The Mechanisms Underlying Autonomous Adrenocorticotropic Hormone Secretion in Cushing's Disease
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Additional Methods
Additional Methods Cell Expression Profiles The tissue-dependent gene expression dataset from the Genome Novartis Foundation contains 32 healthy major tissues, and 47 tumour samples and cell lines. The custom- designed whole-genome gene expression microarrays used on each sample targets 44775 human mRNA transcripts. Previous analysis of this dataset identified many chromo- somal regions of correlated transcription that are under the control of both tissue and parental allele-specific expression. The expression levels of TF genes across tissue sam- ples are observed to be lower than non-TF genes. This is coherent with the mechanistic explanation that the effect of a single TF molecule is amplified by transcribing many copies of mRNA from a target gene. Across all samples, the proportion of TFs rel- ative to all expressed genes is remarkably stable at ∼ 6%. In the bootstrap test for highly predictive CRMs, we resampled from this set of TFs to generate the bootstrap replicates. High variance in gene expression profiles are observed between replicates for samples with more heterogeneous composition. Therefore, we treat each replicate as an independent sample in our analysis. When analyzing expression variation in a single sample, we found that a Gaussian distributional assumption for gene expression is more suitable compared to other distributions. Smoothing and Model Fitting Since gene expression response by the target gene varies over different TF expression values in a smooth fashion, a curved function is needed to fit our gene expression data. For additive models, the partial response of the target gene to the expression of each TF is described by a smooth function. -
The Immuno-Neuroendocrine Interface
Amendment history: Erratum (December 2001) Series Introduction: The immuno-neuroendocrine interface Shlomo Melmed J Clin Invest. 2001;108(11):1563-1566. https://doi.org/10.1172/JCI14604. Perspective The CNS and the various endocrine organs are linked in a dynamic manner through networks of reciprocal interactions that allow for both long-term adaptation and short-term shifts in environmental conditions. These regulatory systems embrace the hypothalamus, the pituitary gland, and any of several target glands, including the adrenal gland and the thyroid. Because the anterior pituitary gland secretes at least six key hormones — adrenocorticotropin (ACTH), growth hormone (GH), prolactin (PRL), thyrotropin (TSH), and the gonadotropins follicle stimulating hormone and luteinizing hormone — such diverse parameters as cell integrity, stress responses, growth, development, reproduction, and energy homeostasis are all directly or indirectly under central control (1). In addition, largely because of the dominant role of the hypothalamo-pituitary-adrenal (HPA) axis, inflammation and immunity are also subject to neuroendocrine effects. The articles in this Perspective series explore some of the developmental, physiological, and molecular interactions occurring at the immuno-neuroendocrine interface. Control of pituitary function Three tiers of control subserve regulation of anterior pituitary trophic hormone secretion (2). First, the hypothalamus synthesizes and secretes releasing and inhibiting hormones, which traverse the hypothalamo-pituitary portal system and bind to specific anterior pituitary G protein−linked transmembrane […] Find the latest version: https://jci.me/14604/pdf PERSPECTIVE SERIES Neuro-immune interface Shlomo Melmed, Series Editor SERIES INTRODUCTION The immuno-neuroendocrine interface Shlomo Melmed Cedars-Sinai Research Institute, University of California Los Angeles, School of Medicine, Los Angeles, California 90048, USA. -
Mouse Anti-Human Testicular Receptor 4
