Biochemistry and Cell Biology

Inhibition of brain-type phosphorylase ameliorates high glucose-induced cardiomyocyte apoptosis via Akt-HIF-1α activation

Journal: Biochemistry and Cell Biology

Manuscript ID bcb-2019-0247.R1

Manuscript Type: Article

Date Submitted by the 02-Dec-2019 Author:

Complete List of Authors: Wu, Xuehan; Nanchang University Huang, Weilu; Nanchang University Quan, Minxue; Nanchang University Chen, Yongqi;Draft Nanchang University Tu, Jiaxin; Nanchang University Zhou, Jialu; Nanchang University Xin, Hong Bo; Nanchang University Qian, Yisong; Nanchang University

Keyword:

Is the invited manuscript for consideration in a Special Not applicable (regular submission) Issue? :

https://mc06.manuscriptcentral.com/bcb-pubs Page 1 of 24 Biochemistry and Cell Biology

1 Inhibition of brain-type ameliorates high glucose-induced cardiomyocyte

2 apoptosis via Akt-HIF-1α activation

3 Xuehan Wu, Weilu Huang, Minxue Quan, Yongqi Chen, Jiaxin Tu, Jialu Zhou, Hong-Bo Xin, Yisong

4 Qian

5 The National Engineering Research Center for Bioengineering Drugs and the Technologies, Institute of

6 Translational Medicine, Nanchang University, 1299 Xuefu Avenue, Nanchang 330031, P.R. China

7

8 Corresponding author: Yisong Qian (email: [email protected]).

9

10 Xuehan Wu and Weilu Huang contributedDraft equally to this study.

11

1

https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 2 of 24

13 Abstract

14 The brain-type glycogen phosphorylase (pygb) is one of the rate-limiting in

15 that plays a crucial role in the pathogenesis of type 2 diabetes mellitus. Here we investigated the role of

16 pygb in high glucose (HG)-induced cardiomyocyte apoptosis and explored the underlying mechanisms,

17 by using the specific pygb inhibitors or pygb siRNA. Results showed that inhibition of pygb

18 significantly attenuated cell apoptosis and oxidative stress induced by HG in H9c2 cardiomyocytes.

19 Inhibition of pygb improved glucose in cardiacmyocytes, as evidenced by increased

20 glycogen content, glucose consumption and glucose transport. Mechanismly, pygb inhibition activated

21 Akt/GSK-3β signal pathway and suppressed NF-κB activation in H9c2 cells exposed to HG. 22 Additionally, pygb inhibition promoted theDraft expression and the translocation of hypoxia-inducible 23 factor-1α (HIF-1α) after HG stimulation. However, the changes in glucose metabolism and HIF-1α

24 activation mediated by pygb inhibition were significantly reversed in the presence of Akt inhibitor

25 MK2206. In conclusion, the present study suggested that inhibition of pygb prevents HG-induced

26 cardiomyocyte apoptosis via Akt-HIF-α activation.

27 Keywords: pygb; high glucose; cardiomyocyte; Akt; HIF-1α

2

https://mc06.manuscriptcentral.com/bcb-pubs Page 3 of 24 Biochemistry and Cell Biology

29

30 Introduction

31 Cardiovascular disease and its complications are the primary causes of morbidity and mortality,

32 especially in patients with diabetes mellitus (Mazzone 2010). Diabetic cardiomyopathy (DCM) is

33 characterized by impaired cardiac contractility and poor myocardial performance and can progress

34 toward overt heart failure (Trost et al. 2002). Hyperglycemia is the key initiating event in DCM that

35 triggers a series of downstream signals leading to cardiomyocyte apoptosis, oxidative stress, and

36 inflammation (Chatham and Seymour 2002; Clark et al. 2003). Therefore, the interference of

37 glycometablism in cardiomyocytes may be one of the effective strategies for DCM treatment. 38 Glycogen phosphorylase is the rate-limitingDraft enzyme in glycogenolysis which catalyzes the 39 phosphorolytic cleavage of the glucose polymer glycogen at the α-1,4-glycosidic linkage to release

40 glucose-1-phosphate from glycogen. There are three isoforms of mammalian glycogen phosphorylase,

41 liver, muscle, and brain (Henke and Sparks 2006). The brain-type glycogen phosphorylase (pygb) is

42 also highly expressed in cardiomyocytes (Kato et al. 1989) and is used as a diagnostic biomarker for

43 acute (Cubranic et al. 2012; Peetz et al. 2005). Recently, the repression of

44 glycogen phosphorylase by specific inhibitors has been used for the treatment of type 2 diabetes (Nagy

45 et al. 2013; Sanae et al. 2014) and myocardial -reperfusion injury (Tracey et al. 2004) in

46 animal models. We have previously identified that naturally occurring pentacyclic triterpenes including

47 asiatic acid and maslinic acid are potent glycogen phosphorylase inhibitors, which bind at the allosteric

48 activator site, where the physiological activator AMP binds and efficiently suppress the activation of

49 glycogen phosphorylase (Guan et al. 2009; Wen et al. 2008). In addition, we also demonstrated that

50 asiatic acid protests against myocardial ischemia-reperfusion injury in in vitro and in vivo models (Dai

3

https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 4 of 24

51 et al. 2018; Huang et al. 2016). However, the role of pygb in high glucose-induced cardiomyocyte

52 injury and its regulatory mechanisms still remain unknown.

