DOCSLIB.ORG

Mouse Appbp2 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Appbp2 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Appbp2 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Appbp2 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Appbp2 gene (NCBI Reference Sequence: NM_025825 ; Ensembl: ENSMUSG00000018481 ) is located on Mouse chromosome 11. 13 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 13 (Transcript: ENSMUST00000018625). Exon 2~4 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Appbp2 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-151A16 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from about 7.92% of the coding region. The knockout of Exon 2~4 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 18147 bp, and the size of intron 4 for 3'-loxP site insertion: 4127 bp. The size of effective cKO region: ~2789 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 13 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Appbp2 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(9289bp) | A(28.36% 2634) | C(20.17% 1874) | T(30.78% 2859) | G(20.69% 1922) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 7 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr11 - 85216775 85219774 3000 browser details YourSeq 1702 1209 2992 3000 98.0% chr4 + 123735357 123743574 8218 browser details YourSeq 1622 1197 3000 3000 96.6% chr17 - 36179321 36181179 1859 browser details YourSeq 1600 1194 3000 3000 95.9% chr17 - 36158198 36160068 1871 browser details YourSeq 1191 1194 2472 3000 96.4% chr6 - 92088687 92089961 1275 browser details YourSeq 749 1223 2501 3000 85.9% chr14 - 61376714 61377926 1213 browser details YourSeq 155 1383 1597 3000 85.8% chr4 - 48009062 48009275 214 browser details YourSeq 86 268 427 3000 88.3% chr12 - 108182333 108182519 187 browser details YourSeq 84 268 428 3000 90.8% chr16 + 31400103 31400466 364 browser details YourSeq 76 338 554 3000 89.7% chr14 - 7746178 7746731 554 browser details YourSeq 76 336 428 3000 92.5% chr13 + 38120232 38120333 102 browser details YourSeq 74 292 431 3000 94.1% chr11 + 29676888 29677034 147 browser details YourSeq 73 331 429 3000 92.1% chr15 + 78766238 78766345 108 browser details YourSeq 72 331 430 3000 89.3% chr11 - 50263797 50263904 108 browser details YourSeq 70 347 542 3000 90.6% chr6 + 40647531 40647822 292 browser details YourSeq 69 296 427 3000 87.3% chr19 + 5552126 5552258 133 browser details YourSeq 69 282 426 3000 83.6% chr17 + 79981855 79981991 137 browser details YourSeq 68 333 429 3000 88.8% chr11 - 118930103 118930208 106 browser details YourSeq 67 333 432 3000 90.6% chr13 - 103939084 103939193 110 browser details YourSeq 67 333 429 3000 89.6% chr11 - 54980880 54981427 548 Note: The 3000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr11 - 85210986 85213985 3000 browser details YourSeq 137 2361 2550 3000 94.3% chr11 + 3604500 3697103 92604 browser details YourSeq 126 2359 2982 3000 92.7% chr10 + 61754335 62162074 407740 browser details YourSeq 121 2374 2550 3000 93.7% chr1 - 180728888 180881884 152997 browser details YourSeq 117 2356 2538 3000 92.1% chr13 - 14167867 14586564 418698 browser details YourSeq 111 2376 2549 3000 94.5% chr11 - 87830831 88043619 212789 browser details YourSeq 106 2433 2887 3000 79.9% chr4 + 118151657 118151833 177 browser details YourSeq 90 2436 2550 3000 94.3% chr9 + 25467576 25467692 117 browser details YourSeq 86 2435 2547 3000 93.1% chr8 + 25554173 25554288 116 browser details YourSeq 81 2434 2550 3000 87.0% chr7 + 46623101 46623208 108 browser details YourSeq 78 2434 2548 3000 