Modification and Utilization of Carbohydrates by Streptococcus Pneumoniae

Home , Bacterial capsule, Raffinose

Modification and Utilization of Carbohydrates by Streptococcus pneumoniae

DISSERTATION

Presented in Partial Fulfillment of the Requirements for

the Degree Doctor of Philosophy in the Graduate School

of The Ohio State University

Carolyn Marion M.S.

The Integrated Biomedical Science Graduate Program

*****

The Ohio State University

2012

Dissertation Committee:

Dr. Samantha King, Advisor

Dr. Kevin Mason

Dr. Robert Munson Jr.

Dr. Larry Schlesinger

Carolyn Marion

2012

Abstract

Streptococcus pneumoniae (the pneumococcus) is responsible for over one million deaths each year worldwide. The majority of this mortality is in children and S. pneumoniae is therefore considered the greatest cause of vaccine preventable pediatric deaths.

Colonization of the airway is a necessary precursor to disease, but little is known about how the bacterium establishes and maintains colonization. Carbohydrates are required as a carbon source for growth and therefore colonization, however free sugars are not readily available in the airway. Carbohydrates are instead present in the airway as N- and

O-linked glycans. S. pneumoniae is adept at manipulating carbohydrates and produces at least ten sugar-cleaving enzymes. We have previously demonstrated the ability of S. pneumoniae to deglycosylate N-linked glycans; however it was unknown whether O- linked glycans could similarly be modified. It was known that pneumococci produced an

O-glycosidase, but unknown what gene encoded this and whether it impacted colonization. We identified eng as encoding the O-glycosidase and showed that Eng acts sequentially with neuraminidase NanA to deglycosylate O-linked glycans to release sialic acid and galactose β1-3 N-acetylgalactosamine. An eng mutant was deficient in adherence to airway epithelial cells and was reduced in airway colonization.

Deglycosylation of O-linked glycans may contribute to colonization my multiple mechanisms including mediating adherence as well as utilizing released carbohydrates

ii for growth. Sialic acid is the most common terminal modification on N- and O-linked glycans and is likely encountered frequently in the airway. We showed that sialic acid can support growth as the sole carbon source. In order to utilize liberated carbohydrates including sialic acid for nutrition, S. pneumoniae must encode a mechanism for import.

Out of three candidate transporters, we identified satABC as encoding the substrate binding protein and two permeases of an ATP binding cassette (ABC) importer that recognizes sialic acid. SatABC contributes to growth on a human glycoprotein and to airway colonization. In addition to the substrate binding protein and permeases, two

ATPases are also required for ABC transporters; however no predicted ATPase is encoded in the satABC locus. Mutation of a candidate gene encoding a predicted carbohydrate ATPase, msmK, revealed that like satABC, msmK is required for growth on sialic acid. MsmK was able to hydrolyze ATP; this suggests that MsmK energizes

SatABC. In addition to satABC there are five additional loci predicted to encode CUT1 carbohydrate ABC transporters that contain a substrate binding protein, two permeases, but lack predicted ATPases. Together, these are the only six loci in the TIGR4 genome with this arrangement, and comprise all predicted CUT1 carbohydrate transporters; thus we hypothesized that MsmK energizes all CUT1 carbohydrate ABC transporters. Indeed, msmK is required for growth on each CUT1 ABC importer substrate identified to date.

Unlike many other characterized carbohydrate ABC transporters, msmK is encoded in its own transcript although the reason for this remains unknown. A shared carbohydrate

ATPase may have implications in carbohydrate substrate preference or gene regulation

iii and creates an opportunity to gain greater understanding of carbohydrate utilization in S. pneumoniae.

To my family: Wesley, Mom, Dad, and Jessica

Acknowledgements

I am humbled by the incredible number of people that have supported me over the past five years. This has been an amazing journey and I’m indebted to all the mentors, colleagues, friends and family who have helped me along my way.

I am extraordinarily grateful to my mentor Sam without whom, I would not be the scientist I am. I hope that as I leave this lab, I carry with me Sam’s logical approach to science, articulate storytelling and highest standards. She’s helped me see that I am capable of all these things and I will continue to look up to Sam throughout my career.

Sam is only one of the amazing team with Drs. Mason, Munson and Schlesinger who have watched me grow these past five years. I am so fortunate to have had this knowledgeable dissertation committee guiding me and pushing me to achieve more than I thought was possible.

It’s difficult for me to think of anyone in the Center for Microbial Pathogenesis that hasn’t helped me in some way. Science is a team sport and I’m thankful to the CMP for all of the technical and intellectual input and for keeping me always looking forward to cake o’clock. I’m grateful to all past and present members of the King Lab, especially my

vi coauthors for making my papers better than I could on my own and to Caroline Linke,

Greg Bobulsky and Hussam Salhi whose unpublished data are included within. I also thank the Munson and White Labs for technical advice in my experimental designs, and

William Barson, Mario Marcon, and Marilyn Hribar for providing clinical isolates.

I’m lucky to have Rebecca, Jen, Dee, Matt, Katie, Laura and my sister Jessica to thank, who despite never really understanding what I do, support me endlessly. Lastly, I’m grateful to my parents John and Cathy, who have given me opportunities, confidence and love from day one, and to my husband Wesley, who makes me nicer.

This research was supported in part by The American Heart Association pre-doctoral fellowship 10PRE3490014.

vii

Vita

February 22, 1984 ………………………………… Born, Garfield Heights, Ohio

May, 2006 ………………………………………… B.S. Biology, Duquesne University

May, 2007 ………………………………………… M.S. Forensic Science and Law,

Duquesne University

June 2007 - present…………………………………Graduate Research Assistant and

Fellow, The Ohio State University

Publications

Marion C, Limoli DH, Bobulsky GS, Abraham JL, Burnaugh AM, King SJ. 2009.

Identification of a pneumococcal glycosidase that modifies O-linked glycans. Infect.

Immun. 77:1389-1396.

Marion C, Burnaugh AM, Woodiga SA, King SJ. 2011. The pneumococcal sialic acid transporter contributes to colonization. Infect. Immun. 79:1262-1269.

Marion C, Aten AE, Woodiga SW, King SJ. 2011. Identification of an ATPase, MsmK, which energizes multiple carbohydrate ABC transporters in Streptococcus pneumoniae.

Infect. Immun. 79:4193-4200.

Marion C, Stewart JM, Tazi MF, Burnaugh AM, Linke CM, Woodiga SA, King SJ.

2012. Streptococcus pneumoniae utilization of hyaluronic acid for growth. Infect.

Immun. 80:1390-1398.

viii

Fields of Study

Major Field: Integrated Biomedical Science

Area of Emphasis: Microbial Pathogenesis

Table of Contents

Page

Abstract ...... ii

Dedication ...... v

Acknowledgements ...... vi

Vita ...... viii

List of Tables ...... xiv

List of Figures ...... xv

Chapter 1: Introduction ...... 1

1.1. Background ...... 1 1.1.1. Streptococcus pneumoniae ...... 1 1.1.2. Colonization ...... 2 1.1.3. Adult disease ...... 3 1.1.4. Pediatric disease ...... 5 1.1.5. Virulence determinants ...... 6 1.1.6. Antibiotic therapy and resistance ...... 7 1.1.7. Vaccines ...... 9 1.1.7.1. Pneumococcal polysaccharide vaccine (PPSV) ...... 9 1.1.7.2. Protein conjugate vaccine (PCV) ...... 10 1.1.7.3. Vaccine limitations ...... 12 1.1.7.4. Serotype-independent vaccines ...... 13

1.2. Molecular aspects of colonization ...... 15 1.3. Host glycosylation ...... 18 1.3.1. N-linked glycans ...... 19 1.3.2. O-linked glycans ...... 20 1.3.3. Proteoglycans and glycosaminoglycans ...... 20 1.3.4. Glycolipids ...... 21 1.3.5. Bacterial mimicry...... 22

1.3.6. Sialic acids ...... 22

1.4. Pneumococcal glycosidases ...... 23 1.4.1. Glycosidases and colonization ...... 25 1.4.2. Glycosidases and disease ...... 28 1.4.3. Neuraminidases ...... 29

1.5. Utilization of carbohydrates ...... 32 1.5.1. Phosphoenolpyruvate-dependent phosphotransferase system (PTS)34 1.5.2. PTS in S. pneumoniae ...... 35 1.5.3. Carbohydrate ATP binding cassette (ABC) transporters ...... 36 1.5.4. ABC transporters in S. pneumoniae ...... 38 1.5.5. Other carbohydrate transporters ...... 39 1.5.6. Sialic acid transporters ...... 39 1.5.7. Regulation of carbohydrate import ...... 40 1.5.7.1. Gram negative CCR ...... 41 1.5.7.2. Gram positive CCR ...... 41 1.5.7.3. Carbohydrate utilization regulation in S. pneumoniae ...... 43

1.6 Project hypotheses and goals ...... 45

Chapter 2: Identification of a pneumococcal glycosidase that modifies O-linked glycans ...... 47

2.1. Introduction ...... 48

2.2. Materials and Methods ...... 51 2.2.1. Bacterial strains, culture media, and chemicals ...... 51 2.2.2. Mutation of glycosidases ...... 53 2.2.3. O-glycosidase activity ...... 55 2.2.4. Deglycosylation of O-linked glycans...... 56 2.2.5. Adherence of S. pneumoniae to human epithelial cells ...... 57 2.2.6. Mouse model of pneumococcal colonization ...... 57 2.2.7. Statistical analysis ...... 58

2.3. Results ...... 58 2.3.1. Analysis of the pneumococcal genome identified a putative O-glycosidase ...... 58 2.3.2. SP0368 encodes an S. pneumoniae O-glycosidase ...... 60 2.3.3. NanA and Eng sequentially deglycosylate O-linked glycans ...... 62 2.3.4. Eng contributes to pneumococcal adherence and colonization ...... 66

2.4. Discussion ...... 68

Chapter 3: Sialic acid transport contributes to pneumococcal colonization ...... 73

3.1. Introduction ...... 74

3.2. Materials and Methods ...... 76 3.2.1. Bacterial strains, culture media and chemicals ...... 76 3.2.2. Construction of mutants ...... 76 3.2.3. RNA extraction and reverse transcriptase PCR ...... 81 3.2.4. Dialysis of human alpha-1 glycoprotein (AGP) ...... 82 3.2.5. Growth assays ...... 83 3.2.6. Neuraminidase activity assay ...... 84 3.2.7. Southern blot ...... 85 3.2.8. Sialic acid transport assay ...... 85 3.2.9. Murine colonization ...... 86

3.3. Results ...... 86 3.3.1. S. pneumoniae can utilize sialic acid as a sole carbon source ...... 86 3.3.2. Proposed pneumococcal sialic acid transporters...... 87 3.3.3. SP1681-3 (satABC) is required for growth on sialic acid ...... 89 3.3.4. satABC is required for transport of sialic acid ...... 91 3.3.5. The SP1328 predicted symporter does not contribute to sialic acid transport ...... 94 3.3.6. satABC contributes to growth on human glycoprotein ...... 94 3.3.7. satABC contributes to airway colonization ...... 97

3.4. Discussion ...... 99

Chapter 4: Identification of an ATPase, MsmK, which energizes multiple carbohydrate ABC transporters in Streptococcus pneumoniae ...... 103

4.1. Introduction ...... 104

4.2. Materials and Methods ...... 106 4.2.1 Bacterial strains, culture media and chemicals ...... 106 4.2.2. Construction of mutants ...... 108 4.2.3. Growth assays ...... 111 4.2.4. Sialic acid transport assays ...... 112 4.2.5. Cloning and expression of recombinant MsmK (rMsmK) ...... 113 4.2.6. ATPase assay ...... 114 4.2.7. RNA extraction and reverse transcriptase PCR (RT-PCR) ...... 115 4.2.8. Murine colonization ...... 116

4.3. Results ...... 117 4.3.1. msmK is required for growth on sialic acid ...... 117

xii

4.3.2. msmK is required for transport of sialic acid ...... 118 4.3.3. MsmK is an ATPase ...... 120 4.3.4. msmK contributes to growth on multiple carbohydrates...... 120 4.3.5. msmK expression is increased in the presence of multiple carbohydrates ...... 123 4.3.6. msmK contributes to airway colonization ...... 125

4.4. Discussion ...... 128

Chapter 5: Discussion ...... 133

5.1. Does maintenance of so many carbohydrate transporters benefit S. pneumoniae colonization and pathogenesis? ...... 134

5.2. Why do pneumococci ferment such diverse carbohydrates? ...... 138

5.3. Are multiple transporters examples of redundancy? ...... 141

5.4. Why share an ATPase amongst the CUT1 ABC transporters? ...... 144 5.4.1. Genome conservation...... 146 5.4.2. Regulation ...... 147

5.5. Could carbon acquisition ever be a target for vaccine or therapy development? ...... 149

5.6. Concluding remarks ...... 151

References ...... 152

xiii

List of Tables

Table Page

1.1 Surface glycosidases of S. pneumoniae ...... 24

2.1 Strains used in this study...... 52

2.2 Primers used in this study ...... 54

3.1 Strains used in this study...... 77

3.2 Primers used in this study ...... 79

4.1 Strains used in this study...... 107

4.2 Primers used in this study ...... 109

4.3 Gene expression fold change compared to glucose-grown bacteria ...... 126

xiv

List of Figures

Figure Page

1.1 ABC transport and PTS are the primary carbohydrate import mechanisms in S.

pneumoniae ...... 33

2.1 Schematic representation of the core-1 O-linked glycan structure commonly found on

glycoconjugates...... 50

2.2 O-glycosidase activity is cell associated in a sortase-dependent manner ...... 59

2.3 SP0368 encodes the pneumococcal O-glycosidase (Eng) ...... 61

2.4 Levels of O-glycosidase activity differ between strains ...... 63

2.5 Neuraminidase and O-glycosidase sequentially deglycosylate fetuin ...... 64

2.6 Relative adherence of an eng mutant to human epithelial cells is reduced ...... 67

3.1 Sialic acid supports S. pneumoniae growth ...... 88

3.2 Schematic of regions encoding known and putative neuraminidases and transporters

as found in S. pneumoniae strain TIGR4 ...... 90

3.3 satABC (SP1681-3) is required for efficient growth on sialic acid ...... 92

3.4 satABC is required for transport of sialic acid ...... 93

3.5 satABC contributes to growth on a human glycoprotein ...... 96

3.6 satABC contributes to pneumococcal colonization...... 98

4.1 msmK contributes to growth on and transport of sialic acid ...... 119

4.2 MsmK is an ATPase ...... 121

4.3 Schematic of regions encoding known and putative carbohydrate ABC transporter

components in S. pneumoniae strain TIGR4 ...... 122

4.4 msmK is required for growth on raffinose and maltotetraose ...... 124

4.5 Expression of msmK in different carbohydrate substrates ...... 126

4.6 msmK contributes to pneumococcal colonization ...... 127

xvi

Chapter 1: Introduction

1.1. Background

1.1.1. Streptococcus pneumoniae. Streptococcus pneumoniae (the pneumococcus, previously Diplococcus pneumoniae) is an aerotolerant Gram-positive opportunistic pathogen with profound historical and modern-day significance. S. pneumoniae was integral in the development of modern molecular genetics. In one of two sets of classic experiments, Griffith showed in 1928 that transformation of an avirulent to virulent mouse phenotype was achievable through the mixing of avirulent bacteria with heat killed virulent bacteria (113). It was not until 1944 in another famous experiment that

Avery, MacLeod and McCarty would prove that DNA was the cellular material which allowed for phenotypic transformation (20). Over half of a century later the S. pneumoniae genome would be sequenced, revealing that it contained approximately two million base pairs and 2000 open reading frames (300). The pneumococci are incredibly diverse; two multi-genome analyses have characterized the pneumococcal core genome as containing 73-4% of the genome and between 1553-1666 genes (91, 225). S. pneumoniae is closely related to Mitis group streptococci including Streptococcus mitis, and Streptococcus oralis. The genetic differences underlying the ability of S. pneumoniae but not S. mitis or S. oralis to cause frequent disease are of great interest and yet

1 unknown. In fact, besides capsule, relatively few gene products seem to be unique to S. pneumoniae (86, 91, 148, 184).

The capsule of S. pneumoniae is one of the most important factors for survival in the host and 93 protective polysaccharide capsules are now known to exist (41, 234, 344, 345). Of the 93 identified to date, 11 capsules are associated with 70% percent of invasive disease

(147). This classification can be misleading though, because owing to the natural ability of S. pneumoniae to undergo genetic transformation, capsule switching allows for two genetically related virulent strains to appear very different upon recombination of the capsule locus. An alternate method of classification relies instead on allele sequencing of housekeeping genes through multi locus sequence typing (MLST) (96, 185). This typing scheme provides a better representation of relatedness between species as evolution of these loci is theoretically lower. Even taking all of this information into account, the pan- genome study conducted by Donati et al. consisting of 44 sequenced pneumococcal isolates failed to draw any relationships between ancestral evolution, MLST, serotype, site of isolation or disease caused (91). This goes to highlight the incredible range of pneumococcal variation and the challenges posed to combating this opportunistic pathogen.

1.1.2. Colonization. It is generally thought that pneumococcus will colonize the nasopharynx asymptomatically until opportunity arises in the local environment that allows for bacterial spread. A person can be colonized by more than one strain at the

2 same time without consequence and while the majority of children are colonized, by adulthood colonization is much less common (50, 61, 101). In this respect, in the majority of healthy people S. pneumoniae exists as an undetectable component of the nasal flora.

Local or global immune inhibition caused by young or old age, underlying disease, or viral comorbidity permits uncontrolled division and spread of the bacterium to normally sterile sites to cause disease (230). However, there is no evidence that severe disease offers S. pneumoniae increased opportunity for transmission, it is more likely that it is instead a byproduct of reduced immune protection in its colonizing environment (331).

The fact that most surface proteins or putative virulence determinants of S. pneumoniae are also present in the avirulent Streptococcus mitis demonstrates the poor likelihood that any of these factors are sufficient for virulence and are more likely important for successful colonization (91). Despite this, S. pneumoniae remains a devastating killer especially of children and the elderly.

1.1.3. Adult disease. S. pneumoniae can cause serious invasive diseases in adults

(defined by the identification of S. pneumoniae in normally sterile sites including the bloodstream and cerebrospinal fluid). Diseases like bacteremia, meningitis, endocarditis and bacteremic pneumonia contribute to morbidity and mortality and estimated 2010 invasive pneumococcal disease (IPD) rates in the US for all populations remained at 12.9 per 100,000; the rate increases significantly to 42 per 100,000 when only adults over 65 are considered (64). Of particular importance, S. pneumoniae is considered to be the leading cause of community acquired pneumonia. Estimations of etiology are imprecise

3 as culture identification is not routine; however a recent study in the Netherlands relying on detection of anti-pneumococcal antibody to assess community acquired pneumonia etiology found that 54% of the cases were directly attributable to S. pneumoniae (312).

Based on the best information available it is thought that greater than 500,000 cases of non-bacteremic pneumonia occur in the >50 population each year in the United States

(334). In total, pneumococcal disease results in greater than $5 billion in direct and indirect healthcare costs annually (334).

Many risk factors increase the likelihood that an adult will contract pneumococcal disease with most of these altering the airway environment or the immune system; however, some risk factors like male gender and black race are less well understood (64, 257).

Chronic disease of the heart, lung, liver, kidney, alcoholism, presence of hematologic and solid-organ malignancies all increase rates of invasive pneumococcal disease (213, 257,

319, 338). Furthermore any inhibition of the primary immune system, including asplenia or complement deficiencies increase disease risk (243). Smoking and asthma both affect the local lung environment and increase one’s risk for pneumococcal infection (220,

296).

Pneumococcal pneumonia is often associated with other microbial comorbidities. For example, it is now appreciated that during the Spanish flu epidemic of 1918 the majority of deaths were attributable not to influenza infection directly, but rather pneumonia caused by secondary pneumococcal infections (51). Secondary pneumococcal infection

4 also contributes significantly to mortality during seasonal and pandemic influenza outbreaks (160). Additionally, even with aggressive antiretroviral therapies and both pediatric and adult vaccine administration, HIV-positive individuals have a substantial risk of S. pneumoniae infection and mortality (53, 281).

1.1.4. Pediatric disease. Most pneumococcal deaths are of children and therefore S. pneumoniae is globally considered the single greatest cause of vaccine-preventable child deaths. Infectious diseases were responsible for nearly six million or 68% of child deaths in 2008 (38). An estimated 700,000 HIV-negative children under the age of five die each year from pneumococcal infections which highlights the role of S. pneumoniae as a devastating killer of children (222). Most of these children have succumbed to serious, non-bacteremic pneumonia (5, 222). This excessive mortality in the pediatric population is considered unacceptable and steps are being taken to improve the global situation. As such, the WHO advocates for increased global pneumococcal vaccination, with a goal of all children receiving a three-dose vaccine regimen during the first year of life. As of

2010, 55 countries have introduced widespread use of the pneumococcal vaccine, but this represents only 17% of the birth cohort (1, 2). This leaves tremendous room for improvement for prevention of mortality in children under five years of age.

In addition to life-threatening childhood disease, S. pneumoniae is also a major causative agent of otitis media. Along with Moraxella catarrhalis and Nontypeable Haemophilus influenzae, S. pneumoniae contributes to otitis media-related healthcare costs in the US

5 that exceed $3.5 billion annually (223). Otitis media is the primary cause for doctor visits and antibiotic prescription in children (264). Although theoretically curable through oral antibiotics, usage of prescription drugs for treatment of otitis media is questioned due to concerns with the potential contribution to antibiotic resistance and the limited ability to shorten disease duration and severity.

1.1.5. Virulence determinants. There are many gene products besides capsule in S. pneumoniae to which special attention is paid regarding their role in pathogenesis.

Although it is unlikely that the identified virulence determinants have evolved especially for this purpose, it remains important to recognize the roles and relationships between these factors and pathogenesis.

Pneumolysin (Ply) falls into the large class of cholesterol-dependent pore-forming toxins

(109). Pneumolysin is also known to activate the classical complement pathway and each of these functions contribute differently early in pneumococcal infection (238, 266).

Pneumolysin is unique amongst cholesterol-dependent cytolysins in that it lacks an N- terminal secretion signal. The prevailing hypothesis is that membrane disruption via autolysin releases cytoplasmic stores of pneumolysin, although this is disputed (21).

Autolysin (N-acetyl muramoyl-L-alanine alanine amidase, LytA) is a choline-bound membrane enzyme postulated to play an important role in membrane degradation during cell division (259). Because it can ultimately induce cell lysis, in addition to releasing cell

6 contents during stress, LytA-mediated lysis may have important implications for pneumococcal fratricide, a process by which pneumococci cause death to genetic siblings

(94, 135). Although the role of LytA remains unclear, the fact that deletion of lytA results in attenuation in vivo supports the hypothesis that LytA is important during pathogenesis

(34). Other choline binding proteins have been implicated in pathogenesis (reviewed in

(116)), including the major adhesin choline binding protein A, CbpA, and the lactoferrin- binding pneumococcal surface protein A, PspA (119, 347).

In addition to choline-binding proteins, several proteins covalently bound to the surface via sortase processing of the LPXTG motif have been demonstrated to contribute to pneumococcal pathogenesis (197). Hyaluronidase is an endoglycosidase that has been shown to degrade hyaluronic acid of the extracellular matrix and is thought to contribute to tissue invasion (33, 162, 350). Pneumococci produce an atypically sortase-localized

IgA protease which is proposed to play a role in immune evasion by cleaving at the hinge region of mucosal immunoglobulins (29, 249, 326). The role of neuraminidase NanA is discussed below (see section 1.4.3). Several sortase-processed proteins have been identified in genome-wide virulence screens and disruption of sortase A is associated with a defect in a mouse pneumonia model (126, 237, 245). Collectively, it is clear that many diverse factors affect pathogenesis in S. pneumoniae.

1.1.6. Antibiotic therapy and resistance. Several types of antibiotics are routinely used to clear pneumococcal infections including beta-lactams, macrolides, fluoroquinolone,

7 tetracycline, chloramphenicol and others. Resistance to antimicrobials was identified in the laboratory in the 1940s and worldwide in patients in the 1960s, but antibiotics continue to be the primary treatment modality (18). Marked increase in antibiotic use during the 1990s directly led to increased prevalence of single and multiply resistant strains by selection (90). Of particular concern are young children who have highest colonization rates and highest antimicrobial use and thus act as a reservoir for resistant pneumococci. Indeed when 2010 antibiotic resistance is compared to 1999 rates (pre- conjugate vaccine era), the CDC has reported decreases in resistance to all but one antibiotic (levofloxacin, which has increased from 0.2% to 0.3% resistant) (64). Other populations have shown that resistance is increasing over the same period (318).

Therefore continued surveillance and judicious prescribing of antibiotics are important.

Since the 1940s, treatment with penicillin has been a mainstay in therapeutics for pneumococcal infections. Penicillin (and other β-lactam antibiotics) disrupt peptidoglycan restructuring and weaken cell walls. This eventually causes rupture and elimination of bacterial cells. Unlike other organisms, there is no evidence of S. pneumoniae mediating resistance through beta-lactamases, a family of enzymes capable of cleaving beta-lactam antibiotics and rendering them inactive (55). Instead penicillin resistance is mediated through mutation of the penicillin binding proteins (PBP) 1a, 1b,

2x, 2a, 2b, and 3, a set of proteins required during murein biosynthesis (115). These molecules acquire subtle structural differences within the active site that weaken the interaction between the antibiotic and the binding protein. Thus resistance is not absolute,

8 and increased dosage of beta-lactams can overcome partial resistance phenotypes.

Resistance to beta-lactam antibiotics is thought to be initially acquired horizontally through transformation with resistant streptococci in the normal flora and has now spread between pneumococcal isolates (71, 248).

Moreover, horizontal acquisition is believed to account for the majority of antibiotic resistance mechanisms in pneumococci. Like with penicillin, acquiring genes that encode proteins with lower or no affinity for antibiotics is a main mechanism for antibiotic resistance; examples include 23S rRNA, topoisomerase and gyrase modifications (336).

In addition, acquisition of efflux pumps is a major source of resistance to macrolides and quinolones.

1.1.7. Vaccines.

1.1.7.1. Pneumococcal polysaccharide vaccine (PPSV). As early as 1929, it was observed that capsule polysaccharide can be protective against pneumococcal infection (102, 183,

301). Modern antibiotics stalled the interest in pneumococcal vaccines until 1967 when the National Institute of Allergy and Infectious Diseases acknowledged the high morbidity and mortality associated with S. pneumoniae and sponsored development of a polysaccharide-based vaccine (19). Polysaccharide vaccines rely on a T-cell independent immune response which allows production of protective antibodies. A 14-valent vaccine was licensed in 1977 and replaced by a 23-valent vaccine in 1983 (8). This vaccine

(Pneumovax 23) protects against serotypes 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A,

12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F, and 33F which cause 85-90% of invasive pneumococcal disease in the US (7). The CDC Advisory Council on

Immunization Practices current vaccine recommendations are for all adults greater than

65 years of age and adults between 19 and 65 that have underlying conditions that increase susceptibility to disease (9). Because polysaccharide antigens do not induce immunologic memory; this can cause responses to wane over time and require additional dosing (9). In the elderly (over 65 years), data are conflicting over the responsiveness and overall efficacy of vaccination (168, 216). Furthermore, across all vaccine recipients, data vary about the vaccine effectiveness against non-bacteremic pneumonia which remains a major cause of morbidity and mortality (144, 320). PPSV was initially recommended for children greater than two years who were at risk, but recommendations have since shifted to promote use of protein conjugate vaccines (described below) (4, 9).

1.1.7.2. Protein conjugate vaccine (PCV). The polysaccharide capsule is regarded as the single most important species specific virulence determinant in S. pneumoniae. Although capsule polysaccharide vaccines can be very effective in adults, T-cell independent responses are poor in children, especially those under two years who are at greatest risk for pneumococcal diseases. Efforts have been focused then on establishing T-cell dependent capsule vaccines that are conjugated to a protein of known immunogenicity.

The first seven-valent protein conjugate vaccine (PCV7, Prevnar) was licensed in 2000 and its use was quickly recommended for all children under two years of age (6). Prevnar

10 uses the mutant diphtheria toxoid cross reacting material 197 (CRM197) as the protein conjugate and protects against serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, representing the most common serotypes in the developed world (125, 228). Initial vaccination efforts in the United States were very successful and by 2005, a 77% decrease in invasive pneumococcal disease was observed amongst vaccinated children; vaccination is also presumed responsible for decreased invasive pneumococcal disease overall and in children too young for the vaccine due to herd immunity (3, 244). During this time, 9- and 10-valent vaccines were developed and used for immunization, though neither of these were licensed or recommended for use in the United States (228). Invasive disease rates steadily declined through 2002, at which point serotype 19A emerged as a major cause of invasive disease although not to the extent of pre-vaccination IPD rates (3).

Newer vaccines have focused on increasing the range of serotypes covered to include serotypes of global importance. The second generation vaccine, PCV13 (Prevnar13), was licensed and recommended for vaccination in 2010; PCV13 adds further protection against serotypes 1, 3, 5, 6A, 7F, and importantly, 19A (4, 221). Pre-clinical data are now available for PCV15 which will supplement serotypes 22F and 33F and is currently undergoing clinical trials (284).

Despite the undeniable success of childhood vaccination in developed countries, the high cost, and storage requirements of PCV have limited its use worldwide. It is of note that in developing countries an estimated 49-74% of pediatric pneumococcal-associated deaths are due to vaccine serotypes and therefore completely preventable (147). In addition to

11 improving current vaccines, more attention needs to be paid to distribution of vaccines to the children at the greatest risk.

1.1.7.3. Vaccine limitations. The success of both childhood and adult vaccination at reducing invasive pneumococcal disease directly and through herd immunity is clearly evident. Rates of invasive disease in the United States in both children under five and adults over 65 have exceeded the benchmarks for the Healthy People 2010 initiative, with incidence at 18 and 37 per 100,000, respectively (64). However, no vaccine is without limitations, and the polysaccharide and conjugate vaccines are no exception.

By eliminating part of the nasopharyngeal flora, other common colonizers of the airway will undoubtedly fill the void and potentially cause disease as well. These can be non- vaccine serotypes of S. pneumoniae or other resident bacteria including nontypeable H. influenzae and M. catarrhalis. One study revealed that nontypeable H. influenzae became the dominating colonizing and otitis media-causing species amongst Australian children vaccinated with PCV7 (337). Alternatively, because there is little serotype cross- protection, it is not surprising that non-vaccine S. pneumoniae serotypes have increased in frequency. Very quickly after introduction of the seven-valent conjugate vaccine, increasing prevalence of serotype 19A was reported (204, 231, 240). Although 19A was included in the second generation conjugate vaccine, this highlights the importance of serotype replacement as a persisting hurdle for vaccine developers. One can predict that

12 over the next several years, other serotypes not protected by the 13-valent vaccine will become more common and more deadly.

Relatedly, a person can be colonized by more than one strain of S. pneumoniae at the same time (50). This creates an environment wherein a disease-associated strain can acquire a new (and non-vaccine) capsule. If we consider MLST as best defining a strain, instead of capsule serotype, then capsule switching allows for escape of a deadly strain from vaccine protection. Prior to vaccine introduction sequence type (ST) 695 was only associated with serotype 4; however evidence of a large recombination event introducing the 19A capsule and flanking sequence has allowed for vaccine escape of ST695 (49).

This selective pressure may allow particularly harmful strains to persist by acquiring a new capsule.

1.1.7.4. Serotype-independent vaccines. One major limitation of both polysaccharide and conjugate vaccines is the fairly strict serotype specificity. Although current vaccines are protective against most of the clinically important serotypes, this may not always be the case. Thus pneumococcal vaccine development will always be playing “catch-up” in trying to assess the current serotype threats and add them to vaccine formulations. An ideal pneumococcal vaccine would stop the progression from colonization to disease.

Because this process remains poorly understood, the best approach at this time is to target serotypes-independent factor(s) which would prevent colonization of most or all pneumococcal strains at once.

Several strategies that have had varying historical success in protection against other pathogens are in development in S. pneumoniae as well. Live attenuated and whole-cell killed bacterial vaccines take advantage of the whole repertoire of pneumococcal products as potential antigens for protection. It has been known for nearly 100 years that whole-cell killed bacteria are protective against infection (52). Live attenuated pneumococcal vaccines have had efficacy in animal models (256). Live vaccine strategies would take advantage of the naturally colonizing state of pneumococcus but eliminate key processes necessary for infection from the vaccine strain. However, because

“virulence determinants” are poorly defined and S. pneumoniae is naturally transformable

(and thus has the capability of acquiring virulence or antibiotic resistant traits), this strategy seems generally unattractive. A drawback of both live attenuated and whole-cell killed vaccines lies in the phylogenetic relatedness between streptococci and the unstudied effects on resident commensal streptococci (91). Despite this, whole-cell killed vaccines are currently in preparation for clinical safety trials (209).

One major area of investigation that has provided great inroads to new vaccines is the study of antigenic protein components. Most of these candidates possess key characteristics: surface association, conservation, low diversity amongst strains, and protection of disease in animal modeling. The current proteins of interest fall into one of several functional classes: Enzymes/toxins (including pneumolysin Ply, autolysin LytA and glycosidases NanA, NanB, StrH, BgaA, Eng), choline binding proteins (including

PspA, CbpA), nutrient acquisition transporter lipoproteins (including manganese binding

14 protein PsaA, iron binding proteins PiuA, PiaA, carbohydrate binding protein MalX), and histidine triad proteins (including PhpA, PhtB, and PhtE) (reviewed in (25, 209)). The majority of these candidates were recently confirmed as being antigenic during identification of the pneumococcal antigenome which also identified StkP and PcsB as previously unappreciated vaccine candidates (108). Many have gone on to pre-clinical and Phase I and Phase II clinical trials (25). The lower cost and serotype-independent protection make the benefits clear of pursuing protein vaccines. Limitations of protein candidates need to be considered as well. First the high genetic relatedness of pathogenic and commensal streptococci cannot be overlooked. While a certain few candidates, like

PspA, are restricted to pneumococci, nearly all other candidates have orthologs in commensal streptococci (15, 91). This, too, raises a huge concern about the potential effects of eliminating non-pneumococcal streptococci from the airway.