Catalog Clonality, clone Reactive Reg. Product Name Quantity Applications Number (isotype) species Status mAb clone H0107B WB, ELISA, 434700 Mouse anti-human TR4 100 µg Hu, Ms, Rt RUO (Ms IgG2a) IP, IHC Mouse Anti-Human Testicular Receptor 4 Description Testicular receptor 4 (TR4, TAK1; NR2C2) is a member of the orphan nuclear receptor family. TR4 was originally cloned from lymphoblastoma Raji cells or mouse brain cDNA library. No ligand has been reported. Northern blot shows TR4 is transcribed as a 9kb mRNA in many tissues and as a 2.8kb mRNA in testis, mainly in spermatocytes. TR4 has two isoforms called TR4α1 and TR4-α2, which differ in 19 amino acids coded by two separate exons. Both products translated from 9kb transcript are ubiquitously expressed. Since TR4 binds to the same elements for the RAR-RXR or TR-RXR heterodimers, TR4 may have an inhibitory affect for retinoic-acid mediated transactivation. Nomenclature NR2C2 Genbank L27586 Origin Produced in BALB/c mouse ascites after inoculation with hybridoma of mouse myeloma cells (NS-1) and spleen cells derived from a BALB/c mouse immunized with Baculovirus-expressed recombinant human TR4 (23-52 aa). Specificity This antibody specifically recognizes human TR4 and cross reacts with mouse and rat TR4. Purification Ammonium sulfate fractionation Formulation Concentration is 1 mg/mL in physiological saline with 0.1% sodium azide as a preservative. Application Recommended Concentration* Western Blot 2 μg/mL Non reducing Western Blot Not tested ELISA 0.1 μg/mL Immunoprecipitation Determine by use Electrophoretic Mobility Shift Assay Not tested Chromatin Immunoprecipitation Not tested Immunohistochemistry 10 μg/mL *In order to obtain the best results, optimal working dilutions should be determined by each individual user. -
Role of Nuclear Receptors in Central Nervous System Development and Associated Diseases
Role of Nuclear Receptors in Central Nervous System Development and Associated Diseases The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Olivares, Ana Maria, Oscar Andrés Moreno-Ramos, and Neena B. Haider. 2015. “Role of Nuclear Receptors in Central Nervous System Development and Associated Diseases.” Journal of Experimental Neuroscience 9 (Suppl 2): 93-121. doi:10.4137/JEN.S25480. http:// dx.doi.org/10.4137/JEN.S25480. Published Version doi:10.4137/JEN.S25480 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:27320246 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Journal name: Journal of Experimental Neuroscience Journal type: Review Year: 2015 Volume: 9(S2) Role of Nuclear Receptors in Central Nervous System Running head verso: Olivares et al Development and Associated Diseases Running head recto: Nuclear receptors development and associated diseases Supplementary Issue: Molecular and Cellular Mechanisms of Neurodegeneration Ana Maria Olivares1, Oscar Andrés Moreno-Ramos2 and Neena B. Haider1 1Department of Ophthalmology, Schepens Eye Research Institute, Massachusetts Eye and Ear, Harvard Medical School, Boston, MA, USA. 2Departamento de Ciencias Biológicas, Facultad de Ciencias, Universidad de los Andes, Bogotá, Colombia. ABSTRACT: The nuclear hormone receptor (NHR) superfamily is composed of a wide range of receptors involved in a myriad of important biological processes, including development, growth, metabolism, and maintenance. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Cell-Specific Alterations in Pitx1 Regulatory Landscape Activation Caused 2 by the Loss of a Single Enhancer
bioRxiv preprint doi: https://doi.org/10.1101/2021.03.10.434611; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Cell-specific alterations in Pitx1 regulatory landscape activation caused 2 by the loss of a single enhancer 3 4 5 Raquel Rouco1,2*, Olimpia Bompadre1,2*, Antonella Rauseo1,2, Olivier Fazio3, Fabrizio Thorel3, 6 Rodrigue Peraldi1,2, Guillaume Andrey1,2 7 8 9 1Department of Genetic Medicine and Development, Faculty of Medicine, University of 10 Geneva, Geneva, Switzerland 11 2Institute of Genetics and Genomics in Geneva (iGE3), University of Geneva, Geneva, 12 Switzerland 13 3 Transgenesis Core Facility, Faculty of Medicine, University of Geneva, Geneva, Switzerland 14 15 *Authors contributed equally 16 Correspondence: [email protected] 17 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.10.434611; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 18 Abstract 19 20 Most developmental genes rely on multiple transcriptional enhancers for their accurate expression 21 during embryogenesis. Because enhancers may have partially redundant activities, the loss of one 22 of them often leads to a partial loss of gene expression and concurrent moderate phenotypic 23 outcome, if any. -