53 In the present study, a high glucose (HG)-induced cardiomyocyte injury model in human

54 cardiomyocyte cell line H9c2 was established to investigate the role of pygb in cardiomyocyte

55 apoptosis, by using the specific pygb inhibitors and pygb siRNA. In addition, the pygb-mediated signal

56 pathways were explored, with the aim to provide novel insights into the therapeutic strategies for

57 DCM.

58 Materials and methods

59 Materials

60 H9c2 cell lines were purchased fromDraft American Type Culture Collection (ATCC, CRL-1446).

61 Asiatic acid and maslinic acid were purchased from Sigma-Aldrich. MK2206 was obtained from

62 Biovision. The anti-Bcl-2, anti-Bax, anti-Akt, anti-phosphor-Akt and anti-GAPDH antibodies were

63 obtained from Santa Cruz, the anti-GLUT4, anti-HIF-1α, anti-NF-κB p65 and anti-NF-kB p65

64 (phosphor S276) antibodies were from Abcam, the anti-GSK-3β, anti-phospho-GSK-3 (Ser9) and

65 anti-caspase-9 antibodies were from Cell Signaling Technology, and the anti-pygb antibody was

66 obtained from ZenBioScience.

67 Cell culture and treatment

68 H9c2 cells were cultured in low-glucose Dulbecco’s modified essential medium (DMEM, Life

69 Technologies) containing 10% fetal bovine serum (FBS, Life Technologies), 1% streptomycin (100

70 μg/mL) and 1% penicillin (100 U/mL) at pH 7.4 in a 5% CO2 incubator at 37 ℃. The cultures were

71 incubated with 10 μM of asiatic acid or maslinic acid for 4 h, followed by the exposure of 33.3 mM of

4

https://mc06.manuscriptcentral.com/bcb-pubs Page 5 of 24 Biochemistry and Cell Biology

72 glucose (HG) for 48 h. Apoptosis was determined by Hoechst 33258 staining, cleaved caspase-9, bax

73 and bcl-2 levels. The oxidative stress was evaluated by ROS production, SOD activity and MDA

74 content, according to the manufacturer's instructions (Nanjing Jiancheng Bioengineering Institute).

75 Pygb knockdown by siRNA

76 The siRNA target sequence was selected in rat pygb (GenBank accession NM_013188.1) as

77 follows: siRNA1: GCATGTGATGAAGCCACTTAT and siRNA2:

78 GGTTCAAGTCGTCCAAGTTTG. Pygb siRNA was constructed into the lentivirus expression vector

79 PDS019_pL_shRNA_F carrying the green fluorescent protein (GFP) gene. A universal sequence was

80 used as a negative control for RNA interference. The viral particles were produced by third generation

81 packaging in 293T cells and Lentiviral stocksDraft were concentrated using ultracentrifugation. H9c2 cells

82 (5 × 104/ml) were prepared and infected at a Multiplicity of Infection (MOI) of 20 with negative

83 control (GFP) or pygb siRNA lentiviruses for 16 h at 37°C in the presence of 10 mg/ml polybrene. The

84 cultures were then washed and cultured in fresh medium for 72 h. GFP expression was detected to

85 calculate the infection efficiency.

86 Hoechst 33258 Staining

87 Cells were rinsed with phosphate-buffered saline (PBS, pH 7.4) three times and fixed with 4%

88 paraformaldehyde for 30 min at room temperature, followed by incubation with 5 μM Hoechst 33258

89 at 37 ℃ for 20 min. Fluorescence images were examined under the fluorescence microscope. Cells

90 with bright, condensed and rounded nuclei were considered as the apoptotic cells.

91 ROS measurement

5

https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 6 of 24

92 The production of ROS was monitored using the fluorescent probe 2’-7’-dichlorofluorescein

93 diacetate (DCFH-DA, Sigma), which is converted into highly fluorescent 2’-7’-dichlorofluorescein

94 (DCF) in the presence of ROS. Samples were rinsed with PBS, and incubated with 10 mM DCFH-DA

95 at 37 ℃ for 30 min. Fluorescence was observed using a fluorescence microscope (IX71, Olympus).

96 Western Blot

97 At the end of treatment, cells were rinsed in PBS and lysed in RIPA lysis buffer. Twenty

98 micrograms of protein were loaded into each lane, separated by 10% sodium dodecyl

99 sulfate-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes in Tris-glycine

100 buffer (48 mM Tris, 39 mM glycine, pH 9.2) containing 20% methanol. The membranes were blocked

101 with skimmed milk for 1 h, washed in TrisDraft buffered saline containing 0.1% Tween-20 (TBST) and

102 incubated overnight with the primary antibodies. After washing three times with TBST, nitrocellulose

103 membranes were incubated for 1 h at room temperature with horseradishperoxidase-conjugated goat

104 anti-rabbit or anti-mouse IgG. Bands were visualized using the SuperSignal West Pico

105 Chemiluminescent SubstrateTrial Kit (Pierce). Images were taken using the ChemiDoc XRS system

106 with Quantity One software (Bio-Rad).