1.2. Molecular aspects of colonization

Most commonly, S. pneumoniae colonizes the airway asymptomatically (328). Only under appropriate conditions, such as viral infection, can pneumococci spread to otherwise sterile sites to cause disease (160). Thus, colonization is a necessary precursor to disease. Despite this, the intricacies of pneumococcal colonization are only beginning to be understood. It is clear however that certain factors are critical for establishing and maintaining colonization including adherence to epithelia, host immune evasion, nutrient acquisition, and interspecies competition. Not surprisingly, several of these factors have

15 proposed or known roles in multiple aspects of colonization and are also implicated in virulence.

The first step in nasopharyngeal colonization is the initial binding to underlying host epithelial cell surfaces. Through a process that remains poorly understood, phase variation from opaque to transparent morphology is thought to prime pneumococci for colonization (332). This may be due to thinning of the capsule allowing better exposure of surface proteins, but altered gene expression is also known to occur (155, 332). Other mechanisms of adhesion that have been explored include CbpA which is a protein whose membrane association is dependent upon binding to the phosphorylcholine (263). CbpA binds human secretory component located on the polymeric immunoglobulin receptor

(347). The pneumococcal glycosidases neuraminidase NanA and beta-galactosidase

BgaA were shown to both contribute to adhesion; NanA likely removes sialic acid to reveal a receptor, while BgaA acts directly as an adhesin (156, 173). Several other factors have been implicated in adherence and are described in detail in recent reviews (118, 154,

175).

Surviving in the airway, pneumococci are likely targets of immune clearance by the host;

S. pneumoniae has acquired strategies for modulation and avoidance of immune clearance. Perhaps the best recognized mechanism of resistance to opsonophagocytic clearance is the presence of the polysaccharide capsule (140). Rarely are unencapsulated species isolated and the precise carbohydrate composition of the capsule can affect the

16 ability to resist host clearance (141, 203). Avoidance of complement deposition can also be aided by the presence of the surface glycosidases NanA, BgaA, and StrH, although the target of this deglycosylation remains unknown (81). Furthermore, presence of a metalloprotease with specificity for human IgA1 also helps prevent recognition at the mucosal surface (29, 249, 326).

Within the host, S. pneumoniae must compete with other resident bacteria for space and nutrients. Although direct competition assays between S. pneumoniae and H. influenzae have suggested an advantage for H. influenzae, it is known that S. pneumoniae may combat direct competition in part by deglycosylating the surface of H. influenzae and other species (179, 280).

Survival of pneumococcus in any environment demands acquisition of certain nutrients.

Pneumococcus is devoid of several amino acid biosynthesis pathways and thus must acquire them from the environment (134). Furthermore, requirements for metals must also be met. S. pneumoniae requires carbohydrates as a source for carbon (134, 300). Not surprisingly, many transport mechanisms for nutrients are present in the pneumococcal genome and have been shown to be important for host survival (27, 46, 124, 134, 143,

195, 300). Additionally, pneumococcal metabolism is anaerobic but must tolerate aeration in the nasopharynx. Thus, metabolic systems are in place to convert oxygen to hydrogen peroxide during both homolactic and mixed acid fermentation (123, 134).

1.3. Host glycosylation

Glycans represent an incredibly diverse class of molecules in human cells that modify proteins, lipids, or exist freely. Protein modifications are typically classified by their core linkage as N-linked (when attached to a free nitrogen on asparagine) or O-linked (when attached to a free oxygen on serine or threonine). Glycolipids include glycosphingolipids

(which modify ceramide) and glycophospholipids (which tether proteins to the lipid bilayer) (297). Broadly speaking, glycosylation serves two main purposes: modification of structure/function and recognition of self/non-self. Terminal carbohydrates and unique modifications or linkages tend to be associated with recognition while inner carbohydrates tend towards structural roles. Glycosylation is typically a co- or post- translational modification occurring as proteins transverse through the endoplasmic reticulum the Golgi and the trans-Golgi network. Lipid glycosylation also occurs in the endoplasmic reticulum. Glycosyltransferases mediate the addition of activated sugar- nucleotides from the cytosol to the growing glycan (315). Generally, each of the glycosyltransferases is unique in the linkage with which it catalyzes. Unlike protein synthesis, glycosylation is not a regimented process and can generate highly diverse structures; the diversity for polysaccharides is estimated to be several orders of magnitude greater than for a polypeptide of the same length (166). Because of this diversity, it is incredibly difficult to predict the effects of aberrant or absent glycosylation and effects can differ temporally, by tissue and in vitro versus in vivo. Altered glycosylation is implicated in diverse diseases including congenital defects, arthritis and cancer metastasis (297).

1.3.1. N-linked glycans. With little exception, synthesis of N-linked glycans begins as a co-translational event in the endoplasmic reticulum with transfer of Glc3Man9GlcNAc2

(where Glc is glucose, Man is mannose and GlcNAc is N-acetylglucosamine) precursor from the lipid dolichol to an asparagine in the context of Asn-X-Ser/Thr (where X is not proline) (275, 297). Dolichol glycosylation and translocation is poorly understood. After transfer, the precursor carbohydrate is often trimmed to a core pentasaccharide structure consisting of two GlcNAc and three Man carbohydrates in a biantennary structure. This allows for remodeling and addition of diverse carbohydrate linkages to the core N-linked glycan to produce N-linked glycans of three types: high-mannose, complex or hybrid

(275). As the name indicates, high-mannose N-linked glycans contain between five and nine mannose molecules decorating the core structure. Complex branchings can vary widely in linkages, but one common modification is addition of lactosamine

(GlcNAc(β1-4)Gal) (where Gal is galactose) and terminal sialic acid in the trans-Golgi network. Hybrid glycans have characteristics of both high-mannose and complex glycans

(297).

An important function of N-linked glycosylation is to permit proper folding and conformation during translation; impaired glycosylation can lead to immediate protein degradation. Many serum proteins and IgG rely on N-linked glycosylation for this purpose (138).

1.3.2. O-linked glycans. In contrast to N-linked glycans, O-linked glycosylation occurs post-translationally with stepwise sequential addition of single carbohydrates molecules in the Golgi. In addition to tissue and temporal regulation, diversity of O-linked glycans is thought to also be due to competition of glycosyltransferases for the same carbohydrate substrates. Modifications are incredibly diverse with mucin-type and O-GlcNAc O- glycans being the most common. Eight core structures of the mucin-type O-glycans have been described and only have an initial N-acetylgalactosamine (GalNAc) linked to serine or threonine in common (the Tn-epitope) although most mucin-type glycans are predominantly composed of GalNAc, GlcNAc, Gal, with fucose (Fuc) or sialic acid as a terminal carbohydrate. Like N-linked glycans lactosamine repeats can elongate O-glycan structures (122, 297). Mucin-type O-glycans are important for lubrication and can be very dense with complex glycosylation occupying up to every third residue of the underlying protein (120). Comparatively, much less is known about O-GlcNAc modified proteins.

This modification seems to be limited to cytoplasmic and nuclear proteins, and the O-

GlcNAc always appears to be the only carbohydrate present. A relationship between O-

GlcNAc addition/removal and de/phosphorylation of a protein is beginning to be understood (122).

1.3.3. Proteoglycans and glycosaminoglycans. Proteoglycans represent a separate class of O-glycosylated proteins. Unlike mucins and O-GlcNAc-modified proteins, the carbohydrates decorating proteoglycans consist of 80 or greater repeating units (297).

The glycosaminoglycans are so named as they are disaccharides consisting of an amino

20 sugar and a hexose both of which are subject to further modifications (97). Chondroitin sulfate, dermatin sulfate and heparan sulfate are all attached to the protein backbone via a xylose. Keratan sulfate is linked to a GlcNAc. Hyaluronic acid is unique amongst glycosaminoglycans in that it is not attached to a protein. The central purpose of proteoglycans is to provide structure to the extracellular matrix such as in the skin and joints (97).

1.3.4. Glycolipids. Two major classes of glycolipids exist in eukaryotes: glycosphingolipids and glycosylphosphatidylinositols (GPI) (297). Glycosphingolipids encompass a diverse group of carbohydrates that modify ceramide. These structures are embedded in the outer leaflet of the lipid bilayer and can account for up to 30% of membrane lipids in some cell types. Glycosphingolipids are formed in the ER or Golgi, depending on the first carbohydrate added (Glu or Gal). After this, further carbohydrates can be added stepwise in the Golgi complex. Gangliosides are often terminally decorated with sialic acids (180). GPI-anchored proteins are unique in a number of ways. During formation in the endoplasmic reticulum, glucosamine (GlcN) is attached to phosphatidylinositol; this is the only known existence of GlcN in a glycoconjugate without acetylation or sulfation. From here, three mannose residues are added followed by addition of phosphoethanolamine. At this point, recognition of a C-terminal sequence targets addition of the protein to the GPI anchor. These proteins can then be further modified (including additional glycosylation) and trafficked to the cell membrane (158).

1.3.5. Bacterial mimicry. An interesting adaptation of some bacterial species is ability to decorate the surface with host-like glycans. This mimicry allows bacteria to be detected as “self” and avoid immune recognition. Common examples include LOS modification of

Neisseria and Haemophilus species with sialic acid and carbohydrates resembling glycosphingolipids as well as the hyaluronan capsule of S. pyogenes (187, 188, 333).

1.3.6. Sialic acids. Owing to the prominent terminal position on N-linked glycans, O- linked glycans, glycosphingolipids and GPI anchors, special attention is often paid to sialic acids. Sialic acids are typically thought to occur in complex invertebrates and vertebrates (172). The term “sialic acid” refers to a family of nine-carbon carbohydrates consisting of a hexose ring and a pyruvate at the 6-position, which together display extensive diversity. Linkages at the 2-position to other carbohydrates can be of multiple types (α2-3, α2-6, α2-8) and modifications 4, 5, 7, 8 and 9-positions are described (314).

This unmatched diversity in carbohydrate structure is hypothesized to be a result of strong and ongoing selective pressures that must keep a balance between benefits and functions required by the host and the recognition by many pathogens (105, 317). For example, the prevalence of α2-6 linked N-acetylneuraminic acid in the upper airway is thought to directly contribute to the infectivity of influenza A virus (105). Many other examples of pathogenic recognition of host sialic acids are described and include Vibrio cholerae, Plasmodium falciparum, Clostridium botulinum and Helicobacter pylori (316,

317). Bacteria appear to have evolved numerous novel mechanisms of sialic acid acquisition, production and surface decoration (172, 187, 188, 316, 322).

Certainly, there is no shortage of benefits that sialic acids provide to the human host and dysregulation of sialic acid production is associated with many diseases (316). A role for sialic acids in development is supported by the fact that an inability to present sialic acids is embryonic lethal in mice (276). Sialic acids serve important structural roles by providing a net negative charge to surface structures. An important example is the repulsion of erythrocytes (316). Recognition of presence or absence of sialic acids is also a contributing factor to half-lives of proteins, as recognition of underlying carbohydrates can target degradation (330). Sialic acids are also recognized by Siglecs which have important signaling and cell-cell interaction roles. Interestingly, bacteria can hijack this interaction both through mimicry of sialic acids to mediate binding and dampening of immune responses as well as removal of sialic acids on leukocytes to minimize Siglec recognition and increasing immune responses (62, 66).

1.4. Pneumococcal glycosidases

The interaction between S. pneumoniae and host epithelia is influenced by the remarkable ability of pneumococci to alter host carbohydrates. Airway mucin, epithelial cell surfaces and other important immune molecules all feature glycosylation which is necessary for their optimum function (72, 92, 260). S. pneumoniae produces at least ten surface- associated or secreted glycosidases; based on data and predictions, seven of these cleave terminal carbohydrates and are exoglycosidases, while the other three are endoglycosidases that cleave internally (see Table 1.1 and references therein). Most of these glycosidases carry a classic LPXTG sequence and as such, are covalently linked to

(2001)

(2000)

(1994)

al. (2008) (1995)

(2009) et al. (1994) (1996)

al. et c (2011) al.

et al. et al. et et al. et al. et al.

Reference Clarke Jeong Bongaerts Berry Caines Muramatsu Zahner Hakenbeck& (2000) Xu Berry Camara

Ser

- 4)GlcNAc

3)Gal 3)Gal 3)Gal 6)Gal 3)GalNAc 2)Man 3)Gal 4)Gal ------

3)GalNAc) 6)Glu - 3)GlcNAc 4)GlcA 4)GlcNAc - - - -

Specificity GlcNAc(β1 GlcNAc(β1 GlcNAc(β1 Gal(β1 Glu(α1 Gal(β1 (Gal(β1 Man3GlcNAc(β1 Gal(β1 Neu5Ac(α2 Neu5Ac(α2 Neu5Ac(α2 Neu5Ac(α2 Neu5Ac(α2

b sortase sortase sortase

Localization surface, surface surface, sortase surface, sortase surface, surface, surface, sortase secreted secreted surface, sortase

acetylgalactosaminidase acetylglucosaminidase - - S. pneumoniae N N - - α β - - acetylglucosaminidase galactosidase galactosidase - - -

Activity N β pullulanase hyaluronate lyase Endo Endo β neuraminidase neuraminidase neuraminidase

Glycosidase StrH BgaC SpuA Hyl SpGH101 EndoD BgaA NanC NanB NanA

a eference from which gene was describedoriginially Italicized indicates text predicted localization mechanism ORF designationsORF TIGR4 from R

Table 1.1: Surface glycosidases of ORF SP_0057 SP_0060 SP_0268 SP_0314 SP_0368 SP_0498 SP_0648 SP_1326 SP_1687 SP_1693 a b c

24 the surface via sortase (126, 197). The exceptions are BgaC which localizes by a yet unknown mechanism and NanB and NanC which are presumed secreted (146, 300, 340).

By best estimates the surface/secreted glycosidases of S. pneumoniae are highly conserved. The only variation noted is the presence of NanB in 96% of isolates and NanC present in up to 51% of isolates (241). The ability to modify human glycans combined with close surface association and high conservation together suggests the importance of carbohydrate modification at the bacterial-host interface.

Based on biochemical analyses, all studied surface/secreted glycosidases have specificity for carbohydrates known to be in human glycans. Indeed, studies have demonstrated the ability of pneumococcus to cleave N-linked glycans and glycosaminoglycans, and it is hypothesized that pneumococcus can likewise modify mucin-type O-linked glycans and possibly glycolipids (156, 173, 195). S. pneumoniae is known to express an O- glycosidase that specifically cleave core-1 O-linked glycans (35, 45, 161, 309). O-linked glycans are abundant on airway mucins and the ability to modify mucin could therefore aid in pneumococcal colonization (260). However, the gene encoding the O-glycosidase remains unidentified and whether O-glycan modification contributes to colonization is unknown.

1.4.1. Glycosidases and colonization. Because asymptomatic colonization is the normal homeostatic state of the pneumococcus in the nasopharynx, it is likely that glycosidases play an important role during colonization or transmission. Indeed, glycosidases have

25 been shown to be important in different models of colonization (155, 171, 195, 286).

Deglycosylation of host N-linked glycans, O-linked glycans and glycosaminoglycans has been suggested and has recently begun to be investigated more fully. Deglycosylation of

N-linked glycans including secretory component and lactoferrin was shown to occur via the activities of neuraminidase NanA, beta-galactosidase BgaA and N- acetylglucosaminidase StrH to expose mannose (156). Neuraminidase NanB is also able to contribute to glycoconjugates deglycosylation under some conditions (54).

Hyaluronidase Hyl is known to have specificity for hyaluronic acids (33, 195). Although not yet studied, it is suggested that BgaC may modify O-linked glycans (146). The ability to deglycosylate host glycans could contribute to bacterial survival by multiple mechanisms including: (i) providing a carbon source for growth,(ii) promoting movement through mucin and adherence to epithelial cells (iii) modifying function of host clearance molecules, (iv) and competing with other bacteria for the niche (155, 224, 280, 304).

S. pneumoniae requires carbohydrates for growth, and free carbohydrates are scarce in the airway suggesting that carbohydrates are instead procured by deglycosylation of host glycoconjugates (242). We have demonstrated that released carbohydrates from the complex N-linked glycans on the model alpha-1 glycoprotein can sustain pneumococcal growth in vitro (54). This growth is dependent upon the sequential activity of NanA,

BgaA and StrH. In the absence of NanA, NanB can contribute to deglycosylation and growth as well (54). A high mannose N-linked glycan, RNase B, was shown to support pneumococcal growth and this growth is dependent in part on EndoD (H. Salhi, S. King

26 unpublished and (132)).Utilization of the highly O-glycosylated mucins was shown to be dependent on NanA, although the NanA-dependence could not be reproduced in our laboratory (G. Bobulsky, C. Marion, S. King unpublished and (343)).

Adherence to the epithelium is regarded as a first critical step in establishment of colonization. It has been proposed that carbohydrates may serve as initial receptors for S. pneumoniae (16, 79, 163). Thus, glycosidases could contribute to adherence by removing masking sugars to reveal the receptor. Evidence also suggests that the receptor may be sialylated which may implicate a role for NanA (26, 305). Indeed, we have also shown the importance of both NanA and BgaA in modulating adherence to host epithelium (156,

173). NanA is implicated in revealing a receptor while BgaA was shown to have a novel activity directly as a cellular adhesin (156, 173). There is alternate evidence that NanA may have direct adhesive properties (308). In contrast, a BgaC mutant was shown to be increased in adherence possibly indicating that a galactose receptor is being left intact

(145). Data are generally in support of pneumococcal glycosidases contributing to epithelial adherence.

Avoidance of immune clearance is required for S. pneumoniae to successfully colonize the nasopharynx. Sequential deglycosylation of lactoferrin, secretory component and

IgA2 have all been demonstrated and may aid in airway survival (155, 156). NanA, BgaA and StrH were also shown to aid in minimization of complement deposition and avoidance of opsonophagocytic killing in vitro (81). Perhaps surprisingly, mutation of

27 nanA, bgaA, and strH, had no effect in a mouse model of colonization; although, it is speculated that the diversity of colonization factors or host-species specific factors may be accountable for the lack of effect seen (156).

Co-colonization of S. pneumoniae with other commensal bacteria is documented (50).

Many bacteria are protected by carbohydrates, and it is known that at least H. influenzae,

N. meningitidis, and S. pyogenes present surface structures that mimic host glycosylation and are theoretically able to be modified by S. pneumoniae glycosidases (187, 188, 333).

Our in vitro data support the hypothesis and suggests a mechanism by which resident pneumococci compete with other bacteria for maintenance of colonization within the niche (195, 280).

1.4.2. Glycosidases and disease. By virtue of the surface exposure, the pneumococcal glycosidases are vulnerable to immune recognition during both colonization and disease.

Antibodies against five of these were recently detected in serum of healthy and convalescing patients, demonstrating that glycosidases can be antigenic and recognition by the immune system may be protective against disease (108). It is possible then, that in addition to contributing to colonization, that surface/secreted glycosidases may also contribute to invasive disease. In accordance with this, it has been suggested that SpuA may degrade glycogen in the lung (10, 39, 310). Hyl has long been recognized as a virulence factor which may aid in localized tissue invasion through degradation of extracellular matrix (33, 162, 350). Reports are conflicting over the roles of

28 neuraminidases NanA and NanB in pathogenesis (155, 186, 229). Several surface glycosidases were identified in a genome-wide screen for virulence determinants in a lung infection model (126).

Biofilms are often considered as important reservoirs for colonizing bacteria but identification of S. pneumoniae in biofilms of children with middle ear infections suggests that pneumococcal biofilms are also important to pathogenesis (117). Several glycosidases are implicated in formation or maintenance of biofilms. Neuraminidases

NanA and NanB, and beta-galactosidase BgaA were each identified as potentially contributing to biofilm formation (214, 226, 306).

1.4.3. Neuraminidases. Because of this prominent surface exposure of sialic acids, much experimental effort has been devoted to understanding the pneumococcal neuraminidases in disease. S. pneumoniae genomes contain between one and three neuraminidases:

NanA, NanB and NanC (32, 59, 340). Differences in localization and substrate specificity suggest that the neuraminidases may have different roles during infection. nanA encodes a 112 kDa surface-associated protein that recognizes α2-3 and α2-6 linked sialic acid

(59). It is expressed by all strains examined, and is considered to be a part of the pneumococcal core genome (59, 155, 157). The predicted nanB locus contains five open reading frames and occurs between genes of the nanA locus (155). nanB encodes a 74.5 kDa secreted protein that is specific for the α2-3 linked sialic acid, and is present in 96% of strains tested (32, 241). Strains lacking nanB still contain the other genes in the nanB

29 operon suggesting that these genes may encode proteins with important functions (153). nanC encodes an 82 kDa protein specific for α2-3 linked sialic acid and is present in less than 51% of strains tested (241, 340). Those strains lacking nanC lack the entire predicted region, demonstrating that these genes are not essential for pneumococcal colonization (241). All known functions of pneumococcal neuraminidases were previously attributed to NanA, however it is now appreciated that NanB contributes to growth on human glycoconjugates in vitro and to invasive disease (54, 186).

As described above, neuraminidase-dependent sequential deglycosylation likely contributes to colonization by revealing receptors for adherence, modulating immune molecules, competing with other airway bacteria, and providing a carbon source for growth (54, 156, 173, 280). Given the ability to modify surface glycans of host structures, neuraminidase contribution to pathogenesis of S. pneumoniae has been studied in some detail. Biofilms may represent a reservoir of bacteria during colonization and studies have revealed upregulation of neuraminidases during biofilm growth (214, 226). Loss of the locus containing both NanA and NanB is associated with reduced biofilm formation under certain conditions (306). A more direct assessment showed that inactivation of

NanA by mutation or addition of inhibitors reduced biofilm formation (235). This is consistent with demonstrations that NanA is important in otitis media, as S. pneumoniae biofilms have been identified in children with middle ear infections (117, 302, 303).

Targeted mutation of NanA indicated a role in different tissue models mimicking the transition from upper to lower airway infection (229). More thorough studies by Manco

30 et al. (2006) demonstrate that both NanA and NanB enhance infection of upper and lower airways and indicate that the activities of the two neuraminidases are not compensatory for one another. This study further shows that neuraminidases are essential for survival of pneumococci in the blood, however this is contradicted by data which instead indicate that a NanA mutant displays better survival in blood (74, 186). Coats et al. shows a role for NanA in exposure of Thomsen Freidrichen antigen on red blood cells; this is thought to be the main mechanism by which hemolytic uremic syndrome develops (74).

Pneumococcal hemolytic uremic syndrome is a serious complication of pneumococcal infection in children. Removal of sialic acid from erythrocytes exposes underlying Galβ1-

3GalNAc carbohydrates (TF antigen) which are recognized by IgM, causing aggregation and blockage of kidney glomeruli (74, 176). Pneumococcal hemolytic uremic syndrome is rare but apparently increasing, and if left untreated pneumococcal hemolytic uremic syndrome approaches a mortality rate of 90% (75).

Data have been published recently that implicates NanA in invasion of the blood brain barrier. This work shows that NanA is both necessary and sufficient for adhesion and invasion to human brain microvascular endothelial cells (308). It has been suggested, although not tested, that NanA desialylation of monocytes and HIV may promote HIV entry into the brain as well (261). Additionally, desialylation of monocytes and NanA- mediated endothelial invasion both trigger pro-inflammatory responses with yet unknown consequences (23, 66).

1.5. Utilization of Carbohydrates

S. pneumoniae relies exclusively on carbohydrate fermentation to acquire carbon, however free carbohydrates are not readily available in the airway where initial colonization occurs (242). Instead, glycans can be found linked to human lipids and proteins, where they are unavailable to S. pneumoniae unless cleaved. S. pneumoniae is adept at manipulating sugars, as demonstrated by the expression of at least ten glycosidases (Table 1.1) (73, 155, 346). Concomitantly, S. pneumoniae has acquired the ability to import and utilize an incredible array of carbohydrates.

The original sequenced genome of S. pneumoniae TIGR4 predicted that 28 loci encode mechanisms for carbohydrate transport (300). A recent survey of all 26 published pneumococcal genomes indicates that each contains between 15-20 phosphoenolpyruvate dependent phosphotransferase systems (PTS), seven to eight ATP-binding cassette

(ABC) transporters, occasionally one sodium:solute symporter, and up to three as yet unverified glycerol type porins (Fig. 1.1) (36). S. pneumoniae therefore is predicted to devote 30% of its transport mechanisms specifically to carbohydrate import. This results in the proposed ability to ferment greater than 30 unique carbohydrates and it has been speculated that utilization of diverse substrates evolved to accommodate carbohydrates available within the anatomical niche. Relative to genome size, this number of carbohydrate transport mechanisms is doubled compared to other species of similar genomic size (250).

ABC Transporter PTS

SBP

permeases EIIC(D)

P ATP ATPase ATPase ADP + P P i EIIA/B

ADP + Pi ATP P HPr

P EI PEP pyruvate

Figure 1.1. ABC transport and PTS are the primary carbohydrate import mechanisms in S. pneumoniae. Depicted are representative components of an ABC transporter including the substrate binding protein (SBP), membrane-spanning permeases and the energy- generating ATPases or ABC domains. All PTS share the enzyme I (EI) and HPr, and the enzyme II domains (EIIABCD) are specific to each substrate.

1.5.1. Phosphoenolpyruvate dependent phosphotransferase system (PTS). The PTS was first described by Kundig, Ghosh and Roseman who recognized this as a novel mechanism of carbohydrate phosphorylation in E. coli (164). To date, PTS are present exclusively in bacteria potentially indicating that PTS arose later in evolution (24).

Carbohydrates are specifically imported and coordinately phosphorylated which is presumed to serve the dual purpose of preventing carbohydrate leakage out of the cell as well as preparing the carbohydrate for further degradation (24). A PTS typically consists of the phosphorelay from Enzyme I (EI) to heat stable protein (HPr) to Enzymes II (EII)

(247). The initial histidine phosphorylation of EI is caused by conversion of phosphoenolpyruvate (PEP) to pyruvate (164, 299). The full-length EI proteins of E. coli and Staphylococcus carnosus have been structured and data are consistent with a model of the N-terminal domain containing the phosphorylation site and HPr binding site and the C-terminal domain mediating PEP binding and dimerization (196, 299). From here the 9 kDa HPr is phosphorylated at His-15 (247). EI and HPr represent common proteins utilized for translocation of all PTS substrates; EII components are substrate specific (24,

247). EII components consist of cytoplasmically located EIIA and EIIB, and the transmembrane channel EIIC (247). Collectively these domains are well defined and different components of EII and even EI or HPr can be fused as single polypeptides

(255). It is typically thought that EIIABC domains must be present for successful translocation of a substrate; a notable exception is that certain glucose PTS can be functional without an EIIA encoded in the operon (298). Because EIIC is membrane- spanning, structural information on the EIIC has been lacking and the first crystal

34 structure from Bacillus cereus was only recently made available (60). Based on bioinformatic evidence, PTS EII components are believed to have arisen through multiple independent evolutionary routes and are classified in one of the four families: glucose- fructose-lactose (Glc-Fru-Lac), ascorbate-galactitol (Asc-Gat), mannose (Man), and dihydroxyacetone (Dha). (267). Of note, the Man family PTS differ insomuch as they contain an additional domain, EIID (247, 349). While the precise role of EIID remains to be elucidated, mannose type PTS are speculated to be associated with adaptation to human mucosa (349).

1.5.2. PTS in S. pneumoniae. The TIGR4 genome of S. pneumoniae is predicted to encode 17 complete PTS: four Glc, three Fru, five Lac, four Man, and one Asc (24). Until recently, very few of these had been studied experimentally and with varying robustness

(128, 143, 151, 195, 202, 279). Studies of a two-component regulatory system led to the discovery of a cellobiose-specific PTS which was independently confirmed elsewhere

(202, 279). It was reported that the PTS in proximity to the beta-galactosidase was responsible for galactose transport; however this finding could not be duplicated in our laboratory (C. Marion, S. King, unpublished data and (151)). Indirect evidence implicated a PTS in sucrose transport based on presence of a sucrose hydrolase in the same genetic locus, and on observed phenotypes of a hydrolase mutant (143). We have recently demonstrated that the PTS downstream of hyaluronate lyase is necessary for import of hyaluronic acid (195). The remaining assumptions regarding PTS specificity are based on genome annotations (134, 167, 300). Surprisingly, although glucose is often utilized

35 experimentally as representative of a preferred carbon source, the glucose PTS was not characterized until this year (36). This same report by Bidossi et al. attempted to survey all predicted carbohydrate transporters in S. pneumoniae. Based on this work, conclusive substrate identification was only possible for two additional PTS: trehalose (open reading frame SP1884) and fructose (SP0877); tentative assignments have been given to several additional PTS, including glucose (open reading frames SP0282-4), mannitol (SP0394-6), maltose (SP0758), lactose (SP1185-6) (36). The authors cite broad substrate overlap between PTS as causing the inability to identify more PTS substrates; however it is unknown whether the overlap detected was an in vitro artifact or evidence of widespread

PTS substrate overlap (36).

1.5.3. Carbohydrate ATP binding cassette (ABC) Transporters. ATP binding cassette

(ABC) transporters facilitate transport across a membrane. ABC transporters are identifiable based on key characteristic sequences found in the energy-generating ABC domain. (131, 239). A core transporter minimally requires two ABC domains along with two transmembrane domains that span the membrane to create the transport channel.

These four domains can be encoded as discrete proteins, but many different fusion combinations exist (37). Based on phylogenetic relatedness of ABC domains, evidence suggests that ABC transporters divided early into three classes: exporters, importers, and non-transporting (82, 84, 269). ABC importers are seemingly unique amongst prokaryotes and additionally require a substrate binding protein to aid in substrate delivery and confer specificity of the transporter (84). In Gram negative bacteria, these

36 subunits are periplasmic while in Gram positive bacteria the substrate binding proteins are anchored lipoproteins. Substrates of the importers vary greatly, in S. pneumoniae alone ABC importers are predicted for carbohydrates, ions, phosphate, peptides, and amino acids (134, 300).

As mentioned, the ABC domains are well-characterized well-conserved, and much is known about the organization. The Walker A and B sequence motifs have long been recognized as facilitating ATP binding, however these sequences are not unique to transport ATPases (324). Rather, this distinction is based upon the invariable presence of the Signature motif (LSGGQ) which is required for interactions between the ATPase and the conserved EAA loop of the permeases (212, 273). Much of our current understanding about ABC import comes from elegant structural studies from Davidson, Chen and collaborators on the model maltose transporter MalEFGK2. Their work has been integral in demonstrating how the two ATPases interact through the C-terminal domain and ATP binding to cause a tweezer-like closing of the ATPases (68, 177, 268). Recent work has shown that delivery of the substrate via the substrate binding protein to the transmembrane domains is organized with ATP hydrolysis and ATPase closing (227).

In prokaryotic importers, the five domains are typically encoded separately (84).

Furthermore, the majority of transport components are typically organized within a single operon, however it was noted that streptococcal species frequently lack the ATPase in operon organization suggesting that the functional ATPase is encoded elsewhere (329).

Although encoded in operons, the recent demonstration that the carbohydrate ATPases can functionally compensate in S. mutans indicates that carbohydrate ATPases may have the ability to interact with multiple core transport components (329). The phenomenon of

ATPases encoded separately from core transporters has been sporadically reported in other nonpathogenic species. Both Streptomyces reticuli and Streptomyces lividans encode an ATPase, MsiK that can energize multiple transporters (83, 139, 271, 272). The thermophilic bacterium Thermus thermophilus was shown to encode the ATPase, MalK1 that energizes at least two transporters, but the authors hypothesize that based on genomic organizations that there may be others (70, 282). One of three predicted monocistronic

ATPases in B. subtilis, MsmX, was recently demonstrated to energize at least two transporters, although whether this is acting as a homo- or heterodimer remains to be elucidated (99). To the best of our knowledge the only non-carbohydrate example of a shared ATPase is amongst iron acquisition transporters in staphylococci where the

ATPase FhuC was shown to energize multiple transporters (28, 287). An important distinction is that the ATPase FhuC is not encoded as a single transcript and is instead encoded as a part of the ABC transport operon containing fhuABC, perhaps suggesting the mechanism by which this arose is unique from the carbohydrate ATPases (28, 287).

Overall, the general restriction of the shared ATPase to carbohydrate importers and the ramifications of sharing an ATPase have yet to be studied.

1.5.4. ABC transporters in S. pneumoniae. S. pneumoniae is predicted to encode up to

30 ABC transporters; the relatively large number is likely indicative of the complexity of

38 the bacterial niche (30, 121). As annotated, six to seven regions are predicted to encode

ABC transport components lacking only the ATPase (300). This includes the previously characterized transporters for maltose/maltodextrin, sucrose/fructooligosaccharides, and raffinose (143, 217, 262). That all six to seven of these regions are implicated in carbohydrate transport further supports the hypothesis of a shared ATPase. The shared

ATPase for carbohydrate transport in streptomycetes, MsiK, may suggest that one pneumococcal ATPase likewise energizes multiple ABC transporters. At the amino acid level, the predicted pneumococcal MsmK (encoded by SP1580) has the greatest match to

MsiK in S. reticuli, sharing 43% identity and 61% similarity. It also shares 73% identity and 84% similarity with the known carbohydrate ATPase MsmK in S. mutans (189,

191). Thus, the pneumococcal msmK may encode a carbohydrate-specific ABC ATPase, and may be a component of more than one transporter lacking an ATPase.

1.5.5. Other carbohydrate transporters. In addition to PTS and ABC, S. pneumoniae is predicted to contain up to one transporter of the sodium:solute symport family and up to

3 porins (36, 300). The symporter is encoded in the same transcript as the neuraminidase

NanC, and has thus been predicted to be involved in utilization of sialic acid (321).

Additionally up to three predicted glycerol type permeases may be present although these have not yet been studied in detail (36).

1.5.6. Sialic acid transport. Demonstration of growth on sialic acid by both Gram negative and Gram positive bacteria suggests sialic acid uptake is important for bacterial

39 colonization (42, 54, 145, 278, 292, 322, 327). Despite identification of sialic acid transporters in other bacteria and knowledge that sialic acid is released from human glycoconjugates, the mechanism of sialic acid transport in S. pneumoniae remains unknown. Furthermore, transport mechanisms in other bacteria are not conserved. Sialic acid transport in E. coli occurs via the NanT sugar cation symporter (198). H. influenzae utilizes the tripartite ATP-independent periplasmic transporter, SiaT (13, 278). By sequence analysis, S. pneumoniae was previously proposed to use a sodium symporter

(SP1328) as the primary sialic acid transporter (300, 321). However, as the nanC region encoding this transporter is present in fewer than 51% of strains, this is not likely the primary mechanism of sialic acid transport (241).

