DOCSLIB.ORG

THE SPATIAL and TEMPORAL ROLE of EZH2 in SKULL BONE FORMATION by JAMES W. FERGUSON Submitted in Partial Fulfillment of the Requi

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
THE SPATIAL and TEMPORAL ROLE of EZH2 in SKULL BONE FORMATION by JAMES W. FERGUSON Submitted in Partial Fulfillment of the Requi THE SPATIAL AND TEMPORAL ROLE OF EZH2 IN SKULL BONE FORMATION by JAMES W. FERGUSON Submitted in partial fulfillment of the requirements of the degree of Doctor of Philosophy Department of Biology CASE WESTERN RESERVE UNIVERSITY August 2018 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the dissertation of James Ferguson candidate for the degree of Doctor of Philosophy. Committee Chair: Brian McDermott, PhD Radhika Atit, PhD Emmitt K. Jolly, PhD Stephen E. Haynesworth, PhD Veronique Lefebvre, PhD Peter Harte, PhD Date of Defense: April 18, 2018 *We also certify that written approval has been obtained for any proprietary material contained therein. Completion of this dissertation was not feat I accomplished alone. I would like to dedicate this to all the people who made this possible through both emotional and intellectual support. i Table of Contents Abstract: Chapter 1: Introduction and significance 1.1: Anatomy and development of bone: 1.1a: Structure and function of bone 1.1b: Skeletal bone formation 1.1c: Anatomy and structure of the skull bones 1.2: Cellular and molecular mechanisms of skull bone development: 1.2a: Stem cell origins of the skull bones 1.2b: Embryonic developmental timeline of cranial mesenchyme bone 1.3 Transcriptional regulation of the bone initiation program: 1.3a: MshHomeobox 1 (Msx1) and MshHomeobox 2 (Msx2) mark bone precursors 1.3b: Runt Related Transcription Factor 2 (Runx2) and Osterix (Sp7/OSX) are the key determinants of skull bone formation: 1.4: Regulation of molecular signal during of murine skull bone formation: 1.4a: Fibroblast Growth Factor signaling is preferentially active in the CNCC: 1.4b: The Bone Morphogenic Protein signaling pathway is primarily active in the PM 1.4c: Wnt/β-catenin signaling pathway is required throughout skull bone formation 1.4d: Twist Family BHLH Transcription Factor 1 (Twist1) is regulated by Wnt/β-catenin signaling and required for skull bone formation: 1.4e: Retinoic Acid signaling affects many different signaling pathways required for skull bone formation 1.4f: Epigenetic regulation of skull bone development 1.4g: The in vivo role of PRC2 in craniofacial development 1.5: Functional interaction and regulation of bone transcriptional program by BMP, FGF, Wnt/β- catenin, RA, and PRC2: 1.6: Clinical significance: Chapter 2: PRC2 is Dispensable in Vivo for β-Catenin-Mediated Repression of Chondrogenesis in Mouse Embryonic Cranial Mesenchyme Abstract: 2.1: Introduction: 2.2: Results: 2.2a: Genes dysregulated upon loss of β-catenin are enriched for the PRC2-associated H3K27me3 histone mark 2.2b: Chondrocyte fate genes are enriched for H3K27me3 in the embryonic CM 2.2c: Endogenous β-catenin and EZH2 may physically interact in the CM 2.2d: β-catenin is not required for PRC2 component expression or bulk H3K27me3 levels 2.2e: Loss of Ezh2 does not lead to ectopic cell type fate selection or chondrogenesis in the CM 2.2f: Loss of β-catenin does not significantly alter H3K27me3 enrichment genome-wide 2.2g: H3K27me3 enrichment is not depleted on ectopically expressed chondrocytic gene determinants in β-catenin mutants ii 2.3: Discussion: 2.4: Materials and methods: 2.4a: Mice and genotyping 2.4b: Cranial mesenchyme isolation 2.4c: RT-qPCR 2.4d: Immunofluorescence 2.4e: Co-immunoprecipitation 2.4f: Protein Isolation and Immunoblotting 2.4g: RNA sequencing 2.4h: ChIP-sequencing 2.4i: Cell Culture 2.4j: Statistics 2.4k: Data Availability 2.5: Acknowledgments: Chapter 3: Ezh2 is required for skull bone formation in a tissue- and developmental-stage specific manner Abstract 3.1: Introduction: 3.2: Results: 3.2a: Conditional deletion of Ezh2in cranial mesenchyme stem cells 3.2b: E8.5-CMEzh2mutants have decreased craniofacial bone volume and size 3.2c: The effect of Ezh2 on skull bone formation is developmental-stage specific 3.2d: Diminished cranial bones in E8.5-CMEzh2 mutants is not due to defects in cell survival and proliferation at E10.5 3.2e: E8.5-CMEzh2 mutants exhibit defects in the differentiation of the skull bone progenitors 3.2f: In vivo inhibition of Retinoic Acid signaling partially restores skull bones 