107 Determination of glycogen and glucose

108 Cellular glycogen was measured as described previously (Verleysdonk et al. 2005). Briefly, the

109 cells were washed in ice-cold PBS and lysed by 0.1 M NaOH. The lysates were incubated at 80 °C for

110 1 h, and the glycogen was precipitated by the addition of 2.5 volumes of ethanol. After centrifugation,

111 the pellet was dried in a vacuum concentrator and resuspended in 50 mM sodium acetate buffer (pH

112 4.8). The glycogen was digested with amyloglucosidase at 37 °C for 90 min, and the resulting glucose

6

https://mc06.manuscriptcentral.com/bcb-pubs Page 7 of 24 Biochemistry and Cell Biology

113 was assayed in the microtiter plate at 492 nm using a glucose detection kit (Nanjing Jiancheng

114 Bioengineering Institute). The glucose consumption was evaluated by measuring the glucose content in

115 the supernatant of H9c2 cells, according to the manufacturer's instructions (Nanjing Jiancheng

116 Bioengineering Institute).

117 Immunocytochemistry

118 Cells were rinsed with PBS three times, fixed with 4% paraformaldehyde for 30 min at room

119 temperature and permeabilised in 0.1% Triton X-100 for 10min. An incubation in 5% bovine serum

120 albumin (BSA) in PBS for 1 h was performed to prevent the non-specific binding. The cultures were

121 incubated with the anti-HIF-1α antibody overnight at 4 °C. Then cells were incubated with fluorescein

122 isothiocyanate (FITC)-conjugated goat anti-rabbitDraft IgG (Alexa 488, Thermo Fisher) and the nuclei were

123 stained with DAPI. Immunostained cells were examined under a fluorescence microscope and digital

124 images were analyzed with Image-Pro Plus software.

125 Statistical Analysis

126 All values are expressed as the mean ± standard deviation (SD) of at least three independent

127 preparations. Differences among the groups were compared using one-way analysis of variance

128 (ANOVA) analysis followed by a Tukey post-hoc test. A difference with p < 0.05 was considered

129 statistically significant.

130 Results

131 Inhibition of pygb alleviates HG-induced myocardial apoptosis

132 The chemical structures of asiatic acid and maslinic acid, the pygb inhibitors, are shown in Fig.

133 1A. The control and pygb inhibitors-treated H9c2 cells showed weak Hoechst and DCF fluorescence,

7

https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 8 of 24

134 which was significantly increased after HG exposure. Both asiatic acid and maslinic acid suppressed

135 HG-induced cell apoptosis and oxidative stress in H9c2 cells (Fig. 1B). We further investigated the

136 effects of pygb on apoptotic pathways in H9c2 cells by using two pygb siRNAs. Both siRNAs reduced

137 pygb protein levels to <30% (Fig 1C and 1D). Pygb knockdown by siRNA1 caused a decrease in

138 cleaved caspase-9 and Bax/Bcl-2 ratio under normal conditions. HG induced an increase in cleaved

139 caspase-9 and Bax/Bcl-2 ratio. However, these effects were obviously reversed by both pygb siRNAs

140 (Fig. 1C, 1E and 1F). In addition, pygb knockdown prevented HG-induced inhibition of SOD activity

141 (Fig. 1G) and suppressed the accumulation of MDA (Fig. 1H). These data suggested that inhibition of

142 pygb effectively protected cardiomyocyte against HG-induced apoptosis and oxidative stress.

143 Inhibition of pygb improves glucose metabolismDraft after HG exposure in H9c2 cells

144 The effects of pygb on glucose metabolism were determined in HG-treated H9c2 cells. Glycogen

145 accumulation was significantly increased after asiatic acid or maslinic acid treatment. HG induced

146 glycogen synthesis which was further promoted in the presence of pygb inhibitors (Fig. 2A). The

147 glucose concentration in the supernatant was detected before and after HG stimulation to evaluate

148 glucose consumption. Results showed asiatic acid and maslinic acid accelerated the absorbance of

149 extracellular glucose compared with the control, and improved the uptake ability of glucose following

150 HG exposure (Fig. 2B). GLUT4 levels were determined for evaluation of the glucose transport capacity.

151 Both pygb inhibitors up-regulated the GLUT4 levels under normal conditions. HG resulted in an

152 increase in GLUT4 levels, but asitic acid and maslinic acid did not further promote its expression in the

153 presence of HG (Fig. 2C). Knockdown of pygb yielded the similar results with the pygb inhibitors. The

154 pygb siRNAs increased glycogen content (Fig. 2D) and enhanced glucose consumption (Fig. 2E) in

8

https://mc06.manuscriptcentral.com/bcb-pubs Page 9 of 24 Biochemistry and Cell Biology

155 H9c2 cells under normal conditions and with HG exposure. The pygb siRNAs induced a slight increase

156 in GLUT4 protein levels in the absence of HG, but remarkably up-regulated GLUT4 expression after

