Inventory of Supplemental Information presented in relation to each of the main figures in the manuscript
1. Figure S1. Related to Figure 1. 2. Figure S2. Related to Figure 2. 3. Figure S3. Related to Figure 3. 4. Figure S4. Related to Figure 4. 5. Figure S5. Related to Figure 5. 6. Figure S6. Related to Figure 6. 7. Figure S7. Related to Figure 7. 8. Table S1. Related to Figures 1 and S1. 9. Table S2. Related to Figures 3, 4, 6 and 7. 10. Table S3. Related to Figure 3.
Supplemental Experimental Procedures
1. Patients and samples 2. Cell culture 3. Long term culture-initiating cells (LTC-IC) assay 4. Differentiation of CD34+ cord blood cells 5. Bi-phasic erythroid differentiation assay 6. Clonal assay 7. Mutation and sequencing analysis 8. Bisulphite sequencing and quantitative pyrosequencing 9. Human SNP genotyping 10. Strand-specific cDNA synthesis and PCR 11. Chromatin Immuno-precipitation (ChIP) 12. Immunoprecipitation and western blot 13. Colony genotyping 14. shRNA generation and viral infection 15. Retrovirus generation and transduction 16. Study approval 17. Statistical Methods 18. Primers list
Supplementary References (19)
1
Additional SGK2 families
2 3 4 ♀ ♂ ♀ ♂ ♀ ♂ ♀ C/G C/C C/C C/G C/C C/G ♀ ♀ ♂ ♀ C/G C/G C/G C/G
T T C T G C T A G A T T C T C C T A G A T T C T C C T A G A T T C T C C T A G A
T-Cells T-Cells T-Cells T-Cells
Additional GDAP1L1 familiy 2 ♀ ♂ ♀ G/G A/A ♀ G/A
A C A C G G T G
Erythroblasts
Figure S1 - . )4126 ;-,,-
# # # # " " ! ! !! # " $"" # ! ! ! ! $ # ! $ " ! !# $ ! # # ! " " # $ " " " "6@4:7EG=H# "6@4:7EG=H#
?6-JGE=H# K3-7@GE=H#
K)GE=H# *4,NGO-EGE=H#
+K)H!GE=H#
/ )-E-F16
L%)K$L( O"I' PBQPR )( PBQPR )(
# # # # ! $ " "" ! ! $ " "" ! #!!! " $ " $ # !!! " $ " $ ! !
"6@4:7EG=H#
I7J@6/GE=H#
L7M63GE=H#
;K!GE=H#
0
+34.4.5637- +,-./012
904221: )6.-.5637- C% (AA ;-,,-
=4> (BC $5637- )4126 DD D' 81.5637- )-E-F16 '' ?1:-@ %&& '&& (&& & )*#
!"#$%&'() *+#&', " 89:;"8< =$%( 2( 2& 2<9 2(B 2< 29
&%I # ; ! C9 C&
89:;"8 89:;"8 89:;"8 :;"< :;"( :;"9 !(H! =# J,-->-2+K1L>G>MM(** : N7COP&'(E9Q :;"< C)2R5/12R>3L.)1>S.)4><>G>9(9** N+.>*//2335.+>+.TQ :;" :;"9 !(H! =# C)2R5/12R>3L.)1>S.)4>(>G>9EP** >>( : N+.>*//2335.+>+.TQ %&'( H7"9B ! - %&'( $)*+,-./0123 ! ! ! # " $ $2+.45/ 67# G>!.+1).- G>!.+1).- " " =2+32>/67# C)542)>/.+1).-? =2+32>/67##+1532+32>/67#C)542)>/.+1).-? #+1532+32>/67# 89:;"8< @A><9 =2+32>?7# @A> @A>(B C9 C& < 9:2%)42*; 6(P=<<<&<>>>>>>>>6(P=B''>>>>>>>>>>>6(P=<&P>>>>> # PTB ;: PT( ?2-*15V2>2AU)2335.+ PTP 7G< 7G( C1G< C1G' %&'( H7"9B !.*/*0)1)2%34* 566 78 77 $%&'()*+, 3 !"#$%&#'((' . =67>"?') 2)5:((D('''''2)5:((<'''''' (5A555 (A555 /'B%??C (55 3.+ ' (5 ( "C'I'68 5@( 17"& E%?"#$F%'%GH7%CC$6& 5@5( 9 1- 9 1- 9 1- 9 1- 9 1- +,-./+( :1;) 123!(+( -0.. 4)5678((( 2%?'B6?C 4 2 !"#$%&#'*' !"#$%&#'<' (5A555 (5A555 (A555 (A555 3.+ (55 ' (55 (5 (5 ( "C'I'68 ( 5@( E%?"#$F%'%GH7%CC$6& 5@( ' 5@5( 5@5( =6 2%? =6 2%? =6 2%? =6 2%? =6 2%? =6 2%? =6 2%? =6 2%? 2%? 2%? 2%? 2%? 2%? 2%? 2%? 2%? ' +,-./+(123!(+( -0.. 4)5678((( +,-./+(123!(+( -0.. 4)5678((( 9 O !"#$%&#'()'' !"#$%&#'(, (5A555 (5A555 (A555 (A555 (55 (55 3.+ ' (5 (5 ( ( "C'I'68 5@( 5@( E%?"#$F%'%GH7%CC$6& 5@5( 5@5( =6 2%? =6 2%? =6 2%? =6 2%? =6 2%? =6 2%? =6 2%? =6 2%? 2%? 2%? 2%? 2%? 2%? 2%? 2%? 2%? +,-./+(123!(+( -0.. 4)5678((( +,-./+(123!(+( -0.. 4)5678((( 1 P (5A555 !"#$%&#'(JK97L#M76$N (5A555 !"#$%&#'(JK-L%?6$N (A555 (A555 (55 (55 3.+ ' (5 (5 ( ( "C'I'68 5@( 5@( E%?"#$F%'%GH7%CC$6& 5@5( 5@5( =6 2%? =6 2%? =6 2%? =6 2%? =6 2%? =6 2%? =6 2%? =6 2%? 2%? 2%? 2%? 2%? 2%? 2%? 2%? 2%? +,-./+(123!(+( -0.. 4)5678((( +,-./+(123!(+( -0.. 4)5678((( !"#$%&'() + 0,(120/ !"#$ 01@;4? ;)A8%&' ?67)& ;B48CC)&=<% %&' 1. 6 ()* 0.04 ()* 1. 2 0.03 0.8 0.02 0.4 0.01 0.0 0.00 + D E /$ + D E /$ 285);FG6'CH * 0,(120/ !"#$ /$+ ! %&' ! %&' ! ()* ! ()* .+ -+ ,+ + 34&56789):;%<=>;&)7>;?4;@10 Scr-shRNA Scr-shRNA Scr-shRNA Scr-shRNA L3-shRNA1L3-shRNA2 L3-shRNA1L3-shRNA2 S2-shRNA1S2-shRNA2 S2-shRNA1S2-shRNA2 W . "UT !I&JCKL3@ !I&JCKL3@ /++P 0,JCKL3@$ !$JCKL3@$ W VV RQP VV VV VV W Q+P $QP ;SGR/;"T@ +P !I&JCKL3@ !I&JCKL3@ W 0,JCKL3@$ !$JCKL3@$ -+P VV DQP VV W ,+P VV VV /QP SGD/;SG-/ +P D E /$ D E /$ 285);FG6'CH , M1@ M11 - *=NO 01@;4? ; > 7)& ; >=<%;:)98 765&43 D D 01@;4?D ;)A8 ?67)& ;B48CC)&=<% , , , $ $ $ / / / + + + !I&JCKL3@0,JCKL3@/!$JCKL3@/ !I&JCKL3@0,JCKL3@/!$JCKL3@/ !I&JCKL3@0,JCKL3@/!$JCKL3@/ !"#$%&'() A Phase&I&Culture + + + GFP GFP&CFP ScrAshRNA ScrAshRNA ScrAshRNA Day&0 Day&14 L3AshRNA1 S2AshRNA1 DiAshRNA 100% + 75% 50% CD71 Phase&I 25% CD71 0% GPA Phase&II&Culture Day&2 Day&14 100% + 75% 50% GPA 25% Phase&II 0% CD71 2 6 10 14 2 6 10 14 2 6 10 14 GPA Time&(Days) Phase&I + + + + + B GFP&CD71 GFP&CFP&CD71 40% * ** ScrAshRNA L3AshRNA1 S2AshRNA1 DiAshRNA 35% * * 13.8 27.3 20.5 32.1 20% 1.37 4.01 1.81 6.31 10% SAPhase&cells 84.1 67.9 77.1 61.1 BrdU 0% 7AAD L3+S2 rAshRNA AshRNA1 c 3 2AshRNA1 AshRNA Phase&I + + + + + S L S C GFP&CD71 GFP&CFP&CD71 16% ScrAshRNA L3AshRNA1 S2AshRNA1 DiAshRNA + 88.1 6.7 88.4 2.5 76.5 12 85.8 9.3 12% 8% + 4% 4.5 0.2 9.0 0.1 11.1 0.4 4.9 0 7AAD&Anx&V& 0% Annexin&V 7AAD L3+S2 rAshRNA AshRNA1 c 3 2AshRNA1 shRNA S L S 0.0 M&5AAC D E F G 0.10 0.8 L3MBTL1 EV L3MBTL1 0.3 HBA 0.2 M&5AAC 0.08 0.5 M&5AAC 0.6 ABL 0.2 0.06 0.4 0.04 0.1 0.2 0.02 Exp.&rel.&to& Exp.&rel.&to&ABL Exp.&rel.&to&ABL 0 0.0 0.00 L3MBTL1 SGK2 H 0.20 SGK2 SGK2 L3MBTL1&& 0.5 HBB 150 Number&of&cells SGK2 0.15 120 0.3 90 0.10 60 0.05 0.1 GPA&(MFI) 30 Exp.&rel.&to&ABL Exp.&rel.&to&ABL 0.00 0.0 0 EV M M M K562HEL GPA 0 SGK2 SGK2 0.2 0.5 L3MBTL1 Uninduced& Uninduced A UninducedL3MBTL1 Uninduced GFP ! Empty&vector 50 M&Hemin + 50 M& L3MBTL1&+&SGK2 GFP L3MBTL1&&&SGK2 &&+&5AAC + + Hemin 50 M&Hemin GFP&CFP induction &induction 50 M&Hemin &induction &&induction Figure(S6 ((Page(1 I CFU5GM 80 5 BFU5E 40 CFU5GEMM 4 60 30 3 40 20 2 20 1 10 0 0 0 Colonies/1000/cells L3+S2 L3+S2 L3+S2 r5shRNA 5shRNA1 r5shRNA 5shRNA1 r5shRNA 5shRNA1 c 25shRNA1 5shRNA c 25shRNA1 shRNA c 25shRNA1 shRNA S L3 S S L3 S S L3 S J K 15 CFU5S 150 L3mbtl1 Sgk2 120 12 90 9 60 6 30 3 0 Colonies/spleen 0 relative/to/GapdH Normalised/expression 5shRNA 5shRNA5shRNA r5shRNA 25shRNA cr 25shRNA Uninfectedc L3 S S L3 S mL3+mS2 S m m m m Scr25shRNA shRNA L M 150 L3mbtl1 H LSK d 2.0 2.5 CMP p 120 a G 90 2.0 / 1.5 t o t s / 1.5 o e 60 v 1.0 i H t + 1.0 a r l 30 e o r t 0.5 / i t 0.5 n 0 e o i p s 0.0 0.0 s 150 Sgk2 m e o r p 120 C 2.0 GMP MEP / x r e / o d 90 n 1.5 e o s i D l 60 a 1.0 m r 30 o N 0 0.5 0.0 5shRNA5shRNA5shRNA5shRNA cr 3 2 2 25shRNA L S cr S S m + m S 3 L 5shRNA 5shRNA 5shRNA 5shRNA 5shRNA 5shRNA 5shRNA 5shRNA m r 3 2 2 25shRNA r 3 2 2 25shRNA c L S r S c L S r S S c + S c + m m S 3 m m S 3 L L N m m + + + 2.0 BM/B220 BM/CD71 BM/Mac51 1.5 t s o 1.0 H + r o t 0.5 i t e p 0.0 m o Spleen/B220+ + + C 1.5 Spleen/Mac51 Thymus/CD3 / r o n o 1.0 D 0.5 0.0 5shRNA 5shRNA 5shRNA 5shRNA 5shRNA 5shRNA 5shRNA 5shRNA 5shRNA 5shRNA 5shRNA 5shRNA r 3 2 2 25shRNA r 3 2 2 25shRNA r 3 2 2 25shRNA c L S r S c L S r S c L S r S S c + S c + S c + m m S 3 m m S 3 m m S 3 L L L m m m Figure*S6 **Page*2 A 12 MYC 12 ABL 8 8 4 4 Exp.@rel.@ 0 0 L3+S2 L3+S2 )shRNA )shRNA Scr)shRNA Scr)shRNA L3)shRNA2 S2)shRNA3 L3)shRNA1S2)shRNA2 B ph)S2)PolII 3000 6000 2000 4000 1000 2000 0 0 Fold@enrch.