DOCSLIB.ORG

Comprehensive Copy Number and Gene Expression Profiling of the 17Q23 Amplicon in Human Breast Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Comprehensive Copy Number and Gene Expression Profiling of the 17Q23 Amplicon in Human Breast Cancer Comprehensive copy number and gene expression profiling of the 17q23 amplicon in human breast cancer Outi Monni*†, Maarit Ba¨ rlund†‡, Spyro Mousses*, Juha Kononen*, Guido Sauter§, Mervi Heiskanen*, Paulina Paavola¶, Kristiina Avelaʈ, Yidong Chen*, Michael L. Bittner*, and Anne Kallioniemi*,** *Cancer Genetics Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, MD 20892; ‡Laboratory of Cancer Genetics, Institute of Medical Technology, University of Tampere and Tampere University Hospital, 33520 Tampere, Finland; §Institute of Pathology, University of Basel, CH-4003 Basel, Switzerland; ¶Department of Human Molecular Genetics, National Public Health Institute, 00300 Helsinki, Finland; and ʈHaartman Institute, Department of Medical Genetics, University of Helsinki and the Folkha¨lsan Institute of Genetics, 00280 Helsinki, Finland Edited by Janet D. Rowley, University of Chicago Medical Center, Chicago, IL, and approved March 2, 2001 (received for review December 8, 2000) The biological significance of DNA amplification in cancer is CGH also have been reported in tumors of the brain (12–14), thought to be due to the selection of increased expression of a lung (15, 16), bladder (17), testis (18), and liver (19), indicating single or few important genes. However, systematic surveys of the that genes located at 17q23 may contribute to the development copy number and expression of all genes within an amplified of other tumor types as well. region of the genome have not been performed. Here we have To date, five genes (RPS6KB1, RAD51C, PAT1͞APPBP2, used a combination of molecular, genomic, and microarray tech- SIGMA1B, and TBX2) have been implicated as putative target nologies to identify target genes for 17q23, a common region of genes for the 17q23 amplification (11, 20–22). In the present amplification in breast cancers with poor prognosis. Construction study, we describe a comprehensive characterization of the of a 4-Mb genomic contig made it possible to define two common 17q23 amplification in breast cancer, including molecular clon- regions of amplification in breast cancer cell lines. Analysis of 184 ing of an about 4-Mb region at 17q23 and detailed evaluation of primary breast tumors by fluorescence in situ hybridization on the amplicon structure in breast cancer cell lines and primary GENETICS tissue microarrays validated these results with the highest ampli- breast tumors. A full expression profiling of the amplified region fication frequency (12.5%) observed for the distal region. Based on was performed by using a custom-made complementary DNA GeneMap’99 information, 17 known genes and 26 expressed (cDNA) microarray containing 156 transcripts from the 17q23 sequence tags were localized to the contig. Analysis of genomic region as well as all known genes mapping to chromosome 17. sequence identified 77 additional transcripts. A comprehensive analysis of expression levels of these transcripts in six breast cancer Materials and Methods cell lines was carried out by using complementary DNA microar- Physical and Transcript Mapping. Yeast artificial chromosome rays. The expression patterns varied from one cell line to another, (YAC) clones representing the amplified region were identified and several overexpressed genes were identified. Of these, from the Whitehead Institute database (http:͞͞www- RPS6KB1, MUL, APPBP2, and TRAP240 as well as one uncharacter- genome.wi.mit.edu͞) by using mapping information from our ized expressed sequence tag were located in the two common previous study (23). Corresponding sequence tag sites (STSs) amplified regions. In summary, comprehensive analysis of the and expressed sequence tags (ESTs) were identified from the 17q23 amplicon revealed a limited number of highly expressed dbSTS and dbEST databases (http:͞͞www.ncbi.nlm.nih.gov͞), genes that may contribute to the more aggressive clinical course and