157 HG exposure (Fig. 2F). These data indicated that inhibition of pygb improved glucose metabolism in

158 H9c2 cells

159 Inhibition of pygb activates Akt/GSK-3β signaling pathway and prevents NF-κB activation

160 Akt/GSK-3β signaling pathway play a vital role in the regulation of glycogen synthesis in skeletal

161 muscle including heart (Markou et al. 2008; Patel et al. 2008). Our data revealed that the levels of

162 phosphor-Akt increased with the treatment of pygb inhibitor and siRNAs, leading to the inactivation of

163 GSK-3β, as evidenced by the enhanced phosphorylation at Ser9. Inhibition of pygb further activated

164 Akt/GSK-3β signaling pathway followingDraft HG stimulation (Fig. 3A-E). NF-κB signaling is involved in

165 oxidative stress and inflammation response triggered by HG (Panahi et al. 2018). Asiatic acid and

166 maslinic acid reduced the levels of phosphor-NF-κB p65 whereas pygb siRNAs did not obviously

167 affect the phosphorylation of NF-κB p65 without HG stimulation. Both pygb inhibitors and siRNAs

168 effectively suppressed p65 phosphorylation following HG treatment (Fig. 3A, 3F and 3G). Inhibition of

169 pygb also decreased the total p65 levels in H9c2 cells after 24 h of HG exposure (Fig. 3A, 3H and 3I).

170 It has been reported that HIF-1α is a key mediator of glycolysis in cardiomyocytes (Gao et al. 2015;

171 Malhotra et al. 2002). Therefore, whether pygb-mediated glucose metabolism is associated with

172 HIF-1α was examined. The result demonstrated that pygb inhibition by the inhibitors and siRNAs

173 significantly up-regulated HIF-1α levels in the absence and presence of HG treatment (Fig. 3A, 3J and

174 3K).

175 Inhibition of pygb activates HIF-1α and promotes glycogen synthesis through Akt

9

https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 10 of 24

176 The function of Akt in pygb-mediated HIF-1α activation and glucose metabolism were further

177 tested. The specific Akt inhibitor MK2206 was used in the experiment and was added to the cultures 1

178 h before asiatic acid treatment. HG caused an obvious nuclear translocation of HIF-1α, which was

179 further promoted in the presence of asiatic acid. However, this effect was abolished by the addition of

180 MK2206 (Fig. 4A). In addition, the increased glycogen synthesis mediated by pygb inhibition was also

181 blocked by MK2206 (Fig. 4B and 4C).

182 Discussion

183 Here we demonstrated that inhibition of pygb remarkably attenuated HG-evoked oxidative stress

184 and apoptosis in cardiomyocytes. In addition, pygb inhibition activated Akt/GSK-3β signaling pathway

185 and modulated HIF-1α activation, which Draftmay contribute to the improvement of glycometabolism in

186 cardiomyocytes during HG exposure.

187 Hyperglycemia-induced myocardial injury has been associated with cardiac inflammation,

188 oxidative stress and apoptosis (Brownlee 2005; Goldberg 2009). Hyperglycemia causes increased

189 mitochondrial production of ROS, which triggers the breakage of nuclear DNA strands and

190 subsequently the activation of mitochondria-dependent apoptosis. In the present study we showed that

191 pygb inhibition significantly reduced ROS production, alleviated oxidative stress and prevented

192 myocardial apoptosis exposed to HG, indicating that pygb play a crucial role in HG-induced cellular

193 damage.

194 Pygb is the key enzyme in glycogen metabolism, which increases intracellular glucose levels by

195 promoting glycogen decomposition. Therefore, we speculated that pygb inhibition protects against

196 HG-induced apoptosis by modulation of glycometabolism. The results confirmed that both pygb

10

https://mc06.manuscriptcentral.com/bcb-pubs Page 11 of 24 Biochemistry and Cell Biology

197 inhibitors and siRNA promoted the syntheses of glycogen, accelerated the consumption of glucose and

198 increased the expression of GLUT4, thus maintained the extracellular glucose at a lower level to

199 effectively reduced HG-induced cell damage. Akt and GSK-3 are involved in the activation of

200 glycogen synthase and stimulation of glycogen synthesis (Lavoie et al. 1999). We found here that

201 Akt/GSK-3β was remarkably activated by pygb inhibition. This result was in agreement with the

202 previous study that the pygb inhibitor maslinic acid significantly enhanced the phosphorylation levels

203 of Akt and GSK3β to modulate the hepatic glycogen metabolism (Liu et al. 2014). The activation of

204 NF-κB and its cascade can be regulated by PI3K/Akt signaling pathway, which plays a crucial

205 role in regulating various biological functions such as cell proliferation, cell differentiation, and

206 apoptosis (Liu et al. 2010). The present resultsDraft suggested that inhibition of pygb suppressed

207 HG-induced NF-κB activation, which in turn attenuated the NF-κB-dependent gene transcription and

208 protected cardiomyocytes from HG-induced oxidative stress and apoptosis at least partly through Akt

209 signaling.

210 Additionally, we have previously showed that maslinic acid did not reduce fasting blood glucose

211 but significantly increased liver glycogen contents in normal mice (Tang et al. 2008), which is

212 coincided with the current results that pygb inhibitors promotes glycogen synthesis whereas they have

213 no effects on oxidative stress and apoptosis under normal conditions in vitro. Thus we speculate that

214 the modulation of Akt and NF-κB pathways may have few effects on physiological parameters

215 including fasting blood glucose under normal conditions, indicating a minor side effect mediated by

216 pygb inhibitors.