94.5% chr3 + 135668648 135668762 115 browser details YourSeq 78 2427 2547 3000 87.8% chr10 + 92848349 92848464 116 browser details YourSeq 77 2434 2547 3000 94.5% chr12 + 52798539 52798671 133 browser details YourSeq 76 2429 2538 3000 87.3% chr18 + 42024409 42024510 102 browser details YourSeq 75 2427 2547 3000 84.5% chr17 + 17429586 17429698 113 browser details YourSeq 75 2427 2546 3000 86.7% chr11 + 96079599 96079713 115 browser details YourSeq 74 2361 2888 3000 78.9% chrX - 103337603 103338084 482 browser details YourSeq 74 2433 2547 3000 94.2% chr13 + 53316061 53316181 121 browser details YourSeq 72 2434 2542 3000 90.6% chr2 + 154600307 154600413 107 browser details YourSeq 71 2323 2427 3000 83.4% chr2 + 156883136 156883226 91 Note: The 3000 bp section downstream of Exon 4 is BLAT searched against the genome. No significant similarity is found. Page 4 of 7 https://www.alphaknockout.com Gene and protein information: Appbp2 amyloid beta precursor protein (cytoplasmic tail) binding protein 2 [ Mus musculus (house mouse) ] Gene ID: 66884, updated on 10-Oct-2019 Gene summary Official Symbol Appbp2 provided by MGI Official Full Name amyloid beta precursor protein (cytoplasmic tail) binding protein 2 provided by MGI Primary source MGI:MGI:1914134 See related Ensembl:ENSMUSG00000018481 Gene type protein coding RefSeq status PROVISIONAL Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as PAT1; AI465480; 1300003O07Rik Expression Ubiquitous expression in ovary adult (RPKM 24.7), placenta adult (RPKM 21.7) and 28 other tissues See more Orthologs human all Genomic context Location: 11; 11 C See Appbp2 in Genome Data Viewer Exon count: 13 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 11 NC_000077.6 (85191308..85235120, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 11 NC_000077.5 (85004810..85048622, complement) Chromosome 11 - NC_000077.6 Page 5 of 7 https://www.alphaknockout.com Transcript information: This gene has 1 transcript Gene: Appbp2 ENSMUSG00000018481 Description amyloid beta precursor protein (cytoplasmic tail) binding protein 2 [Source:MGI Symbol;Acc:MGI:1914134] Gene Synonyms 1300003O07Rik, PAT1 Location Chromosome 11: 85,187,262-85,235,130 reverse strand. GRCm38:CM001004.2 About this gene This gene has 1 transcript (splice variant), 175 orthologues, 6 paralogues and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Appbp2-201 ENSMUST00000018625.9 6463 585aa ENSMUSP00000018625.9 Protein coding CCDS25193 Q9DAX9 TSL:1 GENCODE basic APPRIS P1 67.87 kb Forward strand 85.18Mb 85.20Mb 85.22Mb 85.24Mb Genes 1700125H20Rik-202 >protein coding Akirin1-ps-201 >processed pseudogene Appbp2os-202 >pseudogene (Comprehensive set... 1700125H20Rik-201 >protein coding Appbp2os-201 >lncRNA Contigs AL596183.11 > Genes < Appbp2-201protein coding (Comprehensive set... Regulatory Build 85.18Mb 85.20Mb 85.22Mb 85.24Mb Reverse strand 67.87 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding pseudogene RNA gene Page 6 of 7 https://www.alphaknockout.com Transcript: ENSMUST00000018625 < Appbp2-201protein coding Reverse strand 47.87 kb ENSMUSP00000018... Superfamily Tetratricopeptide-like helical domain superfamily SMART Tetratricopeptide repeat Pfam PF13424 PF13374 PROSITE profiles Tetratricopeptide repeat Tetratricopeptide repeat-containing domain PANTHER Amyloid protein-binding protein 2 Gene3D Tetratricopeptide-like helical domain superfamily All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend synonymous variant Scale bar 0 60 120 180 240 300 360 420 480 585 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 7 of 7.