Examination of the nanA and nanB loci in the pneumococcal genome reveals two possible ATP binding cassette (ABC) transport systems: SP1681-83 in the nanA locus and SP1688-90 in the nanB locus (32, 300). Demonstration that NanA and NanB, but not

NanC, significantly contribute to growth on N-linked glycoconjugates suggests that

NanA and NanB-associated transport mechanisms may be important for sialic acid utilization (54). Of note, the nuclear binding domains (ATPases) facilitating hydrolysis of

ATP molecules are absent from the regions of interest and supports the hypothesis that a nuclear binding domain may be shared between some pneumococcal ABC transporters.

1.5.7. Regulation of carbohydrate import. Bacteria benefit from the efficient system for regulating the preferential import of abundant or favorable substrates. The general

40 phenomenon of carbon catabolite repression (CCR) leads to repression of transport and metabolic genes involved in utilization of secondary carbohydrate sources (110).

Typically, glucose is the preferred source for carbohydrates, although there are examples where other carbohydrates are preferred in both Gram positive and negative bacteria (76,

233, 311). A recent report in B. subtilis indicates that in addition to glucose, other carbohydrates can exert varying degrees of CCR (283). CCR is achieved by divergent mechanisms in Gram negative and Gram positive bacteria, but in both cases, components of the PTS mediate CCR.

1.5.7.1. Gram negative CCR. In Gram negative bacteria, EIIAGlc is central to global CCR and exerts regulatory control by two main mechanisms. During rapid import of glucose, most EIIAGlc are present in the unphosphorylated state; this can interact directly with permeases, ATPases and other proteins block activity through the process of inducer exclusion (88, 247). When preferred carbohydrates (typified by glucose) are lacking,

EIIAGlc is more likely to exist in a phosphorylated state because it is not able to transfer the phosphate to the EIIB and ultimately EIIC and incoming sugar. Phosphorylated

EIIAGlc stimulates the conversion of ATP to cAMP via adenylate cyclase. cAMP binds cyclic AMP receptor protein (CRP) which as a result, activates catabolic pathways (88).

1.5.7.2. Gram positive CCR. CCR in Gram positive bacteria is mainly dictated by HPr.

During the phosphorelay involved in carbohydrate import, HPr is phosphorylated at histidine 15; however, a second phosphorylation site exists at serine 46 (89). Serine

41 phosphorylation of HPr is a result of HPr kinase/phosphatase (HPrK/P) which has kinase activity in the presence of metabolic intermediate fructose-1,6-bisphosphate and is therefore indicative of rapid transport and metabolism of a preferred carbohydrate (293).

Serine-phosphorylated HPr binds the LacI/GalR family regulator CcpA which exerts transcriptional control over metabolic genes (88, 110). The HPr-CcpA complex preferentially binds to the DNA sequence termed cre for “catabolite responsive element”

(137). It is thought that affinity of CcpA to different cre varies, and that not all annotated cre are responsive to CcpA (63).

An alternate mechanism of regulation exists that takes advantage of histidine- phosphorylated HPr and specific EII components. Accumulation of histidine- phosphorylated HPr is indicative of low PTS transport levels. This phosphate can be transferred to individual operon regulators (antiterminators and activators have both been described) to promote expression of secondary transport and metabolic genes (110, 247).

Phosphorylation occurs at a PTS responsive domain (PRD) which invariably occur in pairs (294). A second layer of regulation depends upon the phosphorylation state of the second PRD. Instead of responding to a general need for carbohydrate (as the histidine- phosphorylated HPr indicates), phosphorylation of the second PRD is dictated by presence of the specific carbohydrate. Different from the first PRD regulation, dephosphorylation of the second PRD is necessary for activation (294).

Dephosphorylation occurs in the presence of the EII specific carbohydrate because the phosphate of the EIIA/B is directed instead to the EIIC for import (112). Thus the two

42 levels of regulation allow activation of the regulator when both conditions are met: (i) phosphorylation of one PRD in response to low overall carbohydrate levels and (ii) dephosphorylation of the other PRD in response to presence of the carbohydrate for that transporter/metabolic locus. Only then can the regulators dimerize to exert transcriptional changes (110). This is thought to dictate the preference amongst transporters.

1.5.7.3. Carbohydrate utilization regulation in S. pneumoniae. Although regulation of carbohydrate uptake has been studied in the model organism B. subtilis, relatively little is known about regulation in S. pneumoniae (104). Presumably, much of the knowledge gained from B. subtilis can be extrapolated for S. pneumoniae and indeed, orthologs of requisite regulatory proteins have been identified, but the paucity of data about carbohydrate regulation hinders our understanding of general pneumococcal biology.

Based on sequence similarity to Staphylococcus aureus ccpA, an ortholog was identified in S. pneumoniae (107). Both this and a follow-up study demonstrated that CcpA contributes to colonization and virulence in animal models of pneumonia and sepsis (107,

142). Loss of ccpA is associated with decreased in vitro fitness, consistent with aberrant derepression of carbohydrate utilization loci (313). Deletion of ccpA has been associated with increases of enzymatic activity of proteins presumed to be under control of CcpA, however, data suggest multiple levels of regulation (142, 151, 262). Recently a whole genome microarray approach revealed that up to 8% of open reading frames were directly regulated by CcpA and up to 11% were indirectly regulated by CcpA (63). Importantly,

43 this did not perfectly correlate with presence of a predicted cre, indicating that either alternate regulatory mechanisms are exerting control or that not all predicted cre are responsive to CcpA. Despite this, the study revealed differential expression of 17 out of

29 predicted carbohydrate transport loci, overall consistent with the hypothesis that CcpA is a global regulator that responds to carbohydrate availability (63).

Several additional carbohydrate regulators have been studied. The LacI/GalR family regulator RegR was predicted to be a global regulator based on the pleotropic effects originally observed, but based on fitness interaction studies and qPCR data, it seems more likely that RegR is instead a specific regulator for hyaluronic acid degradation and utilization (S. Woodiga, S. King, unpublished data and (67, 313)). MalR is a LacI/GalR family repressor that regulates two operons for the transport and metabolism of maltooligosaccharides (217, 218, 252). ScrR is the last of the studied LacI/GalR family repressors; it is implicated in regulation of a sucrose ABC carbohydrate transporter (143).

The raffinose utilization locus is controlled both by an activator RafR and a repressor

RafS (262). Cellobiose utilization is mediated through the activator CelR (279). Based on database predictions from RegPrecise, S. pneumoniae is predicted to contain 11 carbohydrate regulatory genes including some described above (219). Transcriptional analysis of S. mutans grown in the presence of different carbohydrates revealed a complex expression pattern with carbohydrate utilization loci being constitutively expressed, broadly responding to multiple carbohydrates or tightly responsive to the corresponding substrate (12). No such comprehensive studies have been undertaken in S.

44 pneumoniae. Despite increasing knowledge about CcpA and other individual regulators, a relatively poor view of carbohydrate utilization regulation by S. pneumoniae remains a roadblock in fully understanding nutrient acquisition during colonization and disease.

1.6. Project hypotheses and goals

Recent research has begun to shed light on the complex and integral processes employed by S. pneumoniae for carbohydrate modification and utilization. Carbohydrates serve as the only source of carbon for S. pneumoniae growth and are therefore essential for both colonization and disease (300). As carbohydrates are not freely available in the airway, pneumococci most likely scavenge carbohydrates from glycoconjugates in the airway

(242). We have demonstrated that S. pneumoniae is able to modify both N-linked glycans and glycosaminoglycans and use liberated carbohydrates as the sole carbon source (54,

156, 195). However, it was unknown whether O-linked glycans could be utilized as well.

We hypothesized that in addition to N-linked glycans and glycosaminoglycans that S. pneumoniae modifies O-linked glycans and uses released carbohydrates as a carbon source in vivo. Modification of O-linked glycans would release Gal β1-3 GalNAc after removal of terminal sialic acid by the neuraminidase NanA. We propose that sialic acid released from both N-linked and O-linked glycans may be used by S. pneumoniae as a sole carbon source and we identified three candidate transporter loci that may encode a mechanism for transport of sialic acid. Two of the three candidate loci encode core components of ABC transporters, but bioinformatics analysis does not predict genes in these loci to encode the necessary ATPases for these transporters. Based on similarity to

45 genes encoding known carbohydrate ATPases, we hypothesize that open reading frame

SP1580 (msmK) encodes an ATPase that energizes carbohydrate ABC transporters.

Therefore the goals of the studies presented herein were three-fold: (i) identify the gene encoding the pneumococcal O-glycosidase and ascertain the contribution of O- glycosidase to colonization, (ii) determine whether sialic acid released from N-linked or

O-linked glycans could serve as a carbon source to S. pneumoniae, and if so, characterize the mechanism by which sialic acid is imported, and (iii) study the relationship between the proposed sugar ATPase MsmK and the core carbohydrate ABC transporters in S. pneumoniae.

Chapter 2: Identification of a pneumococcal glycosidase that modifies O-linked

glycans

Colonization of the airway by Streptococcus pneumoniae is typically asymptomatic; however, progression of the bacteria beyond the oronasopharynx can cause diseases including otitis media and pneumonia. The mechanisms by which S. pneumoniae establish and maintain colonization remain poorly understood. Both N-linked and O- linked glycans are abundant in the airway. Our previous research demonstrated that S. pneumoniae can sequentially deglycosylate N-linked glycans and suggested this modification of sugar structures may aid colonization. There is published evidence that S. pneumoniae expresses a secreted O-glycosidase that cleaves galactose 1-3 N- acetylgalactosamine (Gal1-3GalNAc) from core-1 O-linked glycans; however, the biological function of this enzyme has not been previously determined. We established that the activity is not secreted, but is instead surface associated in a sortase-dependent manner. Genome analysis revealed an open reading frame predicted to encode a sortase- dependent surface protein with sequence similarity to the O-glycosidase of

Bifidobacterium longum. Deletion of this pneumococcal open reading frame confirmed that this gene encodes an O-glycosidase. Experiments using a model glycoconjugate demonstrated that this O-glycosidase, together with the neuraminidase NanA, is required

47 for S. pneumoniae to cleave sialylated core-1 O-linked glycans. The ability of the O- glycosidase mutant to cleave this glycan structure was restored both by genetic complementation and addition of O-glycosidase. The mutant showed a reduction in adherence to human airway epithelial cells and significantly decreased ability to colonize the upper respiratory tract, suggesting that cleavage of core-1 O-linked glycans enhances the ability of S. pneumoniae to colonize the human airway.

2.1 Introduction

S. pneumoniae is the leading cause of community acquired pneumonia and also a major cause of otitis media, bacteremia and meningitis (100, 169, 254). While S. pneumoniae is an important human pathogen, the bacterium more frequently colonizes the oronasopharynx asymptomatically (87, 328). Although colonization is often cleared by the host, it is a necessary precursor to disease and therefore essential to pneumococcal pathogenesis. Despite the importance of this process, little is known about the mechanisms by which the bacterium establishes and maintains colonization.

The epithelial cell surface, host defense molecules, and the mucus layer are decorated with diverse sugar structures including both N- and O-linked glycans. S. pneumoniae is adept at manipulating sugars, encoding at least six surface associated glycosidases that likely modify human glycoconjugates (33, 59, 73, 215, 309, 346). We have previously demonstrated that S. pneumoniae glycosidases mediate sequential deglycosylation of N- linked glycans (156). This deglycosylation has been proposed to contribute to

48 colonization by providing sugar residues for bacterial growth, revealing receptors for adherence, and modifying the function of host defense molecules (54, 156). The ability of

S. pneumoniae to modify O-linked glycans and the contribution of this deglycosylation to pneumococcal pathogenesis has not yet been examined. In addition to contributing to pneumococcal pathogenesis by the mechanisms proposed for N-linked glycans, the deglycosylation of O-linked glycans could also contribute to pathogenesis by enabling progression through the mucus layer.

S. pneumoniae expresses an O-glycosidase, designated Eng, that acts to specifically cleave core-1 O-linked glycans (35, 45, 161, 309). The core-1 structure consists of a galactose 1-3 N-acetylgalactosamine (Gal1-3GalNAc) disaccharide linked to a serine or threonine residue (Fig. 2.1). This core structure can be further modified to create more complex glycan structures. The addition of terminal sialic acid, as shown in Fig. 2.1, is a common modification. This structure is present in the human airway, for example, decorating the hinge region of IgA (199). In conjunction with other glycosidases, including the neuraminidase NanA, O-glycosidase could enable S. pneumoniae to deglycosylate O-linked glycans. Despite the demonstration that S. pneumoniae expresses secreted O-glycosidase activity, any contribution of this glycosidase to pneumococcal pathogenesis has not been investigated.

In this study, we identify the gene encoding the pneumococcal O-glycosidase. The product of this gene is surface associated in a sortase-dependent manner, and our

Neuraminidase O-Glycosidase NanA Eng

2 3 1 3 1 O Ser/Thr

Sialic Acid Galactose GalNAc

Figure 2.1. Schematic representation of the core-1 O-linked glycan structure commonly found on human glycoconjugates. The sugar residues are labeled beneath their corresponding symbol. Lines represent linkages between the sugar residues and numbers above indicate the specific linkage. Arrows above the schematic indicate potential cleavage sites of the glycosidases.

evidence suggests that this gene encodes the only detectable O-glycosidase expressed by

S. pneumoniae. We also establish that the O-glycosidase cleaves the core-1 structure from glycoconjugates, following cleavage of terminal sialic acid by NanA. Furthermore, we identify a role for this enzyme in colonization of the upper respiratory tract and adherence to human epithelial cells, which suggest that the O-glycosidase may contribute to pneumococcal pathogenesis.

2.2 Materials and Methods

2.2.1. Bacterial strains, culture media, and chemicals. Parental and genetically modified strains of S. pneumoniae and the five pneumococcal clinical isolates utilized in this study are described in Table 2.1. The five clinical isolates represent five different multilocus sequence types and five distinct serotypes. Broth cultures were routinely grown at 37°C in Todd-Hewitt broth (Becton, Dickinson, and Company) supplemented with 0.2% w/v yeast extract (Becton, Dickinson, and Company) (THY). C media with

5% yeast extract (C+Y) pH 8 was used for transformations (165). S. pneumoniae was also grown at 37°C and 5 % CO2 overnight on tryptic soy (TS) (Becton, Dickinson, and

Company) plates with 1.5 % agar that were spread with 5000 units of catalase

(Worthington Biochemical Corporation) prior to plating bacteria. Mutants were selected on TS plates that contained either streptomycin (200 µg mL-1), or kanamycin (500 µg mL-1), as appropriate. Unless otherwise specified, all chemicals, substrates, and enzymes were purchased from Sigma Chemicals.

(2008) (2008) (2008) (2008) (2008)

(2001)

et al. et al. et al. et al. et al. et al. and Weiser

ender

Source or reference Tettelin B (2006) Dr J.Weiser N. This study This study This study This study This study Burnaugh Burnaugh This study This study Burnaugh Burnaugh This study This study Burnaugh

r r r r

) r

) r )] conferring )] conferring Sm )] conferring Sm )] conferring Sm )] conferring Sm

) (Sm 6T

(Sm .

K56T K56T K56T K5 ( ( ( (

K56T a (

) ) ) ) r r r r rpsL rpsL rpsL rpsL rpsL

) (Sm ) (Sm ) (Sm ) (Sm eng

) Δ r K56T K56T K56T K56T used in this studyused

( ( ( ( Thr RpsL [ in Thr RpsL [ in Thr RpsL [ in Thr RpsL [ in (Cm → → → → rpsL rpsL rpsL rpsL

genetically reconstitutedgenetically

r eng eng nanA eng eng Characteristics/genotype Clinical isolate Lys56 Cm Δ Lys56 Δ eng Δ Clinical isolate Clinical isolate Lys56 Δ Clinical isolate Clinical isolate Lys56 Δ Clinical isolate indicates resistance to chloramphenicol. to resistance indicates

Serotype 4 4 4 4 23F 23F 23F 23F 15B/C 23F 23F 23F 35F 6A/B 6A/B 6A/B 19A Streptococcus pneumoniae

nanA

r r

eng Δ r /

eng eng

srtA eng r 1: Strains of Δ

Δ Δ eng eng eng

2. Δ Δ Δ indicates resistance to streptomycin; Cm to streptomycin; resistance indicates

r Table NameStrain TIGR4 TIGR4 Sm TIGR4 TIGR4 1121 Sm 1121 1121 1121 C06_29 C06_31 C06_31 Sm C06_31 C06_39 C06_57 C06_57 Sm C06_57Δ C06_58 a. Sm

2.2.2. Mutation of glycosidases. An unmarked mutant in SP0368, the last open reading frame in the predicted transcriptional unit, was generated using the Janus cassette selection system (295). Construction of mutant using this method requires two rounds of transformation. The first round introduces a Janus cassette, which contains kanamycin resistance and streptomycin sensitivity (rpsL+) genes, into the genome of a streptomycin- resistant (Smr) S. pneumoniae strain in place of the gene of interest. DNA fragments flanking the region to be deleted were amplified (primers O.1 and O.2, and O.4 and O.5) and sequentially joined to the Janus cassette PCR product (primers J.1 and J.2) using a variation on the splicing by overlap extension (SOE) by PCR process (54), first described by Horton et al. (133). All genomic DNA was prepared as previously described (335). In order to minimize PCR generated errors, all PCRs were conducted using a high-fidelity proofreading polymerase (Pfx-50; Invitrogen). The Janus construct was transformed into

S. pneumoniae; the transformants were selected on kanamycin, and confirmed by PCR

(O.7 and O.8). The second round of transformation replaced the Janus cassette with an engineered segment of DNA consisting of the two DNA fragments flanking SP0368 spliced together via SOE. Fragments flanking SP0368 were amplified using primers O.1 and O.3 (upstream fragment) and O.5 and O.6 (downstream fragment). Construction of an unmarked SP0368 mutant (1121 eng) was confirmed by PCR with primers flanking the construct (O.7 and O.8) and sequencing (Table 2.2). The complemented strain (1121

eng/eng+) was generated by transforming 1121 eng with the Janus construct and then subsequently with 1121 Smr DNA. Complementation was confirmed by PCR with primers flanking the construct (O.7 and O.8) and activity assays. To further investigate

247527(AE005672) 340586(AE005672) 341364(AE005672) 341364(AE005672) 346604(AE005672) 347451(AE005672) 346604(AE005672) 340467(AE005672) 347718(AE005672) 343759(AE005672) 343487(AE005672) ------1972 (V01277) 1126 (V01227) 1037 (U43526) - - - 169(X72967)

30 (AY334019) -

Location (accessionLocation number) 149 1953 1101 1008 7 247511 340567 341344 341344 346586 347431 346586 340450 347691 343742 343468

. ( 3 ) ( 3

and J.2

( 2 ) ( 2 CATTTTTGAGCAAGCGTTTACA

O.6 O.6

TGCCAGCAACAGGTGAGAG

( 1 ) ( 1

ATTTTTGAGCAAGCGTTTACA

) 5' → 3'5' (

Primer SequencePrimer TATCGAGTAGGGTAGTTCTT ACGGGGCAGGTTAGTGACAT TAGTTCAACAAAGGAAAATTGGATAA AGCACGAACTGGAATCTTACCT CCGTTTGATTTTTAATGGATAATG GGGCCCCTTTCCTTATGCTT CTGCTGGCGAAGACTGGGAT CATTATCCATTAAAAATCAAACGG CTCACCTGTTGCTGGCAC AAGCATAAGGAAAGGGGCCC GTGCCATGAAAGAAACGACAG TGCCAGCAACAGGTGAGAG GCGTCCAATCTATGAAAC CAGCCGTGGAAACTCTAAACA AGCGCCAGCCTTGTTTGT AACGCTTCAGAAACTTATCC

3 Number N.1 N.2 N. N.4 J.1 J.2 O.1 O.2 O.3 O.4 O.5 O.6 O.7 O.8 O.9 O.10 2: used in Primers study.this

gly Underlining indicatesUnderlining reverse complement sequence primerof J.1 Group Table nanA Janus o a

54 the pneumococcal O-glycosidase, unmarked mutations were also generated in TIGR4 and two recent clinical isolates (C06_31 and C06_57). The gene encoding the pneumococcal neuraminidase, NanA, is predicted to be in single transcriptional unit (300). Therefore, an insertion-deletion mutant was constructed in strain 1121 eng as previously described and confirmed by PCR and sequencing using primers A.1 and A.2; A.3 and A.4 (156).

Growth rates and maximum optical densities at 600 nm (OD600) were not significantly different for mutant strains as compared to parental strains (data not shown). As opacity can also affect adherence of S. pneumoniae, all mutants were confirmed to be of the same opacity as their parental strains (80, 111, 152).

2.2.3. O-glycosidase activity. O-glycosidase activity was measured using the colorimetric substrate Gal1-3GalNac1pNP (Calbiochem). Bacterial strains were grown to the appropriate OD600. Aliquots of the culture were lysed with toluene, to prevent growth during the assay, and used for activity assays. The reaction was started with the addition of 40 l of 50 mM sodium acetate buffer (pH 5.0) containing 250 M Gal1-

3GalNac1pNP to 40 l of bacterial sample. After incubation at 37oC for 1 hr, the reactions were stopped with the addition of 60 l of 1 M sodium carbonate. The reactions were centrifuged to remove any bacterial cells and the amount of p-nitrophenol released was determined by measuring absorbance at 400 nm. All assays were performed in triplicate on three independent occasions. An appropriate media alone control was subtracted from all data.

2.2.4. Deglycosylation of O-linked glycans. To assess the ability of pneumococci to cleave O-linked glycans from glycoconjugates, lectin blots were performed on samples incubated with different bacterial strains and glycosidases. Bacterial cultures were grown to stationary phase, then 20 l of culture was added to 0.2 µg of fetuin, and the reactions were incubated at 37°C overnight. Controls consisting of media alone incubated overnight with the protein were also performed. To terminate the reactions, gel-loading buffer was added and samples were placed at −20°C. Where specified, the following enzymes were added: 0.0008 units of purified Clostridium perfringens neuraminidase

(resuspended in 10 mM potassium phosphate buffer pH 7), 0.00016 units of S. pneumoniae O-glycosidase (in 50 mM sodium phosphate pH 7.5) (QA Bio). These quantities of glycosidases were selected by in vitro assays, which demonstrated that they possessed approximately the same level of activity as that of 20 µl of stationary phase culture.

To investigate deglycosylation following glycosidase treatment, sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) (12.5%) was performed, samples were transferred onto Immobilon-P membranes (Millipore), and were detected using lectins

Maackia amurensis agglutinin (MAA), Peanut agglutinin (PNA), and Datura stramonium agglutinin (DSA) from the DIG glycan differentiation kit (Roche), according to manufacturer’s instructions. MAA recognizes terminal sialic acid α2-3 linked to galactose, PNA recognizes terminal galactose 1-3 linked to N-acetylgalactosamine and

DSA recognizes GlcNAc present in both N- and O-linked glycans. The contrast on digital images was manipulated using Adobe Photoshop Elements 2.0.

2.2.5. Adherence of S. pneumoniae to human epithelial cells. The contribution of

SP0368 to pneumococcal adherence was tested essentially as previously described (111,

156). Adherence of the parental strain and eng mutants to Detroit 562 cells, (ATTC CCL-

138) a human pharyngeal epithelial carcinoma cell line, was assessed. To more accurately mimic the interaction of bacteria with the epithelial cell layer, the protocol was altered so that bacterial cells were not centrifuged onto the epithelial cells. Adherence after 60 min of incubation was expressed as a percentage of parental strain, 1121 Smr, adherence under the same experimental conditions. Where indicated 0.0000125 or 0.000625 U of recombinant O-glycosidase per 1.9 cm2 of well surface area was added with the bacterial inoculum. Three independent experiments performed in triplicate were used for statistical analysis.

2.2.6. Mouse model of pneumococcal colonization. Nasopharyngeal colonization was performed essentially as described previously (201). For 1121 Smr,1121 Δeng, and 1121

ΔnanA Δeng, 20 six to eight week-old C57BL/6 mice were inoculated intranasally with 2 x 107 midlog phase organisms. The density of colonization was assessed by upper respiratory tract lavage and quantitative culture in 10 mice at 36 hours and the remaining mice at day 5. The animal data are presented as the mean (cfu ml−1) ± SEM (standard error of the mean).

2.2.7. Statistical analysis. O-glycosidase activity of mutants and adherence assays were compared by two-tailed Student’s t-tests. Analysis of variance (ANOVA) was used to assess differences in activity between recent clinical isolates. Differences in the ability of strains to colonize mice were assessed by one-tailed Student’s t-tests.

2.3. Results

2.3.1. Analysis of the pneumococcal genome identified a putative O-glycosidase. S. pneumoniae is known to express O-glycosidase activity (35, 95, 309), which was previously detected in culture supernatants (95); however the majority of other pneumococcal glycosidases are predicted to be surface associated in a sortase-dependent manner (300). To narrow the number of O-glycosidase candidate genes, we investigated whether the S. pneumoniae protein is surface associated and if sortase A (SrtA) is required for surface localization. The O-glycosidase activity associated with the whole culture, cells, and supernatant of TIGR4 and TIGR4 srtA was determined. While the majority of the O-glycosidase activity was cell associated in the parental strain, mutation of srtA resulted in the majority of the activity being secreted (Fig. 2.2). These data demonstrate that the O-glycosidase, like the majority of other pneumococcal glycosidases, is surface associated in a sortase-dependent manner.

There are 19 predicted sortase-dependent cell associated proteins in the TIGR4 genome

(300). Basic Local Alignment Search Tool (BLAST) (http://www.ncbi.nlm.nih.gov/ blast/Blast.cgi) demonstrated that one of the open reading frames predicted to encode a

0.25

0.20

0.15

0.10

0.05 * ** Optical Optical Density (400nm) 0

TIGR4 TIGR4 ΔsrtA

Figure 2.2. O-glycosidase activity is cell associated in a sortase-dependent manner. O- glycosidase activity was compared in TIGR4 and a sortase mutant (TIGR4 ΔsrtA). Strains were grown to stationary phase, and when noted, centrifuged to separate cells from supernatants prior to toluene treatment. Reactions were incubated for 1 hr with the colorimetric substrate Gal1-3GalNac1pNP. Reactions were stopped with 1 M sodium carbonate and activity was measured by optical density at 400 nm. Values are the mean of three independent experiments ± standard deviation. *Indicates a significant difference between TIGR4 total and supernatant (P<0.0001). **Indicates a significant difference between TIGR4 ΔsrtA total and cell (P<0.0002).

59 sortase-dependent cell associated protein, SP0368, shared a high level of sequence similarity to engBF of Bifidobacterium longum (38% sequence identity and 54% sequence similarity over 1749 amino acids), which encodes a protein with core-1 specific

O-glycosidase activity (103). SP0368 is predicted to encode a 137.8 kDa protein, which in addition to encoding a predicted secretion signal (amino acids 1-38) and an LPXTG motif is also predicted to encode a family 32 carbohydrate binding module CBM32

(amino acids 1497-1601) (190). This locus is distal to, but predicted to be in the same transcriptional unit as the polypeptide transporter, AliA (Fig. 2.3A) (300).

2.3.2. SP0368 encodes an O-glycosidase. To determine if SP0368 encodes an O- glycosidase, a non-polar unmarked deletion was constructed in the 1121 background.

Successful construction of the mutant was confirmed by both PCR and sequencing. 1121

eng was shown to lack O-glycosidase activity using the colorimetric substrate Gal1-

3GalNac1pNP (Fig. 2.3B). SP0368 was previously proposed to be essential for in vitro growth of TIGR4 (285); however, we were also able to construct a mutant in TIGR4 and the resulting strain had no detectable O-glycosidase activity (data not shown). Together these data suggest that SP0368 is not essential for in vitro growth and that this gene encodes the only pneumococcal O-glycosidase detectable under these assay conditions.

All 29 pneumococcal genome sequences available contain a homologue of SP0368 and have low levels of sequence diversity, up to 3.4%, at the amino acid level. These sequence changes were not evenly distributed throughout the predicted sequence

aliA SP0368 pbp1A

SP0364 SP0369 1 Kb

B. 0.25

0.20

0.15

0.10

0.05 *

0 Optical Optical Density (400nm)

-0.05 r 1121 Sm 1121 Δeng

Figure 2.3. SP0368 encodes the pneumococcal O-glycosidase (Eng). (A) Schematic representation of the genetic region surrounding the putative O-glycosidase gene, SP0368. Open reading frames from the TIGR4 sequence are represented by block arrows. Arrows above the schematic indicate predicted transcription start sites. (B) O-glycosidase activity in 1121 Δeng is significantly reduced compared to 1121 Smr. Strains were grown to stationary phase, toluene lysed, and incubated for 1 hr with the colorimetric substrate Gal1-3GalNac1pNP. The reaction was stopped with 1 M sodium carbonate and activity was measured by optical density at 400 nm. Values are the mean of three independent experiments ± standard deviation. *Indicates a significant difference between 1121 Smr and 1121 Δeng (P<0.002).

61 suggesting that the locus may have evolved by recombination. In addition, one strain contains a 15 bp duplication at nucleotide 367, which results in a five amino acid insertion. Although there were statistically significant differences in O-glycosidase activity amongst different recent clinical isolates, the five isolates tested all contained

SP0368 homologues and expressed O-glycosidase activity (Fig. 2.4 and data not shown).

Deletion of SP0368 in two of these recent clinical isolates (C06_31 and C06_57) resulted in the absence of detectable O-glycosidase activity. These data further support the hypothesis that all pneumococcal strains encode an O-glycosidase and that SP0368 encodes the only pneumococcal O-glycosidase activity.

2.3.3. NanA and Eng sequentially deglycosylate O-linked glycans. Previously published work demonstrated that S. pneumoniae sequentially deglycosylates N-linked glycans on human proteins (156). We used the model glycoconjugate fetuin to determine if S. pneumoniae can sequentially deglycosylate O-linked glycans, which are also common in the airway. Fetuin is a well characterized serum protein that has an average of three N-linked glycans and three O-linked glycan chains per molecule (288-291). The majority of the O-linked glycan chains on fetuin are the sialylated core-1 structure (Fig.

2.1) (342), which is also present on many proteins in the human airway, including IgA.

The extent of deglycosylation was determined using the lectins MAA and PNA, which detect terminal sialic acid 2-3 linked to galactose and terminal Gal1-3GalNAc, respectively (Fig. 2.5). Incubation of fetuin with the parental strain, 1121 Smr, resulted in

0.20

0.15

0.10

0.05 Optical Optical Density (400nm)

0.00

Figure 2.4. Levels of O-glycosidase activity differ between strains. Five recent clinical isolates of different genetic backgrounds and serotypes were used to investigate difference in enzyme activity between strains. 1121 Smr and 1121 eng were used as controls. Strains were grown to an optical density of 0.6 at 600 nm, toluene lysed, and incubated for 1 hr with the colorimetric substrate Gal1-3GalNac1pNP. The reaction was stopped with 1 M sodium carbonate and activity was measured by optical density at 400 nm. Values are the mean of three independent experiments ± standard deviation. Analysis of variance (ANOVA) demonstrated that the O-glycosidase activity between the recent clinical isolates were significantly different (P 0.001).

A. M 1121 Smr 1121Δogly 1121ΔoglyΔnanA +O ogly+ +N +O +NO 76 kDa

31 kDa

B. M 1121 Smr 1121Δogly 1121ΔoglyΔnanA +O ogly+ +N +O +NO 76 kDa

31 kDa

Figure 2.5. Neuraminidase and O-glycosidase sequentially deglycosylate fetuin. Media alone (M) or stationary phase cultures of 1121 Smr, 1121 Δeng, 1121 eng/eng+ (eng+), and 1121 ΔnanA Δeng were incubated overnight with 0.2 µg of fetuin at 37ºC. Where indicated, 0.0008 units of purified Clostridium perfringens neuraminidase (+N) or 0.00016 units of recombinant S. pneumoniae O-glycosidase (+O) were added. Following incubation, samples were resolved by SDS-PAGE (12.5%), transferred to a membrane and detected by lectins MAA (A) and PNA (B) that detect 2-3 linked sialic acid and Gal1-3GalNAc, respectively.

64 removal of all detectable O-linked glycans as determined by the absence of binding of both MAA and PNA. As predicted, terminal sialic acid was detected following incubation of fetuin with media alone. The presence of the protein in all lanes was confirmed by a third lectin, DSA, which detected the GlcNAc present in the N-linked glycan structures of fetuin (77) (data not shown).

We predicted that deglycosylation of O-linked glycans is dependent on the activity of neuraminidase NanA, and the O-glycosidase encoded by SP0368. The Eng mutant cleaved only the terminal sialic acid to expose Gal1-3GalNAc, as detected by the binding of PNA. Cleavage of the disaccharide could be restored by both addition of pneumococcal O-glycosidase, and by genetically complementing the mutant (1121

eng/eng+). Neuraminidase NanA, has previously been shown to contribute to cleavage of terminal sialic acid from N-linked glycans. To confirm a role for NanA in deglycosylation of O-linked glycans, a double mutant, 1121 eng nanA, was shown to be unable to modify O-linked glycans, as determined by the detection of terminal sialic acid. Addition of purified neuraminidase resulted in the exposure of Gal1-3GalNAc, while the addition of both neuraminidase and O-glycosidase resulted in cleavage of the entire glycan structure. These data demonstrate that S. pneumoniae can sequentially deglycosylate O-linked glycans and that NanA and Eng are essential for this activity in this model system.

2.3.4. Eng contributes to pneumococcal adherence and colonization. In order to investigate the in vivo contribution of the O-glycosidase, 1121 Δeng, 1121 eng nanA and 1121 Smr were compared in a mouse model of nasopharyngeal colonization. We hypothesized that the O-glycosidase mutant would be significantly reduced in adherence.

A significant reduction in the level of upper respiratory tract colonization (P ≤ 0.05) between 1121 Δeng (2.10 ± 0.90 × 103) and 1121 Smr (2.52 ± 1.34 × 104), and 1121 eng

nanA (2.34 ± 1.3 × 103) and 1121 Smr (2.52 ± 1.34 × 104), was observed at 36 hours post inoculation. There was no significant difference in the level of upper respiratory tract colonization between 1121 eng and 1121 eng nanA. By five days post inoculation there were no significant difference in the ability of the three strains to colonize the upper respiratory tract of mice [1121 Δeng (3.30 ± 1.04 × 103), 1121 eng nanA (6.60 ± 2.62

× 103) and 1121 Smr (1.00 ± 0.21 × 104)].

