but with primer SIV-Tat-Stop (GAGGGAGCAGGAGAACTGATAAGAATCCTCCA) instead of SIV-Tat-AUGmut.

In plasmid pSIV-rtTAopt an optimized promoter configuration is present in the 5’ and 3’ LTR. This configuration was obtained through evolution of SIV-rtTA-TAR+78C-U [48] upon long-term culturing in 174xCEM cells (to be described elsewhere). The 63-nt sequence encompassing the NFκB site and adjacent tetO element (TCGCTGAAACAGCAGGGACTTTCCACAGGATCCCTATCAGTGATAGAGAAATACCACTCCCTA; NFκB site underlined; tetO site in bold) was triplicated and a 289-nt upstream U3 sequence was deleted (positions 9776-10064 in the SIVmac239 sequence; GenBank/EMBL accession number M33262). In addition, this virus contained a TAR+43U-C

40 Tat has a dual role in SIV transcription mutation. These mutations did not affect dox-control, nor did they restore Tat-responsiveness. Moreover, AUGmut stop pSIV-rtTAopt contained the rtTA-V16 gene [37]. The NarI-SphI fragment of pSIV-rtTA-Tat and pSIV-rtTA-Tat AUGmut stop was ligated into the corresponding sites of pSIV-rtTAopt, resulting in pSIV-rtTAopt-Tat and pSIV-rtTAopt-Tat , respectively.

For the construction of the SIV-rtTAtetO-CMV variant, mutagenesis PCR was performed with primers SIV-CMV2loop-Fwd (GCTCCCCGGGTAACTAAGTAAGGATCTCATTTTATAAAAGAAAAGGGGGGACTGGAAGGGATTTATTACAGTGCAGATATCCG TCGAGTTTACCACTCCCT; SIV-rtTA nucleotides underlined; tetO-CMV nucleotides in italics) and HIV-CMV2loop-Rev

(GCGTGGTCAGATCGCTGGTGAATTCTTCAGGC; all nucleotides match the HIV-rtTAtetO-CMV U3-promoter) on the pHIV-rtTAtetO-CMV template [30]. A second PCR was performed with primers CMV2loop-SIV-pA

(CGCCTGAAGAATTCACCAGCGATCTGACCACGCTTGCTTGCTTGAAGCCCT) and pLAI3’Seq on the pSIV-rtTAopt template. 2 The products were purified, mixed and PCR-amplified with primers SIV-CMV2loop-Fwd and pLAI3’Seq. The resulting fragment was digested with XmaI and AatII and ligated into the corresponding sites of pSIV-rtTAopt. The resulting plasmid pSIV-rtTA3’tetO-CMV contained the tetO-CMV promoter in the 3’LTR. To introduce the tetO-CMV promoter into the 5’LTR, the 3’LTR sequence was PCR-amplified with primers SIV-LTR-4 (AGCTCTAGAGCGGCCGCTGGAAGGGATTTATTACAGTGCA; NotI site underlined) and SIV-LTR-5 (ATGGACGTCTCGAGTCGCATGCTAGGCGCCAATCTGCTAGGGATTTTCCTGCT; NarI site underlined). The product was digested with NotI and NarI and used to replace the corresponding 5’LTR fragment in pSIV-rtTAopt and pSIV-rtTA3’tetO-

CMV, resulting in pSIV-rtTA5’tetO-CMV and pSIV-rtTAtetO-CMV, respectively.

Cell and virus cultures. 293T, PM1 and 174xCEM cells were transfected with 1 µg (293T) or 5 µg (PM1, 174xCEM) SIV-rtTA plasmid and cultured with 1 µg/ml dox as previously described [31, 49]. Cell-free culture supernatants were harvested and virus production was quantified by CA-p27 ELISA (Advanced Bioscience Laboratories). PBMC isolated from cynomolgus macaques were infected with equal amounts of virus (corresponding to 5 ng CA-p27) and cultured with 1 µg/ml dox as described previously [48]. The virus level in the culture medium was determined with a real- time PCR-based RT assay [31, 50]. Total cellular DNA was isolated from infected cells and the Tat-coding region was analyzed as previously described [48].

Tat and promoter activity assays. Tat activity of the SIV-rtTA variants was measured upon transfection of 293T cells with 1 µg SIV-rtTA plasmid, 20 ng pBlue3’LTR-luc (plasmid in which expression of the firefly luciferase gene is controlled by the wild-type HIV-1 LTR-promoter) and 0.5 ng pRL-CMV as previously described [30]. After culturing the cells for 48h with 1 µg/ml dox, firefly and renilla luciferase production was measured (dual-luciferase assay; Promega). The Tat activity was calculated as the ratio between the firefly and renilla luciferase activities and cor- rected for between-session variation [51].