@rel.@to@IgG L3+S2 L3+S2 )shRNA Scr)shRNA )shRNA Scr)shRNA L3)shRNA1S2)shRNA1 L3)shRNA1S2)shRNA2 C H3K4me3 2500 3000 2000 2400 1500 1800 1000 1200 500 600 0 0 Fold@enrch.@rel.@to@IgG L3+S2 L3+S2 Scr)shRNA )shRNA Scr)shRNA )shRNA L3)shRNA1S2)shRNA1 L3)shRNA1S2)shRNA1 D L3MBTL1 250 200 200 160 150 120 100 80 50 40 0 0 Fold@enrch.@rel.@to@IgG L3+S2 L3+S2 )shRNA )shRNA Scr)shRNAL3)shRNA1 S2)shRNA1 Scr)shRNAL3)shRNA1 S2)shRNA1 E BRG1 1000 2500 800 2000 600 1500 400 1000 200 500 0 0 Fold@enrch.@rel.@to@IgG L3+S2 L3+S2 )shRNA )shRNA Scr)shRNAL3)shRNA1S2)shRNA1 Scr)shRNAL3)shRNA1S2)shRNA1 F BRG1 900 750 600 500 300 250 0 0 Fold@enrch.@rel.@to@IgG SGK2 SGK2 Empty@vector Empty@vector Figure'S7 Figure S1. Additional families showing SGK2 and GDAP1L1 are paternally expressed. Family studies demonstrate that SGK2 and GDAP1L1 are expressed from the paternally derived allele in T cells and erythroblasts respectively. These cell types were chosen because they express readily detectable levels of SGK2 and GDAP1L1 respectively. Family 1 can be found in Figure 1. The expressed allele is indicated by an arrow. Figure S2. The L3MBTL1 gene cluster shows biallelic expression in mouse and wallaby but predominantly monoallelic expression in the macaque. A Expression analysis in mouse tissue. Sequences are shown for SNPs in exon 6 of L3MBTL1 (rs27347041), exon 6 of SGK2 (rs27331555) and exon 5 of GDAP1L1 (rs28243099), each experiment was performed twice, representative traces are shown. BM, bone marrow; PBMNC, peripheral blood mononuclear cells. B Expression analysis in the Wallaby. Head and yolk sac membrane cDNA were analysed in four animals, a representative animal is shown. C L3MBTL1 and SGK2 show polymorphic tissue-specific monoallelic expression in the macaque (Macaca fascicularis). Two representative animals are shown. M1-male 1, F4/5 – females 4 (for the kidney and liver samples) and 5 (for the blood sample), at least three SNPs were tested for each gene per tissue from each animal; a representative trace is shown per tissue. Arrows indicate the position of the SNP; WBC, white blood cells. D Phylogenetic tree demonstrating the evolutionary relationships between species studied, MYA, million years ago. Figure S3. Characterization of L3MBTL1 antisense transcript and microsatellite quantitation of 20q deletion. A Diagram of the genomic region between human L3MBTL1 and SGK2 demonstrating genomic arrangement, putative promoters and alternatively spliced isoforms of L3MBTL1 around exons 11-13, with corresponding encoded mRNAs and proteins annotated with known domains. MBT, malignant brain tumour repeat; C2HC, C2HC-type Zinc Finger domain; SAM, Sterile Alpha Motif. Arrows indicate locations for primers A, B and C for different mRNA transcripts, and P3 and 10 P5 between which lies the start point of the L3MBTL1 antisense RNA. B Characterization of L3MBTL1 antisense RNA. Strand specific cDNAs for the sense and antisense strands were analysed by RT-PCR. Controls are a primer control lacking template, indicating no template independent amplification, and RT- control (reverse transcriptase minus), indicating no DNA contamination of the RNA. C Stand specific RT-PCR and sequencing of sense and antisense transcript from K562 and a normal informative individual. L3MBTL1 exon 24 expression is detected with a SNP in K562 (rs6124571) and normal PB granulocytes (rs6030948). D Strand specific quantitative RT-PCR for antisense RNA on two normal individuals and two patient samples, one 20q normal cell line (K562) and one 20q del cell line (HNT-34) using primer set for L3MBTL1 antisense RNA in exon 18 region and cDNA synthesis using primer L3MBTL1-AS-P2 and ABL cDNA exon 4 primer. E Microsatellite PCR analysis of Patient 6, MDS (RAEB 2) with 20q deletion in bone marrow (BM) sample compared to peripheral blood mononuclear (PBMNC) cells control (Con). At least 3 microsatellites were analysed per patient, representative traces shown. The percentages of cells carrying the deletion were calculated as described in the materials and methods. Arrows indicate the allele lost. Figure S4. Microsatellite quantitation and expression analysis to characterise hematopoietic colonies carrying the 20q deletion. A Patient 11, MPN (ET) with 20q deletion in granulocytes (Gran), compared to peripheral blood T cells control, and representative traces for each marker from BFU-E colonies with deletion (n=9). The percentages of granulocytic cells carrying the deletion were calculated as described in the materials and methods. Arrows indicate the allele lost. Note the complete loss of the deleted allele in the colony-derived samples. Expression of imprinted genes in hematopoietic colonies from B, normal individuals and C-E, from patients 8, 9, 12, 13 and 14. E, BFU-E colonies; GM, CFU-GM colonies. Each point represents the mean of two PCR technical replicates for a single colony. C Patient 8, CFU-GM colonies; D Patient 9, BFU-E colonies; E Patient 12, BFU-E colonies; F Patient 13, BFU-E colonies; G Patient 14, CFU-GM colonies; H Patient 14, BFE-U colonies. See also figure 4. 11 Figure S5. Cooperative and compensatory effects of L3MBTL1 and SGK2 on erythroid and megakaryocytic differentiation. A L3MBTL1 and SGK2 expression kinetics during in vitro CD34+ cord blood erythroid ( ) and megakaryocytic differentiation ( ). B Quantitative RT PCR for expression of L3MBTL1 and SGK2 following infection of CD34+ cord blood cells with shRNAs against L3MBTL1 (L3-shRNA1 and L3-shRNA2) and SGK2 (S2-shRNA1 and S2-shRNA2) at day 4 of differentiation. Expression levels relative to ABL were normalized to results obtained using scrambled control shRNA. C Differentiation of cord blood CD34+ cells. Effect on erythroid (CD71+GPA+) or megakaryocytic (CD41+CD61+) cell number of shRNA-mediated knockdown of L3MBTL1 (L3-shRNA2 ), SGK2 (S2-shRNA2 ) or scrambled control (Scr-shRNA ). Each data point is the mean of three independent cord blood differentiation experiments each performed in triplicate. Error bars indicate standard error of the mean (SEM), **, p<0.01 relative to scramble control. D Quantitative RT-PCR for expression of and globins (HBA and HBB) in day 4 infected cells (GFP+) cells in erythroid differentiation conditions. E Quantitative RT-PCR for glycoprotein IX (gpIX) expression in day 4 infected cells (GFP+) in megakaryocytic differentiation conditions. See also figure 5. Figure S6: Cooperative effect of knocking down L3MBTL1 and SGK2 on erythropoiesis. Bi- phasic erythroid culture of CD34+ cells (see legend to Figure 4D). A Effect on percentage of CD71+ or GPA+ cells of shRNA-mediated knockdown of L3MBTL1 (L3-shRNA1 ), SGK2 (S2-shRNA1 ), L3MBTL1 and SGK2 (L3+S2-shRNA ) or scrambled control (Scr-shRNA ). B Lentiviral infected erythroid progenitor cells (GFP+CD71+ or GFP+CFP+CD71+) were analysed for proliferation at day 8 of phase I differentiation. Representative FACS profiles showing BrdU/7AAD analysis of infected erythroid progenitor cells (GFP+CD71+ or GFP+CFP+CD71+). Percentage of cells in S-phase; presented here as the histogram summarising results from three independent