DOCSLIB.ORG

A Molecular Neuroethological Approach for Identifying and Characterizing a Cascade of Behaviorally Regulated Genes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Molecular Neuroethological Approach for Identifying and Characterizing a Cascade of Behaviorally Regulated Genes Corrections NEUROSCIENCE. For the article ‘‘A molecular neuroethological BIOPHYSICS. For the article ‘‘A molecular mechanism for os- approach for identifying and characterizing a cascade of behav- molyte-induced protein stability,’’ by Timothy O. Street, D. iorally regulated genes,’’ by Kazuhiro Wada, Jason T. Howard, Wayne Bolen, and George D. Rose, which appeared in issue 38, Patrick McConnell, Osceola Whitney, Thierry Lints, Miriam V. September 19, 2006, of Proc Natl Acad Sci USA (103:13997– Rivas, Haruhito Horita, Michael A. Patterson, Stephanie A. 14002; first published September 12, 2006; 10.1073͞pnas. White, Constance Scharff, Sebastian Haesler, Shengli Zhao, 0606236103), the authors note the following: ‘‘For Fig. 2 of our Hironobu Sakaguchi, Masatoshi Hagiwara, Toshiyuki Shiraki, article, we inadvertently published a plot of the contact surface Tomoko Hirozane-Kishikawa, Pate Skene, Yoshihide Hayash- area rather than the accessible surface area as intended. Also, izaki, Piero Carninci, and Erich D. Jarvis, which appeared in the correlation coefficient given should be 0.81, not 0.88 as in the issue 41, October 10, 2006, of Proc Natl Acad Sci USA original figure caption. All other aspects of the article remain (103:15212–15217; first published October 3, 2006; 10.1073͞ unaffected by this correction. We regret the errors.’’ The cor- pnas.0607098103), the authors note that Fig. 1 appeared incor- rected figure and legend appear below. rectly due to a printer’s error. The corrected figure and its legend appear below. Fig. 2. The polar fraction of osmolyte surface correlates with measured ⌬gtr osmolyte ⌬ values. Fractional polar SA, f polar surface, is plotted against gtr values from Table 1 for the 10 osmolytes in Fig. 1. The linear regression line (solid line) has a negative slope with a correlation coefficient of 0.81, indicating that back- bone͞osmolyte interactions become increasingly favorable as osmolytes be- come increasingly polar. www.pnas.org͞cgi͞doi͞10.1073͞pnas.0608836103 Fig. 1. Molecular functions and variant analysis. (A) Distribution of putative molecular functions for 1,924 clusters and 2,449 subclusters of zebra finch brain cDNAs that received gene ontology annotations (www.geneontology- .org), compared with 27,048 human genes. Genes can be represented in more than one category because of multiple molecular functions, and thus catego- ries add up to Ͼ100%. Human values were obtained from ref. 24. (B) mRNA variant analysis. Percentage represents the proportion of a specific variant type relative to the total number of variants from 100 randomly selected cDNA clusters containing 256 subclusters and 668 clones. *, P Ͻ 0.01 from chance distribution (horizontal line, t test across variant types in n ϭ 10 bins of 10 clusters each). Because not all clones have full sequence coverage, the abso- lute distribution may change when such sequences are present. Colors denote mRNA subdomains quantified. alt, Alternative. www.pnas.org͞cgi͞doi͞10.1073͞pnas.0608997103 17064–17065 ͉ PNAS ͉ November 7, 2006 ͉ vol. 103 ͉ no. 45 www.pnas.org Downloaded by guest on September 24, 2021 NEUROSCIENCE. For the article ‘‘Neurotoxic protein expression CELL BIOLOGY. For the article ‘‘A bio-chemo-mechanical model reveals connections between the circadian clock and mating for cell contractility,’’ by Vikram S. Deshpande, Robert M. behavior in Drosophila,’’ by Sebastian Kadener, Adriana Villella, McMeeking, and Anthony G. Evans, which appeared in issue 38, Elzbieta Kula, Kristyna Palm, Elzbieta Pyza, Juan Botas, Jeffrey