11

https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 12 of 24

217 HIF-1 is a heterodimeric transcription factor consisting of a constitutively expressed β-subunit

218 and an oxygen-regulated α-subunit (Gu et al. 2013). Under normoxic conditions, HIF-1α is constantly

219 degraded via the ubiquitin-proteasome pathway. However, under hypoxic conditions, the HIF-1α

220 subunits are no longer degraded and translocated into the nuclei for binding to hypoxic responsive

221 elements and up-regulates several hypoxia-responsive genes and glycolytic genes (Kim et al. 2006;

222 Taylor 2008). It has been demonstrated that glucose activates HIF1 and HIF2 in beta cells and that both

223 HIF isoforms play distinct roles in the glucose stimulation of expression of glycolytic

224 (Bensellam et al. 2012). In another report, high glucose induces oxidative stress and glucose transport

225 alterations in kidneys, resulting in HIF-1α stability and more HIF-1 production. Activation of HIF-1α

226 may not only improve tubular transport efficiencyDraft but also prevent diabetes-induced alteration in

227 kidney oxygen metabolism (Nordquist et al. 2015). The Akt/GSK-3β signal pathway has been

228 implicated in the modulation of HIF-1α degradation. Exposure of cells to the PI3K inhibitor caused

229 Akt inhibition, hypophosphorylation of GSK-3β, and depletion of HIF-1α, while treatment with the

230 GSK-3β inhibitor led to a partial recovery of the HIF-1α protein depletion (Li et al. 2018). Our findings

231 are consistent with the reported roles of Akt and GSK-3β in the regulation of HIF-1α protein stability.

232 An obvious nuclear localization of HIF-1α induced by HG in H9c2 cells was observed and treatment

233 with asiatic acid further increased the fluorescence intensity in HG exposure. However, this effect was

234 strongly blocked by the Akt inhibitor MK2206, suggesting that pygb regulated HIF-1α activation

235 through Akt signaling. In addition, the increased glycogen synthesis induced by pygb inhibition was

236 abolished in the presence of MK2206. Therefore, we may concluded that Akt/GSK-3β is involved in

237 pygb-mediated HIF-1α activation and glycogen metabolism in cardiomyocytes. However, more

12

https://mc06.manuscriptcentral.com/bcb-pubs Page 13 of 24 Biochemistry and Cell Biology

238 regulators, possibly mTOR (Masoud and Li 2015), that medicate HIF-1α translocation and stabilization

239 in our model remain unknown and warrant further investigation.

240 Previous studies revealed the physical and functional interactions between HIF and NF-κB. On

241 the one hand, NF-κB activation results in HIF stabilization and activation in response to infection and

242 inflammation. On the other hand, HIF-1α is required to restrain the transcriptional activity of NF-κB

243 (Bandarra et al. 2015). It has been reported that inhibition of HIF-1α by 2-MeOE2 results in

244 suppression of NF-κB signaling pathway (Liu et al. 2019). Taken together, the suppression of NF-κB

245 mediated by pygb inhibition in our experiment is possibly attributed to direct Akt or Akt-HIF-1α

246 signaling.In conclusion, pygb inhibition prevents cardiomyocytes apoptosis through the activation of

247 Akt-HIF-1α signal pathway, which leads Draftto ameliorated glycometabolism and attenuated oxidative

248 stress. The study suggested that pygb is an important target involved in DCM and advanced the

249 understanding of the molecular mechanisms underlying the cardioprotection of pygb inhibitors.