Genetic Mechanisms of Pitx1 Action in Murine Hindlimb Development
1 Genetic mechanisms of Pitx1 action in murine hindlimb development Stephen Nemec, Division of Experimental Medicine, McGill University, Montreal August 2017 A thesis submitted to McGill University in partial fulfillment of the degree of PhD © Stephen Nemec 2017 2 Table of Contents Contents Page Abstract 4 Acknowledgements 8 Abbreviations 9 Preface – Contribution to knowledge 10 Contribution of authors 11 Introduction 13 Figures 1 and 2: Basics of limb anatomy and development 13 Evolutionary origins of the limb 14 Chick embryology and the early study of the limb 16 Molecular limb development 21 Hox genes – Engines of limb development 25 The genetics of forelimb vs. hindlimb development 30 Pitx1: major regulator of HL-specific pattern 30 Tbx4 and Tbx5 – limb-type-specific Tbox paralogs 35 Tbx4, Tbx5 and developmental anomalies in humans 41 Pitx1 Tbx4 42 Purpose and Aims 45 Pitx1 directly modulates the core limb development 46 program to implement hindlimb identity Contributions 47 Abstract 48 Introduction 49 Results 51 Discussion 60 Materials and Methods 65 Figure Legends 69 Figures 74 Interlude A – From Sox9 to signaling 89 Shh signaling influences the 91 phenotype of Pitx1-/- hindlimbs Contributions 92 Abstract 93 Introduction 94 Results 96 Discussion 98 Materials and Methods 100 Figure Legends 102 Figures 104 Interlude B – Regulatory complexity and developmental constraints 110 3 Table of Contents (continued) Contents Page Regulatory integration of Hox factor action with 111 Tbox factors in limb development Contributions 112 Abstract 113 Introduction 114 Results 116 Discussion 124 Materials and Methods 128 Figure Legends 134 Figures 141 Discussion 152 Evolutionary constraints determine the 152 developmental roles of limb-type-specific genes Future Directions 156 References 159 4 Abstract In tetrapods, the forelimbs (FL) and hindlimbs (HL) emerge from the flank of the developing embryo as buds of mesenchyme sheathed in ectoderm. -
Characterization of Transcription Factor Complexes Involved in Globin Gene Regulation
Characterization of Transcription Factor Complexes involved in Globin Gene Regulation Katarzyna Ewa Kołodziej 26th March 2008 Cover: Rodota The work presented in this thesis was performed at the Department of Cell Biology at the Erasmus Univer- sity Medical Center Rotterdam. This department is member of the Medisch Genetisch Centrum Zuid-West Nederland. The research was partially supported by the Netherlandse Organizatie voor Wetenschappelijk Onderzoek (NWO) and by EU. Characterization of Transcription Factor Complexes involved in Globin Gene Regulation Karakterizering van transcriptie factor complexen betrokken bij de regulatie van globine genen PROEFSCHRIFT ter verkrijging van de graad van doctor aan de Erasmus Universiteit Rotterdam op gezag van de Rector Magnificus Prof.dr. S.W.J. Lamberts en volgens besluit van het College voor Promoties. De openbare verdediging zal plaatsvinden op woensdag 26 maart 2008 om 15.45 uur. door Katarzyna Ewa Kołodziej geboren te Wrocław, Polen Promotiecommissie Promotor: Prof.dr. F.G. Grosveld Overige laden: Prof.dr. J.N.J. Philipsen Prof.dr. J.D. Engel Dr.ir. D.N. Meijer Copromotor: Dr. J. Strouboulis Moim rodzicom & for Luc TABLE OF CONTENTS Chapter 1 : Introduction 9 Chapter 2 : Isolation of transcription factor complexes by in vivo biotinylation tagging and direct binding to streptavidin beads (Patrick Rodriguez, Harald Braun, Katarzyna E. Kolodziej, Ernie de Boer, Jennifer Campbel, Edgar Bonte, Sjaak Philipsen and John Strouboulis Methods Mol Bio. 2006; 338: 305-23 ) 33 Chapter 3 : GATA-1 forms distinct activating and repressive complexes in erythroid cells (Patrick Rodriguez, Edgar Bonte, Jeroen Krijgsveld, Katarzyna E. Kolodziej, Boris Guyot, Albert Heck, Paresh Vyas, Ernie de Boer, Frank Grosveld and John Strouboulis, EMBO J. -