September 19, 2006, of Proc Natl Acad Sci USA (103:14015– C. Hall, and Michael Rosbash, which appeared in issue 36, 14020; first published September 7, 2006; 10.1073͞pnas. September 5, 2006, of Proc Natl Acad Sci USA (103:13537–13542; 0605837103), the authors note that Eq. 3 is incorrect. The first published August 28, 2006; 10.1073͞pnas.0605962103), the corrected equation appears below. This error does not affect the authors note that there were errors in the Acknowledgments. conclusions of the article. The corrected version appears below. ˙␧ ␩ Ͻ Ϫ 0 ␧ ៮ We thank Nancy Bonini (Howard Hughes Medical Institute, University ˙o k␯ of Pennsylvania, Philadelphia, PA) for the UAS-MJDtr lines; R. Allada, ៮ ␴ k␯ ˙␧ ␩ ˙␧ P. Emery, K. Abruzzi, K. Dower, D. Stoleru, and S. Lacadie for critical ϭ 1 ϩ ͩ ͪ Ϫ Յ Յ 0. [3] ␴ ␩ ␧ ៮ ˙␧ readings of the manuscript; and Heather Felton for administrative o Ά ˙o k␯ o assistance. S.K. is a recipient of a Human Frontier Science Program ˙␧ Ͼ postdoctoral fellowship. This work was supported in part by National 1 ␧ 0 Institutes of Health Grants NS44232 (to M.R.), GM66778 (to J.C.H. and ˙o M.R.), and GM-21473 and NS33352 (to J.C.H.). www.pnas.org͞cgi͞doi͞10.1073͞pnas.0608707103 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0608504103 CORRECTIONS PNAS ͉ November 7, 2006 ͉ vol. 103 ͉ no. 45 ͉ 17065 Downloaded by guest on September 24, 2021 A molecular neuroethological approach for identifying and characterizing a cascade of behaviorally regulated genes Kazuhiro Wada*†, Jason T. Howard*, Patrick McConnell‡, Osceola Whitney*, Thierry Lints§, Miriam V. Rivas*, Haruhito Horita*, Michael A. Patterson*, Stephanie A. White¶, Constance Scharffʈ, Sebastian Haeslerʈ, Shengli Zhao*, Hironobu Sakaguchi**, Masatoshi Hagiwara††, Toshiyuki Shiraki‡‡§§, Tomoko Hirozane-Kishikawa‡‡§§, Pate Skene*, Yoshihide Hayashizaki‡‡§§, Piero Carninci‡‡§§, and Erich D. Jarvis*† *Department of Neurobiology and ‡Duke Bioinformatics Shared Resource, Duke University Medical Center, Durham, NC 27710; §Department of Biology, City College of New York, New York, NY 10031; ¶Department of Physiological Science, University of California, Los Angeles, CA 90095; ʈNeurobiology Group, Max Planck Institute for Molecular Genetics, 14195 Berlin, Germany; **Department of Physiology and Biological Information, Dokkyo Medical University, Tochigi 321-0293, Japan; ††Department of Functional Genomics, Tokyo Medical and Dental University, Tokyo 113-8519, Japan; ‡‡Genome Science Laboratory, RIKEN, Wako Main Campus, Saitama 351-0198, Japan; and §§Laboratory for Genome Exploration Research Group, RIKEN Yokohama Institute, Yokohama 230-0045, Japan Communicated by Fernando Nottebohm, The Rockefeller University, Millbrook, NY, August 18, 2006 (received for review November 4, 2005) Songbirds have one of the most accessible neural systems for the lecular resource that was focused, from start to finish, on cloning study of brain mechanisms of behavior. However, neuroethologi- full-length cDNAs expressed in the brain from a variety of devel- cal studies in songbirds have been limited by the lack of high- opmental and behavioral conditions. The resource includes an throughput molecular resources and gene-manipulation tools. To annotated database, cDNA microarrays, and a gene-manipulation overcome these limitations, we constructed 21 regular, normal- approach. We used this resource to identify a dynamic cascade of ized, and subtracted full-length cDNA libraries from brains of zebra genes up- and down-regulated in brain vocal nuclei by singing finches in 57 developmental and behavioral conditions in an behavior. The genes include some activity-dependent transcription attempt to clone as much of the brain transcriptome as possible. factors and many late-response housekeeping molecules. Their From these libraries, Ϸ14,000 