their location in the YACs was confirmed by PCR. The STSs observed in breast cancer patients with 17q23-amplified tumors. and ESTs were used to screen commercially available P1 and bacterial artificial chromosome (BAC) libraries (Genome Sys- NA amplification is an important mechanism that allows tems, St. Louis; Research Genetics, Huntsville, AL) or a PAC Dcancer cells to increase expression of critical genes, such as library provided by Pieter J. De Jong (Roswell Park Institute, oncogenes and genes conferring drug resistance. In breast Buffalo, NY). New STSs were generated by clone end sequenc- cancer, several genes, such as ERBB2 (at 17q12), MYC (8q24), ing. The STS, EST, and clone end sequences were compared and CCND1 (11q13), are known to be amplified in 10–25% of against the nr and htgs databases by using the BLASTN program tumors, and their amplification is associated with advanced stage (http:͞͞www.ncbi.nlm.nih.gov͞BLAST͞) to identify genomic of the disease (1, 2). Several other regions of the genome also are clones with sequence information. All clones were hybridized to amplified in breast cancer. Efforts are underway to identify the normal metaphase chromosomes to verify their chromosomal genes affected in these amplifications and their role in breast location and in some instances fiber-fluorescence in situ hybrid- cancer development. For example, studies of the 20q12-q13 ization (FISH) was performed to confirm the clone order as amplification have implicated a number of genes with putative described (23, 24). To create a transcript map for the amplified oncogenic potential, such as AIB1, BTAK, CAS-1, and ZNF217 region, ESTs identified from the Whitehead YAC map and (3–6), indicating that multiple genes may be activated in a given amplification locus. The chromosomal region 17q23 initially was found to be This paper was submitted directly (Track II) to the PNAS office. amplified in breast cancer based on genomewide copy number Abbreviations: BAC, bacterial artificial chromosome; cDNA, complementary DNA; CGH, analysis by comparative genomic hybridization (CGH) (7). The comparative genomic hybridization; EST, expressed sequence tag; FISH, fluorescence in situ 17q23 amplification is seen in Ϸ20% of primary breast tumors hybridization; STS, sequence tag site; YAC, yeast artificial chromosome. † by CGH, and it seems to be more common in high-grade tumors O.M. and M.B. contributed equally to this work. (8, 9) and in tumors from BRCA1 or BRCA2 mutation carriers **To whom reprint requests should be addressed at: National Human Genome Research Institute, National Institutes of Health, 49 Convent Drive, Room 4B24, Bethesda, MD (10). Recently, we showed that this amplification is associated 20892-4465. E-mail: [email protected]. with poor prognosis of breast cancer patients (11), suggesting The publication costs of this article were defrayed in part by page charge payment. This that genes affected by this amplification may have a crucial role article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. in breast cancer progression. Copy number gains at 17q23 by §1734 solely to indicate this fact. www.pnas.org͞cgi͞doi͞10.1073͞pnas.091582298 PNAS ͉ May 8, 2001 ͉ vol. 98 ͉ no. 10 ͉ 5711–5716 Downloaded by guest on September 24, 2021 GeneMap’99 (http:͞͞www.ncbi.nlm.nih.gov͞genemap) were lo- cancer cell lines and normal placental reference was digested for calized to the contig by PCR. All primer sequences, PCR 14–18 h with AluI and RsaI restriction enzymes (Life Technol- conditions, and genomic clone information are available on ogies, Rockville, MD) and purified by phenol͞chloroform ex- request. traction. Six micrograms of digested cell line DNA was labeled with Cy3-dUTP (Amersham Pharmacia) and 8 ␮g of placental Breast Cancer Cell Lines. Seven breast cancer cell lines (BT-474, DNA with Cy5-dUTP (Amersham Pharmacia) by using a HCC1428, MCF7, MDA-157, MDA-361, MDA-436, and Bioprime Labeling kit (Life Technologies). Hybridization was UACC-893; American Type Culture Collection) were used in done according to the protocol by Pollack et al. (28), and this study. Normal human mammary epithelial