Understanding the Molecular Strategies of Campylobacter Jejuni for Survival in Amoeba and Chicken

University of Arkansas, Fayetteville ScholarWorks@UARK

Theses and Dissertations

1-2019 Understanding the Molecular Strategies of Campylobacter jejuni for Survival in Amoeba and Chicken. Deepti Pranay Samarth University of Arkansas, Fayetteville

Follow this and additional works at: https://scholarworks.uark.edu/etd Part of the Food Microbiology Commons, Food Processing Commons, and the Pathogenic Microbiology Commons

Recommended Citation Samarth, Deepti Pranay, "Understanding the Molecular Strategies of Campylobacter jejuni for Survival in Amoeba and Chicken." (2019). Theses and Dissertations. 3302. https://scholarworks.uark.edu/etd/3302

This Dissertation is brought to you for free and open access by ScholarWorks@UARK. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of ScholarWorks@UARK. For more information, please contact [email protected]. Understanding the Molecular Strategies of Campylobacter jejuni for Survival in Amoeba and Chicken.

A dissertation submitted in partial fulfilment of the requirements for the degree of Doctor of Philosophy in Poultry Science

Deepti Pranay Samarth Guru Ghasidas University Bachelor of Science, 2005 RTM Nagpur University Master of Science in Microbiology, 2007

August 2019 University of Arkansas

This dissertation is approved for recommendation to the Graduate Council.

______Young Min Kwon Ph.D. Dissertation Director

______Steven C. Ricke, Ph.D. Billy M. Hargis, Ph.D. Committee Member Committee Member

______Ravi D. Barabote, Ph.D. Committee Member

Abstract

Campylobacter jejuni endure to be major cause of gastroenteritis in humans worldwide.

C. jejuni is fastidious in laboratory setup but can cause waterborne infection through contaminated water where none of these fastidious conditions are met. This dissertation presents an assortment of studies focused in reviewing three major factors which could present a helping hand to C. jejuni in its environmental survival viz. i) association with free-living amoebae (FLA) ii) horizontal gene transfer (HGT) contributing towards its genetic diversity iii). Viable but non- culturable (VBNC) state.

Acanthamoeba is a FLA linked to environmental survival of many intracellular pathogens, including C. jejuni. In Chapter-2, we studied role of 10 important C. jejuni genes in

C. jejuni-Acanthamoeba interactions. Deletion mutants of these C. jejuni genes were constructed and used in internalization and 24-hrs survival assay with A. castellanii and A. polyphaga. We found that these genes are important in C. jejuni-Acanthamoeba interactions.

C. jejuni benefits in transition in changing ecology by its genetic diversity largely attributed by HGT. In Chapter-3, we presented evidence of extensive HGT through homologous recombination between two C. jejuni marker strains distinguished by their chromosomally encoded antibiotic markers. We found that naked extrachromosomal DNA is an important player in contributing genetic diversity in C. jejuni. Chicken cecal supernatant was found a better recombination medium for HGT for C. jejuni.

In chapter-4, whole-proteome of C. jejuni from C. jejuni-Acanthamoeba interaction was analyzed using differentially expressed proteins. Relative abundance of 404 C. jejuni proteins help us understand that in 3hrs interaction C. jejuni shifts its metabolism towards fumarate in its

intracellular survival in A. castellanii. Results from chapter-2 and 4, indicate that C. jejuni has conserved mechanisms while interacting with both human and amoeba host.

Inability to culture using conventional culture techniques present a major hurdle in studying C. jejuni in its VBNC state. C. jejuni transition from physiologically active to VBNC, whole-proteome comparison between samples collected at time-points between 1day and 30days was made in chapter-5. After clustering analysis by using 575 identified C. jejuni proteins, 7 clusters of proteins were identified which share a similar trend in this transition period.

Dedication

This dissertation is dedicated to My Mother – Mrs. Surekha Ramtekkar.

“Mom, I can never thank enough for your love and support”.

Acknowledgements

This dissertation is possible through the support and encouragement of many people. It is a pleasure for me to acknowledge them before I could finish my degree.

Foremost, I am sincerely thankful to Dr. Young Min Kwon, for being an excellent guide and my constant source of inspiration. I am deeply influenced by his humble nature and truly believe that my experiences in this degree program was enjoyable because I could work with him and his research group. His way of looking at scientific problems have shaped and enhanced my research perspective.

I would like to thank Dr. Tieshan Jiang and all lab mates, especially Yichao Yang, Sardar

Karash, Rabindra Mandal, Turki Dawoud, Bishnu Adhikari and Dr. Nicole Colhoun. I was incredibly fortunate to have the support of such amazing lab mates.

I would like to express gratitude to my dissertation committee. My sincere thanks to Dr.

Steven Ricke for research advice and improving my scientific writing skills. I would like to thank Dr. Billy Hargis for providing me with valuable feedback on my research and to Dr. Ravi

Barabote for constructive scientific advice and insightful comments to improve my experiments.

I am thankful to Department Head, Dr. Michael Kidd, Graduate Coordinator, Dr. John

Marcy and all faculty members of the Department of Poultry Science. I would also like to acknowledge administrative staff, and graduate students of the Department of Poultry Science for their help and support during the course of my degree.

I am also grateful to Dr. Michael Slavik and Dr. Geetha S. Kumar-Phillips for teaching me how to work with C. jejuni which help me to put a strong foundation for most experiments. I appreciated the efforts of Dr. Rohana Liyanage who helped me with the proteomic experiments.

I would like to acknowledge the Department of Poultry Science for graduate assistantship provide 4 years (May 2013-May 2017) and SREB (Southern Regional Education Board) for

Dissertation year fellowship.

Finally, I would like to thank God for blessing me with an incredibly supportive family who motivated me in every disposition of this degree. I owe thanks to my husband, Pranay

Samarth, my son Aditya, my father, Late. Khemraj D. Ramtekkar, my mother, Surekha

Ramtekkar and my siblings for becoming pillars of my strength.

Table of Contents

Chapter 1: Introduction/Literature Review 1

1.1. Taxonomy and history of C. jejuni 2

1.2 Infection, symptoms and sequel of C.jejuni 3

1.3 Physiological characteristics of C. jejuni 5

1.4. Virulent factors of C. jejuni 6

1.5. Natural reservoirs of C. jejuni 7

1.6. Transmission of C. jejuni in poultry flock 8

1.6.1 Horizontal transmission of C. jejuni in poultry flock 8

1.6.2 Vertical transmission of C. jejuni in poultry flock 9

1.7. Role of environmental water in the transmission 10

1.8. VBNC (Viable but non-culturable) forms of C. jejuni 11

1.9. Free living amoeba- C. jejuni interactions 12

1.9.1. FLA and its role in the transmission of pathogens 13

1.9.2. Acanthamoeba - one of the most common FLA studied with C. jejuni 15

1.9.3. C. jejuni interactions with Acanthamoeba 16

1.9.4. Mechanism of C. jejuni and Acanthamoeba interaction 17

1.10. C. jejuni genetic diversity and genome plasticity 19

1.11. Horizontal gene transfer in C. jejuni 20

1.12. Objectives of the dissertation 21

1.13. References 22

Chapter 2: Genetic factors of Campylobacter jejuni required for the interaction with free- living amoebae 35

2.1. Abstract 37

2.2. Introduction 39

2.3. Material and methods 42

2.3.1. Strains and culture conditions 42

2.3.2 DNA manipulation and C. jejuni deletion mutant construction 43

2.3.3. Internalization assay 44

2.3.4. 24-hrs intracellular survival assay 46

2.3.5. Statistical analyses 47

2.4. Results 47

2.4.1. Internalization assay 48

2.3.4. 24-hrs intracellular survival assay 49

2.5. Discussion 50

2.6. References 60

2.7 Tables and figures 69

2.8 Appendix 75

2.8.1. IBC protocol 75

Chapter 3: Horizontal genetic exchange of chromosomally encoded markers between

Campylobacter jejuni cells 76

3.1. Abstract 78

3.2. Introduction 80

3.3. Material and methods 82

3.3.1. Bacterial strains 82

3.3.2. Construction of marker strains of C. jejuni 83

3.3.3. Recombination assay 84

3.3.4. PCR assay to check homologous recombination 85

3.3.5. Extension of incubation time to 24 hrs 85

3.3.6. Comparison of recombination in liquid media and biphasic medium 85

3.3.7. Recombination across strain background barrier 86

3.3.8. Use of CFS to evaluate the HGT in absence of cell-to-cell contact 86

3.3.9. Recombination experiment in the presence of DNase I treatment 86

3.3.10. Detection of released C. jejuni chromosomal DNA in the culture

supernatant 87

3.3.11. Chicken cecal supernatant preparation 87

3.3.12. Recombination in presence of chicken cecal supernatant 88

3.3.13. Statistical analyses 88

3.4. Results 88

3.4.1. Construction of the Marker strains 88

3.4.2. Recombination assay 89

3.4.3. PCR validating homologous recombination 89

3.4.4. Extension of incubation time to 24 hrs 90

3.4.5. Comparison of recombination in liquid media and biphasic medium 90

3.4.6. Recombination across strain background barrier 90

3.4.7. Use of CFS to evaluate HGT in absence of cell-to-cell contact 91

3.4.8. Recombination experiment in the presence of DNase I treatment 91

3.4.9. Detection of released C. jejuni chromosomal DNA in the culture

supernatant 92

3.4.10. Recombination in presence of chicken cecal-supernatant 92

3.5. Discussion 93

3.6. Abbreviation 103

3.7. References 104

3.8 Tables and figures 112

3.9 Appendix 123

3.9.1. IBC protocol 123

3.9.1. IACUC protocol 124

Chapter 4: Proteomic Analysis of Campylobacter jejuni during interaction with Amoeba

Host 125

4.1. Abstract 127

4.2. Introduction 129

4.3. Material and methods 131

4.3.1. Bacterial and amoeba strains and culture methods 131

4.3.2. C. jejuni-A. castellanii co-culture and modified gentamicin protection

assay 132

4.3.3 Sample preparation for proteomics and mass spectrometry analysis 134

4.3.4. HPLC and mass spectrometry 136

4.3.5. Database searching and bioinformatics 137

4.3.6. Statistical analyses 138

4.4. Results and Discussion 138

4.4.1 Modified gentamicin assay 139

4.4.2 Identified C. jejuni proteins using LC-MS/MS 141

4.4.3. Distribution of identified proteins 141

4.4.3.A. GO term classification 141

4.4.3.B. Overlap of identified proteins in protein samples 141

4.4.4. Differentially expressed proteins 142

4.4.5. Proteins regulating respiration 145

4.4.6. Proteins regulating oxidative stress 146

4.4.7. Proteins related to chemotaxis 146

4.4.8. Other proteins 147

4.5. Reference 148

4.6 Tables and figures 153

4.7 Appendix 188

4.7.1. IBC protocol 188

Chapter 5: Proteomic changes in Campylobacter jejuni cells during transition to viable but non-culturable (VBNC) state 189

5.1. Abstract 191

5.2. Introduction 193

5.3. Material and methods 196

5.3.1. Bacterial and amoeba strains and culture methods 196

5.3.2. Preparation of microcosm water 196

5.3.3. Starvation and VBNC cells preparation 196

5.3.4. Culturability of C. jejuni cells 197

5.3.5. Resazurin assay 197

5.3.6. Sample preparation for proteomics and mass spectrometry analysis 198

5.3.7. HPLC and mass spectrometry 200

5.3.8. Database searching and bioinformatics 200

5.3.9. Statistical analyses 201

5.4. Results and Discussion 202

5.4.1. Starvation and VBNC cell preparation 203

5.4.2. Culturability of C. jejuni cells 203

5.4.3. Resazurin assay 204

5.4.4. Identified C. jejuni proteins using LC-MS/MS 204

5.4.5. Distribution of identified proteins 205

5.4.5.A. GO term classification 205

5.4.5.B. Overlap of identified proteins in protein samples 205

5.4.6. Differentially expressed proteins 205

5.4.7. Clustering analysis 206

5.4.7. Clustering proteins by abundance in time-points during starvation 206

5.5. Reference 210

5.6 Tables and figures 215

5.7 Appendix 242

5.7.1. IBC protocol 242

6.0 Conclusion 243

List of Tables

Chapter 2.

Table 1. Oligonucleotides used in this study 72

Chapter 3.

Table 1. Oligonucleotides used in this study 122

Chapter 4.

Table 1.A. Significantly upregulated and downregulated proteins in C. jejuni-A. castellanii after 20 mins (CA-20mins-NGNT) as compared to control sample 153

Table 1.B. Significantly upregulated and downregulated proteins in C. jejuni-A. castellanii after 3 hrs (CA- 3hrs-NGNT) as compared to control sample 155

Table 1.C. Significantly upregulated and downregulated proteins in C. jejuni-A. castellanii after 3 hrs and gentamicin treatment (CA-3hrs-GNT) as compared to control sample 156

Table 1.D. Significantly upregulated and downregulated proteins in C. jejuni-A. castellanii after 3 hrs and gentamicin treatment (CA-3hrs-GT) as compared to control sample 162

Table 2.A. Classification of molecular function (Gene Ontology term) of all the downregulated proteins in CA-20mins-NTNG sample in comparison to that of the control sample 164

Table 2.B. Classification of biological processes (Gene Ontology term) of all the downregulated proteins in CA-20mins-NTNG sample in comparison to that of the control sample 165 Table 3.A. Classification of molecular function (Gene Ontology term) of all the downregulated proteins in CA-3hrs-NTNG sample in comparison to that of the control sample 167

Table 3.B. Classification of biological processes (Gene Ontology term) of all the downregulated proteins in CA-3hrs-NTNG sample in comparison to that of the control sample 169

Table 4.A. Biological function (GO terms) for downregulated proteins in CA-3hrs-GT as compared to the control sample 169

Chapter 5

Table 1 Proteins in different cluster obtained by clustering analysis. Proteins are expressed as the alternate ID (Gene locus ID) 215

List of Figures

Chapter 2.

Figure 1. Internalization and intracellular survival (%) of the deletion mutants of Campylobacter jejuni of the genes responsible for adhesion and chemotaxis as compared to wildtype in A. castellanii and A. polyphaga 69

Figure 2. Internalization and intracellular survival (%) of the deletion mutants of Campylobacter jejuni of the genes responsible for invasion and sialyation of lipooligosaccaride as compared to Wildtype in A. castellanii and A. polyphaga 70

Figure 3. Internalization and intracellular survival (%) of the deletion mutants of Campylobacter jejuni of the genes responsible for motility and oxidative stress response as compared to Wildtype in A. castellanii and A. polyphaga 71

Chapter 3.

Figure 1. Diagram showing the method used to perform the recombination assay 112

Figure 2. Diagram showing possible homologous recombination that takes place between the two marker strains 113

Figure 3. Location of primers used to amplify the insertion junction where antibiotic markers are inserted. 113

Figure 4. Gel picture showing the result of colony PCR of 10 recombinant colonies picked from MH agar plate with kanamycin and chloramphenicol 114

Figure 5. Comparison of the recombinant levels as expressed in percentage recombinants in the total number of parent cells between incubation for 5 hrs (control) vs. 24 hrs 115

Figure 6. Comparison of the recombinant levels as expressed in percentage recombinants in the total number of parent cells between biphasic medium vs. liquid medium 116

Figure 7. Comparison of the recombinant levels as expressed in percentage recombinants in the total number of parent cells when the different combination of the marker strains in two different strain backgrounds (11168 and 81-176) were used 117

Figure 8. Comparison of the recombinant levels as expressed in percentage recombinants in the total number of parent between the standard recombination assay and the modified assay in which the cell-free supernatant was used to replace one of the marker strains (KmR or CmR) 118

Figure 9. Comparison of the recombinant levels as expressed in percentage recombinants in the total number of parent cells when the recombination assay was performed without (control) and with the addition of DNAse I (DNase I) to eliminate extracellular DNA from the medium 119

Figure 11. Comparison of the recombinant levels as expressed in percentage recombinants in the total number of parent cells when the recombination assay was performed in the presence of varying concentrations of chicken cecal contents: control (0%) and treatments (1 to 100%) 121

Chapter 4

Figure 1.A Protein sample processing for LC-MS/MS 170

Figure 1.B. Flowchart of C. jejuni-A. castellanii sample processing for proteomic analysis 171

Figure 2.A-Figure 2.C. Functional annotation of C. jejuni proteins identified in the study. All the identified proteins from three replicates of the experiment were categorized using Gene oncology consortium (GO) using Scaffold software and the proteins were classified according to biological process (A), molecular function (B), and cellular component (C) 172-174 Figure 3 Venn diagrams showing the distribution of identified C. jejuni proteins in comparison to control (Sample containing only C. jejuni cells and no A. castellanii cells) 175

Figure 4 Venn diagrams showing the distribution of identified C. jejuni proteins in different protein samples of MGPA assay with 3hrs interaction time (CA-3hrs-NGNT, CA-3hrs-GNT, CA-3hrs-GT) 176

Figure 5 Venn diagrams showing the distribution of identified C. jejuni proteins in control and MGPA assay protein samples at different interaction time (CA-20mins-NGNT, CA-3hrs-NGNT) 177

Figure 6.A. Volcano plots were generated after comparing identified C. jejuni proteins between the control sample and samples CA-20mins-NGNT 178

Figure 6.B. Volcano plots were generated after comparing identified C. jejuni proteins between the control sample and CA-3hrs-NGNT 179

Figure 6.C. Volcano plots were generated after comparing identified C. jejuni proteins between the control sample and CA-3hrs-GNT 180

Figure 6.D. Volcano plots were generated after comparing identified C. jejuni proteins between the control sample and CA-3hrs-GNT 181

Figure 7 Protein association network in STRING analysis showing significantly downregulated proteins CA-20mins-NGNT (A), CA-3hrs-NGNT (B) and CA-3hrs-GT (C) compared to control sample. Description of the Protein alternate IDs and related functions shown in the protein association network are mentioned in Table 3 A, B and C respectively 182-184

Figure 8 Protein association network in STRING analysis showing significantly upregulated proteins CA- 3hrs-GNT, and compared to control sample. Description of the Protein alternate IDs and related functions shown in the protein association network are mentioned in Table 3 C 185

Figure 9 Volcano plot showing differentially expressed C. jejuni proteins between samples CA-3hrs-GNT and CA-3hrs-GT. Proteins with statistically significant differential expression (≥1.3-fold, P < 0.05) labelled in green color and located in the top right and left quadrants 186

Figure 10 Fumarate reductase (FrdA) abundance (expressed as spectral counts) in different samples obtained after LC-MS/MS data analysis. The bars with different letters are significantly different at P < 0.05 187

Chapter 5

Figure 1.A Experimental design 221

Figure1. B Protein sample processing for LC-MS/MS 222

Figure 1.C. Flowchart of proteomic data analysis 223

Figure 2. Results of resazurin assay 224

Figure 3.A-Figure 3.C. Functional annotation of C. jejuni proteins identified in the study. All the identified proteins from three replicates of the experiment were categorized using Gene oncology consortium (GO) using Scaffold software and the proteins were classified according to biological process (A), molecular function (B), and cellular component (C) 225-227

Figure 4. Venn diagrams showing the distribution of identified C. jejuni proteins from different samples in comparison to control 228

Figure 5.A.-Figure 5.E. Volcano plots were generated after comparing identified C. jejuni proteins between the control and other samples 229-233

Figure 6. Clustering analysis 234

Figure 7 Protein association network after STRING analysis showing protein association in different clusters. Description of the Protein alternate IDs shown in the protein association network are mentioned in Table 3 235-244

List of Publications (Under Review)

1. Samarth, D. P., Kwon, Y. M. Horizontal genetic exchange of chromosomally encoded markers between Campylobacter jejuni cells. Frontiers in Microbiology (Chapter 3).

List of Publications (In Preparation)

1. Samarth, D. P., Kwon, Y. M. Genetic factors of Campylobacter jejuni required for the interaction with free-living amoebae. Applied and Environmental Microbiology (Chapter 2). 2. Samarth, D. P., Liyanage, R., Lay, J. O., Kwon, Y. M. Proteomic Analysis of Campylobacter jejuni during interaction with Amoeba Host. Molecular and Cellular Proteomics (Chapter 4). 3. Samarth, D. P., Liyanage, R., Lay, J. O., Kwon, Y. M. Proteomic changes in Campylobacter jejuni cells during the transition to viable but non-culturable (VBNC) state. Gut Pathogens (Chapter 5).

Chapter 1

Introduction/Literature Review

Campylobacter jejuni is a major cause of bacterial gastroenteritis in developed and developing countries, responsible for 400 million to 500 million cases of diarrhea each year

(Ruiz-Palacios 2007). In the United States, an estimated 2 million cases of campylobacteriosis occur every year costing $2.9 billion (Ruiz-Palacios 2007, Bolton 2015). C. jejuni resides commensally in the intestinal tract of many warm-blooded animals, as well as is ubiquitous in the environment (Horrocks et al. 2009). Members of genera Campylobacter are Gram-negative, a microaerophilic bacterium from the taxonomical order Epsilonproteobacteria. The thermotolerant species of Campylobacter are the most common in human clinical cases where the majority (over 90%) of these cases are caused by C. jejuni (Bolton 2015). Although C. jejuni infections in humans can originate from multiple reservoirs (the gastrointestinal tracts of domestic, feral and wild animals), most cases of campylobacteriosis are often associated with infected poultry carcasses (Bolton 2015). Human campylobacteriosis is often a self-limiting acute watery or bloody diarrhea with abdominal cramps, sometimes followed by severe post- infection complications. C. jejuni infections are one of the major common antecedents of

Guillain-Barré syndrome (GBS) and Miller Fisher syndrome (MFS) (Nachamkin, Allos and Ho

1998, Halpin et al. 2018, Allos 1997), which are aberrant autoimmune response targeting peripheral nerves due to molecular mimicry between C. jejuni liposaccharide and nerve cells

(Ang et al. 2001, Allos 1997).

1.1. Taxonomy and History of C. jejuni

Campylobacter was first described by Theodor Escherich (1886) as a nonculturable spiral form bacteria. In its early research, Campylobacter cells were misidentified as Vibrio cells and mostly isolated from veterinary samples. In 1906, McFadyean and Stockman isolated spiral-

shaped organisms from aborting ewes during their investigation of epizootic abortions in animals in the United Kingdom (Solomon and Hoover 1999). In 1962 Elisabeth King observed the strains of Vibrio, which she termed as “related Vibrios”, and were later renamed as C. jejuni and C. coli causing diarrhea in humans (Stern and Kazmi 1989). Prior to 1977, many scientists attempted to isolate Campylobacter using different techniques, but the breakthrough in C. jejuni research was marked with the development of selective media by Dekeyser et al. in 1972, which enabled isolation of Campylobacter from stool samples. Skirrow (1977) used this method to isolate C. jejuni from the blood of 1-month-old baby suffering from febrile diarrhea and concluded that it was also a cause of human gastroenteritis. This was a crucial landmark in the history of C. jejuni research as this led to the foundation for many subsequent studies of this pathogen.

In 1963, Sebald and Veron moved V. fetus and V. bubulus into a new genus and named the genus “Campylobacter”(Nachamkin, Szymanski and Blaser 2008). The genus

Campylobacter belongs to class Epsilonproteobacteria and to the family of

Campylobacteriaceae. Veron and Chalelain (1973) published a comprehensive study on the taxonomy of genus Campylobacter where 4 species were described viz. C. jejuni, C.fetus, C. coli, and C. sputorum. As a result of improved taxonomy methods, particularly genotypic methods, the genus Campylobacter presently has 25 species and 9 subspecies (Zautner and

Masanta 2016). Although new species of Campylobacter have been recently discovered, human cases of campylobacterosis are dominated by C. jejuni followed by C. coli (Tresse, Alvarez-

Ordóñez and Connerton 2017, Butzler 2004).

1.2. Infection, symptom and sequel of C. jejuni

C. jejuni predominantly causes a self-limiting diarrheal illness in humans (Butzler, De

Mol and Mandal 2018). The clinical spectrum of Campylobacter enteritis ranges from a watery,

non-bloody, non-inflammatory diarrhea to severe inflammatory diarrhea with abdominal pain and fever. C. jejuni adheres to the epithelial cells in the stomach and the mucus layer of the intestines and proliferates (Janssen et al. 2008). A dose as low as 500 organisms can infect, colonize and produce disease symptoms in humans and typically need an incubation period of 2 to11 days (Skirrow 1982). Antibiotic therapy is recommended in cases of severe infections and in immunocompromised people (Nachamkin et al. 2008).

It has been reported that C. jejuni may sometimes result in post infection neurologic complications such as Guillian Barré syndrome and reactive arthritis (Nachamkin et al. 1998,

Ajene, Walker and Black 2013). Guillain-Barré syndrome (GBS) is an autoimmune disorder, affecting the peripheral neurons, causing flaccid paralysis (Nachamkin et al. 1998). The evidence that C. jejuni is the most important trigger of GBS that came from 3 sources viz. anecdotal reports, serologic studies, and culture data (Allos 1997). Approximately 20% of Guillain-Barré syndrome patients remain severely disabled and approximately 5% die despite immunotherapy

(Ang et al. 2001). C. jejuni infections are also often associated with Miller Fisher syndrome, a rare variant of Guillain-Barré syndrome, which is characterized by ataxia, loss of tendon reflexes

(areflexia), ophthalmoplegia, and presence of anti GQ1b antibodies in serum (Ang et al. 2001,

Willison and O'Hanlon 1999). C. jejuni infections are thought to induce anti-ganglioside antibodies in patients with Guillain-Barré syndrome (GBS) and Miller Fisher syndrome (MFS) by molecular mimicry between C. jejuni lipopolysaccharides (LPS) and gangliosides (Ang et al.

2001). C. jejuni infections have also been reported as a cause of reactive arthritis as post- infection sequelae (Pope et al. 2007). Reactive arthritis is one of the spondyloarthropathies and is known to be triggered by bacteria including Salmonella, Shigella, Yersinia and Campylobacter spp. (Van de Putte et al. 1980). In addition, there are rare cases of meningitis reported post-

infection by C. jejuni (Ajene et al. 2013, Tsoni et al. 2012). Studies to gain insights into the pathogenesis of post-infection complications C. jejuni infection are gaining considerable momentum, but many aspects are still unanswered, requiring further investigations.

1.3. Physiological characteristics of C. jejuni

C. jejuni, a Gram-negative bacterium, is motile and have corkscrew-shaped rod type morphology, ranging from 0.5 to 5 microns in length and 0.2 to 0.9 microns in width (Fischer and Paterek 2019). They grow well at 37°C but optimal growth is observed at 42°C. It is a microaerophile and requires microaerophilic conditions, with an atmosphere containing 5% oxygen, 10% carbon dioxide and nitrogen (remaining balance) (Stern and Kazmi 1989). They are obligate microaerobe and are believed to be sensitive to environmental stressors, including changes in pH, temperature and exposure to high oxygen concentration (Park 2002, Butzler

2004). Contrary to the fastidious nature of the organism in the laboratory, C. jejuni can survive in water, as well as in a wide range of reservoir. Poultry, cattle and swine are primary reservoir but are isolated from numerous other animals. The major sources of campylobacteriosis are contaminated poultry and meat, unpasteurized dairy products and drinking water (Ziprin and

Harvey 2004). It is proposed that C. jejuni can resist environmental stressors and survive as a viable but non-culturable form (VBNC) (Patrone et al. 2013a, Baffone et al. 2006, Tholozan et al. 1999, Rollins and Colwell 1986). The VBNC state refers to the ability of bacterial cells to remain viable by retaining basal metabolic activities, but unable to grow in laboratory culture media. In this stage, C. jejuni cells undergo both morphological and physiological changes in response to changing environmental conditions. The role of VBNC stage of C. jejuni in disease transmission is debatable by the scientific community. We will cover this topic in more detail in section 7.

1.4. Virulent factors

Except for a cytolethal distending toxin (CDT) and homologs of a type-IV secretion system on the pVir plasmid of strain 81–176, C. jejuni lacks most of the classical virulence factors present in other gastrointestinal pathogens. Therefore, it has been suggested that motility and metabolic capabilities of C. jejuni are important for virulence and colonization of the host, which is attributed by flagella composed by two major flagellin proteins (FlaA, FlaB) and a hook. The hook is composed of many proteins encoded by motility complex genes (fliF, fliY, fliM, fliA, fliK, flgI, flgE, flgH, motA, motB) (Bolton, 2015). Flagella is considered as one of the most important virulence factors of C. jejuni (Svensson, Pryjma and Gaynor 2014, Nachamkin,

Yang and Stern 1993). A functional flagellum is essential for chemotaxis, adhesion and invasion during human infection (Wassenaar and Blaser 1999). Flagella is also responsible for the export of proteins outside the cell using an export system. Some important proteins are transported out of C. jejuni cells and are responsible for invasion, which includes CiaB, CiaC, VirB proteins encoded from pVir plasmid of strain 81–176 (Bacon et al. 2000). Almost all strains of C. jejuni and C. coli possess CDT genes and secrete cytolethal distending toxin, which may cause cytotoxicity by cell cycle arrest (Johnson and Lior 1988, Dasti et al. 2010).

Other virulence factors are lipooligosaccharide (LOS) (Louwen et al. 2008, Guerry et al.

2002), adhesion proteins which are contributed by outer membrane proteins (such as like CadF,

JlpA , Peb proteins) (Patrone et al. 2013b, Bolton 2015), polysaccharide capsule (Bacon et al.

2001, Maue et al. 2013), Periplasmic or membrane-associated protein (PEB1)(Cróinín and

Backert 2012, Hermans et al. 2011) and chemotaxic proteins like Che proteins (CheA, CheB,

CheR, CheV, CheW, CheZ) (Yao, Burr and Guerry 1997, Hermans et al. 2011).

1.5. Natural reservoirs of C. jejuni

Different species of C. jejuni resides commensally in the intestinal tract of many warm- blooded animals, as well as being ubiquitous in the environment as they have been detected from the farm, slaughter houses and urban environment including drinking water (Horrocks et al.

2009). Contaminated chicken carcass and poultry are the major sources of C. jejuni infection

(Hermans et al. 2011, Sahin, Kobalka and Zhang 2003, Corry and Atabay 2001). Broiler chickens are asymptomatic carriers of C. jejuni and often carry C. jejuni in the intestine. During processing, C. jejuni ends up becoming contaminants on the chicken carcass, which in turn serves as major causes of campylobacteriosis in humans (Horrocks et al. 2009). Preventing the transmission of C. jejuni within the chicken flock can downsize contamination in retail chicken products and ultimately reduce clinical cases of human campylobacteriosis. C. jejuni mainly resides in the large intestine, ceca and cloaca in colonized chickens as a member of the dominant microbiota (Corry and Atabay 2001), but also can colonize the crop, other parts of gastrointestinal parts and muscles. The warm body temperature (42oC) of chickens is optimal for growth of thermophilic Campylobacter spp., resulting in considerable Campylobacter cell number in the chicken gut upon infection. After colonization in the chicken gut, C. jejuni remains at high numbers, often in the range of 105 to 107 CFU per gram of cecal content (Newell

2002). The increased temperature may allow thermophilic species to regulate gene expression that benefits motility and energy regulation based on specific growth requirement (Horrocks et al. 2009).

1.6. Transmission of C. jejuni in poultry flock

Two major routes of C. jejuni infection in the chicken flock are horizontal transmission from environmental sources and vertical transmission from the breeder chicken (Cox et al. 2002,

Horrocks et al. 2009).

1.6.1. Horizontal transmission of C. jejuni in poultry flock

Horizontal transmission of C. jejuni in poultry flock from neighbouring birds and other environmental sources is a major concern for the poultry industry. In a commercial setting, C. jejuni infection is rarely detected in broiler chickens less than 2 to 3 weeks, although newly hatched chicks can be experimentally infected with C. jejuni (Sahin, Morishita and Zhang 2002).

Cawthraw et.al (1996) found that when one-day-old chicks were challenged with as low as 40

CFU of C. jejuni strain 81116 the C. jejuni was recovered from cecum as high as 108 to 109

CFU/g contents after 5 days of infection. Once some chickens becomes infected with C. jejuni in chicken houses, the infection spreads rapidly to most of the other birds in the flock. There are many factors that could initiate and facilitate the transmission of C. jejuni to the chicken flocks.

Environmental means of transmission can be aerosols (Zhao et al. 2011), contaminated water

(Bronowski, James and Winstanley 2014), feed (Newell and Fearnley 2003), fecal contact, and other vectors such as insects, small mammals, other livestock (Doyle and Erickson 2006), wild birds (Craven et al. 2000) and farm personnel (Adkin et al. 2006). Transportation, slaughtering, washing, dressing, packing and storage are some common ways through which healthy bird and

C. jejuni negative carcass can easily become contaminated by C. jejuni positive carcasses

(Ridley et al. 2011). Moreover, proper cooking and hygiene practices in the kitchen and restaurants are essential to prevent outbreaks. Adkin et al. (2006) after reviewing the published

literature from 159 relevant research papers catalogued 14 sources of on-farm contaminant and

37 contributing factors in C. jejuni infection and horizontal transmission in chicken houses.

1.6.2. Vertical transmission of C. jejuni in poultry flock

Many researchers support that the major cause of the spread of C. jejuni in chickens in the flock is the horizontal transmission. However, there are few reports suggesting vertical transmission of C. jejuni from the parent flock although it is much debatable (Newell and

Fearnley 2003). Sahin (2002) suggested that vertical transmission is unlikely a major phenomenon for C. jejuni transmission due to following reasons: First, most chickens remain uninfected by C. jejuni up to 2-3 weeks even though chicks are hatched from infected parent flocks. Second, the C. jejuni strains infecting chicken flocks are different from those frequently infecting breeder flock. Many researchers were not successful in their attempts to detect C. jejuni colonization through vertical transmission in newly hacked chicks which supports the hypothesis that vertical transmission is not a major role in C. jejuni transmission (Callicott et al.

2006, Corry and Atabay 2001, Fonseca et al. 2006, Sahin et al. 2003, Shreeve et al. 2002).

However, some reports proposed that pathogen transmission through eggs from one generation to the next is possible at least circumstantially (Cox et al. 2002). Campylobacter spp are isolated from the oviduct and other parts of the chicken reproductive system. Genotyping results show some of them are identical to those of faeces (Buhr et al. 2002, Camarda et al. 2000). Clark and

Bueschkens (1985) inoculated fertile chicken eggs with C. jejuni and found that 11% of the resulting chicks had the same C. jejuni strain that was used for inoculation in their intestinal tracts at hatch. Allen and Griffiths (2001) found that 4% of eggs of those immersed in C. jejuni suspension were infected. Also, Newell and Fearnley (2003) have discussed in detail that vertical transmission is unlikely but possible.

1.7. Role of environmental water in the transmission

One of the potential sources of transmission is drinking water in chicken houses

(Pitkänen 2013, Bronowski et al. 2014). Also, there are a number of infections and sporadic outbreaks of campylobacteriosis associated with water sources (Cools et al. 2003, Duke et al.

1996, Palmer et al. 1983, Mughini-Gras et al. 2016). Untreated water is known to be a source of

C. jejuni infection for over a decade (Thomas et al. 1998). Also, recreation and public water supply sources are often associated with these outbreaks (Kuusi et al. 2005). The survival of C. jejuni in water is also considered to contribute to cross-contamination in the chicken flock and also related products in poultry facility (Newell and Fearnley 2003). The role of water in C. jejuni transmission might have been underestimated and our understanding of the potential role of water as a source of C. jejuni infection is currently limited. Nilsson et al. (2018) concluded that it is quite evident from different reports that C. jejuni can survive in environmental water sources but expressed the need to study different factors that may contribute towards its environmental survival.

Contaminated environmental water sources can influence C. jejuni epidemiology critically by both directly transmitting C. jejuni to humans as well as indirectly by transmitting

C. jejuni to chicken, which in return is transmitted to humans. Therefore, it is important to study different factors that could affect C. jejuni survival in environmental water sources. Important among them are the potential role of VBNC (viable but non-culturable) forms of Campylobacter in transmission and the presence of free-living amoeba as a potential environmental reservoir.

The potential role of VBNC and free-living amoeba has received much attention in recent years to understand environmental survival and transmission of C. jejuni, and we will put the focus on these topics in this review.

1.8. VBNC (Viable but non-culturable) forms of C. jejuni

Despite its fastidious nature and sensitivity to environmental stress, C. jejuni can thrive in a hostile poultry production environment (Cokal et al. 2011, Jang et al. 2007). It is well documented that with exposure to any adverse condition Campylobacter spp. (including C. jejuni) cells enter into VBNC form but are thought to still be capable of causing infection (Cools et al. 2003). VBNC cells are characterized by a loss of ability to be cultured by conventional culture methods, which impairs their detection by plate enumeration techniques (Li et al. 2014).

C. jejuni cells alter from a characteristic spiral shape in the exponential phase to a coccoid shape in the VBNC state (Li et al. 2014). Some authors have described the possibility of recovering

VBNC cells of C. jejuni by animal passage (Jones, Sutcliffe and Curry 1991, Stern et al. 1994,

Saha, Saha and Sanyal 1991). Some other investigators were unable to recover VBNC C. jejuni cells after animal passage and interpreted VBNC as a transitory stage in the degeneration of Campylobacter population in the aquatic environments (Thomas, Hill and Mabey 2002), although this hypothesis is not accepted universally. Many researchers have speculated that

VBNC forms may have no significant role in the environmental transmission of C. jejuni

(Beumer, De Vries and Rombouts 1992, Mederma et al. 1992, Van de Giessen et al. 1996).

Lázaro et al. (1999) found the C. jejuni cells which were maintained in phosphate-buffered saline at 4°C have cellular integrity and respiratory activity up to 7 months, which indicates the viability of cells but were not culturable. Also, Lázaro et al. (1999) have described intact DNA content after 116 days. Interestingly, the ability to enter the VBNC state varies between strains of

C. jejuni (Mederma et al. 1992, Lázaro et al. 1999, Tholozan et al. 1999, Cools et al. 2003), which supports the association of some strains of C. jejuni with environmental sources.

VBNC forms demonstrate reduced intracellular ATP levels, cellular leakage and an inability to adapt cytoplasmic membranes to temperature fluctuation. At the same time, due to their reduced metabolic rate and better peptidoglycan cross-linking which strengthen cells,

VBNC cells are more tolerant to physical and chemical stresses than culturable cells. (Li et al.

2014, He and Chen 2010, Reilly, Alonso and Gillil 2004). During the VBNC state, gene expression can be detected for extended periods of time (Patrone et al. 2013b). In the process of coccoid cell formation, it has been also observed that cells undergo membrane blebs and budded forms, and de novo protein synthesis is inhibited. However, there were no detectable changes in the protein components of the inner and outer cell membranes (He and Chen 2010).

Moreover, C. jejuni in the VBNC state can adhere to chicken carcasses (Jang et al. 2007) as well as intestinal cells in vivo (Patrone et al. 2013b). Despite the presence of flagella, coccoid forms are non-motile; it has been suggested that the cells simply do not have the energy to maintain motility (Moore, Caldwell and Millar 2001, Moran and Upton 1986). The embryonated chicken egg can resuscitate the most species of VBNC cells, including C. jejuni (Cappelier et al.

1999) and C. coli (Chaveerach et al. 2003). However, the possibility cannot be overruled that

VBNC may also in some fashion to contribute the transmission of C. jejuni in farms and processing units as in this state it can adhere to the host cells (Patrone et al. 2013b).

1.9. Free Living Amoeba- C. jejuni interactions

Many protozoan vectors, mainly Free Living Amoeba (FLA), have a capability of harboring microorganisms inside their cells. Particularly, FLA are ubiquitously found in the drinking water supply as well as other environmental sources of water and feed on the microorganisms present in the aquatic environment (Khan 2006, Rodríguez-Zaragoza 1994,

Siddiqui and Khan 2012). Because most groups of FLA are non-pathogenic to humans with

some exception, there are few efforts to remove them during water treatment and they often escape physical filtration due to their flexible morphology (Thomas et al. 2010). FLA graze on bacteria and other smaller living creatures as their food, but some microorganisms have evolved to resist protozoan grazing, survive and replicate in FLA cell (Matz and Kjelleberg 2005, Huws,

McBain and Gilbert 2005). This area has attracted the attention of many researchers in recent times.

1.9.1. FLA and its role in the transmission of pathogens

FLA are ubiquitous in the environment including the settings related to the food industry and have been detected in poultry drinking water systems (Snelling et al. 2005) and meat cutting environments (Vaerewijck et al. 2008). However, the diversity of FLA in food processing environments have not been studied much. Food safety inspections in chicken carcass processing and packaging industries are performed related to microbial analysis such as total aerobic bacteria and foodborne pathogenic bacteria. Protozoa are considered relatively innocuous and therefore not included in microbial monitoring.

FLA have been considered as a reservoir and potential environmental host for many microorganisms including bacteria and viruses (Brown and Barker 1999). They play a vital role in the transmission of many infectious diseases. Some of the examples of microorganisms to which protozoans provide approachable niches in hostile environmental conditions are

Enterobacter aerogens, Aeromonas hydrophilia, Vibrio cholera, Adenovirus , Salmonella

Typhimurium, Mycobacterium avium, Chlamydia pneumonia, Legionella pneumophila and

Burkholderia cepacia within Acanthamoeba spp. (Marolda et al. 1999, Molmeret et al. 2005,

Casson et al. 2006, Akya, Pointon and Thomas 2010, Salah and Drancourt 2010, Yousuf,

Siddiqui and Khan 2013). Noteworthy, bacteria inside protozoan are well protected against

disinfectants (Vieira, Seddon and Karlyshev 2015), antimicrobials (Miltner and Bermudez 2000) and other perilous situations (Bui et al. 2012a, Bui et al. 2012b, Steinert et al. 1997) and thus can dynamically facilitate bacterial survival and dispersal in respective hosts (Winiecka-Krusnell et al. 2002). FLA are well adapted to hostile environments that can occur during chlorination, exposure to dissolved disinfectant and variation in water temperature. Vaerewijck (2014) suggested that interaction of foodborne pathogens with the free-living protozoans could be a potential setback for food safety.

FLA feed on microorganisms including bacteria (Axelsson-Olsson et al. 2005). However, several bacteria have developed mechanisms to survive against phagocytosis by free-living amoebae and are able to exploit them as hosts (Molmeret et al. 2005). FLA can be widely found in environmental matrices such as soil and water and can harbor numerous bacteria (Bui et al.

2012a). Some microorganisms have evolved to become resistant to these protists (Greub and

Raoult 2004). Few of more characterized examples are Cryptococcus neoformans (Chrisman,

Alvarez and Casadevall 2010), Legionella spp. (Bozue and Johnson 1996), Mycobacterium avium (Salah and Drancourt 2010), Pseudomonas aeruginosa (Abd et al. 2008).

Matz and Kjelleberg (2005) discussed how bacteria can adapt in different ways to escape killing by FLA. Briefly, these adaptations can be either before ingestion (pre-ingestional or extracellular) or afterwards inside the food vacuole (post-ingestion or intracellular). Motility and bulky morphology, surface masking, antimicrobial chemical production and biofilms include pre-ingestion strategies through which bacteria prevent themselves from amoeba scavenging

(Matz and Jürgens 2005, Matz and Kjelleberg 2005, Huws et al. 2005). After ingestion, microorganisms have to deal with different challenges in order to survive from being digested.

Intracellular strategies include survival in vacuoles; toxin and secondary metabolite production

are few of them (Molmeret et al. 2005, Casadevall 2008). Greub and Raoult (2004) discussed microorganisms that were resistant to amoeba and divided them into two categories 1. Obligate endobionts, 2. Those that use amoeba as a secondary host or a carrier. The microorganisms using amoeba as a secondary host may have a relationship ranging from pathogenic to symbiotic.

Bacteria enter the protozoan cell via phagocytosis, which may or may not be receptor-mediated

(Vaerewijck et al. 2014).

Some microorganism can resist protist grazing. One of the most common tactics is via simple avoidance of digestion. Fate of amoebae resistant bacteria may differ. The non-digestive vacuole is a potential shelter from lytic enzymes and chemicals possessed by the amoeba. L. monocytogenes harbored inside both vacuoles and mostly acidic vacuoles, whereas S. aureus and

Burkholderia cepacia tend to survive in acidic vacuoles (Molmeret et al. 2005, Huws et al. 2008,

Lamothe, Thyssen and Valvano 2004). L. pnemoniae and Mycobacterium avium escape the phagosome leading to the lysosome (Cirillo et al. 1997, Bozue and Johnson 1996). Intracellular replication of L. pneumophila within mammalian and protozoan cells has been shown to occur in a ribosome-studded phagosome that does not fuse to lysosomes (Kwaik et al. 1998).

1.9.2. Acanthamoeba - one of the most common FLA studied with C. jejuni

Acanthamoeba is a genus of amoebae that includes free-living protozoan pathogens commonly found in soil and water and characterized by spine-like structures on their surface, known as acanthopodia (Vieira et al. 2015). Approximately 20% of isolates of ubiquitous

Acanthamoeba spp. recovered from clinical and environmental sources were found to harbor bacterial endosymbionts (Fritsche et al. 1993). Most members of this genus are non-pathogenic to human with a few exceptions (Lorenzo-Morales, Khan and Walochnik 2015). Also, many of them including A. casetallanii and A. polyphaga are comparatively easier to culture due to their

axenic nature. Being axenic implies a method of culture where FLA can be cultured without bacterial cells that are otherwise provided as food to the amoeba cells (typically used as food for protozoan cell in xenic method of culture) (Koptina et al. 2015, Khan 2009). This aspect eliminates the complications that are caused by the consumption of the bacteria under the study for bacteria-FLA interaction as food, which makes it easy to interpret the experimental data. This is one of the reasons why Acanthamoeba spp. are used frequently to study FLA-endobionts relationship.

1.9.3. C. jejuni interactions with Acanthamoeba

C. jejuni can survive and be transmitted through contaminated water (Newell and

Fearnley 2003). C. jejuni is a fastidious bacteria which require a strict microaerophilic condition

(facultative anaerobe) and a temperature range of 30-45 °C for its normal physiological state

(Nilsson et al. 2018). However, C. jejuni has been isolated from environmental water sources where neither the atmosphere nor the temperature has been optimal (Pitkänen 2013, Nilsson et al.

2018). Some studies have shown that C. jejuni-FLA interactions could increase the persistence of

C. jejuni in environmental water sources. Broilers were only colonized with C. jejuni if FLA was also present in their drinking water. It has been also suggested that there is a C. jejuni-amoeba interaction that facilitates C. jejuni horizontal transmission in the chicken flock (Snelling et al.

2005, Axelsson-Olsson et al. 2005, Axelsson-Olsson et al. 2010a, Snelling et al. 2008,

Bronowski et al. 2014). C. jejuni has been shown to colonize protozoa and survive longer than its planktonic counterpart in a protozoan host (Cokal et al. 2011). C. jejuni was reported to adhere to

Acanthamoeba cell membrane when co-cultured with Acanthamoeba castellanii and

A.polyphaga (Axelsson-Olsson et al. 2005, Baré et al. 2010). During in vitro assays, which involved co-culturing Campylobacter and Acanthamoeba castellanii, it was observed C. jejuni

remained culturable for significantly longer period of time (up to 36 hours) as compared to the pure culture with FLA (Snelling et al. 2008). Internalized Campylobacter cells were also significantly more resistant to chlorine and iodine-based industrial disinfectant (King et al. 1988,

Axelsson-Olsson et al. 2010b, Axelsson-Olsson et al. 2010a).

1.9.4. Mechanism of C. jejuni-amoeba interaction

Elucidating the genetic mechanisms behind adhesion and invasion of C. jejuni to protozoan cells could be instructive on how to develop control strategies for limiting transmission of C. jejuni in chicken houses as well as industrial and clinical settings. To date, few studies have focused on the interactions of C. jejuni and protozoans, and the molecular aspects of the interactions have remained largely unexplored (Axelsson-Olsson et al. 2010a,

Vieira et al. 2015). However, interactions of C. jejuni with macrophage and epithelial cells have been studied, which may provide valuable insights on C. jejuni adhesion and the subsequent invasion to amoeba. Some studies have shown that that there is a significant overlap in molecular factors of bacteria required for their interactions with mammalian cells and with amoeba, including Staphylococcus aureus (Cardas, Khan and Alsam 2012) and Legionella pneumophila (Segal and Shuman 1999, Kim et al. 2009, Al-Khodor et al. 2009).