The ability of S. pneumoniae to modify O-linked glycans may contribute to pneumococcal pathogenesis in multiple ways. Adherence to the epithelial cell surface is likely essential to pneumococcal colonization. A significant reduction in adherence for

1121 eng to upper airway epithelial cells (D562) was observed, as compared to that of the parental strain (Fig. 2.6). Genetic complementation of the mutation (1121 eng/eng+) restored parental levels of adherence. A neuraminidase mutant of 1121 did not show any reduction in adherence to D562 cells, suggesting cleavage of sialic acid is not required for the role of Eng in pneumococcal adherence (data not shown). The adherence of the O- glycosidase mutant was not complemented by the addition of recombinant enzyme,

120 100 80 * 60 40 20

Relative Relative Adherence (%) 0

Figure 2.6. Relative adherence of an eng mutant to human epithelial cells is reduced. 1121 Smr, 1121 Δeng and 1121 Δeng/eng+ were grown to an optical density of 0.6 at 600 nm and adherence to D562 cells was determined. Mutant strain adherence is expressed as a percentage of parental strain adherence over a 60 minute incubation period under the same conditions. Values are the mean of three independent experiments ± standard deviation. *Indicates a significant difference between 1121 Δeng and 1121 Smr (P<0.02).

67 despite the use of enzyme in excess of that produced by the number of bacteria included in the assay (data not shown).

2.4. Discussion

These data demonstrate that SP0368 encodes an O-glycosidase and supports the hypothesis that this enzyme is a member of the recently identified glycoside hydrolase family 101 (103). Recently Caines et al. (2008), published the structure of the protein encoded by SP0368 and independently demonstrated that this recombinant protein possessed O-glycosidase activity (58). Here, we explore the biological relevance of this enzymatic activity. Our studies using lectin blots demonstrate that this enzyme, in conjunction with NanA, deglycosylates a model glycoconjugate. In addition, we demonstrate the first biological function of this protein, demonstrating that it contributes to pneumococcal colonization of the upper respiratory tract and to adherence to human epithelial cells.

Pneumococcal O-glycosidase activity was previously proposed to be secreted (95). Our studies demonstrate that Eng is surface associated in a sortase-dependent manner and suggest that the activity detected in culture supernatants was likely due to enzyme released from the surface during cell wall turnover. This mechanism of surface attachment is utilized by the majority of pneumococcal glycosidases suggesting that the surface localization of these enzymes may be important for their contribution to pathogenesis.

A mutagenesis screen of pneumococcal open reading frames in TIGR4 suggested that

SP0368 may be essential for growth in vitro (285). We successfully deleted this locus in

TIGR4 and three other genetic backgrounds. Song et al. proposed that genes which could not be mutated in three attempts were essential; however, this designation was not confirmed. The construction of a mutant allowed us to extend previous observations by demonstrating that SP0368 encoded the only detectable O-glycosidase expressed by pneumococci. The construction of an O-glycosidase mutant also allows us to investigate the contribution of this enzyme to pathogenesis.

Published data demonstrate that the protein encoded by SP0368 is expressed in vivo; as convalescent sera contain antibodies that react with the protein and immunization with the protein provided significant protection against intravenous challenge in mouse models of infection (108). All available genome sequences contained this gene and all strains tested expressed detectable O-glycosidase activity; suggesting that this enzyme activity is common to all S. pneumoniae strains. Giefing et al. (2008) reported that SP0368 was absent in approximately 8% of isolates screened (108). This disparity may be explained by the sequence diversity within the gene, resulting in a failure to detect the gene by

PCR.

Our findings demonstrate that Eng and NanA are required to cleave sialylated core-1 O- linked glycans from glycoconjugates. This expands our previous finding that S. pneumoniae can sequentially deglycosylate N-linked glycans and demonstrates that

69 pneumococcal glycosidases can also sequentially deglycosylate O-linked glycans (156).

Recently published data support a role for NanA in modification of mucin, which is heavily decorated with O-linked glycans (343). These authors propose that cleavage of sialic acid from mucin supports growth of S. pneumoniae; although, as mucin contains both N- and O-linked glycans it was unclear which structures were being cleaved by

NanA. In this study, we demonstrated that NanA cleaves terminal sialic acid from O- linked glycans.

We recently reported that under some conditions, a second pneumococcal neuraminidase

NanB, contributes to cleavage of terminal sialic acid from N-linked glycans (54). We cannot rule out a role for NanB in modification of O-linked glycans, although there was no detectable cleavage of sialic acid by the NanA mutant in this study. In addition, recently published data suggest that the main function of NanB may be as an intramolecular trans-sialidase (114). This study utilized a simple and well characterized

O-linked glycan. It is possible that other pneumococcal glycosidases could contribute to the deglycosylation of more complex structures.

Our demonstration that O-glycosidase mutants were reduced in the ability to colonize the upper respiratory tract of mice suggests that the degradation of O-linked glycans may contribute to pneumococcal pathogenesis. A significant reduction in colonization was observed at 36 hours post inoculation, but not at five days. These data imply that the

70 enzyme contributes to establishment of colonization; although, further studies would be required to investigate this possibility.

Pneumococcal modification of N-linked glycans is proposed to alter the clearance function of host defense molecules, expose binding sites on the epithelial surface, and contribute to bacterial growth (54, 156). Modification of host O-linked glycans may also contribute to pneumococcal pathogenesis by multiple mechanisms. Published data imply that S. pneumoniae binds to host cell glycoconjugates including GalNAc1-4Gal found in gangliosides GM1 and GM2 (163), the glycolipid globoside (GalNAc1-3Gal1-

4Gal1-4GlcCer) (79), and the naturally occurring milk oligosaccharide lacto-N- neotetraose (LNnT)(17). If S. pneumoniae utilizes glycans as receptors on epithelial cells, it is possible glycosidases act to expose these receptors. This possibility is strengthened by the previous finding that pneumococcal glycosidases neuraminidase NanA, and - galactosidase BgaA, play a role in adherence of some strains (156). Together these data suggest that pneumococcal O-glycosidase may contribute to bacterial adherence.

The significant reduction in adherence to human epithelial cells suggests that the degradation of O-linked glycans may contribute to pneumococcal adherence. The residual adherence of the Eng mutant is presumably as a result of other adherence mechanisms perhaps including those previously identified (78, 347). Given the critical nature of adherence to colonization, there are likely several mechanisms each of which will have to be elucidated individually (118). The mechanism by which the O-

71 glycosidase contributes to adherence is unclear. The absence of a role for neuraminidase in adherence of 1121 suggests that sequential deglycosylation of O-linked glycans does not contribute to adherence of this strain. 1121 eng could not be complemented by the addition of purified enzyme. This result may be due to the level of O-glycosidase activity under the conditions utilized or our inability to add sufficient enzyme. Alternatively, these data may suggest that the role of O-glycosidase in adherence is independent of its enzymatic activity.

In summary, we have identified the gene encoding the pneumococcal O-glycosidase. This enzyme in conjunction with the neuraminidase NanA, sequentially deglycosylates O- linked glycan structures found in humans. These findings highlight that modification of both N- and O-linked glycans likely contributes to pneumococcal colonization.

Furthermore, we identify the first putative function for this enzyme in pneumococcal pathogenesis. Given the wide distribution of O-linked glycans, further investigation will likely reveal multiple functions for bacterial modification of these structures in pneumococcal pathogenesis.

Chapter 3: Sialic acid transport contributes to pneumococcal colonization

Streptococcus pneumoniae is a major cause of pneumonia and meningitis. Airway colonization is a necessary precursor to disease, but little is known about how the bacteria establish and maintain colonization. Carbohydrates are required as a carbon source for pneumococcal growth and, therefore, for colonization. Free carbohydrates are not readily available in the naso-oropharynx; however, N- and O-linked glycans are common in the airway. Sialic acid is the most common terminal modification on N- and O-linked glycans, and is likely encountered frequently by S. pneumoniae in the airway. Here we demonstrate that sialic acid supports pneumococcal growth when provided as a sole carbon source. Growth on sialic acid requires import into the bacterium. Three genetic regions have been proposed to encode pneumococcal sialic acid transporters: one sodium solute symporter, and two ATP binding cassette (ABC) transporters. Data demonstrate that one of these, satABC, is required for transport of sialic acid. A satABC mutant displayed significantly reduced growth on both sialic acid and the human glycoprotein, alpha-1. The importance of satABC for growth on human glycoprotein suggests that sialic acid transport may be important in vivo. Indeed, the satABC mutant was significantly reduced in colonization of the murine upper respiratory tract. This work demonstrates that S. pneumoniae is able to use sialic acid as a sole carbon source and that utilization of sialic acid is likely important during pneumococcal colonization. 73

3.1. Introduction

Streptococcus pneumoniae (pneumococcus) is responsible for over one million deaths per year worldwide (339). Although asymptomatic, colonization of the naso-oropharynx is required for the bacteria to cause disease (328). Relatively little is known about pneumococcal growth and colonization of the airway. Carbohydrates provide a carbon source to the bacteria and are therefore necessary for growth. Free carbohydrates are not readily available in the airway where initial colonization occurs (242). Instead, carbohydrates are found in the form of glycan modifications on human lipids and proteins.

S. pneumoniae express at least nine surface-associated glycosidases that modify host glycans (for review, see (154)). The ability to deglycosylate host glycans could contribute to bacterial survival by multiple mechanisms including but not limited to: providing a carbon source for growth, modifying function of host clearance molecules, competing with other bacteria for a niche, aiding in movement through the mucin layer and promoting adherence to epithelial cells (54, 81, 156, 280, 308, 343). It was previously demonstrated that pneumococci sequentially deglycosylate both N- and O-linked glycan structures (156, 194). We have demonstrated that S. pneumoniae can grow on a human protein decorated with N-linked glycans and that this growth is dependent on the ability of the bacteria to sequentially deglycosylate this structure (54). The most common terminal carbohydrate present on N- and O-linked glycans is sialic acid, which is cleaved by pneumococcal neuraminidase NanA. As sialic acid is the initial sugar released during

74 sequential deglycosylation, we hypothesize it will contribute to pneumococcal growth in vivo.

Further supporting our hypothesis that sialic acid can be utilized for growth, S. pneumoniae is predicted to encode required proteins for the catabolism of sialic acid (14).

While the catabolic enzymes appear to be conserved amongst many bacterial species, four distinct mechanisms of sialic acid transport have been identified: the major facilitator superfamily, sodium solute symporters, tripartite ATP-independent transporters, and ATP-binding cassette (ABC) transporters (13, 14, 246, 265, 277, 292,

323). Through a bioinformatics approach, a putative sodium solute symporter encoded by open reading frame SP1328 in strain TIGR4 was initially predicted to be the primary pneumococcal sialic acid transporter (300, 322). Based on similarity to known sialic acid transporter components, it was later suggested that putative permease components of the

ABC transporters SP1681-3 and SP1688-90 may also be involved in sialic acid uptake

(14).

Here, we show that S. pneumoniae can utilize sialic acid as a carbon source for growth.

Furthermore, using mutants in the three predicted transporters we identify the ABC transporter encoded by SP1681-3 as the primary sialic acid transporter. This sialic acid transporter contributes to growth on a human glycoprotein and colonization in vivo.

Together, these data suggest that sialic acid transport may be important for pneumococcal pathogenesis.

3.2. Materials and Methods

3.2.1. Bacterial strains, culture media, and chemicals. Parental and genetically modified strains of S. pneumoniae utilized in this study are described in Table 3.1. Broth cultures were routinely grown at 37°C in Todd-Hewitt broth (Becton, Dickinson, and

Company) supplemented with 0.2% w/v yeast extract (Becton, Dickinson, and Company)

(THY). C media with 5% yeast extract (C+Y) pH 8.0 was used for transformations.

Chemically defined medium (CDM) was used for growth analyses and was supplemented with no sugar, 12 mM glucose, 12 mM sialic acid, or 5 mg ml-1 alpha-1 glycoprotein

(AGP), as indicated (159). S. pneumoniae was also grown at 37°C and 5% CO2 overnight on tryptic soy agar plates (Becton, Dickinson, and Company) spread with 5000 U of catalase (Worthington Biochemical Corporation) prior to plating bacteria as well as on trypic soy agar plates supplemented with 5% sheep blood (Becton, Dickinson, and

Company). Bacteria were selected on tryptic soy agar plates that contained streptomycin

(200 µg ml-1), kanamycin (500 µg ml-1), chloramphenicol (2.5 µg ml-1) or neomycin (20

µg ml-1), as appropriate.

Unless otherwise specified, all chemicals, substrates, and enzymes were purchased from

Sigma Chemicals.

3.2.2. Construction of mutants. Unmarked, in-frame deletions of the putative sialic acid transporters were generated using the Janus cassette selection system (295). This method requires two rounds of transformations. The first round introduces an engineered cassette

(2008) (2008) (2008) (2008) (2008) (2002) (2001) (2009)

al.

et al. et al. et al. et al. et al.

et et al. et al. and Weiser

Source or reference McCool Marion This study This study This study This study This study This study This study Tettelin Bender (2006) This study This study This study This study Burnaugh Burnaugh Burnaugh Burnaugh Burnaugh

Site Site of isolation blood BAL BAL BAL blood

) r ) (Sm

r r K56T (

) r rpsL

, ) ) (Sm +

) ) r r 90 - )] conferring Sm)] conferring Sm)] conferring K56T ) (Sm

( ) ) (Sm ) (Sm r 1688

+ )

K56T K56T r rpsL K56T ) ( ) ( )

r r r ( ) K56T K56T ) (Sm r

( ( a rpsL rpsL ) (Sm rpsL ) (Sm satABC ) (Sm ) (Sm

rpsL rpsL K56T , ) (Sm

( , +

+ 90 90/ 90 Δ1328 K56T - - - 90 ( - K56T K56T K56T

( rpsL ( ( K56T ( , ) r rpsL rpsL satABC Δ1688 Δ1688 Δ1688 . / rpsL

, (Cm 90 90/1688

- -

. satABC rpsL satABC satABC satABC nanA satABC rpsL satABC Characteristics/genotype Clinical isolate Lys56→Thr RpsL [ in Δ Δ Δ1688 Δ1688 Δ Δ Δ Clinical isolate Lys56→Thr RpsL [ in Δ satABC ΔSP1328 Δ Clinical isolate Clinical isolate Clinical isolate Clinical isolate Clinical isolate

to wild type

used in this studyused

Serotype 23F 23F 23F 23F 23F 23F 23F 23F 23F 4 4 4 4 4 4 22F 15B/C 23F 6A/B 19A .

+ 90

- . reconstituted 1688

+ satABC

+ 90 Δ1328 +

- + 90 90/ Streptococcus pneumoniae - - 90 - satABC Δ1688 / satABC Δ1688 Δ1688 /

90 90/1688

- -

satABC satABC satABC r 1: Strains of

satABC satABC satABC satABC nanA

3. Δ

indicates resistance to streptomycin

r indicates the genetic hasmutation been BAL BAL indicates bronchioalveolar lavage/aspirate Sm Table NameStrain 1121 1121 Sm 1121 Δ 1121 Δ 1121 Δ1688 1121 Δ1688 1121 Δ 1121 Δ 1121 TIGR4 TIGR4 Sm TIGR4 Δ TIGR4 Δ TIGR4 Δ1328 TIGR4 Δ C06_18 C06_29 C06_31 C06_57 C06_58

a b +

77 conferring kanamycin resistance and streptomycin sensitivity (rpsL+) into a streptomycin resistant (Smr) parental strain. Regions flanking the gene(s) of interest were amplified with primers 1 and 2, and 4 and 6, then sequentially joined to the Janus cassette using modified splicing by overlap extension (SOE) (54, 133). A high fidelity proofreading polymerase, Pfx-50, (Invitrogen) was used throughout to minimize PCR-generated errors and all genomic DNA was prepared essentially as described previously (335). All Janus constructs were transformed into pneumococci and transformants were selected on kanamycin and confirmed by PCR with primers 7 and 8, which flank the mutant construct. All primer sequences can be found in Table 3.2.

The second round of transformation replaced the Janus cassette with a DNA construct consisting of the fragments flanking the region to be deleted; these fragments were generated with primers 1 and 3, and 5 and 6 and joined by SOE PCR. Introduction of this construct restores kanamycin sensitivity and streptomycin resistance. Transformants were confirmed by PCR with primers 7 and 8 and genetic sequencing of this same region confirmed that no spurious mutations had been introduced during generation of the mutants. As opacity can also affect pneumococcal colonization and glycosidase expression all mutants were confirmed as being of the same opacity as that of their parental strains (155, 332).

All mutants have been genetically reconstituted by reintroducing the deleted region into the same genetic location in the same orientation through two additional rounds of

Continued (AE007317) 1505236 (AE007317) 1504662 (AE007317) 1504662 (AE007317) 1501086 (AE007317) 1501086 (AE007317) 1500724 1505419 (AE007317) 1500470 (AE007317) 1652146 (AE007317) 1652433 (AE007317) 1513804 (AE007317) 1513472 (AE007317) 1513472 (AE007317) 1510335 (AE007317) 1510335 (AE007317) 1509936 (AE007317) 1513907 (AE007317) 1509647 (AE007317) 1509893 (AE007317) 1510225 (AE007317) ------Location (accessionLocation number) 1505216 1504642 1504642 1501066 1501066 1500702 1505403 1500451 1652124 1652408 1513786 1513451 1513451 1510314 1510314 1509913 1513885 1509625 1509872 1510202

1 (5) 1

3 and C.5

3 ( 4 ) , B.5 , ( 3 ) J.R

( 2 ) A.5 A.5 ( 1 )

TCATCCATCACTCTCCTCTGT TTTTTCATCGTTCTTCTCTTTC

TTTTTCATCGTTCTTCTCTTTC TCATCCATCACTCTCCTCTGT

TCTACAAAATGGAGGGTATGC CTGTGAAGTAGACGAAAGAAGG

a AGGTC AGGTC

Primer SequencePrimer → (5' 3') CTATATGTTGTTCACGCATTC CATTATCAATTAAAAATCAAACGG GCATACCCTCCATTTTGTAGA GGAAAGGGGCCC TCTACAAAATGGAGGGTATGC GAATGCTACTGCCTCGTCTTTGA TTTGCAGGTCGTTTCTC TATTCTCATTTCTCTACCTC GCCTTTGAGGCGACAGC ACACGATGCCCCACTTCTTTCTG TGGTAATCGATTGTTTGGG CATTATCAATTAAAAATCAAACGG CCTTCTTTCGTCTACTTCACAG GGAAAGGGGCCC CTGTGAAGTAGACGAAAGAAGG GAAGCTGGTCTAGAAAATAAATAA GTTTAGGAACTTATGTGGGAGTA GGATTTGATAAGGGAATAGTTGA GTGTATTTTCAACTGCCTGTCC ATGCGAATGAATTAAACTATGGTC

Number A.1 A.2 A.3 A.4 A.5 A.6 A.7 A.8 A.9 A.10 B.1 B.2 B.3 B.4 B.5 B.6 B.7 B.8 B.9 B.10

2: used in thisPrimers study. 90 -

3. Underlining indicatesUnderlining reverse complement sequence primerof J.F Group Table satABC SP1688 a

1254134 (AE005672) 1253591 (AE005672) 1253591 (AE005672) 1252148 (AE005672) 1252148 (AE005672) 1251735 (AE005672) 1254280 (AE005672) 1251686 (AE005672) 1253090 (AE005672) 1252288 (AE005672) 1232203 (AE007317) 1231747 (AE007317) ------247527(AE005672) - 30 (AY334019) - (accessionLocation number) 1254113 1253572 1253572 1252127 1252127 1251714 1254259 1251664 1253070 1252270 1232187 1231725 7 247511

TAGATACCTGCAACCAACAC

GAAATTAAAGCGGATTCAAGTT

a SequencePrimer → (5' 3') GCAACAATGCGTCAAAATCCTC CATTATCCATTAAAAATCAAACGG AACTTGAATCCGCTTTAATTTC AAGCATAAGGAAAGGGGCCC GAAATTAAAGCGGATTCAAGTT TTCTTCAAAAGTCACCAACATA CAGCTATCCCACCTATTTATTT AGTTTTTTAACAGTTTCATCATT GTGATTCTGATTAGTGGTGTC ACAGCTGTTGGAGGAAGGA TGCAGTTCARAAACATWTTCTAA TGCTAGCCCATCATATTCGTTTGTTG CCGTTTGATTTTTAATGGATAATG GGGCCCCTTTCCTTATGCTT

C.1 C.2 C.3 C.4 C.5 C.6 C.7 C.8 C.9 C.10 RT.F RT.R J.F J.R

Group Table 3.2 Continued SP1328 aroE Janus

80 genetic transformation: one to reintroduce the cassette and the second to restore the original parental region. Growth of all strains was tested in rich medium to ensure that the mutation did not introduce generalized growth defects.

The glycosidase NanA is predicted to be encoded in a single gene transcript (300).

Therefore, an insertion-deletion mutation was constructed as previously described (155,

156).

3.2.3. RNA extraction and reverse transcriptase PCR. The Janus system of mutant generation is designed to generate unmarked mutants; however, as the genes encoding the predicted ABC transporters are predicted to be in operons, we demonstrated the mutants had no effect on transcription of the distal genes by reverse transcriptase PCR. RNA extraction was conducted using a modified RNeasy extraction protocol (Qiagen).

Bacteria were grown in THY to OD600 = 0.3 ± 0.01. Each 5 ml culture was centrifuged and resuspended in 500 μl of 10 mM Tris, 50 mM EDTA (pH 8) and cells were lysed by addition of 30 μl of sodium N-lauroyl sarcosinate (20% w/v) with incubation for 10 min at 37°C. Concentrated samples were combined with 2 ml of Tri-Reagent (MRC Inc.) and allowed to stand at room temperature for 5 min. A 400 μl aliquot of chloroform was added to each sample followed by gentle shaking for 15 s and then allowed to stand at room temperature for an additional 3 min. After centrifugation at 4000 x g at 4°C for 15 min, the aqueous layer was removed and 1 volume of 75% ethanol was added and mixed

81 by pipetting. Samples were then processed on RNeasy mini columns (Qiagen), eluted into

30 μl of RNAse-free water and quantified on a Nanodrop spectrophotometer.

After DNAse I treatment (Invitrogen), 1 μg of RNA was used for cDNA synthesis with

SuperScript II reverse transcriptase (Invitrogen) according to the manufacturer’s specifications. Parallel samples lacking reverse transcriptase were processed and served as a negative control for each sample to ensure purity of RNA isolation. cDNA and no reverse transcriptase negative control samples were tested by PCR; primers 9 and 10 were designed in the immediate downstream gene to the relevant mutations, and primers

RT.F and RT.R are within a control housekeeping gene, aroE (Table 3.2). Products were visualized by agarose gel electrophoresis and ethidium bromide staining.

3.2.4. Dialysis of human alpha-1 glycoprotein (AGP). Dialysis was conducted in order to remove any free sugar from AGP as previously described (54). The Slide-A-Lyzer dialysis cassette (10,000 molecular weight cutoff) was used according to the instructions of the manufacturer (Pierce). Human AGP was reconstituted at 10 mg ml-1 in distilled water (dH2O) and dialyzed against 2 L of dH2O at 4°C for 2 h and then overnight in fresh, prechilled dH2O (2 L). Samples were concentrated using Slide-A-Lyzer concentrating solution (Pierce) according to the instructions provided, and the protein was then extracted, diluted to the original volume, filter sterilized, and stored at 4°C.

3.2.5. Growth Assays. Growth assays were conducted essentially as described previously by our laboratory (54). S. pneumoniae strains were grown in THY medium to an OD600 of

0.6 ± 0.005, representative of exponential growth, and 1 ml was washed and resuspended in 130 μl of 1:1 phosphate buffered saline (PBS):catalase (3x104 U ml-1). 20 μl of bacterial suspension or PBS/catalase (no bacteria control) was added to 180 μl of CDM supplemented with the appropriate carbon source (12 mM glucose, 12 mM sialic acid, or

5 mg ml-1 AGP). Medium supplemented with glucose (12 mM) was used as a positive control in all experiments to confirm the viability of strains. Medium supplemented with no sugar served as a negative control in all experiments. Plates were incubated at 37oC in a BIO-TEK Synergy HT plate reader for at least 60 h and OD600 was measured every 20 min.

Data were corrected for path-length and the averages from triplicate no-sugar medium controls were subtracted from values for experimental wells. Results for triplicate wells were then averaged, and this value was considered as one datum point for further analysis. Data from at least three independent experiments were averaged, and the 95% confidence interval was calculated for each time point.

To determine if the growth of bacterial inoculums on rich media contributed to the delay observed in growth on sialic acid, as compared to glucose, we prepared inoculums from bacteria grown on sialic acid. Bacteria were prepared and grown on sialic acid in a 96- well plate as described above. When strains reached a path-length corrected OD600 of 0.3,

83 bacteria were harvested from the wells, pooled, washed in PBS and resuspended in 1:1

PBS:catalase. To ensure a fair comparison of growth between conditioned and non- conditioned bacteria it is important to use essentially identical bacterial inoculums. To achieve this goal a range of dilutions of the conditioned bacteria recovered from the plate was used to inoculate fresh sialic acid media. Enumeration of inoculums allowed selection of wells containing inoculums closest to but not exceeding the original inoculums.

3.2.6. Neuraminidase activity assay. Neuraminidase activity was measured using a fluorimetric assay (174). The fluorogenic substrate 2’-(4-methyl-umbelliferyl)-a-D-N acetylneuraminic acid (MUAN) was resuspended in 0.25 M sodium acetate buffer (pH 7) at 0.35% (wt/vol) and stored in aliquots at -20°C. After cultures were grown to an OD600 of 0.2 ± 0.01 in CDM supplemented with 5 mg ml-1 AGP, bacteria were toluene lysed. 10

μl of MUAN was mixed with 10 μl of bacterial lysate and incubated at 37°C for 5 min.

The reaction was stopped by the addition of 1.5 ml of 50 mM sodium carbonate buffer pH 9.6. The fluorescence was detected using a BIO-TEK Synergy HT plate reader at an excitation wavelength of 366 nm and an emission wavelength of 446 nm. The average fluorescence of controls with media alone was subtracted from the sample readings.

Experiments were conducted three times in triplicate; significance was determined by a two-tailed Student’s t-test, and a P-value below 0.05 was considered significant.

3.2.7. Southern blot. Distribution of SP1328 was assessed via Southern blot analysis.

Each 2 μg sample of genomic DNA was digested with the restriction enzyme EcoRV

(Fisher Scientific) for 2 h at 37°C. Samples were resolved on a 1% agarose gel and visualized by ethidium bromide staining to ensure that DNA was digested and present in each lane. The Turboblotter rapid alkaline transfer system (Whatman) was used according to the manufacturer’s instructions to transfer digested DNA to a polyvinylidine fluoride membrane. DNA was crosslinked to the membrane via UV radiation. The DNA probe was generated via PCR using primers C.9 and C.10 (Table 3.2) and labeled using the ECL Direct Nucleic Acid Labeling and Detection System (GE Life Sciences).

Hybridization was conducted as per the manufacturer’s instructions and followed by autoradiography to detect DNA binding.

3.2.8. Sialic acid transport assay. Cultures of parental and mutant S. pneumoniae strains were grown in THY broth to an OD600 of 0.6 ± 0.01. Each sample was pelleted, washed in PBS and concentrated in CDM without sugar to an OD600 = 2.0. CDM containing sialic acid was prepared such that [3H]-sialic acid (American Radiolabeled Chemicals Inc.) accounted for 1% total sialic acid. Triplicate 90 μl aliquots were first incubated for 3 min at 37°C to acclimate. CDM medium containing sialic acid was then added to the culture to achieve a final concentration of 2.5 μM. After incubation at 37°C for the designated time, reactions were terminated by filtration through 0.22 μm filters (Millipore). Filters were washed 3 times with 2 ml CDM without sugar. After air-drying the filters, 10 ml of

30% ScintiSafe LCS Cocktail (Fisher Scientific) was added to each sample. Incorporated

85 sialic acid was measured in a Packard Tri-Carb Liquid Scintillation Analyzer. Average measurements conducted with heat-killed bacteria were subtracted from each value. Data were normalized to label incorporated per 107 cells. Time course experiments were conducted twice in triplicate. All other transport experiments were conducted three times in triplicate. Where applicable, significance was determined by a two-tailed Student’s t- test and a P-value below 0.05 was considered significant.

3.2.9. Murine colonization. Nasopharyngeal colonization was performed as described previously (201). Groups of 10, 6 to 8 week-old female C57BL/6 mice (Jackson

Laboratory) were inoculated intranasally with 1 x 108 mid-log-phase organisms of 1121

Smr, 1121 ΔsatABC, 1121 ΔSP1688-90, 1121 ΔsatABC ΔSP1688-90, or 1121 ΔnanA.

After 5 days, the density of colonization was assessed by upper respiratory tract lavage and quantitative culture of recovered organisms on tryptic soy agar supplemented with neomycin. The animal data are presented as the mean colony forming units ml-1 ± SEM

(standard error of the mean). Significance was assessed by a two-tailed Student’s t-test; a

P-value below 0.05 was considered significant.

3.3. Results

3.3.1. S. pneumoniae can utilize sialic acid as a sole carbon source. We have previously demonstrated the ability of S. pneumoniae to remove sialic acid from both N- and O-linked glycans via neuraminidase cleavage (54, 156, 194). As sialic acid is found terminally positioned on glycoconjugates, S. pneumoniae likely encounters sialic acid

86 frequently in the airway (69). Release of sialic acid may thus provide S. pneumoniae with a source of carbohydrates necessary for growth. To first test whether sialic acid could be used as a sole carbon source, bacteria were grown in CDM supplemented with sialic acid.

Sialic acid was able to support significant pneumococcal growth (OD600=0.4), although, this growth was delayed and to a lower final optical density than growth in glucose at the same molar concentration (Fig. 3.1). Conditioning bacteria in sialic acid media resulted in a reduction, but not elimination, of the time taken to achieve the maximal optical density

(data not shown). These data suggest that the delay in growth on sialic acid is in part due to the prior growth of the bacteria in rich media.

To determine whether sialic acid can support the growth of diverse pneumococcal strains, recent clinical isolates of different serotypes and genetic backgrounds (Table 3.1) were tested for their ability to utilize sialic acid as a sole carbon source (data not shown).

While growth rate and maximal OD600 achieved varied, each strain tested grew on sialic acid, suggesting that the ability to utilize sialic acid is conserved. In order for S. pneumoniae to utilize sialic acid as a nutrient source, the bacteria must have a mechanism for import of the carbohydrate; however, no pneumococcal sialic acid transporter has yet been identified.

3.3.2. Proposed pneumococcal sialic acid transporters. Based on annotation of the

TIGR4 genome, three distinct genetic regions have been suggested to encode sialic acid transporters: a predicted sodium solute symporter SP1328, and two predicted ABC

0.9 12 mM sialic acid 0.8 12 mM glucose 0.7 0.6 0.5 0.4 0.3 0.2

Optical Density 600 nm 600 Density Optical 0.1 0 12 24 36 48 60 -0.1 Time (hours)

Figure 3.1. Sialic acid supports S. pneumoniae growth. 1121 Smr was grown on chemically defined medium for 60 h supplemented with 12 mM sialic acid, or 12 mM glucose as the sole carbon source. Growth was measured by the optical density at 600 nm. Data points are the mean of three independent experiments performed in triplicate. Gray shading indicates a 95% confidence interval.

88 transporters SP1681-3, and SP1688-90 (Fig. 3.2) (14, 277, 300, 322). Of these, the predicted sodium solute symporter (SP1328) was previously proposed to be the primary transporter (322). However, the open reading frame SP1328 is absent in at least half of pneumococcal strains (241, 322). By Southern blot analysis, strain 1121, and 4 of 5 recent clinical isolates tested were shown to lack homologs to SP1328, and yet were all able to maintain growth upon sialic acid (Fig. 3.1, data not shown). These data suggest that SP1328 is not the primary sialic acid transporter; therefore, initial efforts focused on determining the role of the two putative ABC transporters.

The open reading frames SP1681-3 and SP1688-90 are predicted to encode components of ABC transporters (Fig. 3.2) (300). Unlike the predicted symporter, both loci are considered to be part of the pneumococcal core genome (225). Presence of open reading frames SP1681-3 and SP1688-90 was confirmed in strain 1121 and five recent clinical isolates by PCR amplification (Table 3.1, data not shown). These genes exist in proximity to the genes encoding the two characterized neuraminidases, NanA and NanB, as well as a predicted sugar kinase (SP1675), a predicted N-acetylneuraminate lyase (SP1676), and a predicted N-acetylmannosamine-6-phosphate 2-epimerase (SP1685) (300). Together, this evidence suggests that one or both of these predicted ABC transporters are involved in sialic acid utilization.

3.3.3. SP1681-3 (satABC) is required for growth on sialic acid. In order to test whether

SP1681-3 or SP1688-90 contribute to growth on sialic acid, unmarked deletions were

SP1688-90 SP1681-3

nanA nanB nanE nanA nanK

SP1693 SP1674 1 kb

neuraminidase nanE nanA nanC nanK predicted transport component SP1331 SP1324

Figure 3.2. Schematic of regions encoding known and putative neuraminidases and transporters as found in S. pneumoniae strain TIGR4. Arrows indicate open reading frames. Neuraminidases are depicted in gray and predicted transporter components are depicted in black. Open reading frames predicted to be involved in sialic acid utilization are labeled as follows: sugar kinase nanK, N-acetylneuraminate lyase nanA (note this is distinct from neuraminidase nanA), and N-acetylmannosamine-6-phosphate 2-epimerase nanE.

90 constructed, resulting in strains 1121 Δ1681-3, 1121 Δ1688-90, and 1121 Δ1681-3

Δ1688-90. Mutations were confirmed by both PCR and sequencing and determined to lack polar effects by reverse-transcriptase PCR (data not shown). Data suggest that only one of these regions, SP1681-3, contributed to growth on sialic acid (Fig. 3.3). As such,

1121 Δ1681-3, but not 1121 ΔSP1688-90, showed a significant reduction in growth

r (maximum OD600 < 0.1) compared to the parental strain 1121 Sm . The double mutant showed no additional reduction in growth, suggesting that no additive effect of the two transporters existed (data not shown). All mutant strains were genetically reconstituted, and each reconstituted strain grew as efficiently as the parent on sialic acid (data not shown). These data suggest that SP1681-3 encodes the primary sialic acid transporter in

S. pneumoniae, and henceforth is referred to as the sialic acid transporter, satABC. In this locus, satA (SP1683) is predicted to encode a substrate binding protein, while satB

(SP1682) and satC (SP1681) are predicted to encode permease components.