Load more

Recommended publications
  • Seq2pathway Vignette
    seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Novel and Highly Recurrent Chromosomal Alterations in Se´Zary Syndrome
    Research Article Novel and Highly Recurrent Chromosomal Alterations in Se´zary Syndrome Maarten H. Vermeer,1 Remco van Doorn,1 Remco Dijkman,1 Xin Mao,3 Sean Whittaker,3 Pieter C. van Voorst Vader,4 Marie-Jeanne P. Gerritsen,5 Marie-Louise Geerts,6 Sylke Gellrich,7 Ola So¨derberg,8 Karl-Johan Leuchowius,8 Ulf Landegren,8 Jacoba J. Out-Luiting,1 Jeroen Knijnenburg,2 Marije IJszenga,2 Karoly Szuhai,2 Rein Willemze,1 and Cornelis P. Tensen1 Departments of 1Dermatology and 2Molecular Cell Biology, Leiden University Medical Center, Leiden, the Netherlands; 3Department of Dermatology, St Thomas’ Hospital, King’s College, London, United Kingdom; 4Department of Dermatology, University Medical Center Groningen, Groningen, the Netherlands; 5Department of Dermatology, Radboud University Nijmegen Medical Center, Nijmegen, the Netherlands; 6Department of Dermatology, Gent University Hospital, Gent, Belgium; 7Department of Dermatology, Charite, Berlin, Germany; and 8Department of Genetics and Pathology, Rudbeck Laboratory, University of Uppsala, Uppsala, Sweden Abstract Introduction This study was designed to identify highly recurrent genetic Se´zary syndrome (Sz) is an aggressive type of cutaneous T-cell alterations typical of Se´zary syndrome (Sz), an aggressive lymphoma/leukemia of skin-homing, CD4+ memory T cells and is cutaneous T-cell lymphoma/leukemia, possibly revealing characterized by erythroderma, generalized lymphadenopathy, and pathogenetic mechanisms and novel therapeutic targets. the presence of neoplastic T cells (Se´zary cells) in the skin, lymph High-resolution array-based comparative genomic hybridiza- nodes, and peripheral blood (1). Sz has a poor prognosis, with a tion was done on malignant T cells from 20 patients. disease-specific 5-year survival of f24% (1).
    [Show full text]
  • APPBP2 Blocking Peptide (CDBP5093) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    APPBP2 blocking peptide (CDBP5093) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Antigen Description The protein encoded by this gene interacts with microtubules and is functionally associated with beta-amyloid precursor protein transport and/or processing. The beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. The encoded protein may be involved in regulating cell death. This gene has been found to be highly expressed in breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013] Immunogen 18 amino acids near the carboxy terminus of human APPBP2. Nature Synthetic Expression System N/A Species Reactivity Human, mouse, rat Conjugate Unconjugated Applications Used as a blocking peptide in immunoblotting applications. Procedure None Format Liquid Concentration 200 μg/mL Size 0.05mg Preservative None Storage -20°C ANTIGEN GENE INFORMATION Gene Name APPBP2 amyloid beta precursor protein (cytoplasmic tail) binding protein 2 [ Homo sapiens (human) ] Official Symbol APPBP2 Synonyms APPBP2; amyloid beta precursor protein (cytoplasmic tail) binding protein 2; PAT1; APP-BP2; 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved HS.84084; amyloid protein-binding protein 2; protein interacting with APP tail 1 Entrez Gene ID 10513 mRNA Refseq NM_001282476 Protein Refseq NP_001269405 UniProt ID Q92624 Pathway Regulation of Androgen receptor activity Function microtubule motor activity; protein binding 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 2 © Creative Diagnostics All Rights Reserved.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Chromatin Conformation Links Distal Target Genes to CKD Loci