FLA share similar features with macrophage and epithelial cells in many aspects: (1) all three are eukaryotic cells, (2) C. jejuni can survive intracellularly within all of them by using similar mechanisms (Matz and Kjelleberg 2005). Watson and Galán (2008) found that C. jejuni survived in the eukaryotic intestinal cells by residing in vacuoles which avoid delivery to the lysosome, allowing the pathogen to survive and multiply in intestinal cells. Olofsson et al. (2013) have reported that C. jejuni can survive in Acanthamoeba spp. by escaping to non-digestive vacuoles. The function of vacuole mentioned by both Watson and Galán (2008) and Olofsson et

al. (2013) were of non-digestive vacuole which provided a chance for C. jejuni to survive in the respective host cells.

C. jejuni factors related to internalization in non-phagocytic cells remains unclear. Most intracellular pathogens employ an actin-based motility cytoskeleton (Cossart and Sansonetti

2004), whereas C. jejuni cytoskeleton is microtubulin dependent (Oelschlaeger, Guerry and

Kopecko 1993, Cróinín and Backert 2012). The use of caveolae (flask-like membrane structures enriched in cholesterol and glycosphingolipids) for internalization to non-phagocytic cells has been suggested (Wooldridge, Williams and Ketley 1996).

Little is known about the genetic factors of C. jejuni in C. jejuni-amoeba interaction. One efficient way to assess those genetic factors is to evaluate the factors known to be important in C. jejuni-mammalian cell interactions for their role in C. jejuni-FLA interactions. Therefore, in our study (Chapter 2) we selected 10 genes based on their known roles as followings.and evaluated their roles in C. jejuni-FLA interaction using deletion mutants.

Flagella are a critical trait in adhesion and invasion in human epithelial cells. According to one study, a trigger mechanism is a key element for invasion process of C. jejuni (Cróinín and

Backert 2012) In many intracellular Gram-negative bacteria like Salmonella and Shigella, this process is performed by type III and type IV secretion systems. Trigger mechanism refers to injecting bacterial proteins which often mimic or hijack specific host factors to trigger internalization (Cossart and Sansonetti 2004). However, C. jejuni lacks these secretion systems

(Konkel et al. 2004). Flagella are often referred to as a flagellar type III secretion system (Larson et al. 2008) responsible for secretions of invasion associated effector molecules. These proteins are termed C. jejuni invasion antigens (Cia), some of which are CiaB, CiaC, YlpA, Csp. Other proteins reported to play a role in invasion is FlaC, share homology with flagellin subunits and

are believed to be secreted extracellularly (Song et al. 2004). Adhesins (JlpA, Peb proteins,

KpsE) and fibronectin binding protein (CadF and FlpA) facilitate the attachment to epithelial cells. Outer membrane vesicles of C. jejuni are involved in the delivery of secreted proteins including the cytolethal distending toxin (Elmi et al. 2012). Sialyation of liposaccharide outer core plays an important role in epithelial cell invasion (Louwen et al. 2008). Cróinín and Backert

(2012) reported a list of host factors and signal transduction pathways mediating C. jejuni internalization from adhesion to lysosome. C. jejuni internalization factors required to enter host cells have been also identified as being implicated in motility, chemotaxis, capsule synthesis, and glycosylation (Watson and Galán 2008). Defects in these pathways can lead to a reduced ability or inability to adhere to and invade the host cells (Cróinín and Backert 2012).

1.10. C. jejuni genetic diversity and genome plasticity

C. jejuni is zoonotic and is related to a broad spectrum of hosts (Nachamkin et al. 2008,

Fischer and Paterek 2019). Many studies have reported the rapid host switching of

Campylobacter spp. due to its genome plasticity (Dearlove et al. 2016, Woodcock et al. 2017).

Genome plasticity which is attributed by genetic diversity and exchange of genetic material laterally either within members of the same species or gain from other microorganisms (Taboada et al. 2004). Many Studies point towards vast genetic diversity within C. jejuni strains and among different species of genus Campylobacter (Vegge et al. 2012, Dorrell et al. 2001, Pearson et al. 2003, Duong and Konkel 2009). Genetic diversity explains the greater ability of bacterial population to survive in a hostile environment and their better adaptation to the colonization of the host gut. In other words, acquiring genetic material from other bacteria provides bacteria with an increased chance to acquire new beneficial metabolic capacities (Korona 1996).

C. jejuni genome is compact (1.6 to 1.8 Mbp) (Parkhill et al. 2000, Fouts et al. 2005), but genomic content varies significantly among the different strains of C. jejuni (Fouts et al. 2005,

Rivoal et al. 2005, Gripp et al. 2011). Approximately 1,600 genes are present in a C. jejuni genome (Parkhill et al. 2000), but the number of genes estimated in pan-genome of C. jejuni is about 2,600 genes (Lefebure et al. 2010, Duong and Konkel 2009). Pan-genome is defined as a total number of genes (both core and dispensable genes) present in all strains and species of a microorganism (Medini et al. 2005). There are multiple reports which indicate complex strain diversity of C. jejuni isolated from the infected chicken flock (Rivoal et al. 2005). It is important to study and understand the pace of genetic diversification in C. jejuni and its causes and underlying mechanisms. The coexistence of C. jejuni lineages with generalist and specialist ecology remains poorly understood and little is known about the factors that promote the emergence of lineages related to distinct ecologies. It is important to understand the mechanisms of genetic diversity in C. jejuni as it could explain and answer many epidemiological questions.

1.11. Horizontal gene transfer in C. jejuni

Horizontal gene transfer (HGT) plays a significant role in incorporating genetic diversity to C. jejuni genome (Avrain, Vernozy‐Rozand and Kempf 2004, Wilson et al. 2009). There are many molecular epidemiologic studies which support HGT among C. jejuni strains at a remarkable rate (Fearnhead et al. 2005, Schouls et al. 2003). HGT is often defined as any occurrence of heritable material passing between organisms, asynchronous with reproduction of the organisms (Heinemann and Bungard 2006). Not only does the dynamically changing genetic composition influences the diversity of C. jejuni diversity in the environment and host epidemiology but is a limiting factor for the scientific community as it affects gene manipulation in C. jejuni as well. One of the sources evidence for genome diversity in C. jejuni cells is

reflected in immense variation in flagellin gene clearly revealed from FlaA typing of C. jejuni which is commonly used for epidemiological studies (Wassenaar, Fry and Van der Zeijst 1995, de Boer et al. 2002, Singh and Kwon 2013). There are several studies which present evidence of

HGT (Avrain et al. 2004, Duong and Konkel 2009, Wassenaar et al. 1995, Gardner and Olson

2012, Harrington, Thomson-Carter and Carter 1997, Qu et al. 2008, Oyarzabal, Rad and Backert

2007). Also, de Boer et al. (2002) have reported horizontal gene exchange of chromosomally located antibiotic marker strains in in vivo chicken colonization studies. Although there are many reports that support the hypothesis of HGT, it lacks a comprehensive study of different factors that could affect the HGT. There is urgent need to understand both molecular and environmental factors influencing the ability of C. jejuni to exchange and acquire genetic material between cells of same of the same species, genus, or of different genera and the host barriers existing between these different backgrounds.

1.12. Objectives of the dissertation

After reviewing the literature we experience a need to study the following topics in order to understand the environmental survival of C. jejuni.

The specific objectives of this dissertation were:

1. Study different strategies C. jejuni employs in C. jejuni-Amoeba interaction using

deletion mutants (Chapter 2).

2. Study different factors affecting HGT between C. jejuni cells (Chapter3).

3. Proteomic analysis of C. jejuni-Amoeba interaction to get a comprehensive

understanding of changes in C. jejuni proteins in the interaction (Chapter 4).

4. Study role of VBNC forms in environmental survival of C. jejuni (Chapter 5)

1.13. References

Abd, H., Wretlind, B., Saeed, A., Idsund, E., Hultenby, K., and Sandström, G. (2008). Pseudomonas aeruginosa utilises its type III secretion system to kill the free‐living amoeba Acanthamoeba castellanii. Journal of Eukaryotic Microbiology, 55(3), 235-243. Adkin, A., Hartnett, E., Jordan, L., Newell, D., and Davison, H. (2006). Use of a systematic review to assist the development of Campylobacter control strategies in broilers. Journal of Applied Microbiology, 100(2), 306-315. Ajene, A. N., Walker, C. L. F., and Black, R. E. (2013). Enteric pathogens and reactive arthritis: a systematic review of Campylobacter, Salmonella and Shigella-associated reactive arthritis. Journal of Health, Population, and Nutrition, 31(3), 299. Akya, A., Pointon, A., and Thomas, C. (2010). Listeria monocytogenes does not survive ingestion by Acanthamoeba polyphaga. Microbiology, 156(3), 809-818. Al-Khodor, S., Kalachikov, S., Morozova, I., Price, C. T., and Kwaik, Y. A. (2009). The PmrA/PmrB two-component system of Legionella pneumophila is a global regulator required for intracellular replication within macrophages and protozoa. Infection and Immunity, 77(1), 374-386. Allen, K. J., and Griffiths, M. W. (2001). Use of luminescent Campylobacter jejuni ATCC 33291 to assess eggshell colonization and penetration in fresh and retail eggs. Journal of Food Protection, 64(12), 2058-2062. Allos, B. M. (1997). Association between Campylobacter infection and Guillain-Barré syndrome. Journal of Infectious Diseases, 176 S125-S128. Ang, C., De Klerk, M., Endtz, H., Jacobs, B., Laman, J., Van Der Meche, F., and Van Doorn, P. (2001). Guillain-Barré syndrome-and Miller Fisher syndrome-associated Campylobacter jejuni lipopolysaccharides induce anti-GM1 and anti-GQ1b antibodies in rabbits. Infection and Immunity, 69(4), 2462-2469. Avrain, L., Vernozy‐Rozand, C., and Kempf, I. (2004). Evidence for natural horizontal transfer of tetO gene between Campylobacter jejuni strains in chickens. Journal of Applied Microbiology, 97(1), 134-140. Axelsson-Olsson, D., Olofsson, J., Svensson, L., Griekspoor, P., Waldenström, J., Ellström, P., and Olsen, B. (2010). Amoebae and algae can prolong the survival of Campylobacter species in co-culture. Experimental Parasitology, 126(1), 59-64. doi:10.1016/j.exppara.2009.12.016 Axelsson-Olsson, D., Svensson, L., Olofsson, J., Salomon, P., Waldenström, J., Ellström, P., and Olsen, B. (2010). Increase in acid tolerance of Campylobacter jejuni through coincubation with amoebae. Applied and Environmental Microbiology, 76(13), 4194- 4200. Axelsson-Olsson, D., Waldenström, J., Broman, T., Olsen, B., and Holmberg, M. (2005). Protozoan Acanthamoeba polyphaga as a potential reservoir for Campylobacter jejuni.

Applied and Environmental Microbiology, 71(2), 987-992. doi:10.1128/AEM.71.2.987- 992.2005 Bacon, D. J., Alm, R. A., Burr, D. H., Hu, L., Kopecko, D. J., Ewing, C. P., and Guerry, P. (2000). Involvement of a plasmid in virulence of Campylobacter jejuni 81-176. Infection and Immunity, 68(8), 4384-4390. Bacon, D. J., Szymanski, C. M., Burr, D. H., Silver, R. P., Alm, R. A., and Guerry, P. (2001). A phase‐variable capsule is involved in virulence of Campylobacter jejuni 81‐176. Molecular Microbiology, 40(3), 769-777. Baffone, W., Casaroli, A., Citterio, B., Pierfelici, L., Campana, R., Vittoria, E., Guaglianone E. and Donelli, G. (2006). Campylobacter jejuni loss of culturability in aqueous microcosms and ability to resuscitate in a mouse model. International Journal Food Microbiology, 107(1), 83-91. doi:10.1016/j.ijfoodmicro.2005.08.015 Baré, J., Sabbe, K., Huws, S., Vercauteren, D., Braeckmans, K., Van Gremberghe, I., Favoreel H. and Houf, K. (2010). Influence of temperature, oxygen and bacterial strain identity on the association of Campylobacter jejuni with Acanthamoeba castellanii. FEMS Microbiology Ecology, 74(2), 371-381. Beumer, R., De Vries, J., and Rombouts, F. (1992). Campylobacter jejuni non-culturable coccoid cells. International Journal of Food Microbiology, 15(1), 153-163. Bolton, D. J. (2015). Campylobacter virulence and survival factors. Food Microbiology, 48, 99- 108. Bozue, J. A., and Johnson, W. (1996). Interaction of Legionella pneumophila with Acanthamoeba castellanii: uptake by coiling phagocytosis and inhibition of phagosome- lysosome fusion. Infection and Immunity, 64(2), 668-673. Bronowski, C., James, C. E., and Winstanley, C. (2014). Role of environmental survival in transmission of Campylobacter jejuni. FEMS Microbiology Letters, 356(1), 8-19. Brown, M. R., and Barker, J. (1999). Unexplored reservoirs of pathogenic bacteria: protozoa and biofilms. Trends in Microbiology, 7(1), 46-50. Buhr, R., Cox, N., Stern, N., Musgrove, M., Wilson, J., and Hiett, K. (2002). Recovery of Campylobacter from segments of the reproductive tract of broiler breeder hens. Avian diseases, 46(4), 919-924. Bui, X. T., Qvortrup, K., Wolff, A., Bang, D. D., and Creuzenet, C. (2012). Effect of environmental stress factors on the uptake and survival of Campylobacter jejuni in Acanthamoeba castellanii. BMC Microbiology, 12(1), 232. Bui, X. T., Winding, A., Qvortrup, K., Wolff, A., Bang, D. D., and Creuzenet, C. (2012). Survival of Campylobacter jejuni in co‐culture with Acanthamoeba castellanii: role of amoeba‐mediated depletion of dissolved oxygen. Environmental microbiology, 14(8), 2034-2047. Butzler, J., De Mol, P., and Mandal, B. K. (2018). Clinical aspects of Campylobacter infections in humans. In Campylobacter Infection in Man and Animals (pp. 21-32): CRC Press.

Butzler, J.-P. (2004). Campylobacter, from obscurity to celebrity. Clinical Microbiology and Infection, 10(10), 868-876. Callicott, K. A., Friðriksdóttir, V., Reiersen, J., Lowman, R., Bisaillon, J.-R., Gunnarsson, E., Berndtson E., Hiett K. L., Needleman D. S. and Stern, N. J. (2006). Lack of evidence for vertical transmission of Campylobacter spp. in chickens. Applied and Environmental Microbiology, 72(9), 5794-5798. Camarda, A., Newell, D., Nasti, R., and Di Modugno, G. (2000). Genotyping Campylobacter jejuni strains isolated from the gut and oviduct of laying hens. Avian Diseases, 907-912. Cappelier, J., Minet, J., Magras, C., Colwell, R., and Federighi, M. (1999). Recovery in embryonated eggs of viable but nonculturable Campylobacter jejuni cells and maintenance of ability to adhere to HeLa cells after resuscitation. Applied and Environmental Microbiology, 65(11), 5154-5157. Cardas, M., Khan, N. A., and Alsam, S. (2012). Staphylococcus aureus exhibit similarities in their interactions with Acanthamoeba and ThP1 macrophage-like cells. Experimental Parasitology, 132(4), 513-518. Casadevall, A. (2008). Evolution of intracellular pathogens. Annual Review Microbiology., 62, 19-33. Casson, N., Medico, N., Bille, J., and Greub, G. (2006). Parachlamydia acanthamoebae enters and multiplies within pneumocytes and lung fibroblasts. Microbes and Infection, 8(5), 1294-1300. Cawthraw, S., Wassenaar, T., Ayling, R., and Newell, D. (1996). Increased colonization potential of Campylobacter jejuni strain 81116 after passage through chickens and its implication on the rate of transmission within flocks. Epidemiology and Infection, 117(01), 213-215. Chaveerach, P., Ter Huurne, A., Lipman, L., and Van Knapen, F. (2003). Survival and resuscitation of ten strains of Campylobacter jejuni and Campylobacter coli under acid conditions. Applied and Environmental Microbiology, 69(1), 711-714. Chrisman, C. J., Alvarez, M., and Casadevall, A. (2010). Phagocytosis of Cryptococcus neoformans by and nonlytic exocytosis from Acanthamoeba castellanii. Applied and Environmental Microbiology, 76(18), 6056-6062. Cirillo, J. D., Falkow, S., Tompkins, L. S., and Bermudez, L. E. (1997). Interaction of Mycobacterium avium with environmental amoebae enhances virulence. Infection and Immunity, 65(9), 3759-3767. Clark, A., and Bueschkens, D. (1985). Laboratory infection of chicken eggs with Campylobacter jejuni by using temperature or pressure differentials. Applied and Environmental Microbiology, 49(6), 1467-1471. Cokal, Y., Caner, V., Sen, A., Cetin, C., and Telli, M. (2011). The presence of Campylobacter jejuni in broiler houses: results of a longitudinal study. African Journal Microbiology Research, 5, 389-393.

Cools, I., Uyttendaele, M., Caro, C., D'Haese, E., Nelis, H., and Debevere, J. (2003). Survival of Campylobacter jejuni strains of different origin in drinking water. Journal of Applied Microbiology, 94(5), 886-892. Corry, J., and Atabay, H. (2001). Poultry as a source of Campylobacter and related organisms. Journal of Applied Microbiology, 90(S6), 96S-114S. Cossart, P., and Sansonetti, P. J. (2004). Bacterial invasion: the paradigms of enteroinvasive pathogens. Science, 304(5668), 242-248. Cox, N. A., Stern, N. J., Hiett, K. L., and Berrang, M. E. (2002). Identification of a new source of Campylobacter contamination in poultry: transmission from breeder hens to broiler chickens. Avian Diseases, 46(3), 535-541. Craven, S., Stern, N., Line, E., Bailey, J., Cox, N., and Fedorka-Cray, P. (2000). Determination of the incidence of Salmonella spp., Campylobacter jejuni, and Clostridium perfringens in wild birds near broiler chicken houses by sampling intestinal droppings. Avian Diseases, 715-720. Cróinín, T. Ó., and Backert, S. (2012). Host epithelial cell invasion by Campylobacter jejuni: trigger or zipper mechanism? Frontiers in Cellular And Infection Microbiology, 2, 25. Dasti, J. I., Tareen, A. M., Lugert, R., Zautner, A. E., and Groß, U. (2010). Campylobacter jejuni : a brief overview on pathogenicity-associated factors and disease-mediating mechanisms. International Journal of Medical Microbiology, 300(4), 205-211. de Boer, P., Wagenaar, J. A., Achterberg, R. P., van Putten, J. P. M., Schouls, L. M., and Duim, B. (2002). Generation of Campylobacter jejuni genetic diversity in vivo. Molecular Microbiology, 44(2), 351-359. doi:10.1046/j.1365-2958.2002.02930.x Dearlove, B. L., Cody, A. J., Pascoe, B., Méric, G., Wilson, D. J., and Sheppard, S. K. (2016). Rapid host switching in generalist Campylobacter strains erodes the signal for tracing human infections. The ISME journal, 10(3), 721. Dorrell, N., Mangan, J. A., Laing, K. G., Hinds, J., Linton, D., Al-Ghusein, H., Barrell G., Parkhill J., Stoker N. G. and Karlyshev, A. V. (2001). Whole genome comparison of Campylobacter jejuni human isolates using a low-cost microarray reveals extensive genetic diversity. Genome Research, 11(10), 1706-1715. Doyle, M., and Erickson, M. (2006). Reducing the carriage of foodborne pathogens in livestock and poultry. Poultry Science, 85(6), 960-973. Duke, L., Breathnach, A., Jenkins, D., Harkis, B., and Codd, A. (1996). A mixed outbreak of Cryptosporidium and Campylobacter infection associated with a private water supply. Epidemiology and Infection, 116(3), 303-308. Duong, T., and Konkel, M. E. (2009). Comparative studies of Campylobacter jejuni genomic diversity reveal the importance of core and dispensable genes in the biology of this enigmatic food-borne pathogen. Current Opinion in Biotechnology, 20(2), 158-165. Elmi, A., Watson, E., Sandu, P., Gundogdu, O., Mills, D. C., Inglis, N. F., E. Manson, Imrie L., Bajaj-Elliott M. and Wren, B. W. (2012). Campylobacter jejuni outer membrane vesicles

play an important role in bacterial interactions with human intestinal epithelial cells. Infection and Immunity, 80(12), 4089-4098. Fearnhead, P., Smith, N. G., Barrigas, M., Fox, A., and French, N. (2005). Analysis of Recombination in Campylobacterjejuni from MLST Population Data. Journal of Molecular Evolution, 61(3), 333-340. Fischer, G. H., and Paterek, E. (2019). Campylobacter. In StatPearls [Internet]: StatPearls Publishing. Fonseca, B. B., Soncini, R. A., Gimarães, A. R., and Rossi, D. A. (2006). Campylobacter sp in eggs from cloacal swab positive breeder hens. Brazilian Journal of Microbiology, 37(4), 573-575. Fouts, D. E., Mongodin, E. F., Mandrell, R. E., Miller, W. G., Rasko, D. A., Ravel, J., L. Brinkac M., DeBoy R. T., Parker C. T. and Daugherty, S. C. (2005). Major structural differences and novel potential virulence mechanisms from the genomes of multiple Campylobacter species. PLoS Biology, 3(1), e15. Fritsche, T., Gautom, R., Seyedirashti, S., Bergeron, D., and Lindquist, T. (1993). Occurrence of bacterial endosymbionts in Acanthamoeba spp. isolated from corneal and environmental specimens and contact lenses. Journal of Clinical Microbiology, 31(5), 1122-1126. Gardner, S. P., and Olson, J. W. (2012). Barriers to horizontal gene transfer in Campylobacter jejuni . In Advances in Applied Microbiology (Vol. 79, pp. 19-42): Elsevier. Greub, G., and Raoult, D. (2004). Microorganisms resistant to free-living amoebae. Clinical Microbiology Reviews, 17(2), 413-433. Gripp, E., Hlahla, D., Didelot, X., Kops, F., Maurischat, S., Tedin, K., Alter T., Ellerbroek L., Schreiber K. and Schomburg, D. (2011). Closely related Campylobacter jejuni strains from different sources reveal a generalist rather than a specialist lifestyle. Bmc Genomics, 12(1), 584. Guerry, P., Szymanski, C. M., Prendergast, M. M., Hickey, T. E., Ewing, C. P., Pattarini, D. L., and Moran, A. P. (2002). Phase variation of Campylobacter jejuni 81-176 lipooligosaccharide affects ganglioside mimicry and invasiveness in vitro. Infection and Immunity, 70(2), 787-793. Halpin, A. L., Gu, W., Wise, M., Sejvar, J., Hoekstra, R., and Mahon, B. (2018). Post- Campylobacter Guillain Barré Syndrome in the USA: secondary analysis of surveillance data collected during the 2009–2010 novel Influenza A (H1N1) vaccination campaign. Epidemiology and Infection, 1-6. Harrington, C. S., Thomson-Carter, F. M., and Carter, P. E. (1997). Evidence for recombination in the flagellin locus of Campylobacter jejuni : implications for the flagellin gene typing scheme. Journal of Clinical Microbiology, 35(9), 2386-2392. He, Y., and Chen, C.-Y. (2010). Quantitative analysis of viable, stressed and dead cells of Campylobacter jejuni strain 81-176. Food Microbiology, 27(4), 439-446.

Heinemann, J. A., and Bungard, R. A. (2006). Horizontal gene transfer. Reviews in Cell Biology and Molecular Medicine. Hermans, D., Van Deun, K., Martel, A., Van Immerseel, F., Messens, W., Heyndrickx, M., Haesebrouck F. and Pasmans, F. (2011). Colonization factors of Campylobacter jejuni in the chicken gut. Veterinary Research, 42(1), 82. Horrocks, S. M., Anderson, R. C., Nisbet, D. J., and Ricke, S. C. (2009). Incidence and ecology of Campylobacter jejuni and coli in animals. Anaerobe, 15(1-2), 18-25. doi:10.1016/j.anaerobe.2008.09.001 Huws, S., McBain, A., and Gilbert, P. (2005). Protozoan grazing and its impact upon population dynamics in biofilm communities. Journal of Applied Microbiology, 98(1), 238-244. Huws, S. A., Morley, R. J., Jones, M. V., Brown, M. R., and Smith, A. W. (2008). Interactions of some common pathogenic bacteria with Acanthamoeba polyphaga. FEMS Microbiology Letters, 282(2), 258-265. Jang, K., Kim, M., Ha, S., Kim, K., Lee, K., Chung, D., and Kim, C. (2007). Morphology and adhesion of Campylobacter jejuni to chicken skin under varying conditions. Journal of Microbiology and Biotechnology, 17(2), 202. Janssen, R., Krogfelt, K. A., Cawthraw, S. A., van Pelt, W., Wagenaar, J. A., and Owen, R. J. (2008). Host-pathogen interactions in Campylobacter infections: the host perspective. Clinical Microbiology Reviews, 21(3), 505-518. Johnson, W. á., and Lior, H. (1988). A new heat-labile cytolethal distending toxin (CLDT) produced by Campylobacter spp. Microbial Pathogenesis, 4(2), 115-126. Jones, D., Sutcliffe, E., and Curry, A. (1991). Recovery of viable but non-culturable Campylobacter jejuni. Journal of General Microbiology, 137(10), 2477-2482. Khan, N. A. (2006). Acanthamoeba: biology and increasing importance in human health. FEMS Microbiology Reviews, 30(4), 564-595. Khan, N. A. (2009). Acanthamoeba. Biology and pathogenesis. In Parasites and Vectors Caister Academic Press.. Kim, E.-H., Charpentier, X., Torres-Urquidy, O., McEvoy, M. M., and Rensing, C. (2009). The metal efflux island of Legionella pneumophila is not required for survival in macrophages and amoebas. FEMS Microbiology Letters, 301(2), 164-170. King, C. H., Shotts, E. B., Wooley, R. E., and Porter, K. G. (1988). Survival of coliforms and bacterial pathogens within protozoa during chlorination. Applied and Environmental Microbiology, 54(12), 3023-3033. Konkel, M. E., Klena, J. D., Rivera-Amill, V., Monteville, M. R., Biswas, D., Raphael, B., and Mickelson, J. (2004). Secretion of virulence proteins from Campylobacter jejuni is dependent on a functional flagellar export apparatus. Journal of Bacteriology, 186(11), 3296-3303.

Koptina, A., Strese, Å., Backlund, A., and Alsmark, C. (2015). Challenges to get axenic cultures of Trichomonas spp. A new approach in eradication of contaminants and maintenance of laboratory microbiological cultures. Journal of Microbiological Methods, 118, 25-30. Korona, R. (1996). Genetic divergence and fitness convergence under uniform selection in experimental populations of bacteria. Genetics, 143(2), 637-644. Kuusi, M., Nuorti, J., Hänninen, M.-L., Koskela, M., Jussila, V., Kela, E., Miettinen I. and Ruutu, P. (2005). A large outbreak of campylobacteriosis associated with a municipal water supply in Finland. Epidemiology and Infection, 133(4), 593-601. Kwaik, Y. A., Gao, L.-Y., Stone, B. J., Venkataraman, C., and Harb, O. S. (1998). Invasion of protozoa by Legionella pneumophila and its role in bacterial ecology and pathogenesis. Applied and Environmental Microbiology, 64(9), 3127-3133. Lamothe, J., Thyssen, S., and Valvano, M. A. (2004). Burkholderia cepacia complex isolates survive intracellularly without replication within acidic vacuoles of Acanthamoeba polyphaga. Cellular Microbiology, 6(12), 1127-1138. Larson, C. L., Christensen, J. E., Pacheco, S. A., Minnich, S. A., Konkel, M., Nachamkin, I., Szymanski C. and Blaser, M. (2008). Campylobacter jejuni secretes proteins via the flagellar type III secretion system that contribute to host cell invasion and gastroenteritis. Campylobacter (Ed. 3), 315-332. Lefebure, T., Pavinski Bitar, P. D., Suzuki, H., and Stanhope, M. J. (2010). Evolutionary dynamics of complete Campylobacter pan-genomes and the bacterial species concept. Genome Biology and Evolution, 2, 646-655. Li, L., Mendis, N., Trigui, H., Oliver, J. D., and Faucher, S. P. (2014). The importance of the viable but non-culturable state in human bacterial pathogens. Frontiers in Microbiology, 5. Lorenzo-Morales, J., Khan, N. A., and Walochnik, J. (2015). An update on Acanthamoeba keratitis: diagnosis, pathogenesis and treatment. Parasite, 22. Louwen, R., Heikema, A., van Belkum, A., Ott, A., Gilbert, M., Ang, W., Endtz H. P., Bergman M. P. and Nieuwenhuis, E. E. (2008). The sialylated lipooligosaccharide outer core in Campylobacter jejuni is an important determinant for epithelial cell invasion. Infection and Immunity, 76(10), 4431-4438. Lázaro, B., Cárcamo, J., Audícana, A., Perales, I., and Fernández-Astorga, A. (1999). Viability and DNA maintenance in nonculturable spiral Campylobacter jejuni cells after long-term exposure to low temperatures. Applied and Environmental Microbiology, 65(10), 4677- 4681. Marolda, C. L., Hauröder, B., John, M. A., Michel, R., and Valvano, M. A. (1999). Intracellular survival and saprophytic growth of isolates from the Burkholderia cepacia complex in free-living amoebae. Microbiology, 145(7), 1509-1517. Matz, C., and Jürgens, K. (2005). High motility reduces grazing mortality of planktonic bacteria. Applied and Environmental Microbiology, 71(2), 921-929.

Matz, C., and Kjelleberg, S. (2005). Off the hook–how bacteria survive protozoan grazing. Trends in Microbiology, 13(7), 302-307. Maue, A. C., Mohawk, K. L., Giles, D. K., Poly, F., Ewing, C. P., Jiao, Y., and Hill, C. L. (2013). The polysaccharide capsule of Campylobacter jejuni modulates the host immune response. Infection and Immunity, 81(3), 665-672. Mederma, G., Schets, F., Giessen, A., and Havelaar, A. (1992). Lack of colonization of 1 day old chicks by viable, non‐culturable Campylobacter jejuni. Journal of Applied Bacteriology, 72(6), 512-516. Medini, D., Donati, C., Tettelin, H., Masignani, V., and Rappuoli, R. (2005). The microbial pan- genome. Current Opinion in Genetics and Development, 15(6), 589-594. Miltner, E. C., and Bermudez, L. E. (2000). Mycobacterium avium grown in Acanthamoeba castellanii is protected from the effects of antimicrobials. Antimicrobial Agents and Chemotherapy, 44(7), 1990-1994. Molmeret, M., Horn, M., Wagner, M., Santic, M., and Kwaik, Y. A. (2005). Amoebae as training grounds for intracellular bacterial pathogens. Applied and Environmental Microbiology, 71(1), 20-28. Moore, J., Caldwell, P., and Millar, B. (2001). Molecular detection of Campylobacter spp. in drinking, recreational and environmental water supplies. International Journal of Hygiene and Environmental Health, 204(2), 185-189. Moran, A., and Upton, M. E. (1986). A comparative study of the rod and coccoid forms of Campylobacter jejuni ATCC 29428. Journal of Applied Bacteriology, 60(2), 103-110. Mughini-Gras, L., Penny, C., Ragimbeau, C., Schets, F. M., Blaak, H., Duim, B., Wagenaar J. A., de Boer A., Cauchie H.-M. and Mossong, J. (2016). Quantifying potential sources of surface water contamination with Campylobacter jejuni and Campylobacter coli. Water Research, 101, 36-45. Nachamkin, I., Allos, B. M., and Ho, T. (1998). Campylobacter species and Guillain-Barre syndrome. Clinical Microbiology Reviews, 11(3), 555-567. Nachamkin, I., Szymanski, C. M., and Blaser, M. J. (2008). Campylobacter: ASM Press. Nachamkin, I., Yang, X.-H., and Stern, N. J. (1993). Role of Campylobacter jejuni flagella as colonization factors for three-day-old chicks: analysis with flagellar mutants. Applied and Environmental Microbiology, 59(5), 1269-1273. Newell, D. (2002). The ecology of Campylobacter jejuni in avian and human hosts and in the environment. International Journal of Infectious Diseases, 6, S16-S21. Newell, D., and Fearnley, C. (2003). Sources of Campylobacter colonization in broiler chickens. Applied and Environmental Microbiology, 69(8), 4343-4351. Nilsson, A., Johansson, C., Skarp, A., Kaden, R., Bertilsson, S., and Rautelin, H. (2018). Survival of Campylobacter jejuni and Campylobacter coli water isolates in lake and well water. APMIS, 126(9), 762-770.

Oelschlaeger, T. A., Guerry, P., and Kopecko, D. J. (1993). Unusual microtubule-dependent endocytosis mechanisms triggered by Campylobacter jejuni and Citrobacter freundii. Proceedings of the National Academy of Sciences, 90(14), 6884-6888. Olofsson, J., Axelsson-Olsson, D., Brudin, L., Olsen, B., and Ellström, P. (2013). Campylobacter jejuni actively invades the amoeba Acanthamoeba polyphaga and survives within non digestive vacuoles. PLoS One, 11. Oyarzabal, O. A., Rad, R., and Backert, S. (2007). Conjugative transfer of chromosomally encoded antibiotic resistance from Helicobacter pylori to Campylobacter jejuni . Journal of Clinical Microbiology, 45(2), 402-408. Palmer, S., Gully, P., White, J., Pearson, A., Suckling, W., Jones, D., Rawes J. and Penner, J. (1983). Water-borne outbreak of Campylobacter gastroenteritis. The Lancet, 321(8319), 287-290. Park, S. F. (2002). The physiology of Campylobacter species and its relevance to their role as foodborne pathogens. International Journal of Food Microbiology, 74(3), 177-188. Parkhill, J., Wren, B., Mungall, K., Ketley, J., Churcher, C., Basham, D., Chillingworth T., Davies R., Feltwell T. and Holroyd, S. (2000). The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature, 403(6770), 665-668. Patrone, V., Campana, R., Vallorani, L., Dominici, S., Federici, S., Casadei, L., Gioacchini A. M., Stocchi V. and Baffone, W. (2013). CadF expression in Campylobacter jejuni strains incubated under low-temperature water microcosm conditions which induce the viable but non-culturable (VBNC) state. Antonie Van Leeuwenhoek, 103(5), 979-988. Patrone, V., Campana, R., Vallorani, L., Dominici, S., Federici, S., Casadei, L.,and Baffone, W. (2013). CadF expression in Campylobacter jejuni strains incubated under low- temperature water microcosm conditions which induce the viable but non-culturable (VBNC) state. Antonie Van Leeuwenhoek, 103(5), 979-988. doi:10.1007/s10482-013- 9877-5 Pearson, B., Pin, C., Wright, J., I’anson, K., Humphrey, T., and Wells, J. (2003). Comparative genome analysis of Campylobacter jejuni using whole genome DNA microarrays. FEBS Letters, 554(1-2), 224-230. Pitkänen, T. (2013). Review of Campylobacter spp. in drinking and environmental waters. Journal of Microbiological Methods, 95(1), 39-47. Pope, J. E., Krizova, A., Garg, A. X., Thiessen-Philbrook, H., and Ouimet, J. M. (2007). Campylobacter reactive arthritis: a systematic review. In Seminars in arthritis and rheumatism Qu, A., Brulc, J. M., Wilson, M. K., Law, B. F., Theoret, J. R., Joens, L. A., and Edwards, R. A. (2008). Comparative metagenomics reveals host specific metavirulomes and horizontal gene transfer elements in the chicken cecum microbiome. PloS One, 3(8), e2945.

Reilly, S., Alonso, L., and Gillil, S. (2004). Influence of gaseous atmosphere on morphology and cellular fatty acid composition of Campylobacter jejuni. Journal of Food Science, 69(6), M145-M150. Ridley, A., Morris, V., Gittins, J., Cawthraw, S., Harris, J., Edge, S., and Allen, V. (2011). Potential sources of Campylobacter infection on chicken farms: contamination and control of broiler‐harvesting equipment, vehicles and personnel. Journal of Applied Microbiology, 111(1), 233-244. Rivoal, K., Ragimbeau, C., Salvat, G., Colin, P., and Ermel, G. (2005). Genomic diversity of Campylobacter coli and Campylobacter jejuni isolates recovered from free-range broiler farms and comparison with isolates of various origins. Applied and Environmental Microbiology, 71(10), 6216-6227. Rodríguez-Zaragoza, S. (1994). Ecology of free-living amoebae. Critical Reviews in Microbiology, 20(3), 225-241. Rollins, D., and Colwell, R. (1986). Viable but nonculturable stage of Campylobacter jejuni and its role in survival in the natural aquatic environment. Applied and Environmental Microbiology, 52(3), 531-538. Ruiz-Palacios, G. M. (2007). The health burden of Campylobacter infection and the impact of antimicrobial resistance: playing chicken. Clinical Infectious Diseases, 44(5), 701-703. Saha, S., Saha, S., and Sanyal, S. (1991). Recovery of injured Campylobacter jejuni cells after animal passage. Applied and environmental microbiology, 57(11), 3388-3389. Sahin, O., Kobalka, P., and Zhang, Q. (2003). Detection and survival of Campylobacter in chicken eggs. Journal of Applied Microbiology, 95(5), 1070-1079. doi:10.1046/j.1365- 2672.2003.02083.x Sahin, O., Morishita, T. Y., and Zhang, Q. (2002). Campylobacter colonization in poultry: sources of infection and modes of transmission. Animal Health Research Reviews, 3(2), 95-105. Salah, I. B., and Drancourt, M. (2010). Surviving within the amoebal exocyst: the Mycobacterium avium complex paradigm. BMC microbiology, 10(1), 99. Schouls, L. M., Reulen, S., Duim, B., Wagenaar, J. A., Willems, R. J., Dingle, K. E., Colles F. M. and Van Embden, J. D. (2003). Comparative genotyping of Campylobacter jejuni by amplified fragment length polymorphism, multilocus sequence typing, and short repeat sequencing: strain diversity, host range, and recombination. Journal of Clinical Microbiology, 41(1), 15-26. Segal, G., and Shuman, H. A. (1999). Legionella pneumophila utilizes the same genes to multiply within Acanthamoeba castellanii and human macrophages. Infection and Immunity, 67(5), 2117-2124. Shreeve, J., Toszeghy, M., Ridley, A., and Newell, D. (2002). The carry-over of Campylobacter isolates between sequential poultry flocks. Avian Diseases, 46(2), 378-385.

Siddiqui, R., and Khan, N. A. (2012). War of the microbial worlds: Who is the beneficiary in Acanthamoeba–bacterial interactions? Experimental parasitology, 130(4), 311-313. Singh, P., and Kwon, Y. M. (2013). Comparative analysis of Campylobacter populations within individual market-age broilers using fla gene typing method. Poultry Science, 92(8), 2135-2144. Skirrow, M. (1977). Campylobacter enteritis: a" new" disease. Br Med J, 2(6078), 9-11. Skirrow, M. (1982). Campylobacter enteritis–the first five years. Epidemiology and Infection, 89(2), 175-184. Snelling, W., McKenna, J., Lecky, D., and Dooley, J. (2005). Survival of Campylobacter jejuni in waterborne protozoa. Applied and Environmental Microbiology, 71(9), 5560-5571. Snelling, W. J., Stern, N. J., Lowery, C. J., Moore, J. E., Gibbons, E., Baker, C., and Dooley, J. S. (2008). Colonization of broilers by Campylobacter jejuni internalized within Acanthamoeba castellanii. Archives of Microbiology, 189(2), 175-179. Solomon, E. B., and Hoover, D. G. (1999). Campylobacter jejuni : a bacterial paradox. Journal of Food Safety, 19(2), 121-136. Song, Y., Jin, S., Louie, H., Ng, D., Lau, R., Zhang, Y., Weerasekera R., Al Rashid S., Ward L. and Der, S. (2004). FlaC, a protein of Campylobacter jejuni TGH9011 (ATCC43431) secreted through the flagellar apparatus, binds epithelial cells and influences cell invasion. Molecular Microbiology, 53(2), 541-553. Steinert, M., Emödy, L., Amann, R., and Hacker, J. (1997). Resuscitation of viable but nonculturable Legionella pneumophila Philadelphia JR32 by Acanthamoeba castellanii. Applied and Environmental Microbiology, 63(5), 2047-2053. Stern, N., Jones, D., Wesley, I., and Rollins, D. (1994). Colonization of chicks by non-culturable Campylobacter spp. Letters in Applied Microbiology, 18, 333-336. Stern, N. J., and Kazmi, S. (1989). Campylobacter jejuni . Foodborne Bacterial Pathogens, 3, 71-110. Svensson, S. L., Pryjma, M., and Gaynor, E. C. (2014). Flagella-mediated adhesion and extracellular DNA release contribute to biofilm formation and stress tolerance of Campylobacter jejuni . PloS One, 9(8), e106063. Taboada, E. N., Acedillo, R. R., Carrillo, C. D., Findlay, W. A., Medeiros, D. T., Mykytczuk, O. L., Roberts M. J., Valencia C. A., Farber J. M. and Nash, J. H. (2004). Large-scale comparative genomics meta-analysis of Campylobacter jejuni isolates reveals low level of genome plasticity. Journal of Clinical Microbiology, 42(10), 4566-4576. Tholozan, J., Cappelier, J., Tissier, J., Delattre, G., and Federighi, M. (1999). Physiological Characterization of Viable-but-Nonculturable Campylobacter jejuni Cells. Applied and Environmental Microbiology, 65(3), 1110-1116. Thomas, C., Gibson, H., Hill, D., and Mabey, M. (1998). Campylobacter epidemiology: an aquatic perspective. Journal of Applied Microbiology, 85(S1), 168S-177S.

Thomas, C., Hill, D., and Mabey, M. (2002). Culturability, injury and morphological dynamics of thermophilic Campylobacter spp. within a laboratory‐based aquatic model system. Journal of Applied Microbiology, 92(3), 433-442. Thomas, V., McDonnell, G., Denyer, S. P., and Maillard, J.-Y. (2010). Free-living amoebae and their intracellular pathogenic microorganisms: risks for water quality. FEMS Microbiology Reviews, 34(3), 231-259. Tresse, O., Alvarez-Ordóñez, A., and Connerton, I. F. (2017). about the foodborne pathogen Campylobacter. Frontiers in Microbiology, 8, 1908. Tsoni, K., Papadopoulou, E., Michailidou, E., and Kavaliotis, I. (2012). Campylobacter jejuni meningitis in a neonate: a rare case report. Journal of Neonatal-Perinatal Medicine, 6(2), 183-185. Vaerewijck, M. J., Baré, J., Lambrecht, E., Sabbe, K., and Houf, K. (2014). Interactions of foodborne pathogens with free‐living protozoa: potential consequences for food safety. Comprehensive Reviews in Food Science and Food Safety, 13(5), 924-944. Vaerewijck, M. J., Sabbe, K., Baré, J., and Houf, K. (2008). Microscopic and molecular studies of the diversity of free-living protozoa in meat-cutting plants. Applied and Environmental Microbiology, 74(18), 5741-5749. Van de Giessen, A., Heuvelman, C., Abee, T., and Hazeleger, W. (1996). Experimental studies on the infectivity of non-culturable forms of Campylobacter spp. in chicks and mice. Epidemiology and Infection, 117(03), 463-470. Van de Putte, L., Berden, J., Boerbooms, M., Muller, W., Rasker, J., Reynvaan-Groendijk, A., and Van Der Linden, S. (1980). Reactive arthritis after Campylobacter jejuni enteritis. Journal Rheumatology, 7(4), 531-535. Vegge, C. S., Brøndsted, L., Ligowska-Marzęta, M., and Ingmer, H. (2012). Natural transformation of Campylobacter jejuni occurs beyond limits of growth. PloS one, 7(9), e45467. Vieira, A., Seddon, A. M., and Karlyshev, A. V. (2015). Campylobacter–Acanthamoeba interactions. Microbiology, 161(5), 933-947. Wassenaar, T., Fry, B., and Van der Zeijst, B. (1995). Variation of the flagellin gene locus of Campylobacter jejuni by recombination and horizontal gene transfer. Microbiology, 141(1), 95-101. Wassenaar, T. M., and Blaser, M. J. (1999). Pathophysiology of Campylobacter jejuni infections of humans. Microbes and Infection, 1(12), 1023-1033. Watson, R. O., and Galán, J. E. (2008). Campylobacter jejuni survives within epithelial cells by avoiding delivery to lysosomes. PLoS Pathogen, 4(1), e14. Willison, H. J., and O'Hanlon, G. M. (1999). The immunopathogenesis of Miller Fisher syndrome. Journal of Neuroimmunology, 100(1), 3-12.

Wilson, D. J., Gabriel, E., Leatherbarrow, A. J., Cheesbrough, J., Gee, S., Bolton, E., Fox A., Hart C. A., Diggle P. J. and Fearnhead, P. (2009). Rapid evolution and the importance of recombination to the gastroenteric pathogen Campylobacter jejuni . Molecular biology and evolution, 26(2), 385-397. Winiecka-Krusnell, J., Wreiber, K., von Euler, A., Engstrand, L., and Linder, E. (2002). Free- living amoebae promote growth and survival of Helicobacter pylori. Scandinavian Journal of Infectious Diseases, 34(4), 253-256. Woodcock, D. J., Krusche, P., Strachan, N. J., Forbes, K. J., Cohan, F. M., Méric, G., and Sheppard, S. K. (2017). Genomic plasticity and rapid host switching can promote the evolution of generalism: a case study in the zoonotic pathogen Campylobacter. Scientific Reports, 7(1), 9650. Wooldridge, K. G., Williams, P. H., and Ketley, J. M. (1996). Host signal transduction and endocytosis of Campylobacter jejuni. Microbial Pathogenesis, 21(4), 299-305. Yao, R., Burr, D. H., and Guerry, P. (1997). CheY‐mediated modulation of Campylobacter jejuni virulence. Molecular Microbiology, 23(5), 1021-1031. Yousuf, F. A., Siddiqui, R., and Khan, N. A. (2013). Acanthamoeba castellanii of the T4 genotype is a potential environmental host for Enterobacter aerogenes and Aeromonas hydrophila. Parasite and Vectors, 6, 169. Zautner, A., and Masanta, W. (2016). Campylobacter: Health Effects and Toxicity. In Encyclopedia of Food and Health, Caballero B., Finglas P. M. and F. Toldra (Eds.), Elsevier. Zhao, Y., Aarnink, A., Koerkamp, P. G., and Hagenaars, T. (2011). Detection of airborne Campylobacter with three bioaerosol samplers for alarming bacteria transmission in broilers. Biological Engineering Transactions, 3(4), 177-186. Ziprin, R. L., and Harvey, R. B. (2004). Inability of cecal microflora to promote reversion of viable nonculturable Campylobacter jejuni. Avian Diseases, 48(3), 647-650.

Chapter 2

Genetic factors of Campylobacter jejuni required for the interaction

with free-living amoebae

Genetic factors of Campylobacter jejuni required for the interaction

with free-living amoebae

Deepti Pranay Samarth1 and Young Min Kwon12.