250

251 Conflict of interest statement

252 The authors declare that there is no conflict of interest associated with this work.

253

254 Funding statement

255 This work was supported by grants to Y.-S. Qian from the National Natural Science Foundation of

256 China (grants 81400220 and 81860020).

13

https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 14 of 24

258 References 259 260 Bandarra, D., Biddlestone, J., Mudie, S., Muller, H.A., and Rocha, S. 2015. 261 HIF-1alpha restricts NF-kappaB-dependent gene expression to control innate 262 immunity signals. Disease models & mechanisms 8(2): 169-181. 263 doi:10.1242/dmm.017285. 264 265 Bensellam, M., Duvillie, B., Rybachuk, G., Laybutt, D.R., Magnan, C., Guiot, Y., et 266 al. 2012. Glucose-induced O(2) consumption activates hypoxia inducible 267 factors 1 and 2 in rat insulin-secreting pancreatic beta-cells. PloS one 7(1): 268 e29807. doi:10.1371/journal.pone.0029807. 269 270 Brownlee, M. 2005. The pathobiology of diabetic complications: a unifying 271 mechanism. Diabetes 54(6): 1615-1625. doi:10.2337/diabetes.54.6.1615. 272 273 Chatham, J.C., and Seymour, A.M. 2002. Cardiac metabolism in Zucker 274 diabetic fatty rats. Cardiovascular research 55(1): 104-112. 275 doi:10.1016/s0008-6363(02)00399-1. 276 Draft 277 Clark, R.J., McDonough, P.M., Swanson, E., Trost, S.U., Suzuki, M., Fukuda, M., et 278 al. 2003. Diabetes and the accompanying hyperglycemia impairs 279 cardiomyocyte calcium cycling through increased nuclear O-GlcNAcylation. 280 The Journal of biological chemistry 278(45): 44230-44237. 281 doi:10.1074/jbc.M303810200. 282 283 Cubranic, Z., Madzar, Z., Matijevic, S., Dvornik, S., Fisic, E., Tomulic, V., et al. 2012. 284 Diagnostic accuracy of heart fatty acid binding protein (H-FABP) and 285 glycogen phosphorylase isoenzyme BB (GPBB) in diagnosis of acute 286 myocardial infarction in patients with acute coronary syndrome. Biochemia 287 medica 22(2): 225-236. doi:10.11613/bm.2012.025. 288 289 Dai, Y., Wang, Z., Quan, M., Lv, Y., Li, Y., Xin, H.B., et al. 2018. Asiatic acid 290 protests against myocardial ischemia/reperfusion injury via modulation of 291 glycometabolism in rat cardiomyocyte. Drug design, development and therapy 292 12: 3573-3582. doi:10.2147/DDDT.S175116. 293 294 Gao, Q., Guan, L., Hu, S., Yao, Y., Ren, X., Zhang, Z., et al. 2015. Study on the 295 mechanism of HIF1a-SOX9 in glucose-induced cardiomyocyte hypertrophy. 296 Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 74: 297 57-62. doi:10.1016/j.biopha.2015.07.009. 298

14

https://mc06.manuscriptcentral.com/bcb-pubs Page 15 of 24 Biochemistry and Cell Biology

299 Goldberg, R.B. 2009. Cytokine and cytokine-like inflammation markers, endothelial 300 dysfunction, and imbalanced coagulation in development of diabetes and its 301 complications. The Journal of clinical endocrinology and metabolism 94(9): 302 3171-3182. doi:10.1210/jc.2008-2534. 303 304 Gu, H.F., Zheng, X., Abu Seman, N., Gu, T., Botusan, I.R., Sunkari, V.G., et al. 2013. 305 Impact of the hypoxia-inducible factor-1 alpha (HIF1A) Pro582Ser 306 polymorphism on diabetes nephropathy. Diabetes care 36(2): 415-421. 307 doi:10.2337/dc12-1125. 308 309 Guan, T., Li, Y., Sun, H., Tang, X., and Qian, Y. 2009. Effects of maslinic acid, a 310 natural triterpene, on glycogen metabolism in cultured cortical astrocytes. 311 Planta medica 75(10): 1141-1143. doi:10.1055/s-0029-1185481. 312 313 Henke, B.R., and Sparks, S.M. 2006. Glycogen phosphorylase inhibitors. Mini 314 reviews in medicinal chemistry 6(8): 845-857. 315 doi:10.2174/138955706777934991. 316 317 Huang, X., Zuo, L., Lv, Y., Chen, DraftC., Yang, Y., Xin, H., et al. 2016. Asiatic Acid 318 Attenuates Myocardial Ischemia/Reperfusion Injury via 319 Akt/GSK-3beta/HIF-1alpha Signaling in Rat H9c2 Cardiomyocytes. 320 Molecules 21(9). doi:10.3390/molecules21091248. 321 322 Kato, K., Shimizu, A., Kurobe, N., Takashi, M., and Koshikawa, T. 1989. Human 323 brain-type glycogen phosphorylase: quantitative localization in human tissues 324 determined with an immunoassay system. Journal of neurochemistry 52(5): 325 1425-1432. doi:10.1111/j.1471-4159.1989.tb09189.x. 326 327 Kim, J.W., Tchernyshyov, I., Semenza, G.L., and Dang, C.V. 2006. HIF-1-mediated 328 expression of pyruvate dehydrogenase kinase: a metabolic switch required for 329 cellular adaptation to hypoxia. Cell metabolism 3(3): 177-185. 330 doi:10.1016/j.cmet.2006.02.002. 331 332 Lavoie, L., Band, C.J., Kong, M., Bergeron, J.J., and Posner, B.I. 1999. Regulation of 333 glycogen synthase in rat hepatocytes. Evidence for multiple signaling 334 pathways. The Journal of biological chemistry 274(40): 28279-28285. 335 doi:10.1074/jbc.274.40.28279. 336 337 Li, A.G., Murphy, E.C., Culhane, A.C., Powell, E., Wang, H., Bronson, R.T., et al. 338 2018. BRCA1-IRIS promotes human tumor progression through PTEN 339 blockade and HIF-1alpha activation. Proceedings of the National Academy of