transcripts were isolated, represent- functions and differential patterns suggest that large gene regula- ing an estimated 4,738 genes. With the cDNAs, we created a tory networks for basic brain processes are recruited as a result of hierarchically organized transcriptome database and a large-scale behavioral performance. Figs. 10–21, Tables 1–6, and Appendix, songbird brain cDNA microarray. We used the arrays to reveal a set which are published as supporting information on the PNAS web of 33 genes that are regulated in forebrain vocal nuclei by singing site, all cited below, show additional information. behavior. These genes clustered into four anatomical and six temporal expression patterns. Their functions spanned a large Results range of cellular and molecular categories, from signal transduc- Brain Transcriptome Libraries. We used brains of 60 zebra finches in tion, trafficking, and structural, to synaptically released molecules. 57 different developmental, pathological, and behavioral states With the full-length cDNAs and a lentiviral vector system, we were (Table 1) to create 21 cDNA libraries: 6 normalized, 4 abundant, 5 able to overexpress, in vocal nuclei, proteins of representative subtracted, and 6 regular (Table 2; definitions are in Glossary in singing-regulated genes in the absence of singing. This publicly Appendix). The 6 normalized libraries were made from a silent ͞͞ accessible resource http: songbirdtranscriptome.net can now be male, undirected singing males, directed singing males, embryonic used to study molecular neuroethological mechanisms of behavior. males and females, 50 juvenile and adult animals in different behavioral states, and animals undergoing rapid vocal learning (Fig. scine songbirds learn their songs by imitating those of adults. 10 and Table 2). Subtracted libraries were focused on enriching for OTheir song behavior is readily quantified and is controlled by genes related to vocal learning and singing. For each library, the a system of discreet brain vocal nuclei (Fig. 8, which is published as first-strand reactions were made with primers that contain unique supporting information on the PNAS web site) (1, 2). For these 3Ј sequence
Load more

Recommended publications
  • The University of Chicago Genetic Services Laboratories
    The University of Chicago Genetic Services Laboratories 5841 S. Maryland Ave., Rm. G701, MC 0077, Chicago, Illinois 60637 Toll Free: (888) UC GENES (888) 824 3637 Local: (773) 834 0555 FAX: (773) 702 9130 [email protected] dnatesting.uchicago.edu. CLIA #: 14D0917593 CAP #: 18827-49 Next Generation Sequencing Panel for Early Infantile Epileptic Encephalopathy Clinical Features and Molecular Genetics: Early infantile epileptic encephalopathy (EIEE), also known as Ohtahara syndrome, is a severe form of epilepsy characterized by frequent tonic spasms with onset in the first months of life. EEG reveals suppression-burst patterns, characterized by high- voltage bursts alternating with almost flat suppression phases. Seizures are medically intractable with evolution to West syndrome at 3-6 months of age and then Lennox-Gastaut syndrome at 1-3 years of age. EIEE represents approximately 1% of all epilepsies occuring in children less than 15 years of age (1). Patients have severe developmental delay and poor prognosis. The diagnostic workup of EIEEs remains challenging because of frequent difficulties in defining etiologies. Acquired structural abnormalities like hypoxic-ischemic insults and isolated cortical malformations, which represent the most common causes of epileptic encelphalopathy in infancy should be excluded first (2). Our EIEE Panel includes sequence analysis of all 15 genes listed below, and deletion/duplication analysis of the 12 genes listed in bold below. Early Infantile Epileptic Encephalopathy Panel ARHGEF9 KCNQ2 PNKP SLC2A1 ARX MAGI2 SCN1A SPTAN1 CDKL5 PCDH19 SCN2A STXBP1 GRIN2A PLCB1 SLC25A22 Gene / Condition Clinical Features and Molecular Pathology ARHGEF9 The ARHGEF9 gene encodes the protein collybistin, which is a brain-specific protein involved in EIEE8 inhibitory synaptogenesis (3).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Table of Contents Neurology.Org/Ng  Online ISSN: 2376-7839 Volume 3, Number 3, June 2017