1Department of Poultry Science, University of Arkansas, Fayetteville, AR, 72701

2Cell and Molecular Biology Program, University of Arkansas, Fayetteville, AR, 72701

*Corresponding author:

Young Min Kwon,

Department of Poultry Science

University of Arkansas

1260 W. Maple St.

Fayetteville, AR, 72701

Phone: 479-575-4935

Email: [email protected]

2.1. Abstract

Acanthamoeba is a free living amoeba ubiquitously present in environmental water and water supply and has been widely considered as the environmental reservoir of several bacterial pathogens, including Campylobacter jejuni, an intracellular pathogen causing self-limiting gastroenteritis in humans. Acanthamoeba- C. jejuni interaction points to the possibility of intricate molecular interactions between the two organisms. In this study, we constructed single deletion mutants of C. jejuni strain 81-176 for the selected 10 genes (motAB, ciaB, kpsE, virB11, cheY, flaAB, cstII, docB, sodB, and cadF) that were previously shown to be important for the interaction

(invasion and intracellular survival) of C. jejuni with mammalian hosts. Two species of

Acanthamoeba (A. castellanii and A. polyphaga) were used to compare the internalization and intracellular survival potential of these mutants versus the wild type C. jejuni 81-176. Modified gentamycin protection assay was used to quantitatively investigate the internalization (3 hrs incubation) and intracellular survival (3 hrs internalization followed by 24 hrs incubation). The internalization percentage was significantly lower for all mutants tested with both A. castellanii and A. polyphaga as compared to the wild type at P < 0.05, except ΔcstII with A. castellanii. For intracellular survival, all mutants showed significantly lower percentage survival in both amoeba strains as compared to the wild type at P < 0.05. For A. castellanii, the internalization and intracellular survival percentage of wild type was 1.72% (±0.27) and 1.71% (±0.07), respectively, whereas for A. polyphaga it was 0.752% (±0.108) and 0.314% (±0.108), respectively. For the assay using A. castellanii, the internalization percentage was the highest for ΔcstII (1.33% ± 0.081) and the lowest for ΔflaAB (0.11% ± 0.06), whereas it was 0.39% ± 0.015 (ΔcstII) and 0.016% ± 0.0006

(ΔflaAB) for the assay using A. polyphaga. The result of this study highlights the conserved mechanisms of C. jejuni internalization and intracellular survival between amoeba and mammalian

hosts and provides a better understanding of the C. jejuni-amoeba interactions, which may lead to the development of effective strategies to reduce the C. jejuni transmission to chickens.

Keyword: Campylobacter, Free-living amoeba, Environmental survival, Host interactions,

Intracellular survival, Genetic factors.

2.2. Introduction

Campylobacter jejuni is a major cause of bacterial gastroenteritis in many countries including developed countries, responsible for 400 million to 500 million cases of diarrhea each year (Ruiz-Palacios 2007, Scheid 2014). In the United States alone, an estimated 2 million cases of campylobacteriosis occur every year costing $2.9 billion of economic burden (Ruiz-Palacios

2007, Bolton 2015). Human campylobacteriosis is mostly a self-limiting acute watery or bloody diarrhea with abdominal cramps and may need hospitalizations. Nevertheless, campylobacteriosis can sometimes lead to severe post-infection complications such as Guillain-

Barré syndrome (GBS) and Miller Fisher syndrome (MFS), which could result in some life- threatening consequences. C. jejuni infections are thought to induce antiganglioside antibodies in these patients (MFS) by molecular mimicry between C. jejuni lipopolysaccharides (LPS) and gangliosides (Ang et al. 2001). Approximately 20% of GBS patients remain severely disabled with approximately 5% mortality, despite immunotherapy (Ang et al. 2001). In addition, reactive arthritis and meningitis have been linked to C. jejuni infection (Ajene, Walker, & Black, 2013;

Tsoni, Papadopoulou, Michailidou, & Kavaliotis, 2012).

C. jejuni is Gram-negative, microaerophilic bacterium from the taxonomical order

Epsilonproteobacteria (On 2001). Except for a cytolethal distending toxin (CDT) and homologs of a type-IV secretion system on the pVir plasmid of strain 81–176, C. jejuni lacks most of the classical virulence factors present in other gastrointestinal pathogens. Therefore, it has been suggested that motility and metabolic capabilities of C. jejuni could be responsible for its virulence and colonization of the host and need future research to gain more insights.

Different species of C. jejuni resides commensally in the intestinal tract of many warm- blooded animals, as well as being ubiquitous in the environment (Horrocks et al. 2009). C. jejuni

is often present in chicken caeca in high bacterial load without any obvious clinical symptoms

(Awad, Hess and Hess 2018). The thermotolerant species of Campylobacter are the most common in human clinical cases where the majority (over 90%) of these cases are caused by C. jejuni (Bolton 2015). Although C. jejuni infections in humans can originate from multiple reservoirs, most cases of campylobacteriosis are often associated with infected poultry carcasses

(Bolton 2015). Horizontal transmission is the most common way of C. jejuni transmission into a chicken flock. Furthermore, during poultry processing, C. jejuni originating from intestinal contents can frequently cause cross-contamination of chicken carcasses.

Water is considered to be a key contributor in the horizontal transmission of C. jejuni in chicken houses (Newell and Fearnley 2003). Additionally, consumption of contaminated water is linked with many human infections and sporadic outbreaks of campylobacteriosis. C. jejuni is identified frequently from environmental untreated water (Moore et al. 2001) which makes recreational water leading cause of water-borne infections (Jones 2001, Hokajärvi et al. 2013).

Nevertheless, there are outbreaks from treated water supply too (Thomas et al. 1998).

Assessment of infections caused due to water sources is often underestimated as most of the infections are not related to outbreaks and those are related may be self-limiting and therefore, every so often does not need medical attention (Olson et al. 2008, Blaser and Engberg 2008). In most of these outbreaks, the numbers of infected patients are smaller in scale as compared to that of food-borne outbreaks, usually less than 5000 cases. Sewage waste, farm animals waste and wild birds carrying C. jejuni commensally in their gut are the primary sources of C. jejuni in contaminated water (Frost 2001). Contaminated recreational water and seepage of septic sewer into ground-water contaminating drinking water supplies are linked with water-related outbreaks

(Pitkänen 2013). Due to different reasons, isolation of C. jejuni strain causing outbreak is usually challenging.

Free-living amoebae (FLA) are gaining recognition as a potential environment reservoir of many intracellular pathogens including C. jejuni (Greub and Raoult 2004, Thomas and

Ashbolt 2010). Microorganisms resisting protozoan grazing are not limited to a particular taxonomic group, instead FLA hosts a phylogenetically diverse group of microorganism comprising viruses, yeast and even protists (Scheid 2014). Common characteristics among amoeba resisting microorganisms include their ability to escape the digestion process of amoeba and survive/grow intracellularly (Matz and Kjelleberg 2005, Greub and Raoult 2004). Numerous reports support the fact that FLA increases the number and virulence of amoeba resisting bacteria

(Scheid 2014, Scheid 2015). Some bacteria which are well studied to survive in FLA are

Legionella spp. (Berk et al. 1998), Mycobacterium spp. (Miltner and Bermudez 2000), Vibrio cholera (Abd et al. 2007), Coxiella burnetii (Scola and Raoult 2001).

FLA are ubiquitously found in the drinking water supply as well as other environmental sources of water and feed on the microorganism present in the aquatic environment (Khan 2006,

Rodríguez-Zaragoza 1994, Siddiqui and Khan 2012). With some exceptions, most members of

FLA are non-pathogenic to humans because of this reason, there are fewer efforts to remove them during water treatment and often escape physical filtration due to their flexible morphology

(Thomas et al. 2010).

Many reports substantiate that C. jejuni, an intracellular bacteria interacts with

Acanthamoeba spp. in environmental water sources (Vieira, Seddon and Karlyshev 2015,

Axelsson-Olsson et al. 2005). Acanthamoeba, commonly present in water and soil, benefit C. jejuni by providing it protection from aerobic stress and physico-chemical stress (Snelling et al.

2008, Axelsson-Olsson et al. 2010a, Axelsson-Olsson et al. 2010b). However, the molecular mechanisms involved in the interaction between C. jejuni and FLA are not well understood.

Deciphering the molecular mechanisms will assist in better understanding C. jejuni transmission and will help in developing effective control strategies.

In the present study, using selected 10 C. jejuni genes with important known functions for C. jejuni to infect and survive within mammalian cells, we have made an attempt to understand the molecular basis of C. jejuni interactions with FLA. Due to potential variations in different amoeba hosts, two strains of Acanthamoeba spp., A. castellanii and A. polyphaga, were used as model organisms in the study.

2.3. Materials and methods

2.3.1. Strains and culture conditions

Campylobacter jejuni Strain 81-176 is used as the wild-type and as a parental strain to construct 10 deletion mutants of selected C. jejuni genes. C. jejuni strain 81-176 used in the experiments was generously provided by Dr. Michael Slavik, University of Arkansas,

Fayetteville AR, U.S.A. C. jejuni strain 81-176 was cultured in Mueller‐Hinton (MH) agar or broth at 37°C in microaerophilic condition where gas composition is O2 (5%), CO2 (10%) and N2

(remaining balance) and are stored in MH broth containing 15% glycerol at -80°C. When necessary antibiotics viz. trimethoprim (10 μg ml−1), chloramphenicol (6 μg ml−1) were added in the media. For all the following experiments, C. jejuni starter culture was prepared by recovering cells from the frozen stock onto MH agar plates with trimethoprim (24 hrs incubation) and passing heavy inoculum from culture plate to 5 ml MH broth followed by 16 hrs incubation. All procedures involving C. jejuni (Biosafety level 2) were conducted according to the protocol approved by the Institutional Biosafety Committee (IBC) at the University of Arkansas.

Two strains of Acanthamoeba (a free-living amoeba) - A. castellanii strain ATCC 50374 and A. polyphaga strain ATCC 30871 were kindly provided by Dr. Kristen E. Gibson

(Department of Food Science, University of Arkansas, Fayetteville AR, U.S.A). The axenic cultivation of the Acanthamoeba species was done in accordance with ATCC protocols using peptone-yeast extract-glucose medium (PYG medium ATCC 712) (pH 6.5) with additives (0.4 mM CaCl2, 4 mM MgSO4·7H2O, 2.5 mM Na2HPO4·7H2O, 2.5 mM KH2PO4, 0.05 mM Fe

(NH4)2(SO4)2·6H2O, 1g/liter sodium citrate·2H2O) (Hsueh and Gibson 2015). Frozen trophozoites (vegetative amoebal cells)/cyst (amoebal dormant form) aliquots were thawed quickly in a water bath at 37°C and resuspended in 10-15 ml of fresh media and centrifuged at

500 rpm for 5 mins, the supernatant is discarded to remove DMSO. Amoeba pellets were suspended in 250 µl of fresh PYG medium and transferred to new T-25 flasks with vent caps containing fresh medium and incubated at 25°C. The cells were passed when ~95% confluent sheet of trophozoites culture was formed on the bottom surface of the flask (i.e., near peak density) which typically takes 2-5 days. The flask was incubated in -20°C for 10 mins followed by tapping to detach amoeba from the flask base and the media containing amoeba trophozoites were collected and used for the further experiments. A mature culture containing a mixture of cysts and trophozoites were detached from a T-flask and resuspended in 15% DMSO for long term preservation in liquid nitrogen.

2.3.2. DNA manipulation and C. jejuni deletion mutant construction

Ten C. jejuni genes, previously known to be important in the interaction of C. jejuni with the mammalian host were selected from the previous studies: cadF (Ziprin et al. 1999), cheY

(Van Vliet and Ketley 2001), ciaB (Hermans et al. 2011), cstII (Louwen et al. 2008), docB

(Hendrixson and DiRita 2004), flaAB (Nachamkin, Yang and Stern 1993), kpsE (Bachtiar, Coloe

and Fry 2007), motAB (Mertins et al. 2012), sodB (Purdy et al. 1999, Chintoan-Uta et al. 2015), and virB11(Larsen and Guerry 2005). These genes were used to construct single deletion mutants for this study. Oligonucleotide primers used in this study are listed in Table 1 and were synthesized by Integrated DNA Technologies (IDT, Coralville, IA). Overlapping PCR protocol described by Hansen et al. (2007) was used to construct deletion cassettes of the target genes mentioned above. Three DNA fragments (PCR products) used to perform overlapping PCR protocol are-1) 400 bp upstream of target gene flanking region (amplified from C. jejuni strain

81-176 genomic DNA), 2) 400 bp downstream target gene flanking region (amplified from C. jejuni strain 81-176 genomic DNA) and 3) Chloramphenicol resistance (CmR) gene (amplified using E.coli strain carrying pRY112 as a DNA template) (Yao, Alm and Guerry 1993). Three gel-purified DNA fragments were joined together by overlapping extension PCR (Phusion®

High-Fidelity DNA Polymerase, New England Biolabs) through overlapping extension sequences incorporated into upstream and downstream region fragments (which are amplified from target gene) creating a DNA cassette. This DNA cassette was used to transform onto electrocompetent C. jejuni cells by electroporation at 2,500 V and plated onto MH agar plate with chloramphenicol and trimethoprim for 48 hrs (Van Vliet et al. 1998). Putative deletion mutants were checked for insertion by PCR and Sanger sequencing before making stock.

Additionally, natural transformation (Van Vliet et al. 1998) was performed to transfer the deletion cassette to a fresh background of C. jejuni strain 81-176 using genomic DNA of confirmed mutant and was again validated by PCR and Sanger sequencing before preservation.

2.3.3. Internalization assay

Role of selected genes in the interaction between C. jejuni and amoeba and was studied using internalization assays. A modification of the gentamicin protection assay described by

Dirks and Quinlan (2014) was used to perform internalization assays where the assay was conducted in centrifuge tubes instead of T-flasks or wells and a low centrifugation speed of 600g for 5 min was used for different washing step to avoid washing off of amoeba cells. Before mixing C. jejuni cells and amoeba cells to make a co-culture to perform the assay, both amoeba and C. jejuni cells were prepared accordingly. The amoeba culture from multiple flasks was pooled and washed three times with PBS (Phosphate buffered saline) by centrifugation at 600g for 5 min and resuspended in PBS. Amoeba trophozoites were counted by performing trypan- blue exclusion assay using hemocytometer and trypan-blue dye (10X) which allowed us to avoid counting of any non-viable amoebae in cell counts. The Amoebae cells were visualized for counting by phase contrast microscopy with a 40x objective in an inverted table-top microscope.

Then it was adjusted to a concentration of 1 X 107 amoebae/mL using PBS. C. jejuni cells were cultured for 16 hrs at 37°C and washed twice before resuspending in PBS. C. jejuni cell concentration was determined by spectrophotometer and checked CFU/ml by plating the culture in MH agar plates and incubating for 48 hrs. Finally, C. jejuni (1 X 109 CFU/mL) was mixed with 100 µL Acanthamoeba culture (1 X 107 amoebae/mL) giving a multiplicity of infection

(MOI) of 1000:1 in a 2ml centrifuge tube. The co-culture was incubated for 3 hrs at room temperature. The co-culture was then resuspended in 1ml of gentamicin (200µg/ml) followed incubated for 2 hrs at room temperature. Then, this co-culture was washed three times to remove any remaining extracellular and attached C. jejuni. Intracellular bacteria were released by treating this co-culture with 1mL PYG (ATCC 712) containing 0.3% Triton X-100 for 20 mins.

After determining the total viable amoeba trophozoites count, the amoeba cell lysate was serially diluted in MHB, plated onto MHA containing 5μg/mL trimethoprim, and incubated 48h at 37°C under microaerophilic conditions to estimate C. jejuni internalization. All the washing steps in

this assay and invasion assay were performed by centrifugation at 600g for 5 mins. At all times an additional control tube containing C. jejuni- amoeba co-culture was processed along with the experimental tubes and after every step, the amoeba cell viability and the count were monitored.

The rate of internalization (ROI), the ratio of internalized C. jejuni from recovered amoeba cells was calculated by first taking out the difference between C. jejuni CFU from the co-culture and that of control tube having no amoeba cells and then dividing with the total number of amoeba cells recovered (Dirks and Quinlan 2014).

[(CFU C. jejuni co-incubated with amoebae cells recovered after internalization assay) – (CFU C. jejuni controls samples)] ROI = ------(Amoebae cells recovered at the end of internalization assay)

2.3.4. 24-hrs intracellular survival assay

Survival for 24 hrs inside amoeba host could provide the required leverage to C. jejuni in the harsh environment and support its transmission. 24 hrs intracellular survival was examined by 24hr intracellular survival assay which was performed in the same way as internalization assay except for the incubation time of C. jejuni-amoeba co-culture was extended to 24 hrs After

24 hrs-intracellular survival period, which was followed after 3 hrs internalization period, the extracellular C. jejuni were washed using gentamicin (200µg/ml for 1 hr) and the experimental tubes incubated for 24 hrs and then Triton X-100 treatment (0.3% in PBS for 20 mins) was performed. Subsequently, after the Triton-X 100 incubation all tubes viz. control tube (C. jejuni without amoebae) and other experimental tubes containing both C. jejuni (wildtype and mutants) and amoeba were serially diluted in MHB, plated onto MHA containing trimethoprim and chloramphenicol (for experimental tubes containing C. jejuni deletion mutants), and incubated

48 hrs at 37 °C under microaerophilic conditions to evaluate C. jejuni 24 hrs intracellular survival. The rate of intracellular survival (ROIS), the ratio of C. jejuni from recovered amoeba cells after the 24 hrs survival period was calculated in the same way as ROI.

[(CFU C. jejuni co-incubated with amoebae cells recovered after 24hr survival period) – (CFU C. jejuni controls samples)] ROIS = ------(Amoebae cells recovered at the end of 24hr survival assay)

2.3.5. Statistical analysis

JMP® genomics 9.0 software program (SAS, Cary, NC) was used for statistical analysis.

The statistical significance of differences between groups was determined by one-way analysis of variance (ANOVA) using by each pair Student’s t-test and the difference was considered statistically significant at P < 0.05. The results are expressed as the mean ± standard error. All the experiments were performed at least in triplicate to ensure the replicability of results.

2.4. Results

There are many sporadic outbreaks of C. jejuni which indicate that campylobacteriosis can be spread by ingestion of water contaminated with C. jejuni (Jones 2001, Kuusi et al. 2005).

C. jejuni is a fastidious bacteria and free-living amoeba have been associated with its environmental survival from a few years (Axelsson-Olsson et al. 2005, Axelsson-Olsson et al.

2010a). We have selected 10 C. jejuni genes which are responsible for invasion to and intracellular survival in mammalian cells to get more insights about C. jejuni-Acanthamoeba interaction. This experimental approach is based on the hypothesis that a certain set of molecular mechanisms utilized by C. jejuni to interact with the host cells is conserved between amoeba and mammalian cells. Many previous studies with focus on other bacterial pathogens have shown that there are conserved mechanisms (Segal and Shuman 1999, Habyarimana et al. 2008). In the current study, the 10 genes were selected based on different factors which are important for C. jejuni host-interaction which includes chemotaxis, motility, adhesion, invasion, and intracellular survival. We constructed 10 deletion mutants using overlapping PCR protocol as described by

Hansen et al. (2007). Utilizing the above mentioned 10 knock-out mutants of C. jejuni, an attempt to study the internalization and hrs intracellular survival of C. jejuni cells using Modified

gentamicin protection assay described by Dirks and Quinlan (2014) in its environmental host

Acanthamoeba was made.

2.4.1. Internalization assay

C. jejuni is invasive in nature to both human epithelial and macrophage cells (Skarp et al.

2015). Internalization in amoeba host could be a vital step for intracellular C. jejuni to seek shelter in its environmental survival process. Simultaneously, amoebae cells are known to graze on planktonic bacteria present in both environmental soil and water which complicates the understanding of the C. jejuni-Acanthamoeba interaction. The internalization assay is aimed to quantify the internalized C. jejuni cells by enumeration of C. jejuni cells recovered from the 3 hrs

C. jejuni-Acanthamoeba co-culture. In the current study, we compared the C. jejuni ROI inside amoeba cells between C. jejuni wild-type strain and 10 deletion mutants of C. jejuni by conducting the internalization assay.

We used 2 strains of Acanthamoeba viz. A. castellanii and A. polyphaga to study the C. jejuni internalization. The results obtained after performing internalization assay is presented in

Figure 1, 2 and 3. We found that after optimization, we were able to get maximum and consistent number of C. jejuni recovered after using 3 hrs co-culture incubation time (data not shown). We noticed that ROI of wild-type C. jejuni was more than double in A. castellanii co-culture (1.72%

± 0.27%) as compared between to A. polyphaga co-culture (0.752% ± 0.1085%) at P < 0.05.

Conversely, in both Amoeba host - A. castellanii and A. polyphaga co-culture, when ROI was also compared among different combinations of co-culture (wildtype and 10 deletion mutants), we found ROI of wild-type was significantly higher at P < 0.05 as compared to all the deletion mutants except CJΔcstII in C. jejuni-A.castellanii. In both C. jejuni-A.castellanii co-culture, among the 10 deletion mutant, we found ROI of CJΔcstII (1.33% ± 0.081 in C. jejuni-

A.castellanii co-culture; 0.3863% ± 0.015% in C. jejuni-A. polyphaga co-culture) was found highest and ROI of CJΔflaAB (0.111% ± 0.0605% in C. jejuni-A.castellanii co-culture; 0.0156 %

± 0.0006 % in C. jejuni-A. polyphaga co-culture) was the lowest.

2.4.2. 24-hrs survival assay

The successful endobionts which can thrive inside free-living amoeba have evolved to resist protozoan grazing (Balczun and Scheid 2017). Few of them use the strategy to avoid degradation by escaping digestion in amoeba cells, often inside non-digestive vacuoles (Bozue and Johnson 1996, Cirillo et al. 1997, Lamothe, Thyssen and Valvano 2004). The ability to survive for a long time inside amoeba cells could help C. jejuni to lie dormant for an extended period of time and flourish when the time is favourable to C. jejuni. We endeavoured to examine the long term survival of C. jejuni inside amoeba cells by carrying out 24 hrs survival assay performed in a similar way as internalization assay. An extended 24 hrs incubation time of C. jejuni-Acanthamoeba co-culture was applied after removing the extracellular C. jejuni cells by gentamicin treatment. At the end of 24 hrs incubation period, the intracellular C. jejuni was released by treating the amoeba with Triton-X 100 (detergent).

The results of 24 hrs survival assay, comparing survival efficiency of 10 deletion mutants with the wildtype C. jejuni cells into 2 amoeba host are presented in Figure 1, 2 and 3. To get a better picture where we can easily visualize the difference in comparative survival efficiency of deletion mutants and strain background variation of amoeba host, we have combined the results from the internalization assay and 24 hrs survival assay into 3 graphs (Figure 1, 2 and 3). Figure

1, 2 and 3 is divided based on the gene functions of the genes used to create the deletion mutants, where figure 1 highlights the results from deletions mutants affecting the adhesion and chemotaxis. Figure 2 shows the result from deletion mutants affecting invasion and sialyation of

LOSs (lipooligosaccharide) and figure 3 shows results from deletion mutants affecting motility and oxidative stress response.

We found variation in the final result of the 24 hrs survival assay when C. jejuni wildtype-A. castellanii co-culture and C. jejuni wild-type-A. polyphaga co-culture was compared.

The percent survival of C. jejuni after the internalization assay (1.72% ± 0.27%) and after 24 hrs survival assay (1.71% ± 0.07%) in C. jejuni wild-type-A. castellanii co-culture is almost the same. However, in a C. jejuni -A. polyphaga co-culture recovery of C. jejuni reduced by nearly half after 24 hrs survival assay (0.752% ± 0.1085%) as compared to recovery after internalization assay (0.314% ± 0.108%).

In the 24 hrs survival assay of both co-cultures (C. jejuni -A. castellanii co-culture and C. jejuni -A. polyphaga co-culture), all mutants showed significantly lower percentage survival as compared to wild type at P < 0.05. In C. jejuni-A.castellanii co-culture, among the 10 deletion mutant, we found ROIS (rate of intracellular survival) of CJΔdocB (0.529 % ± 0.123) was found highest and ROIS of CJΔkpsE (0.0144 ± 0.005) was lowest. In A. polyphaga co-culture, ROI is highest in CJΔcadF (0.1844 0.0089) and is lowest for CJΔflaAB (0.0017 ± 0.00017).

2.5. Discussion

FLA are known to be an environmental host for many organisms smaller than them in size (Scheid 2014, Scheid 2015). The amoeba graze and depend on these organisms for their food (Horn and Wagner 2004). Amoeba grazing is a major cause of depletion of microbial ecosystem and amoeba graze on both planktonic microorganisms and microbial biofilms (Huws,

McBain and Gilbert 2005, Matz and Kjelleberg 2005, Matz and Jürgens 2005). Simultaneously, a number of studies have emphasized the role of unicellular eukaryotes, particularly (FLA on the survival and dissemination of many waterborne bacterial pathogens ((Balczun and Scheid 2017).

FLA grazing is resisted by many bacteria (Matz and Kjelleberg 2005, Olofsson et al. 2013, Matz and Jürgens 2005). Many of them can survive intracellularly including C. jejuni (Olofsson et al.

2013), Mycobacterium avium (Steinert et al. 1998), Legionella pneumophila (Bozue and Johnson

1996), Listeria monocytogenes (Zhou, Elmose and Call 2007), Francisella tularensis (Abd et al.

2003) and Vibrio cholera (Abd et al. 2007).

Individual cases and sporadic outbreaks of campylobacteriosis often caused by contaminated water raises questions on the mechanism by which C. jejuni survive in the environments. Despite having a fastidious nature in culture in laboratory conditions, C. jejuni can survive in the environment for long periods of time (Joshua et al. 2006). Free-living amoeba in environmental water could provide a safer protection from inhospitable environmental conditions and may support its survival under atmospheric oxygen tension. Association of C. jejuni with free-living amoeba and algae in environmental water is described now for more than a decade through many scientific reports (Snelling et al. 2005, Snelling et al. 2008, Axelsson-Olsson et al.

2005, Axelsson-Olsson et al. 2010a). Snelling et al. (2008) indicated that FLA which contain C. jejuni intracellularly can transmit C. jejuni to chickens in chicken-houses and this increases the risk of transmission from drinking water. Olofsson et al. (2015) have demonstrated that the presence of FLA increase survival efficiency of C. jejuni in milk and orange juice which also could add to cases of campylobacteriosis. Co-cultures with Acanthamoeba is even recognized to enrich the low concentration of Campylobacter spp. from environmental samples without the dependency of microaerophilic conditions which is a basic requirement for the culture of C. jejuni in conventional culture technique (Axelsson-Olsson et al. 2007, Reyes-Batlle et al. 2017).

Moreover, evidence suggest that the presence of Acanthamoeba helps C. jejuni to increase tolerance towards chemical stress commonly occurring in the environment, including chlorine

used to treat drinking water (Axelsson-Olsson et al. 2010b, King et al. 1988). There are scientific reports focused on interactions of C. jejuni with Acanthamoeba with a mixed conclusions (Vieira et al. 2015). Most studies support the idea of intracellular survival of C. jejuni inside

Acanthamoeba cells which is one of the most commonly isolated free-living amoebae in environmental water source (Snelling et al. 2005, Axelsson-Olsson et al. 2005, Olofsson et al.

2013, Snelling et al. 2008). Axelsson-Olsson et al.(2005) have provided microscopic image of A. polyphaga infected by C. jejuni inside its vacuole sometime after the co-culture. Olofsson et al.

(2013) showed that C. jejuni can actively invade Acanthamoeba polyphaga and persist and replicate in the vacuole. On the contrary, some other reports accept the advantages by the

Acanthamoeba co-cultures on C. jejuni survival but are skeptical about the intracellular survival of C. jejuni (Bui et al. 2012a, Bui et al. 2012b, Baré et al. 2010). Bui et al. (2012b) have suggested that presence of Acanthamoeba cells in C. jejuni surrounding have reduce oxidative stress in C. jejuni as FLA depletes oxygen from surrounding. In both ways- intracellularly or in

Acanthamoeba’s proximity, the association between Acanthamoeba and C. jejuni can significantly affect C. jejuni transmission to both humans directly and in sources which could eventually increase incidences of C. jejuni infections in human. This creats an urgency to study different aspects of this interaction, especially molecular interaction as we have little knowledge about it.

This is the first attempt to understand genetic factors of C. jejuni in interaction with

Acanthamoeba. While choosing the candidate genes which could be important in the

Acanthamoeba-C. jejuni interaction we had to guesstimate the genes which could be important in this interaction. We observed that there are similarities between Acanthamoeba cell and mammalian cells. Both mammalian cells and Acanthamoeba cells are eukaryotic cells

(Casadevall 2008). Human macrophages is analogous in its 1) morphology and structural features (Siddiqui and Khan 2012), 2) amoebic invasive properties including phagocytosis

(Lamothe et al. 2004, Olofsson et al. 2013, Watson and Galán 2008) and 3) share similarity in mechanisms at the transcriptional, post-transcriptional and cellular levels (Habyarimana et al.

2008, Molmeret et al. 2005, Escoll et al. 2013, Derengowski et al. 2013, Cróinín and Backert

2012, Elmi et al. 2012). In the way numerous bacteria infect and multiply amoeba cells share an intriguing similarity with mammalian cells especially human macrophage cells (Cardas, Khan and Alsam 2012, Khan 2009). These similarities are demonstrated in studies focused on

Staphylococcus aureus (Cardas et al. 2012) and Legionella pneumophila (Segal and Shuman

1999, Kim et al. 2009, Al-Khodor et al. 2009). C. jejuni can infect and persist intracellularly inside vacuoles in both mammalian and Acanthamoeba cells. These point towards the possibility that bacteria could carry out their infection in both hosts in a similar fashion. There is considerable research on the genetic basis of interactions between C. jejuni and mammalian cells like human epithelial and macrophage cells (Herman et al. 2011, Hendrixson and DiRita 2004).

We focused on 6 different molecular mechanisms and related genes of C. jejuni which play important role in colonization and survival inside mammalian cells viz. cell adhesion- cadF

(Patrone et al. 2013), motility - flaAB (Yao et al. 1994, Nachamkin et al. 1993), motAB (Mertins et al. 2012, Van Alphen et al. 2012), invasion - ciaB (Dasti et al. 2010, Christensen, Pacheco and

Konkel 2009, Konkel et al. 1999), kpsE (Bachtiar et al. 2007, Bacon et al. 2001), virB11 (Bacon et al. 2000, Wieczorek and Osek 2008), chemotaxis - cheY (Yao, Burr and Guerry 1997, Chang and Miller 2006), docB 2 (Müller et al. 2006, Vegge et al. 2009), sialyation of lipooligosaccharide (cstII) (Louwen et al. 2008)and oxidative stress (sodB (Chintoan-Uta et al.

2015, Gaynor et al. 2005).

We chose two strains of Acanthamoeba which were different in their cell sizes, viz. A. casetallani and A. polyphaga to examine their ability to harbor C. jejuni. Choosing two strains of most commonly isolated FLA from environmental water sources (Rodríguez-Zaragoza 1994,

Khan 2006) would provide more competent results obtained after these experiments.

Acanthamoeba are the convenient choice to study interactions of C. jejuni with FLA as 1) They can be grown axenically (without using bacteria as amoeba feed 2. Significantly prolong C. jejuni viability in low nutrient conditions (Axelsson-Olsson et al. 2005) 3.It has been reported to protect some bacteria from halogen disinfectants (Snelling et al. 2008).

Typically, the survival of C. jejuni inside a host cell is examined using the gentamicin protection assay (Bryne et al. 2007). We tried to use gentamicin protection assay (GPA) to study the internalization and intracellular survival potential of deletion mutants (of selected 10 candidate genes) to survive inside amoeba host cells which would give us understanding of the role of these gene in the interaction with the amoeba host. During the assay gentamicin is used to remove all the C. jejuni on the surface of amoeba cell and in the suspension after the

Acanthamoeba – C. jejuni co-culture after incubation for 3 hrs. Unfortunately, we experienced variations between different replicates of GPA due to the suspension nature of the

Acanthamoeba cell culture. As, the cells are loosely attached to the base of the culture flask and upon different washing steps we lose cells with the wash. This caused variation in the count of

Acanthamoeba cells and eventually leading to inconsistently recovered C. jejuni cells. We found that by using a modification of GPA known as ‘Modified Gentamicin Protection assay’ (MGPA) developed by Dirks and Quinlan (2014), we were able to eliminate the problem of experimental variation as we lose minimal Acanthamoeba cells during the assay. Also, by counting

Acanthamoeba cells after the assay is performed we know exactly how many Acanthamoeba

cells are remaining which helps us to calculate the survival percentage of recovered C. jejuni.

MGPA was conducted in centrifuge tubes instead of culture flask and a low centrifugation speed of 600g (to reduce the cell damage by centrifugation) for 5min was used for washing to avoid washing off of the amoeba cells. Besides, at the starting of the experiment we counted the number of Acanthamoeba and C. jejuni cells to be used in the experiment. Acanthamoeba cells number and cells viability was monitored at each step and which help us eliminate the experimental variation. We also observed that higher number of C. jejuni was recovered after the modified gentamicin assay in a C. jejuni-amoeba co-culture as compare to that of C. jejuni growing without amoeba (data not shown).

We carefully choose 3 hrs incubation time in the internalization assay after experimental optimization to allow maximum internalization of C. jejuni. Allowing longer incubation period did not helped in increasing the number of C. jejuni in the internalization assay (data not shown).

Internalization inside Acanthamoeba would protect C. jejuni from external inhabitable environment, but intracellular survival is critical for C. jejuni for its further transmission to primary hosts. We performed MGPA with an extended 24 hrs period to monitor C. jejuni survival in Acanthamoeba cells. The difference between internalization versus 24 hrs survival assay was that the incubation time for internalization assay was 3 hrs, after which the samples were plated on MH agar plates (with chloramphenicol) to determine the CFUs of bacteria internalized.

Whereas, in 24 hrs intracellular survival assay, extracellular bacteria were washed using gentamicin after 3 hrs internalization period and incubated for 24 hrs before cell counts were determined. Our results are in line with results presented with Axelsson-Olsson et al (2005) which also supports the survival of C. jejuni in A. polyphaga for upto 48 hrs. The survival of C. jejuni for 24hr would indicate the ability of C. jejuni to persist in amoeba cells for a duration which

could be significant enough to affect C. jejuni transmission and could play a major role in C. jejuni epidemiology. There are different sets of mechanism needed to be activated for C. jejuni to survive intracellularly.

We found that there is a variation among two Acanthamoeba strains in their ability for internalization/uptake of C. jejuni cells. A. castellanii was better in internalizing C. jejuni cells as compared to A. polyphaga. Similar tendency was also reflected in the 24 hrs survival assay where C. jejuni was able to survive intracellularly for a longer period of time in A. castellanii as compared to A. polyphaga. We know that the two Acanthamoeba strains differ in their cell size and there could be differences in their bacterivorous ability. It is hard to speculate on the possible reasons of this variation and more research is needed to improve understanding of different factors which could contribute towards their bacterivorous ability of Acanthamoeba strains.

The results of internalization and 24 hrs survival assay where 10 single gene deletion mutants of C. jejuni were compared in their ability to internalize in 3hr co-culture and survive intracellularly for 24 hrs in 2 Acanthamoeba host show that there are many similarities in the mechanism of internalization and survival between Acanthamoeba and mammalian cells. We found that all the selected 10 C. jejuni genes that are important in mammalian cell internalization and intracellular survival are also important in the interaction studies with A. castellanii (except

ΔCJcstII which had lower ROIS as compared to WT but was not significant (P > 0.05). The same trend was observed in the interaction study with A. polyphaga host where all the genes appear to be important for the C. jejuni- A. polyphaga interaction.

When we made comparisons among these genes after internalization assay in A. castellanii host, mutants related to the motility had the most disadvantage, which made us think that genes flaAB which encodes for flagellar filament protein (Nachamkin et al. 1993, Yao et al.

1994) and motAB encodes for the flagellar motor which enables the rotation of the flagellum

(Mertins et al. 2012) are the most important among 10 selected genes for the internalization.

These proteins are not only responsible for the motility which is a requisite for C. jejuni to infect the host but also is a chief virulence factor and a vital component for export of virulence proteins

(Konkel et al. 2004). Among the selection of 10 genes, mutation in cstII gene least affected the internalization potential of C. jejuni to invade A. castellanii. cstII is responsible for sialyation of

LOSs which is a major virulence factor of C. jejuni (Hermans et al. 2011) and also a major determinant for microbial cell adhesion and epithelial cell invasion (Louwen et al. 2008). In comparison between percentage survival of C. jejuni cells after A. castellanii internalization assay and after 24 hrs survival assay using ΔCJdocB and ΔCJcadF, we did not find a decrease in percentage recovered C. jejuni cells unlike other deletion mutants. This result point towards less significance of docB and cadF gene in intracellular survival in A. castellanii as compared to other genes. docB encodes for methyl‐accepting chemotaxis domain signal (Lertsethtakarn,

Ottemann and Hendrixson 2011) whereas cadF is gene encoding a fibronectin‐binding protein and responsible for adhesion to mammalian cells. Both of these genes are known to reduce colonization in mammalian cells in case of their absence (Vegge et al. 2009, Hendrixson and

DiRita 2004, Ziprin et al. 1999). Conversely, ROIS reduced drastically as compared to ROI of

ΔCJciaB, ΔCJkpsE, ΔCJvirB and ΔCJcstII which suggest that ciaB, virB and cstII play an important role in intracellular survival process in A. castellanii cells.

When we look closely at the interaction between A. polyphaga and deletion mutants/WT of C. jejuni, we found the trend is similar, as it was with interaction with A. castellanii host with some differences. All of these genes appear to be important for the C. jejuni- A. polyphaga interaction. The gene most altering internalization potential in A. polyphaga host was flaAB but

recovery of motAB deletion mutants were not as reduced as it was in A. castellanii host even though motAB would also affect motility. Intracellular survival was affected most by altering genes all the selected genes but eminent among them were cstII, kpsE, cheY, motAB, docB and flaAB. Deletion of docB had almost no effect on intracellular survival of C. jejuni in A. castellanii but it is not the case with A. polyphaga host.

The result of this study highlights the conserved mechanisms of C. jejuni internalization and intracellular survival between amoeba and mammalian hosts. The involvement of multiple genes in the interaction with amoeba indicates that C. jejuni utilize multiple mechanisms to invade and survive in amoeba. The result of intracellular assay also indicate towards the possibility that C. jejuni may seek shelter in amoeba to survive in chicken house water supply.

Acanthamoeba is not only associated with a transient host in the environment where it is also termed as “Trojan horses of microbial world” (Barker and Brown 1994) but also suspected to be a (evolutionary) training grounds where these endosymbionts bacteria improve and develop mechanism for infecting higher animals (Molmeret et al. 2005, Casadevall 2008, Harb, Gao and

Kwaik 2000, Goebel and Gross 2001, Al-Quadan, Price and Kwaik 2012). This theory can be supported by our study to as we found similarity in mechanism by which C. jejuni infect both amoeba cell and mammalian cells. Also, the interactions between Legionellae and FLA

(Habyarimana et al. 2008, Al-Khodor et al. 2009) and chlamydia-related symbionts of FLA

(Greub, Mege and Raoult 2003, Casson et al. 2006) shows strong similarity with processes that occur during infection of mammalian cells by Legionellae (Molmeret et al. 2005, Escoll et al.

2013) and Cryptococcus neoformans (Chrisman, Alvarez and Casadevall 2010). FLA infection by these bacteria is also suspected to increase virulence of bacteria towards mammalian cells

(Cirillo et al. 1997, Casadevall, Steenbergen and Nosanchuk 2003, Derengowski et al. 2013).

Our study is an effort to enlighten a small portion of molecular mechanism in C. jejuni-

Acanthamoeba interaction. We emphasize on necessarily to more elaborate and detailed studies which uncover more traits of in C. jejuni- Acanthamoeba interaction. A better understanding of these processes will help to develop novel strategies and targets for vaccines and antibiotics against C. jejuni. Although, there are some studies which shows the role of FLA in transmission of C. jejuni. Further studies are needed to obtain more detailed insights of role of free-living amoeba host in C. jejuni epidemiology.

2.6. References

Abd, H., T. Johansson, I. Golovliov, G. Sandström and M. Forsman (2003) Survival and growth of Francisella tularensis in Acanthamoeba castellanii. Applied and Environmental Microbiology, 69, 600-606. Abd, H., A. Saeed, A. Weintraub, G. B. Nair and G. Sandström (2007) Vibrio cholerae O1 strains are facultative intracellular bacteria, able to survive and multiply symbiotically inside the aquatic free-living amoeba Acanthamoeba castellanii. FEMS Microbiology Ecology, 60, 33-39. Ajene, A. N., Walker, C. L. F., and Black, R. E. (2013). Enteric pathogens and reactive arthritis: a systematic review of Campylobacter, Salmonella and Shigella-associated reactive arthritis. Journal of Health, Population and Nutrition, 31(3), 299. Al-Khodor, S., S. Kalachikov, I. Morozova, C. T. Price and Y. A. Kwaik (2009) The PmrA/PmrB two-component system of Legionella pneumophila is a global regulator required for intracellular replication within macrophages and protozoa. Infection and Immunity, 77, 374-386. Al-Quadan, T., C. T. Price and Y. A. Kwaik (2012) Exploitation of evolutionarily conserved amoeba and mammalian processes by Legionella. Trends in Microbiology, 20, 299-306. Ang, C., M. De Klerk, H. Endtz, B. Jacobs, J. Laman, F. Van Der Meche and P. Van Doorn (2001) Guillain-Barré syndrome-and Miller Fisher syndrome-associated Campylobacter jejuni lipopolysaccharides induce anti-GM1 and anti-GQ1b antibodies in rabbits. Infection and Immunity, 69, 2462-2469. Awad, W. A., C. Hess and M. Hess (2018) Re-thinking the chicken–Campylobacter jejuni interaction: a review. Avian Pathology, 47, 352-363. Axelsson-Olsson, D., P. Ellström, J. Waldenström, P. D. Haemig, L. Brudin and B. Olsen (2007) Acanthamoeba-Campylobacter coculture as a novel method for enrichment of Campylobacter species. Applied and Environmental Microbiology, 73, 6864-6869. Axelsson-Olsson, D., J. Olofsson, L. Svensson, P. Griekspoor, J. Waldenström, P. Ellström and B. Olsen (2010a) Amoebae and algae can prolong the survival of Campylobacter species in co-culture. Experimental Parasitology, 126, 59-64. Axelsson-Olsson, D., L. Svensson, J. Olofsson, P. Salomon, J. Waldenström, P. Ellström and B. Olsen (2010b) Increase in acid tolerance of Campylobacter jejuni through coincubation with amoebae. Applied and Environmental Microbiology, 76, 4194-4200. Axelsson-Olsson, D., J. Waldenström, T. Broman, B. Olsen and M. Holmberg (2005) Protozoan Acanthamoeba polyphaga as a potential reservoir for Campylobacter jejuni. Applied and Environmental Microbiology, 71, 987-92. Bachtiar, B. M., P. J. Coloe and B. N. Fry (2007) Knockout mutagenesis of the kpsE gene of Campylobacter jejuni 81116 and its involvement in bacterium–host interactions. FEMS Immunology and Medical Microbiology, 49, 149-154.

Bacon, D. J., R. A. Alm, D. H. Burr, L. Hu, D. J. Kopecko, C. P. Ewing and P. Guerry (2000) Involvement of a plasmid in virulence of Campylobacter jejuni 81-176. Infection and Immunity, 68, 4384-4390. Bacon, D. J., C. M. Szymanski, D. H. Burr, R. P. Silver, R. A. Alm and P. Guerry (2001) A phase‐variable capsule is involved in virulence of Campylobacter jejuni 81‐176. Molecular Microbiology, 40, 769-777. Balczun, C. and P. Scheid (2017) Free-living amoebae as hosts for and vectors of intracellular microorganisms with public health significance. Viruses, 9, 65. Barker, J. and M. Brown (1994) Trojan horses of the microbial world: protozoa and the survival of bacterial pathogens in the environment. Microbiology, 140, 1253-1259. Baré, J., K. Sabbe, S. Huws, D. Vercauteren, K. Braeckmans, I. Van Gremberghe, H. Favoreel and K. Houf (2010) Influence of temperature, oxygen and bacterial strain identity on the association of Campylobacter jejuni with Acanthamoeba castellanii. FEMS Microbiology Ecology, 74, 371-381. Berk, S. G., R. S. Ting, G. W. Turner and R. J. Ashburn (1998) Production of respirable vesicles containing live Legionella pneumophila cells by two Acanthamoeba spp. Applied and Environmental Microbiology, 64, 279-286. Blaser, M. J. and J. Engberg. 2008. Clinical aspects of Campylobacter jejuni and Campylobacter coli infections. In Campylobacter, Third Edition, 99-121. American Society of Microbiology. Bolton, D. J. (2015) Campylobacter virulence and survival factors. Food Microbiology, 48, 99- 108. Bozue, J. A. and W. Johnson (1996) Interaction of Legionella pneumophila with Acanthamoeba castellanii: uptake by coiling phagocytosis and inhibition of phagosome-lysosome fusion. Infection and Immunity, 64, 668-673. Bui, X. T., K. Qvortrup, A. Wolff, D. D. Bang and C. Creuzenet (2012a) Effect of environmental stress factors on the uptake and survival of Campylobacter jejuni in Acanthamoeba castellanii. BMC Microbiology, 12, 232. Bui, X. T., A. Winding, K. Qvortrup, A. Wolff, D. D. Bang and C. Creuzenet (2012b) Survival of Campylobacter jejuni in co‐culture with Acanthamoeba castellanii: role of amoeba‐ mediated depletion of dissolved oxygen. Environmental Microbiology, 14, 2034-2047. Byrne C. M, Clyne M., Bourke B. (2007) Campylobacter jejuni adhere to and invade chicken intestinal epithelial cells in vitro. Microbiology 153, 561-569. Cardas, M., N. A. Khan and S. Alsam (2012) Staphylococcus aureus exhibit similarities in their interactions with Acanthamoeba and ThP1 macrophage-like cells. Experimental Parasitology, 132, 513-518. Casadevall, A. (2008) Evolution of intracellular pathogens. Annual. Review Microbiology., 62, 19-33.

Casadevall, A., J. N. Steenbergen and J. D. Nosanchuk (2003) ‘Ready made’virulence and ‘dual use’virulence factors in pathogenic environmental fungi—the Cryptococcus neoformans paradigm. Current Opinion in Microbiology, 6, 332-337. Casson, N., N. Medico, J. Bille and G. Greub (2006) Parachlamydia acanthamoebae enters and multiplies within pneumocytes and lung fibroblasts. Microbes and Infection, 8, 1294- 1300. Chang, C. and J. F. Miller (2006) Campylobacter jejuni colonization of mice with limited enteric flora. Infection and Immunity, 74, 5261-5271. Chintoan-Uta, C., R. L. Cassady-Cain, H. Al-Haideri, E. Watson, D. J. Kelly, D. G. Smith, N. H. Sparks, P. Kaiser and M. P. Stevens (2015) Superoxide dismutase SodB is a protective antigen against Campylobacter jejuni colonisation in chickens. Vaccine, 33, 6206-6211. Chrisman, C. J., M. Alvarez and A. Casadevall (2010) Phagocytosis of Cryptococcus neoformans by and nonlytic exocytosis from Acanthamoeba castellanii. Applied and Environmental Microbiology, 76, 6056-6062. Christensen, J. E., S. A. Pacheco and M. E. Konkel (2009) Identification of a Campylobacter jejuni secreted protein required for maximal invasion of host cells. Molecular Microbiology, 73, 650-662. Cirillo, J. D., S. Falkow, L. S. Tompkins and L. E. Bermudez (1997) Interaction of Mycobacterium avium with environmental amoebae enhances virulence. Infection and Immunity, 65, 3759-3767. Cróinín, T. Ó. and S. Backert (2012) Host epithelial cell invasion by Campylobacter jejuni: trigger or zipper mechanism? Frontiers in Cellular and Infection Microbiology, 2. Dasti, J. I., A. M. Tareen, R. Lugert, A. E. Zautner and U. Groß (2010) Campylobacter jejuni: a brief overview on pathogenicity-associated factors and disease-mediating mechanisms. International Journal of Medical Microbiology, 300, 205-211. Derengowski, L. d. S., H. C. Paes, P. Albuquerque, A. H. F. Tavares, L. Fernandes, I. Silva- Pereira and A. Casadevall (2013) The transcriptional response of Cryptococcus neoformans to ingestion by Acanthamoeba castellanii and macrophages provides insights into the evolutionary adaptation to the mammalian host. Eukaryotic cell, 12, 761-774. Dirks, B. P. and J. J. Quinlan (2014) Development of a modified gentamicin protection assay to investigate the interaction between Campylobacter jejuni and Acanthamoeba castellanii ATCC 30010. Experimental parasitology, 140, 39-43. Elmi, A., E. Watson, P. Sandu, O. Gundogdu, D. C. Mills, N. F. Inglis, E. Manson, L. Imrie, M. Bajaj-Elliott and B. W. Wren (2012) Campylobacter jejuni outer membrane vesicles play an important role in bacterial interactions with human intestinal epithelial cells. Infection and Immunity, 80, 4089-4098. Escoll, P., M. Rolando, L. Gomez-Valero and C. Buchrieser. 2013. From amoeba to macrophages: exploring the molecular mechanisms of Legionella pneumophila infection in both hosts. In Molecular Mechanisms in Legionella Pathogenesis, 1-34. Springer.