3.3.4. satABC is required for transport of sialic acid. To directly test whether satABC encodes a sialic acid transporter, uptake assays utilizing radiolabeled sialic acid were conducted. A time course experiment with the parental strain was conducted first to demonstrate temporal increase in uptake of [3H] sialic acid (Fig. 3.4A). From this experiment, a ten-minute incubation time was selected for subsequent experiments. When compared to the parent strain, 1121 ΔsatABC was significantly reduced in uptake of [3H] sialic acid (Fig 3.4B). While SP1688-90 showed no growth defect on sialic acid, it remained possible that this predicted transporter was still responsible for some uptake

1121 Smr 0.5 1121 ΔsatABC (SP1681-3) 1121 Δ1688-90 0.4

0.3

0.2

0.1

Optical density 600 nm 600 density Optical 0 12 24 36 48 60 -0.1 Time (hours)

Figure 3.3. satABC (SP1681-3) is required for efficient growth on sialic acid. 1121 Smr and mutants were grown for 60 h on chemically defined medium supplemented with 12 mM sialic acid as the sole carbon source. Growth was measured by the optical density at 600 nm. Data points are the mean of three independent experiments performed in triplicate. Gray shading indicates a 95% confidence interval.

A 6

CFU 5 7 7 4 3 2

H] sialic acid / 10 / acid sialic H] 3 0 nM [ nM 0 5 10 15 -1 B

CFU 7 7 3

1 H] sialic acid / 10 / acid sialic H]

3 * *

nM [ nM 0

C 1.2

CFU 1 7 7 0.8

0.6

0.4 * H] sialic acid / 10 / acid sialic H] 3 0.2 *

nM [ nM 0

Figure 3.4. satABC is required for transport of sialic acid. 1121 Smr and mutants were incubated for the designated amount of time in chemically defined media supplemented with 2.5 μM sialic acid containing 1% [3H]-sialic acid. Following incubation, bacteria were filtered, washed, and radioactivity associated with cells was measured using a scintillation counter. (A) Data are a representative of two time course experiments with strain 1121 Smr conducted in triplicate. (B + C) Data are averages from parental and mutant strains from three independent experiments performed in triplicate. Standard deviation is depicted. Statistical significance was tested by a two-tailed Student’s t-test; * indicates P≤0.05. 93 of sialic acid. However, the SP1688-90 mutant strain showed no statistically significant reduction in transport of sialic acid under these conditions and the double mutant showed no significant reduction in transport compared to the satABC single mutant (Fig. 3.4B).

These data demonstrate that satABC encodes the primary transporter for sialic acid under these conditions.

3.3.5. The SP1328 predicted symporter does not contribute to sialic acid transport.

Although 1121 lacks the predicted sodium solute symporter, it remained possible that

SP1328 contributes to transport of sialic acid when present. To test this, we measured the uptake of [3H] sialic acid in the TIGR4 strain which contains all three candidate transporters. TIGR4 ΔsatABC showed a significant reduction in sialic acid transport which could be restored in the genetically reconstituted strain, TIGR4 ΔsatABC /satABC+

(Fig. 3.4C). A TIGR4 ΔsatABC ΔSP1688-90 ΔSP1328 triple mutant had no greater reduction compared to the satABC mutant, which suggests that neither SP1688-90 nor

SP1328 contribute to sialic acid import under these assay conditions. Overall transport in the TIGR4 background was lower than for 1121; this is consistent with the delayed growth and lower maximal OD achieved when TIGR4 is grown on sialic acid as a sole carbon source (data not shown). Together, these data suggest that satABC encodes the primary sialic acid transporter in multiple strain backgrounds.

3.3.6. satABC contributes to growth on human glycoprotein. While the data presented demonstrate that SatABC transports sialic acid, we wanted to test whether this transport

94 contributed to growth on human glycoprotein. We have previously shown that S. pneumoniae can grow on a model human glycoprotein, AGP (54). AGP is decorated with complex N-linked glycans containing terminal sialic acid, galactose, and N- acetylglucosamine. These three carbohydrates can be sequentially cleaved by pneumococcal exoglycosidases (neuraminidase NanA, beta-galactosidase BgaA, and N- acetylglucosaminidase StrH) and used for growth. Mutation of any of these exoglycosidases results in a reduction in growth (54). Thus, sialic acid released by neuraminidase and transported by SatABC likely contributes to growth of S. pneumoniae.

We therefore hypothesized that the inability to transport sialic acid would result in a reduction, but not elimination of growth on AGP.

When 1121 Smr and the satABC mutant were grown on AGP, a significant reduction in growth on AGP was seen for 1121 ΔsatABC (Fig. 3.5); growth was restored in the 1121

ΔsatABC/satABC+ reconstituted strain (data not shown). As was the case with growth on free sialic acid, 1121 Δ1688-90 was not significantly reduced in growth on AGP and the double mutant showed no further reduction compared to 1121 ΔsatABC (Fig. 3.5 and data not shown), suggesting that SP1688-90 does not contribute to growth on AGP under these experimental conditions.

As the transport of a substrate into the cell often upregulates utilization pathways, it was possible that 1121 satABC may express lower neuraminidase levels than 1121 Smr (65,

142). A reduction in neuraminidase expression would reduce cleavage of sialic acid,

0.6 1121 Smr 1121 ΔsatABC 0.5 1121 Δ1688-90

0.4

0.3

0.2

0.1 Optical density 600 nm 600 density Optical

0 12 24 36 48 60 Time (hours) -0.1

Figure 3.5. satABC contributes to growth on a human glycoprotein. 1121 Smr and mutants were grown for 60 h on chemically defined medium supplemented with 5 mg ml- 1 alpha-1 glycoprotein as the sole carbon source. Growth was measured by the optical density at 600 nm. Data points are the mean from three independent experiments performed in triplicate. Gray shading indicates a 95% confidence interval.

96 which would restrict other pneumococcal glycosidases from releasing underlying carbohydrates for growth. To determine if less efficient cleavage of carbohydrates from

AGP significantly contributed to the reduced growth of 1121 satABC, the neuraminidase activity of bacteria growing on AGP (OD600 = 0.3) was determined. No significant difference in neuraminidase activity between the mutant and parental strain was observed (data not shown). This supports the original hypothesis that the inability to utilize sialic acid results in a reduction in growth on AGP. As glycoconjugates are likely used as a carbon source during colonization, these data suggest that sialic acid utilization contributes to growth in the airway.

3.3.7. satABC contributes to airway colonization. Although no reduction in colonization was observed in a ΔnanA mutant compared to the parental strain, it remained possible that transport of sialic acid may still contribute to colonization (data not shown). Indeed, significantly fewer bacteria were recovered from the upper respiratory tract of mice inoculated with 1121 ΔsatABC when compared to those inoculated with 1121 Smr, suggesting that sialic acid transport contributes to colonization

(Fig. 3.6). In contrast, 1121 Δ1688-90 showed no significant attenuation in vivo and there was no statistically significant difference in colonization between 1121 ΔsatABC and

1121 ΔsatABC Δ1688-90. Although we cannot rule out that SP1688-90 is important at other times during infection or that its role is human-specific, these data suggest that

SP1688-90 does not contribute to airway colonization. Collectively, these data

* 106 *

105

104

Log CFU/mL Log 10

102

101

Figure 3.6. satABC contributes to pneumococcal colonization. Groups of 10 mice received intranasal inoculation with 1 x 108 CFU of mutant or parental strain (1121 Smr). Five days after inoculation, mice were sacrificed by carbon dioxide asphyxiation. Nasal lavage fluid was collected and bacterial titers assessed. The gray dashed line indicates the limit of detection. The mean and standard error of the mean are depicted. Statistical significance was tested by a two-tailed Student’s t-test; * indicates P≤0.05.

98 demonstrate that satABC, and presumably transport of sialic acid, is important for colonization of the naso-oropharynx.

3.4. Discussion

Data here demonstrate that sialic acid can be used as a sole carbon source for growth.

Several bacteria that are able to colonize the human airway or gut mucosa have been shown to utilize sialic acid as a carbon source, including H. influenzae, and multiple streptococcal and bifidobacteria strains (56, 57, 278, 321, 327). Growth of S. pneumoniae on free sialic acid appeared less efficient than growth on the same molar concentration of glucose under our experimental conditions. While the reason for this remains unknown, it may relate to the differences in the carbohydrate structures, or mechanisms of transport.

Even though growth on sialic acid may be less efficient than other carbohydrates, because it is often the first carbohydrate encountered on glycoconjugates it is likely used as a carbon source in the airway.

Growth on sialic acid is dependent upon satABC which encodes an ABC transporter. The absence of satABC resulted in reduced bacterial growth on a human glycoprotein and reduced colonization in a mouse model, suggesting that this genetic locus and therefore transport of sialic acid are important for human airway colonization. Previous studies have suggested co-regulation of the operon containing satABC and nanA; as nanA encodes the neuraminidase that cleaves terminal sialic acid from host glycoconjugates,

99 these data suggest the cleavage and utilization of sialic acid is a coordinated process

(155).

Despite this, a nanA mutant showed no reduction in colonization in the same model, although a role for NanA in murine colonization has previously been demonstrated (186,

229). The reason for this discrepancy is unclear, but data here are consistent with our previous colonization modeling with nanA mutants in other strain backgrounds (155,

156). These results may indicate that SatABC has additional unidentified substrates or that sialic acid is being made available to pneumococcus by some other mechanism. It is possible that host protein turnover or neuraminidases from other sources, including the host, other bacterial cohabitants of the niche, or pneumococcus itself (NanB), may each contribute to sialic acid availability that is independent of NanA.

The SatABC transporter is a member of the ABC transport superfamily. Although other

ABC transporters are predicted to import sialic acid, the only other characterized ABC transporter responsible for sialic acid import is SatABCD in Haemophilus ducreyi (246).

ABC importers require two nuclear binding domains (ATPases), two transmembrane domains (permeases) and a substrate-binding domain that confers specificity (131, 239).

The genetic organization of satABC in pneumococcus notably lacks predicted ATPases.

While transport components are typically organized within a single operon, there are other examples of streptococcal species lacking ATPases in operon organization (329).

100

Our data show that the SatABC transporter is functional for uptake and utilization of sialic acid, and thus require that the ATPases be encoded elsewhere.

The functions of the other two predicted sialic acid transporters remain unknown. Despite

SP1688-90 and SP1328 being located within the same operons as nanB and nanC, respectively, we could demonstrate no role for either in sialic acid transport under our assay conditions. These data suggest that the additional predicted transporters are either specific for other substrates or contribute to sialic acid transport under other conditions.

SP1688-90 is considered part of the core pneumococcal genome and as such is likely essential for some aspect of pathogenesis. In contrast, the gene encoding the predicted symporter (SP1328) is not part of the core genome (225). SP1328 is encoded within a 20 kb region that correlates with invasive disease; although, how each gene product within this region contributes to this is unknown (225). The absence of this region in some strains demonstrates that SP1328 cannot be essential for human colonization (241).

Furthermore, our data demonstrate that this locus is not essential for invasive disease as neither of our clinical isolates recovered from blood possess this genomic region (Table

3.1).

The human glycoprotein AGP contains N-linked glycans with sialic acid, galactose, and

N-acetylglucosamine that can be sequentially cleaved by pneumococcal glycosidases

(156). Here we show that sialic acid released from AGP is imported via SatABC and utilized as a carbon source for growth. For these experiments, a limiting concentration of

101

AGP was used; given the solubility of AGP, higher concentrations of AGP could not be tested. This leaves open the possibility that sialic acid is not utilized for growth in vivo where pneumococcus presumably encounters an excess of glycoconjugates. However, the significant reduction of the satABC mutant in murine colonization supports the hypothesis that sialic acid is used as a carbon source in vivo.

In summary, we have demonstrated that S. pneumoniae is able to utilize sialic acid as a sole carbon source and have identified satABC as encoding an ABC transporter for sialic acid. Furthermore, we have shown that import of sialic acid by SatABC contributes to colonization in the airway.

102

Chapter 4: Identification of an ATPase, MsmK, which energizes multiple

carbohydrate ABC transporters in Streptococcus pneumoniae

Streptococcus pneumoniae is the leading cause of community acquired pneumonia and results in over one million deaths each year worldwide. Asymptomatic colonization of the airway precedes disease and acquisition of carbohydrates from the host environment is necessary for bacterial survival. We previously demonstrated that S. pneumoniae cleaves sialic acid from human glycoconjugates to be used as a carbohydrate source. The genes satABC are required for growth and import of sialic acid. satABC is predicted to encode components of an ABC transporter, but not the ATPases essential to energize transport. As this subunit is essential, an ATPase must be encoded elsewhere in the genome. We identified msmK as a candidate based on similarity to other known carbohydrate ATPases. Recombinant MsmK hydrolyzed ATP, revealing that MsmK is an

ATPase. An msmK mutant was reduced in growth on and transport of sialic acid, altogether demonstrating that MsmK is the ATPase energizing the sialic acid transporter.

In addition to satABC, S. pneumoniae contains five other loci that are predicted to encode

CUT1 family carbohydrate ABC transporter components; each of these lacks a predicted

ATPase. Data indicate that msmK is also required for growth on raffinose and maltotetraose, which are the substrates of two other characterized carbohydrate ABC

103 transporters. Furthermore, an msmK mutant was reduced in airway colonization.

Together, these data imply that in vivo, MsmK energizes multiple carbohydrate transporters in S. pneumoniae. This is the first demonstration of a shared ATPase in a pathogenic bacterium.

4.1. Introduction

Streptococcus pneumoniae (pneumococcus) is an important Gram positive respiratory pathogen that results in an estimated $3.5 billion of healthcare costs annually in the US

(136). S. pneumoniae is the causative agent of many diseases including otitis media and pneumonia, but more commonly colonizes the airway asymptomatically (328).

Acquisition of carbohydrates as a carbon source is necessary for pneumococcal growth and survival and therefore ultimately pathogenesis. Despite this, carbohydrate utilization in S. pneumoniae remains poorly understood.

The two main mechanisms of carbohydrate transport in S. pneumoniae are the phosphoenolpyruvate phosphotransferase system (PTS) and the ATP binding cassette

(ABC) transporter systems. ABC transporters can be found in all domains of life and represent one of the most highly conserved protein superfamilies (84). ABC transporters minimally require two permease domains that create the membrane channel and two

ATPase domains that energize the transport via ATP hydrolysis. The two permease and two ATPase domains can each be found as homodimers encoded by single genes, heterodimers encoded by two genes, or in some cases one gene will encode for a

104 polypeptide containing both copies of the domain. ABC importers additionally require a substrate binding domain that helps confer specificity of the transporter and bring the substrate in contact with the permeases (84, 93).

We have recently identified genes encoding components of the pneumococcal ABC transporter for sialic acid and have shown that it contributes to airway colonization

(193). As free carbohydrates are scarce in the airway, S. pneumoniae likely utilizes complex glycans for growth (154). S. pneumoniae can cleave sialic acid which is the most common terminal carbohydrate on both N- and O-linked glycans and is therefore likely used as a carbohydrate source during colonization. The genes satABC are required for both growth and transport of sialic acid and encode the substrate binding protein

(satA) and two permeases (satBC). However, no predicted ATPases were identified in the satABC genetic locus (193). Because two ATPases are absolutely necessary for transport, this requires that a gene(s) encoding the ATPase to energize this transporter must be encoded elsewhere in the genome.

Here, we identify the open reading frame SP1580 (annotated as msmK in the R6 genome) as a candidate for encoding the ATPase to energize SatABC. Mutation of SP1580 resulted in the inability to grow upon or transport sialic acid. In addition, recombinantly expressed MsmK was able to hydrolyze ATP in vitro, thus demonstrating MsmK is an

ATPase that likely interacts with SatABC to transport sialic acid. Furthermore, we report that msmK is also required for growth on two additional substrates, raffinose and

105 maltotetraose. These carbon sources are known to be imported by ABC transporters that similarly lack a predicted ATPase. Thus, we demonstrate for the first time in a pathogenic bacterium, that a single ATPase has the capacity to energize multiple carbohydrate transporters.

4.2. Materials and Methods

4.2.1. Bacterial strains, culture media, and chemicals. Parental and genetically modified strains of S. pneumoniae utilized in this study are described in Table 4.1. Broth cultures were routinely grown at 37°C in Todd-Hewitt broth (Becton, Dickinson, and

Company) supplemented with 0.2% w/v yeast extract (Becton, Dickinson, and Company)

(THY). C media with 5% yeast extract (C+Y) pH 8.0 was used for transformations.

Chemically defined medium (CDM) was used for growth and transcriptional analyses and was supplemented with no sugar, 12 mM glucose, 12 mM mannose, 12 mM fructose,

12 mM sialic acid, 12 mM raffinose, or 6 mM maltotetraose as indicated (159). S. pneumoniae was also grown at 37°C and 5% CO2 overnight on tryptic soy agar plates

(Becton, Dickinson, and Company) spread with 5000 U of catalase (Worthington

Biochemical Corporation) prior to plating bacteria as well as on tryptic soy agar plates supplemented with 5% sheep blood (Becton, Dickinson, and Company). Bacteria were selected on tryptic soy agar plates that contained streptomycin (200 µg ml-1), kanamycin

(500 µg ml-1), or neomycin (20 µg ml-1), as appropriate.

106

(2007) (2009) (2011) (2011)

al.

al. al.

et et et et al. Source or reference Marion Marion Marion This study This study This study Clontech EnglandNew Biolabs Berrow This study

r indicates resistance to ampicillin to resistance indicates

, Amp hsdS

) ) ] ∆ s r

) )] r r ) )] conferring Sm)] conferring r Sm

dcm r [

Tet (Amp b

( ) ) (Sm K56T ) (Sm ( ) r

) (Kan )

r ) DE3 a r msmK K56T 1 hsdR17 supE44 relA1 lac ( - rpsL (λ K56T

( ) (Sm K56T ) (Sm ( rpsL + rpsL K56T indicates resistance to tetracycline resistance indicates

( r K56T ( ompT gal ] rpsL kan/rpsL rpsL restored, ::

lon restored, [

satABC msmK msmK F' proAB laclqZΔM15 Tn10 Characteristics/genotype Lys56→Thr RpsL [ in Δ satABC Δ Δ msmK recA1 endA1gyr96 thi [ fhuA2 Expression vector (Amp Derived pOPINF, from

Serotype 23F 23F 23F 23F 23F 23F indicates resistance to kanamycin, Tet kanamycin, to resistance indicates

+ rpsL ame - satABC / kan

msmK :: /

r 1: Strains and plasmid in used this study

satABC satABC msmK msmK msmK Blue 4.

- indicates resistance to streptomycin, Kan to streptomycin, resistance indicates

r MsmK Sm XL1 XL1 Table orStrain plasmid n S. pneumoniae 1121 Sm 1121 Δ 1121 Δ 1121 Δ 1121 Δ 1121 Δ E. coli BL21(DE3) Plasmid pOPINF p a

107

Planktonic culture of Escherichia coli was grown in Luria Bertani (LB) broth at either

37°C or 16°C, with aeration. E. coli was also grown on LB agar plates at 37°C and 5%

-1 CO2. Ampicillin (100 µg ml ) was supplemented for bacterial selection.

Unless otherwise specified, all chemicals, substrates, and enzymes were purchased from

Sigma Chemicals.

4.2.2. Construction of mutants. An unmarked, in-frame deletion of the putative ATPase was generated using the Janus cassette selection system (295). This method requires two rounds of transformations. The first round introduces an engineered cassette conferring kanamycin (Kanr) resistance and streptomycin sensitivity (rpsL+) into a streptomycin resistant (Smr) parental strain. Regions flanking the gene of interest were amplified with primers M.1 and M.2, and M.4 and M.6, then sequentially joined to the Janus cassette using modified splicing by overlap extension (SOE) (54, 133). A high fidelity proofreading polymerase, Pfx-50, (Invitrogen) was used throughout to minimize PCR- generated errors and all genomic DNA was prepared essentially as described previously

(335). All Janus constructs were transformed into pneumococci and transformants were selected on kanamycin and confirmed by PCR with primers M.7 and M.8, which flank the mutant construct. All primer sequences can be found in Table 4.2.

The second round of transformation replaced the Janus cassette with a DNA construct consisting of the fragments flanking the region to be deleted; these fragments were

108

Continued (AE005672)

14856000 (AE005672) 1485973 (AE005672) 1485973 (AE005672) 1485198 1485198 (AE005672) 1484633(AE005672) 1486526 (AE005672) 1484505 (AE005672) 1486257 (AE005672) 1485152 (AE005672) ------247527 (AE005672) - 30 (AY334019) - Location (accessionLocation number) 1485577 1485950 1485950 1485178 1485178 1484613 1486503 1484485 1486238 1485133 7 247511

3) ( andJ.R

2) ( M.5 M.5

1) ATGTCTTCTTTGCTGTATTTACGC (

ATGTCTTCTTTGCTGTATTTACGC GTAGAATTGAATCTTAAAAA

GTAGATTGTTTTTTCAGTTT

GTTGAGCTTGGATTTGACTTG a,b

Primer SequencePrimer → (5' 3') TAGACAAAAGCAGAAACAAGGATC CATTATCCATTAAAAATCAAACGG CAAGTCAAATCCAAGCTCAAC GGAAAGGGGCCCAGGTG GTTGAGCTTGGATTTGACTTG TGACCTGCTTCTGACATTTGA CTACACAAAAATAAGCTCCATAAT TTCCCCTATTACACGCAACCT AAGTTCTGTTTCAGGGCCCG ATGGTCTAGAAAGCTTTA CCGTTTGATTTTTAATGGATAATG GGGCCCCTTTCCTTATGCTT

J.F J.R M.1 M.2 M.3 M.4 M.5 M.6 M.7 M.8 M.9 M.10 Number 2: used in thisPrimers study. . 4

Mismatch Mismatch of with sequence primer the TIGR4 Bolded indicates sequenceplasmidtext Underlining complement indicates reverse sequence J.F primer of

Table Group msmK Janus a b *

109

1485500 (AE005672) 1485375 (AE005672) 1582442 (AE005972) 1582361 (AE005672) 1803279 (AE005672) 1803187 (AE005672) 2021403 (AE005672) 2021506 (AE005672) ------762211 (AE005672) 762378 (AE005672) - - (accessionLocation number) 762190 762358 1485479 1485354 1582421 1582340 1803258 1803166 2021382 2021485

a GAGTGGGGACCTAA * SequencePrimer → (5' 3') TTAGCCCGTTATAGTGAAGGTC CTCTACTCGATCCCCCATCAA TCACCGTGAAATTGGTTGGTAG GTTCTGCATTCACGTCTTCTGG ATGACAAA CTGATTGTTTCCATGCGTTTGT ATGCCTTTACGGATCGTCACTT TGACCATGCCTTGTTTATCACC GCCAAAACGGTAAAGACGCTAA TCCAGCACCTTCTGTATCTTGC

Q.3 Q.4 Q.5 Q.6 Q.7 Q.8 Q.9

Q.10 Q.11 Q.12

.2 Continued

4 PCR - Group Table qRT

110 generated with primers M.1 and M.3, and M.5 and M.6 and joined by splicing by overlap extension PCR. Introduction of this construct restores kanamycin sensitivity and streptomycin resistance. Transformants were confirmed by PCR with primers M.7 and

M.8 and genetic sequencing of this same region confirmed that no spurious mutations had been introduced during generation of the mutants. Although the Janus system is designed to preclude polar effects, it is remains possible that downstream genes could be affected.

However, no defects immediately distal to the mutation were observed by sequencing and furthermore, SP1580 is believed to occur as a discrete transcript due to a predicted hairpin terminator present between SP1580 and SP1581 and a predicted transcriptional start site upstream of SP1581 (300). As opacity can also affect pneumococcal colonization and glycosidase expression the mutant was confirmed as being of the same opacity as that of their parental strain (155, 332).

The mutant was genetically reconstituted by reintroducing the deleted region into the same genetic location in the same orientation through two additional rounds of genetic transformation: one to reintroduce the cassette and the second to restore the original parental region. Growth of all strains was tested in rich medium to ensure that the mutations did not introduce generalized growth defects.

4.2.3. Growth Assays. Growth assays were conducted essentially as described previously by our laboratory (54). S. pneumoniae strains were grown in THY medium to an OD600 of

0.3 ± 0.005 and each 1 ml aliquot was washed and resuspended in 130 μl of 1:1

111 phosphate buffered saline (PBS):catalase (3x104 U ml-1). A ratio of 1 part bacterial suspension or PBS/catalase (no bacteria control) was added to 9 parts CDM supplemented with the appropriate carbon source. Medium supplemented with glucose

(12 mM) was used as a positive control in all experiments to confirm the viability of strains. Medium supplemented with no sugar served as a negative control in all experiments.

For plate-based assays, a final volume of 200 μl was used; plates were incubated at 37oC in a BIO-TEK Synergy HT plate reader for a minimum of 24 h and OD600 was measured every 20 min. Data were corrected for path-length and the averages from triplicate no- sugar medium controls were subtracted from values for experimental wells. Results for triplicate wells were then averaged and this value was considered as one datum point for further analysis. Data from at least three independent experiments were averaged, and the

95% confidence interval was calculated for each time point.

4.2.4. Sialic acid transport assay. Transport assays were conducted as described previously (193). Cultures of parental and mutant S. pneumoniae strains were grown in

THY broth to an OD600 of 0.6 ± 0.01. Each sample was pelleted, washed in PBS and concentrated in CDM without sugar to an OD600 = 2.0. CDM containing sialic acid was prepared such that [3H]-sialic acid (American Radiolabeled Chemicals Inc.) accounted for 1% total sialic acid. Triplicate 90 μl aliquots were first incubated for 3 min at 37°C to acclimate. CDM medium containing sialic acid was then added to the culture to achieve a

112 final concentration of 2.5 μM. After incubation at 37°C for 10 min, reactions were terminated by filtration through 0.22 μm filters (Millipore). Filters were washed 3 times with 2 ml CDM without sugar. After air-drying the filters, 10 ml of 30% ScintiSafe LCS

Cocktail (Fisher Scientific) was added to each sample. Incorporated sialic acid was measured in a Packard Tri-Carb Liquid Scintillation Analyzer. Average measurements conducted with heat-killed bacteria were subtracted from each value. Data were normalized to label incorporated per 107 cells. All transport experiments were conducted three times in triplicate. Significance was determined by a two-tailed Student’s t-test and a P-value below 0.05 was considered significant.

4.2.5. Cloning and expression of recombinant MsmK (rMsmK). The msmK coding sequence was PCR amplified from strain 1121 with primers M.9 and M.10 to introduce overhangs corresponding to the pOPINF vector (31). The In-Fusion Dry Down PCR

Cloning Kit (Clontech) was used according to the manufacturer’s instructions for plasmid ligation and plasmid was transformed into competent Fusion Blue E. coli. Following confirmation of correct insertion by PCR, plasmid containing msmK was used to transform E. coli BL21(DE3) (New England Biosciences). Clones were confirmed by

PCR and sequencing. Strains and plasmids are listed in Table 4.2. For protein expression, overnight cultures of E. coli harboring the MsmK or empty plasmid were diluted 1:100 and grown to an OD600 = 0.6. At that point, 5 ml of culture were added to 700 ml of fresh media grown overnight at 16°C. No additional IPTG was added for induction, as optimization revealed sufficient protein production occurred without IPTG. Cells were

113 collected by centrifugation at 3000 x g for 10 min and 600 OD units resuspended in 30 ml 20 mM Tris 150 mM NaCl buffer. Bacteria were lysed with a French pressure cell and debris was removed by centrifugation at 10,000 x g for 30 min. The resulting samples were purified by affinity chromatography with the ProBond Purification System

(Invitrogen) according to the manufacturer’s recommendations for native purification with minor modifications. To avoid phosphate contamination for downstream applications, a 20 mM Tris 150 mM NaCl buffer was substituted throughout. After confirmation by SDS-PAGE and Coomassie staining, designated eluent fractions were pooled and dialyzed overnight against 1 L prechilled 20 mM Tris 150 mM NaCl buffer using the D-Tube Dialysis Maxi system with a 3.5 molecular weight cutoff (Novagen).

Equivalent eluent fractions were pooled and dialyzed for the mock purified protein and used as a negative control. Total protein was measured in a microtiter plate using a Micro

BCA Protein Assay Kit (Pierce) according to the manufacturer’s recommendations.

4.2.6. ATPase assay. Invitrogen EnzChek assay was used to measure ATPase activity of rMsmK. In addition to the supplied reagents required for the standard assay, each 1 ml reaction also contained 1 mM ATP, 5 mM MgCl2, and the designated amount of protein or control. Reactions were incubated for 30 min at room temperature and triplicate 200 μl aliquots were measured in a microtiter plate at 360 nm. Samples incubated with 20 mM

Tris 150 mM NaCl were subtracted. The amount of ATP hydrolyzed was determined by comparison to a Pi standard curve as recommended by the manufacturer.

114

4.2.7. RNA extraction and reverse transcriptase PCR. RNA was isolated by an acid- phenol extraction, with modifications for S. pneumoniae (149). Bacteria were grown as described for above for growth assays, but a final volume of 10 ml was incubated in a

37°C water bath. When samples reached OD600 of 0.3 ± 0.005, they were combined with

10 ml acid phenol and 100 μl 10% SDS and incubated at 90°C until phases merged.

Samples were then cooled on ice and centrifuged for 30 min at 3200 x g at 4°C. Two additional extractions were performed first with equal volumes of 1:1 acid phenol:choloroform and then with chloroform. RNA was precipitated with 10 ml isopropanol and 2 ml of 3 M sodium acetate at -20°C overnight. RNA was concentrated and washed twice with 1 ml 70% ethanol and then vacuum dried for 20 minutes.

- Resulting RNA was resuspended in 100 μl H2O, quantified, and adjusted to 100 μg 41 μl

1 to allow for a final reaction volume of 50 μl for DNase treatment. Nucleic acid was incubated with 5 μl DNase I buffer, 3 μl DNase I (New England Biolabs) and 1 μl Super

RNaseIN (Promega) at 37°C for 1 hr. Cleanup of RNA was performed with a Qiagen

RNeasy mini kit as per manufacturer’s instructions. DNase- and RNase-free reagents were used throughout. cDNA was generated with SmartScribe reverse transcriptase as according to the manufacturer’s recommendations (New England Biolabs). Parallel samples were processed without addition of reverse transcriptase as a negative control.

Quantitative real-time RT-PCR (qRT-PCR) was conducted to measure gene expression profiles under varying growth conditions. The Brilliant SYBR Green qRT-PCR Master

Mix (Stratagene) was used according to the manufacturer’s instructions. Reactions were

115 performed on a Mx3005 Multiplex Quantitative PCR System (Stratagene) using the

SYBR Green protocol. Cycling parameters were as follows: 95°C for 10 min, and then 40 cycles of 95°C (30 s), 60°C (1 min), 72°C (30 s), followed by a melting curve analysis.

Housekeeping genes rpoB (primers Q.1 and Q.2) and gyrB (primers Q.3 and Q.4) were used for all experiments. Primers within genes msmK (primers Q.5 and Q.6) satA

(primers Q.7 and Q.8), rafE (primers Q.9 and Q.10) and malX (primers Q.11 and Q.12) were used for analysis. The median cycle threshold value was used for analysis and all cycle threshold values were normalized to expression of rpoB and gyrB. All reactions were performed in triplicate on three independent biological replicates with reference dye normalization. Statistical analysis was performed using a Student’s t-test and a P-value below 0.01 was considered significant. Primer sequences for housekeeping and test genes can be found in Table 4.2.

4.2.8. Murine colonization. Nasopharyngeal colonization was performed as described previously (201). Groups of 20, 6 to 8 week-old female C57BL/6 mice (Jackson

Laboratory) were inoculated intranasally with 1 x 108 mid-log-phase organisms of a 1:1 mix of 1121 Smr and 1121 msmK::kan-rpsL+. After 36 h or 5 days, the density of colonization was assessed by upper respiratory tract lavage and quantitative culture of recovered organisms on tryptic soy agar supplemented with neomycin and a selective antibiotic. TS with neomycin and streptomycin was selective for 1121 Smr, while TS with neomycin and kanamycin was selective for 1121 msmK::kan-rpsL+. The competitive index was determined to be the ratio of mutant bacteria divided by the number of parental

116 strain bacteria recovered from each individual mouse. The animal data are presented as the mean competitive index ± standard error of the mean (SEM). Significance was assessed by a one-sample, two-tailed Student’s t-test; a P-value below 0.05 was considered significant.

To confirm that phenotypes observed in vivo were not artifacts of growth differences; a competition assay was conducted in vitro. 1121 Smr and 1121 msmK::kan-rpsL+ bacteria were grown in THY medium to an OD600=0.300 ± 0.005 and combined at a ratio of 1:1.

Bacteria were incubated at 37°C and enumerated by serial dilution on the appropriate antibiotic at 0, and 120 min. After two hours the ratio of mutant to parental bacteria was

0.92.

4.3. Results

4.3.1. msmK is required for growth on sialic acid. We have previously identified three components of an ABC transporter encoded by the genes satABC as being required for growth on and transport of sialic acid (193). However, satABC encode only the substrate binding and permease proteins of this transporter and there is no predicted ATPase encoded in this locus. Because two ATPase domains are necessary for transport of a substrate through an ABC transporter, the gene encoding the ATPase domains that interact with SatABC must be elsewhere in the genome. We selected the open reading frame SP1580 (designated msmK in the R6 genome, and used here) as a candidate gene based on its high predicted amino acid sequence similarity to the Streptococcus mutans

117 carbohydrate ATPase MsmK (Fig. 4.1A) (11, 134, 300). msmK is predicted to be in a single transcriptional unit and is separated by greater than 93 kb from the nearest genes encoding carbohydrate ABC transporter components. However, analysis of the MsmK predicted amino acid sequence revealed the presence of all conserved features indicative of an ATPase including: the Walker A, Walker B, Q-loop, D-loop, H-loop and Signature motif (84, 189).