experiments each performed in duplicate, *, p<0.05; **, p<0.01 relative to scramble control. Error bars indicate 12 standard error of the mean (SEM). C Apoptosis analysis at day 8 of phase I differentiation. Representative FACS profiles showing Annexin V/7AAD analysis of infected erythroid progenitor cells (GFP+CD71+ or GFP+CFP+CD71+) together with a histogram summarising results from three independent experiments each performed in duplicate. Error bars indicate standard error of the mean (SEM), *: p<0.05 relative to scramble control. D Quantitative RT-PCR analysis of retrovirally expressed L3MBTL1 or SGK2 transcript levels in HNT-34 cells compared to endogenous transcript levels in K562 and HEL cells. E FACS analysis shows that hemin-induced GPA expression is inhibited by introduction of L3MBTL1 and/or SGK2. HNT-34 cells were infected with retroviruses expressing L3MBTL1, or SGK2 or both before induction of erythroid differentiation by hemin. Analysis was performed five days after induction. F. Quantitative RT-PCR analysis showing that hemin-induced -globin (HBA) and -globin (HBB) expression is inhibited by introduction of L3MBTL1 and/or SGK2. Error bars indicate standard error of mean. G Expression of imprinted genes relative to ABL after 5-azacytidine induction at differing concentrations in 20q deleted HNT-34 cell line. H Hemin induced expression of GPA with or without 5-azacytidine induction. Analysis was performed 3 days after induction. I LTC-IC assay as in figure 6. Left panel shows the number of GM colonies, middle panel - erythroid colonies (BFU-E) and right panel - mix colonies (CFU-GEMM). Histograms represent mean of three independent experiments. J Lineage negative bone marrow cells from normal C57B6 mice were infected with lentivirus expressing shRNA against L3mbtl1 and/or Sgk2 or scrambled shRNA control. Transcript levels of L3mbtl1 and Sgk2 were analysed by quantitative RT-PCR 3 days post infection. K CFU-S assay. Lineage negative bone marrow cells were infected with lentivirus expressing shRNA against L3mbtl1 (mL3-shRNA), Sgk2 (mS2-shRNA), both (mL3+mS2) or scramble control shRNA (Scr-ShRNA), sorted and injected into lethally irradiated mice (5 per genotype) CFU-S were counted at day 10. L Assessment of knock-down efficiency in recipient mice 16 weeks after competitive bone marrow transplantation. Quantitative RT-PCR was performed on CD45.2+ lineage negative bone marrow cells. M Assessment of chimerism in recipients of the competitive bone marrow transplant. Box plots represent the ratio of donor (CD45.2+) to competitor (F1: CD45.1+CD45.2+) and host (CD45.1+) in the progenitor compartments (LSK, CMP, 13 GMP MEP) of five mice for each shRNA experiment. N Same as in panel K but analysis of mature cells positive for B220, CD71, Mac-1, or CD3 in bone marrow, spleen and thymus. Figure S7: L3MBTL1 and SGK2 collaborate to regulate MYC expression. A-E Analysis of cord blood derived erythroid cells 8 days after lentiviral shRNA infection in phase I of biphasic erythroid differentiation assay. One experiment from each independent cord blood sample is shown per panel, the first experiment is shown in figure 7B-D. A Quantitative RT-PCR of MYC transcript levels relative to ABL. ChIP-PCR analysis of B H3K4me3 on the MYC promoter, C phospho-S2 PolII binding on the MYC transcriptional start site, D L3MBTL1 and E BRG1 binding to the MYC promoter. F Analysis of HNT-34 cells, ChIP-PCR analysis of BRG1 binding to the MYC promoter following retroviral expression of SGK2. Fold enrch. Rel. to IgG – QPCR quantitation Mean value normalised to IgG control, with IgG value normalised to 1. 14 PB PB CD34+ mesenchymal GPA+ Gene Gr T BM cells from BM cells K562 293T L3MBTL1 M M M M NI M M SGK2 M M LE ND NI NI NI GDAP1L1 M LE LE ND M NI NI Supplementary table S1: Summary of cell types tested for monoallelic expression. All primary cell types were derived from hematologically normal individuals. PB – peripheral blood, Gr – granulocytes, T – CD2 positive T-lymphocytes, CD34+ - CD34 expressing hematopoietic stem/progenitor cells, BM – bone marrow, mesenchymal cells – adherent CD34 negative bone marrow cells cultured for 3 weeks. GPA+ cells – isolated GPA expressing erythroblasts. M- monoallelic expression, NI – gene expressed, but no informative SNPs in samples tested, LE – low expression precludes allelic expression analysis, ND – not done. 15 Age Dis dur WBC Hb at Plt at ID Dx Dx (yrs) at Dx Dx Dx BM Cytogenetics JAK2 1 PV 59 21 8.5 20.7 467 46,XX del(20q) [10/10] V617F 2 PV 75 >6 12.8* 13.4* 315* 46,XX del(20q) [7/12] V617F 3 PV 79 NA** 5.7* 11.4* 90* 46,XY del(20q) V617F 46,XY del(20q)(q11.2q13.3) 4 PMF 77 8 22.1 11.5 196 [20/20] V617F 5 CMML 75 2 14.7 14.9 35 46,XY del(20q)(q11,q13) WT 46,XY del(20q)(q12) [x/20] , 6 RAEB 65 0 2.1 9.1 38 45,X-Y del(20q)(q12) [2/20] WT 47,XY,+8,del(20q) [12/12]; nuc ish 20q11.2(D20S108x1) 7 RCMD 57 2 5.2 12.8 58 [129/200] WT 46, XY, del(20q)(q11,q13) [22], 45, X-Y, idem [2], 46, X-Y [3], 8 MDS 67 2 3.1 10.4 108 46,XY [4] WT 9 RCMD 41 9 5.5 9.4 80 46,XY del(20q) 100% ND FISH: BCR/ABL 66%, del(20q) 10 CML 52 8 13.4 26.8 167 D20S108 77% WT 11 ET 69 10 8.1 14.2 991 46,XY del(20q) [7/10] V617F 46,XY del(20q)(q11,q13) [9], N542- 12 PV/AML 43 26 12*** 1.3*** 81*** 46,XY [5] E543del 46/XX del(20q). nuc ish 13 ET 55 5 8.3 12.4 >2000 20q11.2(D20S108x1) 19% WT Karyotyping failed. nuc ish 14 ET 45 14 14.1 12.7 1080 20q11.2(D20S108x1) 38% WT *At time of sample collection **Not Available ***At transformation to AML Supplementary Table S2. Summary of patient disease characteristics. Patients 1 to 5 were studied for expression and mutation screening in peripheral blood granulocytes, patient 6 was studied for expression and mutation screening in bone marrow, and patients 7-14 were studied for expression in hematopoietic colonies. See materials and methods for diagnosis abbreviations used. 16 Gene name Exon Coding SNP amino- Proportion SNP id (genbank id) region acid with SNP GDAP1L1 4 Y 669c/t S204S 3/42 Rs2425632 (NM_024034) 6 N 1373a/g na 10/42 Rs12479863 6 N 1386c/g na 1/42 Na 6 N 2196g/c na 3/42 Rs3810511 SGK2 2 N c/g na 7/42 Rs3827067 (NM_016276) 3 N 44g/a na 1/42 Na 3 N 66a/g na 10/42 Rs6065627 3 Y 253t/a S12T 3/42 Rs33969356 8 Y 816c/t Y199Y 1/42 Na 11 Y 1092g/a L291L 1/42 Na Supplementary Table S3. Exonic SNPs identified by mutation screening analysis of GDAP1L1 and SGK2. GenBank identifiers for the mRNA and Rs numbers are given where previously published for each gene, and novel SNPs were confirmed by sequencing of constitutional samples where available. All patients were previously screened by either microsatellite analysis or FISH in the common deleted region of chromosome 20q12, results for L3MBTL1 have been published by Bench et al (1). 