Frost, J. (2001) Current epidemiological issues in human campylobacteriosis. Journal of Applied Microbiology, 90, 85S-95S. Gaynor, E. C., D. H. Wells, J. K. MacKichan and S. Falkow (2005) The Campylobacter jejuni stringent response controls specific stress survival and virulence‐associated phenotypes. Molecular Microbiology, 56, 8-27. Goebel, W. and R. Gross (2001) Intracellular survival strategies of mutualistic and parasitic prokaryotes. Trends in Microbiology, 9, 267-273. Greub, G., J.-L. Mege and D. Raoult (2003) Parachlamydia Acanthamoeba enters and multiplies within human macrophages and induces their apoptosis. Infection and Immunity, 71, 5979-5985. Greub, G. and D. Raoult (2004) Microorganisms resistant to free-living amoebae. Clinical Microbiology Reviews, 17, 413-433. Habyarimana, F., S. Al‐khodor, A. Kalia, J. E. Graham, C. T. Price, M. T. Garcia and Y. A. Kwaik (2008) Role for the Ankyrin eukaryotic‐like genes of Legionella pneumophila in parasitism of protozoan hosts and human macrophages. Environmental Microbiology, 10, 1460-1474. Hansen, C. R., A. Khatiwara, R. Ziprin and Y. M. Kwon (2007) Rapid construction of Campylobacter jejuni deletion mutants. Letters in Applied Microbiology, 45, 599-603. Harb, O. S., L. Y. Gao and Y. A. Kwaik (2000) From protozoa to mammalian cells: a new paradigm in the life cycle of intracellular bacterial pathogens. Environmental Microbiology, 2, 251-265. Hendrixson, D. R. and V. J. DiRita (2004) Identification of Campylobacter jejuni genes involved in commensal colonization of the chick gastrointestinal tract. Molecular Microbiology, 52, 471-484. Hermans, D., K. Van Deun, A. Martel, F. Van Immerseel, W. Messens, M. Heyndrickx, F. Haesebrouck and F. Pasmans (2011) Colonization factors of Campylobacter jejuni in the chicken gut. Veterinary Research, 42, 82. Hokajärvi, A.-M., T. Pitkänen, H. M. Siljanen, U.-M. Nakari, E. Torvinen, A. Siitonen and I. T. Miettinen (2013) Occurrence of thermotolerant Campylobacter spp. and adenoviruses in Finnish bathing waters and purified sewage effluents. Journal of Water and Health, 11, 120-134. Horn, M. and M. Wagner (2004) Bacterial Endosymbionts of Free‐living Amoebae 1. Journal of Eukaryotic Microbiology, 51, 509-514. Horrocks, S. M., R. C. Anderson, D. J. Nisbet and S. C. Ricke (2009) Incidence and ecology of Campylobacter jejuni and coli in animals. Anaerobe, 15, 18-25. Hsueh, T. Y. and K. E. Gibson (2015) Interactions between human norovirus surrogates and Acanthamoeba spp. Applied and Environmental Microbiology, 81, 4005-4013.

Huws, S., A. McBain and P. Gilbert (2005) Protozoan grazing and its impact upon population dynamics in biofilm communities. Journal of Applied Microbiology, 98, 238-244. Jones, K. (2001) Campylobacters in water, sewage and the environment. Journal of Applied Microbiology, 90, 68S-79S. Joshua, G. P., C. Guthrie-Irons, A. Karlyshev and B. Wren (2006) Biofilm formation in Campylobacter jejuni. Microbiology, 152, 387-396. Khan, N. A. (2006) Acanthamoeba: biology and increasing importance in human health. FEMS Microbiology Reviews, 30, 564-595. Khan, N. A (2009) Acanthamoeba. Biology and pathogenesis. Caister Academic Press, Norfolk, United Kingdom. Kim, E.-H., X. Charpentier, O. Torres-Urquidy, M. M. McEvoy and C. Rensing (2009) The metal efflux island of Legionella pneumophila is not required for survival in macrophages and amoebas. FEMS Microbiology Letters, 301, 164-170. King, C. H., E. B. Shotts, R. E. Wooley and K. G. Porter (1988) Survival of coliforms and bacterial pathogens within protozoa during chlorination. Applied and Environmental Microbiology, 54, 3023-3033. Konkel, M. E., B. J. Kim, V. Rivera‐Amill and S. G. Garvis (1999) Bacterial secreted proteins are required for the internalization of Campylobacter jejuni into cultured mammalian cells. Molecular Microbiology, 32, 691-701. Konkel, M. E., J. D. Klena, V. Rivera-Amill, M. R. Monteville, D. Biswas, B. Raphael and J. Mickelson (2004) Secretion of virulence proteins from Campylobacter jejuni is dependent on a functional flagellar export apparatus. Journal of Bacteriology, 186, 3296- 3303. Kuusi, M., J. Nuorti, M.-L. Hänninen, M. Koskela, V. Jussila, E. Kela, I. Miettinen and P. Ruutu (2005) A large outbreak of campylobacteriosis associated with a municipal water supply in Finland. Epidemiology and Infection, 133, 593-601. Lamothe, J., S. Thyssen and M. A. Valvano (2004) Burkholderia cepacia complex isolates survive intracellularly without replication within acidic vacuoles of Acanthamoeba polyphaga. Cellular Microbiology, 6, 1127-1138. Larsen, J. C. and P. Guerry (2005) Plasmids of Campylobacter jejuni 81-176. Campylobacter molecular and cellular biology. Horizon Bioscience, Wymondham, United Kingdom, 181- 192. Lertsethtakarn, P., K. M. Ottemann and D. R. Hendrixson (2011) Motility and chemotaxis in Campylobacter and Helicobacter. Annual Review of Microbiology, 65, 389-410. Louwen, R., A. Heikema, A. van Belkum, A. Ott, M. Gilbert, W. Ang, H. P. Endtz, M. P. Bergman and E. E. Nieuwenhuis (2008) The sialylated lipooligosaccharide outer core in Campylobacter jejuni is an important determinant for epithelial cell invasion. Infection and immunity, 76, 4431-4438.

Matz, C. and K. Jürgens (2005) High motility reduces grazing mortality of planktonic bacteria. Applied and Environmental Microbiology, 71, 921-929. Matz, C. and S. Kjelleberg (2005) Off the hook–how bacteria survive protozoan grazing. Trends in Microbiology, 13, 302-307. Mertins, S., B. J. Allan, H. G. Townsend, W. Köster and A. A. Potter (2012) Role of motAB in adherence and internalization in polarized Caco-2 cells and in cecal colonization of Campylobacter jejuni. Avian Diseases, 57, 116-122. Miltner, E. C. and L. E. Bermudez (2000) Mycobacterium avium Grown in Acanthamoeba castellanii Is Protected from the Effects of Antimicrobials. Antimicrobial Agents and Chemotherapy, 44, 1990-1994. Molmeret, M., M. Horn, M. Wagner, M. Santic and Y. A. Kwaik (2005) Amoebae as training grounds for intracellular bacterial pathogens. Applied and Environmental Microbiology, 71, 20-28. Moore J, Caldwell P, Millar B. 2001. Molecular detection of Campylobacter spp. in drinking, recreational and environmental water supplies. International Journal of Hygine and Environmental Health, 204, 185-189 Müller, J., F. Schulze, W. Müller and I. Hänel (2006) PCR detection of virulence-associated genes in Campylobacter jejuni strains with differential ability to invade Caco-2 cells and to colonize the chick gut. Veterinary Microbiology, 113, 123-129. Nachamkin, I., X.-H. Yang and N. J. Stern (1993) Role of Campylobacter jejuni flagella as colonization factors for three-day-old chicks: analysis with flagellar mutants. Applied and Environmental Microbiology, 59, 1269-1273. Newell, D. and C. Fearnley (2003) Sources of Campylobacter colonization in broiler chickens. Applied and Environmental Microbiology, 69, 4343-4351. Olofsson, J., D. Axelsson-Olsson, L. Brudin, B. Olsen and P. Ellström (2013) Campylobacter jejuni actively invades the amoeba Acanthamoeba polyphaga and survives within non digestive vacuoles. PLoS ONE, 11. Olofsson, J., P. Griekspoor Berglund, B. Olsen, P. Ellström and D. Axelsson-Olsson (2015) The abundant free-living amoeba, Acanthamoeba polyphaga, increases the survival of Campylobacter jejuni in milk and orange juice. Infection Ecology and Epidemiology, 5, 28675. Olson, C. K., S. Ethelberg, W. van Pelt and R. V. Tauxe. 2008. Epidemiology of Campylobacter jejuni infections in industrialized nations. In Campylobacter, Third Edition, 163-189. American Society of Microbiology. On S. L., 2001. Taxonomy of Campylobacter, Arcobacter, Helicobacter and related bacteria: current status, future prospects and immediate concerns. Journal of Applied Microbiology, 90, 1S-15S. Patrone, V., R. Campana, L. Vallorani, S. Dominici, S. Federici, L. Casadei, A. M. Gioacchini, V. Stocchi and W. Baffone (2013) CadF expression in Campylobacter jejuni strains

incubated under low-temperature water microcosm conditions which induce the viable but non-culturable (VBNC) state. Antonie Van Leeuwenhoek, 103, 979-88. Pitkänen, T. (2013) Review of Campylobacter spp. in drinking and environmental waters. Journal of Microbiological Methods, 95, 39-47. Purdy, D., S. Cawthraw, J. H. Dickinson, D. G. Newell and S. F. Park (1999) Generation of a superoxide dismutase (SOD)-deficient mutant of Campylobacter coli: evidence for the significance of SOD in Campylobacter survival and colonization. Applied and Environmental Microbiology, 65, 2540-2546. Reyes-Batlle, M., C. Girbau, A. López-Arencibia, I. Sifaoui, A. R. Liendo, C. J. B. Estrella, A. B. G. Méndez, O. Chiboub, S. Hajaji and A. Fernández-Astorga (2017) Variation in Campylobacter jejuni culturability in presence of Acanthamoeba castellanii Neff. Experimental Parasitology, 183, 178-181. Rodríguez-Zaragoza, S. (1994) Ecology of free-living amoebae. Critical Reviews in Microbiology, 20, 225-241. Ruiz-Palacios, G. M. (2007) The health burden of Campylobacter infection and the impact of antimicrobial resistance: playing chicken. Clinical Infectious Diseases, 44, 701-703. Scheid, P. (2014) Relevance of free-living amoebae as hosts for phylogenetically diverse microorganisms. Parasitology Research, 113, 2407-2414. Scheid, Patrick (2015) Viruses in close associations with free-living amoebae. Parasitology Research, 114, 3959-3967. Scola, B. L. and D. Raoult (2001) Survival of Coxiella burnetii within free‐living amoeba Acanthamoeba castellanii. Clinical Microbiology and Infection, 7, 75-79. Segal, G. and H. A. Shuman (1999) Legionella pneumophila utilizes the same genes to multiply within Acanthamoeba castellanii and human macrophages. Infection and Immunity, 67, 2117-2124. Siddiqui, R. and N. A. Khan (2012) War of the microbial worlds: Who is the beneficiary in Acanthamoeba–bacterial interactions? Experimental parasitology, 130, 311-313. Skarp, C., O. Akinrinade, A. J. Nilsson, P. Ellström, S. Myllykangas and H. Rautelin (2015) Comparative genomics and genome biology of invasive Campylobacter jejuni. Scientific Reports, 5, 17300. Snelling, W., J. McKenna, D. Lecky and J. Dooley (2005) Survival of Campylobacter jejuni in waterborne protozoa. Applied and Environmental Microbiology, 71, 5560-5571. Snelling, W. J., N. J. Stern, C. J. Lowery, J. E. Moore, E. Gibbons, C. Baker and J. S. Dooley (2008) Colonization of broilers by Campylobacter jejuni internalized within Acanthamoeba castellanii. Archives of Microbiology, 189, 175-179. Steinert, M., K. Birkness, E. White, B. Fields and F. Quinn (1998) Mycobacterium avium bacilli grow saprozoically in coculture with Acanthamoeba polyphaga and survive within cyst walls. Applied and Environmental Microbiology, 64, 2256-2261.

Thomas, C., H. Gibson, D. Hill and M. Mabey (1998) Campylobacter epidemiology: an aquatic perspective. Journal of Applied Microbiology, 85, 168S-177S. Thomas, J. M. and N. J. Ashbolt (2010) Do free-living amoebae in treated drinking water systems present an emerging health risk? Environmental Science and Technology, 45, 860-869. Thomas, V., G. McDonnell, S. P. Denyer and J.-Y. Maillard (2010) Free-living amoebae and their intracellular pathogenic microorganisms: risks for water quality. FEMS Microbiology Reviews, 34, 231-259. Tsoni K, Papadopoulou E, Michailidou E, Kavaliotis I. 2012. Campylobacter jejuni meningitis in a neonate: a rare case report. Journal of Neonatal and Perinatal Medicine 6, 183-185. Van Alphen, L. B., S. A. Burt, A. K. Veenendaal, N. M. Bleumink-Pluym and J. P. Van Putten (2012) The natural antimicrobial carvacrol inhibits Campylobacter jejuni motility and infection of epithelial cells. PloS one, 7, e45343. Van Vliet, A. and J. Ketley (2001) Pathogenesis of enteric Campylobacter infection. Journal of Applied Microbiology, 90, 45S-56S. Van Vliet, A. H. M., A. C. Wood, J. Henderson, K. Wooldridge and J. M. Ketley (1998) Genetic manipulation of enteric Campylobacter species. Methods in Microbiology, Vol 27, 27, 407-419. Vegge, C. S., L. Brøndsted, Y.-P. Li, D. D. Bang and H. Ingmer (2009) Energy taxis drives Campylobacter jejuni toward the most favorable conditions for growth. Applied Environmental Microbiology, 75, 5308-5314. Vieira, A., A. M. Seddon and A. V. Karlyshev (2015) Campylobacter-Acanthamoeba interactions. Microbiology, 161, 933-947. Watson, R. O. and J. E. Galán (2008) Campylobacter jejuni survives within epithelial cells by avoiding delivery to lysosomes. PLoS Pathogen, 4, e14. Wieczorek, K. and J. Osek (2008) Identification of virulence genes in Campylobacter jejuni and C. coli isolates by PCR. Bulletin of the Veterinary Institute in Pulawy, 52, 211-6. Yao, R., R. A. Alm and P. Guerry (1993) Construction of new Campylobacter cloning vectors and a new mutational cat cassette. Gene, 130, 127-130. Yao, R., D. H. Burr, P. Doig, T. J. Trust, H. Niu and P. Guerry (1994) Isolation of motile and non‐motile insertional mutants of Campylobacter jejuni: the role of motility in adherence and invasion of eukaryotic cells. Molecular Microbiology, 14, 883-893. Yao, R., D. H. Burr and P. Guerry (1997) CheY‐mediated modulation of Campylobacter jejuni virulence. Molecular Microbiology, 23, 1021-1031. Zhou, X., J. Elmose and D. R. Call (2007) Interactions between the environmental pathogen Listeria monocytogenes and a free‐living protozoan (Acanthamoeba castellanii). Environmental Microbiology, 9, 913-922.

Ziprin, R. L., C. R. Young, L. H. Stanker, M. E. Hume and M. E. Konkel (1999) The absence of cecal colonization of chicks by a mutant of Campylobacter jejuni not expressing bacterial fibronectin-binding protein. Avian Diseases, 586-589.

2.7. Tables and Figures

Figure 1. Internalization and intracellular survival (%) of the deletion mutants of Campylobacter jejuni of the genes responsible for adhesion and chemotaxis as compared to Wildtype in A. castellanii and A. polyphaga. Error bars mark the standard error for the mean (n=3).

Figure 2. Internalization and intracellular survival (%) of the deletion mutants of Campylobacter jejuni of the genes responsible for invasion and sialyation of lipopolysaccaride as compared to Wildtype in A. castellanii and A. polyphaga. Error bars mark the standard error for the mean (n=3).

Table 1 Oligos used in the study

Oligos Primer sequence (5’3’) Use Cat-f GCGGTGTTCCTTTCCAAGT Primers used to amplify chloramphenicol resistance Cat-r CAGTGCGACAAACTGGGATT gene from Plasmid – Pry112. FlaAB-lf-fk-f ATTTTAGGACCTACCTTGCATCA Primers used to amplifying left flanking region of flaAB TCAATCTATATCACGCAATTAACTTGGAAAG FlaAB-lf-fk-r gene from genomic DNA of C. jejuni strain 81-176. GAACACCGCTTAAAGCAGCCGAATCAACC AAGACTTGCTGAATAAATAAAATCCCAGTTT FlaAB-rt-fk-f Primers used to amplifying right flanking region of GTCGCACTGCATCCCTGAAGCATCATCTG flaAB gene from genomic DNA of C. jejuni strain 81- FlaAB-rt-fk-r CAACCAATCGTGGTGCTAAA 176. CadF-lf-fk-f TTGCTTTAGGCAAAAGAGTGG Primers used to amplifying left flanking region of cadF TCAATCTATATCACGCAATTAACTTGGAAAG

72 CadF-lf-fk-r gene from genomic DNA of C. jejuni strain 81-176. GAACACCGCCTCGCTCAAGCAATGACACT

AAGACTTGCTGAATAAATAAAATCCCAGTTT CadF-rt-fk-f Primers used to amplifying right flanking region of GTCGCACTGATCCCTGGTGCATAACGATT cadF gene from genomic DNA of C. jejuni strain 81- CadF-rt-fk-r GCAGCTATGGATGCTGATTTT 176. CheY-lf-fk-f CCAAAGGCTAAGGCTGGATT Primers used to amplifying left flanking region of cheY TCAATCTATATCACGCAATTAACTTGGAAAG CheY-lf-fk-r gene from genomic DNA of C. jejuni strain 81-176. GAACACCGCTGCAGCTGAGTAAAGGCTGA AAGACTTGCTGAATAAATAAAATCCCAGTTT CheY-rt-fk-f GTCGCACTGAACGCCATGCTCAGCTTCTA Primers used to amplifying right flanking region of cheY gene from genomic DNA of C. jejuni strain 81-176. CheY-rt-fk-r TTGGTGATCTTTCTCAGATGGTT CiaB-lf-fk-f GTTAGCCCAGCTGTTTGAGC Primers used to amplifying left flanking region of cheY TCAATCTATATCACGCAATTAACTTGGAAAG CiaB-lf-fk-r gene from genomic DNA of C. jejuni strain 81-176. GAACACCGCTGGCAAAGGGTTGATGAAGT

Table 1 Oligos used in the study (Cont.)

Oligos Primer sequence (5’3’) Use AAGACTTGCTGAATAAATAAAATCCCAGTTTG Primers used to amplifying right flanking region of CiaB-rt-fk-f TCGCACTGTCAATCAAACGCCTAAGTATGG cheY gene from genomic DNA of C. jejuni strain 81- CiaB-rt-fk-r ACAACGCGTTCAGGAGAAAG 176. CstII-lf-fk-f CAGCTTTCTATTGCCCTTGC Primers used to amplifying left flanking region of cstII TCAATCTATATCACGCAATTAACTTGGAAAGG CstII-lf-fk-r gene from genomic DNA of C. jejuni strain 81-176. AACACCGCCGGTCTCATATTCTTGATTTTGG AAGACTTGCTGAATAAATAAAATCCCAGTTTG Primers used to amplifying right flanking region of CstII-rt-fk-f TCGCACTGCAAATTTTATAGAACTAGCGCCAA cstII gene from genomic DNA of C. jejuni strain 81- A 176. CstII-rt-fk-r GCGCTAAAGGCTGCATCTAC DocB-lf-fk-f AAAGCCAAGCTACCATTACCAA Primers used to amplifying left flanking region of 73 TCAATCTATATCACGCAATTAACTTGGAAAGG docB gene from genomic DNA of C. jejuni strain 81- DocB-lf-fk-r AACACCGCTCAACCCAAACCATGAAAGA 176. AAGACTTGTGAATAAATAAAATCCCAGTTTGT Primers used to amplifying right flanking region of DocB-rt-fk-f CGCACTGTTGCTTGAACACTTGGATCG docB gene from genomic DNA of C. jejuni strain 81- DocB-rt-fk-r TATAGCCAAAACCGCACCTT 176. KpsE-lf-fk-f AAACTCAACAGCTCCCCAAA Primers used to amplifying left flanking region of TCAATCTATATCACGCAATTAACTTGGAAAGG docB gene from genomic DNA of C. jejuni strain 81- KpsE-lf-fk-r AACACCGCCCAGAAAGCGCAAAATATCC 176. AAGACTTGCTGAATAAATAAAATCCCAGTTTG Primers used to amplifying right flanking region of KpsE-rt-fk-f TCGCACTGCTTGGTGCTGCAATCAATGT docB gene from genomic DNA of C. jejuni strain 81- KpsE-rt-fk-r ATGGGGCTTTTCAAGGTTCT 176. MotAB-lf-fk-f TCGCTCTTCGCATAAAACAA Primers used to amplifying left flanking region of TCAATCTATATCACGCAATTAACTTGGAAAGG motAB gene from genomic DNA of C. jejuni strain 81- MotAB-lf-fk-r AACACCGCCATATTTGCCACCTCAAGCA 176. AAGACTTGCTGAATAAATAAAATCCCAGTTTG Primers used to amplifying right flanking region of MotAB-rt-fk-f TCGCACTGGCAGCCGTTGGCATAACTA motAB gene from genomic DNA of C. jejuni strain 81- MotAB-rt-fk-r TACTTTAAGCGGTCGCAAGC 176.

Table 1 Oligos used in the study (Cont.)

Oligos Primer sequence (5’3’) Use SodB-lf-fk-f TGCGAAAGCACCTAGTAATGC Primers used to amplifying left flanking region of TCAATCTATATCACGCAATTAACTTGGAAAG motAB gene from genomic DNA of C. jejuni strain 81- SodB-lf-fk-r GAACACCGCTAAATACGCCCCCATTTGAA 176. AAGACTTGCTGAATAAATAAAATCCCAGTTT Primers used to amplifying right flanking region of SodB-rt-fk-f GTCGCACTGCTTCAAACGCAGCTACACCA motAB gene from genomic DNA of C. jejuni strain 81- SodB-rt-fk-r ATTTCCGCAACCAAAATCAA 176. TGCAAAACCTAAAAACAACGAA VirB11-lf-fk-f Primers used to amplifying left flanking region of

motAB gene from genomic DNA of C. jejuni strain 81- TCAATCTATATCACGCAATTAACTTGGAAAG VirB11-lf-fk-r 176. GAACACCGCGGGGTAAGGCAACTCACAAG AAGACTTGCTGAATAAATAAAATCCCAGTTT Primers used to amplifying right flanking region of VirB11-rt-fk-f

74 GTCGCACTGGGGGCTTACAAAACCCTGAT motAB gene from genomic DNA of C. jejuni strain 81-

VirB11-rt-fk-r TGTGTTCCTTGTGCTCGTTT 176.

2.8. Appendix

2.8.1 IBC protocol

Chapter 3

Horizontal genetic exchange of chromosomally encoded markers

between Campylobacter jejuni cells

Horizontal genetic exchange of chromosomally encoded markers

between Campylobacter jejuni cells

Deepti Pranay Samarth1 and Young Min Kwon1, 2

1Department of Poultry Science, University of Arkansas, Fayetteville, AR 72701

2Cell and Molecular Biology Program, University of Arkansas, Fayetteville, AR 72701

Running title: Horizontal gene transfer in Campylobacter

*Corresponding author:

Dr. Young Min Kwon Department of Poultry Science

University of Arkansas

1260 W. Maple St.

Fayetteville, AR 72701

Email: [email protected]

3.1. Abstract

Genetic diversity is considered a vital characteristic feature in the survival of bacterial populations. This provides genome plasticity and increased capability to adapt to dynamic environments. Many epidemiological studies provide us with the evidences of horizontal gene transfer contributing towards bacterial genomic diversity. Campylobacter jejuni (C. jejuni) is one of the major causes of acute enteritis in the U.S., often linked with severe post-infection neuropathies such as Guillain-Barré syndrome. C. jejuni exhibits largely a non-clonal population structure and colossal strain-level genetic variation. In this study, we provide evidence of the horizontal genetic exchange of chromosomally encoded genetic markers between C. jejuni cells in biphasic Mueller-Hinton (MH) medium. For this experiment, we used two C. jejuni mutants in the same strain background (NCTC 11168) harbouring distinct antibiotic markers

(chloramphenicol and kanamycin resistance markers) present at two different neutral genomic loci. The cultures of both marker strains were mixed together in biphasic MH medium, incubated for 5 hrs, and plated on MH agar plates supplemented with both antibiotics. The recombinant cells with double antibiotic markers were generated at the frequency of 0.02811 ± 0.0035 % of both parental strains. PCR assays using locus-specific primers confirmed that the transfer of the markers was through homologous recombination. We further evaluated the effects of chicken cecal content on recombination efficiency, which increased significantly (approximately 10-fold) in the presence of 100% cecal extracts in comparison to the control (biphasic MH medium alone;

P < 0.05). Furthermore, treating the cells with DNase I decreased the recombination efficiency significantly by 99.92% (P < 0.05). We used the cell supernatant of 16 hrs-culture of C. jejuni as a template for PCR and found DNA sequences from 6 different genomic regions were easily amplified, indicating the presence of released chromosomal DNA in the culture supernatant. Our

findings suggest that horizontal gene transfer in C. jejuni is facilitated in the chicken gut environment contributing to in vivo genomic diversity, and C. jejuni might have an active mechanism to release its chromosomal DNA into the extracellular environment, further expediting horizontal gene transfer in C. jejuni populations.

Keyword: Campylobacter, Horizontal gene transfer, Genetic diversity, Natural transformation,

Homologous recombination.

3.2. Introduction

Campylobacter jejuni (C. jejuni) infections cause significant impacts on food safety and public health worldwide. C. jejuni, a zoonotic bacterial pathogen and one of the major causes of foodborne enteritis in the developing countries, causes around 2 million campylobacteriosis cases every year alone in the U.S. (Iglesias et al. 2018, Marder et al. 2017). Although C. jejuni – induced diarrhea is self-limiting (Lastovica and Allos 2008, Butzler, De Mol, and Mandal 2018), the infections are frequently associated with post-infection neuropathies like Guillain-Barré syndrome (GBS) (Nachamkin, Allos, and Ho 1998, Halpin et al. 2018) and Miller-Fisher syndrome (Willison and O'Hanlon 1999). GBS, a life-threatening disease has a mortality rate of

37% among North American and European populations which is mostly associated with respiratory and cardiovascular complications (Liou et al. 2016).

Many studies point towards vast genetic diversity within C. jejuni populations and among different species of genus Campylobacter (Vegge et al. 2012, Dorrell et al. 2001, Pearson et al.

2003, Duong and Konkel 2009, Schouls et al. 2003). Different genotypes of C. jejuni are associated with variations in numerous phenotypic traits including host colonization, invasion, sialyation of lipopolysaccharide, and serum resistance (Guerry et al. 2002, Habib et al. 2009,

Jerome et al. 2011). Genetic diversity explains the greater ability of a bacterial population to survive in a hostile environment and its better adaptation for colonization in the host gut. C. jejuni genome is rather compact (1.6 to 1.8 Mbp) (Parkhill et al. 2000, Fouts et al. 2005), but genomic contents vary significantly among different strains of C. jejuni (Fouts et al. 2005,

total number of genes (both core and dispensable genes) present in all strains of a clade (Medini et al. 2005). There are multiple epidemiological reports supporting a complex strain diversity of

C. jejuni (Suerbaum et al. 2001, Dingle et al. 2001) and a similar observation was made in C. jejuni strains isolated from an infected chicken flock (Rivoal et al. 2005). It is important to study and understand the patterns of genetic diversification and its underlying mechanisms in C. jejuni.

The understanding will help us comprehend the epidemiology of C. jejuni-mediated diseases and therefore ultimately lead to effective control and prevention of C. jejuni infections (Fearnhead et al. 2005). The analysis of infecting C. jejuni strains using strain typing methods in a chicken flock is typically complicated as a chicken flock is often infected by different genotypes over time (Vidal et al. 2016).

Horizontal gene transfer (HGT) plays a significant role in incorporating genetic diversity to C. jejuni genomes (Avrain, Vernozy‐Rozand, and Kempf 2004, Wilson et al. 2009, Hänninen,

Hakkinen, and Rautelin 1999). There are many molecular epidemiologic studies suggesting HGT among C. jejuni strains occurs at a remarkable rate (Fearnhead et al. 2005, Schouls et al. 2003).

HGT is often defined as any occurrence of passing inheritable material between organisms, which is asynchronous to the reproduction of the organisms (Heinemann and Bungard 2006,

Gomez-Valero, 2011). The dynamically changing genetic composition not only influences the diversity of C. jejuni in the environment and host but also raises challenges for the scientific community to study C. jejuni. Immense variation in flagellin gene is clearly revealed from FlaA typing of C. jejuni, which has been commonly used for epidemiological studies (Wassenaar, Fry, and Van der Zeijst 1995, de Boer et al. 2002, Singh and Kwon 2013). de Boer et al. (2002) have demonstrated that horizontal gene exchange could be a major cause of genetic diversity in C. jejuni via in vivo chicken colonization studies.

Naturally competent bacteria such as C. jejuni take up DNA from the environment, which can serve as a source of nutrients to bacterial cells. At the same time, these extracellular DNA act as a source of exogenous DNA fragments which sometimes recombine with and replace homologous segments of the chromosome (Mell and Redfield 2014). The HGT process is accomplished by 1) release of DNA from the donar cell 2) uptake to DNA by the recipient cells and 3) incorporation of incoming DNA by mostly homologous recombination. Along with natural transformation, conjugation and transduction also are modes of uptake of DNA which facilitate HGT in C. jejuni and in turn contribute to its genetic diversity (Wiesner and Dirita

2008, Taylor 2018, Lang, 2012).

Previously, de Boer et al. (2002) have shown bidirectional HGT of genetic material in vivo during C. jejuni infection in the chicken gut. We made an attempt to study HGT within C. jejuni cells in vitro. This study also highlights different factors which could affect the final step of HGT which is recombination of incoming DNA from other cells and adding to genetic diversity of C. jejuni cells. Notably, we co-cultured two C. jejuni marker strains in which the two different selectable antibiotic markers were stably inserted into different chromosomal loci. We also compared HGT between C. jejuni cells in the presence of chicken cecal supernatant to study the role of chicken cecal content in providing a favorable environment for HGT in C. jejuni cells boosting its efficiency to adapt in dynamically changing environments.

3.3. Materials and Method

3.3.1. Bacterial strains.

C. jejuni NCTC 11168 and C. jejuni 81-176 were used and cultured in MH agar or broth at 37°C in microaerophilic condition where the gas composition was O2 (5%), CO2 (10%) and N2

(remaining balance). The strains were stored in MH broth containing 15% glycerol at -80°C. For

all the experiments C. jejuni culture was prepared by recovering cells from the frozen stock onto

MH agar plates with appropriate antibiotics (24 hrs incubation) and passing heavy inoculum from culture plate to 5 ml MH broth supplemented with appropriate antibiotics, followed by incubation for 16 hrs. When necessary, appropriate antibiotics were used at the following concentrations: trimethoprim (10 μg ml−1), chloramphenicol (Cm; 6 μg ml−1) and kanamycin

(Km; 50 μg ml−1).

3.3.2. Construction of marker strains of C. jejuni.

In order to examine the transfer of genetic material between C. jejuni cells, we constructed two C. jejuni strains with distinct chromosomal antibiotic markers: chloramphenicol resistance (CmR) and kanamycin (KmR) resistance gene. Construction of CmR marker strain

(11168 hipO::CmR) involved overlapping PCR protocol (Hansen et al. 2007), which was performed by amplifying and joining three DNA fragments: 1) CmR gene (amplified from plasmid pRY112) (Yao, Alm, and Guerry 1993), 2) 400 bp upstream hipO gene flanking region, and 3) 400 bp downstream hipO flanking region. Three gel-purified DNA fragments were joined using overlapping PCR creating a CmR marker cassette (hipO upstream flanking region-CmR- hipO downstream flanking region). The product of the overlapping PCR reaction was transformed into electrocompetent C. jejuni cells using electroporation at 2,500 V and plated onto MH agar plate with Cm (Van Vliet et al. 1998). The sequence of primers used in the construction of 11168 hipO::CmR are listed in Table 1. Putative hipO::CmR mutants were checked for insertion of CmR marker cassette at hipO gene locus by PCR before making stock.

Additionally, natural transformation (Van Vliet et al. 1998) was performed to transfer the deletion cassette to a fresh background of C. jejuni strain NCTC 11168 using genomic DNA of confirmed mutant to eliminate any possible unwanted mutations. The resulting mutant strain in

the fresh background was again validated by PCR and Sanger sequencing before the strain was used to make a stock and for the experiments.

For the KmR marker strain, we selected 10 mutants randomly from the C. jejuni strain

11168 Tn5 transposon mutant library previously described by Mandal et al. (2017) and compared their natural transformation efficiency using genomic DNA of the C. jejuni CmR marker strain.

One strain was selected as the candidate KmR marker strain for further studies based on its natural transformation efficiency very similar to that of the wild type strain. To determine the insertion site for the selected Tn5 mutant selected, RATE protocol (Ducey and Dyer 2002) was used with the primers Inv-1, Inv-2 and KAN2 FP-1 (Table1), and the PCR product was sequenced by Sanger sequencing using primer KAN2 FP-1. The sequencing result showed that the Tn5 insertion was in livH gene, and thus the strain was designated as 11168livH::KmR.

3.3.3. Recombination assay.

Using a heavy inoculum from 24 hrs MH plates, both strains (11168 hipO::CmR and

11168 livH::KmR) were separately resuspended in MH broth with appropriate antibiotics and incubated for 16 hrs. Cells were then resuspended on MH broth without antibiotics and diluted to

9 OD600 of 0.5 (~1 × 10 CFU/ml) with MH broth. Equal volume (0.25ml) of both marker strains were mixed together. The final volume of 0.5 ml of the mixed culture was subjected to biphasic

MH system (Wang and Taylor 1990, Van Vliet et al. 1998) and co-cultured together for 5 hrs at appropriate growth conditions. The number of recombinant cells was determined by CFU of recombinants which was obtained after serial dilutions in phosphate-buffered saline and plated onto MH broth agar plate supplemented with both chloramphenicol and kanamycin, followed by incubation for 3 days (Figure 1). The number of recombinant colonies were used to calculate the percent of recombinant cells obtained out of the total number of both parent strains. This percent

of recovered recombinant cells per recombination assay is hereafter referred to as

“recombination efficiency” for simplicity.

3.3.4. PCR assay to check homologous recombination.

We hypothesized that the strains that became resistant to both Cm and Km are the result of homologous recombination (Figure 2). We designed primers sets (Table 1) corresponding to the insertion junction of DNA markers in such a way that annealing location of forward primer is outside the antibiotic cassette, whereas the reverse primer anneals inside the antibiotic cassette

(Figure 3). This way, we would yield amplification only when the antibiotic marker is inserted to the homologous genomic DNA region. We randomly picked 10 double antibiotic resistant colonies obtained after the recombination assay. We performed colony PCR using these recombinant colonies as DNA templates using the primer sets described above. Along with the recombinant colonies, we also used the parent strains (CmR and KmR; positive control for each locus) and wild type strain (negative control) in the PCR assay.

3.3.5. Extension of incubation time to 24 hrs.

We aimed to monitor whether the recombination efficiency increased with the longer incubation time of the co-culture. We performed the recombinant assay with 24 hrs incubation and then compared the recombination efficiency to that of 5 hrs (control).

3.3.6. Comparison of recombination in liquid medium.

The recombination assay was also conducted with liquid MH medium in place of biphasic MH medium using essentially the same parameters for the assay. Equal volume of both the marker strains were mixed together and transferred to a 5 ml culture tube. Resulting recombinant colonies were enumerated and the recombination efficiency was compared to that obtained when the biphasic medium (control) was used.

3.3.7. Recombination across strain background barriers.

The marker strains in different strain backgrounds viz. 11168 hipO::CmR, 11168 livH::KmR, 81-176 hipO::CmR, 81-176 livH::KmR were used to perform the recombination assay in different combinations of the parental strains. We compared the recombination efficiency to examine the role of the potential strain-to-strain barrier in HGT. Natural transformation using genomic DNA of appropriate marker strains was used to construct the markers strains in different strain backgrounds (Van Vliet et al. 1998).

3.3.8. Use of cell-free supernatant to evaluate HGT in the absence of cell-to-cell contact.

Recombination between C. jejuni cells can happen after DNA is introduced into the cell via multiple pathways including natural transformation. Conjugation is also one of the prominent contributors of the HGT in C. jejuni cells (Zeng, Ardeshna, and Lin 2015) for which cell-to-cell contact is important. In this experiment, we wanted to determine the changes in the frequency of

HGT in the absence of cell-to-cell contact during the recombination assay. After centrifuging for

30 mins, we filtered (0.2 µm filter) the overnight culture of marker strains (OD600 of

0.5~1×109 CFU/ml) cultured in MH broth. To verify the sterility of cell-free suspension, 200 µl of cell-free suspension was plated on MH agar plate (incubated in microaerophilic condition) and

Luria-Bertani (LB) plate (incubated in aerobic condition), followed by incubation at 37°C for 3 days. We performed the recombination assay as described earlier, except that one marker strain was replaced with an equal volume of its cell-free extract. The recombination assay where both the marker strains were employed was used as the control for this experiment.

3.3.9. Recombination experiment in the presence of DNase I treatment.

DNase I enzyme nonspecifically cuts DNA and is often used to remove extracellular

DNA (Whitchurch et al. 2002). We aimed to check the role of extracellular DNA in the present

recombination study. Recombination assay was conducted in the presence or absence of DNase

I. DNase I (NEB) (final concentration of 4 U ml-1) was added to the marker strain culture mixture before the mixture was transferred to a biphasic MH system. After incubation, the number of recombinants were enumerated, and the recombination efficiency was determined as described above.

3.3.10. Detection of released C. jejuni chromosomal DNA in the culture supernatant.

The cell-free supernatant from a 16 hrs wild-type C. jejuni 81-176 culture (MH broth) was processed by centrifugation at maximum speed for 30 min, followed by filtration through

0.1-micron syringe filter. The sterility of culture supernatant was checked as described above.

We quantified the DNA concentration of the culture supernatant using QubitTM dsDNA BR assay kit. We performed PCR using 6 primer sets targeted to amplify different regions of C. jejuni genome (Table 1) using a sterile culture supernatant. We used a 2µl cell-free supernatant in 35 cycle PCR. PCR amplification products were visualized using agarose gel electrophoresis.

3.3.11. Chicken cecal supernatant preparation.

The cecal supernatant was prepared by the method of Lin et al. (2003) with some modifications. Cobb 500 broiler chickens were raised with ad libitum access to water and an antibiotic-free corn-soybean meal diet. At the ages between 2 and 3 weeks, 10 birds were sacrificed humanely, and cecal samples were collected aseptically according to the animal use protocol approved by the Institutional Animal Care and Use Committee (IACUC) at the

University of Arkansas. The cecal contents were pooled from the 10 chickens and mixed with the same volume of MH broth by vortexing, followed by centrifugation with 10,000g at 4°C for

30 min. The supernatant obtained after centrifugation was pre-filtered with different pore size filters (Millipore; 1.2 μm and 0.45 μm filters) to remove all the intestinal tissue debris and

microorganisms and finally by 0.2 μm filter. The filtered cecal extracts were tested for sterility as described above.

3.3.12. Recombination in the presence of chicken cecal supernatant.

Different concentrations of sterile chicken cecal extract were added to MH medium for the recombination assay. Cecal extract media with different concentrations (0.1%, 1%, 10%,

25% and 100%) of cecal extract were prepared by mixing appropriate volumes of cecal extract with MH broth to make up the final volume to 0.5 ml. The cecal extract media prepared were used in the recombination assay replacing the MH broth in biphasic system. The recombination efficiency was determined for each cecal extract medium, and compared with that of the control where biphasic MH media was used for the assay.

3.3.13. Statistical analyses.

JMP genomics software program was used for statistical analysis. The statistical significance of differences between groups was determined by one-way analysis of variance

(ANOVA) using by each pair Student’s t-test and P < 0.05 was used to determine significant difference. The results were expressed as the mean ± standard error. For comparing 3 or more treatments, All-pair Tukey HSD was used and the difference was considered significant at P <

0.05. All experiments were performed at least in triplicate to ensure the replicability of results.

3.4. Results

3.4.1. Construction of the Marker strains.

The CmR and KmR markers were introduced in distinct genomic loci of C. jejuni strains

NCTC 11168, and these marker strains were used for the recombination assay. To observe the

HGT in an experimental setting, it is important to use the marker strains with distinct genomic tags inserted at neutral genomic loci. hipO gene locus was used previously by Boer et.al. (2002)

to construct a marker strain, which was used to study HGT in C. jejuni strains. The natural transformation efficiency of 11168 hipO::CmR was comparable to that of the wild type C. jejuni strain NCTC 11168 (P>0.05). One Tn5 mutant strain (KmR) with a similar natural transformation efficiency as the wild type C. jejuni 11168 strain (P>0.05) was selected and used as a marker strain for the recombinant assays. The DNA sequencing of Tn5-flanking regions showed the insertion was in livH gene in the KmR marker strain.

3.4.2. Recombination assay.

The recombination experiment was performed to observe the allelic exchange of the antibiotic resistance markers between the two markers strains (11168 hipO::CmR, 11168 livH::KmR). Both marker strains were mixed at the ratio of 1:1 in a MH biphasic system and incubated for 5 hrs incubation. The biphasic system is known to enhance the natural transformation efficiency of C. jejuni (Wang and Taylor, 1990). We were able to recover a mean of 1.14×1040.0571×104 CFUs of the double antibiotic resistant mutants per recombination assay. When expressed as a percentage of the parental strains, the recombination efficiency was

0.02811 ± 0.0035% of the parent strains.

3.4.3. PCR validating homologous recombination.

Colony PCR with an insertion-specific primer set was performed for 10 randomly selected colonies obtained after the recombination assay on MH agar plate supplemented with both Cm and Km. After running agarose gel electrophoresis (Figure 4), we observed that all 10 colonies used for colony PCR yielded amplification of the products of expected sizes for both primer sets. This result indicates that the antibiotic marker genes were inserted at the same respective loci as in the parent marker strains, suggesting that the HGT was achieved through homologous recombination. On the contrary, the wild type did not yield any amplification,

whereas the positive PCR result was obtained only for the corresponding genomic loci for the

CmR and KmR marker strains (Figure 4).

3.4.4. Extension of incubation time to 24 hrs.

There was an increase in the number of recombinants recovered after 24 hrs as compared to 5 hrs incubation time used in the recombination assay. After 5 hrs incubation (control), we recovered a mean of 0.02811 ± 0.0035% of the parent strains and upon longer incubation of 24 hrs, the recombination efficiency was significantly increased to 0.49129 ± 0.01562% of the parent strains (P < 0.05) (Figure 5).

3.4.5. Comparison of recombination in liquid media and biphasic medium.

Biphasic MH system is often considered to have advantages over the liquid medium when performing the natural transformation of C. jejuni (Van Vliet et al. 1998). We obtained the recombination efficiency of 0.0194 ± 0.00246% when the liquid medium was used to perform the recombination assay, whereas it was 0.03019 ± 0.0029% when MH biphasic medium was used. This result shows that the frequency of recombination event decreased significantly when

MH broth was used in comparison to that of MH biphasic medium (P < 0.05) (Figure 6).

3.4.6. Recombination across strain background barrier.

Some studies showed that natural competency differs when different strain of C. jejuni cells were used during natural transformation experiments (Wassenaar, Fry, and van der Zeijst

1993). We used the two marker strains in two strain backgrounds (NCTC 11168 and 81-176) in the recombination assay. The result in Figure 7 shows that the recombination efficiency ranged from 0.0241 to 0.0271% of the parent strains, and there was no significant difference among different combinations of the parent strains (P > 0.05).

3.4.7. Use of cell-free supernatant to evaluate HGT in the absence of cell-to-cell contact.

Cell-free supernatants of the marker strains were prepared by filtering the cell cultures.

One of the marker strains was replaced by an equal amount of its cell-free supernatant and then the recombination assay was performed. The number of recovered double antibiotic resistant cells was compared to that of the control recombination assay where both marker strain cells were used. In the recombination experiment where CmR (cells) + KmR (cell-free) was used, the number of recovered recombinant cells was significantly lower than the control (0.01024 

0.000987% vs. 0.03294 ± 0.0014% of parent strain cells). In recombination experiment where

CmR (cell-free) + KmR (cells) was used, the recombination efficiency reduced more dramatically

(0.00002122  0.00001% of the parent strains) (Figure 8). The recombination efficiency with the control recombination assay was 0.0329  0.001405% of the parent strains. This indicates that the cell-to-cell contact plays an important role in recombination in C. jejuni cells, but is not an absolute requirement for the recombination. There was significant difference (P < 0.01) in the recombination efficiency between the recombination experiment using CmR (cell-free) + KmR

(cells) and recombination experiment using KmR (cell-free) + CmR (cells).

3.4.8. Recombination experiment in the presence of DNase I treatment.

We noticed that the number of recombinants recovered after the recombination assay with DNAse I treatment was drastically reduced as compared to the control. There was a decline of 99.92% in the recovery of recombinants when compared to the control (P < 0.05).

Recombination assay without the DNAse I treatment (control) yielded recombinant efficiency of

0.0338 ± 0.0056 % (2.72×104  0.49× 104 CFUs/recombination assay) whereas the recombinant efficiency in the presence of DNase I treatment was 0.0000112  0.0000031% which corresponded to 8.4  2.33 CFUs/recombination assay (Figure 9).

3.4.9. Detection of released C. jejuni chromosomal DNA in the culture supernatant.

High concentrations of extracellular DNA can facilitate HGT in C. jejuni by increasing encounters of DNA to the recipient cells (Solomon and Grossman 1996, Wiesner 2006). Based on the role of extracellular DNA in the HGT events as demonstrated by DNAse I experiment, we wanted to investigate if C. jejuni can release its chromosomal DNA into the extracellular space.

After DNA quantification from three independent experimental replicates, we estimated 2.923 

0.13 ng/µl DNA in the cell-free culture supernatant, whereas MH broth alone had a mean of

1.503  0.1 ng/µl DNA. Then, we wanted to check if the DNA of C. jejuni is present in the extracellular DNA. The culture supernatant from 16 hrs culture of wild type C. jejuni 81-176 was used as DNA template in PCR reaction using 6 different primer sets designed to target genomic regions which are positioned with roughly similar intervals throughout the entire C. jejuni genome (the genomic regions from ciaB, motAB, docB, kpsE, cstII and CJJ81176_RS02890). We used 5 µl of PCR reaction to run agarose gel electrophoresis and found that all 6 genomic regions were effortlessly amplified from the cell-free culture supernatant, producing the PCR products of the expected sizes (Figure 10). On the contrary, there was no amplification from the supernatant of MH broth alone (data not shown).