    Table of Contents Neurology.org/ng Online ISSN: 2376-7839 Volume 3, Number 3, June 2017 THE HELIX e151 HSP and deafness: Neurocristopathy caused by e157 Collaboration, workshops, and symposia a novel mosaic SOX10 mutation S.M. Pulst S. Donkervoort, D. Bharucha-Goebel, P. Yun, Y. Hu, P. Mohassel, A. Hoke, W.M. Zein, D. Ezzo, A.M. Atherton, A.C. Modrcin, M. Dasouki, A.R. Foley, and C.G. Bönnemann EDITORIAL e159 ARHGEF9 mutations cause a specific recognizable X-linked intellectual disability e155 Genetic analysis of age at onset variation in syndrome spinocerebellar ataxia type 2 P. Striano and F. Zara K.P. Figueroa, H. Coon, N. Santos, L. Velazquez, Companion article, e148 L.A. Mederos, and S.M. Pulst ARTICLES e158 Previously unrecognized behavioral phenotype in e148 ARHGEF9 disease: Phenotype clarification and Gaucher disease type 3 genotype-phenotype correlation M. Abdelwahab, M. Potegal, E.G. Shapiro, and M.Alber,V.M.Kalscheuer,E.Marco,E.Sherr, I. Nestrasil G. Lesca, M. Till, G. Gradek, A. Wiesener, C. Korenke, S. Mercier, F. Becker, T. Yamamoto, S.W. Scherer, C.R. Marshall, S. Walker, U.R. Dutta, A.B. Dalal, e160 Intramyocellular lipid excess in the mitochondrial V. Suckow, P. Jamali, K. Kahrizi, H. Najmabadi, and disorder MELAS: MRS determination at 7T B.A. Minassian S. Golla, J. Ren, C.R. Malloy, and J.M. Pascual Editorial, e159 e149 Clinicopathologic and molecular spectrum of CLINICAL/SCIENTIFIC NOTES RNASEH1-related mitochondrial disease e147 Camptocormia and shuffling gait due to a novel E. Bugiardini, O.V. Poole, A. Manole, A.M. Pittman, MT-TV mutation: Diagnostic pitfalls A.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Genetic and Pharmacological Approaches to Preventing Neurodegeneration
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2012 Genetic and Pharmacological Approaches to Preventing Neurodegeneration Marco Boccitto University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Neuroscience and Neurobiology Commons Recommended Citation Boccitto, Marco, "Genetic and Pharmacological Approaches to Preventing Neurodegeneration" (2012). Publicly Accessible Penn Dissertations. 494. https://repository.upenn.edu/edissertations/494 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/494 For more information, please contact [email protected]. Genetic and Pharmacological Approaches to Preventing Neurodegeneration Abstract The Insulin/Insulin-like Growth Factor 1 Signaling (IIS) pathway was first identified as a major modifier of aging in C.elegans. It has since become clear that the ability of this pathway to modify aging is phylogenetically conserved. Aging is a major risk factor for a variety of neurodegenerative diseases including the motor neuron disease, Amyotrophic Lateral Sclerosis (ALS). This raises the possibility that the IIS pathway might have therapeutic potential to modify the disease progression of ALS. In a C. elegans model of ALS we found that decreased IIS had a beneficial effect on ALS pathology in this model. This beneficial effect was dependent on activation of the transcription factor daf-16. To further validate IIS as a potential therapeutic target for treatment of ALS, manipulations of IIS in mammalian cells were investigated for neuroprotective activity. Genetic manipulations that increase the activity of the mammalian ortholog of daf-16, FOXO3, were found to be neuroprotective in a series of in vitro models of ALS toxicity.