To measure the Tat-responsiveness of the SIV-rtTA LTR-promoter variants, 293T cells were transfected with

20 ng pSIV-rtTA-LTR-luc [31], pSIV-rtTAopt-LTR-luc or pTetO-CMV-LTR-luc, 0.4 ng pCMV-rtTA-V16 [37], 0.5 ng pRL- CMV, 0-50 ng pcDNA3-SIV-Tat [31], 0-50 ng pcDNA3 (empty vector; total amount of pcDNA3-SIV-Tat and pcDNA3 was kept at 50 ng) and 930 ng pBluescript as carrier DNA as previously described [31]. In the plasmid pSIV-rtTA-LTR-luc, the expression of the firefly luciferase gene is controlled by the SIV-rtTA LTR-promoter [31]. For the construction of pSIV-rtTAopt-LTR-luc, the XhoI-XmaI LTR fragment of SIV-rtTAopt was used to replace the

41 Tat has a dual role in SIV transcription corresponding sequence in pSIV-rtTA-LTR-luc. In pTetO-CMV-LTR-luc, expression of firefly luciferase is controlled by the tetO-CMV promoter as present in SIV-rtTAtetO-CMV and HIV-rtTAtetO-CMV [30]. For the construction of pTetO-CMV-

LTR-luc, the 5’LTR region of HIV-rtTAtetO-CMV was PCR-amplified with primers U3XbaNot and AD-AUG [30]. The product was digested with EcoRV and HindIII and ligated into the corresponding sites of pHIV-LTR-2∆tetO-X/H-luc [52]. TARwt-mediated activation of transcription by Tat was measured as previously described [31]. After transfection, the cells were cultured for 48h with 0-100 ng/ml dox, the firefly and renilla luciferase activities were measured and the promoter activity was calculated as the ratio between the firefly and renilla luciferase activities and cor- rected for between-session variation [51].

Acknowledgements

This research was funded by the Aids Fonds (grant 2007028). We thank Alex Harwig and Bep Klaver for discussions and technical support and Neil Almond and Mark Page (HPA-NIBSC, UK) for providing macaque PBMC.