3.4.10. Recombination in presence of chicken cecal-supernatant.

In this experiment, we aimed to study HGT in the presence of a chicken cecal extract.

Since the chicken intestinal tract is the main habitat where C. jejuni colonizes at high levels, we speculated that chicken intestinal environment might facilitate genetic exchanges within the C. jejuni populations. Cecal content was filtered to remove the cells and tissue debris present in the chicken ceca, retaining only sterile cecal supernatant. For all replicates, fresh cecal contents from chickens at the ages ranging 23 weeks were used. We formulated 0.1%, 1%, 10%, 25% and

100% cecal extract medium where MH broth was used to make up the remaining volume. We observed an increasing trend of the recombination efficiency with higher concentrations of the cecal extract, although there was no significant difference among the control and 1%, 10% and

25% cecal supernatant media at P < 0.05. However, a significant difference (P < 0.01) was found with 100% cecal supernatant medium as compared to the control (biphasic MH broth) (Figure

11).

3.5. Discussion

Genomic variation provides a great advantage for bacterial survival and persistence in unfavorable environments. Microevolution by spontaneous mutations is considered as a sequential and slow process as compared to HGT (Zhang et al. 2002), which results in the acquisition of foreign genes (Jain et al. 2003,Thomas et al. 2005). C. jejuni has a high degree of antigenic variation often correlated to the intra/inter-species recombination, helping it escape the host immune system (Wilson et al. 2003, Harrington, Thomson-Carter, and Carter 1997, Nuijten et al. 2000). In a rapidly changing environment, HGT often provides immediate genetic changes, which could be beneficial for adapting to the dynamically changing environment. Acquisition of antibiotic resistance genes via HGT increases C. jejuni fitness as demonstrated in multiple studies (Pratt and Korolik 2005, Crespo et al. 2016, Gibreel et al. 2004, Griggs et al. 2005).

Cognizance of the consequences of HGT demands our better understanding of HGT in C. jejuni in more details. In this study, we used simple, but convincing experiments to illustrate HGT between C. jejuni cells, and present strong evidence that the HGT is achieved by homologous recombination using extracellular DNA. Our finding included the demonstration that chicken cecal supernatant serves as a better medium for C. jejuni to transfer DNA horizontally.

We used the two marker strains both having unique selectable DNA marker (CmR and

KmR) at two distinct chromosomal loci for the recombinant assay. After 5 hrs of co-culture, we recovered 0.02811 ± 0.00350% of double antibiotic resistant recombinants of the parent strain.

This number increased to 0.49129 ± 0.01562% of the parent strains in 24 hrs co-culture illustrating high efficiency of the recombination process. The significant increase in the number of recombinants probably reflects the increased events due to a longer period of time for the process and also the multiplication of the parent strains during the increased incubation time. We were able to recover a reliable number of recombinants in 5 hrs and hence, it was used as a default incubation time for all experiments. We did not use any purified DNA as a DNA source for the recombination as previously done in typical natural transformation experiments (Wang and Taylor 1990, Wiesner and Dirita 2008, Vegge et al. 2012). Instead, the two marker strains were co-cultured together and DNA was exchanged between the marker strain cells.

The recovery of recombinants after co-culture of 2 strains of C. jejuni has been reported in some more studies. Wassenaar et. al. (1995) reported the generation of double antibiotic resistance transformants after co-culture of two C. jejuni strains [flagellin mutants R1

(flaA::KmR) and T1 (flaB::TcR)]. After 48 hrs incubation, approximately 0.18 % recombinants were recovered. Wilson et al. (2003) have also observed recombinants after performing co- culture of two C. jejuni strains (C. jejuni 81-176-Tn5CmR19 and C. jejuni 81-176-23SK4) in an experiment focused on improved liquid shaking culture to maximize natural transformation efficiency. In a 3 hrs co-cultivation of parent strains, Wilson et.al (2003) recovered the mean of

0.000188 % recombinants. To make the data from our study comparable to those from Wilson et al. (2003), we presented our result as the percentage of the parent strains (termed “recombination efficiency”) according to Wilson et.al (2003). Svensson et al. (2014) have also observed that the

number of double antibiotic transformants increased in the presence of sodium deoxycholate when streptomycin and kanamycin resistance marker strains were co-cultured. Also, de Boer et. al. (2002) reported similar results with C. jejuni strains 2412 and 2535. They have mentioned the observation that the DNA was exchanged between heterologous marker strains in liquid medium

(in vitro) before performing an in vivo chicken colonization experiment that highlighted that exchange of genetic material occurs in vivo despite potential strain barriers.

Dingle et al. (2001) studied 194 C. jejuni isolates of diverse origins, including humans, animals, and environments using MLST, which suggested a weak clonal population structure where both inter- and intra-species HGT is common. Taboada et al. (2004) found that gene variance in C. jejuni is observed mainly in the variable genomic region and also proposed that divergent genes are likely the result of homologous recombination of large genomic sequences.

The divergent genes were observed in clusters where highly divergent genes were often located next to other divergent genes. Pearson (2003) analyzed genome of 18 C. jejuni strains from diverse environments and described a common seven hyper-variable plasticity regions in C. jejuni genomes, which consist of 136 genes and comprise of 50% of variable gene pool.

Sheppard et al. (2008) presumed that recombination occurs frequently within C. jejuni species as well as C. coli and plays an important role in their microevolution. Sheppard et al. (2008) also speculated that high rate of recombination is causing a reverse speciation process between C. jejuni and C. coli, where it is suspected that C. jejuni and C. coli will become one species over the time of microevolution due to the high rate of recombination between them.

There can be multiple mechanisms by which exogenous DNA introduced from the environment into a bacterial cell can be incorporated into the chromosome. Homologous recombination is the most discussed mechanisms for the integration of exogenous DNA

(Heinemann and Bungard 2006). Genetic exchange between two homologous DNA molecules helps to maintain chromosomal integrity and generate genetic diversity. Both Wassenaar et al.

(1995) and Harrington et al. (1997) have presented strong evidence for inter-genomic recombination between different C. jejuni strains using polymorphism analysis of PCR-amplified flagellin genes where the start site of crossover could not be detected as the adjoining DNA sequence was homologous. This suggests a strong possibility of homologous recombination in flagellin genes. We present the evidence that the DNA markers were exchanged by homologous recombination. The design of marker-specific primers used in our PCR assay ensured that the genetic exchange occurred at homologous loci. These also suggest that gene typing especially using flagellin gene is not a reliable method to monitor C. jejuni epidemiology due to frequent inter-species and inter-strain exchange in this genetic locus.

E.coli, a model organism to study homologous recombination in Gram-negative bacteria, has at least 25 genetic components involved in homologous recombination. On the contrary, we still have a substantial gap in our knowledge about the mechanism of the homologous recombination in C. jejuni (Gilbreath et al. 2011). RecA is a protein that promotes general homogenous recombination in Campylobacter spp (Guerry et. al. 1994, Dworkin et al. 1997).

Helicobacter is closely related to Campylobacter and share some components of recombination system such as AddAB (an enzyme with dual nuclease activity). Helicobacter pylori and C. jejuni RecC protein (an enzyme with both helicase and nuclease activities) share strong similarity with that of some naturally competent Gram-positive bacteria. The recombination pathway of H. pylori resembles that of B. subtilis (a model organism to study homologous recombination in Gram-positive bacteria). Among 40 known naturally competent bacterial species, H. pylori and C. jejuni share unique machinery for transformation which requires

complement of type IV secretion system (Wiesner, Hendrixson, and DiRita 2003, Christie and

Vogel 2000). Significant reduction in transformation efficiency was observed when one of the type IV secretion system genes was mutated. In comparison to other naturally competent species, regulation of competence is not known in C. jejuni. It is quite evident there is a need to study the pathway and components related to natural transformation, including DNA uptake, transport and homologous recombination of C. jejuni.

The uptake of exogenous DNA by C. jejuni is not unfamiliar. Its natural competence is used for genetic manipulation of C. jejuni for more than a decade (Wang and Taylor 1990, Van

Vliet et al. 1998). The mechanism of genetic exchange is not clear, but there are enough reports to support that natural transformation plays an important role in HGT (Wang and Taylor 1990,

Wilson et al. 2003, Wiesner and Dirita 2008, Vegge et al. 2012). In this study, we used DNase I enzyme to eliminate extracellular DNA from recombination medium (Whitchurch et al. 2002,

Brown et al. 2015) which nonspecifically cleaves DNA into small oligonucleotides. Our finding from DNase I treatment experiment points the critical role of extracellular DNA present in the medium surrounding C. jejuni cells in the HGT events observed in our study. This result is in line with Brown et al. (2015) and Wilson et al. (2003), where they observed a similar reduction in a number of transformants after DNase I treatment. Gaasbeek et al. (2009) and Gaasbeek et al.

(2010) have mentioned the presence of endogenous DNases encoded by integrated element

CJIE1, CJIE2 and CJIE4, (originated from prophage) which could inhibit natural transformation in C. jejuni strains. These prophage genetic elements are also associated with strains of C. jejuni which are non-naturally competent. Also, Gaasbeek et al. (2009) have highlighted the role of dns gene, which encodes for Dns protein having DNAse activity and act on extracellular DNA

causing hydrolysis of DNA. Knocking out of dns gene strongly reduced natural transformability in C. jejuni.

The extracellular DNA is one of the major drivers of natural transformation (Ibáñez de

Aldecoa, Zafra, and González-Pastor 2017). There are different mechanisms by which microorganisms release DNA, including autolysis, active secretion as well as secretion as a part of membrane vesicles. There are reports on the detection of DNA in the culture medium of many naturally competent bacteria such as Neisseria spp. (Dillard and Seifert 2001), Neisseria meningitides (Lappann et al. 2010), Bacillus subtilis (Sinha and Iyer 1971, Brito et al. 2017),

Streptococcus pneumoniae (Steinmoen, Knutsen, and Håvarstein 2002) and C. jejuni (Vegge et al. 2012). In N. gonorrhea, DNA donation is an active process where DNA is released actively by cell using type IV secretion system (T4SS) and by autolysis. Neisseria, especially N. gonorrhoeae is a model organism to study natural competence. High amount of DNA in the C. jejuni supernatant demonstrated in our current study indicates a similar phenomenon where DNA is exported to the environment by perhaps a similar mechanism. By regulating competence in a cell density-dependent manner, it is likely that a bacterium becomes competent when it is surrounded by members of its own species and will have a high concentration of homologous donor DNA available (Solomon and Grossman 1996, Wiesner 2006). DNA donation to the environment by either autolysis or active secretion increases chances of DNA uptake by the member of same species and incidence of homologous recombination (Hamilton and Dillard

2006, Christie and Vogel 2000, Vegge et al. 2012). Dillard and Seifert (2001) have reported approximately 0.1- 0.2 ng/µl (0.1-0.2 µg/ml) DNA secreted by N. gonorrhoeae in culture medium (4 -24 hrs old culture) which is approximately 5-10 times less than what we reported in this study. Vegge et al. (2012) estimated the extracellular DNA present in C. jejuni strain NCTC

11168 cell supernatant to be approximately 0.04 µg/ml DNA in early stationary phase. This amount of DNA corresponds to approximately one molecule of a C. jejuni genome per 100 CFUs and is comparable to that reported for N. meningitides (Lappann et al. 2010) which actively release DNA without the cell lysis in the environment. We demonstrated that the amplification of genomic DNA from cell-free culture supernatant of C. jejuni is quite straight-forward and the result of the PCR assay indicated easy availability of DNA to surrounding C. jejuni cells. More research is needed in this area to investigate this issue closely. Not much is known about the mechanism by which DNA is released in C. jejuni. Svensson et al. (2014) have pointed out that no accessary autolysin (lytic transglycosylases) was detected in C. jejuni which could support lytic mechanism of DNA release. However, they have reported a decrease in CFUs is often observed in C. jejuni cultures after the exponential phase of growth, suggesting possible cell death, leading to release of DNA. N. gonorrhoeae uses type IV secretion system for active release of eDNA (extracellular DNA) to extracellular medium, and it was demonstrated that this secreted DNA is taken up by other cell from the same species or genus contributing towards

HGT (Hamilton et al. 2005, Ramsey, Woodhams, and Dillard 2011). T4SS is present in many species of genus Campylobacter and is possibly involved in its conjugative plasmid transfer or secretion of virulence factors (Fouts et al. 2005). We speculate that it is possible that C. jejuni also have a specific mechanism to release DNA without cell lysis, which warrants more attention in the future.

Along with natural transformation, DNA can be transported by a few more mechanisms in C. jejuni like conjugation (Zeng, Ardeshna, and Lin 2015, Oyarzabal, Rad, and Backert 2007) and transduction (Taylor et al. 1981). Conjugation has been used often in C. jejuni for genetic manipulation (Van Vliet et al. 1998). We studied the changes in the extent of HGT in absence of

cell-to-cell contact which eliminates the possibility of conjugation and other factors that require cell to cell in HGT in our study by removing cells of one marker strain in recombination assay.

For this purpose, filter-sterilized cell-supernatant was used, where cells were eliminated. But it is difficult to remove extracellular DNA by filtration. Wiesner (2006) previously used cell-free supernatant to demonstrate that C. jejuni releases DNA to its growth medium, which accelerates the recombination process. We found that recombination was possible when mere supernatant of overnight marker strain culture was present. The frequency of recombination decreased in cell- free supernatant in comparison to the recombination where both marker cells were used. This helps us conclude that cell-to-cell contact is an important contributing factor for DNA recombination observed in our studies but not a limiting factor for HGT in C. jejuni cells.

C. jejuni is a natural competent bacterium and can undergo natural transformation but is selective in DNA uptake. There are reports that point towards its selective behavior for DNA integration to the chromosome in C. jejuni (Wassenaar, Fry, and van der Zeijst 1993, Wilson et al. 2003, Beauchamp et al. 2017). While some other Gram-negative bacteria like N. gonorrhoeae and H. influenzae identifies self DNA based on specific DNA sequence repeated in their genome, there is no evidence supporting this possibility for C. jejuni (Beauchamp et al. 2017). But some reports suggest that C. jejuni can determine non-self DNA based on the DNA methylation patterns (Holt et al. 2012). Beauchamp (2017) has described the role of methylation of DNA as robust system to discriminate non-self DNA from self DNA. This is regulated by the two- component restriction modification system which comprise of restriction endonuclease and methyl-transferase. Many C. jejuni strains contain one Type I RM and four Type II systems

(Miller, 2005, Gardner and Olson, 2012). Another possible mechanism that plays a role in providing a barrier to C. jejuni from heterologous DNA is via CRISPR-CAS system (Gardner

100

and Olson 2012, Louwen et al. 2013). C. jejuni is believed to employ type II/Nmeni subtype

CRISPR-CAS system which uses Cas1, Cas2 and CsnII (Gardner and Olson 2012). While there are many pieces of evidence supporting the hypothesis that C. jejuni restricts DNA from other genus/species (Wiesner and Dirita 2008, Wang and Taylor 1990), some also suspect the preference towards DNA from the same strain. On the contrary, we found that when the recombination assay was performed using the marker strains in two different backgrounds, the result was not significantly different than with the same strain combinations (Figure 7). It might be that the host-restriction barrier in C. jejuni is conserved within the species so that the barrier might be lower or negligible among different strains of C. jejuni. We believe there is a need to study different factors which could have nullified the effect of strain barrier in this particular experiment. Of course, the above mentioned references have used purified DNA to perform natural transformation experiment while we are investigating the transfer of genetic material in a co-culture experiment without involving any purified DNA.

The biphasic medium is reported to support better C. jejuni growth (Shadowen and

Sciortino 1989) in comparison to liquid medium and it is widely used in C. jejuni natural transformation experiments (Wassenaar, Fry, and van der Zeijst 1993, Jeon et al. 2008). The biphasic medium system is a way to get more efficient natural transformation (Van Vliet et al.,

1998). But, our observation that liquid medium could also yield a significant number of recombinants indicates that biphasic medium system is not a critical factor for recombination in this experiment.

There are many reports showing that HGT is taking place in an environmental setting

(Gardner and Olson 2012). Chickens are the natural host of C. jejuni. C. jejuni infected chickens carry a very high C. jejuni load in their gastrointestinal tract, especially the ceca (Hermans,

101

Pasmans, Messens, et al. 2012) and considered to have an advantage in colonization as compared to other hosts (Hermans, Pasmans, Heyndrickx, et al. 2012). Wilson et al. (2010) analyzed genetic variation in C. jejuni cells before and after passage through broilers and mice. C. jejuni was found to be more adapted with a high frequency of genetic variation and a higher degree of genetic diversity when passaged through broilers as compared to that of mice. The data suggests that the broiler gastrointestinal tract provides an environment which promotes outgrowth and genetic variation in C. jejuni. The enhancement of genetic diversity at this location may contribute to its importance as a human disease reservoir. Reports have suggested that horizontal gene transfer occurs during colonization in the chicken gut environment (de Boer et al. 2002, Qu et al. 2008, Hänninen, Hakkinen, and Rautelin 1999). Genomic rearrangement as a result of gene transfer between C. jejuni and C. coli strains during colonization was observed by Korolik et al.

(1998).

We hypothesize that the chicken gut environment provides better conditions for recombination for C. jejuni cells. In this study, we removed all the cell debris and bacteria through filtration, providing a sterile supernatant of chicken ceca (Lin et al. 2003) and found that when it was used as a medium for recombination the frequency of recovered recombinants was

10-fold higher in comparison to MH broth. Considering the chicken gut is the natural habitat for

C. jejuni, it is interesting to observe the cecal environments is facilitating HGT in C. jejuni.

Increased HGT in the chicken gut environment would enhance genomic diversity within C. jejuni population in the chicken gut, promoting adaptability as a population to the gut environment, which constantly present challenges even though it is the natural habitat for this bacterium. It would be interesting to further expand this research by identifying specific molecules or metabolites responsible for increased HGT in the chicken gut environment. It

102

would reveal a clearer picture of the strategies employed by this pathogen to adapt to the dynamic gut environment.

3.6. Abbreviation

MH – Mueller-Hinton

LB – Luria-Bertani

Cm – Chloramphenicol

Km – Kanamycin

CmR – Chloramphenicol resistant

KmR – Kanamycin resistant

103

3.7. Reference

Avrain, L., Vernozy‐Rozand, C. and Kempf, I., (2004). Evidence for natural horizontal transfer of tetO gene between Campylobacter jejuni strains in chickens. Journal of Applied Microbiology 97 (1):134-140. Beauchamp, J. M., Leveque, R. M., Dawid, S., and DiRita, V. J. (2017). Methylation-dependent DNA discrimination in natural transformation of Campylobacter jejuni. Proceedings of the National Academy of Sciences, U.S.A. 114 (38):E8053-E8061. doi: 10.1073/pnas.1703331114 Brito, P.H., Chevreux, B., Serra, C.R., Schyns, G., Henriques, A.O., Pereira-Leal, J.B. (2017) . Genetic competence drives genome diversity in Bacillus subtilis. Genome Biology and Evolution 10 (1):108-124. Brown, H. L., Hanman, K., Reuter, M., Betts, R. P., Van Vliet, A. H. (2015.) Campylobacter jejuni biofilms contain extracellular DNA and are sensitive to DNase I treatment. Frontiers in Microbiology 6:699. Butzler, J. P., De Mol, P., & Mandal, B. K. (2018). "Clinical Aspects of Campylobacter Infections in Humans." In Campylobacter Infection in Man and Animals, 21-32. CRC Press. Christie, P. J., Vogel, J. P. (2000). Bacterial type IV secretion: conjugation systems adapted to deliver effector molecules to host cells. Trends in Microbiology 8 (8):354-360. Crespo, M. D., Altermann, E., Olson, J., Miller, W. G., Chandrashekhar, K., Kathariou, S. . (2016). Novel plasmid conferring kanamycin and tetracycline resistance in the turkey- derived Campylobacter jejuni strain 11601MD. Plasmid 86:32-37. de Boer, P. D., Wagenaar, J. A., Achterberg, R. P., Putten, J. P. V., Schouls, L. M., & Duim, B. (2002). Generation of Campylobacter jejuni genetic diversity in vivo. Molecular Microbiology 44 (2):351-359. doi: 10.1046/j.1365-2958.2002.02930.x. Dillard, J.P. and Seifert, H.S..( 2001). A variable genetic island specific for Neisseria gonorrhoeae is involved in providing DNA for natural transformation and is found more often in disseminated infection isolates. Molecular Microbiology 41 (1):263-277. Dingle, K.E., Colles, F.M., Wareing, D.R.A., Ure, R., Fox, A.J., Bolton, F.E., et al. (2001). Multilocus Sequence Typing System for Campylobacter jejuni. Journal of Clinical Microbiology 39 (1):14-23. Dorrell, N., Mangan, J.A., Laing, K.G., Hinds, J., Linton, D., Al-Ghusein, H. et al. (2001). Whole genome comparison of Campylobacter jejuni human isolates using a low-cost microarray reveals extensive genetic diversity. Genome Research 11 (10):1706-1715. Ducey TF and Dyer DW. (2002). Rapid identification of EZ:: TN™ transposon insertion sites in the genome of Neisseria gonorrhoeae. Epicentre Forum 9:6–7.

104

Duong, T. and Konkel, M.E., (2009). Comparative studies of Campylobacter jejuni genomic diversity reveal the importance of core and dispensable genes in the biology of this enigmatic food-borne pathogen. Current Opinion in Biotechnology 20 (2):158-165. Dworkin, J., Shedd, O.L., and Blaser, M.J. (1997). Nested DNA inversion of Campylobacter fetus S-layer genes is recA dependent. Journal of Bacteriology 179(23): 7523-7529. Fearnhead, P., Smith, N.G., Barrigas, M., Fox, A. and French, N. (2005). Analysis of recombination in Campylobacter jejuni from MLST population data. Journal of Molecular Evolution 61 (3):333-340. Fouts, D.E., Mongodin, E.F., Mandrell, R.E., Miller, W.G., Rasko, D.A., Ravel, J., et. al.(2005). Major structural differences and novel potential virulence mechanisms from the genomes of multiple Campylobacter species. PLoS Biology 3 (1):e15. Gaasbeek, E.J., Wagenaar, J.A., Guilhabert, M.R., van Putten, J.P., Parker, C.T., and van der Wal, F.J. (2010). Nucleases encoded by the integrated elements CJIE2 and CJIE4 inhibit natural transformation of Campylobacter jejuni. Journal of Bacteriology 192(4): 936- 941. Gaasbeek, E.J., Wagenaar, J.A., Guilhabert, M.R., Wösten, M.M., van Putten, J.P., van der Graaf-van Bloois, L., et al. (2009). A DNase encoded by integrated element CJIE1 inhibits natural transformation of Campylobacter jejuni. Journal of Bacteriology 191(7): 2296-2306. Gardner, Susan P, and Jonathan W Olson. (2012). "Barriers to horizontal gene transfer in Campylobacter jejuni". In Advances in Applied Microbiology, Academic Press 79, 19-42. Gibreel, A., Tracz, D.M., Nonaka, L., Ngo, T.M., Connell, S.R. and Taylor, D.E. (2004). Incidence of antibiotic resistance in Campylobacter jejuni isolated in Alberta, Canada, from 1999 to 2002, with special reference to tet (O)-mediated tetracycline resistance. Antimicrobial Agents and Chemotherapy 48 (9):3442-3450. Gilbreath, J.J., Cody, W.L., Merrell, D.S. and Hendrixson, D.R., (2011). Change is good: variations in common biological mechanisms in the epsilonproteobacterial genera Campylobacter and Helicobacter. Microbiology and Molecular Biology Reviews 75 (1):84-132. Gomez-Valero, L., Rusniok, C., Jarraud, S., Vacherie, B., Rouy, Z., Barbe, V., et al. (2011). Extensive recombination events and horizontal gene transfer shaped the Legionella pneumophila genomes. BMC Genomics 12(1): 536. Griggs, D.J., Johnson, M.M., Frost, J.A., Humphrey, T., Jørgensen, F. and Piddock, L.J. (2005). Incidence and mechanism of ciprofloxacin resistance in Campylobacter spp. isolated from commercial poultry flocks in the United Kingdom before, during, and after fluoroquinolone treatment. Antimicrobial Agents and Chemotherapy 49 (2):699-707. Gripp, E., Hlahla, D., Didelot, X., Kops, F., Maurischat, S., Tedin, K., et al.. (2011). Closely related Campylobacter jejuni strains from different sources reveal a generalist rather than a specialist lifestyle. BMC Genomics 12 (1):584.

105

Guerry, P., Pope, P.M., Burr, D.H., Leifer, J., Joseph, S.W., and Bourgeois, A. (1994). Development and characterization of recA mutants of Campylobacter jejuni for inclusion in attenuated vaccines. Infection and Immunity 62(2): 426-432. Guerry, P., Szymanski, C.M., Prendergast, M.M., Hickey, T.E., Ewing, C.P., Pattarini, D.L. et al. (2002). Phase variation of Campylobacter jejuni 81-176 lipooligosaccharide affects ganglioside mimicry and invasiveness in vitro. Infection and Immunity 70 (2):787-793. Habib, I., Louwen, R., Uyttendaele, M., Houf, K., Vandenberg, O., Nieuwenhuis, E.E. et al, . (2009). Correlation between genotypic diversity, lipooligosaccharide gene locus class variation, and caco-2 cell invasion potential of Campylobacter jejuni isolates from chicken meat and humans: contribution to virulotyping. Applied And Environmental Microbiology 75 (13):4277-4288. Halpin, A.L., Gu, W., Wise, M.E., Sejvar, J.J., Hoekstra, R.M. and Mahon, B.E., (2018). Post- Campylobacter Guillain Barré Syndrome in the USA: secondary analysis of surveillance data collected during the 2009–2010 novel Influenza A (H1N1) vaccination campaign. Epidemiology and Infection:1-6. Hamilton, H.L. and Dillard, J.P. (2006). Natural transformation of Neisseria gonorrhoeae: from DNA donation to homologous recombination. Molecular Microbiology 59 (2):376-385. Hamilton, H.L., Domínguez, N.M., Schwartz, K.J., Hackett, K.T. and Dillard, J.P. (2005). Neisseria gonorrhoeae secretes chromosomal DNA via a novel type IV secretion system. Molecular Microbiology 55 (6):1704-1721. Hansen, C.R., Khatiwara, A., Ziprin, R. and Kwon, Y.M., 2007 (2007). Rapid construction of Campylobacter jejuni deletion mutants. Letters in Applied Microbiology 45 (6):599-603. Harrington, C.S., Thomson-Carter, F.M. and Carter, P.E., (1997). Evidence for recombination in the flagellin locus of Campylobacter jejuni: implications for the flagellin gene typing scheme. Journal of Clinical Microbiology 35 (9):2386-2392. Heinemann, J.A. and Bungard, R.A., (2006). Horizontal gene transfer. Reviews in Cell Biology and Molecular Medicine. doi.org/10.1002/3527600906.mcb.200400141. Hermans, D., Pasmans, F., Heyndrickx, M., Van Immerseel, F., Martel, A., Van Deun, K. and Haesebrouck, F. (2012). A tolerogenic mucosal immune response leads to persistent Campylobacter jejuni colonization in the chicken gut. Critical Reviews in Microbiology 38 (1):17-29. Hermans, D., Pasmans, F., Messens, W., Martel, A., Van Immerseel, F., Rasschaert et al.(2012). Poultry as a host for the zoonotic pathogen Campylobacter jejuni. Vector-Borne and Zoonotic Diseases 12 (2):89-98. Holt, J.P., Grant, A.J., Coward, C., Maskell, D.J. and Quinlan, J.J. (2012). Cj1051c is a Major Determinant for the Restriction Barrier of Campylobacter jejuni Strain NCTC11168. Applied and Environmental Microbiology:AEM. 01799-12. Hänninen, M.L., Hakkinen, M. and Rautelin, H., (1999). Stability of related human and chicken Campylobacter jejuni genotypes after passage through chick intestine studied by pulsed- field gel electrophoresis. Applied and Environmental Microbiology 65 (5):2272-2275.

106

Ibáñez de Aldecoa, A.L., Zafra, O. and González-Pastor, J.E.. (2017). Mechanisms and regulation of extracellular DNA release and its biological roles in microbial communities. Frontiers in Microbiology 8:1390. Iglesias-Torrens, Y., Miro, E., Guirado, P., Llovet, T., Muñoz, C., Cerdà-Cuéllar, M. et al. (2018). Population structure, antimicrobial resistance and virulence-associated genes in Campylobacter jejuni isolated from three ecological niches: gastroenteritis patients, broilers and wild birds. Frontiers in Microbiology 9:1676. Jain, R., Rivera, M.C., Moore, J.E. and Lake, J.A (2003). Horizontal gene transfer accelerates genome innovation and evolution. Molecular Biology and Evolution 20 (10):1598-1602. Jeon, B., Muraoka, W., Sahin, O. and Zhang, Q. (2008). Role of Cj1211 in natural transformation and transfer of antibiotic resistance determinants in Campylobacter jejuni. Antimicrobial Agents and Chemotherapy 52 (8):2699-2708. Jerome, J.P., Bell, J.A., Plovanich-Jones, A.E., Barrick, J.E., Brown, C.T. and Mansfield, L.S. (2011). Standing genetic variation in contingency loci drives the rapid adaptation of Campylobacter jejuni to a novel host. PLoS One 6 (1):e16399. doi.org/10.1371/journal.pone.0016399 Korolik, V., Alderton, M.R., Smith, S.C., Chang, J. and Coloe, P.J. (1998). Isolation and molecular analysis of colonising and non-colonising strains of Campylobacter jejuni and Campylobacter coli following experimental infection of young chickens. Veterinary Microbiology 60 (2-4):239-249. Lappann, M., Claus, H., Van Alen, T., Harmsen, M., Elias, J., Molin, S. and Vogel, U. (2010). A dual role of extracellular DNA during biofilm formation of Neisseria meningitidis. Molecular Microbiology 75 (6):1355-1371. Lastovica, A.J. and Allos, B.M. (2008). "Clinical significance of Campylobacter and related species other than Campylobacter jejuni and Campylobacter coli." In Campylobacter, Third Edition, 123-149. American Society of Microbiology. Lefebure, T., Pavinski Bitar, P.D., Suzuki, H. and Stanhope, M.J. (2010). Evolutionary dynamics of complete Campylobacter pan-genomes and the bacterial species concept. Genome Biology and Evolution 2:646-655. Lin, J., Sahin, O., Michel, L.O. and Zhang, Q. (2003). Critical role of multidrug efflux pump CmeABC in bile resistance and in vivo colonization of Campylobacter jejuni. Infection and Immunity 71 (8):4250-4259. Liou, L.S., Chung, C.H., Wu, Y.T., Tsao, C.H., Wu, Y.F., Chien, W.C. and Chang, C.Y. (2016). Epidemiology and prognostic factors of inpatient mortality of Guillain-Barré syndrome: A nationwide population study over 14 years in Asian country. Journal of the Neurological Sciences 369:159-164. Louwen, R., Horst-Kreft, D., De Boer, A.G., Van Der Graaf, L., de Knegt, G., Hamersma, M. et al. (2013). A novel link between Campylobacter jejuni bacteriophage defence, virulence and Guillain–Barré syndrome. European Journal of Clinical Microbiology And Infectious Diseases 32 (2):207-226.

107

Mandal, R.K., Jiang, T. and Kwon, Y.M. (2017). Essential genome of Campylobacter jejuni. BMC Genomics 18 (1):616. Marder, E.P., Cieslak, P.R., Cronquist, A.B., Dunn, J., Lathrop, S., Rabatsky-Ehr, T. et al.(2017). Incidence and Trends of Infections with Pathogens Transmitted Commonly Through Food and the Effect of Increasing Use of Culture-Independent Diagnostic Tests on Surveillance-Foodborne Diseases Active Surveillance Network, 10 US Sites, 2013-2016. MMWR. Morbidity and Mortality Weekly Report 66 (15):397-403. Medini, D., Donati, C., Tettelin, H., Masignani, V. and Rappuoli, R (2005). The microbial pan- genome. Current Opinion in Genetics and Development 15 (6):589-594. Mell, J.C. and Redfield, R.J. (2014). Natural competence and the evolution of DNA uptake specificity. Journal of Bacteriology:JB. 01293-13. Miller, W.G., Pearson, B.M., Wells, J.M., Parker, C.T., Kapitonov, V.V., and Mandrell, R.E. (2005). Diversity within the Campylobacter jejuni type I restriction–modification loci. Microbiology 151(2): 337-351. Nachamkin, I., Allos, B.M. and Ho, T. (1998). Campylobacter species and Guillain-Barré syndrome. Clinical Microbiology Reviews 11 (3):555-567. Nuijten, P.J., van den Berg, A.J., Formentini, I., van der Zeijst, B.A. and Jacobs, A.A. (2000). DNA rearrangements in the flagellin locus of an flaA mutant of Campylobacter jejuni during colonization of chicken ceca. Infection and Immunity 68 (12):7137-7140. Oyarzabal, O.A., Rad, R. and Backert, S. (2007). Conjugative transfer of chromosomally encoded antibiotic resistance from Helicobacter pylori to Campylobacter jejuni. Journal of Clinical Microbiology 45 (2):402-408. Parkhill, J., Wren, B.W., Mungall, K., Ketley, J.M., Churcher, C., Basham, D. et al. (2000). The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 403 (6770):665-668. Pearson, B.M., Pin, C., Wright, J., I’anson, K., Humphrey, T. and Wells, J.M. (2003). Comparative genome analysis of Campylobacter jejuni using whole genome DNA microarrays. FEBS letters 554 (1-2):224-230. Pratt, A. and Korolik, V.. (2005). Tetracycline resistance of Australian Campylobacter jejuni and Campylobacter coli isolates. Journal of Antimicrobial Chemotherapy 55 (4):452-460. Qu, A., Brulc, J.M., Wilson, M.K., Law, B.F., Theoret, J.R., Joens, L.A. et al. (2008). Comparative metagenomics reveals host specific metavirulomes and horizontal gene transfer elements in the chicken cecum microbiome. PloS ONE 3 (8):e2945. Ramsey, M.E., Woodhams, K.L. and Dillard, J.P. (2011). The gonococcal genetic island and type IV secretion in the pathogenic Neisseria. Frontiers in Microbiology 2:61. Rivoal, K., Ragimbeau, C., Salvat, G., Colin, P. and Ermel, G. (2005). Genomic diversity of Campylobacter coli and Campylobacter jejuni isolates recovered from free-range broiler farms and comparison with isolates of various origins. Applied and Environmental Microbiology 71 (10):6216-6227.

108

Schouls, L.M., Reulen, S., Duim, B., Wagenaar, J.A., Willems, R.J., Dingle, K.E., Colles, F.M. and Van Embden, J.D. (2003). Comparative genotyping of Campylobacter jejuni by amplified fragment length polymorphism, multilocus sequence typing, and short repeat sequencing: strain diversity, host range, and recombination. Journal of Clinical Microbiology 41 (1):15-26. Shadowen, R.D. and Sciortino, C.V. (1989). Improved growth of Campylobacter pylori in a biphasic system. Journal of Clinical Microbiology 27 (8):1744-1747. Sheppard, S.K., McCarthy, N.D., Falush, D. and Maiden, M.C (2008). Convergence of Campylobacter species: implications for bacterial evolution. Science 320 (5873):237- 239. Singh, P, and Kwon Y. M. (2013). Comparative analysis of Campylobacter populations within individual market-age broilers using fla gene typing method. Poultry Science 92 (8):2135-2144. Sinha, RP, and VN Iyer, V. N. (1971). Competence for genetic transformation and the release of DNA from Bacillus subtilis. Biochimica et Biophysica Acta (BBA)-Nucleic Acids and Protein Synthesis 232 (1):61-71. Solomon, J.M. and Grossman, A.D. (1996). Who's competent and when: regulation of natural genetic competence in bacteria. Trends in Genetics 12 (4):150-155. Steinmoen, H., Knutsen, E. and Håvarstein, L.S.(2002). Induction of natural competence in Streptococcus pneumoniae triggers lysis and DNA release from a subfraction of the cell population. Proceedings of the National Academy of Sciences 99 (11):7681-7686. Suerbaum, S., Lohrengel, M., Sonnevend, A., Ruberg, F. and Kist, M. (2001). Allelic diversity and recombination in Campylobacter jejuni. Journal of Bacteriology 183 (8):2553-2559. Svensson, S.L., Pryjma, M. and Gaynor, E.C. (2014). Flagella-mediated adhesion and extracellular DNA release contribute to biofilm formation and stress tolerance of Campylobacter jejuni. PloS ONE 9 (8):e106063. doi.org/10.1371/journal.pone.0106063. Taboada, E.N., Acedillo, R.R., Carrillo, C.D., Findlay, W.A., Medeiros, D.T., Mykytczuk, et al. 2004 (2004). Large-scale comparative genomics meta-analysis of Campylobacter jejuni isolates reveals low level of genome plasticity. Journal of Clinical Microbiology 42 (10):4566-4576. Taylor, D.E., De Grandis, S.A., Karmali, M.A. and Fleming, P.C., (1981). Transmissible plasmids from Campylobacter jejuni. Antimicrobial Agents and Chemotherapy 19 (5):831-835. doi: 10.1128/aac.19.5.831. Taylor, Diane E. (2018). Plasmids from Campylobacter. In Campylobacter Infection in Man and Animals, 87-96. CRC Press. Thomas, C.M., and Nielsen, K.M. (2005). Mechanisms of, and barriers to, horizontal gene transfer between bacteria. Nature Reviews Microbiology 3(9): 711.

109

Van Vliet, A.H., Wood, A.C., Wooldridge, K., Ketley, J.M. and Henderson, J. (1998). Genetic manipulation of enteric Campylobacter species. Methods in Microbiology, Vol 27 27:407-419. Vegge, C.S., Brøndsted, L., Ligowska-Marzęta, M. and Ingmer, H. et al.(2012). Natural transformation of Campylobacter jejuni occurs beyond limits of growth. PloS ONE 7 (9):e45467. doi.org/10.1371/journal.pone.0045467. Vidal, AB, FM Colles, JD Rodgers, ND McCarthy, RH Davies, MCJ Maiden, and FA Clifton- Hadley. (2016). Genetic diversity of Campylobacter jejuni and Campylobacter coli isolates from conventional broiler flocks and the impact of sampling strategy and laboratory method. Applied and Environmental Microbiology. 03693-15. Wang, Y. and Taylor D. E.. (1990). Natural transformation in Campylobacter species. Journal of Bacteriology 172 (2):949-955. Wassenaar, T.M., Fry, B.N. and Van der Zeijst, B.A.M. (1995). Variation of the flagellin gene locus of Campylobacter jejuni by recombination and horizontal gene transfer. Microbiology 141 (1):95-101. Wassenaar, T.M., Fry, B.N. and van der Zeijst, B.A. (1993). Genetic manipulation o f Campylobacter: evaluation of natural transformation and electro-transformation. Gene 132 (1):131-135. Whitchurch, C.B., Tolker-Nielsen, T., Ragas, P.C. and Mattick, J.S. (2002). Extracellular DNA required for bacterial biofilm formation. Science 295 (5559):1487-1487. Wiesner, R. S. (2006). Physiological, genetic, and biochemical studies of natural competence in Campylobacter jejuni. [Doctoral dissertation], University of Michigan. Wiesner, R. S., and Victor J Dirita. (2008). "Natural competence and transformation in Campylobacter". In Campylobacter, Third Edition,. American Society of Microbiology, ASM press, 559-570. Wiesner, R.S., Hendrixson, D.R. and DiRita, V.J. (2003). Natural transformation of Campylobacter jejuni requires components of a type II secretion system. Journal of Bacteriology 185 (18):5408-5418. Willison, H.J. and O'Hanlon, G.M., (1999). The immunopathogenesis of Miller Fisher syndrome. Journal of Neuroimmunology 100 (1):3-12. Wilson, D.J., Gabriel, E., Leatherbarrow, A.J., Cheesbrough, J., Gee, S., Bolton, E. et al. (2009). Rapid evolution and the importance of recombination to the gastroenteric pathogen Campylobacter jejuni. Molecular Biology and Evolution 26 (2):385-397. Wilson, D.L., Bell, J.A., Young, V.B., Wilder, S.R., Mansfield, L.S. and Linz, J.E. (2003). Variation of the natural transformation frequency of Campylobacter jejuni in liquid shake culture. Microbiology 149 (12):3603-3615. Wilson, D.L., Rathinam, V.A., Qi, W., Wick, L.M., Landgraf, J., Bell, J.A. et al. (2010). Genetic diversity in Campylobacter jejuni is associated with differential colonization of broiler chickens and C57BL/6J IL10-deficient mice. Microbiology 156 (7):2046-2057.

110

Yao, R., Alm, R.A., Trust, T.J. and Guerry, P. (1993). Construction of new Campylobacter cloning vectors and a new mutational cat cassette. Gene 130 (1):127-130. Zeng, X., Ardeshna, D. and Lin, J. (2015). Heat Shock Enhanced Conjugation Efficiency in Standard Campylobacter jejuni Strains. Applied and Environmental Microbiology 00346- 15. doi:10.1128/AEM.00346-15 Zhang, Y.X., Perry, K., Vinci, V.A., Powell, K., Stemmer, W.P. and del Cardayré, S.B. (2002). Genome shuffling leads to rapid phenotypic improvement in bacteria. Nature 415 (6872):644-646.

111

3.8. Tables and Figures

Figures

Figure 1. Diagram showing the method used to perform the recombination assay.

112

Figure 2. Diagram showing possible homologous recombination that takes place between the two marker strains.

Figure 3. Location of primers used to amplify the insertion junction where antibiotic markers are inserted.

113

Figure 4. Gel picture showing the result of colony PCR of 10 recombinant colonies picked from MH agar plate with Kanamycin and Chloramphenicol. A. the result of colony PCR using Kanamycin marker specific primers (Kan_in_f and Kan_in_r). B. the result of colony PCR using Chloramphenicol marker-specific primers (Cat_in_f and Cat_in_r). DNA templates used: Lane 1 to 10- recombinant colonies; Lane 11- parent strain with kanamycin resistance marker; Lane 12- parent strain with chloramphenicol resistance marker; Lane 13- wild-type C. jejuni strain 11168 with no marker.

114

Figure 5. Comparison of the recombinant levels as expressed in percentage recombinants in the total number of parent cells between incubation for 5 hrs (control) vs. 24 hrs. *indicates significant difference at P < 0.05.

115

Figure 6. Comparison of the recombinant levels as expressed in percentage recombinants in the total number of parent cells between biphasic medium vs. liquid medium. *indicates significant difference at P < 0.05.

116

117

118

Figure 9. Comparison of the recombinant levels as expressed in percentage recombinants in the total number of parent cells when the recombination assay was performed without (control) and with addition of DNAse I (DNase I) to eliminate extracellular DNA from the medium. **indicates significant difference at P < 0.01.

119

Figure 10. Agarose gel picture showing the result of PCR performed using cell-free culture supernatant of wild type C. jejuni strain 81-176 with the primer sets targeting 6 genomic loci. 5 µl of PCR mix was loaded onto gel. Lane 1 and 8 represent 100kb ladder. Lane 2 to 7 represent the PCR products from ciaB, motAB, docB, kpsE, cstII and CJJ81176_RS02890 regions, re spectively.

120

121

Table 1. Oligonucleotides used in this study.

Name Primer sequence (5’3’) Use Lflk_hipO_f CAAGCAAGGGGCTAAAATAGG TCAATCTATATCACGCAATTAAC Primers used to amplify left flanking Lflk_hipO_r TTGGAAAGGAACACCGCGCTTT region of hipO gene TAGCTAGGGCTGCAA Cat_f GCGGTGTTCCTTTCCAAGT Primers used to amplify chloramphenicol Cat_r CAGTGCGACAAACTGGGATT resistance gene. AAGACTTGCTGAATAAATAAAA Rflk_hipO_f TCCCAGTTTGTCGCACTGTTTTT Primers used to amplify right flanking AAAACCCCCACAACG region of hipO gene. Rflk_hipO_r TTCCAATCCAAATCAAACTGC ATGGCTCATAACACCCCTTGTAT Primer to determine the insertion loci of Inv-1 TA GAACTTTTGCTGAGTTGAAGGA Tn-5 library mutant. Inv-2 TCA Sequencing primer used to sequence KAN-2 FP-1 ACCTACAACAAAGCTCTCATCA ACC insertion loci of Tn-5 mutant. Kan_in_f AGGATCAGATCACGCATCTTC Primers used to amplify insertion junction of genomic locus and kanamycin marker of Kan_in_r AAGTCCACCCAAAACTGCAC recombinant cells. Cat_in_f CAAGCAAGGGGCTAAAATAGG Primers used to amplify insertion junction of genomic locus and chloramphenicol Cat_in_r CAGTGCGACAAACTGGGATT marker of recombinant cells. Primer1-f AAACTCAACAGCTCCCCAAA Primers used to amplify kpsE genomic Primer1-r CCAGAAAGCGCAAAATATCC region of C.jejuni.

Primer2-f CAGCTTTCTATTGCCCTTGC Primers used to amplify cstII genomic Primer2-r CGGTCTCATATTCTTGATTTTGG region of C.jejuni. Primer3-f AAAGCCAAGCTACCATTACCAA Primers used to amplify docB genomic Primer3-r TCAACCCAAACCATGAAAGA region of C.jejuni. Primer4-f TGTTTTGCTATCGCAAGCTG Primers used to amplify genomic region (Locus tag CJJ81176_0620 and Primer4-r TATCATAGCCGTTGCTGCTG CJJ81176_0621) of C.jejuni.

Primer5-f TCAATCAAACGCCTAAGTATGG Primers used to amplify ciaB genomic ACAACGCGTTCAGGAGAAAG region of C.jejuni. Primer5-r Primer6-f TCGCTCTTCGCATAAAACAA Primers used to amplify motB genomic Primer6-r CATATTTGCCACCTCAAGCA region of C.jejuni.

122

3.9 Appendix

3.9.1 IBC protocol

123

3.9.2 IACUC protocol

124

Chapter 4

Proteomic Analysis of Campylobacter jejuni during interaction with Amoeba Host

125

Proteomic Analysis of Campylobacter jejuni during interaction with Amoeba Host

Deepti P. Samarth1, Rohana Liyanage2, Jackson. O. Lay, Jr.2, Young Min Kwon1,4.

1Department of Poultry Science, University of Arkansas, Fayetteville, Arkansas, USA, 72701.

2Arkansas Statewide Mass Spectrometry Facility, University of Arkansas, Fayetteville, AR, USA, Fayetteville, Arkansas, USA, 72701.

1Department of Poultry Science, University of Arkansas, Fayetteville, AR, 72701.

2Cell and Molecular Biology Program, University of Arkansas, Fayetteville, AR, 72701.

Running title:

*Corresponding author:

Dr. Young Min Kwon

Department of Poultry Science University of Arkansas 1260 W. Maple St. Fayetteville, AR 72701 Email: [email protected]

Keyword: Campylobacter, Environmental survival, reservoir, Transmission.

126

4.1. Abstract

Campylobacter jejuni is a zoonotic pathogen and also the major cause of foodborne diarrheal illness in humans. Most of the human C. jejuni infections are associated with consumption of undercooked poultry products contaminated with C. jejuni. Previous studies indicate that free- living amoebae (FLA) can serve as an environmental reservoir of bacterial pathogens, and the possibility of horizontal transmission of C. jejuni in poultry house through its interaction with

FLA which is ubiquitously present in the water supply. However, there is limited information about the complexity of these interactions and underlying molecular mechanisms. In order to gain a better understanding of these interactions, we performed proteomic analysis to identify proteins of C. jejuni 81-176 which are differentially expressed upon its contact with

Acanthamoeba castellanii strain (ATCC 50374). We used modified gentamicin protection assay to achieve A. castellanii cells with only intracellular C. jejuni and removed C. jejuni present in the suspension. C. jejuni was cultured in MH broth for 16 hrs at 42°C in microaerophilic conditions and also further incubated with A. castellanii for 3hrs followed by gentamicin and

Triton X-100 treatment. Samples were collected at 20 mins, 3 hrs, after gentamicin treatment and

Triton X-100 treatment. Samples including control sample having only C. jejuni cells were subjected to SDS-PAGE-based protein extraction, and the extracted proteins were subject to proteomic analysis using liquid chromatography–tandem mass spectrometry (LC–MS/MS).