    BASIC RESEARCH www.jasn.org Chromatin Conformation Links Distal Target Genes to CKD Loci Maarten M. Brandt,1 Claartje A. Meddens,2,3 Laura Louzao-Martinez,4 Noortje A.M. van den Dungen,5,6 Nico R. Lansu,2,3,6 Edward E.S. Nieuwenhuis,2 Dirk J. Duncker,1 Marianne C. Verhaar,4 Jaap A. Joles,4 Michal Mokry,2,3,6 and Caroline Cheng1,4 1Experimental Cardiology, Department of Cardiology, Thoraxcenter Erasmus University Medical Center, Rotterdam, The Netherlands; and 2Department of Pediatrics, Wilhelmina Children’s Hospital, 3Regenerative Medicine Center Utrecht, Department of Pediatrics, 4Department of Nephrology and Hypertension, Division of Internal Medicine and Dermatology, 5Department of Cardiology, Division Heart and Lungs, and 6Epigenomics Facility, Department of Cardiology, University Medical Center Utrecht, Utrecht, The Netherlands ABSTRACT Genome-wide association studies (GWASs) have identified many genetic risk factors for CKD. However, linking common variants to genes that are causal for CKD etiology remains challenging. By adapting self-transcribing active regulatory region sequencing, we evaluated the effect of genetic variation on DNA regulatory elements (DREs). Variants in linkage with the CKD-associated single-nucleotide polymorphism rs11959928 were shown to affect DRE function, illustrating that genes regulated by DREs colocalizing with CKD-associated variation can be dysregulated and therefore, considered as CKD candidate genes. To identify target genes of these DREs, we used circular chro- mosome conformation capture (4C) sequencing on glomerular endothelial cells and renal tubular epithelial cells. Our 4C analyses revealed interactions of CKD-associated susceptibility regions with the transcriptional start sites of 304 target genes. Overlap with multiple databases confirmed that many of these target genes are involved in kidney homeostasis.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name amyloid beta precursor protein (cytoplasmic tail) binding protein 2 Gene Symbol APPBP2 Organism Human Gene Summary The protein encoded by this gene interacts with microtubules and is functionally associated with beta-amyloid precursor protein transport and/or processing. The beta-amyloid precursor protein is a cell surface protein with signal-transducing properties and it is thought to play a role in the pathogenesis of Alzheimer's disease. This gene has been found to be highly expressed in breast cancer. Multiple polyadenylation sites have been found for this gene. Gene Aliases HS.84084, KIAA0228, PAT1 RefSeq Accession No. NC_000017.10, NT_010783.15 UniGene ID Hs.84084 Ensembl Gene ID ENSG00000062725 Entrez Gene ID 10513 Assay Information Unique Assay ID qHsaCID0016219 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000083182 Amplicon Context Sequence CTGCCCAGTTGACATAAGCGTCCCTGTTGGTAAAGCTTGTAGTAAACATCAAACT GGATGTTCTCGGGCAAGGAGCGGATGTCTCGGCGGGAGCGGATGTAGTTGTCC ACGACAGCGGAGATGGCGGTGTTATAG Amplicon Length (bp) 105 Chromosome Location 17:58577814-58603254 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9998 cDNA Cq 21.3 cDNA Tm (Celsius) 84 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 37.62 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report APPBP2, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal
    [Show full text]
  • Tepzz 8Z6z54a T
    (19) TZZ ZZ_T (11) EP 2 806 054 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 26.11.2014 Bulletin 2014/48 C40B 40/06 (2006.01) C12Q 1/68 (2006.01) C40B 30/04 (2006.01) C07H 21/00 (2006.01) (21) Application number: 14175049.7 (22) Date of filing: 28.05.2009 (84) Designated Contracting States: (74) Representative: Irvine, Jonquil Claire AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HGF Limited HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL 140 London Wall PT RO SE SI SK TR London EC2Y 5DN (GB) (30) Priority: 28.05.2008 US 56827 P Remarks: •Thecomplete document including Reference Tables (62) Document number(s) of the earlier application(s) in and the Sequence Listing can be downloaded from accordance with Art. 76 EPC: the EPO website 09753364.0 / 2 291 553 •This application was filed on 30-06-2014 as a divisional application to the application mentioned (71) Applicant: Genomedx Biosciences Inc. under INID code 62. Vancouver, British Columbia V6J 1J8 (CA) •Claims filed after the date of filing of the application/ after the date of receipt of the divisional application (72) Inventor: Davicioni, Elai R.68(4) EPC). Vancouver British Columbia V6J 1J8 (CA) (54) Systems and methods for expression- based discrimination of distinct clinical disease states in prostate cancer (57) A system for expression-based discrimination of distinct clinical disease states in prostate cancer is provided that is based on the identification of sets of gene transcripts, which are characterized in that changes in expression of each gene transcript within a set of gene transcripts can be correlated with recurrent or non- recur- rent prostate cancer.