3.3: Discussion: 3.3a: The role of Ezh2 in the lineage-restriction of cranial bone progenitors 3.3b: The genetic mechanism involved in lineage selection of the cranial bones by Ezh2 3.3c: Ectopic expression of Hox genes may lead to a reduction of skull bone in E8.5- CMEzh2 mutants 3.3d: An upregulation of Hedgehog signaling could lead to a reduction of the skull bones E8.5-CMEzh2 mutants 3.4: Materials and methods: 3.4a: Mice and genotyping 3.4b: Histology, β-Galactosidase, and Immunohistochemistry 3.4c: RT-qPCR 3.4d: Protein Isolation and immunoblotting 3.4e: MicroCT: 3.4f: Whole mount skeletal preparation: 3.4g: Cell Proliferation/Death Assay iii 3.4h: Retinoic acid inhibition 3.4i: Statistics 3.5: Acknowledgements: 3.6 Conflict of interest: Chapter 4: Discussion: Discussion outline: 4.1: β-catenin and its role in the suppression of chondrogenesis 4.1a: Possible repression of chondrogenesis mediated by TWIST1 4.1b: Possible suppression of Sox9 through unliganded RARs 4.1c: Possible inhibition of chondrogensis through β-catenin-SOX9 protein-protein interactions 4.1d: Possible repression of Sox9 by direct β-catenin binding 4.2: Insights into the repressive functions of β-catenin: 4.3: The mechanisms governing the developmental stage and cell type specific role of Ezh2: 4.3a: Ezh2 is required for lineage selection of the cranial bone prior to the expression of Msx genes 4.3b: Canonical vs. non-canonical function of EZH2 4.4: Ezh2 regulates skull bone formation by inhibiting a target of the RA signaling pathway: 4.4a: Hedgehog signaling and Hox genes are potential targets of RA signaling 4.5: The correlation of H3K27me3 enrichment with mRNA expression: 4.6: Conclusion: iv List of Figures: Chapter 1: Figure 1.1: Comparative anatomy of the mouse and human skull. Figure 1.2: The migration of cranial neural crest cells from the neural tube. Figure 1.3: Spatial organization of the mesenchymal stem cell origins and bone primordia. Figure 1.4: The bone initiation program and cell fate selection of the skull bone. Figure 1.5: Temporal differences in the bone initiation program between the CNCC-CM and PM- CM Figure 1.6: Signaling mechanisms regulating the bone initiation program in the CNCC-CM and PM-CM. Figure 1.7: Canonical Wnt/β-catenin signaling: Figure 1.8: Enrichment of H3K27me3 by PRC2 leads to transcriptional repression. Chapter 2: Figure 2.1: β-catenin regulates known PRC2 targets and can physically interact with PRC2. Figure S2.1: Genomic Regions Enrichment of Annotations Tool (GREAT) analysis of differentially expressed genes upon deletion of β-catenin. Figure S2.2: Genes regulated by β-catenin are enriched for PRC2 targets in dorsal dermal fibroblasts. Figure 2.2: β-catenin activity is not required for the expression of PRC2 components and bulk H3K27me3 levels. Figure S2.3: Knockout of Ezh2 with En1Cre does not lead to a change in H3K27me3 enrichment in the CM. Figure 2.3: Knockdown of Ezh2 in the cranial mesenchyme does not lead to changes in cell type fate selection. Figure 2.4: Chemical inhibition of EZH2 methyltransferase does not lead to an up-regulation of early chondrocyte markers in CM+ectoderm. Figure 2.5: Loss of β-catenin does not significantly alter H3K27me3 enrichment genome wide or on cartilage differentiation determinants. Figure S2.4: Analysis of strong, medium, and weak H3K27me3 enrichment in the CM+ectoderm. Figure S2.5: Gene ontology analysis of strong, medium, and weak H3K27me3 enrichment. Figure S2.6: Strong, medium, and weak H3K27me3 peak groups have similar representation in genes regulated by β-catenin. Figure S2.7: H3K27me3 peaks are associated with genes actively transcribed and repressed in CM. Chapter 3: Figure 3.1: Tamoxifen induced knockout of Ezh2at E8.5 in both the mesoderm- and neural crest-derived mesenchymal stem cells is sufficient to lead to craniofacial defects. Figure S3.1: Whole mount analysis of E13.5 and E17.5 E8.5-CMEzh2 mutants. Figure 3.2: e8.5-CMEzh2leads to a reduction of CNCC-derived bones and a severe reduction in PM-derived bones. Figure S3.2: Quantification of the mandible and snout in e8.5-CMEzh2 mutants. v Figure 3.3: Ezh2 is required for skull bone formation in a developmental stage-dependent manner. Figure S3.3: Ezh2 is lost in the same tissue in the E8.5-CMEzh2 and E9.5-CMEzh2 mutant. Figure 3.4: Increased cell death in E8.5-CMEzh2 mutants is insufficient to account for loss of skull bones. Figure S3.4: Significant increase in cell