42 Tat has a dual role in SIV transcription

References 13. Chiu YL, Ho CK, Saha N, Schwer B, Shuman S, Rana TM: Tat stimulates cotranscriptional capping of HIV 1. Bannwarth S, Gatignol A: HIV-1 TAR RNA: the tar- mRNA. Molecular Cell 2002, 10:585–97. get of molecular interactions between the virus and 14. Zhou M, Deng L, Kashanchi F, Brady JN, Shatkin its host. Current HIV Research 2005, 3:61–71. AJ, Kumar A: The Tat/TAR-dependent phosphoryla- 2. Brady J, Kashanchi F: Tat gets the “green” light on tion of RNA polymerase II C-terminal domain stimu- transcription initiation. Retrovirology 2005, 2:69. lates cotranscriptional capping of HIV-1 mRNA. Pro- ceedings of the National Academy of Sciences of the 3. Richter S, Ping YH, Rana TM: TAR RNA loop: a USA 2003, 100:12666–71. scaffold for the assembly of a regulatory switch in HIV replication. Proceedings of the National Academy 15. Braddock M, Thorburn AM, Chambers A, Elliott of Sciences of the USA 2002, 99:7928–33. GD, Anderson GJ, Kingsman AJ, Kingsman SM: A nuclear translational block imposed by the HIV-1 U3 4. Wei P, Garber ME, Fang SM, Fischer WH, Jones KA: region is relieved by the Tat-TAR interaction. Cell A novel CDK9-associated C-type cyclin interacts di- 1990, 62:1123–33. rectly with HIV-1 Tat and mediates its high-affinity, 2 loop-specific binding to TAR RNA. Cell 1998, 92:451– 16. Braddock M, Powell R, Blanchard AD, Kingsman 62. AJ, Kingsman SM: HIV-1 TAR RNA-binding proteins control TAT activation of translation in Xenopus 5. Parada CA, Roeder RG: Enhanced processivity of oocytes. The FASEB Journal 1993, 7:214–22. RNA polymerase II triggered by Tat-induced phos- phorylation of its carboxy-terminal domain. Nature 17. Charnay N, Ivanyi-Nagy R, Soto-Rifo R, Ohlmann T, 1996, 384:375–8. López-Lastra M, Darlix JL: Mechanism of HIV-1 Tat RNA translation and its activation by the Tat protein. 6. Bieniasz PD, Grdina TA, Bogerd HP, Cullen BR: Re- Retrovirology 2009, 6:74. cruitment of cyclin T1/P-TEFb to an HIV type 1 long terminal repeat promoter proximal RNA target is 18. SenGupta DN, Berkhout B, Gatignol A, Zhou AM, both necessary and sufficient for full activation of Silverman RH: Direct evidence for translational regu- transcription. Proceedings of the National Academy lation by leader RNA and Tat protein of human im- of Sciences of the USA 1999, 96:7791–6. munodeficiency virus type 1. Proceedings of the National Academy of Sciences of the USA 1990, 7. Raha T, Cheng SWG, Green MR: HIV-1 Tat stimu- 87:7492–6. lates transcription complex assembly through recruitment of TBP in the absence of TAFs. PLoS Biolo- 19. Harrich D, Ulich C, García-Martínez LF, Gaynor RB: gy 2005, 3:e44. Tat is required for efficient HIV-1 reverse transcription. The EMBO Journal 1997, 16:1224–35. 8. Easley R, Van Duyne R, Coley W, Guendel I, Dadgar S, Kehn-Hall K, Kashanchi F: Chromatin dynamics 20. Kameoka M, Rong L, Götte M, Liang C, Russell RS, associated with HIV-1 Tat-activated transcription. Wainberg MA: Role for human immunodeficiency Biochimica et Biophysica Acta 2010, 1799:275–85. virus type 1 Tat protein in suppression of viral reverse transcriptase activity during late stages of viral 9. Gatignol A: Transcription of HIV: Tat and cellular replication. Journal of Virology 2001, 75:2675–83. chromatin. Advances in Pharmacology 2007, 55:137– 59. 21. Kameoka M, Morgan M, Binette M, Russell RS, Rong L, Guo X, Mouland A, Kleiman L, Liang C, Wain- 10. Romani B, Engelbrecht S, Glashoff RH: Functions berg MA: The Tat protein of human immunodeficien- of Tat: the versatile protein of human immunodefi- cy virus type 1 (HIV-1) can promote placement of ciency virus type 1. Journal of General Virology 2010, tRNA primer onto viral RNA and suppress later DNA 91:1–12. polymerization in HIV-1 reverse transcription. Jour- 11. Jablonski JA, Amelio AL, Giacca M, Caputi M: The nal of Virology 2002, 76:3637–45. transcriptional transactivator Tat selectively regu- 22. Apolloni A, Meredith LW, Suhrbier A, Kiernan R, lates viral splicing. Nucleic Acids Research 2010, Harrich D: The HIV-1 Tat protein stimulates reverse 38:1249–60. transcription in vitro. Current HIV Research 2007, 5:473–83. 12. Chiu YL, Coronel E, Ho CK, Shuman S, Rana TM: HIV-1 Tat protein interacts with mammalian capping 23. Gautier VW, Gu L, O’Donoghue N, Pennington S, enzyme and stimulates capping of TAR RNA. The Sheehy N, Hall WW: In vitro nuclear interactome of Journal of Biological Chemistry 2001, 276:12959–66. the HIV-1 Tat protein. Retrovirology 2009, 6:47.