Overall 404 C. jejuni proteins were detected in this study (control + experimental samples).

Differentially expressed proteins were analyzed for functional annotation and protein association by using String software. We found that fumarate metabolism is favoured by C. jejuni while it is extant intracellularly in amoeba host which indicated by upregulation of protein FrdA. A cluster of chemotaxis proteins, methyl-accepting chemotaxis proteins and proteins aiding oxidative

127

stress were downregulated. The result of this study highlights the conserved mechanisms of C. jejuni intracellular survival between amoeba and mammalian hosts. In conclusion, our study will provide insights on how C. jejuni interact with amoeba host and will help develop effective strategies to control the transmission of C. jejuni in poultry house using amoeba as a protective reservoir.

128

4.2 Introduction

Campylobacteriosis caused by Campylobacter jejuni referred to as acute enteritis and is one of the most reported zoonosis both in developed and developing countries (Jacobs-Reitsma et al., 2008; Tresse et al., 2017; Fischer and Paterek, 2019). Even though a large number of cases go unreported, Foodborne Diseases Active Surveillance Network (FoodNet) estimates that C. jejuni affects over 1.3 million individuals every year (Patrick et al., 2018). C. jejuni infection can often be followed by severe post-infection complications, which include Guillain-Barré syndrome, Miller Fisher syndrome, reactive arthritis and meningitis (Allos, 1997; Nachamkin et al., 1998; Willison and O'Hanlon, 1999; Pope et al., 2007; Liou et al., 2016). C. jejuni infections are a common trigger to cause Guillain-Barré syndrome due to its molecular mimicry to the nerve cells, resulting in aggressive humoral immune response causing neuropathy (Halpin et al.,

2018). Approximately 20% of Guillain-Barré syndrome patients remain severely disabled and with 5% mortality, despite immunotherapy (Ang et al., 2001). C. jejuni is a recognized human pathogen from the mid-20th century (Nachamkin et al., 2008) and one of the first foodborne pathogen genomes to be completely sequenced (Parkhill et al., 2000). Nevertheless, we still know little about its transmission and colonization mechanisms. C. jejuni is sensitive to environmental stress outside warm-blooded hosts and fastidious in nature. C. jejuni can grow only in microaerophilic condition and at a narrow temperature range in a laboratory setup

(Rollins and Colwell, 1986; Park, 2002). On the other hand, contaminated environmental water sources are responsible for numerous campylobacteriosis outbreaks (Jones, 2001; Kuusi et al.,

2005; Nilsson et al., 2018), and many studies reported C. jejuni in environmental samples

(Moore et al., 2001; Kovanen et al., 2016) where none of these fastidious conditions are provided.

129

The role of unicellular eukaryotes, especially free-living amoeba (FLA) has gained some serious attention in support of survival and dissemination of some water-borne human pathogens

(Horn and Wagner, 2004; Vaerewijck et al., 2014; Scheid, 2015; Balczun and Scheid, 2017), including Legionella pneumophila (Kwaik et al., 1998), Mycobacterium avium (Miltner and

Bermudez, 2000) and Vibrio cholerae (Abd et al., 2007). FLA are virtually ubiquitous in environmental water sources (Rodríguez-Zaragoza, 1994; Loret and Greub, 2010; Thomas and

Ashbolt, 2010; Thomas et al., 2010) and feed on the small microorganism. Some microorganisms including bacteria, viruses and smaller protists have evolved to resist protozoan grazing (Greub and Raoult, 2004; Matz and Kjelleberg, 2005). One of the major characteristics of these microorganisms is the ability to survive intracellularly in FLA (Casadevall, 2008), and thus FLA serves as a good environmental host for many of these microorganisms.

Studies have reported that FLA could act as a protective environmental host for C. jejuni and provide an escape to survive away from harsh environmental conditions (Snelling et al.,

2008; Olofsson et al., 2013; Vieira et al., 2015). This commensal association between FLA and

C. jejuni is turning as a serious concern for public health as well as food safety (Snelling et al.,

2008; Axelsson-Olsson et al., 2010; Olofsson et al., 2015; Vieira et al., 2015). Acanthamoeba castellanii, one of the most common FLA found in environmental water sources, is reported to act as environmental reservoir of many microbial pathogens and also a common model organism to study FLA-endobiont bacteria interactions (Khan, 2006; Abd et al., 2007; Huws et al., 2008;

Siddiqui and Khan, 2012; Hsueh and Gibson, 2015; Vieira et al., 2015). There are evidences that

C. jejuni could survive better in both in proximity and intracellularly in A. castellanii (Axelsson-

Olsson et al., 2007; Snelling et al., 2008; Axelsson-Olsson et al., 2010; Bui et al., 2012a; Bui et al., 2012b).

130

Understanding of molecular mechanisms of C. jejuni- FLA interaction is critical to understand the environmental survival of C. jejuni. Since both C. jejuni and FLA co-occur in the same environments (Vaerewijck et al., 2014), deciphering the molecular mechanisms will assist in better understanding of the survival and transmission of C. jejuni and will help in developing effective control strategies to reduce C. jejuni infections. In the present study, a data-dependent whole proteome analysis of intracellular C. jejuni cells inside A. castellanii by mass-spectroscopy was used to get insights into changes of C. jejuni physiology upon interactions with A. castellanii.

4.3. Materials and Methods

4.3.1. Bacterial and amoeba strains and culture methods.

C. jejuni strain 81-176 used in the current study was generously donated by Dr. Michael

Slavik (University of Arkansas, AR, U.S.A.). C. jejuni was cultured in Mueller‐Hinton (MH) agar or broth at 37°C in a microaerophilic condition where gas composition was O2 (5%), CO2

(10%) and N2 (remaining balance) and are stored in MH broth containing 15% glycerol at -80°C.

For all the following experiments, C. jejuni starter culture was prepared by recovering cells from the frozen stock onto MH agar plates with trimethoprim (10 μg ml−1) (24 hrs incubation) and a heavy inoculum from 24 hrs culture plate to 5 ml MH broth followed by 16 hrs incubation. All procedures involving C. jejuni (Biosafety level 2) were conducted according to the protocol approved by the Institutional Biosafety Committee (IBC) at the University of Arkansas.

A. castellanii strain ATCC 50374 (a free-living amoeba) was generously provided by Dr.

Kristen E. Gibson (University of Arkansas, AR, U.S.A) and was axenically cultured in accordance with ATCC protocols using peptone-yeast extract-glucose medium (PYG medium

ATCC 712) (pH 6.5) with additives (0.4 mM CaCl2, 4 mM MgSO4·7H2O, 2.5 mM

Na2HPO4·7H2O, 2.5 mM KH2PO4, 0.05 mM Fe (NH4)2(SO4)2·6H2O, 1g/liter sodium

131

citrate·2H2O) (Hsueh and Gibson, 2015) in vented tissue culture flasks at 25°C. A. castellanii culture was initiated from frozen trophozoites (vegetative amoeba cells)/cyst (amoeba dormant form) aliquots stored in liquid nitrogen. The aliquot was thawed rapidly in a water bath at 37°C and resuspended in 1015 ml of fresh media and centrifuged at 600 rpm for 5 min, the supernatant was discarded to remove DMSO. Amoeba pellet was suspended in 250 µl of fresh

PYG medium and transferred to new T-25 flasks with vent caps containing fresh medium and incubated at 25°C. A. castellanii cells were passed to new T-flask when ~95% confluent sheet of trophozoites culture was formed on the bottom surface of the flask (i.e., near peak density), which typically took 2 to5 days. The trophozoite/cysts were preserved in liquid nitrogen in the

15% DMSO (prepared in PYG medium).

4.3.2. C. jejuni-A. castellanii co-culture and modified gentamicin protection assay (MGPA).

A modification of the gentamicin protection assay described by Dirks and Quinlan (2014) was used to examine C. jejuni-A. castellanii interactions. MGPA was conducted in centrifuge tubes instead of T-flasks or wells, which are used in conventional gentamicin protection assay to study bacterial invasion in animal cell culture experiments. A low centrifugation speed of 600g for 5 min was used for the washing step to avoid washing off of A. castellanii cells. Before mixing C. jejuni cells and A.castellanii cells to prepare a co-culture to perform the assay, both A. castellanii and C. jejuni cells were prepared as followings. The A. castellanii culture from multiple T-flasks was pooled and washed three times with PBS (Phosphate buffered saline) by centrifugation at 600g for 5min and resuspended in PBS. A. castellanii trophozoites were counted by performing trypan-blue exclusion assay (Strober, 1997) using hemocytometer and trypan-blue dye (10X), which allowed us to avoid counting of any non-viable amoebae in cell counts. The amoebae cells were visualized and counted by phase contrast microscopy with a 10×

132

magnification in an inverted table-top microscope. Then, it was adjusted to a concentration of

1×107 amoebae/mL using PBS. C. jejuni cells were cultured for 16 hrs at 37°C in MH broth with trimethoprim (10 μg ml−1) and washed twice before resuspending in PBS. C. jejuni cell concentration was determined by spectrophotometer and checked for a number of CFU/ml by dilution plating (MH agar plates; incubation period 48 hrs). Finally, 25 ml of C. jejuni-A. castellanii mixture was prepared, where C. jejuni (1×109 CFU/mL) was mixed with

Acanthamoeba culture (1×107 amoebae/mL) giving a multiplicity of infection (MOI) of 1000:1 in a 50 ml centrifuge tube. The co-culture was incubated for 20 min at room temperature. A sample (5 ml from the co-culture) were collected for protein extraction at this time-point and the sample represented C. jejuni-A. castellanii interaction after 20 min and abbreviated as CA-

20min-NGNT (where NG represents No Gentamicin treatment, and NT represents No Triton X-

100 treatment). The co-culture was incubated for 2 hrs 40 min, which make the total incubation to 3 hrs from the 0 time-point. A 5 ml sample recovered at that time point and the sample was designated as CA-3hrs-NGNT. Remaining 15 ml co-culture was centrifuged (600 g X 5 mins), and then resuspended in 15 ml of gentamicin (200µg/ml) prepared in PYG medium (ATCC 712) followed by 2 hrs incubation at room temperature. After this, co-culture was washed three times with PBS (600 g×5 min) to remove any remaining extracellular and attached C. jejuni as well as gentamicin present in the medium. After washing the A. castellanii cells were resuspended in 15 ml of PBS. At this time, a sample (5 ml from the co-culture) was collected for protein extraction which corresponded to A. castellanii which contained only intracellular C. jejuni cells and this sample was abbreviated as CA-3hrs-GNT. Ten ml of the remaining co-culture was treated with

0.3% Triton X-100 for 20 min. This step helps to lyse the A. castellanii cells and release any intracellular C. jejuni out of the A. castellanii cells. Five ml of this lysate was recovered for the

133

protein extraction and the sample was abbreviated as CA-3hrs-GT. One hundred µl cell lysate was serially diluted in MH broth, plated onto MH agar plates containing 10μg/mL trimethoprim, and incubated for 48 hrs at 37°C under microaerophilic conditions to verify the presence of intracellular C. jejuni.

At all steps, A.castellanii morphology was closely monitored by visualization using an inverted microscope and amoeba count was monitored by Trypan blue exclusion assay (Strober,

1997) using a hemacytometer by means of an inverted microscope. All washing steps in this assay and invasion assay were performed by centrifugation at 600g for 5 min. All samples were centrifuged for 30 min at 14000 rpm after performing MGPA. The supernatant was removed and the cell pellets were used for protein extraction or stored at -80°C. This experiment was performed in triplicate.

4.3.3. Sample preparation for proteomics and mass spectrometry analysis.

The cell pellet obtained from the MGPA was used to extract the proteins using the

Qproteome Bacterial Protein Prep kit (Qiagen). The cell pellet was lysed using rapid repetitive freezing in liquid nitrogen and thawing in ice before using protein extraction kit. We used spin columns (Vivaspin 15R™ 3,000 MWCO, Vivascience™) for the desalting of proteins samples obtained after protein extraction. This desalting method was compatible with the Triton-X 100

(Bhandary et al., 2012). Protein concentration estimation was performed by Nanodrop 1000

Spectrophotometer (ND-1000, Nanodrop) before running the SDS- PAGE gel. The samples were treated with 2-Mercaptoethanol for 10 mins (boil in a water bath) to reduce disulfide bonds within proteins. One-dimensional electrophoresis was used to separate proteins based on molecular weight and to remove non-protein impurities. In-gel protein digestions were performed for the separated protein gel bands as described below and subsequently, those digests

134

were subjected to LC-MS/MS. NuPAGE™ 4-12% Bis-Tris protein gels, (12-well; 1.0 mm)

(Invitrogen™) was used to load samples and SDS-PAGE gel electrophoresis was performed at

200 V for 50 min. Each protein sample was loaded into one well of the gel. After gel electrophoresis, the entire gel lane having one sample was divided into 2 parts and then processed separately and performed LC-MS/MS to maximize the number of proteins identified.

Data from two gel parts were later combined using the software before performing extensive protein quantitative studies.

After electrophoresis, the gel was stained overnight using Coomassie blue dye. The stained proteins, now visible due to staining were sectioned into 2 parts and processed separately.

These gel parts were chopped into small pieces to increase the surface area for trypsin to penetrate into for digestion. Small gel pieces less than 1 mm2 in size were pooled together and transferred into a micro-centrifuge tube and washed twice with 50 mM ammonium bicarbonate

(NH4HCO3), de-stained with NH4HCO3/ 50% Acetonitrile (ACN), and dried with pure ACN.

Then, the proteins were reduced using 10 mM Dithiothreitol in 50 mM NH4HCO3 for 1hr at

55°C water bath. Ten mg/ml Iodoacetamide Acid in 50 mM NH4HCO3 was used to perform alkylation of proteins in dark for 1 hr at room temperature. Next, the proteins were washed with

50 mM NH4HCO3 and dried with pure acetonitrile (ACN) can before digestion to avoid any interference from excess iodoacetamide for the digestion. Trypsin gold (Mass spectrometry grade) from Promega (~20 ng/μl in 50 mM NH4HCO3) was added enough to cover dried gel pieces and kept in 4 °C for 30 min so that the trypsin would absorb to gels efficiently. After 30 mins in 4 °C, 200-300 µl of 50 mM NH4HCO3 was added to the gel pieces to ensure sufficient hydration of gel pieces for trypsin carry on the trypsin digestion and left overnight at room temperature for efficient in-gel digestion of the proteins. Tryptic peptides produced during the

135

digestion were diffused out to the solution. This solution containing tryptic peptide was collected along with three times by extractions using 5% formic acid (FA) solution, pooled together, evaporated and reconstituted in 50 µl of 0.1% FA before LC-MS/MS analysis.

4.3.4. HPLC and Mass spectrometry.

LC-MS/MS analysis was performed using the data-dependent acquisition of one MS scan followed by MS/MS scans of the most abundant ions in each MS scan based on a set threshold. The tryptic digests obtained from all samples were analyzed by ESI-LC-MS/MS

(Electrospray ionization liquid chromatography-tandem mass spectrometry) at State Wide Mass

Spectrometry Facility, University of Arkansas (Fayetteville AR.). Data-dependent analysis

(DDA) for the in-gel trypsin digested samples from each condition were performed by using an

Agilent 1200 series micro flow HPLC in line with Bruker Amazon-SL quadrupole ion trap ESI mass spectrometer (QIT-ESI-MS). All the ESI-MS analyses were performed in a positive ion mode using Bruker captive electrospray source with a dry nitrogen gas temperature of 200 °C, with a nitrogen flow rate of 3 L/minute. LC-MS/MS data were acquired in the Auto MS (n) mode with optimized trapping condition for the ions at m/z 1000. MS scans were performed in the enhanced scanning mode (8100 m/z/second). The collision-induced dissociation or the

MS/MS fragmentation scans were performed automatically for top precursor ions with a set threshold for one minute in the UltraScan mode (32,500 m/z/second). Tryptic peptides were separated by reverse-phase high-performance liquid chromatography (RP-HPLC) using a Zorbax

SB C18 column, (150 × 0.3 mm, 3.5 μm particle size, 300 Å pore size, Agilent Technologies), with a solvent flow rate of 4 μL/minute, and a gradient of 5% to 38% consisting of 0.1% FA

(solvent A) and ACN (solvent B) over a time period of 320 minutes.

136

4.3.5. Database Searching and Bioinformatics.

Peaks were picked in the LC-MS/MS chromatogram using Bruker default settings using

Bruker Daltonics Data Analysis software 4.0. Bruker Proteinscape bioinformatics suite coupled with MASCOT 2.1 was used to search the uniport Campylobacter jejuni subsp. jejuni serotype

O:23/36 (strain 81-176) database for identification of proteins. Scaffold (version Scaffold_4.8.4,

Proteome Software Inc., Portland, OR) was used to validate MS/MS based peptide and protein identifications by using false discovery rates of less than 5%. Spectral counts of these identified tryptic peptides were compiled and grouped in Scaffold software according to the replicates/conditions to perform statistical analysis. We used data from samples of three different biological replicates to prepare the final Scaffold output file which was used for differential protein analysis. Protein identifications were accepted if they could be established at greater than

99.0% probability to achieve an false discovery rate (FDR) less than 5.0% and contained at least

2 identified peptides (Keller et al., 2002). Protein probabilities were assigned by the Protein

Prophet algorithm (Nesvizhskii et al., 2003). Proteins that contained similar peptides and could not be differentiated based on MS/MS analysis alone were grouped to satisfy the principles of parsimony. Proteins sharing significant peptide evidence were grouped into clusters. Proteins were annotated with GO terms from goa_uniprot_all.gaf (Ashburner et al., 2000). The sample reports were exported to Microsoft Excel from Scaffold, processed and the differentially expressed proteins were analyzed by STRING software. Identified proteins were investigated to predict functional protein association networks for each entry using the STRING online database

(http://string-db.org).

137

4.3.6. Statistical analyses.

The experiments were performed in triplicate. Scaffold software program used for differential protein analysis. Mean spectra counts values were compared using a Student’s t-test between two samples; significance was assigned at P < 0.05. Proteins in more than two samples were compared using Analysis of variance (Anova) test; significance was assigned at P < 0.05. Only those proteins and fold-change increases or decreases and P < 0.05 were considered statistically significant and examined further. Scaffold software was used to generate the Venn diagram. Volcano plots were generated by plotting log2 (p-value) vs. log2 (fold-change) of the identified proteins.

4.4. Results and Discussions.

C. jejuni is known to be major foodborne bacterial pathogen worldwide for a long time

(Allos, 1997) and surprisingly we know little about its pathogenesis and environmental survival

(Murphy et al., 2006; Mihaljevic et al., 2007). Its fastidious nature under laboratory conditions suggests that its environmental survival is difficult unless it goes a dynamic transformation in its physiology and/or phenotype. We also know that some studies have suggested its intracellular survival in small eukaryotes, mainly FLA which is ubiquitously present in environmental water sources (Snelling et al., 2005; Axelsson-Olsson et al., 2010; Olofsson et al., 2015; Vieira et al.,

2015). Some others have suggested that mere presence of FLA in C. jejuni surrounding could help it to cope with the environmental stress especially oxidative stress (Axelsson-Olsson et al.,

2007; Bui et al., 2012a; Bui et al., 2012b). But we know little about molecular aspects of the C. jejuni involved in FLA-C. jejuni interaction.

To get a snapshot of the proteins and changes in C. jejuni physiology in the interaction with A. castellanii (a commonly isolated FLA), we performed whole proteome analysis of C. jejuni after its interaction with A. castellanii. Gentamicin protection assay (GPA) is used to study the invasion and survival efficiency of a bacterial pathogen and to quantify the intracellular

138

bacteria in animal tissue culture cells and many FLA (Zhou, Elmose and Call 2007, Douesnard-

Malo and Daigle, 2011). A. castellanii when grown in T-flasks, produce a suspension culture which means that the cells are non-adherent to the substratum. When performed GPA (C. jejuni with A. castellanii cells), loosely suspended cells are removed during different washing steps. To overcome this challenge, we used a modification of GPA described by Dirks and Quinlan (2014).

Modified Gentamicin assay (MGPA) is performed in a similar manner to that of GPA with a few modifications. The modifications include 1. After combining C. jejuni and A. castellanii in a fixed ratio [multiplicity of infection (MOI) of 1000:1], the entire co-culture containing C. jejuni and A. castellanii cells were transferred to a centrifuge tube, it helps to prevent the amoeba from washing off., 2. All the wash step is performed by centrifugation of amoeba cells at a low centrifugation speed (600 g for 5 min). We used internalization assays where both C. jejuni and

A. castellanii were permitted to interact for 3hrs incubation. We removed both any C. jejuni cells attached to amoeba cells as well as extracellular C. jejuni cells present in the supernatant using gentamicin followed by amoeba cell lysis using Triton X-100 to release the intracellular bacteria.

4.4.1. Modified Gentamicin assay (MGPA).

MGPA was used to obtain intracellular C. jejuni cells internalized inside A. castellanii cells. Using the mild resistance ability of C. jejuni towards TritonX-100, we could obtain intracellular C. jejuni proteins without overwhelming amoeba proteins which could otherwise be surrounding and could later influence the extraction and identification of C. jejuni proteins (Liu et al., 2012). TritonX-100 was used to lyse A. castellanii cells which facilitated the release of those C. jejuni cells that were internalized by A. castellanii into the PBS. Before performing

MGPA, the effect of 0.3% Triton X-100 on C. jejuni was monitored by exposing C. jejuni 0.3%

Triton X-100 prepared in MH broth for 20 mins (same duration of exposure used in MGPA) and

139

we found there was no decrease in recovered C. jejuni cells as compared to PBS (data not shown). TritonX-100 has been previously used in different studies from 2.0% to 0.5% to lyse A. castellanii without significantly affecting intracellular C. jejuni and other bacteria recovery

(Landers et al., 2000; Akya et al., 2010; Vieira et al., 2017). Also, TritonX-100 is also used in a proteomic experiment by Liu et al. (2012) to lyse epithelial cells to release intracellular C. jejuni.

After the gentamicin treatment, while performing the MGPA experiments, the supernatant of A. castellanii- C. jejuni co-culture treated with gentamicin and washed with PBS and was plated on to MH agar plates with 10 µg/ml trimethoprim to see if we could recover any

C. jejuni that was not killed by the gentamicin treatment. In all three replicates, we did not recover any C. jejuni cells on MH agar plates after the step where gentamicin treatment was performed. We also made sure that gentamicin did not adversely affect A. castellanii. For this, before we performed MGPA, we monitored the effect of gentamicin on A. castellanii cells by exposing A. castellanii cells to gentamicin solution (200µg/ml) prepared in PYG medium for 2 hr. Changes in the number of viable A. castellanii cells before and after the exposure of gentamicin was examined by trypan blue viability assay. We did not observe any decrease in A. castellanii cell numbers caused due to exposure of gentamicin (data not shown). The samples were taken for protein extraction at all different time points of this assay which would highlight the proteins involved in this process. The time points to collect samples were carefully chosen to get information about different stages of C. jejuni in interaction with A. castellanii cells. We observed that if we lyse A. castellanii with less than 20 mins (10 min or 15 mins interaction time) of interaction with C. jejuni, we would recover few C. jejuni cells when plated on MH agar plates. This indicates that to recover a significant amount of intracellular bacteria we would have to increase the co-culture interaction time. Sample CA-20mins-NGNT, at this time point, we

140

would able to observe proteome changes reflective of the initial interaction. As the number of C. jejuni could not be maximized after 3 hrs, we took another sample at this time, as the intracellular C. jejuni inside A. castellanii cells is at its maximum number. And we remove extracellular C. jejuni and lysed A. castellanii cells at this time. This provides us with protein profiles of only intracellular C. jejuni.

4.4.2. Identified C. jejuni proteins using LC-MS/MS.

Raw Data from three different independent biological MGPA experiments was used to study changes in C. jejuni protein profile in C. jejuni-A. castellanii cells interaction which is likely to take place in environmental water sources. After removing any redundancy, in total 404

C. jejuni strain 81-176 proteins were identified through the assignments of 15576 MS/MS spectra. We used a data dependent approach in which we used spectral counts to assess the relative protein abundance in the different samples obtained from MGPA experiments. Proteins in the dataset were assigned from multiple spectral counts, which combined with both technical and biological replicates providing strong confidence to the protein assignments.

4.4.3. Distribution of identified proteins.

4.4.3.A. GO classification.

Identified proteins were assigned at least one GO term after searching them against goa_uniprot_all.gaf (downloaded Sep 28, 2017) using Gene ontology consortium. Figure 2 shows the distribution of proteins identified in the study according to GO terms- Molecular function (Figure 2A), Biological process (Figure 2B) and Cellular Components (Figure 2C).

4.4.3.B. Overlap of identified proteins in Protein samples.

The Venn diagrams in Figure 3 (A, B, C and D) shows the distribution of the number of proteins identified in different samples as compared to a control sample which contains only C.

141

jejuni proteins. The overlapping portion of the two circles shows the proteins found in both samples and was designated as upregulated or downregulated according to the fold change in comparison to the control sample. The area which is not overlapping in circles of Venn diagram shows the protein unique to the sample. We found that most of the identified proteins were overlapping with the control sample and a number of unique proteins were less than 10 % for all the samples.

4.4.4. Differentially expressed proteins.

Data from Scaffold software was transferred to excel file and we removed all the protein from the list which had P-value ≥ 0.05 and/or has not same fold change. Table 1 (A, B, C and D) comprise the list of upregulated and downregulated proteins in different experimental samples in comparison to the control sample and their fold changes. We found that as compared to control, the sample containing C. jejuni and A. castellanii together at 20 mins time point of the interaction (CA-20min-NGNT), 15 proteins were upregulated whereas 32 proteins were downregulated. After performing the Protein enrichment analysis using the String software we did not find any enrichment for the upregulated proteins whereas among downregulated proteins many of them were associated with ribosomal structural and assembly proteins, protein synthesis and nucleotide binding. The protein association network of the downregulated proteins shown in

Fig 7A. The molecular enrichment (Table 2A) and biological enrichment (Table 2B) suggest a downshift in metabolism.

CA-3hrs-NGNT (the sample containing C. jejuni and A. castellanii together after 3hrs of interaction) as compared to control, 11 proteins were upregulated whereas 27 proteins were downregulated. In protein enrichment analysis using the String software, we did not find any functional enrichment for the upregulated proteins. Nevertheless, two proteins (GalE,

142

CJJ81176_0439) were related to carbon metabolism. Among downregulated proteins, many of them were associated with ribosomal proteins and RNA binding proteins. The protein association network of the downregulated network shown in Fig 7B. The molecular enrichment (Table 3B) and biological enrichment (Table 3A) suggest downregulation of metabolic pathways related to the utilization of organic and organo-nitrogen compounds pathways and protein synthesis.

Among the downregulated proteins, 7 proteins were related to translation. Approximately 50% proteins of the upregulated proteins were common in CA-20min-NGNT and CA-3hrs-NGNT as compared to the control sample which include Peb1A (major cell binding factor), PorA (A major outer membrane protein -functional porin), GalE (a component of galactose metabolism), AhpC

(Peroxiredoxin), HisG (ATP phosphoribosyltransferase) and GlnA (glutamate-ammonia ligase) which are related to the amino acid synthesis. Peb1A is a common antigen and cell adherent molecule and known to play an important role in mammalian cells adhesion (Pei et al., 1998; Del

Rocio Leon‐Kempis et al., 2006). The proteins which were downregulated in both CA-20mins-

NGNT and CA-3hrs-NGNT were chemotaxis proteins (CJJ81176_0473, CheV) and some related to RNA binding and ribosomal proteins.

CA-3hrs-GT as compared to control, 18 proteins were upregulated whereas 31 proteins were downregulated. Among the upregulated protein were FrdA (fumarate reductase-fumarate metabolism), NapA (Nitrate metabolism), CJJ81176_0439 (Pentose phosphate pathway), PyrC

(pyrimidine metabolism), TopA (DNA topoisomerase). Among 31 downregulated proteins, we observed functional enrichment where proteins related to organic substance and nitrogen transport (Table 4.A). The proteins related to translation and ribosomal bind proteins which were observed as downregulated in previous samples were not downregulated in this sample.

143

CA-3hrs-GNT, the sample collected after using gentamicin to remove extracellular C. jejuni cells to lyses compared to control the sample containing C. jejuni and A. castellanii together after 3hrs of the interaction, 68 proteins were upregulated whereas 121 proteins were downregulated (Table 1 C). The upregulated proteins comprised many proteins related to the carbon metabolism including those enzymes related to glucose metabolism as well as other carbon substrates metabolisms like galactose metabolism and fructose metabolisms. Proteins associated with the respiration were Por (Pyruvate-flavodoxin oxidoreductase; Glycolysis, TCA cycle), SucC (Succinate--CoA ligase; TCA), Eno (Enolase; glycolysis), SucD (Succinate-CoA ligase; TCA cycle), GalU, GalU, NapA (nitrate metabolism), AlgC (glycolysis), OorB

(glycolysis, Phosphate acetyltransferase; Taurine and hypotaurine metabolism) and PrsA (ribose metabolism). Many proteins related to translation were also upregulated. Figure 8 shows the

Protein association network enriched by string software.

CA-3hrs-GNT is the sample which was collected after 3 hrs interaction followed by gentamicin treatment. At this stage, the extracellular C. jejuni is removed and we have only intracellular C. jejuni which is not exposed to the outer environment. We believe that this sample should be considered a more accurate sample to analyze intracellular bacteria. The sample CA-

3hrs-GT is valuable but due to the lysis of A. castellani cells by TritonX-100, C. jejuni cells were again exposed to the external environment which could also influence the protein profiles. Lui et al. (2012) used TritonX-100 treatment to lyse epithelial cells proteins in the sample containing both host cells and intracellular bacterial cell with the intention of releasing intracellular C. jejuni cells and observed that about 15% less host proteins were recovered in protein samples which provided more chance to identify more bacterial proteins in a mass spectrometry analysis. We wonder, whether it is it a huge fraction of host proteins to compromise biological milieu of

144

intracellular C. jejuni cells? Usage of Triton-X 100 for host cell lysis is the logical choice in conventional invasion/internalization assays such as GPA where we aim to quantify the intracellular bacterial cells. In the whole proteome assay, the exposure of detergent may cause some unwanted changes in the protein profile. We did not find a significant increase in a number of identified proteins between CA-3hrs-GNT and CA-3hrs-GT. Most of the proteins which were significantly upregulated from the samples we collected after Triton X-100 were overlapping with CA-3hrs-GNT samples except for the PorA protein. It was the same with downregulated proteins. This can effortlessly be visualized in Volcano plot comparing differentially expressed proteins in CA-3hrs-GNT and CA-3hrs-GT samples (Figure 9). We believe CA-3hrs-GNT would resonate to the more actual metabolic state of C. jejuni cells in comparison to CA-3hrs-GT.

4.4.5. Proteins regulating respiration

Fumarate reductase (FrdA) essential component of fumarate metabolism, is upregulated in all sample (not significant at P < 0.01). Liu et al (2012) have studied changes in the whole proteome of intracellular C .jejuni in epithelial cells and concluded that intracellular C. jejuni favours the respiration of fumarate. GalE (a component of galactose metabolism) and

CJJ81176_0439 (pentose phosphate pathway) was also upregulated. NapA, nitrate reductase was upregulated in CA-3hr-GT as compare to the control sample but not in CA-20mins-NTGNT and

CA-3hr-NGNT. Lui et al. (2012) have found that the spectra count of NapA reduced in the infection in mammalian epithelial cells. Also, we found the protein OorC (2-oxoglutarate- acceptor oxidoreductase, gamma subunit) which is a component of TCA is significantly upregulated in CA-3hrs-GT as compared CA-20mins-GT. But, OorC was not upregulated significantly in CA-3hrs-GT when compared to the control sample. Also, hisG, histidinol

145

dehydrogenase was significantly upregulated in CA-20mins-NGNT as compared to control. But down-regulated in samples obtained from later time points.

4.4.6 Proteins regulating oxidative stress

Superoxide dismutase (SodB) with is responsible to regulate the oxidative stress in C. jejuni (reference) was upregulated in CA-20mins-NGNT as compared to the control sample but was downregulated in the latter samples(CA-3hrs-NGNT, CA-3hrs-GNT, CA-3hrs-GT). Also,

HtrA, (details) also followed the same trend as SodB. HtrA was downregulated in the samples taken after 3 hrs interaction as compared to the control but was upregulated in CA-20mins-

NGNT. Other oxidative stress regulator, Thiol peroxidase (trx) and AhpC (Antioxidant) was downregulated in all of the samples interacting with amoeba as compared to the control sample

(P<0.01).

4.4.7. Proteins related to chemotaxis

A cluster of methyl-accepting chemotaxis proteins and chemotaxis proteins were suppressed in the interaction with A. castellanii. We observed that cluster of chemotaxis proteins

CJJ81176_0289 and CheV, CheW, CheA were downregulated in C. jejuni-A.castellanii samples

(CA-20mins-NGNT, CA-3hrs-NGNT, CA-3hrs-GNT, CA-3hrs-NGNT) as compared to the control sample. Methyl-accepting chemotaxis protein, CJJ81176_1128, CJJ81176_0473,

CJJ81176_1205, CJJ81176_1498, CJJ81176_0289 and CJJ81176_01080 was significantly reduced in all treatment sample where A. castellanii were present for the interaction as compared to the control sample (P < 0.01).

146

4.4.8. Other proteins

LuxS, a major protein involved in quorum sensing was downregulated in all the three samples (P < 0.0001) as compared to the control sample. Cluster of RND (multidrug efflux system), CmeC, CmeA, CmeB was also upregulated in different samples containing A. castellanii cells as compared to the control samples.

To conclude, the results from data-dependent quantitative analysis of protein profiles of C. jejuni cells in the samples in which it interacts with A. castellanii after 3hrs incubation time points towards its intracellular survival inside A. castellanii cells. Also, the fumarate is a major carbon source for the respiration, which is indicated by the upregulation of fumarate reductase enzyme

147

4.5. Reference

Abd, H., Saeed, A., Weintraub, A., Nair, G.B., and Sandström, G. (2007). Vibrio cholerae O1 strains are facultative intracellular bacteria, able to survive and multiply symbiotically inside the aquatic free-living amoeba Acanthamoeba castellanii. FEMS Microbiology Ecology 60(1), 33-39. Akya, A., Pointon, A., and Thomas, C. (2010). Listeria monocytogenes does not survive ingestion by Acanthamoeba polyphaga. Microbiology 156(3), 809-818. Allos, B.M. (1997). Association between Campylobacter infection and Guillain-Barré syndrome. Journal of Infectious Diseases 176 (Supplement_2), S125-S128. Ang, C., De Klerk, M., Endtz, H., Jacobs, B., Laman, J., Van Der Meche, F., et al. (2001). Guillain-Barré syndrome-and Miller Fisher syndrome-associated Campylobacter jejuni lipopolysaccharides induce anti-GM1 and anti-GQ1b antibodies in rabbits. Infection and Immunity 69(4), 2462-2469. Ashburner, M., Ball, C.A., Blake, J.A., Botstein, D., Butler, H., Cherry, J.M., et al. (2000). Gene ontology: tool for the unification of biology. Nature Genetics 25(1), 25. Axelsson-Olsson, D., Ellström, P., Waldenström, J., Haemig, P.D., Brudin, L., and Olsen, B. (2007). Acanthamoeba-Campylobacter coculture as a novel method for enrichment of Campylobacter species. Applied and Environmental Microbiology 73(21), 6864-6869. Axelsson-Olsson, D., Olofsson, J., Svensson, L., Griekspoor, P., Waldenström, J., Ellström, P., et al. (2010). Amoebae and algae can prolong the survival of Campylobacter species in co- culture. Experimental Parasitology 126(1), 59-64. doi: 10.1016/j.exppara.2009.12.016. Balczun, C., and Scheid, P. (2017). Free-living amoebae as hosts for and vectors of intracellular microorganisms with public health significance. Viruses 9(4), 65. Bhandary, B., Lee, G.-H., Marahatta, A., Lee, H.-Y., Kim, S.-Y., So, B.-O., et al. (2012). Water extracts of immature Rubus coreanus regulate lipid metabolism in liver cells. Biological and Pharmaceutical Bulletin 35(11), 1907-1913. Bui, X.T., Qvortrup, K., Wolff, A., Bang, D.D., and Creuzenet, C. (2012a). Effect of environmental stress factors on the uptake and survival of Campylobacter jejuni in Acanthamoeba castellanii. BMC Microbiology 12(1), 232. Bui, X.T., Winding, A., Qvortrup, K., Wolff, A., Bang, D.D., and Creuzenet, C. (2012b). Survival of Campylobacter jejuni in co‐culture with Acanthamoeba castellanii: role of amoeba‐mediated depletion of dissolved oxygen. Environmental Microbiology 14(8), 2034-2047. Casadevall, A. (2008). Evolution of intracellular pathogens. Annual Review of Microbiology. 62, 19-33. Del Rocio Leon‐Kempis, M., Guccione, E., Mulholland, F., Williamson, M.P., and Kelly, D.J. (2006). The Campylobacter jejuni PEB1a adhesin is an aspartate/glutamate‐binding

148

protein of an ABC transporter essential for microaerobic growth on dicarboxylic amino acids. Molecular Microbiology 60(5), 1262-1275. Dirks, B.P., and Quinlan, J.J. (2014). Development of a modified gentamicin protection assay to investigate the interaction between Campylobacter jejuni and Acanthamoeba castellanii ATCC 30010. Experimental Parasitology 140, 39-43. Douesnard-Malo, F. and Daigle, F., (2011). Increased persistence of Salmonella enterica serovar Typhi in the presence of Acanthamoeba castellanii. Applied and. Environmental. Microbiology., 77(21), pp.7640-7646. Fischer, G.H., and Paterek, E. (2019). "Campylobacter," In StatPearls [Internet]. StatPearls Publishing), Treasure Island, FL. Greub, G., and Raoult, D. (2004). Microorganisms resistant to free-living amoebae. Clinical Microbiology Reviews 17(2), 413-433. Halpin, A.L., Gu, W., Wise, M., Sejvar, J., Hoekstra, R., and Mahon, B. (2018). Post- Campylobacter Guillain Barré Syndrome in the USA: secondary analysis of surveillance data collected during the 2009–2010 novel Influenza A (H1N1) vaccination campaign. Epidemiology and Infection, 146 (13), 1740-1745 https://doi.org/10.1017/S0950268818001802. Horn, M., and Wagner, M. (2004). Bacterial Endosymbionts of Free‐living Amoebae 1. Journal of Eukaryotic Microbiology 51(5), 509-514. Hsueh, T.-Y., and Gibson, K.E. (2015). Interactions between human norovirus surrogates and Acanthamoeba spp. Applied and Environmental Microbiology 81(12), 4005-4013. Huws, S.A., Morley, R.J., Jones, M.V., Brown, M.R., and Smith, A.W. (2008). Interactions of some common pathogenic bacteria with Acanthamoeba polyphaga. FEMS Microbiology Letters 282(2), 258-265. Jacobs-Reitsma, W., Lyhs, U., and Wagenaar, J. (2008). "Campylobacter in the food supply," In Campylobacter, Third Edition. Nachamkin, I., Szymanski, C. M. and Blaser, M. J.(Eds.): American Society of Microbiology, Washington D.C., 627-644. Jones, K. (2001). Campylobacters in water, sewage and the environment. Journal of Applied Microbiology 90(S6), 68S-79S. Keller, A., Nesvizhskii, A.I., Kolker, E., and Aebersold, R. (2002). Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search. Analytical Chemistry 74(20), 5383-5392. Khan, N.A. (2006). Acanthamoeba: biology and increasing importance in human health. FEMS Microbiology Reviews 30(4), 564-595. Kovanen, S., Kivistö, R., Llarena, A.K., Zhang, J., Kärkkäinen, U.M., Tuuminen, T., et al. (2016). Tracing isolates from domestic human Campylobacter jejuni infections to chicken slaughter batches and swimming water using whole-genome multilocus sequence typing. International Journal Food Microbiology 226, 53-60. doi: 10.1016/j.ijfoodmicro.2016.03.009.

149

Kuusi, M., Nuorti, J., Hänninen, M.-L., Koskela, M., Jussila, V., Kela, E., et al. (2005). A large outbreak of campylobacteriosis associated with a municipal water supply in Finland. Epidemiology and Infection 133(4), 593-601. Kwaik, Y.A., Gao, L.-Y., Stone, B.J., Venkataraman, C., and Harb, O.S. (1998). Invasion of protozoa by Legionella pneumophila and its role in bacterial ecology and pathogenesis. Applied and Environmental Microbiology 64(9), 3127-3133. Landers, P., Kerr, K., Rowbotham, T., Tipper, J., Keig, P., Ingham, E., et al. (2000). Survival and growth of Burkholderia cepacia within the free-living amoeba Acanthamoeba polyphaga. European Journal of Clinical Microbiology and Infectious Diseases 19(2), 121-123. Liou, L.-S., Chung, C.-H., Wu, Y.-T., Tsao, C.-H., Wu, Y.-F., Chien, W.-C., et al. (2016). Epidemiology and prognostic factors of inpatient mortality of Guillain-Barré syndrome: A nationwide population study over 14 years in asian country. Journal of the Neurological Sciences 369, 159-164. Liu, X., Gao, B., Novik, V., and Galán, J.E. (2012). Quantitative proteomics of intracellular Campylobacter jejuni reveals metabolic reprogramming. PLoS Pathogens 8(3), e1002562. Loret, J.-F., and Greub, G. (2010). Free-living amoebae: biological by-passes in water treatment. International Journal of Hygiene and Environmental Health 213(3), 167-175. Matz, C., and Kjelleberg, S. (2005). Off the hook–how bacteria survive protozoan grazing. Trends in Microbiology 13(7), 302-307. Mihaljevic, R.R., Sikic, M., Klancnik, A., Brumini, G., Mozina, S.S., and Abram, M. (2007). Environmental stress factors affecting survival and virulence of Campylobacter jejuni. Microbial Pathogenesis 43(2-3), 120-125. Miltner, E.C., and Bermudez, L.E. (2000). Mycobacterium avium grown in Acanthamoeba castellanii is protected from the effects of antimicrobials. Antimicrobial Agents and Chemotherapy 44(7), 1990-1994. Moore, J., Caldwell, P., and Millar, B. (2001). Molecular detection of Campylobacter spp. in drinking, recreational and environmental water supplies. International Journal of Hygiene and Environmental Health 204(2), 185-189. Murphy, C., Carroll, C., and Jordan, K. (2006). Environmental survival mechanisms of the foodborne pathogen Campylobacter jejuni. Journal of Applied Microbiology 100(4), 623- 632. Nachamkin, I., Allos, B.M., and Ho, T. (1998). Campylobacter species and Guillain-Barre syndrome. Clinical Microbiology Reviews 11(3), 555-567. Nachamkin, I., Szymanski, C.M., and Blaser, M.J. (2008). In “Campylobacter”. Third Edition. Nachamkin, I., Szymanski, C. M. and Blaser, M. J. (Eds.): American Society of Microbiology, Washington D.C.

150

Nesvizhskii, A.I., Keller, A., Kolker, E. and Aebersold, R. (2003). A statistical model for identifying proteins by tandem mass spectrometry. Analytical Chemistry 75(17), 4646- 4658. Nilsson, A., Johansson, C., Skarp, A., Kaden, R., Bertilsson, S., and Rautelin, H. (2018). Survival of Campylobacter jejuni and Campylobacter coli water isolates in lake and well water. APMIS 126(9), 762-770. Olofsson, J., Axelsson-Olsson, D., Brudin, L., Olsen, B., and Ellström, P. (2013). Campylobacter jejuni actively invades the amoeba Acanthamoeba polyphaga and survives within non digestive vacuoles. PLoS ONE, 8(11), e78873. Olofsson, J., Griekspoor Berglund, P., Olsen, B., Ellström, P., and Axelsson-Olsson, D. (2015). The abundant free-living amoeba, Acanthamoeba polyphaga, increases the survival of Campylobacter jejuni in milk and orange juice. Infection Ecology and Epidemiology 5(1), 28675. Park, S.F. (2002). The physiology of Campylobacter species and its relevance to their role as foodborne pathogens. International Journal of Food Microbiology 74(3), 177-188. Parkhill, J., Wren, B., Mungall, K., Ketley, J., Churcher, C., Basham, D., et al. (2000). The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 403(6770), 665-668. Patrick, M., Henao, O., Robinson, T., Geissler, A., Cronquist, A., Hanna, S., et al. (2018). Features of illnesses caused by five species of Campylobacter, Foodborne Diseases Active Surveillance Network (foodnet) 2010–2015. Epidemiology and Infection 146(1), 1-10. Pei, Z., Burucoa, C., Grignon, B., Baqar, S., Huang, X.-Z., Kopecko, D.J., et al. (1998). Mutation in the peb1A locus of Campylobacter jejuni reduces interactions with epithelial cells and intestinal colonization of mice. Infection and Immunity 66(3), 938-943. Pope, J.E., Krizova, A., Garg, A.X., Thiessen-Philbrook, H., and Ouimet, J.M. (2007). Campylobacter reactive arthritis: a systematic review. Seminars in Arthritis and Rheumatism, 37(1) 48-55. doi.org/10.1016/j.semarthrit.2006.12.006. Rodríguez-Zaragoza, S. (1994). Ecology of free-living amoebae. Critical Reviews in Microbiology 20(3), 225-241. Rollins, D., and Colwell, R. (1986). Viable but nonculturable stage of Campylobacter jejuni and its role in survival in the natural aquatic environment. Applied and Environmental Microbiology 52(3), 531-538. Scheid, P. (2015). Viruses in close associations with free-living amoebae. Parasitology Research 114(11), 3959-3967. Siddiqui, R., and Khan, N.A. (2012). War of the microbial worlds: Who is the beneficiary in Acanthamoeba–bacterial interactions? Experimental Parasitology 130(4), 311-313. Snelling, W., McKenna, J., Lecky, D., and Dooley, J. (2005). Survival of Campylobacter jejuni in waterborne protozoa. Applied and Environmental Microbiology 71(9), 5560-5571.

151

Snelling, W.J., Stern, N.J., Lowery, C.J., Moore, J.E., Gibbons, E., Baker, C., et al. (2008). Colonization of broilers by Campylobacter jejuni internalized within Acanthamoeba castellanii. Archives of Microbiology 189(2), 175-179. Strober, W. (1997). Trypan blue exclusion test of cell viability. Current Protocols in Immunology 21(1), A. 3B. Thomas, J.M., and Ashbolt, N.J. (2010). Do free-living amoebae in treated drinking water systems present an emerging health risk? Environmental Science and Technology 45(3), 860-869. Thomas, V., McDonnell, G., Denyer, S.P., and Maillard, J.-Y. (2010). Free-living amoebae and their intracellular pathogenic microorganisms: risks for water quality. FEMS Microbiology Reviews 34(3), 231-259. Tresse, O., Alvarez-Ordóñez, A., and Connerton, I.F. (2017). Editorial: About the foodborne pathogen Campylobacter. Frontiers in Microbiology 8, 1908. https://doi.org/10.3389/fmicb.2017.01908 Vaerewijck, M.J., Baré, J., Lambrecht, E., Sabbe, K., and Houf, K. (2014). Interactions of foodborne pathogens with free‐living protozoa: potential consequences for food safety. Comprehensive Reviews in Food Science and Food Safety 13(5), 924-944. Vieira, A., Ramesh, A., Seddon, A.M., and Karlyshev, A.V. (2017). CmeABC multidrug efflux pump contributes to antibiotic resistance and promotes Campylobacter jejuni survival and multiplication in Acanthamoeba polyphaga. Applied and Environmental Microbiology 83(22), e01600-01617. Vieira, A., Seddon, A.M., and Karlyshev, A.V. (2015). Campylobacter–Acanthamoeba interactions. Microbiology 161(5), 933-947. Willison, H.J., and O'Hanlon, G.M. (1999). The immunopathogenesis of Miller Fisher syndrome. Journal of Neuroimmunology 100(1), 3-12. Zhou, X., J. Elmose and D. R. Call (2007) Interactions between the environmental pathogen Listeria monocytogenes and a free‐living protozoan (Acanthamoeba castellanii). Environmental Microbiology, 9, 913-922.