15

https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 16 of 24

340 Sciences of the United States of America 115(41): E9600-E9609. 341 doi:10.1073/pnas.1807112115. 342 343 Liu, J., Wang, X., Chen, Y.P., Mao, L.F., Shang, J., Sun, H.B., et al. 2014. Maslinic 344 acid modulates glycogen metabolism by enhancing the insulin signaling 345 pathway and inhibiting glycogen phosphorylase. Chinese journal of natural 346 medicines 12(4): 259-265. doi:10.1016/S1875-5364(14)60052-2. 347 348 Liu, S., Shen, H., Xu, M., Liu, O., Zhao, L., Liu, S., et al. 2010. FRP inhibits 349 ox-LDL-induced endothelial cell apoptosis through an 350 Akt-NF-{kappa}B-Bcl-2 pathway and inhibits endothelial cell apoptosis in an 351 apoE-knockout mouse model. American journal of physiology. Endocrinology 352 and metabolism 299(3): E351-363. doi:10.1152/ajpendo.00005.2010. 353 354 Liu, Y., Zou, X., Ou, M., Ye, X., Zhang, B., Wu, T., et al. 2019. Toxoplasma gondii 355 Cathepsin C1 inhibits NF-kappaB signalling through the positive regulation of 356 the HIF-1alpha/EPO axis. Acta tropica 195: 35-43. 357 doi:10.1016/j.actatropica.2019.04.018. 358 Draft 359 Malhotra, R., Tyson, D.G., Sone, H., Aoki, K., Kumagai, A.K., and Brosius, F.C., 3rd. 360 2002. Glucose uptake and adenoviral mediated GLUT1 infection decrease 361 hypoxia-induced HIF-1alpha levels in cardiac myocytes. Journal of molecular 362 and cellular cardiology 34(8): 1063-1073. doi:10.1006/jmcc.2002.2047. 363 364 Markou, T., Cullingford, T.E., Giraldo, A., Weiss, S.C., Alsafi, A., Fuller, S.J., et al. 365 2008. Glycogen synthase kinases 3alpha and 3beta in cardiac myocytes: 366 regulation and consequences of their inhibition. Cellular signalling 20(1): 367 206-218. doi:10.1016/j.cellsig.2007.10.004. 368 369 Masoud, G.N., and Li, W. 2015. HIF-1alpha pathway: role, regulation and 370 intervention for therapy. Acta pharmaceutica Sinica. B 5(5): 378-389. 371 doi:10.1016/j.apsb.2015.05.007. 372 373 Mazzone, T. 2010. Intensive glucose lowering and cardiovascular disease prevention 374 in diabetes: reconciling the recent clinical trial data. Circulation 122(21): 375 2201-2211. doi:10.1161/CIRCULATIONAHA.109.913350. 376 377 Nagy, L., Docsa, T., Szanto, M., Brunyanszki, A., Hegedus, C., Marton, J., et al. 2013. 378 Glycogen phosphorylase inhibitor 379 N-(3,5-dimethyl-Benzoyl)-N'-(beta-D-glucopyranosyl)urea improves glucose 380 tolerance under normoglycemic and diabetic conditions and rearranges hepatic 381 metabolism. PloS one 8(7): e69420. doi:10.1371/journal.pone.0069420.

16

https://mc06.manuscriptcentral.com/bcb-pubs Page 17 of 24 Biochemistry and Cell Biology

382 383 Nordquist, L., Friederich-Persson, M., Fasching, A., Liss, P., Shoji, K., Nangaku, M., 384 et al. 2015. Activation of hypoxia-inducible factors prevents diabetic 385 nephropathy. Journal of the American Society of Nephrology : JASN 26(2): 386 328-338. doi:10.1681/ASN.2013090990. 387 388 Panahi, G., Pasalar, P., Zare, M., Rizzuto, R., and Meshkani, R. 2018. High glucose 389 induces inflammatory responses in HepG2 cells via the oxidative 390 stress-mediated activation of NF-kappaB, and MAPK pathways in HepG2 391 cells. Archives of physiology and biochemistry 124(5): 468-474. 392 doi:10.1080/13813455.2018.1427764. 393 394 Patel, S., Doble, B.W., MacAulay, K., Sinclair, E.M., Drucker, D.J., and Woodgett, 395 J.R. 2008. Tissue-specific role of glycogen synthase kinase 3beta in glucose 396 homeostasis and insulin action. Molecular and cellular biology 28(20): 397 6314-6328. doi:10.1128/MCB.00763-08. 398 399 Peetz, D., Post, F., Schinzel, H., Schweigert, R., Schollmayer, C., Steinbach, K., et al. 400 2005. Glycogen phosphorylaseDraft BB in acute coronary syndromes. Clinical 401 chemistry and laboratory medicine 43(12): 1351-1358. 402 doi:10.1515/CCLM.2005.231. 403 404 Sanae, F., Kamiyama, O., Ikeda-Obatake, K., Higashi, Y., Asano, N., Adachi, I., et al. 405 2014. Effects of eugenol-reduced clove extract on glycogen phosphorylase b 406 and the development of diabetes in db/db mice. Food & function 5(2): 407 214-219. doi:10.1039/c3fo60514k. 408 409 Tang, X.Z., Guan, T., Qian, Y.S., Li, Y.M., Sun, H.B., Huang, J.H., et al. 2008. 410 Effects of maslinic acid as a novel glycogen phosphorylase inhibitor on blood 411 glucose and hepatic glycogen in mice. Chinese Journal of Natural Medicines 412 6(1): 53-56. doi: 10.1016/S1875-5364(09)60005-4. 413 414 Taylor, C.T. 2008. Mitochondria and cellular oxygen sensing in the HIF pathway. The 415 Biochemical journal 409(1): 19-26. doi:10.1042/BJ20071249. 416 417 Tracey, W.R., Treadway, J.L., Magee, W.P., Sutt, J.C., McPherson, R.K., Levy, C.B., 418 et al. 2004. Cardioprotective effects of ingliforib, a novel glycogen 419 phosphorylase inhibitor. American journal of physiology. Heart and 420 circulatory physiology 286(3): H1177-1184. doi:10.1152/ajpheart.00652.2003. 421 422 Trost, S.U., Belke, D.D., Bluhm, W.F., Meyer, M., Swanson, E., and Dillmann, W.H. 423 2002. Overexpression of the sarcoplasmic reticulum Ca(2+)-ATPase improves