    [Show full text]
  • Phenotype Characterisation of TBX4 Mutation and Deletion Carriers with Neonatal and Paediatric Pulmonary Hypertension
    ORIGINAL ARTICLE PULMONARY HYPERTENSION AND PAEDIATRICS Phenotype characterisation of TBX4 mutation and deletion carriers with neonatal and paediatric pulmonary hypertension Csaba Galambos 1,19, Mary P. Mullen2,19, Joseph T. Shieh3, Nicolaus Schwerk4, Matthew J. Kielt5, Nicola Ullmann6, Renata Boldrini7, Irena Stucin-Gantar8, Cristina Haass9, Manish Bansal10, Pankaj B. Agrawal11, Joyce Johnson12, Donatella Peca7, Cecilia Surace7, Renato Cutrera 6, Michael W. Pauciulo13, William C. Nichols13, Matthias Griese14, Dunbar Ivy15, Steven H. Abman16, Eric D. Austin5 and Olivier Danhaive17,18 @ERSpublications TBX4 mutations and deletions are associated with abnormal distal lung development, persistent pulmonary hypertension of the newborn, paediatric pulmonary hypertension, multiple congenital anomalies and developmental disabilities http://bit.ly/2UXDrl3 Cite this article as: Galambos C, Mullen MP, Shieh JT, et al. Phenotype characterisation of TBX4 mutation and deletion carriers with neonatal and paediatric pulmonary hypertension. Eur Respir J 2019; 54: 1801965 [https://doi.org/10.1183/13993003.01965-2018]. ABSTRACT Rare variants in the T-box transcription factor 4 gene (TBX4) have recently been recognised as an emerging cause of paediatric pulmonary hypertension (PH). Their pathophysiology and contribution to persistent pulmonary hypertension in neonates (PPHN) are unknown. We sought to define the spectrum of clinical manifestations and histopathology associated with TBX4 variants in neonates and children with PH. We assessed clinical data and lung tissue in 19 children with PH, including PPHN, carrying TBX4 rare variants identified by next-generation sequencing and copy number variation arrays. Variants included six 17q23 deletions encompassing the entire TBX4 locus and neighbouring genes, and 12 likely damaging mutations. 10 infants presented with neonatal hypoxic respiratory failure and PPHN, and were subsequently discharged home.
    [Show full text]
  • High-Density Array Comparative Genomic Hybridization Detects Novel Copy Number Alterations in Gastric Adenocarcinoma
    ANTICANCER RESEARCH 34: 6405-6416 (2014) High-density Array Comparative Genomic Hybridization Detects Novel Copy Number Alterations in Gastric Adenocarcinoma ALINE DAMASCENO SEABRA1,2*, TAÍSSA MAÍRA THOMAZ ARAÚJO1,2*, FERNANDO AUGUSTO RODRIGUES MELLO JUNIOR1,2, DIEGO DI FELIPE ÁVILA ALCÂNTARA1,2, AMANDA PAIVA DE BARROS1,2, PAULO PIMENTEL DE ASSUMPÇÃO2, RAQUEL CARVALHO MONTENEGRO1,2, ADRIANA COSTA GUIMARÃES1,2, SAMIA DEMACHKI2, ROMMEL MARIO RODRÍGUEZ BURBANO1,2 and ANDRÉ SALIM KHAYAT1,2 1Human Cytogenetics Laboratory and 2Oncology Research Center, Federal University of Pará, Belém Pará, Brazil Abstract. Aim: To investigate frequent quantitative alterations gastric cancer is the second most frequent cancer in men and of intestinal-type gastric adenocarcinoma. Materials and the third in women (4). The state of Pará has a high Methods: We analyzed genome-wide DNA copy numbers of 22 incidence of gastric adenocarcinoma and this disease is a samples and using CytoScan® HD Array. Results: We identified public health problem, since mortality rates are above the 22 gene alterations that to the best of our knowledge have not Brazilian average (5). been described for gastric cancer, including of v-erb-b2 avian This tumor can be classified into two histological types, erythroblastic leukemia viral oncogene homolog 4 (ERBB4), intestinal and diffuse, according to Laurén (4, 6, 7). The SRY (sex determining region Y)-box 6 (SOX6), regulator of intestinal type predominates in high-risk areas, such as telomere elongation helicase 1 (RTEL1) and UDP- Brazil, and arises from precursor lesions, whereas the diffuse Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 type has a similar distribution in high- and low-risk areas and (B4GALT5).