17 SUPPLEMENTARY METHODS Patients and samples 50ml of peripheral blood was collected from 12 patients with informed consent into an ethically approved research study at Addenbrooke’s Hospital, Cambridge, UK; Belfast City Hospital, Belfast, UK; King’s College Hospital, London, UK; Derriford Hosptial, Plymouth, UK; Hôpital Avicenne and Hôpital St Louis, Paris, France and Karolinska University Hosptial, Stockholm, Sweden. Diagnoses of myeloproliferative neoplasm (MPN), myelodysplastic syndrome (MDS), acute myeloid leukemia (AML) and their subtypes were made according to World Health Organization (WHO) criteria (2). Cell fractions were obtained with Ficoll separation followed by magnetic bead isolation from mononuclear cells of T cells using CD2 Dynabeads (Invitrogen, Paisley, UK) and CD34+ cells using MACS CD34 selection kit (Miltenyi Biotech); and granulocytes. Mature cell population purities were 95% or higher and were confirmed by cytospin or counting of cells attached to beads in a hemocytometer. For granulocyte or bone marrow gene expression analysis, RNA samples were available from 6 individuals. Peripheral blood granulocyte samples were obtained from three patients with polycythemia vera (PV, patients 1-3), one with primary myelofibrosis (PMF, patient 4) and one with chronic myelomonocytic leukemia (CMML, patient 5). A bone marrow sample with 20q deletion in all cells was from patient 6 who had refractory anemia with excess of blasts (RAEB). All were shown to have >98% 20q deletion in these samples by microsatellite PCR for at least three different markers per individual. Samples were obtained from 8 additional patients with less than 95% deletion in granulocytes, for colony analysis. The diagnoses of these patients were: refractory cytopenias with multi-lineage dysplasia (RCMD, patients 7 and 9), unclassified MDS (patient 8), chronic myeloid leukemia (CML, patient 10), essential thrombocythemia (ET, patients 11, 13 and 14), and PV 18 transformed to AML (patient 12). For mutation screening, granulocyte DNA was available from 15 samples with MPN (8 PV, 4 PMF and 3 unclassified MPN), and 8 with MDS (5 Refractory anemia (RA), 1 RAEB, 2 unclassified MDS), with 20q deletion demonstrated by microsatellite PCR present in at least 90% of cells (3); (4); (5). An additional 19 bone marrow DNA samples from PV patients without 20q abnormality were available as described before (1). Fluorescence In situ Hybridization (FISH) FISH was performed on cell lines as described previously (6), using the probes 20ptel (Abbott Vysis) and RP11-1108D11 which contains the JPH2 and GDAP1L1 genes (GeneService Ltd, Cambridge, UK). 20 metaphases were scored for each cell line, and copy number of the CDR (in figure 3A) as indicated by the number of RP11-1108D11 signals was recorded as the primary 20q karyotype in the majority of metaphases analysed. In cell lines HEL, SET-2 and 293T, two signals were scored on the same chromosome in each metaphase analysed, In the cell line K562, 20ptel and CDR signals were seen on the same chromosome once, and separated onto different chromosomes, suggesting a translocation event centromeric of the CDR. In the cell lines UKE-1 and HNT-34, FISH showed one chromosome 20 with signals for both probes, but the other chromosome 20 had just the 20ptel signal, with no other CDR signals seen on other chromosomes. In the cell line CMK, the karyotype was complex, with four signals for both the 20ptel and the CDR probe on different chromosomes, with the 20ptel probe always at the end of small chromosomes, and the CDR probe always close to the centromere on small chromosomes, suggesting translocation events have occurred followed by duplication of the translocated chromosomes. Bi-phasic erythroid differentiation assay A bi-phasic erythroid differentiation method was modified from van den Akker et al (7). Briefly, 100,000 CD34+ cells/condition were cultured for 14 days in StemSpan® (Stem Cell Technologies) 19 medium supplemented with SCF (100ng/ml, Peprotech), Erythropoietin (2U/ml NeoRecormon®), Dexamethasone (1µM, Sigma-Aldrich), Insulin-like growth factor-1 (40ng/ml, R&D Systems), and Cholesterol rich lipids (40µg/ml Sigma-Aldrich). After 14 days in culture, cells were flow-sorted for GFP+ and/or CFP+ and CD71+ expression and transferred to the second phase culture medium comprising of StemSpan medium supplemented with 3% human AB serum (Sigma-Aldrich), Erythropoietin (10U/ml, Insulin (10µg/ml, R&D), Insulin-like growth factor-1 (40ng/ml), and iron saturated transferrin (0.5mg/ml, Sigma-Aldrich). In both cultures, cells were counted and supplementary fresh medium was added every second day with FACS analysis for infection and differentiation. Long term culture-initiating cells (LTC-IC) assay LTC-IC assays were performed as described previously (8) with slight modification. Briefly, cord blood CD34+ cells infected with lentivirus and co-cultured for 5 weeks with feeder cells producing human IL-3, SCF, IL-6 and Flt-3l, with media change every week. After 5 weeks, infected cells flow sorted and used for CFC assay performed using MethoCult H4435 (StemCell Technologies) number and types of colonies formed were scored at day 14. Single Cell Clonality Assay Single cell assays were performed as described before (9). Briefly, 50ml peripheral blood was obtained from consented and informed patients. Mononuclear cells were isolated by density centrifugation of 1:1 PBS diluted blood on Lymphoprep® (Axis-Shield Biotech). Mononuclear cells washed with PBS were used for MACS purification of CD34+ cells using CD34-positive selection kit (Human CD34-EasySep Positive selection Kit, StemCell Technology). Isolated CD34+ cells cultured as with Serum Free Expansion Medium (SFEM, StemCell Technology) and with 1X StemSpan CC110 (StemCell Technology) and 1X Pen/Strep on a 24-well Fibronactin coated plate (BD BioCoat) 20 pre-coated with concentrated retrovirus (retroviral preparation described below). Cells were spin infected for 30 minutes with retrovirus at 25oC at 2500 rpm. 72 Hours post infection, infected viable cells were FACS sorted (7AAD-, GFP+ and/or CFP+) to give one single cell per well in 96 well round bottom plates with Serum Free Expansion Medium containing, 1X Pen/Strep, 3U/ml Epo, SCF25 ng/ml, -merceptoethanol 10nM, Dexamethasone 4g/ml. Clones were FACS analyzed for GPA expression at day 8 post sorting, and half of the culture was taken for genotyping and MYC expression analysis. Cell culture of cell lines All cell lines were obtained from commercial sources (www.dsmz.de). UKE-1 and HNT-34 are derived from 20q deleted ET patient transformed into AML and MDS patient transformed into AML respectively (10); (11). K562, HEL, SET2, CMK, and UKE-1 cells were cultured in RPMI 1640 (Sigma-Aldrich), supplemented with 10% heat inactivated fetal bovine serum (PAA Biotech) and 1% Penicillin and streptomycin (Invitrogen). HNT-34 cells were cultured in RMPI 1640 (Sigma Aldrich), 20% heat inactivated fetal bovine serum (PAA), and 1% penicillin and streptomycin (Invitrogen). 