17

https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 18 of 24

424 myocardial contractility in diabetic cardiomyopathy. Diabetes 51(4): 425 1166-1171. doi:10.2337/diabetes.51.4.1166. 426 427 Verleysdonk, S., Kistner, S., Pfeiffer-Guglielmi, B., Wellard, J., Lupescu, A., Laske, 428 J., et al. 2005. Glycogen metabolism in rat ependymal primary cultures: 429 regulation by serotonin. Brain research 1060(1-2): 89-99. 430 doi:10.1016/j.brainres.2005.08.045. 431 432 Wen, X., Sun, H., Liu, J., Cheng, K., Zhang, P., Zhang, L., et al. 2008. Naturally 433 occurring pentacyclic triterpenes as inhibitors of glycogen phosphorylase: 434 synthesis, structure-activity relationships, and X-ray crystallographic studies. 435 Journal of medicinal chemistry 51(12): 3540-3554. doi:10.1021/jm8000949. 436 437

Draft

18

https://mc06.manuscriptcentral.com/bcb-pubs Page 19 of 24 Biochemistry and Cell Biology

439 Figure captions

440 Fig. 1. Inhibition of pygb attenuates apoptosis in H9c2 cardiomyocytes after high glucose exposure. (A)

441 Chemical structures of asiatic acid and maslinic acid. (B) Nuclear condensation and morphology was

442 visualized by Hoechest 33258 staining (up), and ROS production was detected by DCF fluorescence

443 (down). (C) Protein levels of pygb, cleaved caspase-9, Bax, Bcl-2 and GAPDH were detected by

444 Western blot. (D-F) Semiquantitative analyses of pygb, cleaved caspase-9 and Bax/Bcl-2 ratio were

445 performed by calculating the density of the Western blot bands. (G) The SOD activity and (H) MDA

446 content were determined with the treatment of pygb siRNAs. Values presented are the mean ± SD. *P

447 < 0.05; **P < 0.01. 448 Fig. 2. Inhibition of pygb improves glucoseDraft metabolism in H9c2 cells. The effect of pygb inhibitors 449 asiatic acid (AA) and maslinic acid (MA) on (A) glycogen content, (B) glucose consumption and (C)

450 GLUT4 protein levels were measured under normal and high glucose conditions. The effect of pygb

451 siRNAs on (D) glycogen content, (E) glucose consumption and (F) GLUT4 protein levels were

452 measured under normal and high glucose conditions. Values presented are the mean ± SD. *P < 0.05;

453 **P < 0.01.

454 Fig. 3. Effects of pygb on Akt/GSK-3β, NF-κB and HIF-1α signal pathways in H9c2 cells. (A) Protein

455 levels of phosphor-Akt (pAkt), total Akt (tAkt), phosphor-GSK-3β (pGSK-3β), total GSK-3β

456 (tGSK-3β), phosphor-NF-κB p65 (pNF-κB p65), total NF-κB p65 (tNF-κB p65), HIF-1α and GAPDH

457 were detected by Western blot under normal and high glucose conditions. Semiquantitative analyses of

458 (B and C) pAkt/tAkt, (D and E) pGSK--3β/tGSK-3β, (F and G) pNF-κB p65, (H and I) NF-κB p65 and

459 (J and K) HIF-1α were performed by calculating the density of the Western blot bands. Values

460 presented are the mean ± SD. *P < 0.05; **P < 0.01.

19

https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 20 of 24

461 Fig. 4. Inhibition of pygb activates HIF-1α and promotes glycogen synthesis through Akt. (A) The

462 nuclear translocation of HIF-1α was determined by immunocytochemistry. The glycogen content was

463 measured in (B) asiatic acid-treated and (C) pygb siRNA-treated H9c2 cells in the absence or presence

464 of Akt inhibitor MK2206 under high glucose conditions. Values presented are the mean ± SD. *P <

465 0.05; **P < 0.01. *P < 0.05; **P < 0.01.

Draft

20

https://mc06.manuscriptcentral.com/bcb-pubs Page 21 of 24 Biochemistry and Cell Biology

Draft

182x199mm (300 x 300 DPI)

https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 22 of 24

Draft

https://mc06.manuscriptcentral.com/bcb-pubs Page 23 of 24 Biochemistry and Cell Biology

Draft

https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 24 of 24

Draft

https://mc06.manuscriptcentral.com/bcb-pubs