Recent Advances in Understanding Corticotroph Pituitary Tumor Initiation and Progression [Version 1; Peer Review: 2 Approved] Ulrich Renner , Denis Ciato , Günter K
F1000Research 2018, 7(F1000 Faculty Rev):1354 Last updated: 17 JUL 2019 REVIEW Recent advances in understanding corticotroph pituitary tumor initiation and progression [version 1; peer review: 2 approved] Ulrich Renner , Denis Ciato , Günter K. Stalla Max Planck Institute of Psychiatry, Clinical Neuroendocrinology Group, Munich, Germany First published: 29 Aug 2018, 7(F1000 Faculty Rev):1354 ( Open Peer Review v1 https://doi.org/10.12688/f1000research.14789.1) Latest published: 29 Aug 2018, 7(F1000 Faculty Rev):1354 ( https://doi.org/10.12688/f1000research.14789.1) Reviewer Status Abstract Invited Reviewers Cushing’s disease is the most frequent form of hypercortisolism and is 1 2 caused by hypophyseal corticotroph adenomas secreting excessive amounts of adrenocorticotropic hormone. Most of the tumors develop version 1 sporadically and only a limited number of corticotroph adenomas have published been found to be associated with different neuroendocrine syndromes or 29 Aug 2018 with familial isolated pituitary adenomas. The pathogenic mechanisms of corticotroph adenomas are largely unknown, but the discovered aberrant chaperoning activity of heat shock protein 90 on the one hand and the F1000 Faculty Reviews are written by members of presence of ubiquitin-specific protease 8 mutations on the other hand the prestigious F1000 Faculty. They are partially explained the causes of their development. Corticotroph tumors commissioned and are peer reviewed before arise initially as benign microadenomas but with time form invasively publication to ensure that the final, published version growing aggressive macroadenomas which can switch to corticotroph carcinomas in extremely rare cases. The mechanisms through which is comprehensive and accessible. The reviewers corticotroph tumors escape from glucocorticoid negative feedback are still who approved the final version are listed with their poorly understood, as are the processes that trigger the progression of names and affiliations. -
Alternative Splicing in the Nuclear Receptor Superfamily Expands Gene Function to Refine Endo-Xenobiotic Metabolism S
Supplemental material to this article can be found at: http://dmd.aspetjournals.org/content/suppl/2020/01/24/dmd.119.089102.DC1 1521-009X/48/4/272–287$35.00 https://doi.org/10.1124/dmd.119.089102 DRUG METABOLISM AND DISPOSITION Drug Metab Dispos 48:272–287, April 2020 Copyright ª 2020 by The American Society for Pharmacology and Experimental Therapeutics Minireview Alternative Splicing in the Nuclear Receptor Superfamily Expands Gene Function to Refine Endo-Xenobiotic Metabolism s Andrew J. Annalora, Craig B. Marcus, and Patrick L. Iversen Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, Oregon (A.J.A., C.B.M., P.L.I.) and United States Army Research Institute for Infectious Disease, Frederick, Maryland (P.L.I.) Received August 16, 2019; accepted December 31, 2019 ABSTRACT Downloaded from The human genome encodes 48 nuclear receptor (NR) genes, whose Exon inclusion options are differentially distributed across NR translated products transform chemical signals from endo- subfamilies, suggesting group-specific conservation of resilient func- xenobiotics into pleotropic RNA transcriptional profiles that refine tionalities. A deeper understanding of this transcriptional plasticity drug metabolism. This review describes the remarkable diversifica- expands our understanding of how chemical signals are refined and tion of the 48 human NR genes, which are potentially processed into mediated by NR genes. This expanded view of the NR transcriptome over 1000 distinct mRNA transcripts by alternative splicing (AS). The informs new models of chemical toxicity, disease diagnostics, and dmd.aspetjournals.org average human NR expresses ∼21 transcripts per gene and is precision-based approaches to personalized medicine. -