293T cells were cultured in DMEM (PAA) supplemented with 10% heat inactivated fetal bovine serum (PAA Biotech) and 1% Penicillin and streptomycin (Invitrogen). shRNA generation and viral infection shRNA viruses were purchased from Sigma-Aldrich®, L3MBTL1-shRNA1 (TRCN0000016864), L3MBTL1-shRNA2 (TRCN0000016866), L3MBTL1-shRNA3 (TRCN0000016867), SGK2- shRNA1 (TRCN0000002111) SGK2-shRNA2 (TRCN0000002112), SGK2-shRNA3 (TRCN0000002113), and for murine targets, mL3-shRNA1 (TRCN0000226027), mL3-shRNA2 (TRCN0000226028), mL3-shRNA3 (TRCN0000226091), mS2-shRNA1 (TRCN0000022879) and mS2-shRNA2 (TRCN0000022881) were sub-cloned in lentiviral vector pLKO1.3G co-expressing 21 GFP (Kindly gifted Dr J Larsson, Lund University Sweden) as described before (18). GFP was replaced with CFP from pMSCV-ires-CFP to generate pLKO1.3G CFP vector. To produce lentiviral particles shRNA vectors with psPAX2 and pMD2-G coat plasmids co-transfected in 293T cells using GeneJuice® (Millipore). Medium was changed 24 hours after transfection and viral supernatants were collected 48 hours and 72 hours after transfection and viral particles were concentrated by centrifuging the supernatant at 28000rpm for 3 hours, at 4C. Concentrated viral particles were re- suspended in 500µl of PBS and 50µl of this concentrated virus suspension was coated with Polybrene (4µg/ml) and used to infect 200,000 K562 or CD34+ cells in a fibronectin-coated 24 well dish by spin inoculation. Cells counted and analyzed by FACS every 4th day. For CD34+ cells infection, virus was first coated on 24 well, fibronectin coated plates by spinning the concentrated virus on a dish with medium for 15 minutes at 4C at 3000rpm. After coating with virus, CD34+ cells were added to the plate. Scrambled shRNA infected and uninfected cord blood CD34+ cells were used as controls for off target effects of shRNA viruses. In order to make sure there were no off-target effects, these cells were monitored in the same way as the knock-down cells and found to be consistent with each other for growth and differentiation kinetics. Retrovirus generation and transduction L3MBTL1 cDNA was cloned between EcoRI and XhoI sites in pMSCV-ires-GFP and SGK2 cDNA was cloned between EcoRI and BamHI sites in pMSCV-ires-CFP (A kind gift of Dr BJ Huntly, Cambridge, UK (19)). Amphotropic retroviruses with VSV-G coat were generated as described (http://www.stanford.edu/group/nolan/protocols/pro_helper_free.html). Briefly, 293T cells were transiently transfected with pMSCV-L3MBTL1-ires-GFP and/or pMSCV-SGK2-ires2-CFP, pCMV 8.91 and pVSV-G and medium was changed 24 hours after transfection. Virus containing supernatant was harvested 48 hours and 72 hours post-transfection. Viral supernatant was diluted with fresh RPMI supplemented with 10% heat inactivated FCS and 1% penicillin and streptomycin, and used for infecting HNT-34 cells in 6-well fibronectin coated plates. Two rounds of spin infections 22 were carried out for 12 hours at 2500rpm at 32C. Medium was changed 12 hours after infection then cells induced with 50µM hemin in RPMI supplemented with 10% FCS (heat inactivated) and 1% penicillin/streptomycin. Cell counts and FACS analysis for GPA expression was performed every 24 hours starting 48 hours from infection. RNA was extracted at the day 4 of culture for globin gene expression analysis. Human SNP genotyping for expressed alleles Genomic DNA sequencing for each SNP (SGK2 SNP rs3827067 and GDAP1L1 SNP rs1247963) was performed from buccal or whole blood DNA from informative individuals and their parents. Two independent samples were taken for each individual shown to confirm genotype, except for the parents of the GDAP1L1 families. cDNA sequencing in the probands was performed using the primers described below. For SGK2, CD2+ T cells and for GDAP1L1, GPA+ erythroblasts were found to express a moderate level of transcript, so these were used for further expression analysis. Multiple PCR products were sequenced from independently derived cDNAs of the original cell sample, to confirm the allelic expression pattern. Mutation and sequencing analysis SSCP/HA analysis of all candidate genes except SGK2 and JPH2 was performed as described previously (6). Direct sequencing of SGK2 and JPH2 was performed as described previously (12). Primers used for each fragment are listed below. Bisulphite sequencing and Quantitative Pyro-sequencing Bisulphite sequencing was performed as described previously (13). Quantitative pyrosequencing was done as described before (14) using the primers described by Woodfine et al (15). 23 Colony genotyping BFU-E and CFU-GM colonies were picked into 50µl RLT buffer (Qiagen) in 96-well plates and stored at -80oC. 20ul RLT lysate per colony was transferred to a new plate, and 40µl Isopropanol was added to each well. DNA was precipitated by centrifugation for 1 hour at 3600rpm at room temperature in an Eppendorf 3810R centrifuge with the A-2- DWP rotor. Pellets were washed twice with 70% ethanol, dried by brief centrifugation upside-down and re-suspended in 50µl sterile dH2O. 2.5µl of DNA was used per PCR reaction for each relevant marker. Patient genotypes were determined using a panel of 16 microsatellites across a 5Mb region of 20q encompassing both the previously described MDS and MPN CDRs (38315925-43320563). Constitutional material, either T cells isolated using CD2 Dynabeads (Invitrogen) or buccal DNA isolated using the Epicentre DNA extraction kit (CamBio, Cambridge, UK) was compared to granulocyte DNA. PCR primers for markers with high reported heterozygosity (60 to 85%) were taken from the GenLoc database (http://genecards.weizmann.ac.il/geneloc/index.shtml). One primer was labeled with 6-FAM and PCR products were diluted 1 in 10 before running on an ABI 3700XL. Markers used were: D20S107, D20S170, D20S108, D20S858, D20S466, D20S46, D20S899, D20S96, D20S721, D20S150, D20S169, D20S861, D20S911, D20S119, D20S481 and D20S1151. Microsatellite PCR products were analyzed on an ABI 3730XL analyzer to quantify loss of chromosome 20q as indicated by loss of marker alleles in the tumor sample, compared to constitutional material. The ratio of the areas under each peak in the tumor sample, once normalized to the areas under the corresponding peaks in a constitutional sample, is expressed as a fraction, then subtracted from 1 and converted to a percentage. Colonies were scored for deletion by the retention of just one allele, or no deletion by the presence of both alleles. Colonies not meeting these criteria were excluded from further analysis. At least 3 informative microsatellites were obtained for each colony. Colonies with clear genotypes for all microsatellites analysed were tested by quantitative RT-PCR for expression of L3MBTL1, GDAP1L1, MYBB and C20orf111. 