cells were ob- posthybridization washes were as described (29, 30). For the tained from Clonetics (Walkersville, MD). Cells were grown expression analyses, total RNA (MDA-361 and UACC-893) or under recommended culture conditions. mRNA (BT-474, HCC1428, MCF7, MDA-157, MDA-436, and human mammary epithelial cells) was extracted by using a Tissue Microarray. The tissue microarray used in this study has FASTTRACK 2.0 kit (Invitrogen). The breast cancer cell line been described (25) and included 372 ethanol-fixed primary MDA-436 with no copy number increase at 17q23 (see Results) breast cancers from the Institute of Pathology, University of was used as a standard reference in all experiments. Sixteen Basel. The tumors were 69.6% ductal, 14% lobular, 2.4% micrograms of MDA-436 mRNA was labeled with Cy5-dUTP medullary, 1.6% mucinous, 8.4% other rare histological sub- and 4 ␮g of test mRNA or 80 ␮g of total RNA with Cy3-dUTP types, and 4% ductal carcinoma in situ. The grade distribution by use of oligo(dT)-primed polymerization by SuperScript II was 24% grade 1, 40% grade 2, and 36% grade 3. All specimens reverse transcriptase (Life Technologies). The labeled cDNAs evaluated were anonymous, archival tissue specimens. The use of were hybridized on microarrays as described (29, 30). For both these tissue specimens for tissue microarray analysis was ap- the copy number and expression analyses, the fluorescence proved by the National Institutes of Health Institutional Review intensities at the targets were measured by using a laser confocal Board. scanner (Agilent Technologies, Palo Alto, CA). The fluorescent images from the test and control hybridizations were scanned FISH. Dual-color interphase FISH to breast cancer cell lines was separately, and the data were analyzed by using DEARRAY done as described (23). Probes were labeled with Spectrum- software (31). After background subtraction, average intensities Orange (Vysis, Downers Grove, IL) by random priming, and a at each spot in the test hybridization were divided by the average SpectrumGreen-labeled chromosome 17 centromere probe (Vy- intensity of the same spot in the control hybridization.
Load more

Recommended publications
  • Seq2pathway Vignette
    seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Novel and Highly Recurrent Chromosomal Alterations in Se´Zary Syndrome
    Research Article Novel and Highly Recurrent Chromosomal Alterations in Se´zary Syndrome Maarten H. Vermeer,1 Remco van Doorn,1 Remco Dijkman,1 Xin Mao,3 Sean Whittaker,3 Pieter C. van Voorst Vader,4 Marie-Jeanne P. Gerritsen,5 Marie-Louise Geerts,6 Sylke Gellrich,7 Ola So¨derberg,8 Karl-Johan Leuchowius,8 Ulf Landegren,8 Jacoba J. Out-Luiting,1 Jeroen Knijnenburg,2 Marije IJszenga,2 Karoly Szuhai,2 Rein Willemze,1 and Cornelis P. Tensen1 Departments of 1Dermatology and 2Molecular Cell Biology, Leiden University Medical Center, Leiden, the Netherlands; 3Department of Dermatology, St Thomas’ Hospital, King’s College, London, United Kingdom; 4Department of Dermatology, University Medical Center Groningen, Groningen, the Netherlands; 5Department of Dermatology, Radboud University Nijmegen Medical Center, Nijmegen, the Netherlands; 6Department of Dermatology, Gent University Hospital, Gent, Belgium; 7Department of Dermatology, Charite, Berlin, Germany; and 8Department of Genetics and Pathology, Rudbeck Laboratory, University of Uppsala, Uppsala, Sweden Abstract Introduction This study was designed to identify highly recurrent genetic Se´zary syndrome (Sz) is an aggressive type of cutaneous T-cell alterations typical of Se´zary syndrome (Sz), an aggressive lymphoma/leukemia of skin-homing, CD4+ memory T cells and is cutaneous T-cell lymphoma/leukemia, possibly revealing characterized by erythroderma, generalized lymphadenopathy, and pathogenetic mechanisms and novel therapeutic targets. the presence of neoplastic T cells (Se´zary cells) in the skin, lymph High-resolution array-based comparative genomic hybridiza- nodes, and peripheral blood (1). Sz has a poor prognosis, with a tion was done on malignant T cells from 20 patients. disease-specific 5-year survival of f24% (1).