An unmarked mutant was generated (1121 ΔmsmK) and confirmed to have no growth defects on glucose when compared to the parent (data not shown). 1121 ΔmsmK was significantly reduced in growth compared to the parental strain when sialic acid was the sole carbon source (maximum OD600 < 0.1) (Fig. 4.1B). A genetically reconstituted strain, 1121 ΔmsmK/msmK+, was able to grow as well as the parental strain 1121 Smr on sialic acid (data not shown). The reduction in growth of the mutant is similar to that previously observed for a satABC mutant demonstrating that both satABC and msmK are necessary for growth on sialic acid (193). The requirement of msmK for growth on sialic acid suggests it may directly contribute to sialic acid transport.

4.3.2. msmK is required for transport of sialic acid. To more directly assess whether msmK plays a role in transport, uptake assays using [3H]-labeled sialic acid were conducted. As seen in Fig. 4.1C, 1121 ΔmsmK was significantly reduced for sialic acid import when compared to the parental strain, and this was restored in the genetically reconstituted strain. The reduction for 1121 ΔmsmK was similar to the reduction seen in

118

msmK SP1582 SP1578 1 kb B 0.6 1121 Smr 0.5 1121 ΔmsmK 0.4

0.3

0.2

0.1

0 Optical Density 600 nm 600 Density Optical 12 48 -0.1 24 36 Time (hours) C 3.5

CFU 3 7 7 2.5 2 1.5 1 0.5 *

H] Sialic Acid / 10 / Acid Sialic H] * 3 0

-0.5 1121 Smr ΔsatABC ΔmsmK ΔmsmK/ msmK+ nmol [ nmol

Figure 4.1. msmK contributes to growth on and transport of sialic acid. (A) Schematic of region encoding predicted carbohydrate ATPase, MsmK, in S. pneumoniae strain TIGR4. Arrows indicate open reading frames. Arrows above schematic indicate predicted transcriptional start sites and the predicted terminator is denoted by a stem loop. (B) 1121 Smr and 1121 ΔmsmK were grown for 48 h on chemically defined medium supplemented with 12 mM sialic acid as the sole carbon source. Growth was measured by the optical density at 600 nm. Data points are the mean of three independent experiments performed in triplicate. Gray shading indicates a 95% confidence interval. (C) 1121 Smr and mutants were incubated for 10 min in chemically defined media supplemented with 2.5 μM sialic acid containing 1% [3H]-sialic acid. Following incubation, bacteria were filtered, washed, and radioactivity associated with cells was measured using a scintillation counter. Data are averages from parental and mutant strains from three independent experiments performed in triplicate. Standard deviation is depicted. Statistical significance was tested by a two-tailed Student’s t-test; * indicates P≤0.05. 119

1121 ΔsatABC. This shows that along with the core transport components encoded by satABC, msmK is also essential for transport of sialic acid.

4.3.3. MsmK is an ATPase. The requirement of msmK for growth and transport of sialic acid clearly indicates a role for MsmK in utilization of sialic acid. The very high similarity to known carbohydrate ATPases coupled with the absence of a predicted

ATPase in the satABC locus led to the hypothesis that MsmK is the ATPase energizing

SatABC. To determine whether MsmK had ATPase activity, the protein was recombinantly expressed and tested for its ability to release Pi from ATP. Release of Pi increased with increasing amounts of recombinant protein (Fig. 4.2). To ensure that contaminating proteins were not responsible for release of Pi, equal volumes of a mock purified protein and rMsmK were evaluated. Per 1 ml reaction, detection of 12.23 nmol

-1 (30 min) Pi was observed upon incubation with 128.5 μl mock purified protein as compared to 68.06 nmol (30 min)-1 released by 128.5 μl rMsmK preparation, demonstrating that the activity detected was attributable to MsmK. These data confirm that MsmK energizes the transport of sialic acid.

4.3.4. msmK contributes to growth on multiple carbohydrates. Assessment of the

TIGR4 genome reveals that in addition to satABC there are five other loci predicted to encode a substrate binding protein and two permeases but not an ATPase (Fig. 4.3) (300).

Collectively, these are the only six predicted ABC transporters encoded in the pneumococcal genome with this atypical arrangement and these are the only predicted

120

140 1 - 120 100

80 (30 min) (30

i 60 P 40

20 nmol 0 0 10 20 30 μg rMsmK

Figure 4.2. MsmK is an ATPase. rMsmK was incubated with 1 mM ATP and 5 mM

MgCl2 for 30 min. The amount of ATP hydrolyzed was determined by comparison to a Pi standard curve. Assays were conducted in triplicate and Pi released from ATP was measured at OD360. The average ± standard deviation is depicted.

121

Unknown substrate SP_0088-0095

Unknown substrate nanB SP_1691-1686

Sialic acid satA satB satC SP_1685-1675

Unknown substrate susR susT1 susT2 susX susH SP_1799-1795

Raffinose rafS rafR aga rafE rafF rafG gftA rafX SP_1900-1893

Maltooligosaccharides malP malM malX malC malD malA malR SP_2106-2112

substrate binding protein permease regulator 1 kb

Figure 4.3. Schematic of regions encoding known and putative carbohydrate ABC transporter components in S. pneumoniae strain TIGR4. Arrows indicate open reading frames and genes of known function are labeled. Arrows above schematic indicate transcriptional start sites. Open reading frame designations in TIGR4 and transported substrates are listed at left.

122

CUT1 family ABC carbohydrate transporters (274). Together, this led us to hypothesize that MsmK may be required for transport of additional carbohydrates.

Of the five remaining CUT1 family carbohydrate ABC transporters, two have been experimentally characterized. RafEFG is known to transport raffinose and MalXCD was shown to efficiently transport maltooligosaccharides with between 3 and 8 glucose repeats (10, 251, 262). To test if msmK might also play a role in utilization of these carbohydrates, the msmK mutant was tested for growth with either raffinose or maltotetraose as the sole carbon source. 1121 ΔmsmK was significantly reduced compared to the parental strain for growth on both carbohydrates (maximum OD600 < 0.1)

(Fig. 4.4). Genetic reversion of msmK restored growth that was similar to the parent strain (data not shown). Comparatively, the 1121 ΔsatABC growth deficiency was exclusive to sialic acid and the mutant showed no defect in growth on raffinose or maltotetraose (data not shown). Neither 1121 ΔmsmK nor 1121 ΔsatABC showed significant reductions in growth on the carbohydrates glucose, mannose or fructose (data not shown). This significant contribution of msmK to growth on raffinose, maltotetraose, and sialic acid illustrates that MsmK functions as the ATPase for multiple carbohydrate

ABC transporters (Fig. 4.1B and Fig. 4.4). To the best of our knowledge, this is the first demonstration of a shared ATPase in a pathogenic bacterium.

4.3.5. msmK expression is increased in the presence of multiple carbohydrates. If

MsmK energizes multiple transporters, one would expect that msmK expression would be

123

A 1.4 1.2 1.0 0.8 0.6 r 0.4 1121 Sm 1121 ΔmsmK 0.2 0 Optical Density 600 nm 600 Density Optical 12 48 -0.2 24 36 Time (hours) B 1.4 1.2 1.0 1121 Smr 1121 ΔmsmK 0.8 0.6 0.4 0.2 0 Optical Density 600 nm 600 Density Optical 12 48 -0.2 24 36 Time (hours)

Figure 4.4. msmK is required for growth on raffinose and maltotetraose. 1121 Smr and 1121 ΔmsmK were grown for 48 h on chemically defined medium supplemented with (A) 12 mM raffinose or (B) 6 mM maltotetraose as the sole carbon source. Growth was measured by the optical density at 600 nm. Data points are the mean of three independent experiments performed in triplicate. Gray shading indicates a 95% confidence interval.

124 increased by any one of its carbohydrate substrates when present as the sole carbon source. As predicted, relative to bacteria grown in glucose, expression of msmK significantly increased at least 10-fold in the presence of raffinose, sialic acid or maltotetraose (Fig. 4.5). In contrast, only very small changes in msmK expression were observed for bacteria grown in mannose (1.34-fold change) or fructose (1.56-fold change). As each of the six transporter loci encodes a known or predicted regulator, it is likely that the core transporter components will only be increased in expression when the corresponding substrate is utilized as a carbon source. Accordingly, transcripts of the raffinose, sialic acid and maltooligosaccharide substrate binding proteins show a large and significant expression increase only in the presence of the respective substrate as measured by qRT-PCR (Table 4.3). Growth on any other ABC transported carbohydrate resulted in small but significant expression changes relative to glucose (Table 4.3). The expression increase of msmK by multiple carbohydrate substrates further supports the hypothesis that MsmK is a shared ATPase.

4.3.6. msmK contributes to airway colonization. An msmK mutant was shown to impact the function of the three characterized carbohydrate ABC transporters (Fig. 4.1B,

Fig. 4.4). Our data suggest that loss of msmK would inactivate up to six transporters and this could affect respiratory colonization. In a competition assay, a marked msmK mutant had no significant defect after 36 hours of colonization. However, after 5 days of colonization, significantly fewer 1121 msmK::kan-rpsL+ bacteria were recovered, indicating that msmK likely contributes to maintenance of colonization (Fig. 4.6). This is

125

25 * 20

15 * * fold change fold 10

msmK 5

0 sialic acid raffinose maltotetraose

Figure 4.5. Expression of msmK in different carbohydrate substrates. 1121 Smr was grown in CDM supplemented with 12 mM glucose, 12 mM sialic acid, 12 mM raffinose or 6 mM maltotetraose and msmK expression was measured by qRT-PCR. Fold change is represented as a comparison to bacteria grown in glucose. Statistical significance was tested by a two-tailed Student’s t-test; * indicates P≤0.01.

Table 4.3: Gene expression fold change compared to glucose- grown bacteria (± SEM). sialic acid raffinose maltotetraose satA 69.55 (1.32) 1.70 (1.18) 2.65 (1.10) rafE 3.32 (1.26) 1081.14 (1.30) 1.77 (1.33) malX 4.09 (1.29) 3.73 (1.15) 40.69 (1.10) Bolded text indicates the substrate binding protein expression in the corresponding medium

126

10 *

0.1

0.01 Competitive Index Competitive 0.001 1.5 days 5 days

Figure 4.6. msmK contributes to pneumococcal colonization. Mice received intranasal inoculation with 1 x 108 CFU of a 1:1 mix of 1121 Smr and 1121 msmK::kan-rpsL+. At 36 h or five days after inoculation, mice were sacrificed by carbon dioxide asphyxiation. Nasal lavage fluid was collected and bacterial titers assessed. The ratio of mutant to total bacteria for each animal is represented (Competitive Index). The mean and standard error of the mean are depicted. Statistical significance was tested by a one-sample two-tailed Student’s t-test; * indicates P≤0.001.

127 not presumed to be caused by a general defect in the 1121 msmK::kan-rpsL+ strain, as its growth was not significantly different from the parent when competed in vitro in rich media. Together, these data suggest that one or more of the carbohydrate substrates of the

ABC transporters are used as a carbon source in vivo during both colonization as well as pathogenesis.

4.4. Discussion

There are six predicted CUT1 family carbohydrate ABC transporters within the pneumococcal genome. Each of these six lacks a gene encoding the requisite ATPase within their genomic locus. Here we identify a shared ATPase and demonstrate that msmK is essential for growth on the substrates of three ABC transporters. While the substrates of the remaining three carbohydrate ABC transporters are currently unknown, we hypothesize that MsmK would be required to energize these transporters as well. The putative transport components SP1796-8 were predicted to be involved in sucrose transport (143). However, an msmK mutant showed no significant reduction in growth on sucrose (data not shown). While we cannot rule out that this is due to the presence of an additional ATPase, it seems more likely that the predicted sucrose PTS (SP1722) is fully compensatory for sucrose transport or that sucrose is not the primary substrate of this transporter. The predicted transport components SP1688-90 were proposed to transport sialic acid, although our previous studies demonstrate that at least for the strain used in the current study, SP1688-90 did not contribute to transport of one form of sialic acid, N- acetyl neuraminic acid (14, 193, 300). The substrate of the transporter components

128

SP0090-2 remains unknown, though this locus has been repeatedly identified in genome- wide virulence screens and strongly suggests that this transporter is both functional and important for carbohydrate acquisition at some point during pneumococcal pathogenesis

(126, 150, 229).

Given the reliance on carbohydrate acquisition for pneumococcal growth, we proposed that inactivation of multiple carbohydrate transporters would impact the ability of the bacteria to colonize the airway and cause disease. An msmK mutant was significantly reduced in colonization when competed against its parent strain, suggesting that transport of at least one of the carbohydrate substrates is important during colonization. The exact contribution of each of the six transporters is currently unknown; however, previous data suggest that individual transporters vary in their contributions to both colonization as well as pathogenesis (36, 126, 143, 193, 245, 286). While we did not assess the contribution of msmK to pathogenesis here, during the revision of this manuscript Tyx et al. demonstrated a role for this gene in raffinose transport and pneumococcal pneumonia

(307). While further studies are required, current data certainly indicate that msmK and therefore carbohydrate transport is important during pneumococcal pathogenesis.

For MsmK to efficiently energize multiple ABC carbohydrate transporters, S. pneumoniae would possess a regulatory mechanism by which msmK would respond to overall carbohydrate availability, while the individual transporter components would be tightly regulated to respond only to the presence of the cognate substrate. Control of

129 msmK is likely by means of carbon catabolite repression via CcpA. A catabolite responsive element (cre) occurs upstream of msmK and deletion of ccpA was previously shown to increase MsmK in cell wall fractions (142). Thus the absence of preferred carbohydrates would relieve repression of msmK. Accordingly, msmK expression increased in bacteria grown in sialic acid, raffinose, or maltotetraose as a sole carbon source by at least 10 fold relative to bacteria grown in glucose. In contrast, evidence suggests that regulation of the six individual transporter loci is controlled by multiple mechanisms. Cre sequences are located upstream of each of the transcriptional units encoding the six CUT1 family carbohydrate ABC transporter permeases and substrate binding proteins. This is consistent with the small but significant increase in expression seen by each substrate binding protein expression in a carbohydrate source other than its specific substrate. In addition to the predicted cre sequences, each locus also encodes a known or predicted regulator. This suggests a second level of regulation for the expression of the components of each transporter. Three of these regulators have been studied experimentally and data are in agreement with this hypothesis (143, 252, 262,

300). Further in support of this hypothesis, our data demonstrate that a substantial increase in expression of satA, rafE, and malX occurs in the presence of only the cognate carbohydrate.

Our data support a model for six ABC transporters energized by MsmK which acts as an

ATPase for each. For this to occur, two copies of MsmK would dimerize to interact with the respective permeases and substrate binding protein complex to create a canonical

130 five-protein importer. We acknowledge that, while unlikely, it is possible that MsmK is acting as a heterodimer and a second ATPase is encoded by a third genomic region.

While MsmK has greater than 84% similarity and 74% identity to both S. mutans carbohydrate transporter ATPases over the entire 376 amino acids, the next most similar protein, encoded by pitD (SP0242) is predicted to have only 58% similarity over only

204 amino acids and was previously shown to be involved in iron uptake (47, 189, 300).

To the best of our knowledge, this is the first experimental demonstration of a shared

ATPase in a pathogenic bacterium. This phenomenon has often been suspected to occur in carbohydrate transport in a wide range of Gram-positive organisms, although rarely investigated (84, 93). Previously, data in both streptomyces and Bacillus subtilis have shown growth or transport defects for ATPase mutants on disparate substrates, suggesting sharing of the ATPase (99, 271, 272). In addition to growth, we show directly that MsmK is required for transport and that MsmK has ATP hydrolytic activity. Bioinformatics suggest that a shared carbohydrate ATPase may be widely conserved, occurring in nearly all streptococci, gut commensal bifidobacteria, soil streptomyces, and potentially even the Gram-negative Synechocystis sp. (84, 99, 205, 206, 270, 272). These examples are exclusive to carbohydrate transporters. It could perhaps be related to the regulation of these systems and the fact that the need for carbon as a nutrient source is rather general while the requirements for other transported molecules, for example metal ions, would necessitate individual regulatory mechanisms. These questions would require further investigation. However it is clear that a better comprehension of the S. pneumoniae

131 shared carbohydrate ATPase will provide a model for understanding carbohydrate utilization in multiple organisms.

132

Chapter 5: Discussion

Streptococcus pneumoniae is an opportunistic respiratory pathogen that typically occupies the human airway asymptomatically but can progress beyond to normally sterile sites to cause disease. As free carbohydrates are scarce in the airway, pneumococcus must access and import complex glycans which it uses as a source of carbon. Thus carbohydrate acquisition is essential for both colonization and pathogenesis. Accordingly, pneumococcus is predicted to devote >30% of its transport mechanisms to carbohydrate uptake. While many of the annotated transporters remain unstudied in detail, based on a recent survey it is predicted that there are 21 phosphotransferase systems (PTS) and up to eight ATP binding cassette (ABC) transporters that import 32 distinct carbohydrates for nutrition (36). This bias towards carbohydrate uptake highlights the essentiality of carbon acquisition in the complex niche of the human airway and is unmatched by other resident airway bacteria. In fact, the diversity of usable carbohydrate substrates by pneumococci is more reminiscent of the gut flora. Maintenance of so many carbohydrate import mechanisms strongly suggests that each discrete substrate is encountered at some point during the pneumococcal life cycle in order to uphold a strong selective pressure. That several transporters have been implicated in both colonization as well as invasive disease reinforces the need for carbon acquisition on mucosal surfaces and opens the door to developing both therapeutic and vaccine strategies around carbohydrate transport. In spite

133 of this, several substrates of these carbohydrate transporters remain unidentified, and several other substrates appear to have no obvious localization in the human airway. This suggests that perhaps pneumococci encounter a wider range of carbohydrates than previously appreciated or that pneumococcus has developed carbon acquisition strategies to scavenge from non-host sources, including other bacterial species or dietary carbohydrates. Therefore a better understanding of pneumococcal carbon utilization will likely expand our knowledge of pneumococcal biology.

5.1 Does maintenance of so many carbohydrate transporters benefit S. pneumoniae colonization and pathogenesis?

Prokaryotes are unique in that greater than 85% of DNA is typically coding; large vertebrates and plants can have as little as 5% coding DNA (178). Thus, each species must balance the metabolic burden of maintaining genes with overall benefit that those genes provide. It is widely believed then that selection exists to maintain only processes that are necessary or beneficial to the overall lifestyle of the bacterium (207). For example, inactive remnants of amino acid biosynthetic genes identified in strain D39 suggest that scavenging of intermediates is sufficient for meeting cellular needs and de novo synthesis was expendable (167). Conversely, genes encoding components for twenty carbohydrate transporters are maintained as a part of the proposed core genome

(225). At least two additional loci appear to always encode a transporter, although the allele can vary (128, 143). Based on experimental data, S. pneumoniae is capable of fermenting greater than thirty carbohydrates in vitro (36, 211). One must assume that

134 each of these transporters provides a unique advantage to S. pneumoniae for asymptomatic nasopharyngeal colonization or transmission.

Carbohydrate utilization is critically important during pneumococcal pathogenesis.

Rohmer and colleagues recently postulated that evolutionary adaptations to animal hosts by many bacteria was driven by nutritional diversity (258). Gain or loss of metabolic pathways therefore is likely greatly influenced by the niche. Furthermore, nasopharyngeal colonization is a necessary precursor to disease, so any process (highlighted here by carbohydrate acquisition) that is essential for colonization is a de facto requirement for progression to disease. In support of this, components of carbohydrate transporters have been identified in genome-wide screens for virulence factors (126, 229, 245). Further evidence comes from the fact that dysregulation of carbohydrate utilization results in strain attenuation in both pneumonia and sepsis models (107, 142). Therefore, especially in the case of S. pneumoniae, if virulent attributes of the lifestyle are a consequence of niche adaptation, then a direct link between metabolism and disease exists.

The majority of carbohydrate transporters are of two types: phosphotransferase systems

(PTS) and ATP binding cassette (ABC) transporters. PTS transporters generally have mono- and disaccharides as substrates and ABC transported carbohydrates vary greatly in the number of saccharide repeats (247, 274). Overall cellular efficiency would presumably be low if pneumococcus were to actively translate high amounts of the more than 50 constituent proteins (134, 300). Thus, a consequence of maintaining many

135 carbohydrate transporters is that a system of regulation is necessary to control expression based on carbohydrate availability and preference. An ortholog of the classically studied catabolite control protein A (CcpA) from Bacillus subtilis is present in S. pneumoniae

(262). Presence of the catabolite repressive element cre consensus upstream of numerous genes including carbohydrate transporters suggests some higher level of regulation; however it was suggested that pneumococcal CcpA is not a global regulator and that the regulatory network is far more complex (107, 127, 142, 219, 262). A recent study has provided significant insights into the regulatory capacity of CcpA in S. pneumoniae through microarray analysis and suggests that 19% of the genome is directly or indirectly affected by CcpA (63). We have recently shown that amongst the tested ABC carbohydrate transporter components, each resulted in an upregulation of the transporter in direct response to growth in the corresponding substrate; this is in accordance with other regulators that have been studied and reinforces that multiple levels of regulation occur (67, 143, 192, 252, 262, 279). It is likely that a combination of global and locally acting factors fine tune the sensing of available carbohydrates and the expression of required transport mechanisms.

Despite this, it is logical that the pneumococcus would be able to exert a preference amongst carbohydrate transport utilization mechanisms. The hallmark of primary active transporters, including ABC carbohydrate importers, is the initial investment of energy to facilitate transport against a gradient. PTS, on the other hand require a phosphoenol pyruvate (PEP)-donated phosphate group to trigger the phosphorylation cascade which

136 results in transport and phosphorylation of the substrate (247). There are additional energy requirements including extra- and intracellular hydrolases and enzymes of the

Leloir or tagatose pathways necessary to prepare carbohydrates for further metabolism

(130). Together, the extra direct and indirect energy input required for utilization of ABC transporter carbohydrate substrates is likely greater than for PTS. Furthermore, as PTS transport intermediates exert regulatory control over ABC transporters via CcpA, PTS import should be favored over ABC transport (110). The energy tradeoff of an ABC transporter must be worthwhile or else this mechanism of transport would be unnecessary; perhaps the ability to import longer and more diverse carbohydrate linkages make ABC transport of carbohydrates necessary.

The rather vast ability of S. pneumoniae to utilize carbohydrates is a stark contrast to other nasopharyngeal bacteria. Haemophilus influenzae is able to ferment glucose, galactose, fructose, fucose, xylose, ribose, sialic acid and glycerol (181). Neisseria meningitidis utilizes only the carbohydrates glucose, lactate or pyruvate (170).

Surprisingly, Moraxella catarrhalis is completely unable to import or utilize host carbohydrates (85). The reason for the restricted carbohydrate utilization capabilities in the above airway bacteria is uncertain but it is important to note that amongst these, S. pneumoniae is the only species strictly reliant on carbohydrates as a carbon source. Still, this decisive difference in carbohydrate utilization likely provides a competitive advantage to S. pneumoniae in the nasopharynx.

137

The extent of carbohydrate utilization by S. pneumoniae is instead more similar to oral and gastrointestinal organisms whose interaction with host and dietary carbohydrates is well studied. Some species in the gastrointestinal tract digest amino acids and peptides, but the extensive and diverse carbohydrate fermenting capabilities are what best characterize the gut microbiota (182). Bifidobacterium longum ferments at least 13 distinct carbohydrates, although the B. longum NCC2705 genome contains 19 total predicted transport mechanisms which implies a wider usage profile (232). The colonic

Bacteroides thetaiotamicron contains a predicted 30 carbohydrate transporters with specificity for both dietary and host-derived carbohydrates (341). The oral Streptococcus mutans has 17 predicted carbohydrate transporters; carbohydrate utilization by several other related lactic acid bacteria was reviewed recently by Price et al. and reiterates that usable substrates tend to mimic the niche of a given bacterium (11, 250).

5.2 Why do pneumococci ferment such diverse carbohydrates?

Because the lifestyle of the pneumococcus is principally restricted to the human nasopharynx, one infers that the pneumococcus primarily evolved to utilize carbohydrates present in the airway. Certainly the argument can be made that the ability to ferment carbohydrates elsewhere in the body may help explain its ability to cause disease (10, 143). However, carbohydrate utilization profiles in several lactic acid bacteria provide strong evidence of very specific niche adaptation (250). Overall, one reasonably draws the conclusion that as a human-restricted microorganism, all of the carbohydrate metabolic capabilities of S. pneumoniae are refined for use of human-

138 derived carbohydrates during colonization. Several observations challenge this assumption.

First, several transporter substrates appear to be plant derived (36, 202, 262). Although

Streptococcaceae evolved from soil bacteria at some point in history, adaptation of nearly all other lactic acid bacteria reveal fine tuning of the metabolic abilities to optimize life in their specific niche so we would expect to see no remaining traces for utilization of environmental sugars in any of the human-adapted species (250). This is not the case. In fact, at the turn of the last century, discrimination of pneumococcus from other streptococci was based upon the ability to ferment inulin (129). Inulin is a repeating fructose β2-1 linked polysaccharide capped with a terminal α1-2 linked glucose. Inulin however, is not produced by the human body and is instead a main component of dietary fiber (253). Why pneumococcus evolved/and or maintained the ability to utilize inulin is unclear. S. pneumoniae must necessarily encounter inulin at some point during colonization or transmission. Of course, it may be that inulin is not the primary substrate of its cognate transporter, and instead some other fructose containing oligosaccharide is.

Pneumococcus was also shown to import the β1-4 glucose disaccharide cellobiose, a component of plant cellulose; however, the only suggestion provided by the authors is that the true substrate may be an alternate β-glucoside (202, 279). This is supported by the fact that this PTS showed the ability to transport gentibiose, arbutin, amygdalin and aesculin, although all of these compounds appear to be produced by plants as well (36).

Similarly, the primary sources of raffinose are vegetables and grains and a host-derived

139 source is not easily recognizable (262). A parallel situation arises in the ability to utilize maltooligosaccharides that may hint at an explanation for the quandary above. Abbott et al. revealed that the α1-4 linked glucose molecules of glycogen can be used as a sole carbon source after cleavage of α1-6 branchings by SpuA (10, 310). Glycogen is structurally similar to α1-4 and α1-6 glucose repeats in plant starch (22). Thus these examples may each reflect that what served as a plant carbohydrate transporter evolutionarily has adapted to use of structurally similar host carbohydrates. Despite this, there is compelling experimental evidence that pneumococci can ferment plant-based carbohydrates. Whether this view will change with further exploration remains to be seen.

The transporter substrates described above coupled with the overall usable carbohydrate profile call in to question the view that S. pneumoniae strictly derives carbohydrates from host glycans. As mentioned above, the vast ability and diversity of carbohydrate fermentation seems more in line with oral and gastrointestinal microbes as compared to airway microbes. Conceivably carbohydrates of host diet ought to be considered as a source of carbohydrates. This would go a long way to reconciling the discrepancy between what S. pneumoniae has been shown to ferment and what it reasonably encounters in the host with high enough frequency to maintain selective pressure. This would require that S. pneumoniae resides near enough to the oral cavity to modify and import dietary carbohydrates or that it has some other unappreciated reservoir. The isolation of S. pneumoniae from soil and the recent demonstration of prolonged tolerance

140 to desiccation may prompt the study of pneumococcal survival in other human and non- human environments (98, 325).

Perhaps an underappreciated source of carbohydrates in the airway available to S. pneumoniae are the carbohydrates (and especially capsules) of other resident and/or pathogenic species. Indeed, in vitro studies have shown that S. pneumoniae can alter the capsule structures of other airway bacteria and utilize purified bacterial capsule as a sole carbon source (195, 280). It seems reasonable then that modification of other airway bacteria would serve the dual purpose of exposing the competitor to host immune clearance as well as providing a convenient nutrient source. Therefore, acquiring or maintaining the ability to modify and import bacteria-derived carbohydrates seems likely.

5.3 Are multiple transporters examples of redundancy?

The presence of this large abundance of carbohydrate transport mechanisms begs the question whether these are simply redundancies. This redundancy can be considered on two levels. First, it can be argued that redundancy refers only to instances where multiple transporters import the same substrate. Indeed this has been suggested for the susTTX, scrT transporters which both import sucrose (143). A much wider phenomenon of carbohydrate substrate overlap has been suggested recently by Bidossi et al. with multiple carbohydrates being imported by more than one carbohydrate transporter (36). It seems likely that two factors contribute to these observations: (i) substrate overlap is an

141 artifact of in vitro manipulations (ii) primary substrates and roles of carbohydrate transporters have been misidentified.

Upon mutation of a given carbohydrate transporter in vitro, a strain can only survive if low-affinity or non-preferred import occurs by an alternate mechanism. Thus, constraints placed on bacteria in vitro may enhance unfavorable and non-biologically relevant import, resulting in growth. This may help explain why three transporters each were implicated in transport of mannose and galactose and why so many intermediate phenotypes were observed by Bidossi et al. (36). It seems unlikely that three transporters for mannose would be necessary. Mutation of the primary mannose transporter in vivo would more likely result in out-competition of that bacterium by other pneumococci as opposed to slow growth via an alternate transporter. Again, a role for discrete substrates for each transporter is supported by the fact that 20 of the importers in TIGR4 are part of the core genome (225).

It is also possible that what appears to be redundancy in vitro is caused by a lack of understanding of the true purpose or substrate of a given carbohydrate importer. Recent work by our laboratory suggests that although SusTTX is capable of partially complementing for loss of ScrT in vitro, that the primary substrate of this importer is instead fructooligosaccharides (C. Linke, S. King, unpublished). As fructooligosaccharides are terminated by a sucrose molecule, it is not surprising that

SusTTX can facilitate sucrose transport under unfavorable conditions. Here, true

142 redundancy seemed especially unlikely as the ScrT PTS should be energetically more favorable and have the potential to downregulate SusTTX in the presence of sucrose through carbon catabolite repression (110). Especially in the case of oligosaccharide importers, it is likely that substrate identification is hampered by growth phenotypes observed on constituent carbohydrates.

The maintained ability of S. pneumoniae to import, but not ferment, fucose-containing glycans is a strong example to suggest alternate roles for carbohydrate importers (128).

While the role of fucose-containing glycan import remains unknown, it was suggested that removal of blood group antigens may promote survival in the blood (128).

Furthermore, although S. pneumoniae can utilize sialic acid as a sole carbohydrate source in vitro, it was also suggested that sialic acid serves an important role in cell signaling

(193, 306). Thus even though appreciable growth on many substrates can be detected, additional or even primary roles of carbohydrate importers may be overlooked and future work may reveal novel roles for carbohydrate transport in S. pneumoniae.

An alternate view of redundancy is based in the hypothesis that the need for carbohydrates as a carbon source is general to survival of the bacterium. Therefore encoding a large number of transporters may help ensure that genetic loss of one mechanism will not result in death of that bacterium. However, because each of these transporters are presumably used under different conditions, it seems that instead of being a functional redundancy, this mechanism is instead a well-evolved system to adapt to the

143 changing carbohydrate availability encountered by S. pneumoniae. If this were the case, conservation amongst the gamut of import mechanisms would be low, as loss of a single mechanism would not be detrimental. In disagreement with this, mutation of individual transporters is associated with decreased colonization in vivo (143, 193, 195, 225) . Also challenging this assumption is the fact that at two loci, even when transporter alleles vary, the ability to import the same substrate is conserved. At the fructooligosaccharide utilization locus, one of two different ABC transporters can be found. Despite appearing to have diverged at some point in evolution (likely through recombination with S. mitis) both transporters retain the ability to utilize fructooligosaccharides (C. Linke, S. King unpublished data). Similarly, the fucose utilization locus can encode for either a PTS or

ABC transporter, but both transport fucose (128).

5.4 Why share an ATPase amongst the CUT1 ABC transporters?

The CUT1 carbohydrate ABC transporters have each been studied and shown experimentally to have specificity for the following carbohydrates: raffinose (262), maltooligosaccharides (10), sialic acid (193), fucose (128), N-acetylmannosamine

(putative) (36), fructooligosaccharides (C. Linke, S. King unpublished) and mannose

(putative) (36). Sequencing of the S. pneumoniae genome revealed the curious observation that all of the CUT1 family carbohydrate ABC transporters of S. pneumoniae are lacking a predicted ATPase in the respective genetic locus (300). Depending on the genome there are either six or seven predicted CUT1 ABC importers (36, 128, 300). We have recently demonstrated the ATPase MsmK energizes multiple carbohydrate ABC

144 transporters (192). Loss of the ATPase, MsmK, results in a reduction in growth on raffinose, sialic acid, maltotetraose, and fructooligosaccharides (C. Linke, S. King unpublished data and (192, 307)). Although MsmK is encoded in a separate location on the genome greater than 93 kb away from the nearest ABC carbohydrate transporter, data suggest MsmK is shared amongst all CUT1 family ABC transporters (36, 192, 307).

In addition to the six to seven CUT1 family carbohydrate ABC transporters, S. pneumoniae is predicted to encode one CUT2 family carbohydrate ABC transporter for ribonucleosides (36, 300). A distinguishing feature differentiating the CUT1 and CUT2 transporters is the organization of the ATPase, with CUT2 ATPase amino acid sequences harboring two ABC domains in tandem, although only one is functional (274). The putative ATPase encoded by open reading frame SP0846 outwardly fits these criteria and suggests that the ATPase of the CUT2 transporter has no functional overlap with MsmK.

The absence of compensatory growth in an msmK mutant supports the hypothesis that

SP0846 does not energize the CUT1 carbohydrate transporters in vitro (36, 192).

There is evidence that sharing of an ATPase is not unique to S. pneumoniae. The first reports of a functional carbohydrate ABC transport ATPase discretely encoded with a genome was msiK in Streptomyces lividans and Streptomyces reticuli (139, 271, 272).

This would later be proven true also in Thermus thermophilus and B. subtilis (70, 99,

282). Other reports and genome annotations suggest that a shared ATPase is more widespread than the examples here and also that it is exclusive to carbohydrate transport.

145

There is one conflicting report involving iron acquisition in Staphylococcus. In this case, an ATPase encoded as a part of a functional ABC transporter also energizes a second core transporter that lacks an ATPase. Because the ATPase is not encoded as a single transcript, this may suggest that this mechanism arose by gene deletion or duplication

(28, 287). Overall, the mechanism governing the sharing of a singly encoded ATPase amongst carbohydrate ABC transporters has not been studied in detail. Two main hypotheses have emerged to explain this phenomenon.