    [Show full text]
  • Apoptotic Genes As Potential Markers of Metastatic Phenotype in Human Osteosarcoma Cell Lines
    17-31 10/12/07 14:53 Page 17 INTERNATIONAL JOURNAL OF ONCOLOGY 32: 17-31, 2008 17 Apoptotic genes as potential markers of metastatic phenotype in human osteosarcoma cell lines CINZIA ZUCCHINI1, ANNA ROCCHI2, MARIA CRISTINA MANARA2, PAOLA DE SANCTIS1, CRISTINA CAPANNI3, MICHELE BIANCHINI1, PAOLO CARINCI1, KATIA SCOTLANDI2 and LUISA VALVASSORI1 1Dipartimento di Istologia, Embriologia e Biologia Applicata, Università di Bologna, Via Belmeloro 8, 40126 Bologna; 2Laboratorio di Ricerca Oncologica, Istituti Ortopedici Rizzoli; 3IGM-CNR, Unit of Bologna, c/o Istituti Ortopedici Rizzoli, Via di Barbiano 1/10, 40136 Bologna, Italy Received May 29, 2007; Accepted July 19, 2007 Abstract. Metastasis is the most frequent cause of death among malignant primitive bone tumor, usually developing in children patients with osteosarcoma. We have previously demonstrated and adolescents, with a high tendency to metastasize (2). in independent experiments that the forced expression of Metastases in osteosarcoma patients spread through peripheral L/B/K ALP and CD99 in U-2 OS osteosarcoma cell lines blood very early and colonize primarily the lung, and later markedly reduces the metastatic ability of these cancer cells. other skeleton districts (3). Since disseminated hidden micro- This behavior makes these cell lines a useful model to assess metastases are present in 80-90% of OS patients at the time the intersection of multiple and independent gene expression of diagnosis, the identification of markers of invasiveness signatures concerning the biological problem of dissemination. and metastasis forms a target of paramount importance in With the aim to characterize a common transcriptional profile planning the treatment of osteosarcoma lesions and enhancing reflecting the essential features of metastatic behavior, we the prognosis.
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]
  • Mutation P.R356Q in the Collybistin Phosphoinositide Binding Site Is Associated with Mild Intellectual Disability
    ORIGINAL RESEARCH published: 12 March 2019 doi: 10.3389/fnmol.2019.00060 Mutation p.R356Q in the Collybistin Phosphoinositide Binding Site Is Associated With Mild Intellectual Disability Tzu-Ting Chiou 1, Philip Long 2, Alexandra Schumann-Gillett 3, Venkateswarlu Kanamarlapudi 4, Stefan A. Haas 5, Kirsten Harvey 2, Megan L. O’Mara 3, Angel L. De Blas 1, Vera M. Kalscheuer 6 and Robert J. Harvey 7,8* 1Department of Physiology and Neurobiology, University of Connecticut, Storrs, CT, United States, 2Department of Pharmacology, UCL School of Pharmacy, London, United Kingdom, 3Research School of Chemistry, The Australian National University, Canberra, ACT, Australia, 4Institute of Life Science, School of Medicine, Swansea University, Singleton Park, Swansea, United Kingdom, 5Department of Computational Molecular Biology, Max Planck Institute for Molecular Genetics, Berlin, Germany, 6Group Development and Disease, Max Planck Institute for Molecular Genetics, Berlin, Germany, 7School of Health and Sport Sciences, University of the Sunshine Coast, Sippy Downs, QLD, Australia, 8Sunshine Coast Health Institute, Birtinya, QLD, Australia The recruitment of inhibitory GABAA receptors to neuronal synapses requires a complex interplay between receptors, neuroligins, the scaffolding protein gephyrin and the GDP-GTP exchange factor collybistin (CB). Collybistin is regulated by protein-protein interactions at the N-terminal SH3 domain, which can bind neuroligins 2/4 and the Edited by: Verena Tretter, GABAAR a2 subunit. Collybistin also harbors a RhoGEF domain which mediates Medical University of Vienna, Austria interactions with gephyrin and catalyzes GDP-GTP exchange on Cdc42. Lastly, Reviewed by: collybistin has a pleckstrin homology (PH) domain, which binds phosphoinositides, Hans Michael Maric, Universität Würzburg, Germany such as phosphatidylinositol 3-phosphate (PI3P/PtdIns3P) and phosphatidylinositol Yuchio Yanagawa, 4-monophosphate (PI4P/PtdIns4P).