24 Strand-specific cDNA synthesis and PCR Strand specific cDNA for mRNA for L3mbtl1 and Sgk2 was synthesized from C57BL6 x 129S reciprocal cross F1 mice and Gdap1l1 strand specific cDNA was synthesized from C57BL6 x CAST/EiJ F1 mouse tissue. Strand specific cDNA for murine L3mbtl1, Sgk2 and Gdap1l1 were synthesized using primer L3MBTL-R1671, SGK2-R1462 and GDAP1L1-R1448 respectively. For human L3MBTL1, the cDNA for the sense transcript was primed using a primer in exon 14 and exon 24 (primer L3MBTL1-SS-P3 in the table below) for mRNAs in the coding region of the gene, (primer L3MBLT1-SS-P2) for mRNAs extending into the non-coding region of the gene and in the P5 region, chr20:41614055-74 (see Figure S3A) as a control where no mRNAs are expected to be transcribed (primer L3MBTL1-P1). For the antisense transcript, cDNA was primed from exon 24 (primer L3MBTL1-AS-P2) and the exon 17 region (L3MBTL1-SS-P3) where Ensembl ESTs predict antisense expression; and from exon 12 (L3MBTL1-AS-P4) and P5 region (L3MBTL1-AS-P1) which are not predicted to have antisense expression. In Figure S3B sense RNAs were primed from exon 24 to make the sense cDNA, and the antisense RNAs were primed from either exon 12 region (for exon 13 PCR analysis), exon 24 region (for P3 and P5 analysis), and exon 17 (for analysis of the other exons studied). Chromatin Immuno-Precipitation (ChIP) CD34+ cells differentiated in early erythroid cells using phase I of bi-phasic erythroid differentiation with fresh media change every 2 days. 12 hours before the harvest of cells, cells were stimulated with fresh media containing erythropoietin 2U/ml. Harvested cells were sorted for infected cells and 1 million infected day 8 erythroblasts used per condition of chromatin immune precipitation as described before (16). Briefly, infected cells were twice washed with cold PBS, and cross linked using 0.4% formaldehyde solution in PBS and cross linking stopped by adding with 2M glycine solution to a final concentration of 0.125M glycine, cells were subsequently washed with cold PBS, and lyzed 25 with Cell Membrane lysis solution (10mM Tris/HCl pH 8.0, 10mM NaCl, 0.2% NP40 and protease inhibitor cocktail ) and then with nucleus lysis solution (50mM Tris/HCl pH 8.1, 10mM EDTA, 1% SDS and protease inhibitor cocktail), nuclear material was sonicated and any debris removed by centrifugation. Chromatin material extracted was then diluted with ChIP dilution buffer (20mM Tris/HCl pH 8.1, 2mM EDTA, 150mM NaCl, 1% Triton X100, 0.01%SDS and protease inhibitor cocktail) and cleaned using pre-immune serum and then incubated with respective antibody (4ug for H3K4me3 and 12ug for all others). Antibodies used in ChIP were anti-L3MBTL1 (SantaCruz Biotech, sc-50038) anti-BRG1 (AbCam ab4081), anti-H3K4me3 (Millipore Clone MC315) and anti- phospho-S2-PolII (AbCam ab5095). Chromatin was incubated with respective antibodies overnight (18 hours) at 4oC with constant rotation. Next chromatin and antibody mixture was incubated with 25ul Dynabeads labelled with either protein G or protein A (Invitrogen, 100-04D and 100-01D) for two hours at 4oC with content rotation. Labelled beads were then isolated and washed in a magnetic rack (Invitrogen, 123-21D) and washed using wash buffer 1 (20mM Tris/HCl pH 8.1, 2mM EDTA, 50mM NaCl, 1% Triton X100, and 1% SDS) twice, wash buffer 2 (10mM Tris/HCl pH 8.1, 1mM EDTA, 0.25M LiCl, 1% NP40, and 1% Sodium deoxycholate monohydrate) once and then twice with Tris/EDTA (pH 7.8, 50mM). Precipitated chromatin extracted from beads using extraction buffer o (0.1M NaHCO3, 1% SDS) and precipitated DNA isolated by adding 5M NaCl and incubating at 67 C overnight. Samples were then incubated with 3ul Proteinase K (20mg/ml) and 1ul of RNAse at 55oC for two hours and DNA was purified using a PCR purification kit (Qiagen). Immunoprecipitation and western blot pMSCV-L3MBTL1-ires-GFP or pMSCV-SGK2-ires-GFP (described above) were used to transfect HNT-34 cells with control empty vector (pMSCV-ires-GFP) using Amexa transfection reagent ‘R’ and using transfection protocol T-027 (Amexa®). After 96 hours of transfection HNT34 cells were lysed and BRG1 was immunoprecipitated using anti-BRG1 (Abcam ab4081) and analysed for phosphoserine phosphorylation using antibody against pan-phosphoserine (Abcam, ab6639) as 26 described before (17). Part of cell lysate was used for expression analysis of L3MBTL1, SGK2 and Actin. Western blot analyses were performed on total cell lysates using the following antibodies: anti- L3MBTL1 (Santa Cruz sc-50038), anti-SGK2 (Santa Cruz sc-98972) and anti-Actin (Sigma). Study Approval The study of human samples was approved by the Cambridge and Eastern Region Ethics Committee (REC reference number 07/MRE05/44). Patients gave written informed consent, and research was carried out in accordance with the Declaration of Helsinki. The macaque studies were approved by SingHealth Institutional Animal Care and Use Committee (IACUC #2009/SHS/509). All the mouse work was performed under UK home office project license numbers 80/2376 and 80/2567. All experiments in tammar wallaby were approved by institutional ethics committees at Department of Zoology, University of Melbourne, Australia and specimen transfer agreement reference number is GB107A. Statistical Methods An unpaired Student's t-test was used for all analyses, within the GraphPad Prism4 software (GraphPad Software, Inc). Significance was determined by p-vlaues <0.05, ‘*’; <0.01, ‘**’; and <0.001, ‘***’. 27 Primers list: Quantitative PCR primers: Primer Sequence Human quantitative RT-PCR primers ABL-F 5-GCGTGAGAGTGAGAGCAG-3 ABL ABL-R 5-TCTCGGAGGAGACGTAG-3 SFRS6E1F1 5-GTCTACATAGGACGCCTGAG-3 SFRS6 SFRS6E2R1 5-TTGCCGTTCAGCTCGTAAAC-3 L3MBTLE10F2 5-TGTACTTCATCCTCACCGTG-3 L3MBTL1 L3MBTLE11R1 5-AGTTGGCATTGACCCAGAAG-3 SGK2E9F 5-CTGAAGTGCTTCGGAAAGAG-3 SGK2 SGK2E10R2 5-CGGCTGGTGCAGAATGTTC-3 IFT52E6F2 5-TGCCTGGGATCATTGATGAG-3 IFT52 IFT52E7R1 5-ACAGAACCTGTAGACAGAAC-3 MYBBE4F1 5-AATGCCAGTACAGGTGGCTG-3 MYBB MYBBE5R1 5-TTCAGGTGCTTGGCAATCAG-3 JP2E3F1 5-CTGGGCATAGAGACCAAG-3 JPH2 JP2E4R1 5-TCCCTCCATCAGCATAGGTC-3 C20orf111 CT111E4F2 5-GGATGCATCAGGGTCTGTAG-3 CT11E5R1 5-TGTCTTTAGATGCACATGTGG-3 GD1L1E2F2 5-AAGGTGCGGCTGGTGATC-3 GDAP1L1 GD1L1E2R2 5-ATGAACCAGGGCTCCTTCTG-3 HBA-F 5-TGGACAAGTTCCTGGCTTCT-3 HBA HBA-R 5-CCGCCCACTCAGACTTTATT-3 HBB-F 5-GAAGGCTCATGGCAAGAAAG-3 HBB HBB-R 5-CACTGGTGGGGTGAATTCTT-3 MYC MYC-1F 5-CAGCTGCTTAGACGCTGGATT-3 MYC-1R 5-GTAGAAATACGGCTGCACCGA-3 RUNX1 RUNX1-F 5-ACTTCCTCTGCTCCGTGCTG-3 RUNX1-R 5-GCGGTAGCATTTCTCAGCTC -3 CCNE1 CCNE1-F 5-TGCCACCCGGGTCCACAG-3 CCNE1-R 5-GCACGTTGAGTTTGGGTAAAC-3 Murine quantitative RT-PCR primers. L3mbtl1 Forward 5-CTTTCCAGAAGCGGTCAGTC-3 Reverse 5-GGCTCTGACTCCTCTGATGG-3 Sgk2 Forward 5-ACGTGCTGTTGAAGAACGTG-3 Reverse 5-CCCGCTGTAGATGGAAGAAG-3 GapdH Forward 5-TCAACGACCCCTTCATTGAC-3 Reverse 5-ATGCAGGGATGATGTTCTGG-3 Human quantitative ChIP-PCR primers: MYC Forward 5-GGTGGTGGAGGGAGAGAAAA-3 Promoter Reverse 5-CTGTATGTAACCCGCAAACG-3 MYC Forward 5-GATCCTCTCTCGCTAATCTC -3 TSS Reverse 5-TGCCTCTCGCTGGAATTACT-3 28 Human strand specific cDNA synthesis primers Primer name Sequence mRNA L3MBTL1-SS-P1 5-CTGCTCTTCCAGAGCTGCTT-3 (P5) specific L3MBTL1-SS-P2 5-TGAATTTTCTGCCCTTGACC-3 (E24) primers L3MBTL1-SS-P3 5-GTCAATGCCTTCCAACTTCA-3 (E14) Antisense L3MBTL1-AS-P1 5-CAGTGAAGACAGGGACAGCA-3 ( chr20: 41622153) specific L3MBTL1-AS-P2 5-ATCTGCATGTCTCCTCCCAC-3 (Exon 24 region) primers L3MBTL1-AS-P3 5-CTGCTTCCCTCTCCACTGAC-3 (Exon 17) L3MBTL1-AS-P4 5- GTTCAGCTGGAGCCAGTACC-3 (Exon 12) ABL ABL-mRNA-P 5- GATGAGCCCGTCGGCCACCG-3 (Exon 4) Human L3MBTL1 expression primers for antisense cDNA Region Primer Sequence Annealing Product name temperature size P5F 5-TGCTGTCCCTGTCTTCACTG-3 Intergenic 905bp P5R 5-CGTCACCAATTCACATGAGG-3 60C region P3F 5-CTAAAGCCCCCAGACCCTAC-3 681bp P3R 5-GGTCAAGGGCAGAAAATTCA-3 60C Exon 24 E24-F 5-AGCGAAGGTTGGGTTTACAA-3 581bp region E24R 5-GCCAGGGGCCAAAATATAAG-3 