death, but no change in cell proliferation, in the frontonasal process in E8.5-CMEzh2 mutants. Figure 3.5: Loss of Ezh2 at E8.5 leads to defects in bone progenitor differentiation. Figure S3.5: No change in bone marker, alkaline phosphatase (AP) inE8.5-CMEzh2 mutants and OSX in E9.5-CMEzh2mutants. Figure S3.6: E8.5-CMEzh2 mutants exhibit an ectopic expression of the Hox genes. Figure S3.7: The effects of RA signaling disruptions in the CM. Figure 3.6: Chemical inhibition of RA signaling partially rescues the in E8.5-CMEzh2 mutant phenotype and restores the PM-derived bones. Chapter 4: Figure 4.1: Proposed mechanisms by which β-catenin suppresses chondrogenesis in the cranial mesenchyme. Figure 4.2: Ezh2 is required for the lineage selection of the skull bone precursors prior to the activation of the bone initiation program. vi List of Tables: Chapter 1: Table 1.1: Signaling pathway mutants leading to skull bone defects Chapter 2: Table 2.1: Summary of publications demonstrating a biological interaction between β-catenin and PRC2.
Load more

Recommended publications
  • Variable Clinical Expression in Patients with a Germline MEN1 Disease Gene Mutation: Clues to a Genotype–Phenotype Correlation
    CLINICS 2012;67(S1):49-56 DOI:10.6061/clinics/2012(Sup01)10 REVIEW Variable clinical expression in patients with a germline MEN1 disease gene mutation: clues to a genotype–phenotype correlation Cornelis J. Lips,I Koen M. Dreijerink,I Jo W. Ho¨ ppenerII I University Medical Center Utrecht, Department of Internal Medicine & Endocrinology, Utrecht, The Netherlands. II University Medical Center Utrecht, Department of Metabolic & Endocrine Diseases, Utrecht, The Netherlands. Multiple endocrine neoplasia type 1 is an inherited endocrine tumor syndrome, predominantly characterized by tumors of the parathyroid glands, gastroenteropancreatic tumors, pituitary adenomas, adrenal adenomas, and neuroendocrine tumors of the thymus, lungs or stomach. Multiple endocrine neoplasia type 1 is caused by germline mutations of the multiple endocrine neoplasia type 1 tumor suppressor gene. The initial germline mutation, loss of the wild-type allele, and modifying genetic and possibly epigenetic and environmental events eventually result in multiple endocrine neoplasia type 1 tumors. Our understanding of the function of the multiple endocrine neoplasia type 1 gene product, menin, has increased significantly over the years. However, to date, no clear genotype– phenotype correlation has been established. In this review we discuss reports on exceptional clinical presentations of multiple endocrine neoplasia type 1, which may provide more insight into the pathogenesis of this disorder and offer clues for a possible genotype–phenotype correlation. KEYWORDS: Multiple Endocrine Neoplasia type 1; MEN1; Menin; Genotype–Phenotype Correlation; Clinical Expression. Lips CJ, Dreijerink KM, Ho¨ ppener JW. Variable clinical expression in patients with a germline MEN1 disease gene mutation: clues to a genotype– phenotype correlation. Clinics. 2012;67(S1):49-56.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • An Evolutionary Conserved Region (ECR) in the Human Dopamine Receptor D4 Gene Supports Reporter Gene Expression in Primary Cultu
    Paredes et al. BMC Neuroscience 2011, 12:46 http://www.biomedcentral.com/1471-2202/12/46 RESEARCHARTICLE Open Access An evolutionary conserved region (ECR) in the human dopamine receptor D4 gene supports reporter gene expression in primary cultures derived from the rat cortex Ursula M Paredes1,2, Vivien J Bubb1, Kate Haddley1, Gabriele A Macho1,3 and John P Quinn1* Abstract Background: Detecting functional variants contributing to diversity of behaviour is crucial for dissecting genetics of complex behaviours. At a molecular level, characterisation of variation in exons has been studied as they are easily identified in the current genome annotation although the functional consequences are less well understood; however, it has been difficult to prioritise regions of non-coding DNA in which genetic variation could also have significant functional consequences. Comparison of multiple vertebrate genomes has allowed the identification of non-coding evolutionary conserved regions (ECRs), in which the degree of conservation can be comparable with exonic regions suggesting functional significance. Results: We identified ECRs at the dopamine receptor D4 gene locus, an important gene for human behaviours. The