    [Show full text]
  • Mouse Hnrnph3 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Hnrnph3 Knockout Project (CRISPR/Cas9) Objective: To create a Hnrnph3 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Hnrnph3 gene (NCBI Reference Sequence: NM_001079824 ; Ensembl: ENSMUSG00000020069 ) is located on Mouse chromosome 10. 10 exons are identified, with the ATG start codon in exon 2 and the TGA stop codon in exon 10 (Transcript: ENSMUST00000020263). Exon 2~3 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from the coding region. Exon 2~3 covers 24.18% of the coding region. The size of effective KO region: ~768 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 10 Legends Exon of mouse Hnrnph3 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 534 bp section downstream of Exon 3 is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • ARHGEF9 Mutations in Epileptic Encephalopathy/Intellectual Disability: Toward Understanding the Mechanism Underlying Phenotypic Variation
    Neurogenetics (2018) 19:9–16 https://doi.org/10.1007/s10048-017-0528-2 ORIGINAL ARTICLE ARHGEF9 mutations in epileptic encephalopathy/intellectual disability: toward understanding the mechanism underlying phenotypic variation Jing-Yang Wang1,2 & Peng Zhou1,2 & Jie Wang1,2 & Bin Tang1,2 & Tao Su 1,2 & Xiao-Rong Liu1,2 & Bing-Mei Li1,2 & Heng Meng3,4 & Yi-Wu Shi 1,2 & Yong-Hong Yi 1,2 & Na He1,2 & Wei-Ping Liao1,2 Received: 7 September 2017 /Accepted: 25 October 2017 /Published online: 13 November 2017 # Springer-Verlag GmbH Germany 2017 Abstract ARHGEF9 resides on Xq11.1 and encodes Missense mutations with severe molecular alteration in the collybistin, which is crucial in gephyrin clustering and DH domain, or located in the DH-gephyrin binding region, GABAA receptor localization. ARHGEF9 mutations have or adjacent to the SH3-NL2 binding site were associated with been identified in patients with heterogeneous phenotypes, severe epilepsy, implying that the clinical severity was poten- including epilepsy of variable severity and intellectual disabil- tially determined by alteration of molecular structure and lo- ity. However, the mechanism underlying phenotype variation cation of mutations. Male patients with ARHGEF9 mutations is unknown. Using next-generation sequencing, we identified presented more severe phenotypes than female patients, which a novel mutation, c.868C > T/p.R290C, which co-segregated suggests a gene-dose effect and supports the pathogenic role with epileptic encephalopathy, and validated its association of ARHGEF9 mutations. This study highlights the role of with epileptic encephalopathy. Further analysis revealed that molecular alteration in phenotype expression and facilitates all ARHGEF9 mutations were associated with intellectual dis- evaluation of the pathogenicity of ARHGEF9 mutations in ability, suggesting its critical role in psychomotor develop- clinical practice.
    [Show full text]
  • Endocrine System Local Gene Expression
    Copyright 2008 By Nathan G. Salomonis ii Acknowledgments Publication Reprints The text in chapter 2 of this dissertation contains a reprint of materials as it appears in: Salomonis N, Hanspers K, Zambon AC, Vranizan K, Lawlor SC, Dahlquist KD, Doniger SW, Stuart J, Conklin BR, Pico AR. GenMAPP 2: new features and resources for pathway analysis. BMC Bioinformatics. 2007 Jun 24;8:218. The co-authors listed in this publication co-wrote the manuscript (AP and KH) and provided critical feedback (see detailed contributions at the end of chapter 2). The text in chapter 3 of this dissertation contains a reprint of materials as it appears in: Salomonis N, Cotte N, Zambon AC, Pollard KS, Vranizan K, Doniger SW, Dolganov G, Conklin BR. Identifying genetic networks underlying myometrial transition to labor. Genome Biol. 2005;6(2):R12. Epub 2005 Jan 28. The co-authors listed in this publication developed the hierarchical clustering method (KP), co-designed the study (NC, AZ, BC), provided statistical guidance (KV), co- contributed to GenMAPP 2.0 (SD) and performed quantitative mRNA analyses (GD). The text of this dissertation contains a reproduction of a figure from: Yeo G, Holste D, Kreiman G, Burge CB. Variation in alternative splicing across human tissues. Genome Biol. 2004;5(10):R74. Epub 2004 Sep 13. The reproduction was taken without permission (chapter 1), figure 1.3. iii Personal Acknowledgments The achievements of this doctoral degree are to a large degree possible due to the contribution, feedback and support of many individuals. To all of you that helped, I am extremely grateful for your support.
    [Show full text]