    [Show full text]
  • APPBP2 Blocking Peptide (CDBP5093) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    APPBP2 blocking peptide (CDBP5093) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Antigen Description The protein encoded by this gene interacts with microtubules and is functionally associated with beta-amyloid precursor protein transport and/or processing. The beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. The encoded protein may be involved in regulating cell death. This gene has been found to be highly expressed in breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013] Immunogen 18 amino acids near the carboxy terminus of human APPBP2. Nature Synthetic Expression System N/A Species Reactivity Human, mouse, rat Conjugate Unconjugated Applications Used as a blocking peptide in immunoblotting applications. Procedure None Format Liquid Concentration 200 μg/mL Size 0.05mg Preservative None Storage -20°C ANTIGEN GENE INFORMATION Gene Name APPBP2 amyloid beta precursor protein (cytoplasmic tail) binding protein 2 [ Homo sapiens (human) ] Official Symbol APPBP2 Synonyms APPBP2; amyloid beta precursor protein (cytoplasmic tail) binding protein 2; PAT1; APP-BP2; 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved HS.84084; amyloid protein-binding protein 2; protein interacting with APP tail 1 Entrez Gene ID 10513 mRNA Refseq NM_001282476 Protein Refseq NP_001269405 UniProt ID Q92624 Pathway Regulation of Androgen receptor activity Function microtubule motor activity; protein binding 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 2 © Creative Diagnostics All Rights Reserved.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Chromatin Conformation Links Distal Target Genes to CKD Loci
    BASIC RESEARCH www.jasn.org Chromatin Conformation Links Distal Target Genes to CKD Loci Maarten M. Brandt,1 Claartje A. Meddens,2,3 Laura Louzao-Martinez,4 Noortje A.M. van den Dungen,5,6 Nico R. Lansu,2,3,6 Edward E.S. Nieuwenhuis,2 Dirk J. Duncker,1 Marianne C. Verhaar,4 Jaap A. Joles,4 Michal Mokry,2,3,6 and Caroline Cheng1,4 1Experimental Cardiology, Department of Cardiology, Thoraxcenter Erasmus University Medical Center, Rotterdam, The Netherlands; and 2Department of Pediatrics, Wilhelmina Children’s Hospital, 3Regenerative Medicine Center Utrecht, Department of Pediatrics, 4Department of Nephrology and Hypertension, Division of Internal Medicine and Dermatology, 5Department of Cardiology, Division Heart and Lungs, and 6Epigenomics Facility, Department of Cardiology, University Medical Center Utrecht, Utrecht, The Netherlands ABSTRACT Genome-wide association studies (GWASs) have identified many genetic risk factors for CKD. However, linking common variants to genes that are causal for CKD etiology remains challenging. By adapting self-transcribing active regulatory region sequencing, we evaluated the effect of genetic variation on DNA regulatory elements (DREs). Variants in linkage with the CKD-associated single-nucleotide polymorphism rs11959928 were shown to affect DRE function, illustrating that genes regulated by DREs colocalizing with CKD-associated variation can be dysregulated and therefore, considered as CKD candidate genes. To identify target genes of these DREs, we used circular chro- mosome conformation capture (4C) sequencing on glomerular endothelial cells and renal tubular epithelial cells. Our 4C analyses revealed interactions of CKD-associated susceptibility regions with the transcriptional start sites of 304 target genes. Overlap with multiple databases confirmed that many of these target genes are involved in kidney homeostasis.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name amyloid beta precursor protein (cytoplasmic tail) binding protein 2 Gene Symbol APPBP2 Organism Human Gene Summary The protein encoded by this gene interacts with microtubules and is functionally associated with beta-amyloid precursor protein transport and/or processing. The beta-amyloid precursor protein is a cell surface protein with signal-transducing properties and it is thought to play a role in the pathogenesis of Alzheimer's disease. This gene has been found to be highly expressed in breast cancer. Multiple polyadenylation sites have been found for this gene. Gene Aliases HS.84084, KIAA0228, PAT1 RefSeq Accession No. NC_000017.10, NT_010783.15 UniGene ID Hs.84084 Ensembl Gene ID ENSG00000062725 Entrez Gene ID 10513 Assay Information Unique Assay ID qHsaCID0016219 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000083182 Amplicon Context Sequence CTGCCCAGTTGACATAAGCGTCCCTGTTGGTAAAGCTTGTAGTAAACATCAAACT GGATGTTCTCGGGCAAGGAGCGGATGTCTCGGCGGGAGCGGATGTAGTTGTCC ACGACAGCGGAGATGGCGGTGTTATAG Amplicon Length (bp) 105 Chromosome Location 17:58577814-58603254 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9998 cDNA Cq 21.3 cDNA Tm (Celsius) 84 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 37.62 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report APPBP2, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal
    [Show full text]
  • Tepzz 8Z6z54a T
    (19) TZZ ZZ_T (11) EP 2 806 054 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 26.11.2014 Bulletin 2014/48 C40B 40/06 (2006.01) C12Q 1/68 (2006.01) C40B 30/04 (2006.01) C07H 21/00 (2006.01) (21) Application number: 14175049.7 (22) Date of filing: 28.05.2009 (84) Designated Contracting States: (74) Representative: Irvine, Jonquil Claire AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HGF Limited HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL 140 London Wall PT RO SE SI SK TR London EC2Y 5DN (GB) (30) Priority: 28.05.2008 US 56827 P Remarks: •Thecomplete document including Reference Tables (62) Document number(s) of the earlier application(s) in and the Sequence Listing can be downloaded from accordance with Art. 76 EPC: the EPO website 09753364.0 / 2 291 553 •This application was filed on 30-06-2014 as a divisional application to the application mentioned (71) Applicant: Genomedx Biosciences Inc. under INID code 62. Vancouver, British Columbia V6J 1J8 (CA) •Claims filed after the date of filing of the application/ after the date of receipt of the divisional application (72) Inventor: Davicioni, Elai R.68(4) EPC). Vancouver British Columbia V6J 1J8 (CA) (54) Systems and methods for expression- based discrimination of distinct clinical disease states in prostate cancer (57) A system for expression-based discrimination of distinct clinical disease states in prostate cancer is provided that is based on the identification of sets of gene transcripts, which are characterized in that changes in expression of each gene transcript within a set of gene transcripts can be correlated with recurrent or non- recur- rent prostate cancer.
    [Show full text]
  • Phenotype Characterisation of TBX4 Mutation and Deletion Carriers with Neonatal and Paediatric Pulmonary Hypertension
    ORIGINAL ARTICLE PULMONARY HYPERTENSION AND PAEDIATRICS Phenotype characterisation of TBX4 mutation and deletion carriers with neonatal and paediatric pulmonary hypertension Csaba Galambos 1,19, Mary P. Mullen2,19, Joseph T. Shieh3, Nicolaus Schwerk4, Matthew J. Kielt5, Nicola Ullmann6, Renata Boldrini7, Irena Stucin-Gantar8, Cristina Haass9, Manish Bansal10, Pankaj B. Agrawal11, Joyce Johnson12, Donatella Peca7, Cecilia Surace7, Renato Cutrera 6, Michael W. Pauciulo13, William C. Nichols13, Matthias Griese14, Dunbar Ivy15, Steven H. Abman16, Eric D. Austin5 and Olivier Danhaive17,18 @ERSpublications TBX4 mutations and deletions are associated with abnormal distal lung development, persistent pulmonary hypertension of the newborn, paediatric pulmonary hypertension, multiple congenital anomalies and developmental disabilities http://bit.ly/2UXDrl3 Cite this article as: Galambos C, Mullen MP, Shieh JT, et al. Phenotype characterisation of TBX4 mutation and deletion carriers with neonatal and paediatric pulmonary hypertension. Eur Respir J 2019; 54: 1801965 [https://doi.org/10.1183/13993003.01965-2018]. ABSTRACT Rare variants in the T-box transcription factor 4 gene (TBX4) have recently been recognised as an emerging cause of paediatric pulmonary hypertension (PH). Their pathophysiology and contribution to persistent pulmonary hypertension in neonates (PPHN) are unknown. We sought to define the spectrum of clinical manifestations and histopathology associated with TBX4 variants in neonates and children with PH. We assessed clinical data and lung tissue in 19 children with PH, including PPHN, carrying TBX4 rare variants identified by next-generation sequencing and copy number variation arrays. Variants included six 17q23 deletions encompassing the entire TBX4 locus and neighbouring genes, and 12 likely damaging mutations. 10 infants presented with neonatal hypoxic respiratory failure and PPHN, and were subsequently discharged home.