most conserved non-coding ECR (D4ECR1) supported high reporter gene expression in primary cultures derived from neonate rat frontal cortex. Computer aided analysis of the sequence of the D4ECR1 indicated the potential transcription factors that could modulate its function. D4ECR1 contained multiple consensus sequences for binding the transcription factor Sp1, a factor previously implicated in DRD4 expression. Co-transfection experiments demonstrated that overexpression of Sp1 significantly decreased the activity of the D4ECR1 in vitro. Conclusion: Bioinformatic analysis complemented by functional analysis of the DRD4 gene locus has identified a) a strong enhancer that functions in neurons and b) a transcription factor that may modulate the function of that enhancer.
    [Show full text]
  • The BTB-ZF Family of Transcription Factors: Key Regulators of Lineage
    The BTB-ZF Family of Transcription Factors: Key Regulators of Lineage Commitment and Effector Function Development in the Immune System This information is current as of September 27, 2021. Aimee M. Beaulieu and Derek B. Sant'Angelo J Immunol 2011; 187:2841-2847; ; doi: 10.4049/jimmunol.1004006 http://www.jimmunol.org/content/187/6/2841 Downloaded from References This article cites 103 articles, 44 of which you can access for free at: http://www.jimmunol.org/content/187/6/2841.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The BTB-ZF Family of Transcription Factors: Key Regulators of Lineage Commitment and Effector Function Development in the Immune System Aimee M. Beaulieu* and Derek B. Sant’Angelo*,†,‡ Successful immunity depends upon the activity of mul- 1, -2, -4, -5, and -7 (1–11).
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Transient Activation of Meox1 Is an Early Component of the Gene
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Access to Research and Communications Annals 1 Transient activation of Meox1 is an early component of the gene 2 regulatory network downstream of Hoxa2. 3 4 Pavel Kirilenko1, Guiyuan He1, Baljinder Mankoo2, Moises Mallo3, Richard Jones4, 5 5 and Nicoletta Bobola1,* 6 7 (1) School of Dentistry, Faculty of Medical and Human Sciences, University of 8 Manchester, Manchester, UK. 9 (2) Randall Division of Cell and Molecular Biophysics, King's College London, UK. 10 (3) Instituto Gulbenkian de Ciência, Oeiras, Portugal. 11 (4) Genetic Medicine, Manchester Academic Health Science Centre, Central 12 Manchester University Hospitals NHS Foundation Trust, Manchester, UK. 13 (5) Present address: Department of Biology, University of York, York, UK. 14 15 Running title: Hoxa2 activates Meox1 expression. 16 Keywords: Meox1, Hoxa2, homeodomain, development, mouse 17 *Words Count: Material and Methods: 344; Introduction, Results and Discussion: 18 3679 19 19 * Author for correspondence at: AV Hill Building The University of Manchester Manchester M13 9PT United Kingdom Phone: (+44) 161 3060642 E-mail: [email protected] 1 Abstract 2 Hox genes encode transcription factors that regulate morphogenesis in all animals 3 with bilateral symmetry. Although Hox genes have been extensively studied, their 4 molecular function is not clear in vertebrates, and only a limited number of genes 5 regulated by Hox transcription factors have been identified. Hoxa2 is required for 6 correct development of the second branchial arch, its major domain of expression. 7 We now show that Meox1 is genetically downstream from Hoxa2 and is a direct 8 target.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Single Cell Regulatory Landscape of the Mouse Kidney Highlights Cellular Differentiation Programs and Disease Targets
    ARTICLE https://doi.org/10.1038/s41467-021-22266-1 OPEN Single cell regulatory landscape of the mouse kidney highlights cellular differentiation programs and disease targets Zhen Miao 1,2,3,8, Michael S. Balzer 1,2,8, Ziyuan Ma 1,2,8, Hongbo Liu1,2, Junnan Wu 1,2, Rojesh Shrestha 1,2, Tamas Aranyi1,2, Amy Kwan4, Ayano Kondo 4, Marco Pontoglio 5, Junhyong Kim6, ✉ Mingyao Li 7, Klaus H. Kaestner2,4 & Katalin Susztak 1,2,4 1234567890():,; Determining the epigenetic program that generates unique cell types in the kidney is critical for understanding cell-type heterogeneity during tissue homeostasis and injury response. Here, we profile open chromatin and gene expression in developing and adult mouse kidneys at single cell resolution. We show critical reliance of gene expression on distal regulatory