152

4.6 Tables and figures

Table 1 A, B, C, D.

List of Proteins that are differentially expressed as compared to control (C. jejuni cells in PBS having no A. castellanii cells available for interaction). Table 1A, 1B, 1C and 1D provides us with the differentially expressed proteins identified in CA-20mins-NGNT, CA-3hrs-NGNT, CA-3hrs- GNT, CA-3hrs-GT respectively as compared to the control sample.

Table 1.ASignificantly Upregulated proteins in C. jejuni-A. castellanii after 20 mins (CA-2mins- NGNT) as compared to control

Control vs C. jejuni-A. castellanii after 20 mins Upregulated Protein Alternate ID Protein/function Fold Change by Category Peb1A Major cell-binding factor 2.2 UDP-glucose 4-epimerase GalE INF CJJ81176_0356 (ahpC) Antioxidant 1.6 GlnA Glutamine synthetase 2.1 SlyD protein peptidyl-prolyl isomerizase 2.7 MetC Cystathionine beta-lyase 2.4 AnsA L-asparaginase 12 TrxB Thioredoxin reductase 4.1 HemB Delta-aminolevulinic acid dehydratase 4.9 High affinity branched-chain amino acid ABC CJJ81176_1037(LivK) transporter 1.9 PorA Major outer membrane protein 3.9 CJJ81176_0265 (FdhD) Cysteine desulfurase 1.8 Fba Fructose-bisphosphate aldolase 1.4 RpsS 30S ribosomal protein S19 INF HisG ATP phosphoribosyltransferase INF Downregulated Protein family HMM PF02591(unknown CJJ81176_0729 function) 0 CheV Chemotaxis protein CheV 0 Tsf Elongation factor Ts 0 Protein Alternate ID Protein/function Fold Change by Category FabG 3-oxoacyl-(Acyl-carrier-protein) reductase 0 2-oxoglutarate:acceptor oxidoreductase, gamma OorC subunit 0 AtpD ATP synthase subunit beta 0 RpsP 30S ribosomal protein S16 0

153

Table 1.ASignificantly Upregulated proteins in C. jejuni-A. castellanii after 20 mins (CA-2mins- NGNT) as compared to control (Cont.)

Protein Alternate ID Protein/function Fold Change by Category Bifunctional protein GlmUin the de novo GlmU biosynthetic pathway 0 RplA 50S ribosomal protein L1 0 RplC Ribosomal protein L3 0 Ubiquinol--cytochrome c reductase, cytochrome PetC c1 subunit 0 3-methyl-2-oxobutanoate PanB hydroxymethyltransferase 0 Glutamyl-tRNA(Gln) amidotransferase subunit GatA A 0 TyrS Tyrosine--tRNA ligase 0.2 Pgk Phosphoglycerate kinase 0 RplO 50S ribosomal protein L15 0 RplJ 50S ribosomal protein L10 0 CJJ81176_0127 Uncharacterized protein 0 RplD 50S ribosomal protein L4 0 RpsI 30S ribosomal protein S9 0 PyrG CTP synthase 0 Asd Aspartate-semialdehyde dehydrogenase 0 SerS Serine--tRNA ligase 0 PurA Adenylosuccinate synthetase 0 DnaK Chaperone protein DnaK 0.3 CJJ81176_0264 (NifU) Nitrogen fixation protein 0.1 CtpA Carboxyl-terminal protease 0.2 ClpB ATP-dependent chaperone protein 0.2 CJJ81176_0473 Methyl-accepting chemotaxis protein 0.3 CJJ81176_0397 D-isomer specific 2-hydroxyacid dehydrogenase 0 CJJ81176_1128 Methyl-accepting chemotaxis protein 0.1 Tuf Elongation factor Tu 0.3 Tig Trigger factor; 0.4 *INF (fold change) means only present in the sample and not present in the control sample (P < 0.05) whereas 0 fold-change means the protein was only present in control sample (P < 0.05).

154

Table 1.B Significantly Upregulated and downregulated proteins in C. jejuni-A. castellanii sample after 3 hrs (CA-3hrs-NGNT) as compared to control

Control vs C. jejuni-A. castellanii after 3 hrs. Upregulated Alternate ID Protein/function Fold Change by Category HisG ATP phosphoribosyltransferase; INF Peb1A Major cell-binding factor 2.1 GlnA Glutamine synthetase 2.5 CJJ81176_0356 Antioxidant, AhpC 1.9 PorA Major outer membrane protein 4.4 Pta Phosphate acetyltransferase 2.5 CJJ81176_0439 Oxidoreductase, putative 1.8 CJJ81176_0291 Biotin sulfoxide reductase 2.2 Tpx Thiol peroxidase 2 HydB Quinone-reactive Ni/Fe-hydrogenase, large subunit 1.4 GalE UDP-glucose 4-epimerase INF Downregulated PseB UDP-N-acetylglucosamine 4,6-dehydratase 0 TyrS Tyrosine--tRNA ligase 0 FabG 3-oxoacyl-(Acyl-carrier-protein) reductase 0 GapA Glyceraldehyde-3-phosphate dehydrogenase 0 RpsB 30S ribosomal protein S2 0 Tsf Elongation factor Ts 0.1 RpsP 30S ribosomal protein S16 0 CJJ81176_0473 Methyl-accepting chemotaxis protein 0 CJJ81176_0729 Uncharacterized protein 0.2 RplC Ribosomal protein L3 0 TypA GTP-binding protein TypA 0 CcoP Cbb3-type cytochrome c oxidase subunit 0 Pgk Phosphoglycerate kinase 0 RplO 50S ribosomal protein L15 0 RplJ 50S ribosomal protein L10 0 RplD 50S ribosomal protein L4 0 Tig Trigger factor; Involved in protein export. 0.2 RpoA DNA-directed RNA polymerase subunit alpha 0.3 Tal Transaldolase (pentose-phosphate pathway) 0 CJJ81176_0111 Iron-sulfur cluster binding protein 0 PyrG CTP synthase 0 Cyf Cytochrome c553 0 ClpB ATP-dependent chaperone protein ClpB 0.2 PurA Adenylosuccinate synthetase; 0 CJJ81176_0127 Uncharacterized protein 0.1 RplA 50S ribosomal protein L1 0.3 CheV Chemotaxis protein CheV 0.5 INF (fold change) means only present in the sample and not present in the control sample (P < 0.05) whereas 0 fold-change means the protein was only present in control sample (P < 0.05).

155

Table 1.C Significantly Upregulated and downregulated proteins in C. jejuni-A. castellanii sample after 3 hrs and gentamicin treatment (CA-3hrs-GNT) as compared to control

Control vs C. jejuni-A. castellanii after 3 hrs and gentamicin treatment Upregulated Alternate ID Protein/function Fold Change by Category CJJ81176_0356 Antioxidant, AhpC/Tsa family 2.1 CJJ81176_0291 Biotin sulfoxide reductase 2.7 GalE UDP-glucose 4-epimerase INF High affinity branched-chain amino acid ABC CJJ81176_1038 transporter 3.6 SucD Succinate--CoA ligase 2 Fba Fructose-bisphosphate aldolase 2.6 HemB Delta-aminolevulinic acid dehydratase 6 CJJ81176_0439 Oxidoreductase, putative 2.5 CJB1429c Uncharacterized protein 2.2 Peb1A Major cell-binding factor 2.5 CJJ81176_1037(LivK) High affinity branched-chain amino acid ABC transporter 2.1 GlnA Glutamine synthetase 1.8 PrsA Ribose-phosphate pyrophosphokinase 1.6 IleS Isoleucine-tRNA ligase 5.3 HemE Uroporphyrinogen decarboxylase 3.5 NapA Periplasmic nitrate reductase 1.6 CJJ81176_0315 major antigenic peptide PEB3 1.7 Eno Enolase 2.1 FldA Flavodoxin 1.6 Tpx Thiol peroxidase 1.3 AspS Aspartate--tRNA(Asp/Asn) ligase 1.9 Oxidoreductase, short chain CJJ81176_0828 dehydrogenase/reductase family 2.7 FrdA Fumarate reductase 2.4 CJJ81176_1519 Bacterioferritin, putative 1.7 HisG ATP phosphoribosyltransferase INF Ggt Gamma-glutamyltransferase 1.8 RpoB DNA-directed RNA polymerase subunit beta 2 PorA Major outer membrane protein 1.7 CJJ81176_0836 Amino acid-binding protein 7.7 CJJ81176_1495 Bifunctional protein PutA 2.1 CJJ81176_1418 Putative methyltransferase 1.6 SucC Succinate--CoA ligase 1.8 TopA DNA topoisomerase 1 9.7

156

Table 1.C Significantly Upregulated and downregulated proteins in C. jejuni-A. castellanii sample after 3 hrs and gentamicin treatment (CA-3hrs-GNT) as compared to control (Cont.)

Alternate ID Protein/function Fold Change by Category CJJ81176_0211 Iron ABC transporter, periplasmic iron-binding protein 1.4 LeuS Leucine--tRNA ligase 11 CJJ81176_1650 Uncharacterized protein 1.9 HydB Quinone-reactive Ni/Fe-hydrogenase 1.2 WcbK Putative nucleotidyl sugar transferase 1.8 ModA Molybdenum ABC transporter 2.6 CheY Chemotaxis protein 1.5 Frr Ribosome-recycling factor 1.3 CJJ81176_0265 Cysteine desulfurase, putative 1.3 CJJ81176_1295 Fibronectin type III domain protein 3.3 Biotin carboxyl carrier protein of acetyl-CoA AccB carboxylase 1.5 InfB Translation initiation factor IF-2 2.5 DapB 4-hydroxy-tetrahydrodipicolinate reductase INF PyrC Dihydroorotase INF RpsS 30S ribosomal protein S19 INF IlvE Branched-chain-amino-acid aminotransferase 2.7 Cbf2 Putative peptidyl-prolyl cis-trans isomerase 1.2 OorB 2-oxoglutarate:acceptor oxidoreductase, beta subunit 1.3 CysK Cysteine synthase A 1.5 GlmS Glutamine--fructose-6-phosphate aminotransferase 2.5 FusA Elongation factor G 1.3 Pta Phosphate acetyltransferase 1.3 Peptidyl-prolyl cis-trans isomerase SlyD 1.7 CJJ81176_1469 Pyruvate-flavodoxin oxidoreductase 1.4 Rbr Rubrerythrin 1.3 peb1C Probable ABC transporter ATP-binding protein 1.9 Enoyl-[acyl-carrier-protein] reductase [NADH] FabI 2 HisG ATP phosphoribosyltransferase INF DapB 4-hydroxy-tetrahydrodipicolinate reductase INF PyrC Dihydroorotase INF RpsS 30S ribosomal protein S19 INF 2,3-bisphosphoglycerate-independent phosphoglycerate GpmI mutase INF AlgC Phosphomannomutase/phosphoglucomutase INF GalU UTP--glucose-1-phosphate uridylyltransferase INF MetS Methionine--tRNA ligase INF

157

Table 1.C Significantly Upregulated and downregulated proteins in C. jejuni-A. castellanii sample after 3 hrs and gentamicin treatment (CA-3hrs-GNT) as compared to control (Cont.)

Downregulated Alternate ID Protein/function Fold Change by Category SecA Protein translocase subunit SecA 0 RpsG 30S ribosomal protein S7 0 PseB UDP-N-acetylglucosamine 4,6-dehydratase (inverting) 0 ClpB ATP-dependent chaperone protein 0 CheV Chemotaxis protein CheV 0 TyrS Tyrosine--tRNA ligase 0 FabG 3-oxoacyl-(Acyl-carrier-protein) reductase 0 GapA Glyceraldehyde-3-phosphate dehydrogenase 0 RpsB 30S ribosomal protein S2 0 RpsP 30S ribosomal protein S16 0 Q0ZSS3_CAMJJ UDP-GlcNAc/Glc 4-epimerase 0 RplC Ribosomal protein L3 0 PanB 3-methyl-2-oxobutanoate hydroxymethyltransferase 0 CJJ81176_1382 Glutamyl-tRNA(Gln) amidotransferase subunit A 0 RpoA DNA-directed RNA polymerase subunit alpha 0.3 Glutamyl-tRNA(Gln) amidotransferase subunit A GatA 0 CJJ81176_0264 Nitrogen fixation protein NifU 0 CJJ81176_0473 Methyl-accepting chemotaxis protein 0.1 Tig Trigger factor 0.2 Pgk Phosphoglycerate kinase 0 AroQ 3-dehydroquinate dehydratase 0 RplO 50S ribosomal protein L15 0 RplJ 50S ribosomal protein L10 0 CJJ81176_0127 Uncharacterized protein 0 CJJ81176_0729 Uncharacterized protein 0.3 RplD 50S ribosomal protein L4 0 Tal Transaldolase 0 AspC Aspartate aminotransferase 0 CJJ81176_0111 Iron-sulfur cluster binding protein 0 PyrG CTP synthase 0 Asd Aspartate-semialdehyde dehydrogenase 0 CJJ81176_1128 Methyl-accepting chemotaxis protein 0 PurA Adenylosuccinate synthetase 0 SerA D-3-phosphoglycerate dehydrogenase 0 CJJ81176_1016 Uncharacterized protein 0.4

158

Table 1.C Significantly Upregulated and downregulated proteins in C. jejuni-A. castellanii sample after 3 hrs and gentamicin treatment (CA-3hrs-GNT) as compared to control (Cont.)

Alternate ID Protein/function Fold Change by Category FabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 0 FumC Fumarate hydratase class II 0.6 RplA 50S ribosomal protein L1 0.2 RplB 50S ribosomal protein L2 0.2 D-isomer specific 2-hydroxyacid dehydrogenase family CJJ81176_0397 protein 0 ThiC Phosphomethylpyrimidine synthase 0.3 RplM 50S ribosomal protein L13 0 Acetyl-coenzyme A carboxylase carboxyl AccA transferase subunit alpha 0 Phosphoribosylaminoimidazole-succinocarboxamide PurC synthase 0 Tuf Elongation factor Tu 0.4 RplE 50S ribosomal protein L5 0.3 TypA GTP-binding protein TypA 0.3 CcoP Cbb3-type cytochrome c oxidase subunit 0.3 CtpA Carboxyl-terminal protease 0.3 FlaA Flagellin 0.2 CJJ81176_1338 Flagellin 0.3 Tsf Elongation factor Ts 0.3 RpsQ 30S ribosomal protein S17 0 RibB 3,4-dihydroxy-2-butanone 4-phosphate synthase 0 PepF Oligoendopeptidase F, peptidase family M3B 0 RpoD RNA polymerase sigma factor RpoD 0 AtpH ATP synthase subunit delta 0 ThrS Threonine-tRNA ligase 0 RplQ 50S ribosomal protein L17 0 Lon Lon protease 0 SodB Superoxide dismutase 0 Adk Adenylate kinase 0.5 RplY 50S ribosomal protein L25 0 CJJ81176_1205 Methyl-accepting chemotaxis protein 0 LuxS S-ribosylhomocysteine lyase 0 CJJ81176_1419 Putative methyltransferase 0 HemL Glutamate-1-semialdehyde 2,1-aminomutase 0 FrdB Succinate dehydrogenase iron-sulfur subunit 0 GlyA Serine hydroxymethyltransferase 0.2 GlmU Bifunctional protein GlmU 0.3 PglE General glycosylation pathway protein 0

159

Table 1.C Significantly Upregulated and downregulated proteins in C. jejuni-A. castellanii sample after 3 hrs and gentamicin treatment (CA-3hrs-GNT) as compared to control (Cont.)

Alternate ID Protein/function Fold Change by Category PurM Phosphoribosylformylglycinamidine cyclo-ligase 0 AcsA Acetyl-coenzyme A synthetase 0 PckA Phosphoenolpyruvate carboxykinase (ATP) 0.3 CJJ81176_0107 Uncharacterized protein 0.4 CJJ81176_0395 UPF0323 lipoprotein 0 Phosphate ABC transporter, periplasmic phosphate- CJJ81176_0642 binding protein, putative 0 CarA Carbamoyl-phosphate synthase small chain 0 Ppa Inorganic pyrophosphatase 0.5 YchF Ribosome-binding ATPase 0 PurD Phosphoribosylamine--glycine ligase 0 SerS Serine--tRNA ligase 0.3 ArgS Arginine--tRNA ligase 0 KdsA 2-dehydro-3-deoxyphosphooctonate aldolase 0 AtpD ATP synthase subunit beta 0.4 HtpG Chaperone protein 0.5 CJJ81176_1498 Methyl-accepting chemotaxis protein 0.3 AtpA ATP synthase subunit alpha 0 RplL 50S ribosomal protein L7/L12 0 Hup DNA-binding protein HU 0.5 AccC-2 Acetyl-CoA carboxylase, biotin carboxylase 0.5 AlaS Alanine--tRNA ligase 0.4 CJJ81176_0289 Methyl-accepting chemotaxis protein 0.8 CJJ81176_0180 Methyl-accepting chemotaxis protein 0 CJJ81176_0289 Methyl-accepting chemotaxis protein 0.8 CcpA-2 Cytochrome c551 peroxidase 0.5 CJJ81176_0446 ABC transporter, ATP-binding protein 0.4 HisD Histidinol dehydrogenase 0.6 Ndk Nucleoside diphosphate kinase 0.5 CmeA RND efflux system 0.5 NrdA Ribonucleoside-diphosphate reductase 0.5 GyrB DNA gyrase subunit B 0 CJJ81176_1508 Oxidoreductase 0 Tkt Transketolase 0 PurH Bifunctional purine biosynthesis protein 0 RpsK 30S ribosomal protein S11 0 OorD 2-oxoglutarate:acceptor oxidoreductase 0 CJJ81176_0610 Aspartokinase 0

160

Table 1.C Significantly Upregulated and downregulated proteins in C. jejuni-A. castellanii sample after 3 hrs and gentamicin treatment (CA-3hrs-GNT) as compared to control (Cont.)

Alternate ID Protein/function Fold Change by Category RpsC 30S ribosomal protein S3 0 RacR DNA-binding response regulator 0 CJJ81176_0021 Uncharacterized protein 0 HydA Quinone-reactive Ni/Fe-hydrogenase, small subunit 0 CJJ81176_0295 SPFH domain / Band 7 family protein 0 CobB NAD-dependent protein deacylase 0 RpsL 30S ribosomal protein S12 0 RplT 50S ribosomal protein L20 0.4 HslU ATP-dependent protease ATPase subunit HslU 0.4 AcnB Aconitate hydratase B 0.7 Ubiquinol--cytochrome c reductase, cytochrome c1 PetC subunit 0.5 HtrA Periplasmic serine endoprotease DegP-like 0.6

INF (fold change) means only present in the sample and not present in the control sample (P < 0.05) whereas 0 fold-change means the protein was only present in control sample (P < 0.05).

161

Table 1 D Significantly Upregulated and downregulated proteins in C. jejuni-A. castellanii sample after 3 hrs and gentamicin treatment and Triton X-100 treatment (CA-3hrs-GT) as compared to control

Control vs C. jejuni-A. castellanii after 3 hrs and gentamicin and Triton X-100 treatment Upregulated Alternate ID Protein/function Fold Change by Category PorA Major outer membrane protein 16 HydB Quinone-reactive Ni/Fe-hydrogenase, large subunit 1.8 CmeC RND efflux system, outer membrane lipoprotein CmeC 11 FusA Elongation factor G 2 TopA topA - DNA topoisomerase 4.7 FrdA Fumarate reductase, flavoprotein subunit 2.3 NapA Periplasmic nitrate reductase 1.4 CJJ81176_0439 Oxidoreductase, putative 1.6

SlyD Peptidyl-prolyl cis-trans isomerase 2.7

GalU UTP--glucose-1-phosphate uridylyltransferase INF GalE UDP-glucose 4-epimerase INF AlgC Phosphomannomutase/phosphoglucomutase INF MetS Methionine--tRNA ligase INF 2,3-bisphosphoglycerate-independent phosphoglycerate GpmI mutase INF HisG ATP phosphoribosyltransferase INF DapB 4-hydroxy-tetrahydrodipicolinate reductase INF PyrC Dihydroorotase INF RpsS 30S ribosomal protein S19 INF Downregulated Alternate ID Protein/function Fold Change by Category SecA Protein translocase subunit SecA 0 PseB UDP-N-acetylglucosamine 4,6-dehydratase (inverting) 0 CheV Chemotaxis protein CheV 0.2 TyrS Tyrosine--tRNA ligase 0 FabG 3-oxoacyl-(Acyl-carrier-protein) reductase 0 RpsP 30S ribosomal protein S16 0 RplC Ribosomal protein L3 0 CtpA Carboxyl-terminal protease 0 PetC Ubiquinol-cytochrome c reductase 0 RpoA DNA-directed RNA polymerase subunit alpha 0.5 Tig Trigger factor; Involved in protein export 0.1 ClpB ATP-dependent chaperone protein ClpB 0.2 Pgk Phosphoglycerate kinase 0

162

Table 1 D Significantly Upregulated and downregulated proteins in C. jejuni-A. castellanii sample after 3 hrs and gentamicin treatment and Triton X-100 treatment (CA-3hrs-GT) as compared to control (Cont.)

Alternate ID Protein/function Fold Change by Category RplO 50S ribosomal protein L15 0 RplJ 50S ribosomal protein L10 0 CJJ81176_0729 EAQ72447.1 0.3 Tsf Elongation factor Ts 0.3 RplD 50S ribosomal protein L4 0 Peb1C binding protein PEB1C 0 CJJ81176_0111 Iron-sulfur cluster binding protein 0 CJJ81176_1016 Uncharacterized protein 0.4 Asd Aspartate-semi aldehyde dehydrogenase 0 CJJ81176_0473 Methyl-accepting chemotaxis protein 0.3 HisD Histidinol dehydrogenase 0.2 Cyf Cytochrome c553 0 NrdA Ribonucleoside-diphosphate reductase; 0 PurB-2 Adenylosuccinate lyase 0.7 Ppa Inorganic pyrophosphatase 0.1 Hup DNA-binding protein HU 0 CJJ81176_1128 Methyl-accepting chemotaxis protein 0.1 GapA Glyceraldehyde-3-phosphate dehydrogenase 0.2 INF (fold change) means only present in the sample and not present in the control sample (P < 0.05) whereas 0 fold-change means the protein was only present in control sample (P < 0.05).

163

Table 2 A. Classification of molecular function (Gene Ontology term) of all the downregulated proteins in CA-20mins-NTNG sample in comparison to that of the control sample.

#term Term description Observe Backgrou False Matching proteins in your network ID d gene nd gene discover (labels) count count y rate GO:0 binding 13 201 0.0054 AtpD, GatA, GlmU, PanB, Pgk, 0054 PurA, PyrG, RplA, RplD, RplJ, 88 SerS, Tsf, Tuf GO:0 organic cyclic 11 157 0.0063 AtpD, GatA, Pgk, purA, pyrG, 0971 compound binding rplA, rplD,rplJ, serS, tsf, tuf 59 GO:1 heterocyclic 11 157 0.0063 atpD,gatA,pgk,purA, 9013 compound binding pyrG,rplA,rplD,rplJ,serS,tsf,tuf 63 GO:0 structural 5 49 0.0198 rplA,rplD,rplJ,rpsI,rpsP 0037 constituent of 35 ribosome GO:0 ligase activity, 3 14 0.0198 gatA,purA,pyrG 0168 forming carbon- 79 nitrogen bonds GO:0 purine 7 80 0.0198 atpD,gatA,pgk,purA,pyrG,serS,tuf 0325 ribonucleotide 55 binding GO:0 purine 7 80 0.0198 atpD,gatA,pgk,purA,pyrG,serS,tuf 0356 ribonucleoside 39 triphosphate binding GO:0 ion binding 9 138 0.0198 atpD,gatA,glmU,panB,pgk,purA,p 0431 yrG,serS,tuf 67 GO:0 translation 2 4 0.0256 tsf,tuf 0037 elongation factor 46 activity GO:0 ligase activity 4 34 0.0256 gatA,purA,pyrG,serS 0168 74 GO:0 RNA binding 5 59 0.0282 rplA,rplD,rplJ,tsf,tuf 0037 23 GO:0 catalytic activity 10 222 0.0358 atpD,gatA,glmU,panB,pgk,purA,p 0038 yrG,serS,tig,tuf 24 GO:0 ATP binding 5 66 0.0397 atpD,gatA,pgk,pyrG,serS 0055 24

164

Table 2 B. Classification of biological processes (Gene Ontology term) of all the downregulated proteins in CA-20mins-NTNG sample in comparison to that of the control sample.

#ter Term description Observe Backgrou False Matching proteins in your m d gene nd gene discover network (labels) ID count count y rate GO:0 cellular nitrogen 15 150 1.53E- atpD,gatA,glmU,panB,pgk,purA, 0442 compound biosynthetic 05 pyrG,rplA,rplD,rplJ,rpsI,rpsP,ser 71 process S,tsf,tuf GO:1 organonitrogen 16 196 3.31E- atpD,gatA,glmU,panB,pgk,purA, 9015 compound metabolic 05 pyrG,rplA,rplD,rplJ,rpsI,rpsP,ser 64 process S,tig,tsf,tuf GO:1 organonitrogen 15 181 5.39E- atpD,gatA,glmU,panB,pgk,purA, 9015 compound biosynthetic 05 pyrG,rplA,rplD,rplJ,rpsI,rpsP,ser 66 process S,tsf,tuf GO:0 amide biosynthetic 10 88 0.00022 gatA,panB,rplA,rplD,rplJ,rpsI,rps 0436 process P,serS,tsf,tuf 04 GO:0 cellular protein 10 90 0.00022 gatA,rplA,rplD,rplJ,rpsI,rpsP,ser 0442 metabolic process S,tig,tsf,tuf 67 GO:0 cellular metabolic 16 261 0.00023 atpD,gatA,glmU,panB,pgk, 0442 process purA,pyrG,rplA,rplD,rplJ,rpsI, 37 rpsP,serS,tig,tsf,tuf GO:0 translation 9 79 0.00033 gatA,rplA,rplD,rplJ,rpsI,rpsP,ser 0064 S,tsf,tuf 12 GO:0 peptide metabolic 9 79 0.00033 gatA,rplA,rplD,rplJ,rpsI,rpsP,ser 0065 process S,tsf,tuf 18 GO:0 cellular macromolecule 10 99 0.00033 gatA,glmU,rplA,rplD,rplJ,rpsI,rp 0346 biosynthetic process sP,serS,tsf,tuf 45 GO:0 primary metabolic 15 244 0.00033 atpD,gatA,glmU,pgk,purA,pyrG,r 0442 process plA,rplD,rplJ, 38 rpsI,rpsP,serS,tig,tsf,tuf GO:0 cellular macromolecule 11 126 0.00033 gatA,glmU,rplA,rplD,rplJ,rpsI,rp 0442 metabolic process sP,serS,tig,tsf,tuf 60 GO:0 nucleobase-containing 6 51 0.0056 atpD,glmU,pgk,purA,pyrG,serS 0346 compound biosynthetic 54 process GO:0 nucleobase-containing 5 43 0.0174 atpD,glmU,pgk,purA,pyrG 0550 small molecule 86 metabolic process GO:0 ribonucleotide 4 29 0.0286 atpD,pgk,purA,pyrG 0092 metabolic process 59 GO:0 ribonucleotide 4 29 0.0286 atpD,pgk,purA,pyrG 0092 biosynthetic process 60 GO:1 carbohydrate derivative 5 49 0.0286 atpD,glmU,pgk,purA,pyrG 9011 biosynthetic process 37

165

Table 2 B. Classification of biological processes (Gene Ontology term) of all the downregulated proteins in CA-20mins-NTNG sample in comparison to that of the control sample. (Cont.)

#ter Term description Observed Background False Matching proteins in m ID gene gene count discovery your network (labels) count rate GO:0 ribonucleoside triphosphate 3 14 0.0292 atpD,pgk,pyrG 00919 metabolic process 9 GO:0 ribonucleoside triphosphate 3 14 0.0292 atpD,pgk,pyrG 00920 biosynthetic process 1 GO:0 organophosphate biosynthetic 5 55 0.0332 atpD,glmU,pgk,purA, 09040 process pyrG 7 GO:0 organophosphate metabolic 5 57 0.0342 atpD,glmU,pgk,purA, 01963 process pyrG 7 GO:0 translational elongation 2 5 0.0381 tsf,tuf 00641 4 GO:0 purine ribonucleoside 3 18 0.0381 atpD,pgk,purA 00916 monophosphate metabolic 7 process GO:0 purine ribonucleoside 3 18 0.0381 atpD,pgk,purA 00916 monophosphate biosynthetic 8 process GO:0 small molecule metabolic 7 121 0.0442 atpD,glmU,panB,pgk, 04428 process purA,pyrG,serS 1 GO:0 phosphate-containing 5 65 0.0465 atpD,glmU,pgk,purA, 00679 compound metabolic process pyrG 6

166

Table 3 A. Classification of molecular function (Gene Ontology term) of all the downregulated proteins in CA-3hrs-NTNG sample in comparison to that of the control sample.

#term Term description Observed Backgroun False Matching proteins in your ID gene d gene discovery network (labels) count count rate GO:0 nitrogen compound 12 243 0.0144 pgk,purA,pyrG,rplA,rplD, 00680 metabolic process rplJ,rpoA,rpsB,rpsP,tal,tig,t 7 sf GO:0 cellular nitrogen 11 198 0.0144 pgk,purA,pyrG,rplA,rplD,r 03464 compound metabolic plJ, 1 process rpoA,rpsB,rpsP,tal,tsf GO:0 cellular macromolecule 7 99 0.0144 rplA,rplD,rplJ,rpoA, 03464 biosynthetic process rpsB,rpsP,tsf 5 GO:0 cellular metabolic 12 261 0.0144 pgk,purA,pyrG,rplA,rplD,r 04423 process plJ,rpoA,rpsB,rpsP,tal,tig,ts 7 f GO:0 primary metabolic 12 244 0.0144 pgk,purA,pyrG,rplA,rplD,r 04423 process plJ,rpoA,rpsB,rpsP,tal,tig,ts 8 f GO:0 cellular macromolecule 8 126 0.0144 rplA,rplD,rplJ,rpoA,rpsB,rp 04426 metabolic process sP,tig,tsf 0 GO:0 cellular protein 7 90 0.0144 rplA,rplD,rplJ,rpsB,rpsP,tig 04426 metabolic process ,tsf 7 GO:0 cellular nitrogen 10 150 0.0144 pgk,purA,pyrG,rplA,rplD,r 04427 compound biosynthetic plJ,rpoA,rpsB,rpsP,tsf 1 process GO:0 organic substance 12 268 0.0144 pgk,purA,pyrG,rplA,rplD,r 07170 metabolic process plJ,rpoA,rpsB,rpsP,tal,tig,ts 4 f GO:1 organonitrogen 11 196 0.0144 pgk,purA,pyrG,rplA,rplD,r 90156 compound metabolic plJ,rpsB,rpsP,tal,tig,tsf 4 process GO:1 organic substance 10 215 0.0157 pgk,purA,pyrG,rplA,rplD,r 90157 biosynthetic process plJ,rpoA,rpsB,rpsP,tsf 6

GO:0 translation 6 79 0.0167 rplA,rplD,rplJ,rpsB,rpsP,tsf 00641 2 GO:0 peptide metabolic 6 79 0.0167 rplA,rplD,rplJ,rpsB,rpsP,tsf 00651 process 8

167

Table 3 A. Classification of molecular function (Gene Ontology term) of all the downregulated proteins in CA-3hrs-NTNG sample in comparison to that of the control sample. (Cont.)

#term Term description Observed Background False Matching proteins in ID gene count gene count discovery your network (labels) rate GO:00 gene expression 7 112 0.0167 rplA,rplD,rplJ,rpoA,rps 10467 B,rpsP,tsf

GO:00 ribose phosphate 4 30 0.0167 pgk,purA,pyrG,tal 19693 metabolic process

GO:19 organonitrogen 9 181 0.0167 pgk,purA,pyrG,rplA,rp 01566 compound biosynthetic lD,rplJ,rpsB,rpsP,tsf process GO:00 nucleotide metabolic 4 36 0.0218 pgk,purA,pyrG,tal 09117 process

168

Table 3 B Classification of biological processes (Gene Ontology term) of all the downregulated proteins in CA-3hrs-NTNG sample in comparison to that of the control sample.

#term ID Term description Observ Backgro False Matching proteins in your network ed und gene discov (labels) gene count ery rate count GO:0003 structural constituent 5 49 0.0321 rplA,rplD,rplJ,rpsB,rpsP 735 of ribosome GO:0097 organic cyclic 9 157 0.0321 flmA,pgk,purA,pyrG,rplA,rplD,rpl 159 compound binding J,rpoA,tsf GO:1901 heterocyclic 9 157 0.0321 flmA,pgk,purA,pyrG,rplA,rplD,rpl 363 compound binding J,rpoA,tsf

Table 4 A Biological function (GO terms) for downregulated proteins in CA-3hrs-GT as compared to the control sample.

#term ID Term description Observed Background False Matching gene gene count discovery proteins in count rate your network (labels) GO:0071702 organic substance transport 3 5 0.0389 pebC,secA,tig GO:0071705 nitrogen compound 3 5 0.0389 pebC,secA,tig transport

169

Figures

Figure 1.A Protein sample processing for LC-MS/MS.

170

Figure 1.B. Flowchart of C. jejuni-A. castellanii sample processing for proteomic analysis.

171

Figure 2.A Functional annotation of C. jejuni proteins identified in the study according to the Gene Ontogology terms (Biological process). All the identified proteins from three replicates of the experiment were categorized using Gene oncology consortium (GO) using Scaffold software

172

Figure 2.B Functional annotation of C. jejuni proteins identified in the study according to the Gene Ontogology terms (Molecular function). All the identified proteins from three replicates of the experiment were categorized using Gene oncology consortium (GO) using Scaffold software

173

Figure 2.C Functional annotation of C. jejuni proteins identified in the study according to the Gene Ontogology terms (Cellular component.). All the identified proteins from three replicates of the experiment were categorized using Gene oncology consortium (GO) using Scaffold software

174

Figure 3 Venn diagrams showing the distribution of identified C. jejuni proteins in comparison to control (Sample containing only C. jejuni cells and no A. castellanii cells). Figure 3.A -Venn diagram showing distribution of identified C. jejuni proteins in control sample and CA-20mins- NGNT; Figure 3.B -Venn diagram showing distribution of identified C. jejuni proteins in control sample and CA-3hrs-NGNT; Figure 3.C- Venn diagram showing distribution of identified C. jejuni proteins in control sample and CA-3hrs-GNT; Figure 3.D- Venn diagram showing distribution of identified C. jejuni proteins in control sample and CA-3hrs-GT.

175

Figure 4 Venn diagrams showing distribution of identified C. jejuni proteins in different protein samples of MGPA assay with 3hrs interaction time (CA-3hrs-NGNT, CA-3hrs-GNT, CA-3hrs- GT).

176

Figure 5 Venn diagrams showing the distribution of identified C. jejuni proteins in control and MGPA assay protein samples at different interaction time (CA-20mins-NGNT, CA-3hrs-NGNT).

177

Figure 6. A.Volcano plot showing profile of differentially expressed C. jejuni proteins significantly upregulated/downregulated in CA-20mins-NGNT as compared to control sample (Sample containing only C. jejuni cells and no A. castellanii cells). Proteins with statistically significant differential expression (≥1.25-fold, P<0.05) labelled in green colour and located in the top right and left quadrants.

178

Figure 6.B Volcano plot showing profile of differentially expressed C. jejuni proteins significantly upregulated/downregulated in CA-3hrs-NGNT as compared to control sample (Sample containing only C. jejuni cells and no A. castellanii cells). Proteins with statistically significant differential expression (≥1.25-fold, P<0.05) labelled in green colour and located in the top right and left quadrants.

179

Figure 6.C Volcano plot showing profile of differentially expressed C. jejuni proteins significantly upregulated/downregulated in CA-3hrs-GNT as compared to control sample (Sample containing only C. jejuni cells and no A. castellanii cells). Proteins with statistically significant differential expression (≥1.25-fold, P<0.05) labelled in green colour and located in the top right and left quadrants.

180

Figure 6.D Volcano plot showing profile of differentially expressed C. jejuni proteins significantly upregulated/downregulated in CA-3hrs-GTas compared to control sample (Sample containing only C. jejuni cells and no A. castellanii cells). Proteins with statistically significant differential expression (≥1.25-fold, P<0.05) labelled in green colour and located in the top right and left quadrants.

181

Figure 7.A Protein association network in STRING analysis showing significantly downregulated proteins CA-20mins-NGNT compared to control sample. Description of the Protein alternate IDs and related functions shown in the protein association network are mentioned in Table 1 A.

182

Figure 7.B Protein association network in STRING analysis showing significantly downregulated proteins CA-3hrs-NGNT (B) compared to control sample. Description of the Protein alternate IDs and related functions shown in the protein association network are mentioned in Table 1 B.

183

Figure 7.C Protein association network in STRING analysis showing significantly downregulated proteins CA-3hrs-GT (C) compared to control sample. Description of the Protein alternate IDs and related functions shown in the protein association network are mentioned in Table 1 D.

184

Figure 8 Protein association network in STRING analysis showing significantly upregulated proteins CA-3hrs-GNT, and compared to control sample. Description of the Protein alternate IDs and related functions shown in the protein association network are mentioned in Table 1 C.

185

Figure 9 Volcano plot showing differentially expressed C. jejuni proteins beween samples CA- 3hrs-GNT and CA-3hrs-GT. Proteins with statistically significant differential expression (≥1.25- fold, P < 0.05) labelled in green color and located in the top right and left quadrants.

186

187

4.7 Appendix

4.7.1 IBC protocol

188

Chapter 5

Proteomic changes in Campylobacter jejuni cells during transition to viable but non-

culturable (VBNC) state

189

Proteomic changes in Campylobacter jejuni cells during transition to

viable but non-culturable (VBNC) state

Deepti P. Samarth1, Rohana Liyanage2, Joon Jin Song3, Jackson. O. Lay, Jr.2, Young Min Kwon1,4.

1Department of Poultry Science, University of Arkansas, Fayetteville, Arkansas, USA, 72701.

2Arkansas Statewide Mass Spectrometry Facility, University of Arkansas, Fayetteville, AR, USA, Fayetteville, Arkansas, USA, 72701.

3Department of Statistical Science, Baylor University, Waco, TX, USA, 76798.

1Department of Poultry Science, University of Arkansas, Fayetteville, AR, 72701.

2Cell and Molecular Biology Program, University of Arkansas, Fayetteville, AR, 72701.

Running title: Protein profile of Campylobacter VBNC.

*Corresponding author:

Dr. Young Min Kwon

Department of Poultry Science University of Arkansas 1260 W. Maple St. Fayetteville, AR 72701 Email: [email protected]

Keyword: Campylobacter, Viable but non culturable, Environmental stress, VBNC, Dormancy,

Degenerative, VBNC, survival, persistence, stress.

190

5.1 Abstract

Campylobacter jejuni is a zoonotic pathogen and also a major cause of foodborne diarrheal illness in humans. Under stress conditions, C. jejuni is reported to have a change in metabolism and morphology (from spiral to coccoid). This physiological condition is termed as viable but non- culturable forms (VBNC) and its role in C. jejuni lifecycle still remains a subject of much debate.

It is also unclear whether C. jejuni cells under this condition retain virulence, and remains transmissible to humans. To gain more insight into C. jejuni VBNC state, we performed proteomic studies and analyzed different samples of C. jejuni strain 81-176 cells re-suspended in freshwater microcosm water which were recovered at different time intervals. Overnight culture of C. jejuni on Mueller Hinton broth was re-suspended in microcosm water and incubated at 25°C for 30 days

(maintaining without microaerophilic conditions), and the samples were collected at 1 day, 3 day,

7 day, 15 day, and 30 day. The C. jejuni cells became non-culturable after 7 days on MH plate under the condition. Samples were used for SDS-PAGE-based protein extraction. The extracted proteins were subjected to proteomic analysis using liquid chromatography-tandem mass spectrometry (LC-MS/MS). Total number of C. jejuni proteins identified were 575. The number of identified proteins declined over the time period. Clustering analysis according to the patterns of dynamic changes over time grouped all proteins into 7 different clusters. After functional enrichment analysis of these proteins, we found that proteins of cluster 2 (73 proteins) and cluster

5 (47 proteins) had contrasting protein expression patterns. Also, members of cluster 5 show an increase in protein expression after 7 days. Many proteins related to metabolic pathways were characterized in cluster 1. A cluster of ribosomal protein was grouped under cluster 6 whereas cluster 7 was enriched with chemotaxis protein cluster. By the means of this study, we attempt to

191

speculate the changes in protein levels of C. jejuni cells over the experimental time period.

Proteomic analysis of VBNC will provide new insights about C. jejuni physiology.

192

5.2 Introduction

Campylobacter jejuni is one of the most common causes of acute enteritis in developed countries (Patrick et al., 2018). Gastroenteritis caused by C. jejuni is also known as campylobacteriosis and often self-limiting enteritis, occasionally followed by severe post- infection debilitating neuropathies which include Guillain-Barré syndrome and Miller Fisher syndrome (Ang et al., 2001; Liou et al., 2016; Halpin et al., 2018). Infected poultry carcasses and related products are one of the major source of C. jejuni infection in humans (Stern and Pretanik,

2006). Despite high prevalence of C. jejuni in chickens, intestinal disease is not followed by infection, intestinal inflammation is almost absent and no cellular attachment or invasion is demonstrated in the intestine of colonized birds (Byrne et al., 2007; Van Deun et al., 2008),

(Larson et al., 2008). Additionally, avian gut presents a favorable environment for continuous replication of C. jejuni (Dasti et al., 2010). However, when transmitted to humans, it causes enteritis of varying severity (Hsieh and Sulaiman, 2018). Asymptomatic colonization of C. jejuni in chicken gut influences detection of C. jejuni infection in farm birds. This makes it harder to eliminate the infected birds during processing. Interventions in controlling cross-contamination at farm level can reduce the cross-contamination during processing and preventing campylobacteriosis outbreaks. Beside poultry products, there are a number of infections and sporadic outbreaks of campylobacteriosis associated with water sources (Palmer et al., 1983;

Duke et al., 1996; Cools et al., 2003; Mughini-Gras et al., 2016). Untreated water has been known to be a source of C. jejuni infection for over a decade (Thomas et al., 1998). Prospective

C. jejuni contamination can originate from cross-contamination of septic seepage, faeces of wild birds or farm animal manure (Cools et al., 2003; Pitkänen, 2013). Moreover, recreation and public water supply sources are also related to some sporadic outbreaks (Kuusi et al., 2005;

193

Kovanen et al., 2016). The survival of C. jejuni in water also contributes towards horizontal transmission of C. jejuni to chicken houses and cross-contamination in poultry processing facilities (Newell and Fearnley, 2003). Role of water in C. jejuni transmission has been underestimated and our understanding of the topic is currently limited.

Most foodborne bacterial pathogens are quite adaptive to the environmental conditions, which help them to disperse and spread disease (Orruno et al., 2017, Pienaar et al., 2016,

Ramamurthy et al., 2014; Ayrapetyan et al., 2015). However, C. jejuni is a fastidious bacteria which require microaerophilic condition for its normal physiological state (Nilsson et al., 2018) and can grow only at 32-45 °C in a laboratory setup (Park, 2002; Davis and DiRita, 2017). Also,

C. jejuni lacks many stress response mechanisms commonly found in Gram-negative bacteria

(Magajna and Schraft, 2015). Nevertheless, C. jejuni has been isolated from environmental water sources where neither the microaerophilic conditions nor the temperature has been optimal

(Pitkänen, 2013; Nilsson et al., 2018).

Upon exposure to environmental stressors, some bacteria produce more resistant forms like dormant spores which is evident from their cell morphology, while others reduce their metabolic activity (Yamamoto, 2000). Viable but non-culturable (VBNC) forms are reported as the environmental stress response for many bacteria including C. jejuni (Ayrapetyan et al. 2015,

Beumer et al.1992). Bacterial cells in VBNC state exhibit metabolic activity and are thought to be capable of causing infection (Cools et al., 2003).

C. jejuni is sensitive to environmental stress (Murphy et al., 2006; Mihaljevic et al.,

2007). The concept of the VBNC forms is one of the most discussed response of C. jejuni to environmental stress (Rollins and Colwell, 1986). VBNC can provide an explanation why C. jejuni infections from environmental sources occur in the absence of detectable source. At this

194

stage, C. jejuni could not be cultured in both enrichment media and any appropriate microbiological media with suitable conditions which normally support the growth of physiologically active C. jejuni (Cools et al., 2003).

Many studies reported resuscitation of C. jejuni from VBNC after passage through animal infection or special enrichment media made from animal sources (Jones et al. 1991,

Baffone et al. 2006). However, resuscitation of VBNC has not been reproducible. Conversely, as

C. jejuni cells begin to age in broth culture, they change their morphology from helical spiral to coccoid in shape (Moran and Upton, 1987) (Moran and Upton, 1986; Stern et al., 1994). It can be confounding because similar morphology is also observed in the VBNC forms. Many reports argue that C. jejuni VBNC could be degenerative cells and so may not cause infection to the host. Nevertheless, the possibility of resuscitation of C. jejuni from VBNC cannot be completely rejected, especially when VBNC is formed in conditions similar to those used in food storage facilities especially at lower temperatures (Patrone et al., 2013; Magajna and Schraft, 2015).

Standard culture techniques cannot detect cells in the VBNC state. Due to this fact,

VBNC cells of pathogenic bacteria are considered to be a concern for food safety and public health (Sardessai et al., 2005, Ramamurthy et al., 2014). Both prolong survival of C. jejuni

VBNC in food-related environments and their role in environment survival have been frequently discussed. Despite the crucial association of VBNC with C. jejuni epidemiology, there is inadequate research that covers the molecular aspect of VBNC physiology.

Non-culturable state of VBNC cells makes it difficult to study using conventional techniques. Along with the difficulty to recover VBNC cells, the fastidious nature of C. jejuni can inevitability often complicate the interpretation of the role of VBNC in its physiology in environmental stress. Whole proteome analysis can highlight differential protein expression in

195

VBNC state and can be useful to yield a holistic picture of the changing cell physiology from viable to VBNC state. In the present study, we have made an attempt to describe changes in the proteome of starved C. jejuni cells in VBNC status in a time-series experiment.

5.3. Materials and Method:

5.3.1. Bacterial strains.

C. jejuni strain 81-176 was generously donated by Dr. Michael Slavik (University of

Arkansas, AR, U.S.A.) and was cultured in Mueller‐Hinton (MH) agar or broth at 37°C in microaerophilic condition where gas composition was O2 (5%), CO2 (10%) and N2 (remaining balance). The strain was stored in MH broth containing 15% glycerol at -80°C. For all the following experiments C. jejuni starter culture was prepared by recovering cells from the frozen stock onto MH agar plates supplemented with trimethoprim (10 μg ml−1) (24 hrs incubation) and passing heavy inoculum from culture plate to 5 ml MH broth followed by 16 hrs incubation. All procedures involving C. jejuni (Biosafety level 2) were conducted according to the protocol approved by the Institutional Biosafety Committee (IBC).