5.4.1. Genome conservation. Perhaps the simplest explanation for a shared ATPase amongst the CUT1 carbohydrate transporters is evolution towards a minimization of genome size (210). For this to be the case, one would suspect that each ABC transporter locus encoded its own ATPase(s) at one time and that eventually one ATPase emerged as the dominant ATPase to energize all transporters. As it is suggested that any two

ATPases can share 30% identity, it is not surprising that an ATPase could interact with more than one transporter (131). There is no obvious evidence of carbohydrate ATPase truncations or pseudogenes adjacent to ABC transporter components. Anecdotally, the presence of IS1167 elements in proximity to four of the six ABC transporters and to msmK may provide an alternate route of introduction, deletion or rearrangement of carbohydrate transport genes including the discrete location of msmK apart from other

ABC transporter components (300, 348). Collectively, this would potentially reduce the need for between six (or 12) ATPases to only one and spare approximately five to ten kb on the chromosome.

146

This model would not explain why this phenomenon is seemingly exclusive to carbohydrate transporters. There is no evidence that any other grouping of ABC transporters share an ATPase in S. pneumoniae. For example, the R6 genome has six annotated glutamine ABC transporters and yet each of these maintains an ATPase (124,

134). Although these likely contribute to colonization and infection differently and under different conditions, the same should hold true for the carbohydrate ABC transporters as well (124). Still, the argument can be made that carbohydrates are unique amongst ABC transporter substrates (including metals, amino acids, antibiotics) in that the need for carbon as a nutrient source is a general need while all other importers and exporters are more precise in respective transport. Therefore sharing of a general component for a general cellular nutrient requirement may be logical. Although questions remain, genome simplification is a viable explanation for the shared ATPase.

5.4.2. Regulation. It is well known that the HPr protein shared amongst PTS transporters has extensive regulatory roles in Gram positive bacteria (110). Although it has not been studied in detail, a shared ATPase component may allow for an additional level of regulation over the ABC transporters. There are several ways in which this could occur.

First, MsmK could act as a “master switch” for the ABC transporters. When not required for import, down regulation of msmK would effectively shut off all of the transporters with which it interacts. A predicted cre upstream of msmK may provide a mechanism of regulation and indeed MsmK detection increased in a ccpA mutant (142, 219). However, preliminary data exploring msmK expression under different growth conditions suggest

147 that MsmK is not likely acting as a master switch between PTS and ABC transport (H.

Salhi, S. King unpublished).

Next, if the amount of MsmK were limiting, this would create a situation wherein the available MsmK could exert preference between the available transporters. It is known that in vitro msmK expression increases 10-20 fold in bacteria grown in an ABC- transporter sugar compared to bacteria grown in the PTS sugar glucose but it remains unknown if MsmK levels are limiting in vitro or in vivo (192). If MsmK was limiting, the available MsmK could be steered to energize different core transporters based on the abundance of the core ABC transporter components and differences in affinity of MsmK for different permeases. Thus the most abundant substrate would be favored (assuming this correlated directly with the greatest number of functionally expressed core transporters). Alternatively, if core transporters were produced under a given condition in similar amounts, MsmK could preferentially energize the permeases with the most favorable binding kinetics.

Lastly, it is known that MsmK possesses a regulatory domain that can directly interact with dihydrolipoamide dehydrogenase (DLDH) to alter expression of the raf locus (307).

Whether DLDH has any regulatory capacity over the other ABC transporters remains unknown. Furthermore, whether MsmK has any other unidentified binding partners that function in regulation of the ABC transporters is unknown however, it was noted that many as-yet unidentified proteins co-immunoprecipitated with MsmK (307). Although

148 carbon catabolite repression operates differently in Gram negative and Gram positives,

MsmK has a similar C-terminal domain as the model ATPase MalK of E. coli which has been shown to sequester the transcriptional activator MalT (40). Thus, there is a great possibility that the discrete location, regulatory domain, and sharing of MsmK may serve a regulatory role over ABC transporters (or other genes) and that this ought to be explored. An ABC transporter-wide mechanism of regulation is unprecedented and would greatly add to our understanding of carbohydrate utilization and regulation in bacteria.

5.5 Could carbon acquisition ever be a target for vaccine or therapy development?

As the links between cellular metabolism and pathogenesis are becoming more evident, the question arises whether this knowledge can be used to help prevent pneumococcal disease (258). The requirement of carbohydrates for S. pneumoniae survival implies that this central mechanism could be a poignant mechanism to target for novel therapeutic strategies or vaccine development. ABC import and PTS are especially attractive targets given that both mechanisms are exclusive to prokaryotes.

There is precedence for the use of transporter components in protein-based vaccines for

S. pneumoniae. The protective properties of ABC transporter substrate binding proteins have been demonstrated (43, 44, 48). Immunization with the manganese substrate binding protein PsaA is protective against both carriage and disease (43, 44). Two iron substrate binding proteins, PiuA and PiaA, are protective against systemic disease individually and

149 when administered together (48). Although it has yet to be tested, the substrate binding protein of the maltooligosaccharide transporter MalX has been identified in genome-wide screens for antigenic proteins and is being considered for protein-based vaccines (108,

208). This suggests that proteins involved in carbohydrate transport may be beneficial as vaccine components. One major drawback though is this same fact that pneumococci produce so many carbohydrate import mechanisms that mutants in several can survive in vivo, albeit to a lesser extent (143, 192, 193, 195). Therefore, pressure may select for strains lacking carbohydrate transporter targets. Furthermore, given the relatedness between commensal streptococci and S. pneumoniae, it is unlikely that vaccine targets against carbohydrate transport proteins (and actually many current protein candidates) would be specific in targeting only pneumococci (91).

Another possible approach would also take advantage of the importer itself. It has been suggested that PTS and ABC could each be used as novel drug delivery systems (106,

236). It seems hypothetically possible that engineering antimicrobials to be recognized and bound by transporters would provide an efficient and bacteria-specific route of drug delivery. An alternate approach is disrupting transport machinery directly. A hallmark of successful antimicrobials is the perturbation of microbe-specific processes, of which both

PTS and ABC importers fit. To the best of our knowledge, neither of these approaches is being actively pursued, however these could represent novel therapeutic approaches for targeting S. pneumoniae or other bacterial infections.

150

5.6. Concluding remarks. Although the first genome sequence for S. pneumoniae was published in 2001, it has taken a decade for researchers to pursue large scale studies of carbohydrate uptake and metabolism (36, 63, 300). It is clear that to understand and appreciate pneumococcal disease one must understand the so-called “basic” metabolic processes. The intricacies and interrelated nature suggests that carbohydrate modification and utilization in S. pneumoniae is far from basic and may possess novel processes that are yet unstudied. Identification of the shared ATPase component amongst CUT1 ABC transporters opens the door to exploring how and why this may have arisen and how this impacts the bacterial lifestyle (192). It is hopeful then that as experimental ground work continues to be laid, the questions posed here can eventually be answered. It remains to be seen why S. pneumoniae amongst other respiratory colonizers has four times as many carbohydrate substrates and why several of these substrates appear to be plant-based in origin. For now, we can only speculate which carbohydrates are truly utilized during colonization and disease. A better understanding of the unique carbohydrate metabolic capabilities will likely shed light on the very nature of pneumococcal survival. (200)

151

References

1. 2010. Global routine vaccination coverage, 2009. MMWR Morb Mortal Wkly Rep 59:1367-1371. 2. 2011. Global routine vaccination coverage, 2010. MMWR Morb Mortal Wkly Rep 60:1520-1522. 3. 2008. Invasive pneumococcal disease in children 5 years after conjugate vaccine introduction--eight states, 1998-2005. MMWR Morb Mortal Wkly Rep 57:144- 148. 4. 2010. Licensure of a 13-valent pneumococcal conjugate vaccine (PCV13) and recommendations for use among children - Advisory Committee on Immunization Practices (ACIP), 2010. MMWR Morb Mortal Wkly Rep 59:258-261. 5. 2007. Pneumococcal conjugate vaccine for childhood immunization – WHO position paper. Weekly epidemiological record:93-104. 6. 2000. Preventing Pneumococcal Disease Among Infants and Young Children. MMRW- Morbidity and Mortality- Weekly Report 49:1-35. 7. 1997. Prevention of pneumococcal disease: recommendations of the Advisory Committee on Immunization Practices (ACIP). MMWR Recomm Rep 46:1-24. 8. 1984. Update: pneumococcal polysaccharide vaccine usage--United States. MMWR Morb Mortal Wkly Rep 33:273-276, 281. 9. 2010. Updated recommendations for prevention of invasive pneumococcal disease among adults using the 23-valent pneumococcal polysaccharide vaccine (PPSV23). MMWR Morb Mortal Wkly Rep 59:1102-1106. 10. Abbott, D. W., M. A. Higgins, S. Hyrnuik, B. Pluvinage, A. Lammerts van Bueren, and A. B. Boraston. 2010. The molecular basis of glycogen breakdown and transport in Streptococcus pneumoniae. Mol Microbiol 77:183-199. 11. Ajdic, D., W. M. McShan, R. E. McLaughlin, G. Savic, J. Chang, M. B. Carson, C. Primeaux, R. Tian, S. Kenton, H. Jia, S. Lin, Y. Qian, S. Li, H. Zhu, F. Najar, H. Lai, J. White, B. A. Roe, and J. J. Ferretti. 2002. Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen. Proc Natl Acad Sci U S A 99:14434-14439. 12. Ajdic, D., and V. T. Pham. 2007. Global transcriptional analysis of Streptococcus mutans sugar transporters using microarrays. J Bacteriol 189:5049- 5059. 13. Allen, S., A. Zaleski, J. W. Johnston, B. W. Gibson, and M. A. Apicella. 2005. Novel sialic acid transporter of Haemophilus influenzae. Infect Immun 73:5291- 5300. 14. Almagro-Moreno, S., and E. F. Boyd. 2009. Insights into the evolution of sialic acid catabolism among bacteria. BMC Evol Biol 9:118. 15. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J Mol Biol 215:403-410.

152

16. Andersson, B., E. H. Beachey, A. Tomasz, E. Tuomanen, and C. Svanborg- Eden. 1988. A sandwich adhesion on Streptococcus pneumoniae attaching to human oropharyngeal epithelial cells in vitro. Microb Pathog 4:267-278. 17. Andersson, B., H. Leffler, G. Magnusson, and C. Svanborg Eden. 1983. Molecular mechanisms of adhesion of Streptococcus pneumoniae to human oropharyngeal epithelial cells. Scand J Infect Dis Suppl 39:45-47. 18. Appelbaum, P. C. 1992. Antimicrobial resistance in Streptococcus pneumoniae: an overview. Clin Infect Dis 15:77-83. 19. Austrian, R. 1977. Prevention of pneumococcal infection by immunization with capsular polysaccharides of Streptococcus pneumoniae: current status of polyvalent vaccines. J Infect Dis 136 Suppl:S38-42. 20. Avery, O. T., C. M. Macleod, and M. McCarty. 1944. Studies on the chemical nature of the substance inducing transformation of pneumococcal types. Journal of Experimental Medicine 79:137-158. 21. Balachandran, P., S. K. Hollingshead, J. C. Paton, and D. E. Briles. 2001. The autolytic enzyme LytA of Streptococcus pneumoniae is not responsible for releasing pneumolysin. J Bacteriol 183:3108-3116. 22. Ball, S. G., and M. K. Morell. 2003. From bacterial glycogen to starch: understanding the biogenesis of the plant starch granule. Annu Rev Plant Biol 54:207-233. 23. Banerjee, A., N. M. Van Sorge, T. R. Sheen, S. Uchiyama, T. J. Mitchell, and K. S. Doran. 2010. Activation of brain endothelium by pneumococcal neuraminidase NanA promotes bacterial internalization. Cell Microbiol 12:1576- 1588. 24. Barabote, R. D., and M. H. Saier, Jr. 2005. Comparative genomic analyses of the bacterial phosphotransferase system. Microbiol Mol Biol Rev 69:608-634. 25. Barocchi, M. A., S. Censini, and R. Rappuoli. 2007. Vaccines in the era of genomics: the pneumococcal challenge. Vaccine 25:2963-2973. 26. Barthelson, R., A. Mobasseri, D. Zopf, and P. Simon. 1998. Adherence of Streptococcus pneumoniae to respiratory epithelial cells is inhibited by sialylated oligosaccharides. Infect Immun 66:1439-1444. 27. Basavanna, S., S. Khandavilli, J. Yuste, J. M. Cohen, A. H. Hosie, A. J. Webb, G. H. Thomas, and J. S. Brown. 2009. Screening of Streptococcus pneumoniae ABC transporter mutants demonstrates that LivJHMGF, a branched- chain amino acid ABC transporter, is necessary for disease pathogenesis. Infect Immun 77:3412-3423. 28. Beasley, F. C., E. D. Vines, J. C. Grigg, Q. Zheng, S. Liu, G. A. Lajoie, M. E. Murphy, and D. E. Heinrichs. 2009. Characterization of staphyloferrin A biosynthetic and transport mutants in Staphylococcus aureus. Mol Microbiol 72:947-963. 29. Bender, M. H., and J. N. Weiser. 2006. The atypical amino-terminal LPNTG- containing domain of the pneumococcal human IgA1-specific protease is required for proper enzyme localization and function. Mol Microbiol 61:526-543.

153

30. Bergmann, S., and S. Hammerschmidt. 2006. Versatility of pneumococcal surface proteins. Microbiology 152:295-303. 31. Berrow, N. S., D. Alderton, S. Sainsbury, J. Nettleship, R. Assenberg, N. Rahman, D. I. Stuart, and R. J. Owens. 2007. A versatile ligation-independent cloning method suitable for high-throughput expression screening applications. Nucleic Acids Res 35:1-12. 32. Berry, A. M., R. A. Lock, and J. C. Paton. 1996. Cloning and characterization of nanB, a second Streptococcus pneumoniae neuraminidase gene, and purification of the NanB enzyme from recombinant Escherichia coli. J Bacteriol 178:4854-4860. 33. Berry, A. M., R. A. Lock, S. M. Thomas, D. P. Rajan, D. Hansman, and J. C. Paton. 1994. Cloning and nucleotide sequence of the Streptococcus pneumoniae hyaluronidase gene and purification of the enzyme from recombinant Escherichia coli. Infect Immun 62:1101-1118. 34. Berry, A. M., and J. C. Paton. 2000. Additive attenuation of virulence of Streptococcus pneumoniae by mutation of the genes encoding pneumolysin and other putative pneumococcal virulence proteins. Infect Immun 68:133-140. 35. Bhavanandan, V. P., J. Umemoto, and E. A. Davidson. 1976. Characterization of an endo-alpha-N-acetyl galactosaminidase from Diplococcus pneumoniae. Biochem Biophys Res Commun 70:738-745. 36. Bidossi, A., L. Mulas, F. Decorosi, L. Colomba, S. Ricci, G. Pozzi, J. Deutscher, C. Viti, and M. R. Oggioni. 2012. A Functional Genomics Approach to Establish the Complement of Carbohydrate Transporters in Streptococcus pneumoniae. PLoS ONE 7:e33320. 37. Biemans-Oldehinkel, E., M. K. Doeven, and B. Poolman. 2006. ABC transporter architecture and regulatory roles of accessory domains. FEBS Lett 580:1023-1035. 38. Black, R. E., S. Cousens, H. L. Johnson, J. E. Lawn, I. Rudan, D. G. Bassani, P. Jha, H. Campbell, C. F. Walker, R. Cibulskis, T. Eisele, L. Liu, and C. Mathers. 2010. Global, regional, and national causes of child mortality in 2008: a systematic analysis. Lancet 375:1969-1987. 39. Bongaerts, R. J., H. P. Heinz, U. Hadding, and G. Zysk. 2000. Antigenicity, expression, and molecular characterization of surface-located pullulanase of Streptococcus pneumoniae. Infect Immun 68:7141-7143. 40. Bordignon, E., M. Grote, and E. Schneider. 2010. The maltose ATP-binding cassette transporter in the 21st century--towards a structural dynamic perspective on its mode of action. Mol Microbiol 77:1354-1366. 41. Bratcher, P. E., K. H. Kim, J. H. Kang, J. Y. Hong, and M. H. Nahm. 2010. Identification of natural pneumococcal isolates expressing serotype 6D by genetic, biochemical and serological characterization. Microbiology 156:555-560. 42. Brigham, C., R. Caughlan, R. Gallegos, M. B. Dallas, V. G. Godoy, and M. H. Malamy. 2009. Sialic acid (N-acetyl neuraminic acid) utilization by Bacteroides fragilis requires a novel N-acetyl mannosamine epimerase. J Bacteriol 191:3629- 3638.

154

43. Briles, D. E., E. Ades, J. C. Paton, J. S. Sampson, G. M. Carlone, R. C. Huebner, A. Virolainen, E. Swiatlo, and S. K. Hollingshead. 2000. Intranasal immunization of mice with a mixture of the pneumococcal proteins PsaA and PspA is highly protective against nasopharyngeal carriage of Streptococcus pneumoniae. Infect Immun 68:796-800. 44. Briles, D. E., S. K. Hollingshead, J. King, A. Swift, P. A. Braun, M. K. Park, L. M. Ferguson, M. H. Nahm, and G. S. Nabors. 2000. Immunization of humans with recombinant pneumococcal surface protein A (rPspA) elicits antibodies that passively protect mice from fatal infection with Streptococcus pneumoniae bearing heterologous PspA. J Infect Dis 182:1694-1701. 45. Brooks, M. M., and A. V. Savage. 1997. The substrate specificity of the enzyme endo-alpha-N-acetyl-D-galactosaminidase from Diplococcus pneumoniae. Glycoconj J 14:183-190. 46. Brown, J. S., S. M. Gilliland, and D. W. Holden. 2001. A Streptococcus pneumoniae pathogenicity island encoding an ABC transporter involved in iron uptake and virulence. Mol Microbiol 40:572-585. 47. Brown, J. S., S. M. Gilliland, J. Ruiz-Albert, and D. W. Holden. 2002. Characterization of pit, a Streptococcus pneumoniae iron uptake ABC transporter. Infect Immun 70:4389-4398. 48. Brown, J. S., A. D. Ogunniyi, M. C. Woodrow, D. W. Holden, and J. C. Paton. 2001. Immunization with components of two iron uptake ABC transporters protects mice against systemic Streptococcus pneumoniae infection. Infect Immun 69:6702-6706. 49. Brueggemann, A. B., R. Pai, D. W. Crook, and B. Beall. 2007. Vaccine escape recombinants emerge after pneumococcal vaccination in the United States. PLoS Pathog 3:1628-1636. 50. Brugger, S. D., P. Frey, S. Aebi, J. Hinds, and K. Muhlemann. 2010. Multiple colonization with S. pneumoniae before and after introduction of the seven-valent conjugated pneumococcal polysaccharide vaccine. PLoS ONE 5:e11638. 51. Brundage, J. F., and G. D. Shanks. 2008. Deaths from bacterial pneumonia during 1918-19 influenza pandemic. Emerg Infect Dis 14:1193-1199. 52. Bull, C. G., and C. M. McKee. 1929. Respiratory immunity in rabbits. VII. Resistance to intranasal infection in the absences of demonstratable antibodies. American Journal of Hygeine 9:490-499. 53. Burgos, J., M. Penaranda, A. Payeras, A. Villoslada, A. Curran, M. Garau, M. Riera, M. Crespo, J. Navarro, E. Van den Eynde, A. M. Planes, E. Ribera, A. Pahissa, and V. Falco. 2012. Invasive pneumococcal disease in HIV-infected adults: clinical changes after the introduction of the pneumococcal conjugate vaccine in children. J Acquir Immune Defic Syndr 59:31-38. 54. Burnaugh, A. M., L. J. Frantz, and S. J. King. 2008. Growth of Streptococcus pneumoniae on human glycoconjugates is dependent upon the sequential activity of bacterial exoglycosidases. J Bacteriol 190:221-230. 55. Bush, K., and G. A. Jacoby. 2010. Updated functional classification of beta- lactamases. Antimicrob Agents Chemother 54:969-976.

155

56. Byers, H. L., K. A. Homer, and D. Beighton. 1996. Utilization of sialic acid by Viridans streptococci. J Dent Res 75:1564-1571. 57. Byers, H. L., K. A. Homer, E. Tarelli, and D. Beighton. 1999. N- acetylneuraminic acid transport by Streptococcus oralis strain AR3. J Med Microbiol 48:375-381. 58. Caines, M. E., H. Zhu, M. Vuckovic, L. M. Willis, S. G. Withers, W. W. Wakarchuk, and N. C. Strynadka. 2008. The structural basis for T-antigen hydrolysis by Streptococcus pneumoniae: a target for structure-based vaccine design. J Biol Chem 283:31279-31283. 59. Camara, M., G. J. Boulnois, P. W. Andrew, and T. J. Mitchell. 1994. A neuraminidase from Streptococcus pneumoniae has the features of a surface protein. Infect Immun 62:3688-3695. 60. Cao, Y., X. Jin, E. J. Levin, H. Huang, Y. Zong, M. Quick, J. Weng, Y. Pan, J. Love, M. Punta, B. Rost, W. A. Hendrickson, J. A. Javitch, K. R. Rajashankar, and M. Zhou. 2011. Crystal structure of a phosphorylation- coupled saccharide transporter. Nature 473:50-54. 61. Cardozo, D. M., C. M. Nascimento-Carvalho, F. R. Souza, and N. M. Silva. 2006. Nasopharyngeal colonization and penicillin resistance among pneumococcal strains: a worldwide 2004 update. Braz J Infect Dis 10:293-304. 62. Carlin, A. F., S. Uchiyama, Y. C. Chang, A. L. Lewis, V. Nizet, and A. Varki. 2009. Molecular mimicry of host sialylated glycans allows a bacterial pathogen to engage neutrophil Siglec-9 and dampen the innate immune response. Blood 113:3333-3336. 63. Carvalho, S. M., T. G. Kloosterman, O. P. Kuipers, and A. R. Neves. 2011. CcpA ensures optimal metabolic fitness of Streptococcus pneumoniae. PLoS ONE 6:e26707. 64. Center for Disease Control and Prevention. 2011. Active Bacterial Core Surveillance Report, Emerging Infections Program Network, Streptococcus pneumoniae, 2010. 65. Chan, P. F., K. M. O'Dwyer, L. M. Palmer, J. D. Ambrad, K. A. Ingraham, C. So, M. A. Lonetto, S. Biswas, M. Rosenberg, D. J. Holmes, and M. Zalacain. 2003. Characterization of a novel fucose-regulated promoter (PfcsK) suitable for gene essentiality and antibacterial mode-of-action studies in Streptococcus pneumoniae. J Bacteriol 185:2051-2058. 66. Chang, Y. C., S. Uchiyama, A. Varki, and V. Nizet. 2012. Leukocyte inflammatory responses provoked by pneumococcal sialidase. MBio 3. 67. Chapuy-Regaud, S., A. D. Ogunniyi, N. Diallo, Y. Huet, J. F. Desnottes, J. C. Paton, S. Escaich, and M. C. Trombe. 2003. RegR, a global LacI/GalR family regulator, modulates virulence and competence in Streptococcus pneumoniae. Infect Immun 71:2615-2625. 68. Chen, J., G. Lu, J. Lin, A. L. Davidson, and F. A. Quiocho. 2003. A tweezers- like motion of the ATP-binding cassette dimer in an ABC transport cycle. Mol Cell 12:651-661.

156

69. Chen, X., and A. Varki. 2010. Advances in the biology and chemistry of sialic acids. ACS Chem Biol 5:163-176. 70. Chevance, F. F., M. Erhardt, C. Lengsfeld, S. J. Lee, and W. Boos. 2006. Mlc of Thermus thermophilus: a glucose-specific regulator for a glucose/mannose ABC transporter in the absence of the phosphotransferase system. J Bacteriol 188:6561-6571. 71. Chi, F., O. Nolte, C. Bergmann, M. Ip, and R. Hakenbeck. 2007. Crossing the barrier: evolution and spread of a major class of mosaic pbp2x in Streptococcus pneumoniae, S. mitis and S. oralis. Int J Med Microbiol 297:503-512. 72. Chuang, P. D., and S. L. Morrison. 1997. Elimination of N-linked glycosylation sites from the human IgA1 constant region: effects on structure and function. J Immunol 158:724-732. 73. Clarke, V. A., N. Platt, and T. D. Butters. 1995. Cloning and expression of the beta-N-acetylglucosaminidase gene from Streptococcus pneumoniae. Generation of truncated enzymes with modified aglycon specificity. J Biol Chem 270:8805- 8814. 74. Coats, M. T., T. Murphy, J. C. Paton, B. Gray, and D. E. Briles. 2011. Exposure of Thomsen-Friedenreich antigen in Streptococcus pneumoniae infection is dependent on pneumococcal neuraminidase A. Microb Pathog 50:343-349. 75. Cochran, J. B., V. M. Panzarino, L. Y. Maes, and F. W. Tecklenburg. 2004. Pneumococcus-induced T-antigen activation in hemolytic uremic syndrome and anemia. Pediatr Nephrol 19:317-321. 76. Collier, D. N., P. W. Hager, and P. V. Phibbs, Jr. 1996. Catabolite repression control in the Pseudomonads. Res Microbiol 147:551-561. 77. Crowley, J. F., I. J. Goldstein, J. Arnarp, and J. Lonngren. 1984. Carbohydrate binding studies on the lectin from Datura stramonium seeds. Arch Biochem Biophys 231:524-533. 78. Cundell, D. R., N. P. Gerard, C. Gerard, I. Idanpaan-Heikkila, and E. I. Tuomanen. 1995. Streptococcus pneumoniae anchor to activated human cells by the receptor for platelet-activating factor. Nature 377:435-438. 79. Cundell, D. R., and E. I. Tuomanen. 1994. Receptor specificity of adherence of Streptococcus pneumoniae to human type-II pneumocytes and vascular endothelial cells in vitro. Microb Pathog 17:361-374. 80. Cundell, D. R., J. N. Weiser, J. Shen, A. Young, and E. I. Tuomanen. 1995. Relationship between colonial morphology and adherence of Streptococcus pneumoniae. Infect Immun 63:757-761. 81. Dalia, A. B., A. J. Standish, and J. N. Weiser. 2010. Three surface exoglycosidases from Streptococcus pneumoniae, NanA, BgaA, and StrH, promote resistance to opsonophagocytic killing by human neutrophils. Infect Immun 78:2108-2116. 82. Dassa, E., and P. Bouige. 2001. The ABC of ABCS: a phylogenetic and functional classification of ABC systems in living organisms. Res Microbiol 152:211-229.

157

83. Davidson, A. L., and J. Chen. 2004. ATP-binding cassette transporters in bacteria. Annu Rev Biochem 73:241-268. 84. Davidson, A. L., E. Dassa, C. Orelle, and J. Chen. 2008. Structure, function, and evolution of bacterial ATP-binding cassette systems. Microbiol Mol Biol Rev 72:317-364. 85. de Vries, S. P., S. A. van Hijum, W. Schueler, K. Riesbeck, J. P. Hays, P. W. Hermans, and H. J. Bootsma. 2010. Genome analysis of Moraxella catarrhalis strain RH4, a human respiratory tract pathogen. J Bacteriol 192:3574-3583. 86. Denapaite, D., R. Bruckner, M. Nuhn, P. Reichmann, B. Henrich, P. Maurer, Y. Schahle, P. Selbmann, W. Zimmermann, R. Wambutt, and R. Hakenbeck. 2010. The genome of Streptococcus mitis B6--what is a commensal? PLoS ONE 5:e9426. 87. Denno, D. M., E. Frimpong, M. Gregory, and R. W. Steele. 2002. Nasopharyngeal carriage and susceptibility patterns of Streptococcus pneumoniae in Kumasi, Ghana. West Afr J Med 21:233-236. 88. Deutscher, J., C. Francke, and P. W. Postma. 2006. How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiol Mol Biol Rev 70:939-1031. 89. Deutscher, J., E. Kuster, U. Bergstedt, V. Charrier, and W. Hillen. 1995. Protein kinase-dependent HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in gram-positive bacteria. Mol Microbiol 15:1049-1053. 90. Doern, G. V. 2001. Antimicrobial use and the emergence of antimicrobial resistance with Streptococcus pneumoniae in the United States. Clin Infect Dis 33 Suppl 3:S187-192. 91. Donati, C., N. L. Hiller, H. Tettelin, A. Muzzi, N. J. Croucher, S. V. Angiuoli, M. Oggioni, J. C. Dunning Hotopp, F. Z. Hu, D. R. Riley, A. Covacci, T. J. Mitchell, S. D. Bentley, M. Kilian, G. D. Ehrlich, R. Rappuoli, E. R. Moxon, and V. Masignani. 2010. Structure and dynamics of the pan-genome of Streptococcus pneumoniae and closely related species. Genome Biol 11:R107. 92. Dorscheid, D. R., A. E. Conforti, K. J. Hamann, K. F. Rabe, and S. R. White. 1999. Characterization of cell surface lectin-binding patterns of human airway epithelium. Histochem J 31:145-151. 93. Eitinger, T., D. A. Rodionov, M. Grote, and E. Schneider. 2011. Canonical and ECF-type ATP-binding cassette importers in prokaryotes: diversity in modular organization and cellular functions. FEMS Microbiol Rev 35:3-67. 94. Eldholm, V., O. Johnsborg, K. Haugen, H. S. Ohnstad, and L. S. Havarstein. 2009. Fratricide in Streptococcus pneumoniae: contributions and role of the cell wall hydrolases CbpD, LytA and LytC. Microbiology 155:2223-2234. 95. Endo, Y., and A. Kobata. 1976. Partial purification and characterization of an endo-alpha-N-acetylgalactosaminidase from the culture of medium of Diplococcus pneumoniae. J Biochem 80:1-8. 96. Enright, M. C., and B. G. Spratt. 1998. A multilocus sequence typing scheme for Streptococcus pneumoniae: identification of clones associated with serious invasive disease. Microbiology 144:3049-3060.

158

97. Esko, J. D., and L. Zhang. 1996. Influence of core protein sequence on glycosaminoglycan assembly. Curr Opin Struct Biol 6:663-670. 98. Evstigneeva, A., D. Raoult, L. Karpachevskiy, and B. La Scola. 2009. Amoeba co-culture of soil specimens recovered 33 different bacteria, including four new species and Streptococcus pneumoniae. Microbiology 155:657-664. 99. Ferreira, M. J., and I. Sa-Nogueira. 2010. A multitask ATPase serving different ABC-type sugar importers in Bacillus subtilis. J Bacteriol 192:5312-5318. 100. Fine, M. J., M. A. Smith, C. A. Carson, S. S. Mutha, S. S. Sankey, L. A. Weissfeld, and W. N. Kapoor. 1996. Prognosis and outcomes of patients with community-acquired pneumonia. A meta-analysis. JAMA 275:134-141. 101. Flamaing, J., W. E. Peetermans, J. Vandeven, and J. Verhaegen. 2010. Pneumococcal colonization in older persons in a nonoutbreak setting. J Am Geriatr Soc 58:396-398. 102. Francis, T., and W. S. Tillett. 1930. Cutaneous Reactions in Pneumonia. The Development of Antibodies Following the Intradermal Injection of Type-Specific Polysaccharide. J Exp Med 52:573-585. 103. Fujita, K., F. Oura, N. Nagamine, T. Katayama, J. Hiratake, K. Sakata, H. Kumagai, and K. Yamamoto. 2005. Identification and molecular cloning of a novel glycoside hydrolase family of core 1 type O-glycan-specific endo-alpha-N- acetylgalactosaminidase from Bifidobacterium longum. J Biol Chem 280:37415- 37422. 104. Fujita, Y. 2009. Carbon catabolite control of the metabolic network in Bacillus subtilis. Biosci Biotechnol Biochem 73:245-259. 105. Gagneux, P., M. Cheriyan, N. Hurtado-Ziola, E. C. van der Linden, D. Anderson, H. McClure, A. Varki, and N. M. Varki. 2003. Human-specific regulation of alpha 2-6-linked sialic acids. J Biol Chem 278:48245-48250. 106. Garmory, H. S., and R. W. Titball. 2004. ATP-binding cassette transporters are targets for the development of antibacterial vaccines and therapies. Infect Immun 72:6757-6763. 107. Giammarinaro, P., and J. C. Paton. 2002. Role of RegM, a homologue of the catabolite repressor protein CcpA, in the virulence of Streptococcus pneumoniae. Infect Immun 70:5454-5461. 108. Giefing, C., A. L. Meinke, M. Hanner, T. Henics, D. Bui Minh, D. Gelbmann, U. Lunderberg, B. Henriques Normark, A. Ortqvist, M. Kalin, A. von Gabain, and E. Nagy. 2008. Discovery of a novel class of highly conserved vaccine antigens using genomic scale antigenic fingerprinting of pneumococcus with human antibodies. J Exp Med 205:117-131. 109. Gilbert, R. J. 2010. Cholesterol-dependent cytolysins. Adv Exp Med Biol 677:56-66. 110. Gorke, B., and J. Stulke. 2008. Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nat Rev Microbiol 6:613-624. 111. Gould, J. M., and J. N. Weiser. 2002. The inhibitory effect of C-reactive protein on bacterial phosphorylcholine platelet-activating factor receptor-mediated adherence is blocked by surfactant. J Infect Dis 186:361-371.