60C Exon 21 - E19F 5-AAGAAGCCTCGCCATCACG-3 318bp 19 region E21R 5-GACATGAAGAGGGACTGGTGC-3 59C Exon 18 E18F 5-CCATGTCACAGGCAAGTTCA-3 160bp region E18R 5-GTGATGGCGAGGCTTCTTC-3 58C E13F Exon 13 5-CTTCCAGGTGGGCATGAAG-3 130bp region E13R 5-GTCATAAGTATCATCCCAGT-3 58C Human SNP genotyping primers P5 5AGCGAAGGTTGGGTTTACAA 3 L3MBTL1 rs2664519 P6 5-TGCCAGGGGCCAAAATATAAG-3 SGK2intron1F 5-CCGCGTGACATCAGCTAG-3 SGK2 rs3827067 SGK2Intron2R 5-ACGTGTGTGCTCCTGCAAAC-3 IFT52intron2F 5-TCCCTTCATCTCTGAGCCTC-3 IFT52 rs1883790 iFT52intron3R 5-AGGCCACACAGTAAGTGGTG-3 JPH2Intron1F 5-TTGTCAGGGGCTATGATGAG-3 JPH2 JPH2Intron2R 5-GTCCCTTGAAGCCATGTGTC-3 rs12479863 GD-2F 5-ACTATGTGGAGCGCACCTTC-3 GDAP1L1 GD-6R 5-GTGGATGTCACCCAGGACTT-3 rs12479863 29 Wallaby SNP genotyping primers L3MBTL MeL3UTR_F 5- CACCCACTTTTCTCTCGTCAG-3 o Genomic MeL3MEx22R2 5- GGTCAGAAGTGACCCCACAT-3 60 C DNA L3MBTL MeL3cDNAF1 5 – CGTTGACCCACCCATTTACT-3 60oC cDNA MeL3cDNAR1 5- AGGAAGGCAATGAGGGATTT-3 Macaque cDNA expression primers Gene Primer Sequence Annealing name temperature L3MBTL1 F 5- GCACCAGTCCCTCTTCATGT-3 R 5- TTGTGTTCCCACCATATCAGTC-3 59C F 5- CTCCACCCTTCAACCCAAA-3 SGK2 R 5- GGGCAGAAATACAGCCTCTG-3 60C Macaque SNP genotyping Gene Primer Sequence Annealing SNP location name temperature L3MBTL1 F 5-CATCTTTGGTTTCCAAGGTCTTCGG-3 60C chr10 (-) Genomic DNA R 5- CACTGCACCCGGCTGACAAAA-3 20910951 SGK2 F 5-TAGGAAGCATGGGGCACTCACAG -3 60C chr10 (-) Genomic DNA R 5-CAAAATCCAAACACCAGGAGGCC -3 20867268 L3MBTL1 F 5-GCACCAGTCCCTCTTCATGT-3 59C cDNA R 5-TTGTGTTCCCACCATATCAGTC-3 SGK2 F 5-CTCCACCCTTCAACCCAAA-3 60C cDNA R 5-GGGCAGAAATACAGCCTCTG-3 Macaque bisulphite sequencing primers Location Primer Sequence Annealing Location name temperature F chr10: L3MBTL 5-TGTTGGTGTTGGAGTTGGT-3 59C 20937937 - DMR R 5- ACCCTAAATATATCTTACTTTCCC-3 20938069 30 Mouse genotyping and SNP analysis Primer Sequence mRNA L3mbtl1-R1671 5-TCGTAAGTATCGCCCCAGTC-3 specific Sgk2-R1462 5-CTCCGAGCCACTGTGTCTTA-3 primers Gdap1l1-R1448 5-ATGCTAACCAGTCCCCACAG-3 Primer name Sequence Tm Product SNP oC length L3mbtl1-P2 5-TCAGGCTTCTGGATTGGAC-3 L3mbtl1 59C 415bp L3mbtl1-P4 5-CTGGCTTCTGCTCCACTCTT-3 rs27347041 Sgk2 F359 5-GTTGGAGTTCCTAGCCCACA-3 Sgk2 60C 880bp Sgk2 R1162 5-CATCCCAGTTTATGGGACTG-3 rs27331555 Gdap1l1 F964 5-CCAACCTGCAGTCCTTCTTT-3 Gdap1l1 Gdap1l1 R1134 5-AGTAGGCAAAGTAGCCCATCC-3 61C 192bp rs28243099 Human bisulphite sequencing primers Primer name Sequence Tm oC SGK2 Promoter 1 1st SGK2P1BiF3 5-TTGGAAGTTTTTATGAAATGATTGA-3 55C Round SGK2P1BiR3 5-CCTACTCACAAATAAACCTCTCACC-3 2nd SGK2P1BiF4 5-AGGGTGTTGTGTGAGATTAATTTTT-3 55C Round SGK2P1BiR4 5-AAATCCTAAAAAACAACCCCATAC-3 SGK2 promoter 2 1st SGK2P2BiF1 5-TTTTAAGAAGGTTATGAGGTTGGTG-3 55C Round SGK2P2BiR1 5-AAATATAACCCCTCCCAAACTAATT-3 2nd SGK2P2BiF2 5-TGGGTTAAGATTAAGGTTTTGAGAT-3 55C Round SGK2P2BiR2 5-AAAACATAAAATCTAAACCCATCCC-3 Intergenic CpG island 1st ASBisF3 5-ATTTGGAAGGATTGTTATTTTTTTT-3 55C Round ASBisR3 5-CCACCAACACACATAACAACATATAT-3 2nd ASBisF4 5-AGGTTGGAGTGTAGTGGTATGATTT-3 Round ASBisR4 5-TACTATACCACCAAACTCCCTCTC-3 55C L3MBTL1 Exon 5b 1st L3Ex5bBisF2 5-GTTTGTGGGGATTGGTTAAGTT-3 60C Round L3Ex5bBisR1 5-AATAACCTCCTCCAACCTTCTC-3 2nd L3Ex5bBisF1 5-AGTTGGTTTAGATGATGGGTTTTAG-3 60C Round L3Ex5bBisR2 5-AAACCCAACTCAAAACCTAAAAAA-3 31 Human mutation screening primers PTPRT1 Exon Forward primer Reverse primer Tm °C 1 GTTAGGACTCGGGGGACAC GCCCACACAACTTTCTCCTC 59 2 AGCCGACGAGACAGAGGTAA TGCCATCTCAGAGAGCTCAA 60 3 GATCTCTGGCCACTCCTCTG AGCACCTGTAGGGAGAGCAA 59 4 CACCAAAGTGTGGCCTTTTT TTGGGAGGAAGGGAAAGACT 59 5 CTGAGCCGGGCTACTTCTTA CTCACAAGCCCAGACCTCTC 59 6 TGGATATCCGTGTTGGGAGT GTTTGGGGAGTTTGTGTTGG 60 7 CCTTGTCGTCATGTGCTTGT CATAATGGAGCCTGGGAAAA 60 8 TTTCTTGCCTGCATGTTTTG ACTCCCTGGAGTTGTGCAAT 60 9 AACGTACAGCCCATCAGACC TTTGTTCTTGGGGCTACCAG 60 10 GTATTTGGAGGCTGGGATCA AGTGGGGGTGAAACAACCTT 60 11 CCCCTTTCCTAAACGTCCTC CCATGTGGCACAGAGAAGAA 60 12 CGAACCAATGCTTCCACATA AAAATGCAAACAAGGCAAGG 60 13 GTCATCCGATGGGGAAAAA TGGCTGAAGAACAGGTGAAG 60 14 CAGTTTTGTTCACCGTGCTG GTGTGGGTTGATGGGTGAAT 60 15 TGCCTGGCACATAGTTAGCA CCCTTCAAACAGCAACACAA 60 16 CTTTTTCCCCCATTTTGGAC CAGTGCACTTTCAAATGTAACACA 60 17 CATGGTTTGTTCTGCCTTGA TTAGGATGAACTGCCCCAAG 60 18 TTGAGTCCCAAGTTGGTTCC GCTCCCAGGTGATACTGAGG 60 19 TTCCACTAGGAGTCCCATCG AAGCTTCCATCTTGGCATGT 60 20 TCAACCATCCCCTTGATTTC TGGATGCAGTGGTAGATGGA 60 21 TGTTCTCATTTTGCCCATGA TGAAGCCTCTCTGAGGCACT 60 22 TCAGGCTCACATGTCTCAGG CGATGCATGGAACAAAGAGA 60 23 AACCCTGTGGACTGAAATGC AACAAGCTGGCTCTCATGGT 60 24 GTTCCTCAGTGCAGCAGCTA TCTCGAACTCCTGACCTCGT 60 25 TGTGGTTTGCACATGCATTA CTCCTTGGTCAGGGCTACAG 60 26 TAATTCCCAGGCCACTGTTC CTTGATGCTGGGCTTCTCA 60 27 AGGGTGGAAATAGGCGAGTT CACCTCCACCTCAGGAAGAA 60 28 CAGGGCGTGGAGAGATAAAA GGGATCTCCCTCCAGGTTTA 60 29 GCCTTTGAGCTCCTTCTGTG CACAGGCATCACTTCCTCAA 60 30 TGGTCTGTCTTCCACCATGA AGCATCTGCAAGGATGCTCT 60 31 GGACCTAGGAACATGGCTCA GCATACCAAGGGCACAGAAT 60 32 TGCATTTTCCCTTTCCTTTTT CAACAGGAGACCCCTCAGAA 60 SFRS6 Exon Forward primer Reverse primer Tm °C 1 GCTTCTTTCCTTGGAGAGTTCC CCCCATCAAAACGAGCATCAAC 59 2 CCCCCAGGGTCCCCAAG CGTCCTGGCTAACGACTCC 59 3 ACTGATTACATGCATTTCTACATTTT GGGGGATTTTTGGTTATGTT 59 4 GCATTAGTCATATCATTTCTATCTTGA AGGCATCTAATTGTTCCCTTCA 56 5 ATTGTTTCCTTCCCACAGTGTC GATTTCCGAGTCTGACCAATCT 59 6 TTCACAGTGACTCAACACAACG GGCACGGATGTATTTAAGTTGG 59 7 TGCCTAAGTAGGAAAGTGTTCCAT CTCACTAAGTATTGAGAAAATCGGTC 59 32 SGK2 Exon Forward primer Reverse primer Tm °C 1 GAAGCCAGCTTCCAGCAG GGTAACTAGTCATGCTGGAGACCA 58 2 CAGTCCCATCTTAAGCTCTG TGCAGAACTGCTAAGGAAGC 58 3 TTGTGGCAAGGAGATCGTAG ATTTCCTTAGCCTCGGGAAG 60 4 GTTGTTGGAGAAGGGATCAG GAATGCTAGACCAGAGAATCTG 58 5 CTCCTGGAAGGCTCTCTG TAGGCTGCGGCTTGAGAAG 60 6 GAGGCCTTGTACTGCTGTTG TGTTGTGACCACTTCTGCAC 60 7 CGGGATAAAAGAGGCTGTTG CATTCCAGAACTTGGCATGC 59 8 GGAAGAATGCTGCAGGTCAG GGTGTCTCAGCCATTTAGTG 59 9 GAATAGTTCTCCTGCCAGGAC GTACACAGACTCATGGTCAG 56 10 TAGGCCTGGCCATACCCTTG TATAGCCCACTCAGGAGAAGTG 62 11 GTCAGCTCTTGGTCATCTTC GAGCTTGTGTAGACCACATG 59 12 CTGCCATGCGAGCCATTG TTTAGAAGGCAGCAGGATGC 60 13 CAGTTGCTTGTGGAGCTCTG TTGGCAAGCATAGCAAGCTC 56 14 GACATCCCTCTCTGAGGATC GGTTCTCTGGAGACAAGAAG 54 14a GCTCCTTTGGCAGCTCTG AGGGATAGTCACGTACCCAG 60 14b AATGTTTCGGAGTCCAGGAC GGTTCTCTGGAGACAAGAAG 60 IFT52 Exon Forward primer Reverse primer Tm °C 1 GGGACCCTGGATGTTCTATGAC TGGGTTTATTTTTGGTGAAAAG 56 2 CAGCAGGACAATATCATTTAGAAGG GGGTCTTTGGAATATTGTTTATTGA 56 3 CCGGTATTTCAAAGCTCAGACT GGCCTCTGCTTCCAAATAGTTA 59 4 CACTGGACCTAGAGGGCTATGAT TCGGGCAAAAGTCTTTCAAGTAT 56 5 GATTACAGGTGTGAGCGACGAT CTTCAGGTCAAAATTGGTATGAGTC 59 6 CTCCAAAATGATACATCTTCCTCA TGCTGTACTAATGAATGCAGTGTG 56 7 CATGTTTTTAAAATTTGAATGTGTTTC AAGCCTTCTGGAAATGGTAAGG 59 8 GAGATGCACTTTCGGATTTGAG AGCTGCTTTTAAATGAGCAAAT 56 9 CCTGACCTTCAGCTTTTTCAAAT TGAGAAGCTGGACTCATTTTTCA 10 GCTCTTGCTGTGCTAAAAGGAAC ACACTCAGAATGGAGTGCAGTGT 59 11 GTGTGGTCAGTTAGACGTGCTG GCTGACAAGATAAGGGCAACAG 59 12 TTTCCTTTACCTTATCCTCCCTCA CCTGGGCAACAAGAGTGAAACT 56 13 TGGGAAGGGCAGAAGTTAAGAA GAGGGGCTCCCACTACACTGT 59 14 GTCCAAAGCACTGAAGAGTTTACA ATCCAGAACTGGGGTTGAGAAA 56 MYBB Region Forward primer Reverse primer Tm °C Promoter GGCTCTAGGGACCCAGTAG GAAGGCGTCAGCGTGTCAG 59 Exon 1 GCGGGAGATAGAAAAGTGCTTC GGGGAGGGGTGAGTTAAAGG 56 Exon 2 ATGGACACACCATCCTTGACC ACTCCAGGCTCAGTTCCTCTG 59 Exon 3 CCCTGAGGTTTTCTGCACGTA AGGCACACTGTTCTCCCAGAG 59 33 Exon 4 CCCTGAGCCTAGTACTTAAC