Hormone Research
RECENT PROGRESS IN HORMONE RESEARCH Edited by ANTHONY R. MEANS VOLUME 58 The Human Genome and Endocrinology “Recent Progress in Hormone Research” is an annual publication of The Endocrine Society that is published under the editorial auspices of Endocrine Reviews. The Endocrine Society 8401 Connecticut Avenue, Suite 900 Chevy Chase, Maryland 20815 Copyright 2003 by The Endocrine Society All Rights Reserved The reproduction or utilization of this work in any form or in any electronic, mechanical, or other means, now known or hereafter invented, including photocopying or recording and in any information storage or retrieval system, is forbidden, except as may be expressly permitted by the 1976 Copyright Act or by permission of the publisher. ISBN 0–879225-48-4 CONTENTS Senior Author Correspondence Information v 1. A Functional Proteomics Approach to Signal Transduction 1 Paul R. Graves and Timothy A.J. Haystead 2. The Use of DNA Microarrays to Assess Clinical Samples: The Transition from Bedside to Bench to Bedside 25 John A. Copland, Peter J. Davies, Gregory L. Shipley, Christopher G. Wood, Bruce A. Luxon, and Randall J. Urban 3. Gene Expression Profiling for Prediction of Clinical Characteristics of Breast Cancer 55 Erich Huang, Mike West, and Joseph R. Nevins 4. Statistical Approach to DNA Chip Analysis 75 N.M. Svrakic, O. Nesic, M.R.K. Dasu, D. Herndon, and J.R. Perez-Polo 5. Identification of a Nuclear Factor Kappa B-dependent Gene Network 95 Bing Tian and Allan R. Brasier 6. Role of Defective Apoptosis in Type 1 Diabetes and Other Autoimmune Diseases 131 Takuma Hayashi and Denise L. -
A Three-Dimensional Organoid Model Recapitulates Tumorigenic Aspects
www.nature.com/scientificreports OPEN A three-dimensional organoid model recapitulates tumorigenic aspects and drug responses of Received: 22 June 2018 Accepted: 10 October 2018 advanced human retinoblastoma Published: xx xx xxxx Duangporn Saengwimol1, Duangnate Rojanaporn2, Vijender Chaitankar3, Pamorn Chittavanich4, Rangsima Aroonroch5, Tatpong Boontawon4, Weerin Thammachote4, Natini Jinawath4, Suradej Hongeng6 & Rossukon Kaewkhaw4 Persistent or recurrent retinoblastoma (RB) is associated with the presence of vitreous or/and subretinal seeds in advanced RB and represents a major cause of therapeutic failure. This necessitates the development of novel therapies and thus requires a model of advanced RB for testing candidate therapeutics. To this aim, we established and characterized a three-dimensional, self-organizing organoid model derived from chemotherapy-naïve tumors. The responses of organoids to drugs were determined and compared to relate organoid model to advanced RB, in terms of drug sensitivities. We found that organoids had histological features resembling retinal tumors and seeds and retained DNA copy-number alterations as well as gene and protein expression of the parental tissue. Cone signal circuitry (M/L+ cells) and glial tumor microenvironment (GFAP+ cells) were primarily present in organoids. Topotecan alone or the combined drug regimen of topotecan and melphalan efectively targeted proliferative tumor cones (RXRγ+ Ki67+) in organoids after 24-h drug exposure, blocking mitotic entry. In contrast, methotrexate showed the least efcacy against tumor cells. The drug responses of organoids were consistent with those of tumor cells in advanced disease. Patient-derived organoids enable the creation of a faithful model to use in examining novel therapeutics for RB. Retinoblastoma (RB) is a serious childhood retinal tumor that, if lef untreated, can cause death within 1–2 years.