elements (enhancers). We reveal key cell type-specific transcription factors and major gene- regulatory circuits for kidney cells. Dynamic chromatin and expression changes during nephron progenitor differentiation demonstrates that podocyte commitment occurs early and is associated with sustained Foxl1 expression. Renal tubule cells follow a more complex differentiation, where Hfn4a is associated with proximal and Tfap2b with distal fate. Mapping single nucleotide variants associated with human kidney disease implicates critical cell types, developmental stages, genes, and regulatory mechanisms. The single cell multi-omics atlas reveals key chromatin remodeling events and gene expression dynamics associated with kidney development. 1 Renal, Electrolyte, and Hypertension Division, Department of Medicine, University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA, USA. 2 Institute for Diabetes, Obesity, and Metabolism, University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA, USA.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis Reveals Molecular Subtypes of Pancreatic Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 17), pp: 28990-29012 Research Paper Genome-wide DNA methylation analysis reveals molecular subtypes of pancreatic cancer Nitish Kumar Mishra1 and Chittibabu Guda1,2,3,4 1Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, Omaha, NE, 68198, USA 2Bioinformatics and Systems Biology Core, University of Nebraska Medical Center, Omaha, NE, 68198, USA 3Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE, 68198, USA 4Fred and Pamela Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE, 68198, USA Correspondence to: Chittibabu Guda, email: [email protected] Keywords: TCGA, pancreatic cancer, differential methylation, integrative analysis, molecular subtypes Received: October 20, 2016 Accepted: February 12, 2017 Published: March 07, 2017 Copyright: Mishra et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Pancreatic cancer (PC) is the fourth leading cause of cancer deaths in the United States with a five-year patient survival rate of only 6%. Early detection and treatment of this disease is hampered due to lack of reliable diagnostic and prognostic markers. Recent studies have shown that dynamic changes in the global DNA methylation and gene expression patterns play key roles in the PC development; hence, provide valuable insights for better understanding the initiation and progression of PC. In the current study, we used DNA methylation, gene expression, copy number, mutational and clinical data from pancreatic patients.
    [Show full text]
  • Expression Pattern of the Class I Homeobox Genes in Ovarian Carcinoma
    J Gynecol Oncol Vol. 21, No. 1:29-37, March 2010 DOI:10.3802/jgo.2010.21.1.29 Original Article Expression pattern of the class I homeobox genes in ovarian carcinoma Jin Hwa Hong1, Jae Kwan Lee1, Joong Jean Park2, Nak Woo Lee1, Kyu Wan Lee1, Jung Yeol Na1 Departments of 1Obstetrics and Gynecology, 2Physiology, Korea University College of Medicine, Seoul, Korea Objective: Although some sporadic reports reveal the link between the homeobox (HOX) genes and ovarian carcinoma, there is no comprehensive analysis of the expression pattern of the class I homeobox genes in ovarian carcinoma that determines the candidate genes involved in ovarian carcinogenesis. Methods: The different patterns of expression of 36 HOX genes were analyzed, including 4 ovarian cancer cell lines and 4 normal ovarian tissues. Using a reverse transcription-polymerase chain reaction (RT-PCR) and quantification analysis, the specific gene that showed a significantly higher expression in ovarian cancer cell lines than in normal ovaries was selected, and western blot analysis was performed adding 7 ovarian cancer tissue specimens. Finally, immunohistochemical and immunocytochemical analyses were performed to compare the pattern of expression of the specific HOX gene between ovarian cancer tissue and normal ovaries. Results: Among 36 genes, 11 genes had a different level of mRNA expression between the cancer cell lines and the normal ovarian tissues. Of the 11 genes, only HOXB4 had a significantly higher level of expression in ovarian cancer cell lines than in normal ovaries (p=0.029). Based on western blot, immunohistochemical, and immunocytochemical analyses, HOXB4 was expressed exclusively in the ovarian cancer cell lines or cancer tissue specimens, but not in the normal ovaries.