5.3.2. Preparation of microcosm water.

The microcosm water was prepared by autoclaving and filtering (0.02 micron filter) bottle natural spring water (pH 7.2, as measured without adjustment) (Guillou et al., 2008; Zeng et al., 2013).

5.3.3. Starvation and VBNC cells preparation.

C. jejuni strain 81-176 cells were grown in MH broth (trimethoprim 10 μg ml−1) in microaerophilic conditions at 37 °C for 16 hrs. 66 ml of physiologically active C. jejuni cells in its exponential growth phase (OD600-1.5; incubation time-16 hrs) were then divided into 6 equal parts in separate 15 ml centrifuge tubes (11 ml each; OD600-1.5). Five centrifuge tubes out of the

196

6 tubes containing 11 ml of C. jejuni cells were then resuspended in 11 ml microcosm water.

These tubes were incubated at 25°C for varying time interval (1 day, 3 days, 7 days, 15 days and

30 days). The cap of the centrifuge tube was loosened once a day to prevent the anaerobic/microaerophilic condition. Collected samples were homogenized by inverting the tube several times. One ml of the sample was used in other procedures, which are stated below. Ten ml of the sample was then centrifuged at maximum speed (14000 rpm) for 10 mins. The supernatant was discarded, and the cells were stored at -80°C and later used for protein extraction. One of centrifuge tube containing 10 ml of C. jejuni cells was centrifuged for 10 mins at maximum speed (14000 rpm) and the cells were used for protein extraction. This sample was used as the control in the experiment.

5.3.4. Culturability of C. jejuni cells.

The number of culturable C. jejuni cells after the starvation was assessed by dilution plate followed by CFUcounts. After the completion of incubation time and before the centrifugation,

300 µl of sample containing starved C. jejuni cells mentioned above were removed from the sample for serial dilution and plating (in triplicate). Before removing 300 µl of the sample, it was mixed by inverting the tube several times. One hundred µls sample was serially diluted and plated onto MH agar with (trimethoprim 10 μg ml−1) and was incubated for 48-72 hrs in microaerophilic condition. Colony-forming ability was determined by counting colonies grown on agar plates.

5.3.5. Resazurin assay.

We used resazurin assay to check the viability of VBNC (starved) C. jejuni cells before extracting proteins from samples for further analysis. Resazurin assay is an inexpensive method which employs resazurin, as a redox indicator to assess cell viability and proliferation assays for

197

bacteria, yeast, or mammalian cells (Sarker et al., 2007). Resazurin solution was prepared using resazurin (sodium salt) powder (Acros Organic, Belgium) by diluting to 0.01% (wt/vol) in distilled water and then filter sterilized (stored at 4°C) (Palomino et al., 2002). The 350 µl sample containing starved C. jejuni cells used to extract proteins for proteomics analysis were added into a well in a 24-well-microplate. One hundred µl of resazurin solution was added into the same well containing C. jejuni cells, mixed briefly by gentle shaking of the microplate and incubated overnight at 37°C. It was then assessed for color development after the incubation. A change from blue color to pink indicates a reduction of resazurin, which infers bacterial viability.

This assay was performed for all the three replicate of the experiment before performing protein extraction.

5.3.6. Sample preparation for proteomics and mass spectrometry analysis.

The C. jejuni cell pellets obtained after starvation and was used to extract the proteins using Qproteome Bacterial Protein Prep kit (Qiagen). The cell pellet was lysed using rapid repetitive freezing in liquid nitrogen and thawing in ice before using protein extraction kit. We used spin columns (Vivaspin 15R™ 3,000 MWCO, Vivascience™) for the desalting of proteins samples obtained after protein extraction. Protein concentration estimation was performed by

Nanodrop 1000 Spectrophotometer (ND-1000, Nanodrop) before running the SDS- PAGE gel.

The samples were treated with 2-Mercaptoethanol for 10 mins to reduce disulfide bonds within proteins. One-dimensional electrophoresis was used to separate proteins based on molecular weight and to remove other non-protein impurities. In-gel protein digestions were performed for the separated protein gel bands as described below and subsequently, those digests were subjected to LC-MS/MS. NuPAGE™ 4-12% Bis-Tris Protein Gels, (12-well; 1.0 mm)

(Invitrogen™) was used to load samples and SDS-PAGE gel electrophoresis was performed at

198

200V for 50 mins. Each protein sample was loaded into one well of the gel. After gel electrophoresis, the entire gel lane having one sample was divided into 2 parts and then processed separately and performed LC-MS/MS to maximize the number of proteins identified.

Data from two gel parts were later combined using the software before performing extensive protein quantitative analysis.

After electrophoresis, the gel was stained overnight using Coomassie blue dye. The stained proteins, now visible due to staining were sectioned into 2 parts. These gel parts were chopped into small pieces to increase the surface area for trypsin to penetrate in to for digestion.

Small gel pieces less than 1 mm2 in size were pooled together and transferred into an micro- centrifuge tube and washed twice with 50 mM ammonium bicarbonate (NH4HCO3), de-stained with NH4HCO3/ 50% Acetonitrile (ACN), and dried with pure ACN. Then, the proteins were reduced using 10 mM Dithiothreitol in 50 mM NH4HCO3 for 1 hr at 55°C water bath. Ten mg/ml Iodoacetamide Acid in 50 mM NH4HCO3 was used to perform alkylation of proteins in dark for 1 hr at room temperature. Next, the proteins were washed with 50 mM NH4HCO3 and dried with pure can before digestion to avoid any interference from excess iodoacetamide for the digestion. Trypsin gold (Mass spectrometry grade) from Promega (~20 ng/μl in 50 mM

NH4HCO3) was added enough to cover dried gel pieces and kept in 4 C for 30 min so that the trypsin would absorb to gels efficiently. After 30 mins in 4 C, 200-300 ul of 50 mM NH4HCO3 was added to the gel pieces to ensure sufficient hydration of gel pieces for trypsin carry on the trypsin digestion and left overnight at room temperature for efficient in-gel digestion of the proteins. Tryptic peptides produced during the digestion were diffused out to the solution. This solution along with three times by extractions using 60% in 5% FA solution were pooled, evaporated and reconstituted in 50 ul of 0.1% FA before LC-MS/MS analysis.

199

5.3.7. HPLC and Mass spectrometry.

(Electrospray ionization liquid chromatography-tandem mass spectrometry) at State Wide Mass

Spectrometry Facility, University of Arkansas (Fayetteville AR.). Data-dependent analysis

(DDA) for the in-gel trypsin digested samples from each condition were performed by using an

SB C18 column, (150 × 0.3 mm, 3.5 μm particle size, 300 Å pore size, Agilent Technologies), with a solvent flow rate of 4 μL/minute, and a gradient of 5%–38% consisting of 0.1% FA

(solvent A) and ACN (solvent B) over a time period of 320 minutes.

5.3.8. Database Searching and Bioinformatics.

Peaks were picked in the LC-MS/MS chromatogram using Bruker default settings using

Bruker Daltonics Data Analysis software 4.0. Bruker Proteinscape bioinformatics suite coupled with MASCOT 2.1 was used to search the uniport Campylobacter jejuni subsp. jejuni serotype

200

O:23/36 (strain 81-176) database for identification of proteins. Scaffold (version Scaffold_4.8.4,

99.0% probability to achieve an FDR less than 5.0% and contained at least 2 identified peptides

(Keller et al., 2002). Protein probabilities were assigned by the Protein Prophet algorithm

(Nesvizhskii et al., 2003). Proteins that contained similar peptides and could not be differentiated based on MS/MS analysis alone were grouped to satisfy the principles of parsimony. Proteins sharing significant peptide evidence were grouped into clusters. Proteins were annotated with

GO terms from goa_uniprot_all.gaf (Ashburner et al., 2000). The sample reports were exported to Microsoft Excel from Scaffold, processed and the differentially expressed proteins were analyzed by STRING software. Identified proteins were investigated to predict functional protein association networks for each entry using the STRING online database (http://string-db.org).

5.3.9. Statistical analyses.

The experiments were performed in triplicate. Scaffold software program was used for differential protein analysis. Only those proteins, the fold-change increases or decreases and P <

0.05 were considered statistically significant and examined further. We also performed Benjamini-

Hochberg corrections to narrow the list of proteins which were differentially expressed and also for clustering analysis. Scaffold software was used to generate the Venn diagram. Volcano plots were generated by plotting log2 (p-value) vs. log2 (fold-change) of the identified proteins.

201

Benjamini-Hochberg corrections were performed to generate volcano plots. The differentially expressed genes were analyzed by the Clustering of Regression Models (CORM) method (Qin et al., 2014) to identify clusters of proteins whose proteome profiles are similar over the time series exploiting the biological replication data.

5.4. Results and Discussions.

Conventional culture-based techniques for detecting the bacteria from environmental samples are known to have limitations mainly in detecting VBNC (Engberg et al., 2000; Nocker et al., 2007). VBNC are characterized by a loss of ability to be cultured on routine agar, which impairs their detection by conventional plate enumeration techniques (Li et al., 2014)

It is well documented that with exposure to any adverse condition C. jejuni enters into

VBNC but is thought to still be capable of causing infection (Thomas et al., 2002; Cools et al.,

2003; Baffone et al., 2006). Contaminated water sources are reported as sources of C. jejuni in campylobacteriosis outbreaks suggest that C. jejuni can survive in environmental water sources probably as VBNC (Jones, 2001; Cools et al., 2003; Kuusi et al., 2005). C. jejuni can also thrive in a hostile poultry production environment. Contaminated water is one of the main sources of C. jejuni to the commercial chicken-houses (Jang et al., 2007; Cokal et al., 2011). It’s more than a decade we know VBNC C. jejuni, but its role in C. jejuni environmental survival is not conclusive. Some authors have described the possibility of recovering VBNC cells of C. jejuni by animal passage (Jones et al., 1991; Saha et al., 1991; Stern et al., 1994). Other investigators were unable to recover VBNC C. jejuni cells after animal passage and regarded these cells as degenerative forms, and considered to have no role in the environmental transmission of C. jejuni (Beumer et al., 1992; Mederma et al., 1992; Van de Giessen et al., 1996).

202

As the VBNC C. jejuni are non-culturable in culture media, we are limited on the methods to study molecular changes of C. jejuni cells in the transition to VBNC. It would be a valuable piece of information and can be used in designing interventions to control C. jejuni during its transmission. In this study, we have used a data-dependent whole proteome approach to track changes in C. jejuni proteome in different time-points of its transition to VBNC. Use of mass spectrometry allowed us to bypass the need to recover viable C. jejuni cells. Whole proteome profiles provided us with a snapshot of the relative abundance of different proteins at different time-points.

5.4.1. Starvation and VBNC cell preparation

We used a fresh-water microcosm (pH 7.2) to prepare VBNC cells of C. jejuni. Samples were collected at 1 day, 3 days, 7 days, 15 days and 30 days during its transition to VBNC. The culturability in MH agar plates was checked in these time points. Resazurin assay was also performed to check the respiration of C. jejuni cells. We found that at 30-day samples of C. jejuni cells have lost their ability to be cultured on conventional culture plates Therefore, we termed C. jejuni cells at this stage as VBNC.

5.4.2. Culturability of C. jejuni cells

The cultivability of C. jejuni cells declined progressively with time in microcosm water and in the absence of the microaerophilic condition. One hundred µl of the C. jejuni cells from different samples were plated on to the MH agar plate and the CFU/ml was calculated. The control sample (physiologically active) yield a mean of 19.67×109 ± 5.33×108. The CFU/ml for

1-day, 3-day and 7-day samples 4.43×107 ± 1.24×107, 2.1×104 ± 4.6×103 and 3.96×101 ±

2.05×101 respectively. At 15 day and 30-day time point, we did not recover any C. jejuni cells on

MH agar plates. This indicates towards C. jejuni cells have switched to a non-culturable state.

203

5.4.3. Resazurin assay

Resazurin is a biochemical marker to perform basic colorimetric assays to evaluate the cell’s metabolic activity to determine its cellular viability (Palomino et al., 2002; Sarker et al.,

2007; Präbst et al., 2017). The formation of the omnipresent reducing agents NADH and

NADPH is used as a marker for metabolic activity in the resazurin assays. Using NADH and

NADPH as electron sources, resazurin is biochemically reduced which results in a color change from blue to pink. This change can be determined by naked eyes. Resazurin assay was performed for all the samples used to protein extractions (control to 30-day sample) in this study. As a control for resazurin assay we added resazurin solution to microcosm water with no C. jejuni cells. Resazurin assay for all samples shows that the samples turned from blue to pink signifying that the C. jejuni at that time point were metabolically active (Figure 2). At the same time, all the control wells (microcosm water with no C. jejuni) retained its blue color after overnight incubation.

5.4.4. Identified C. jejuni proteins using LC-MS/MS.

Raw Data obtained from LC-MS/MS using three different independent biological experiments were used to study C. jejuni protein profile changes in C. jejuni during 30 days in microcosm water which is likely to take place in environmental water sources. After removing any redundancy, in total 575 C. jejuni strain 81-176 proteins were identified through the assignments of 57670 MS/MS spectra. We used a data dependent approach in which we used spectral counts to assess the relative protein abundance in the different samples of C. jejuni.

Proteins in the dataset were assigned from multiple spectral counts, which combined with both technical and biological replicates providing strong confidence to the protein assignments.

204

5.4.5. Distribution of identified proteins.

5.4.5.A. GO classification.

Identified proteins were assigned at least one GO term after searching them using goa_uniprot_all.gaf (downloaded Sep 28, 2017) using Gene ontology consortium. Figure 2 shows the distribution of proteins identified in the study according to GO terms- Molecular function (Figure 3A), Biological process (Figure 3B) and Cellular Components (Figure 3C).

5.4.3. B. Overlap of identified proteins in Protein samples.

The Venn diagrams in Figure 4 (A, B, C, D and E) shows the distribution of the number of proteins identified in different samples as compared to a control sample which contains only

C. jejuni proteins. The overlapping portion of the two circles shows the proteins found in both samples and was designated as upregulated or downregulated according to the fold change in comparison to the control sample. The area which is not overlapping in circles of Venn diagram shows the protein unique to the sample. We found that many of the identified proteins in samples were overlapping with the control sample but at least 30% of total number of proteins were unique at for all the samples were not found in the control sample.

5.4.4. Differentially expressed proteins.

Significant and differential proteins were observed in all samples obtained after starvation in microcosm water as compared to the control C. jejuni sample which can be visualized in Venn diagram (Figure 4 A, 4 B, 4 C and 4 D). A volcano plot was generated using scaffold software to narrow down the list of differentially expressed proteins. We used

Benjamini-Hochberg correction to reduce the false discovery rate. Benjamini-Hochberg correction helps us reducing the false discovery rate by type I errors (false positive). Figure 5 A;

B; C; D; E shows the distribution of significant proteins as compared to the control sample and

205

samples from time-points day1, day3, day7, day15 and day30 respectively. Upregulated and downregulated proteins for samples from time-points day1, day3, day7, day15 and day30 were analysed for protein associations.

5.4.5. Clustering analysis.

Even though differentially expressed proteins are important for study the role of a specific protein in 2 sample proteomics study. In the transition from physiologically active C. jejuni to its VBNC, we have designed a time series experiment and have multiple samples. It will be logical to cluster the proteins having similar trends. This information will highlight a set of proteins which are expressed in similar abundance and could be connected in their function to help C. jejuni cells adapt and to sustain the stress during its transition to VBNC.

The clustering of regression models (CORM) method was used to cluster proteins, allowing us to fully utilize the biological replications data and to take into account the time- course experimental design (Qin et al., 2014). Note that one of the protein was omitted because the measurements were zero at every time points. B-spline was applied to construct the design matrix for fixed effects. For the given time points (0 - 30 days), four equally spaced knots were determined. For 4 – 12 clusters, log-likelihood (llh) was computed and compared. A larger number of clusters are expected to have higher llh, but it was observed an increase in llh was not very significant for changes after 9 clusters. Hence, 7 clusters were chosen to be a suitable balance point between efficiency and accuracy.

5.4.6. Clustering proteins by abundance in time-points during starvation

We characterize individual protein expression patterns by clustering analysis using clustering of regression models (CORM) method. The relative proteins abundance of 574 expressed proteins were grouped into seven distinct bins by using K-means clustering. Figure 6

206

shows protein expression patterns of members of different clusters. String software was used to investigate the protein association of different proteins within a cluster. Figure 7- A, B, C, D, E,

F and G shows the protein association map of 7 clusters respectively.

Number of proteins in cluster 1 to cluster 7 were 47 proteins, 73 proteins, 158 proteins,

23 proteins, 47 proteins, 29 proteins and 57 proteins respectively. The protein expression profile of cluster 2 and 5 seemed to be contrasting in at different time-points. Most numbers of proteins were characterized in cluster 3.

Cluster 1 had 47 proteins spiked in its protein expression on day1 and day 3 and after a little reduction on day7 remained constant in its protein expression. This set of proteins include cluster of proteins related to respiration including members of TCA, oxidative phosphorylation and pyruvate, nitrate, amino acid metabolism viz Fumarate hydratase (FumC), Citrate synthase

(GltA), Pyruvate kinase (Pyk), Nitrate reductase (NapA), cytochrome c oxidase (CcoP), ATP synthase subunit beta (AtpD). Translation related proteins include Elongation factor G (FusA) and L-asparaginase (AnsA). Also, FlaA and FlaB (structural flagella proteins) were also characterized in this cluster. CiaB (invasion antigen B) and LuxS (quorum sensing protein) were some other important protein in this cluster.

Cluster 2 had 73 proteins spiked in its protein expression till day 15 after having a little dip in 7 days but after 15 days the protein expression declined in 30 days. But even after declining at the end of day 30, we found that the protein expressions were higher that the control samples. As mentioned earlier the members of this cluster show a contrasting pattern as compared to Cluster 5. This set of proteins include some other proteins related to flagella viz.

FlaG, FliD and FlhB. Some proteins related to amino acid synthesis (ArgS, HisS, ValS, IleS,

GalB- Aspartyl/glutamyl-tRNA Asn/Gln amidotransferase subunit B) were present in this

207

cluster. UvrA a part of UvrABC nucleotide excision repair complex was also characterized in this cluster. Also Rho (transcription termination factors Rho). Some important virulence factors were in this cluster which includes CadF, KpsD and VirB4.

With the highest number of proteins (158 proteins) cluster 3 is the largest cluster of proteins with similar protein expression pattern. Many of the proteins were related to the metabolism and cluster of proteins related to RNA binding, amino acid and protein biosynthesis.

A cluster of ribosomal proteins was included in this cluster. Other important proteins were

UvrABC system protein C (UvrC), CheY (chemotaxis protein), PebC, CcpA-2 (peroxidase),

CmeB and E (multidrug efflux proteins).

Cluster 4 had 23 proteins rapidly declined in their protein expression and at all time- points were lower as compared to the control sample. This set of proteins include protein related to Peb antigens (Peb2, Peb3) including major antigen PebA. Interestingly, proteins related to the oxidative stress are present in Cluster 4 which includes SodB, trxB and ahpC. Also, a cluster of amino acid synthesis came up as function enrichment.

Cluster 5 had 47 proteins and had a contracting pattern as compared to proteins of cluster

5. It will be interesting to compare the functional enrichment profiles of these two clusters. The members of this cluster seem to increase from 15 days to 30 days and include a cluster of ribosomal proteins. Important virulence proteins are JlpA, FliW (flagellar assembly protein) and

CheW. Also, ComEA (Competence protein) which is known to affect the competence of C. jejuni.

Cluster 6 had 29 proteins spiked in its protein expression on day 1 of starvation but declined to half on day3 and then remained constant after that till day30. This set of proteins include a cluster of proteins of ribosomal proteins (11 proteins). This cluster also included 7

208

proteins related to the respiration and had the majority of them belong to glycolysis and TCA cycle. CheV, and CmeA were some other important protein in this cluster.

Cluster 7 had 57 proteins declined in its protein expression on day1 and then had elevated expression on 3day but remained much uniform till day 30. This set of proteins include a chemotaxis proteins cluster which included some methyl-accepting proteins. A cluster of proteins related to oxidative phosphorylation. Also, Fumarate reductase, Succinate dehydrogenase were also included in this cluster. Interestingly, Rnj and RecA proteins were included in this cluster and are related to ATP generation from nucleic acid.

As from the resazurin assay, we know that the after 7 days-15days the C. jejuni cells went

VNBC. The changes in the protein profiles will help us understand different components critical for the transition in VBNC. Also, from the protein profiles of metabolic proteins, we can obtain information about the preferred metabolic pathways in C. jejuni environmental survival.

209

5.5. References

Ang, C., De Klerk, M., Endtz, H., Jacobs, B., Laman, J., Van Der Meche, F. and Van Doorn, P. A. (2001). Guillain-Barré syndrome-and Miller Fisher syndrome-associated Campylobacter jejuni lipopolysaccharides induce anti-GM1 and anti-GQ1b antibodies in rabbits. Infection and Immunity 69(4), 2462-2469. Ashburner, M., Ball, C.A., Blake, J.A., Botstein, D., Butler, H., Cherry, J.M., et al. (2000). Gene ontology: tool for the unification of biology. Nature Genetics 25(1), 25. Ayrapetyan, M., Williams, T.C., and Oliver, J.D. (2015). Bridging the gap between viable but non-culturable and antibiotic persistent bacteria. Trends in Microbiology 23(1), 7-13. Baffone, W., Casaroli, A., Citterio, B., Pierfelici, L., Campana, R., Vittoria, E., Guaglianone, E. and Donelli, G. (2006). Campylobacter jejuni loss of culturability in aqueous microcosms and ability to resuscitate in a mouse model. International Journal Food Microbiol 107(1), 83-91. doi: 10.1016/j.ijfoodmicro.2005.08.015. Beumer, R., De Vries, J., and Rombouts, F. (1992). Campylobacter jejuni non-culturable coccoid cells. International Journal of Food Microbiology 15(1), 153-163. Byrne, C.M., Clyne, M., and Bourke, B. (2007). Campylobacter jejuni adhere to and invade chicken intestinal epithelial cells in vitro. Microbiology 153(2), 561-569. Cokal, Y., Caner, V., Sen, A., Cetin, C., and Telli, M. (2011). The presence of Campylobacter jejuni in broiler houses: Results of a longitudinal study. African Journal of Microbiolgy Research 5, 389-393. Cools, I., Uyttendaele, M., Caro, C., D'Haese, E., Nelis, H., and Debevere, J. (2003). Survival of Campylobacter jejuni strains of different origin in drinking water. Journal of Applied Microbiology 94(5), 886-892. Dasti, J.I., Tareen, A.M., Lugert, R., Zautner, A.E., and Groß, U. (2010). Campylobacter jejuni: a brief overview on pathogenicity-associated factors and disease-mediating mechanisms. International Journal of Medical Microbiology 300(4), 205-211. Davis, L., and DiRita, V. (2017). Growth and laboratory maintenance of Campylobacter jejuni. Current Protocols in Microbiology 10(1), 8A. 1.1-8A. 1.7. Duke, L., Breathnach, A., Jenkins, D., Harkis, B., and Codd, A. (1996). A mixed outbreak of Cryptosporidium and Campylobacter infection associated with a private water supply. Epidemiology and Infection 116(3), 303-308. Engberg, J., On, S.L., Harrington, C.S., and Gerner-Smidt, P. (2000). Prevalence of Campylobacter, Arcobacter, Helicobacter, Andsutterella spp. in human fecal samples as estimated by a reevaluation of isolation methods for Campylobacters. Journal of Clinical Microbiology 38(1), 286-291. Guillou, S., Leguérinel, I., Garrec, N., Renard, M., Cappelier, J.-M., and Federighi, M. (2008). Survival of Campylobacter jejuni in mineral bottled water according to difference in mineral content: Application of the Weibull model. Water Research 42(8-9), 2213-2219.

210

Halpin, A.L., Gu, W., Wise, M., Sejvar, J., Hoekstra, R., and Mahon, B. (2018). Post- Campylobacter Guillain Barré Syndrome in the USA: secondary analysis of surveillance data collected during the 2009–2010 novel Influenza A (H1N1) vaccination campaign. Epidemiology and Infection, 1-6. Hsieh, Y.-H., and Sulaiman, I.M. (2018). "Campylobacteriosis: An Emerging Infectious Foodborne Disease," In Foodborne Diseases. Academic Press, Elsevier, 119-155. Jang, K., Kim, M., Ha, S., Kim, K., Lee, K., Chung, D., et al. (2007). Morphology and adhesion of Campylobacter jejuni to chicken skin under varying conditions. Journal of Microbiology and Biotechnology 17(2), 202. Jones, D., Sutcliffe, E., and Curry, A. (1991). Recovery of viable but non-culturable Campylobacter jejuni. Journal of General Microbiology 137(10), 2477-2482. Jones, K. (2001). Campylobacters in water, sewage and the environment. Journal of Applied Microbiology 90(S6), 68S-79S. Keller, A., Nesvizhskii, A.I., Kolker, E., and Aebersold, R. (2002). Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search. Analytical Chemistry 74(20), 5383-5392. Kovanen, S., Kivistö, R., Llarena, A.K., Zhang, J., Kärkkäinen, U.M., Tuuminen, T., Uksila, J., Hakkinen, M., Rossi, M. and Hänninen, M.L., (2016). Tracing isolates from domestic human Campylobacter jejuni infections to chicken slaughter batches and swimming water using whole-genome multilocus sequence typing. International Journal Food Microbiology 226, 53-60. doi: 10.1016/j.ijfoodmicro.2016.03.009. Kuusi, M., Nuorti, J., Hänninen, M.-L., Koskela, M., Jussila, V., Kela, E., Miettinen, I. and Ruutu, P. (2005). A large outbreak of campylobacteriosis associated with a municipal water supply in Finland. Epidemiology and Infection 133(4), 593-601. Larson, C.L., Shah, D.H., Dhillon, A.S., Call, D.R., Ahn, S., Haldorson, G.J., Davitt, C. and Konkel, M.E. (2008). Campylobacter jejuni invade chicken LMH cells inefficiently and stimulate differential expression of the chicken CXCLi1 and CXCLi2 cytokines. Microbiology 154(12), 3835-3847. Li, L., Mendis, N., Trigui, H., Oliver, J.D., and Faucher, S.P. (2014). The importance of the viable but non-culturable state in human bacterial pathogens. Frontiers in Microbiology 5. Liou, L.-S., Chung, C.-H., Wu, Y.-T., Tsao, C.-H., Wu, Y.-F., Chien, W. C., and Chang, C. Y (2016). Epidemiology and prognostic factors of inpatient mortality of Guillain-Barré syndrome: A nationwide population study over 14 years in Asian country. Journal of the Neurological Sciences 369, 159-164. Magajna, B.A., and Schraft, H. (2015). Campylobacter jejuni biofilm cells become viable but non-culturable (VBNC) in low nutrient conditions at 4 °C more quickly than their planktonic counterparts. Food Control 50, 45-50.

211

Mederma, G., Schets, F., Giessen, A., and Havelaar, A. (1992). Lack of colonization of 1 day old chicks by viable, non‐culturable Campylobacter jejuni. Journal of Applied Bacteriology 72(6), 512-516. Mihaljevic, R.R., Sikic, M., Klancnik, A., Brumini, G., Mozina, S.S., and Abram, M. (2007). Environmental stress factors affecting survival and virulence of Campylobacter jejuni. Microbial pathogenesis 43(2-3), 120-125. Moran, A., and Upton, M.E. (1986). A comparative study of the rod and coccoid forms of Campylobacter jejuni ATCC 29428. Journal of Applied Bacteriology 60(2), 103-110. Moran, A., and Upton, M.E. (1987). Factors affecting production of coccoid forms by Campylobacter jejuni on solid media during incubation. Journal of Applied Bacteriology 62(6), 527-537.

Mughini-Gras, L., Penny, C., Ragimbeau, C., Schets, F.M., Blaak, H., Duim, B.,Wagenaar, J.A., de Boer, A., Cauchie, H.M., Mossong, J. and Van Pelt, W. (2016). Quantifying potential sources of surface water contamination with Campylobacter jejuni and Campylobacter coli. Water research 101, 36-45. Murphy, C., Carroll, C., and Jordan, K. (2006). Environmental survival mechanisms of the foodborne pathogen Campylobacter jejuni. Journal of Applied Microbiology 100(4), 623- 632. Nesvizhskii, A.I., Keller, A., Kolker, E., and Aebersold, R. (2003). A statistical model for identifying proteins by tandem mass spectrometry. Analytical Chemistry 75(17), 4646- 4658. Newell, D., and Fearnley, C. (2003). Sources of Campylobacter colonization in broiler chickens. Applied and Environmental Microbiology 69(8), 4343-4351. Nilsson, A., Johansson, C., Skarp, A., Kaden, R., Bertilsson, S., and Rautelin, H. (2018). Survival of Campylobacter jejuni and Campylobacter coli water isolates in lake and well water. APMIS 126(9), 762-770. Nocker, A., Burr, M., and Camper, A.K. (2007). Genotypic microbial community profiling: a critical technical review. Microbial Ecology 54(2), 276-289. Orruno, M., Kaberdin, V.R., and Arana, I. (2017) Survival strategies of Escherichia coli and Vibrio spp.: contribution of the viable but nonculturable phenotype to their stress- resistance and persistence in adverse environments. Journal of Microbiology and Biotechnology, 33(3), 45. Palmer, S., Gully, P., White, J., Pearson, A., Suckling, W., Jones, D., Rawes, J.C.L. and Penner, J.L. (1983). Water-borne outbreak of Campylobacter gastroenteritis. The Lancet 321(8319), 287-290. Palomino, J.-C., Martin, A., Camacho, M., Guerra, H., Swings, J., and Portaels, F. (2002). Resazurin microtiter assay plate: simple and inexpensive method for detection of drug resistance in Mycobacterium tuberculosis. Antimicrobial Agents and Chemotherapy 46(8), 2720-2722.

212

Park, S.F. (2002). The physiology of Campylobacter species and its relevance to their role as foodborne pathogens. International Journal of Food Microbiology 74(3), 177-188. Patrick, M., Henao, O., Robinson, T., Geissler, A., Cronquist, A., Hanna, S., et al. (2018). Features of illnesses caused by five species of Campylobacter, Foodborne Diseases Active Surveillance Network (foodnet) 2010–2015. Epidemiology and Infection 146(1), 1-10. Patrone, V., Campana, R., Vallorani, L., Dominici, S., Federici, S., Casadei, L., Gioacchini, A.M., Stocchi, V. and Baffone, W. (2013). CadF expression in Campylobacter jejuni strains incubated under low-temperature water microcosm conditions which induce the viable but non-culturable (VBNC) state. Antonie Van Leeuwenhoek 103(5), 979-988. doi: 10.1007/s10482-013-9877-5. Pienaar, J.A., Singh, A., and Barnard, T.G.(2016) The viable but non-culturable state in pathogenic Escherichia coli: A general review. African journal of laboratory medicine, 5(1), 1-9. Pitkänen, T. (2013). Review of Campylobacter spp. in drinking and environmental waters. Journal of Microbiological Methods 95(1), 39-47. Präbst, K., Engelhardt, H., Ringgeler, S., and Hübner, H. (2017). Basic colorimetric proliferation assays: MTT, WST, and resazurin. Cell Viability Assays: Methods and Protocols, 1-17. Qin, L.-X., Breeden, L., and Self, S.G. (2014). Finding gene clusters for a replicated time course study. BMC Research Notes 7(1), 60. Ramamurthy, T., Ghosh, A., Pazhani, G.P., and Shinoda, S. (2014). Current perspectives on viable but non-culturable (VBNC) pathogenic bacteria. Frontiers in Public Health 2, 103. Rollins, D., and Colwell, R. (1986). Viable but nonculturable stage of Campylobacter jejuni and its role in survival in the natural aquatic environment. Applied and Environmental Microbiology 52(3), 531-538. Saha, S., Saha, S., and Sanyal, S. (1991). Recovery of injured Campylobacter jejuni cells after animal passage. Applied and Environmental Microbiology 57(11), 3388-3389. Sarker, S.D., Nahar, L., and Kumarasamy, Y. (2007). Microtitre plate-based antibacterial assay incorporating resazurin as an indicator of cell growth, and its application in the in vitro antibacterial screening of phytochemicals. Methods 42(4), 321-324. Stern, N., Jones, D., Wesley, I., and Rollins, D. (1994). "Colonization of chicks by non- culturable Campylobacter spp". Letters in applied microbiology 18(6), 333-336. Stern, N.J., and Pretanik, S. (2006). Counts of Campylobacter spp. on US broiler carcasses. Journal of Food Protection 69(5), 1034-1039. Thomas, C., Gibson, H., Hill, D., and Mabey, M. (1998). Campylobacter epidemiology: an aquatic perspective. Journal of Applied Microbiology 85(S1), 168S-177S.

213

Thomas, C., Hill, D., and Mabey, M. (2002). Culturability, injury and morphological dynamics of thermophilic Campylobacter spp. within a laboratory‐based aquatic model system. Journal of Applied Microbiology 92(3), 433-442. Van de Giessen, A., Heuvelman, C., Abee, T., and Hazeleger, W. (1996). Experimental studies on the infectivity of non-culturable forms of Campylobacter spp. in chicks and mice. Epidemiology and Infection 117(03), 463-470. Van Deun, K., Pasmans, F., Ducatelle, R., Flahou, B., Vissenberg, K., Martel, A., Van den Broeck, W., Van Immerseel, F. and Haesebrouck, F. (2008). Colonization strategy of Campylobacter jejuni results in persistent infection of the chicken gut. Veterinary Microbiology 130(3-4), 285-297. Yamamoto, H., 2000. Viable but nonculturable state as a general phenomenon of non-spore- forming bacteria, and its modeling. Journal of Infection and Chemotherapy, 6(2),112- 114. Zeng, B., Zhao, G., Cao, X., Yang, Z., Wang, C., and Hou, L. (2013). Formation and resuscitation of viable but nonculturable Salmonella typhi. BioMed Research International 2013.

214

5.6 Tables and figures Table 1 Proteins in different cluster obtained by clustering analysis. Proteins are expressed as the alternate ID (Gene locus ID)

Cluster 1 Cluster 2 Cluster 3 Cluster 4 Cluster 5 Cluster 6 Cluster 7 CJJ81176_ GroL HtrA Tpx 0356 GroS Tuf PurB-2 CJJ81176_ Icd AtpA Hup 1016 RplL SucC GlnA CJJ81176 AcnB ClpB Cbf2 PorA DnaK _0379 CheA CJJ81176_044 CJJ81176_ AspA CJJ81176_0439 3 0315 AcpP Eno HtpG CJJ81176 CJJ81176 FumC UvrA SucD Peb1A _1650 _0473 Cyf CJJ81176 NapA CJJ81176_1508 Tig FldA _1382 RpsG RpoB AtpD CarB CcpA-2 CjaA CtpA GltB GuaB CJJ81176_073 CJJ81176_ CJJ81176 CJJ81176 Tsf CJJ81176_0265 8 0211 _0704 OorA _0148 CJJ81176_pTet0 CJJ81176_ FusA 010 ThiC 1600 RplY RplB RpoC CJJ81176_ CJJ81176_152 CJJ81176_ 0291 PckA 5 1519 Frr CheV RplE CJJ81176 CJJ81176 HydB IlvD RplA MetC _0127 WcbK _0289 CJJ81176_130 CJJ81176_ CJJ81176 CJJ81176 Pyk CJJ81176_1417 4 0584 _0149 Fba _0289 CJJ81176_082 CJJ81176 CJJ81176 Trx FliD 8 Ftn _0428 RpoA _0180 CJJ81176_002 CJJ81176 FlaA Aas 1 IlvC RpsF CmeA _1469 CJJ81176 FlaA CJJ81176_1052 ArgG Ggt Cjp08 _1037 FrdA CJJ81176_ CJJ81176_103 CJJ81176 CJJ81176 1338 FtsH 8 TrxB _1344 RplF _1128 CJJ81176_ CJJ81176 CJJ81176 Ppa CJJ81176_0883 GapA 0799 _1062 PrsA _1495 CJJ81176 Cj1355 GlmS CheY CysK _0792 OorC Pta Cj1355 IleS GyrA SodB GreA OorB GlmM CJJ81176_ 1354 ValS HemB IlvE JlpA RplC PanB

215

Table 1 Proteins in different cluster obtained by clustering analysis. Proteins are expressed as the alternate ID (Gene locus ID) (Cont.)

Cluster 1 Cluster 2 Cluster 3 Cluster 4 Cluster 5 Cluster 6 Cluster 7 GltA Ppk GlyA RibH CheW rpsI Ndk KatA Rho SlyD CjaC RplK rplM PheT CJJ81176_ CJJ81176_ 0940 CadF RplJ 0610 Pnp rplS AccC-2 DnaN PglE AspC PurB-1 serC RpsD CJJ81176 PepA RpoD RplD ComEA rpsB _0397 CJJ81176_072 HisD ArgS 9 RpmC rplQ PurD CJJ81176_ CJJ81176 CJJ81176 0974 VirB4 FabI _0147 _1487 Rnj CJJ81176 CJJ81176 CJJ81176 AnsA KdpB DapA _1285 _1575 _1498 CJJ81176_083 CJJ81176 CJJ81176 GltX2 MsrP 6 _0387 ribB _1418 CJJ81176_012 CJJ81176 AccC-1 PepF 6 _1306 GyrB CJJ81176 CiaB MetAA NrdA MurA _0416 CJJ81176 LuxS CJJ81176_0975 FabF _1624 KdsA ArgF SerA InfB GpmI AtpG Mog ClpX SecA RplT GatB CJJ81176_043 CJJ81176 Cjp48 GatB 0 _0791 GatB CJJ81176_ CJJ81176_010 0395 AccB 7 RplU RecA CJJ81176_ 1210 MetE HslU RpsE TyrS CJJ81176_120 CJJ81176 Rbr MtnA 5 PurE _0965 CJJ81176 AroQ RpsA Lon _0626 FabG Map DsbA Adk PheS RplO CJJ81176_ CJJ81176 1124 KpsD TypA FliW _1533 CJJ81176 CcoP FtsK FdhA _pTet0018 PyrE CJJ81176 MurD PabB HydA _0850 AtpH CJJ81176_ CJJ81176_039 0793 DapB 6 LpxD RpsO

216

Table 1 Proteins in different cluster obtained by clustering analysis. Proteins are expressed as the alternate ID (Gene locus ID) (Cont.)

Cluster 1 Cluster 2 Cluster 3 Cluster 4 Cluster 5 Cluster 6 Cluster 7 CJJ81176_ CJJ81176 1193 ThiG HemE Tmk _1198 CJJ81176 CJJ81176 GmhA-1 CJJ81176_0917 RpsM _0726 _0915 CJJ81176 FabZ AtpC UvrC GrpE _1187 FabD AckA Pgk CJJ81176 CJJ81176_1018 TopA _0075 CJJ81176_1376 Tal PpiB CJJ81176_1511 RpsH RpmA Ldh CmeB FrdB CJJ81176_0438 AlaS PetA CJJ81176_1653 RpsJ RpsQ CJJ81176_129 LpxK 5 RpsC CJJ81176 AccA LysS _0374 CJJ81176 CJJ81176_0436 ThrS _1634 AroA HipO FlhB PurA CJJ81176_072 PyrD 3 CJJ81176_0208 RplI CJJ81176_132 CarA 2 CJJ81176_pTet0 023 Efp CJJ81176_141 HisS 9 MetF PolA CJJ81176_153 ClpP 4 CJJ81176_040 CJJ81176_1241 1 FlaG HslV CJJ81176_029 CJJ81176_0956 2 Fur LepA

217

Table 1 Proteins in different cluster obtained by clustering analysis. Proteins are expressed as the alternate ID (Gene locus ID) (Cont.)

Cluster 1 Cluster 2 Cluster 3 Cluster 4 Cluster 5 Cluster 6 Cluster 7 CJJ81176_0579 AspS MapA FdhD CJJ81176_082 CJJ81176_1011 6 RplP CJJ81176_043 5 RplR CJJ81176_139 4 Dxr CJJ81176_046 6 ProS Mdh LeuS DapF FlgE PseB HemC GalU CJJ81176_009 1 GlyS CJJ81176_018 8 CJJ81176_017 9 CJJ81176_090 7 Tkt RpsS TrpB CJJ81176_063 8 CJJ81176_089 7 SdhA GuaA

218

Table 1 Proteins in different cluster obtained by clustering analysis. Proteins are expressed as the alternate ID (Gene locus ID) (Cont.)

Cluster 1 Cluster 2 Cluster 3 Cluster 4 Cluster 5 Cluster 6 Cluster 7 CJJ81176_047 1 CJJ81176_pTet 0045 Xth CJJ81176_123 2 CJJ81176_149 7 TrpD DnaJ-1 CJJ81176_154 8 AroB GltD CJJ81176_pVir 0049 CJJ81176_065 0 CJJ81176_145 8 CJJ81176_026 4 NusG InfC WaaD HisG CJJ81176_070 8 CJJ81176_163 0 RpsK CJJ81176_045 0 RplX RacR Upp CJJ81176_028 1 IlvH DapE

219

Table 1 Proteins in different cluster obtained by clustering analysis. Proteins are expressed as the alternate ID (Gene locus ID) (Cont.)

Cluster 1 Cluster 2 Cluster 3 Cluster 4 Cluster 5 Cluster 6 Cluster 7 CJJ81176_0105 CJJ81176_1425 CJJ81176_1504 CJJ81176_0031 PseA CJJ81176_1604 CJJ81176_0671 CJJ81176_1596 CJJ81176_0342 CJB1429c CJB1429c CJJ81176_0474 Peb1C GatC Fcl HisC HisB MetX CJJ81176_1434 Ssb CJJ81176_1390 CJJ81176_0813 CJJ81176_0739 CJJ81176_0159 ThiJ DapD GatA CJJ81176_1051 CJJ81176_0337 TrpA RpmE

220

Figures

Figure 1 A Protein sample processing for LC-MS/MS.

221

Figure 1B Flowchart of sample processing for proteomic analysis.

222

Figure 1 C Flowchart of proteomic data analysis.

223

Figure 2 Results of resasuzin assay

224

Figure 3A Functional annotation of C. jejuni proteins identified in the study according to the Gene Ontogology terms (Biological process). All the identified proteins from three replicates of the experiment were categorized using Gene oncology consortium (GO) using Scaffold software

225

Figure 3B. Functional annotation of C. jejuni proteins identified in the study according to the Gene Ontogology terms (Cellular components). All the identified proteins from three replicates of the experiment were categorized using Gene oncology consortium (GO) using Scaffold software

226

Figure 3C. Functional annotation of C. jejuni proteins identified in the study according to the Gene Ontogology terms (Molecular Functions.). All the identified proteins from three replicates of the experiment were categorized using Gene oncology consortium (GO) using Scaffold software

227

Figure 4 A; B; C; D, E. Venn diagrams showing the distribution of identified C. jejuni proteins from different samples in comparison to control

228

Figure 5A. Volcano plots demonstrating the abundance (x-axis) and significance (y-axis) of identified proteins between generated control and 1 day sample (n=3)

229

Figure 5B. Volcano plots demonstrating the abundance (x-axis) and significance (y-axis) of identified proteins between generated control and 3 day sample (n=3)

230

Figure 5C. Volcano plots demonstrating the abundance (x-axis) and significance (y-axis) of identified proteins between generated control and 7 day sample (n=3)

231

Figure 5D. Volcano plots demonstrating the abundance (x-axis) and significance (y-axis) of identified proteins between generated control and 15 day sample (n=3)

232

Figure 5E. Volcano plots demonstrating the abundance (x-axis) and significance (y-axis) of identified proteins between generated control and 30 day sample (n=3)

233

Figure 6. Result of clustering analysis. The clustering of regression models (CORM) method was used to cluster proteins into 7 different clusters.

234

Figure 7.A. Protein association network in STRING analysis showing Proteins of cluster 1 (Spectra count was used for clustering analysis to group all proteins into 7 clusters). List of the protein alternate IDs in the protein association network are mentioned in Table 1.

235

Figure 7.B. Protein association network in STRING analysis showing Proteins of cluster 2 (Spectra count was used for clustering analysis to group all proteins into 7 clusters). List of the protein alternate IDs in the protein association network are mentioned in Table 1.

236

Figure 7.C. Protein association network in STRING analysis showing Proteins of cluster 3 (Spectra count was used for clustering analysis to group all proteins into 7 clusters). List of the protein alternate IDs in the protein association network are mentioned in Table 1.

237

Figure 7.D. Protein association network in STRING analysis showing Proteins of cluster 4 (Spectra count was used for clustering analysis to group all proteins into 7 clusters). List of the protein alternate IDs in the protein association network are mentioned in Table 1.

238

Figure 7.E. Protein association network in STRING analysis showing Proteins of cluster 5 (Spectra count was used for clustering analysis to group all proteins into 7 clusters). List of the protein alternate IDs in the protein association network are mentioned in Table 3.

239

Figure 7.F. Protein association network in STRING analysis showing Proteins of cluster 6 (Spectra count was used for clustering analysis to group all proteins into 7 clusters). List of the protein alternate IDs in the protein association network are mentioned in Table 1.

240

Figure 7.G. Protein association network in STRING analysis showing Proteins of cluster 7 (Spectra count was used for clustering analysis to group all proteins into 7 clusters). List of the protein alternate IDs in the protein association network are mentioned in Table 3.

241

5.7 Appendix

5.7.1 IBC protocol

242

Conclusion

In this dissertation, we studied the mechanisms of Campylobacter jejuni (a major foodborne pathogen) survival in environmental water sources and various factors involved in the related processes. A better environmental survival supports its transmission to chickens in commercial chicken houses, which will eventually lead to increased number of campylobacteriosis cases in humans.

In Chapter 2, we studied different molecular mechanisms which assist C. jejuni in its interaction with free-living amoeba (FLA). FLA is known to benefit C. jejuni by its interactions in environmental water sources and also proposed to be an environmental host for C. jejuni.

Molecular mechanisms that facilitate C. jejuni in internalization and survival in Acanthamoeba. castellanii and A. polyphaga (commonly isolated FLA) were related to motility, chemotaxis, oxidative stress, invasion and sialyation of lipooligosaccharides. We found that C. jejuni have common molecular mechanisms that it uses in its interactions with both FLA and human cells.

In Chapter 3, we presented evidence of horizontal gene transfer (HGT) of chromosomally encoded markers between C. jejuni cells. HGT in C. jejuni cells contributes towards its genetic diversity, which improves its ability to adapt to radical shift in environmental conditions. We studied different factors that could influence HGT in C. jejuni cells. We found that naked extracellular DNA plays a major role in enhancing HGT in C. jejuni cells. Also, we found that extent of HGT was improved when chicken cecal supernatant was used as medium for HGT as compared to the MH broth, suggesting that the unknown factors in cecal environment facilitate

HGT in C. jejuni.

In Chapter 4, after comparing the differentially expressed proteins upon its contact with

A. castellanii, we learned that C. jejuni shares similarity in its mechanisms in C. jejuni

243

intracellular survival between amoeba and mammalian hosts. Rise in expression of fumarate reductase (protein FrdA) indicated that fumarate metabolism is favoured by C. jejuni during its intracellular survival inside A. castellanii cells. Results also point out downregulation of a cluster of chemotaxis proteins, methyl-accepting chemotaxis proteins and proteins aiding oxidative stress. The study facilitates our understanding of molecular mechanisms of C. jejuni-

Acanthamoeba interaction, which could help in developing interventions to control C. jejuni.

In Chapter 5, a time-series experiment studying changes in whole proteome of C. jejuni in its transition from physiologically active state to VBNC (viable but non-culturable) state helped us create 7 protein clusters. Members of cluster follow similar trend in their expression during the course of experiment helping us understand the overall changes in physiology of C. jejuni during its transition to VBNC state.

Overall, the studies included in this dissertation provided valuable insight in C. jejuni environmental survival. This knowledge will be helpful in developing intervention against C. jejuni and enhanced our understanding molecular mechanism behind environmental survival of

C. jejuni.

244