    [Show full text]
  • Novel and Highly Recurrent Chromosomal Alterations in Se´Zary Syndrome
    Research Article Novel and Highly Recurrent Chromosomal Alterations in Se´zary Syndrome Maarten H. Vermeer,1 Remco van Doorn,1 Remco Dijkman,1 Xin Mao,3 Sean Whittaker,3 Pieter C. van Voorst Vader,4 Marie-Jeanne P. Gerritsen,5 Marie-Louise Geerts,6 Sylke Gellrich,7 Ola So¨derberg,8 Karl-Johan Leuchowius,8 Ulf Landegren,8 Jacoba J. Out-Luiting,1 Jeroen Knijnenburg,2 Marije IJszenga,2 Karoly Szuhai,2 Rein Willemze,1 and Cornelis P. Tensen1 Departments of 1Dermatology and 2Molecular Cell Biology, Leiden University Medical Center, Leiden, the Netherlands; 3Department of Dermatology, St Thomas’ Hospital, King’s College, London, United Kingdom; 4Department of Dermatology, University Medical Center Groningen, Groningen, the Netherlands; 5Department of Dermatology, Radboud University Nijmegen Medical Center, Nijmegen, the Netherlands; 6Department of Dermatology, Gent University Hospital, Gent, Belgium; 7Department of Dermatology, Charite, Berlin, Germany; and 8Department of Genetics and Pathology, Rudbeck Laboratory, University of Uppsala, Uppsala, Sweden Abstract Introduction This study was designed to identify highly recurrent genetic Se´zary syndrome (Sz) is an aggressive type of cutaneous T-cell alterations typical of Se´zary syndrome (Sz), an aggressive lymphoma/leukemia of skin-homing, CD4+ memory T cells and is cutaneous T-cell lymphoma/leukemia, possibly revealing characterized by erythroderma, generalized lymphadenopathy, and pathogenetic mechanisms and novel therapeutic targets. the presence of neoplastic T cells (Se´zary cells) in the skin, lymph High-resolution array-based comparative genomic hybridiza- nodes, and peripheral blood (1). Sz has a poor prognosis, with a tion was done on malignant T cells from 20 patients. disease-specific 5-year survival of f24% (1).
    [Show full text]
  • Genome-Wide Mrna and Microrna Profiling of the NCI 60 Cell-Line Screen and Comparison of Fdump[10] with Fluorouracil, Floxuridine, and Topoisomerase 1 Poisons
    Molecular Cancer Spotlight on Molecular Profiling Therapeutics Genome-Wide mRNA and microRNA Profiling of the NCI 60 Cell-Line Screen and Comparison of FdUMP[10] with Fluorouracil, Floxuridine, and Topoisomerase 1 Poisons William H. Gmeiner1, William C. Reinhold2, and Yves Pommier2 Abstract A profile of microRNA (miRNA) and mRNA expression patterns across the NCI-60 cell-line screen was analyzed to identify expression signatures that correlate with sensitivity to FdUMP[10], fluorouracil (5FU), floxuridine (FdU), topotecan, and irinotecan. Genome-wide profile analyses revealed FdUMP[10] resem- bles FdU most closely and shows dissimilarities with 5FU. FdUMP[10] had the largest dynamic range of any of these drugs across the NCI-60 indicative of cancer cell–specific activity. Genes involved in endocytosis, such as clathrin (CLTC), SNF8, annexin A6 (ANXA6), and amyloid protein-binding 2 (APPBP2) uniquely correlated with sensitivity to FdUMP[10], consistent with a protein-mediated cellular uptake of FdUMP[10]. Genes involved in nucleotide metabolism were enriched for the three fluoropyr- imidine drugs, with the expression profile for 5FU correlated to an RNA-mediated cytotoxic mechanism, whereas expression of glycosyltransferases (XYLT2) that use UDP sugars as substrates and the nucleoside diphosphatase and metastasis suppressor NM23 (NME1) were associated with FdUMP[10] sensitivity. Topotecan and irinotecan had significant negative correlations with miR-24, a miRNA with a high aggregate PCT score for topoisomerase 1 (Top1). Our results reveal significant new correlations between FdUMP[10] and Top1 poisons, as well as new information on the unique cytotoxic mechanism and genomic signature of FdUMP[10]. Mol Cancer Ther; 9(12); 3105–14.
    [Show full text]