AACACAAGGCAATCTCACAG 56 Exon 5 TCAGGTGGATGTGAAGGGCTAT AACCCTCCTCCATCAGAAACAC 56 Exon 6 ACAGAGCTGGGGTTCAAAGG GTGAAATCAAACCAAGCCAAAG 59 Exon 7 TATCTCAGCGAAATGCAAATGG TGTGCTCACTGTGAAGTGTTGTG 56 Exon 8 CCCGTAATGAATGAGTCCTCTTG TGTCTGTACCGACCCAATAAGCA 59 Exon 9 GGGATACTCATGCAGGTCATCA GTCTGGTGTTGCTGAGGGAGA 59 Exon 10 ATCCCACTGTGCAGAGATCC GCCCCTATCCTGTCACTAGTTC 59 Exon 11 TTTCTACAACCTGTCCCCAGAC CTGGGTTGGTCCCACAGTC 59 Exon 12 AGGGTCCTCTCCAAAACTCAAC GGAATCCAGACACTCACCCTAA 56 Exon 13 CCTCTTTCAGGTCTCAGCAG CCTATGCAAAGGCCCTGAG 59 Exon 14 TAGTCCCTGCCTGGATGGTAAC TAGGTCACCAGGGAACCATGAG 59 JPH2 Exon Forward primer Reverse primer Tm °C 1a AGGGCATGTGAGTGGTGATG TTACAAGGCCATTGGATCTC 60 1d TCCTTCCTCATGCCTCCAG GTCCCCAGCCTTTTCAAAGA 60 1b CTGACCTTTCCGTCCCAG CTCCATCATCAAAGTCGAAG 60 1c TTGTCAGGGGCTATGATGAG TTCTGTGCCAATTGCCGGTC 60 2a TTGCACTACCATGCGAACTC TGAGGTCGCTCTTAAGGAAG 60 2b GCCATGGCTACGGAGTAC TCCTTGACCAGCACGTTGTG 60 2c CTTCGAGGCCGATATCGAC CGAAGAGCCTCCAATTAACC 60 3 ATTCATTGACTGCCTGCGTG GCATCTCAGATTCCAGTAAGC 60 4a CGACTGAGCCCATGAATGAG CTTTGGGGATGATGGGCTTC 60 4b CTTTACCAGGGCTACCACAG TGCTCTATCCTGCTTCGGTC 60 5 CTCCTGGAAGGCTCTCTG TAGGTCTTGGCTTCTGCAG 60 6a GATGCAGAGGTGGGATCTTG AGACAGAGCACTGTGTTCTG 60 6b AATCCTTTGGCTGTGGGCTG TTCCATGGGCTTCTGTGCTC 64 6c CCTGTGAAATGGCTTGTCTC GAAGGTTCCCAAGCATTGAAG 60 6d TTGGAGGCTTTGGCTTTGTG TCGTGAGAACAAGGACACAG 60 C20orf111 Exon Forward primer Reverse primer Tm °C 1 GGAGGCAGAGGACTACTGTGAA CAGTGGAAGCTGAGACGCAGT 61 2 CCCACCTGTTTTTACTTTGCTC GAGCTTTTTAGGGAAAAGGGACT 59 3 GAACAATATGTTCTCCTCATTTTACAG GGACACTCAGAAAGGAAAATCC 56 4 CTCCATATCCCAACATCTTCTTG CCACAAGGTCTGCCATTAACTAAA 59 GDAP1L1 Exon Forward primer Reverse primer Tm °C 1 AACTGCCCGGTGAGTAATGA TGAGCAGTCCTGGAAGGAAC 60 34 2 CCCTCCTGTGTGTGACCTCT ACCCCTGAGGATCTGTGGTA 60 3 GAGCCCAGTGAGGAGAGATG GAAAGCAGAGGGGCTGTCTC 60 4 GGGAGCAACCAAGGTATCAG GTTCATTTCCGTGGAAGAGC 60 5 TCCTTCCATCCCTGAACATC TCTGACTCCATAGCCCATCC 60 6A TTGCCTCCTCTTTCTTCCAC TGGGACTCACCTCAGATCCT 60 6B TCTGAGGTGAGTCCCAGGAT CAGCACTTGGCAATGAGAAC 60 3' UTR1 GTCTCTGTGCTGTGTGATTC TAGTCCATGTCCAGGAGAAG 56 3' UTR2 AGGTCCCTGAAGATCAGAAG CAGCACTTGGCAATGAGAAC 56 SUPPLEMENTARY REFERENCES 1. Bench, A.J., Li, J., Huntly, B.J., Delabesse, E., Fourouclas, N., Hunt, A.R., Deloukas, P., and Green, A.R. 2004. Characterization of the imprinted polycomb gene L3MBTL, a candidate 20q tumour suppressor gene, in patients with myeloid malignancies. Br J Haematol 127:509- 518. 2. Swerdlow, S.H., Jaffe, E.S., International Agency for Research on Cancer., and World Health Organization. 2008. WHO classification of tumours of haematopoietic and lymphoid tissues. Lyon: International Agency for Research on Cancer. 439 p. pp. 3. Bench, A.J., Aldred, M.A., Humphray, S.J., Champion, K.M., Gilbert, J.G., Asimakopoulos, F.A., Deloukas, P., Gwilliam, R., Bentley, D.R., and Green, A.R. 1998. A detailed physical and transcriptional map of the region of chromosome 20 that is deleted in myeloproliferative disorders and refinement of the common deleted region. Genomics 49:351-362. 4. Asimakopoulos, F.A., White, N.J., Nacheva, E., and Green, A.R. 1994. Molecular analysis of chromosome 20q deletions associated with myeloproliferative disorders and myelodysplastic syndromes. Blood 84:3086-3094. 5. Asimakopoulos, F.A., and Green, A.R. 1996. Deletions of chromosome 20q and the pathogenesis of myeloproliferative disorders. Br J Haematol 95:219-226. 6. Bench, A.J., Nacheva, E.P., Hood, T.L., Holden, J.L., French, L., Swanton, S., Champion, K.M., Li, J., Whittaker, P., Stavrides, G., et al. 2000. Chromosome 20 deletions in myeloid malignancies: reduction of the common deleted region, generation of a PAC/BAC contig and identification of candidate genes. UK Cancer Cytogenetics Group (UKCCG). Oncogene 19:3902-3913. 7. Fiedler, W., Henke, R.P., Ergun, S., Schumacher, U., Gehling, U.M., Vohwinkel, G., Kilic, N., and Hossfeld, D.K. 2000. Derivation of a new hematopoietic cell line with endothelial features from a patient with transformed myeloproliferative syndrome: a case report. Cancer 88:344-351. 35 8. Hamaguchi, H., Suzukawa, K., Nagata, K., Yamamoto, K., Yagasaki, F., and Morishita, K. 1997. Establishment of a novel human myeloid leukaemia cell line (HNT-34) with t(3;3)(q21;q26), t(9;22)(q34;q11) and the expression of EVI1 gene, P210 and P190 BCR/ABL chimaeric transcripts from a patient with AML after MDS with 3q21q26 syndrome. Br J Haematol 98:399-407. 9. Ailles, L.E., Gerhard, B., and Hogge, D.E. 1997. Detection and characterization of primitive malignant and normal progenitors in patients with acute myelogenous leukemia using long- term coculture with supportive feeder layers and cytokines. Blood 90:2555-2564. 10. van den Akker, E., Satchwell, T.J., Pellegrin, S., Daniels, G., and Toye, A.M. 2010. The majority of the in vitro erythroid expansion potential resides in CD34(-) cells, outweighing the contribution of CD34(+) cells and significantly increasing the erythroblast yield from peripheral blood samples. Haematologica 95:1594-1598. 11. James, C., Ugo, V., Le Couedic, J.P., Staerk, J., Delhommeau, F., Lacout, C., Garcon, L., Raslova, H., Berger, R., Bennaceur-Griscelli, A., et al. 2005. A unique clonal JAK2 mutation leading to constitutive signalling causes polycythaemia vera. Nature 434:1144-1148. 12. Baxter, E.J., Scott, L.M., Campbell, P.J., East, C., Fourouclas, N., Swanton, S., Vassiliou, G.S., Bench, A.J., Boyd, E.M., Curtin, N., et al. 2005. Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative disorders. Lancet 365:1054-1061. 13. Arnaud, P., Monk, D., Hitchins, M., Gordon, E., Dean, W., Beechey, C.V., Peters, J., Craigen, W., Preece, M., Stanier, P., et al. 2003. Conserved methylation imprints in the human and mouse GRB10 genes with divergent allelic expression suggests differential reading of the same mark. Hum Mol Genet 12:1005-1019. 14. Messerschmidt, D.M., de Vries, W., Ito, M., Solter, D., Ferguson-Smith, A., and Knowles, B.B. 2012. Trim28 is required for epigenetic stability during mouse oocyte to embryo transition. Science 335:1499-1502. 15. Woodfine, K., Huddleston, J.E., and Murrell, A. 2011. Quantitative analysis of DNA methylation at all human imprinted regions reveals preservation of epigenetic stability in adult somatic tissue. Epigenetics Chromatin 4:1. 16. Delabesse, E., Ogilvy, S., Chapman, M.A., Piltz, S.G., Gottgens, B., and Green, A.R. 2005. Transcriptional regulation of the SCL locus: identification of an enhancer that targets the primitive erythroid lineage in vivo. Mol Cell Biol 25:5215-5225. 17. Pannu, J., Nakerakanti, S., Smith, E., ten Dijke, P., and Trojanowska, M. 2007. Transforming growth factor-beta receptor type I-dependent fibrogenic gene program is mediated via activation of Smad1 and ERK1/2 pathways. J Biol Chem 282:10405-10413. 18. Karlsson, C., Larsson, J., and Baudet, A. 2010. Forward RNAi screens in human stem cells. Methods Mol Biol 650:29-43. 36 19. Dawson, M.A., Prinjha, R.K., Dittmann, A., Giotopoulos, G., Bantscheff, M., Chan, W.I., Robson, S.C., Chung, C.W., Hopf, C., Savitski, M.M., et al. 2011. Inhibition of BET recruitment to chromatin as an effective treatment for MLL-fusion leukaemia. Nature 478:529-533. 37