    [Show full text]
  • Mouse Appbp2 Conditional Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Appbp2 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Appbp2 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Appbp2 gene (NCBI Reference Sequence: NM_025825 ; Ensembl: ENSMUSG00000018481 ) is located on Mouse chromosome 11. 13 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 13 (Transcript: ENSMUST00000018625). Exon 2~4 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Appbp2 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-151A16 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from about 7.92% of the coding region. The knockout of Exon 2~4 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 18147 bp, and the size of intron 4 for 3'-loxP site insertion: 4127 bp. The size of effective cKO region: ~2789 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 13 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Appbp2 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • High-Density Array Comparative Genomic Hybridization Detects Novel Copy Number Alterations in Gastric Adenocarcinoma
    ANTICANCER RESEARCH 34: 6405-6416 (2014) High-density Array Comparative Genomic Hybridization Detects Novel Copy Number Alterations in Gastric Adenocarcinoma ALINE DAMASCENO SEABRA1,2*, TAÍSSA MAÍRA THOMAZ ARAÚJO1,2*, FERNANDO AUGUSTO RODRIGUES MELLO JUNIOR1,2, DIEGO DI FELIPE ÁVILA ALCÂNTARA1,2, AMANDA PAIVA DE BARROS1,2, PAULO PIMENTEL DE ASSUMPÇÃO2, RAQUEL CARVALHO MONTENEGRO1,2, ADRIANA COSTA GUIMARÃES1,2, SAMIA DEMACHKI2, ROMMEL MARIO RODRÍGUEZ BURBANO1,2 and ANDRÉ SALIM KHAYAT1,2 1Human Cytogenetics Laboratory and 2Oncology Research Center, Federal University of Pará, Belém Pará, Brazil Abstract. Aim: To investigate frequent quantitative alterations gastric cancer is the second most frequent cancer in men and of intestinal-type gastric adenocarcinoma. Materials and the third in women (4). The state of Pará has a high Methods: We analyzed genome-wide DNA copy numbers of 22 incidence of gastric adenocarcinoma and this disease is a samples and using CytoScan® HD Array. Results: We identified public health problem, since mortality rates are above the 22 gene alterations that to the best of our knowledge have not Brazilian average (5). been described for gastric cancer, including of v-erb-b2 avian This tumor can be classified into two histological types, erythroblastic leukemia viral oncogene homolog 4 (ERBB4), intestinal and diffuse, according to Laurén (4, 6, 7). The SRY (sex determining region Y)-box 6 (SOX6), regulator of intestinal type predominates in high-risk areas, such as telomere elongation helicase 1 (RTEL1) and UDP- Brazil, and arises from precursor lesions, whereas the diffuse Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 type has a similar distribution in high- and low-risk areas and (B4GALT5).
    [Show full text]
  • Novel and Highly Recurrent Chromosomal Alterations in Se´Zary Syndrome
    Research Article Novel and Highly Recurrent Chromosomal Alterations in Se´zary Syndrome Maarten H. Vermeer,1 Remco van Doorn,1 Remco Dijkman,1 Xin Mao,3 Sean Whittaker,3 Pieter C. van Voorst Vader,4 Marie-Jeanne P. Gerritsen,5 Marie-Louise Geerts,6 Sylke Gellrich,7 Ola So¨derberg,8 Karl-Johan Leuchowius,8 Ulf Landegren,8 Jacoba J. Out-Luiting,1 Jeroen Knijnenburg,2 Marije IJszenga,2 Karoly Szuhai,2 Rein Willemze,1 and Cornelis P. Tensen1 Departments of 1Dermatology and 2Molecular Cell Biology, Leiden University Medical Center, Leiden, the Netherlands; 3Department of Dermatology, St Thomas’ Hospital, King’s College, London, United Kingdom; 4Department of Dermatology, University Medical Center Groningen, Groningen, the Netherlands; 5Department of Dermatology, Radboud University Nijmegen Medical Center, Nijmegen, the Netherlands; 6Department of Dermatology, Gent University Hospital, Gent, Belgium; 7Department of Dermatology, Charite, Berlin, Germany; and 8Department of Genetics and Pathology, Rudbeck Laboratory, University of Uppsala, Uppsala, Sweden Abstract Introduction This study was designed to identify highly recurrent genetic Se´zary syndrome (Sz) is an aggressive type of cutaneous T-cell alterations typical of Se´zary syndrome (Sz), an aggressive lymphoma/leukemia of skin-homing, CD4+ memory T cells and is cutaneous T-cell lymphoma/leukemia, possibly revealing characterized by erythroderma, generalized lymphadenopathy, and pathogenetic mechanisms and novel therapeutic targets. the presence of neoplastic T cells (Se´zary cells) in the skin, lymph High-resolution array-based comparative genomic hybridiza- nodes, and peripheral blood (1). Sz has a poor prognosis, with a tion was done on malignant T cells from 20 patients. disease-specific 5-year survival of f24% (1).
    [Show full text]