43 Tat has a dual role in SIV transcription

24. Bennasser Y, Le SY, Benkirane M, Jeang KT: Evi- virus type 1 (HIV-1) isolates in a unique CD4+ T-cell dence that HIV-1 encodes an siRNA and a suppressor clone (PM1): failure to downregulate CD4 and to of RNA silencing. Immunity 2005, 22:607–19. interfere with cell-line-tropic HIV-1. Journal of Virolo- gy 1995, 69:3712–20. 25. Bennasser Y, Jeang KT: HIV-1 Tat interaction with Dicer: requirement for RNA. Retrovirology 2006, 37. Zhou X, Vink M, Klaver B, Berkhout B, Das AT: 3:95. Optimization of the Tet-On system for regulated gene expression through viral evolution. Gene Thera- 26. Haasnoot J, de Vries W, Geutjes EJ, Prins M, de py 2006, 13:1382–90. Haan P, Berkhout B: The Ebola virus VP35 protein is a suppressor of RNA silencing. PLoS Pathogens 2007, 38. Berkhout B, Gatignol A, Silver J, Jeang KT: Efficient 3:e86. trans-activation by the HIV-2 Tat protein requires a duplicated TAR RNA structure. Nucleic Acids Re- 27. Schnettler E, de Vries W, Hemmes H, Haasnoot J, search 1990, 18:1839–46. Kormelink R, Goldbach R, Berkhout B: The NS3 protein of rice hoja blanca virus complements the RNAi 39. Mueller SM, Lang SM: The first HxRxG motif in suppressor function of HIV-1 Tat. EMBO Reports simian immunodeficiency virus mac239 Vpr is crucial 2009, 10:258–63. for G(2)/M cell cycle arrest. Journal of Virology 2002, 76:11704–9. 28. Lin J, Cullen BR: Analysis of the interaction of primate retroviruses with the human RNA interfer- 40. Gibbs JS, Regier DA, Desrosiers RC: Construction ence machinery. Journal of Virology 2007, 81:12218– and in vitro properties of SIVmac mutants with dele- 26. tions in “nonessential” genes. AIDS Research and Human Retroviruses 1994, 10:607–16. 29. Sanghvi VR, Steel LF: A re-examination of global suppression of RNA interference by HIV-1. PLoS One 41. Hoch J, Lang SM, Weeger M, Stahl-Hennig C, Cou- 2011, 6:e17246. libaly C, Dittmer U, Hunsmann G, Fuchs D, Müller J, Sopper S: vpr deletion mutant of simian immunode- 30. Das AT, Harwig A, Berkhout B: The HIV-1 Tat pro- ficiency virus induces AIDS in rhesus monkeys. Jour- tein has a versatile role in activating viral transcrip- nal of Virology 1995, 69:4807–13. tion. Journal of Virology 2011, 85:9506–16. 42. Gibbs JS, Lackner AA, Lang SM, Simon MA, Sehgal 31. Das AT, Klaver B, Harwig A, Vink M, Ooms M, PK, Daniel MD, Desrosiers RC: Progression to AIDS in Centlivre M, Berkhout B: Construction of a doxycy- the absence of a gene for vpr or vpx. Journal of Virol- cline-dependent simian immunodeficiency virus ogy 1995, 69:2378–83. reveals a nontranscriptional function of tat in viral replication. Journal of Virology 2007, 81:11159–69. 43. Berchtold S, Ries J, Hornung U, Aepinus C: Ex- change of functional domains between Rev proteins 32. Verhoef K, Marzio G, Hillen W, Bujard H, Berkhout of HIV-1 and SIVmac239 results in a dominant nega- B: Strict control of human immunodeficiency virus tive phenotype. Virology 1994, 204:436–41. type 1 replication by a genetic switch: Tet for Tat. Journal of Virology 2001, 75:979–87. 44. Centlivre M, Klaver B, Berkhout B, Das AT: Func- tional analysis of the complex trans-activating re- 33. Das AT, Verhoef K, Berkhout B: A conditionally sponse element RNA structure in simian immunode- replicating virus as a novel approach toward an HIV ficiency virus. Journal of Virology 2008, 82:9171–8. vaccine. Methods in Enzymology 2004, 388:359–79. 45. Pöhlmann S, Flöss S, Ilyinskii PO, Stamminger T, 34. Verhoef K, Koper M, Berkhout B: Determination Kirchhoff F: Sequences just upstream of the simian of the minimal amount of Tat activity required for immunodeficiency virus core enhancer allow effi- human immunodeficiency virus type 1 replication. cient replication in the absence of NF-kappaB and Virology 1997, 237:228–36. Sp1 binding elements. Journal of Virology 1998, 35. Chen Z, Gettie A, Ho DD, Marx PA: Primary SIVsm 72:5589–98. isolates use the CCR5 coreceptor from sooty manga- 46. Ilyinskii PO, Desrosiers RC: Efficient transcription beys naturally infected in west Africa: a comparison and replication of simian immunodeficiency virus in of coreceptor usage of primary SIVsm, HIV-2, and the absence of NF-kappaB and Sp1 binding ele- SIVmac. Virology 1998, 246:113–24. ments. Journal of Virology 1996, 70:3118–26. 36. Lusso P, Cocchi F, Balotta C, Markham PD, Louie A, 47. Mikaelian I, Sergeant A: A general and fast meth- Farci P, Pal R, Gallo RC, Reitz MS: Growth of macro- od to generate multiple site directed mutations. phage-tropic and primary human immunodeficiency Nucleic Acids Research 1992, 20:376.

44 Tat has a dual role in SIV transcription

48. Das AT, Klaver B, Centlivre M, Harwig A, Ooms M, Page M, Almond N, Yuan F, Piatak M, Lifson JD, Berk- hout B: Optimization of the doxycycline-dependent simian immunodeficiency virus through in vitro evolution. Retrovirology 2008, 5:44. 49. Das AT, Zhou X, Vink M, Klaver B, Verhoef K, Mar- zio G, Berkhout B: Viral evolution as a tool to improve the tetracycline-regulated gene expression system. The Journal of Biological Chemistry 2004, 279:18776–82. 50. Maudru T, Peden KW: Adaptation of the fluoro- genic 5’-nuclease chemistry to a PCR-based reverse transcriptase assay. Biotechniques 1998, 25:972–5. 51. Ruijter JM, Thygesen HH, Schoneveld OJLM, Das 2 AT, Berkhout B, Lamers WH: Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology. Retrovirology 2006, 3:2. 52. Das AT, Harwig A, Vrolijk MM, Berkhout B: The TAR hairpin of human immunodeficiency virus type 1 can be deleted when not required for Tat- mediated activation of transcription. Journal of Virol- ogy 2007, 81:7742–8.