    [Show full text]
  • Genetic Mechanisms of Pitx1 Action in Murine Hindlimb Development
    1 Genetic mechanisms of Pitx1 action in murine hindlimb development Stephen Nemec, Division of Experimental Medicine, McGill University, Montreal August 2017 A thesis submitted to McGill University in partial fulfillment of the degree of PhD © Stephen Nemec 2017 2 Table of Contents Contents Page Abstract 4 Acknowledgements 8 Abbreviations 9 Preface – Contribution to knowledge 10 Contribution of authors 11 Introduction 13 Figures 1 and 2: Basics of limb anatomy and development 13 Evolutionary origins of the limb 14 Chick embryology and the early study of the limb 16 Molecular limb development 21 Hox genes – Engines of limb development 25 The genetics of forelimb vs. hindlimb development 30 Pitx1: major regulator of HL-specific pattern 30 Tbx4 and Tbx5 – limb-type-specific Tbox paralogs 35 Tbx4, Tbx5 and developmental anomalies in humans 41 Pitx1 Tbx4 42 Purpose and Aims 45 Pitx1 directly modulates the core limb development 46 program to implement hindlimb identity Contributions 47 Abstract 48 Introduction 49 Results 51 Discussion 60 Materials and Methods 65 Figure Legends 69 Figures 74 Interlude A – From Sox9 to signaling 89 Shh signaling influences the 91 phenotype of Pitx1-/- hindlimbs Contributions 92 Abstract 93 Introduction 94 Results 96 Discussion 98 Materials and Methods 100 Figure Legends 102 Figures 104 Interlude B – Regulatory complexity and developmental constraints 110 3 Table of Contents (continued) Contents Page Regulatory integration of Hox factor action with 111 Tbox factors in limb development Contributions 112 Abstract 113 Introduction 114 Results 116 Discussion 124 Materials and Methods 128 Figure Legends 134 Figures 141 Discussion 152 Evolutionary constraints determine the 152 developmental roles of limb-type-specific genes Future Directions 156 References 159 4 Abstract In tetrapods, the forelimbs (FL) and hindlimbs (HL) emerge from the flank of the developing embryo as buds of mesenchyme sheathed in ectoderm.
    [Show full text]
  • Evidence for a Role of Developmental Genes in the Origin of Obesity and Body Fat Distribution
    Evidence for a role of developmental genes in the origin of obesity and body fat distribution Stephane Gesta*, Matthias Blu¨ her†, Yuji Yamamoto*, Andrew W. Norris*, Janin Berndt†, Susan Kralisch†, Jeremie Boucher*, Choy Lewis*, and C. Ronald Kahn*‡ *Joslin Diabetes Center and Harvard Medical School, Boston, MA 02215; and †Department of Internal Medicine III, University of Leipzig, 04103 Leipzig, Germany Contributed by C. Ronald Kahn, March 9, 2006 Obesity, especially central obesity, is a hereditable trait associated In the present study, we have explored the hypothesis that with a high risk for development of diabetes and metabolic patterns of fat distribution and, perhaps, to some degree, obesity disorders. Combined gene expression analysis of adipocyte- and itself may have a developmental genetic origin. Indeed, we find preadipocyte-containing fractions from intraabdominal and sub- major differences in expression of multiple genes involved in cutaneous adipose tissue of mice revealed coordinated depot- embryonic development and pattern specification between adipo- specific differences in expression of multiple genes involved in cytes taken from intraabdominal and s.c. depots in rodents and embryonic development and pattern specification. These differ- humans. We also demonstrate similar differences in the stromo- ences were intrinsic and persisted during in vitro culture and vascular fraction (SVF)-containing preadipocytes and that these differentiation. Similar depot-specific differences in expression of differences persist in culture. Most importantly, we demonstrate developmental genes were observed in human subcutaneous ver- that some of these developmental genes exhibit changes in expres- sus visceral adipose tissue. Furthermore, in humans, several genes sion that are closely correlated with the level of obesity and the exhibited changes in expression that correlated closely with body pattern of fat distribution.
    [Show full text]