159

112. Greenberg, D. B., J. Stulke, and M. H. Saier, Jr. 2002. Domain analysis of transcriptional regulators bearing PTS regulatory domains. Res Microbiol 153:519-526. 113. Griffith, F. 1928. The significance of pneumococcal types. J Hyg, Cambridge, Eng 27:113-159. 114. Gut, H., S. J. King, and M. A. Walsh. 2008. Structural and functional studies of Streptococcus pneumoniae neuraminidase B: An intramolecular trans-sialidase. FEBS Lett:doi:10.1016/j.febslet.2008.08.026. 115. Hakenbeck, R., K. Kaminski, A. Konig, M. van der Linden, J. Paik, P. Reichmann, and D. Zahner. 1999. Penicillin-binding proteins in beta-lactam- resistant Streptococcus pneumoniae. Microb Drug Resist 5:91-99. 116. Hakenbeck, R., A. Madhour, D. Denapaite, and R. Bruckner. 2009. Versatility of choline metabolism and choline-binding proteins in Streptococcus pneumoniae and commensal streptococci. FEMS Microbiol Rev 33:572-586. 117. Hall-Stoodley, L., F. Z. Hu, A. Gieseke, L. Nistico, D. Nguyen, J. Hayes, M. Forbes, D. P. Greenberg, B. Dice, A. Burrows, P. A. Wackym, P. Stoodley, J. C. Post, G. D. Ehrlich, and J. E. Kerschner. 2006. Direct detection of bacterial biofilms on the middle-ear mucosa of children with chronic otitis media. JAMA 296:202-211. 118. Hammerschmidt, S. 2006. Adherence molecules of pathogenic pneumococci. Curr Opin Microbiol 9:12-20. 119. Hammerschmidt, S., G. Bethe, P. H. Remane, and G. S. Chhatwal. 1999. Identification of pneumococcal surface protein A as a lactoferrin-binding protein of Streptococcus pneumoniae. Infect Immun 67:1683-1687. 120. Hang, H. C., and C. R. Bertozzi. 2005. The chemistry and biology of mucin- type O-linked glycosylation. Bioorg Med Chem 13:5021-5034. 121. Harland, D. N., H. S. Garmory, K. A. Brown, and R. W. Titball. 2005. An association between ATP binding cassette systems, genome sizes and lifestyles of bacteria. Res Microbiol 156:434-442. 122. Hart, G. W. 1997. Dynamic O-linked glycosylation of nuclear and cytoskeletal proteins. Annu Rev Biochem 66:315-335. 123. Hartel, T., E. Eylert, C. Schulz, L. Petruschka, P. Gierok, S. Grubmuller, M. Lalk, W. Eisenreich, and S. Hammerschmidt. 2012. Characterization of central carbon metabolism of Streptococcus pneumoniae by isotopologue profiling. J Biol Chem 287:4260-4274. 124. Hartel, T., M. Klein, U. Koedel, M. Rohde, L. Petruschka, and S. Hammerschmidt. 2011. Impact of glutamine transporters on pneumococcal fitness under infection-related conditions. Infect Immun 79:44-58. 125. Hausdorff, W. P., J. Bryant, P. R. Paradiso, and G. R. Siber. 2000. Which pneumococcal serogroups cause the most invasive disease: implications for conjugate vaccine formulation and use, part I. Clin Infect Dis 30:100-121. 126. Hava, D. L., and A. Camilli. 2002. Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors. Mol Microbiol 45:1389-1406.

160

127. Henkin, T. M., F. J. Grundy, W. L. Nicholson, and G. H. Chambliss. 1991. Catabolite repression of alpha-amylase gene expression in Bacillus subtilis involves a trans-acting gene product homologous to the Escherichia coli lacl and galR repressors. Mol Microbiol 5:575-584. 128. Higgins, M. A., D. W. Abbott, M. J. Boulanger, and A. B. Boraston. 2009. Blood group antigen recognition by a solute-binding protein from a serotype 3 strain of Streptococcus pneumoniae. J Mol Biol 388:299-309. 129. Hiss, P. H. 1905. A Contribution to the Physiological Differentiation of Pneumococcus and Streptococcus, and to Methods of Staining Capsules. J Exp Med 6:317-345. 130. Holden, H. M., I. Rayment, and J. B. Thoden. 2003. Structure and function of enzymes of the Leloir pathway for galactose metabolism. J Biol Chem 278:43885-43888. 131. Holland, I. B., and M. A. Blight. 1999. ABC-ATPases, adaptable energy generators fuelling transmembrane movement of a variety of molecules in organisms from bacteria to humans. J Mol Biol 293:381-399. 132. Homer, K. A., G. Roberts, H. L. Byers, E. Tarelli, R. A. Whiley, J. Philpott- Howard, and D. Beighton. 2001. Mannosidase production by viridans group streptococci. J Clin Microbiol 39:995-1001. 133. Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77:61-68. 134. Hoskins, J., W. E. Alborn, Jr., J. Arnold, L. C. Blaszczak, S. Burgett, B. S. DeHoff, S. T. Estrem, L. Fritz, D. J. Fu, W. Fuller, C. Geringer, R. Gilmour, J. S. Glass, H. Khoja, A. R. Kraft, R. E. Lagace, D. J. LeBlanc, L. N. Lee, E. J. Lefkowitz, J. Lu, P. Matsushima, S. M. McAhren, M. McHenney, K. McLeaster, C. W. Mundy, T. I. Nicas, F. H. Norris, M. O'Gara, R. B. Peery, G. T. Robertson, P. Rockey, P. M. Sun, M. E. Winkler, Y. Yang, M. Young- Bellido, G. Zhao, C. A. Zook, R. H. Baltz, S. R. Jaskunas, P. R. Rosteck, Jr., P. L. Skatrud, and J. I. Glass. 2001. Genome of the bacterium Streptococcus pneumoniae strain R6. J Bacteriol 183:5709-5717. 135. Howard, L. V., and H. Gooder. 1974. Specificity of the autolysin of Streptococcus (Diplococcus) pneumoniae. J Bacteriol 117:796-804. 136. Huang, S. S., K. M. Johnson, G. T. Ray, P. Wroe, T. A. Lieu, M. R. Moore, E. R. Zell, J. A. Linder, C. G. Grijalva, J. P. Metlay, and J. A. Finkelstein. 2011. Healthcare utilization and cost of pneumococcal disease in the United States. Vaccine 29:3398-3412. 137. Hueck, C. J., W. Hillen, and M. H. Saier, Jr. 1994. Analysis of a cis-active sequence mediating catabolite repression in gram-positive bacteria. Res Microbiol 145:503-518. 138. Huhn, C., M. H. Selman, L. R. Ruhaak, A. M. Deelder, and M. Wuhrer. 2009. IgG glycosylation analysis. Proteomics 9:882-913. 139. Hurtubise, Y., F. Shareck, D. Kluepfel, and R. Morosoli. 1995. A cellulase/xylanase-negative mutant of Streptomyces lividans 1326 defective in

161

cellobiose and xylobiose uptake is mutated in a gene encoding a protein homologous to ATP-binding proteins. Mol Microbiol 17:367-377. 140. Hyams, C., E. Camberlein, J. M. Cohen, K. Bax, and J. S. Brown. 2010. The Streptococcus pneumoniae capsule inhibits complement activity and neutrophil phagocytosis by multiple mechanisms. Infect Immun 78:704-715. 141. Ing, J., E. O. Mason, S. L. Kaplan, L. B. Lamberth, P. A. Revell, R. A. Luna, and K. G. Hulten. 2012. Characterization of Nontypeable and Atypical Streptococcus pneumoniae Pediatric Isolates from 1994 to 2010. J Clin Microbiol 50:1326-1330. 142. Iyer, R., N. S. Baliga, and A. Camilli. 2005. Catabolite control protein A (CcpA) contributes to virulence and regulation of sugar metabolism in Streptococcus pneumoniae. J Bacteriol 187:8340-8349. 143. Iyer, R., and A. Camilli. 2007. Sucrose metabolism contributes to in vivo fitness of Streptococcus pneumoniae. Mol Microbiol 66:1-13. 144. Jackson, L. A., K. M. Neuzil, O. Yu, P. Benson, W. E. Barlow, A. L. Adams, C. A. Hanson, L. D. Mahoney, D. K. Shay, and W. W. Thompson. 2003. Effectiveness of pneumococcal polysaccharide vaccine in older adults. N Engl J Med 348:1747-1755. 145. Jeong, H. G., M. H. Oh, B. S. Kim, M. Y. Lee, H. J. Han, and S. H. Choi. 2009. The capability of catabolic utilization of N-acetylneuraminic acid, a sialic acid, is essential for Vibrio vulnificus pathogenesis. Infect Immun 77:3209-3217. 146. Jeong, J. K., O. Kwon, Y. M. Lee, D. B. Oh, J. M. Lee, S. Kim, E. H. Kim, T. N. Le, D. K. Rhee, and H. A. Kang. 2009. Characterization of the Streptococcus pneumoniae BgaC protein as a novel surface {beta}-galactosidase with specific hydrolysis activity for the Gal{beta}-1-3GlcNAc moiety of oligosaccharide. J Bacteriol 191:3011-3023. 147. Johnson, H. L., M. Deloria-Knoll, O. S. Levine, S. K. Stoszek, L. Freimanis Hance, R. Reithinger, L. R. Muenz, and K. L. O'Brien. 2010. Systematic evaluation of serotypes causing invasive pneumococcal disease among children under five: the pneumococcal global serotype project. PLoS Med 7:e1000348. 148. Johnston, C., J. Hinds, A. Smith, M. van der Linden, J. Van Eldere, and T. J. Mitchell. 2010. Detection of large numbers of pneumococcal virulence genes in streptococci of the mitis group. J Clin Microbiol 48:2762-2769. 149. Johnston, J. W. 2009. Example of use of taqman real-time RT-PCR to analyze bacterial gene transcript levels: Haemophilus influenzae. Curr Protoc Microbiol Chapter 1:Unit 1D 1. 150. Karlin, S., J. Theriot, and J. Mrazek. 2004. Comparative analysis of gene expression among low G+C gram-positive genomes. Proc Natl Acad Sci USA 101:6182-6187. 151. Kaufman, G. E., and J. Yother. 2007. CcpA-dependent and -independent control of beta-galactosidase expression in Streptococcus pneumoniae occurs via regulation of an upstream phosphotransferase system-encoding operon. J. Bacteriol. 189:5183-5192.

162

152. Kim, J. O., and J. N. Weiser. 1998. Association of intrastrain phase variation in quantity of capsular polysaccharide and teichoic acid with the virulence of Streptococcus pneumoniae. J Infect Dis 177:368-377. 153. King, S. J. 1999. Epidemiology and evolution of pneumococcal neuraminidases. University of Warwick, Coventry, UK. 154. King, S. J. 2010. Pneumococcal modification of host sugars: a major contributor to colonization of the human airway? Mol Oral Microbiol 25:15-24. 155. King, S. J., K. R. Hippe, J. M. Gould, D. Bae, S. Peterson, R. T. Cline, C. Fasching, E. N. Janoff, and J. N. Weiser. 2004. Phase variable desialylation of host proteins that bind to Streptococcus pneumoniae in vivo and protect the airway. Mol Microbiol 54:159-171. 156. King, S. J., K. R. Hippe, and J. N. Weiser. 2006. Deglycosylation of human glycoconjugates by the sequential activities of exoglycosidases expressed by Streptococcus pneumoniae. Mol Microbiol 59:961-974. 157. King, S. J., A. M. Whatmore, and C. G. Dowson. 2005. NanA, a neuraminidase from Streptococcus pneumoniae, shows high levels of sequence diversity, at least in part through recombination with Streptococcus oralis. J Bacteriol 187:5376- 5386. 158. Kinoshita, T., K. Ohishi, and J. Takeda. 1997. GPI-anchor synthesis in mammalian cells: genes, their products, and a deficiency. J Biochem 122:251- 257. 159. Kloosterman, T. G., J. J. Bijlsma, J. Kok, and O. P. Kuipers. 2006. To have neighbour's fare: extending the molecular toolbox for Streptococcus pneumoniae. Microbiology 152:351-359. 160. Klugman, K. P., Y. W. Chien, and S. A. Madhi. 2009. Pneumococcal pneumonia and influenza: a deadly combination. Vaccine 27 Suppl 3:C9-14. 161. Kobata, A., and S. Takasaki. 1978. endo-beta-Galactosidase and endo-alpha-N- acetylgalactosaminidase from Diplococcus pneumoniae. Methods Enzymol 50:560-584. 162. Kostyukova, N. N., M. O. Volkova, V. V. Ivanova, and A. S. Kvetnaya. 1995. A study of pathogenic factors of Streptococcus pneumoniae strains causing meningitis. FEMS Immunol Med Microbiol 10:133-137. 163. Krivan, H. C., D. D. Roberts, and V. Ginsburg. 1988. Many pulmonary pathogenic bacteria bind specifically to the carbohydrate sequence GalNAc beta 1-4Gal found in some glycolipids. Proc Natl Acad Sci USA 85:6157-6161. 164. Kundig, W., S. Ghosh, and S. Roseman. 1964. Phosphate Bound to Histidine in a Protein as an Intermediate in a Novel Phospho-Transferase System. Proc Natl Acad Sci U S A 52:1067-1074. 165. Lacks, S., and R. D. Hotchkiss. 1960. A study of the genetic material determining an enzyme in pneumococcus. Biochim Biophys Acta 39:508-518. 166. Laine, R. A. 1994. A calculation of all possible oligosaccharide isomers both branched and linear yields 1.05 x 10(12) structures for a reducing hexasaccharide: the Isomer Barrier to development of single-method saccharide sequencing or synthesis systems. Glycobiology 4:759-767.

163

167. Lanie, J. A., W. L. Ng, K. M. Kazmierczak, T. M. Andrzejewski, T. M. Davidsen, K. J. Wayne, H. Tettelin, J. I. Glass, and M. E. Winkler. 2007. Genome sequence of Avery's virulent serotype 2 strain D39 of Streptococcus pneumoniae and comparison with that of unencapsulated laboratory strain R6. J Bacteriol 189:38-51. 168. Lee, H., M. H. Nahm, and K. H. Kim. 2010. The effect of age on the response to the pneumococcal polysaccharide vaccine. BMC Infect Dis 10:60. 169. Leiberman, A., E. Leibovitz, L. Piglansky, S. Raiz, J. Press, P. Yagupsky, and R. Dagan. 2001. Bacteriologic and clinical efficacy of trimethoprim- sulfamethoxazole for treatment of acute otitis media. Pediatr Infect Dis J 20:260- 264. 170. Leighton, M. P., D. J. Kelly, M. P. Williamson, and J. G. Shaw. 2001. An NMR and enzyme study of the carbon metabolism of Neisseria meningitidis. Microbiology 147:1473-1482. 171. LeMessurier, K. S., A. D. Ogunniyi, and J. C. Paton. 2006. Differential expression of key pneumococcal virulence genes in vivo. Microbiology 152:305- 311. 172. Lewis, A. L., N. Desa, E. E. Hansen, Y. A. Knirel, J. I. Gordon, P. Gagneux, V. Nizet, and A. Varki. 2009. Innovations in host and microbial sialic acid biosynthesis revealed by phylogenomic prediction of nonulosonic acid structure. Proc Natl Acad Sci U S A 106:13552-13557. 173. Limoli, D. H., J. A. Sladek, L. A. Fuller, A. K. Singh, and S. J. King. 2011. BgaA acts as an adhesin to mediate attachment of some pneumococcal strains to human epithelial cells. Microbiology 157:2369-2381. 174. Lock, R. A., J. C. Paton, and D. Hansman. 1988. Purification and immunological characterization of neuraminidase produced by Streptococcus pneumoniae. Microb Pathog 4:33-43. 175. Lofling, J., V. Vimberg, P. Battig, and B. Henriques-Normark. 2011. Cellular interactions by LPxTG-anchored pneumococcal adhesins and their streptococcal homologues. Cell Microbiol 13:186-197. 176. Loirat, C., and V. Fremeaux-Bacchi. 2011. Atypical hemolytic uremic syndrome. Orphanet J Rare Dis 6:60. 177. Lu, G., J. M. Westbrooks, A. L. Davidson, and J. Chen. 2005. ATP hydrolysis is required to reset the ATP-binding cassette dimer into the resting-state conformation. Proc Natl Acad Sci U S A 102:17969-17974. 178. Lynch, M. 2006. Streamlining and simplification of microbial genome architecture. Annu Rev Microbiol 60:327-349. 179. Lysenko, E. S., A. J. Ratner, A. L. Nelson, and J. N. Weiser. 2005. The role of innate immune responses in the outcome of interspecies competition for colonization of mucosal surfaces. PLoS Pathog 1:e1. 180. Maccioni, H. J. 2007. Glycosylation of glycolipids in the Golgi complex. J Neurochem 103 Suppl 1:81-90. 181. Macfadyen, L. P., I. R. Dorocicz, J. Reizer, M. H. Saier, Jr., and R. J. Redfield. 1996. Regulation of competence development and sugar utilization in

164

Haemophilus influenzae Rd by a phosphoenolpyruvate:fructose phosphotransferase system. Mol Microbiol 21:941-952. 182. Macfarlane, G. T., and S. Macfarlane. 2012. Bacteria, colonic fermentation, and gastrointestinal health. J AOAC Int 95:50-60. 183. MacLeod, C. M., and R. G. Hodges. 1945. Prevention of pneumococcal pneumonia by immunization with specific capsular polysaccharides. J Exp Med 82:445-465. 184. Madhour, A., P. Maurer, and R. Hakenbeck. 2011. Cell surface proteins in S. pneumoniae, S. mitis and S. oralis. Iran J Microbiol 3:58-67. 185. Maiden, M. C., J. A. Bygraves, E. Feil, G. Morelli, J. E. Russell, R. Urwin, Q. Zhang, J. Zhou, K. Zurth, D. A. Caugant, I. M. Feavers, M. Achtman, and B. G. Spratt. 1998. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc Natl Acad Sci USA 95:3140-3145. 186. Manco, S., F. Hernon, H. Yesilkaya, J. C. Paton, P. W. Andrew, and A. Kadioglu. 2006. Pneumococcal neuraminidases A and B both have essential roles during infection of the respiratory tract and sepsis. Infect Immun 74:4014-4020. 187. Mandrell, R. E., A. J. Lesse, J. V. Sugai, M. Shero, J. M. Griffiss, J. A. Cole, N. J. Parsons, H. Smith, S. A. Morse, and M. A. Apicella. 1990. In vitro and in vivo modification of Neisseria gonorrhoeae lipooligosaccharide epitope structure by sialylation. J Exp Med 171:1649-1664. 188. Mandrell, R. E., R. McLaughlin, Y. Aba Kwaik, A. Lesse, R. Yamasaki, B. Gibson, S. M. Spinola, and M. A. Apicella. 1992. Lipooligosaccharides (LOS) of some Haemophilus species mimic human glycosphingolipids, and some LOS are sialylated. Infect Immun 60:1322-1328. 189. Marchler-Bauer, A., J. B. Anderson, F. Chitsaz, M. K. Derbyshire, C. DeWeese-Scott, J. H. Fong, L. Y. Geer, R. C. Geer, N. R. Gonzales, M. Gwadz, S. He, D. I. Hurwitz, J. D. Jackson, Z. Ke, C. J. Lanczycki, C. A. Liebert, C. Liu, F. Lu, S. Lu, G. H. Marchler, M. Mullokandov, J. S. Song, A. Tasneem, N. Thanki, R. A. Yamashita, D. Zhang, N. Zhang, and S. H. Bryant. 2009. CDD: specific functional annotation with the Conserved Domain Database. Nucleic Acids Res 37:D205-210. 190. Marchler-Bauer, A., J. B. Anderson, M. K. Derbyshire, C. DeWeese-Scott, N. R. Gonzales, M. Gwadz, L. Hao, S. He, D. I. Hurwitz, J. D. Jackson, Z. Ke, D. Krylov, C. J. Lanczycki, C. A. Liebert, C. Liu, F. Lu, S. Lu, G. H. Marchler, M. Mullokandov, J. S. Song, N. Thanki, R. A. Yamashita, J. J. Yin, D. Zhang, and S. H. Bryant. 2007. CDD: a conserved domain database for interactive domain family analysis. Nucleic Acids Res 35:D237-240. 191. Marchler-Bauer, A., and S. H. Bryant. 2004. CD-Search: protein domain annotations on the fly. Nucleic Acids Res 32:W327-331. 192. Marion, C., A. E. Aten, S. A. Woodiga, and S. J. King. 2011. Identification of an ATPase, MsmK, which energizes multiple carbohydrate ABC transporters in Streptococcus pneumoniae. Infect Immun 79:4193-4200.

165

193. Marion, C., A. M. Burnaugh, S. A. Woodiga, and S. J. King. 2011. Sialic acid transport contributes to pneumococcal colonization. Infect Immun 79:1262-1269. 194. Marion, C., D. H. Limoli, G. S. Bobulsky, J. L. Abraham, A. M. Burnaugh, and S. J. King. 2009. Identification of a pneumococcal glycosidase that modifies O-linked glycans. Infect Immun 77:1389-1396. 195. Marion, C., J. M. Stewart, M. F. Tazi, A. M. Burnaugh, C. M. Linke, S. A. Woodiga, and S. J. King. 2012. Streptococcus pneumoniae Can Utilize Multiple Sources of Hyaluronic Acid for Growth. Infect Immun 80:1390-1398. 196. Marquez, J., S. Reinelt, B. Koch, R. Engelmann, W. Hengstenberg, and K. Scheffzek. 2006. Structure of the full-length enzyme I of the phosphoenolpyruvate-dependent sugar phosphotransferase system. J Biol Chem 281:32508-32515. 197. Marraffini, L. A., A. C. Dedent, and O. Schneewind. 2006. Sortases and the art of anchoring proteins to the envelopes of gram-positive bacteria. Microbiol Mol Biol Rev 70:192-221. 198. Martinez, J., S. Steenbergen, and E. Vimr. 1995. Derived structure of the putative sialic acid transporter from Escherichia coli predicts a novel sugar permease domain. J Bacteriol 177:6005-6010. 199. Mattu, T. S., R. J. Pleass, A. C. Willis, M. Kilian, M. R. Wormald, A. C. Lellouch, P. M. Rudd, J. M. Woof, and R. A. Dwek. 1998. The glycosylation and structure of human serum IgA1, Fab, and Fc regions and the role of N- glycosylation on Fc alpha receptor interactions. J Biol Chem 273:2260-2272. 200. McCool, T. L., T. R. Cate, G. Moy, and J. N. Weiser. 2002. The immune response to pneumococcal proteins during experimental human carriage. J Exp Med 195:359-365. 201. McCool, T. L., and J. N. Weiser. 2004. Limited role of antibody in clearance of Streptococcus pneumoniae in a murine model of colonization. Infect Immun 72:5807-5813. 202. McKessar, S. J., and R. Hakenbeck. 2007. The two-component regulatory system TCS08 is involved in cellobiose metabolism of Streptococcus pneumoniae R6. J Bacteriol 189:1342-1350. 203. Melin, M., K. Trzcinski, S. Meri, H. Kayhty, and M. Vakevainen. 2010. The capsular serotype of Streptococcus pneumoniae is more important than the genetic background for resistance to complement. Infect Immun 78:5262-5270. 204. Messina, A. F., K. Katz-Gaynor, T. Barton, N. Ahmad, F. Ghaffar, D. Rasko, and G. H. McCracken, Jr. 2007. Impact of the pneumococcal conjugate vaccine on serotype distribution and antimicrobial resistance of invasive Streptococcus pneumoniae isolates in Dallas, TX, children from 1999 through 2005. Pediatr Infect Dis J 26:461-467. 205. Mikkat, S., and M. Hagemann. 2000. Molecular analysis of the ggtBCD gene cluster of Synechocystis sp. strain PCC6803 encoding subunits of an ABC transporter for osmoprotective compounds. Arch Microbiol 174:273-282.

166

206. Mikkat, S., M. Hagemann, and A. Schoor. 1996. Active transport of glucosylglycerol is involved in salt adaptation of the cyanobacterium Synechocystis sp. strain PCC 6803. Microbiology 142 ( Pt 7):1725-1732. 207. Mira, A., H. Ochman, and N. A. Moran. 2001. Deletional bias and the evolution of bacterial genomes. Trends Genet 17:589-596. 208. Moffitt, K. L., T. M. Gierahn, Y. J. Lu, P. Gouveia, M. Alderson, J. B. Flechtner, D. E. Higgins, and R. Malley. 2011. T(H)17-based vaccine design for prevention of Streptococcus pneumoniae colonization. Cell Host Microbe 9:158- 165. 209. Moffitt, K. L., and R. Malley. 2011. Next generation pneumococcal vaccines. Curr Opin Immunol 23:407-413. 210. Moran, N. A. 2002. Microbial minimalism: genome reduction in bacterial pathogens. Cell 108:583-586. 211. Morch-Lund, E. 1949. The fermenting power of pneumococci. Acta Pathol Microbiol Scand 26:709-714. 212. Mourez, M., M. Hofnung, and E. Dassa. 1997. Subunit interactions in ABC transporters: a conserved sequence in hydrophobic membrane proteins of periplasmic permeases defines an important site of interaction with the ATPase subunits. EMBO J 16:3066-3077. 213. Mufson, M. A., J. B. Hao, R. J. Stanek, and N. B. Norton. 2012. Clinical Features of Patients With Recurrent Invasive Streptococcus pneumoniae Disease. Am J Med Sci 343:303-309. 214. Munoz-Elias, E. J., J. Marcano, and A. Camilli. 2008. Isolation of Streptococcus pneumoniae biofilm mutants and their characterization during nasopharyngeal colonization. Infect Immun 76:5049-5061. 215. Muramatsu, H., H. Tachikui, H. Ushida, X. Song, Y. Qiu, S. Yamamoto, and T. Muramatsu. 2001. Molecular cloning and expression of endo-beta-N- acetylglucosaminidase D, which acts on the core structure of complex type asparagine-linked oligosaccharides. J Biochem (Tokyo) 129:923-928. 216. Musher, D. M., S. B. Manof, C. Liss, R. D. McFetridge, R. D. Marchese, B. Bushnell, F. Alvarez, C. Painter, M. D. Blum, and J. L. Silber. 2010. Safety and antibody response, including antibody persistence for 5 years, after primary vaccination or revaccination with pneumococcal polysaccharide vaccine in middle-aged and older adults. J Infect Dis 201:516-524. 217. Nieto, C., M. Espinosa, and A. Puyet. 1997. The maltose/maltodextrin regulon of Streptococcus pneumoniae. Differential promoter regulation by the transcriptional repressor MalR. J Biol Chem 272:30860-30865. 218. Nieto, C., A. Puyet, and M. Espinosa. 2001. MalR-mediated regulation of the Streptococcus pneumoniae malMP operon at promoter PM. Influence of a proximal divergent promoter region and competition between MalR and RNA polymerase proteins. J Biol Chem 276:14946-14954. 219. Novichkov, P. S., O. N. Laikova, E. S. Novichkova, M. S. Gelfand, A. P. Arkin, I. Dubchak, and D. A. Rodionov. 2010. RegPrecise: a database of

167

curated genomic inferences of transcriptional regulatory interactions in prokaryotes. Nucleic Acids Res 38:D111-118. 220. Nuorti, J. P., J. C. Butler, M. M. Farley, L. H. Harrison, A. McGeer, M. S. Kolczak, and R. F. Breiman. 2000. Cigarette smoking and invasive pneumococcal disease. Active Bacterial Core Surveillance Team. N Engl J Med 342:681-689. 221. Nuorti, J. P., and C. G. Whitney. 2010. Prevention of pneumococcal disease among infants and children - use of 13-valent pneumococcal conjugate vaccine and 23-valent pneumococcal polysaccharide vaccine - recommendations of the Advisory Committee on Immunization Practices (ACIP). MMWR Recomm Rep 59:1-18. 222. O'Brien, K. L., L. J. Wolfson, J. P. Watt, E. Henkle, M. Deloria-Knoll, N. McCall, E. Lee, K. Mulholland, O. S. Levine, and T. Cherian. 2009. Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates. Lancet 374:893-902. 223. O'Brien, M. A., L. A. Prosser, J. L. Paradise, G. T. Ray, M. Kulldorff, M. Kurs-Lasky, V. L. Hinrichsen, J. Mehta, D. K. Colborn, and T. A. Lieu. 2009. New vaccines against otitis media: projected benefits and cost- effectiveness. Pediatrics 123:1452-1463. 224. O'Toole, R. D., L. Goode, and C. Howe. 1971. Neuraminidase activity in bacterial meningitis. J Clin Invest 50:979-985. 225. Obert, C., J. Sublett, D. Kaushal, E. Hinojosa, T. Barton, E. I. Tuomanen, and C. J. Orihuela. 2006. Identification of a candidate Streptococcus pneumoniae core genome and regions of diversity correlated with invasive pneumococcal disease. Infect Immun 74:4766-4777. 226. Oggioni, M. R., C. Trappetti, A. Kadioglu, M. Cassone, F. Iannelli, S. Ricci, P. W. Andrew, and G. Pozzi. 2006. Switch from planktonic to sessile life: a major event in pneumococcal pathogenesis. Mol Microbiol 61:1196-1210. 227. Oldham, M. L., D. Khare, F. A. Quiocho, A. L. Davidson, and J. Chen. 2007. Crystal structure of a catalytic intermediate of the maltose transporter. Nature 450:515-521. 228. Oosterhuis-Kafeja, F., P. Beutels, and P. Van Damme. 2007. Immunogenicity, efficacy, safety and effectiveness of pneumococcal conjugate vaccines (1998- 2006). Vaccine 25:2194-2212. 229. Orihuela, C. J., G. Gao, K. P. Francis, J. Yu, and E. I. Tuomanen. 2004. Tissue-specific contributions of pneumococcal virulence factors to pathogenesis. J Infect Dis 190:1661-1669. 230. Ortqvist, A., J. Hedlund, and M. Kalin. 2005. Streptococcus pneumoniae: epidemiology, risk factors, and clinical features. Semin Respir Crit Care Med 26:563-574. 231. Pai, R., M. R. Moore, T. Pilishvili, R. E. Gertz, C. G. Whitney, and B. Beall. 2005. Postvaccine genetic structure of Streptococcus pneumoniae serotype 19A from children in the United States. J Infect Dis 192:1988-1995.

168

232. Parche, S., J. Amon, I. Jankovic, E. Rezzonico, M. Beleut, H. Barutcu, I. Schendel, M. P. Eddy, A. Burkovski, F. Arigoni, and F. Titgemeyer. 2007. Sugar transport systems of Bifidobacterium longum NCC2705. J Mol Microbiol Biotechnol 12:9-19. 233. Parche, S., M. Beleut, E. Rezzonico, D. Jacobs, F. Arigoni, F. Titgemeyer, and I. Jankovic. 2006. Lactose-over-glucose preference in Bifidobacterium longum NCC2705: glcP, encoding a glucose transporter, is subject to lactose repression. J Bacteriol 188:1260-1265. 234. Park, I. H., D. G. Pritchard, R. Cartee, A. Brandao, M. C. Brandileone, and M. H. Nahm. 2007. Discovery of a new capsular serotype (6C) within serogroup 6 of Streptococcus pneumoniae. J. Clin. Microbiol. 45:1225-1233. 235. Parker, D., G. Soong, P. Planet, J. Brower, A. J. Ratner, and A. Prince. 2009. The NanA neuraminidase of Streptococcus pneumoniae is involved in biofilm formation. Infect Immun 77:3722-3730. 236. Parr, T. R., Jr., and M. H. Saier, Jr. 1992. The bacterial phosphotransferase system as a potential vehicle for the entry of novel antibiotics. Res Microbiol 143:443-447. 237. Paterson, G. K., and T. J. Mitchell. 2006. The role of Streptococcus pneumoniae sortase A in colonisation and pathogenesis. Microbes Infect 8:145- 153. 238. Paton, J. C., B. Rowan-Kelly, and A. Ferrante. 1984. Activation of human complement by the pneumococcal toxin pneumolysin. Infect Immun 43:1085- 1087. 239. Pedersen, P. L. 2005. Transport ATPases: structure, motors, mechanism and medicine: a brief overview. J Bioenerg Biomembr 37:349-357. 240. Pelton, S. I., H. Huot, J. A. Finkelstein, C. J. Bishop, K. K. Hsu, J. Kellenberg, S. S. Huang, R. Goldstein, and W. P. Hanage. 2007. Emergence of 19A as virulent and multidrug resistant Pneumococcus in Massachusetts following universal immunization of infants with pneumococcal conjugate vaccine. Pediatr Infect Dis J 26:468-472. 241. Pettigrew, M. M., K. P. Fennie, M. P. York, J. Daniels, and F. Ghaffar. 2006. Variation in the presence of neuraminidase genes among Streptococcus pneumoniae isolates with identical sequence types. Infect Immun 74:3360-3365. 242. Philips, B. J., J. X. Meguer, J. Redman, and E. H. Baker. 2003. Factors determining the appearance of glucose in upper and lower respiratory tract secretions. Intensive Care Med 29:2204-2210. 243. Picard, C., A. Puel, J. Bustamante, C. L. Ku, and J. L. Casanova. 2003. Primary immunodeficiencies associated with pneumococcal disease. Curr Opin Allergy Clin Immunol 3:451-459. 244. Poehling, K. A., P. G. Szilagyi, C. G. Grijalva, S. W. Martin, B. LaFleur, E. Mitchel, R. D. Barth, J. P. Nuorti, and M. R. Griffin. 2007. Reduction of frequent otitis media and pressure-equalizing tube insertions in children after introduction of pneumococcal conjugate vaccine. Pediatrics 119:707-715.

169

245. Polissi, A., A. Pontiggia, G. Feger, M. Altieri, H. Mottl, L. Ferrari, and D. Simon. 1998. Large-scale identification of virulence genes from Streptococcus pneumoniae. Infect Immun 66:5620-5629. 246. Post, D. M., R. Mungur, B. W. Gibson, and R. S. Munson, Jr. 2005. Identification of a novel sialic acid transporter in Haemophilus ducreyi. Infect Immun 73:6727-6735. 247. Postma, P. W., J. W. Lengeler, and G. R. Jacobson. 1993. Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiol Rev 57:543-594. 248. Potgieter, E., and L. J. Chalkley. 1995. Relatedness among penicillin-binding protein 2b genes of Streptococcus mitis, Streptococcus oralis, and Streptococcus pneumoniae. Microb Drug Resist 1:35-42. 249. Poulsen, K., J. Reinholdt, and M. Kilian. 1996. Characterization of the Streptococcus pneumoniae immunoglobulin A1 protease gene (iga) and its translation product. Infect Immun 64:3957-3966. 250. Price, C. E., A. Zeyniyev, O. P. Kuipers, and J. Kok. 2011. From meadows to milk to mucosa - adaptation of Streptococcus and Lactococcus species to their nutritional environments. FEMS Microbiol Rev. 251. Puyet, A., and M. Espinosa. 1993. Structure of the maltodextrin-uptake locus of Streptococcus pneumoniae. Correlation to the Escherichia coli maltose regulon. J Mol Biol 230:800-811. 252. Puyet, A., A. M. Ibanez, and M. Espinosa. 1993. Characterization of the Streptococcus pneumoniae maltosaccharide regulator MalR, a member of the LacI-GalR family of repressors displaying distinctive genetic features. J Biol Chem 268:25402-25408. 253. Raninen, K., J. Lappi, H. Mykkanen, and K. Poutanen. 2011. Dietary fiber type reflects physiological functionality: comparison of grain fiber, inulin, and polydextrose. Nutr Rev 69:9-21. 254. Reichler, M. R., A. A. Allphin, R. F. Breiman, J. R. Schreiber, J. E. Arnold, L. K. McDougal, R. R. Facklam, B. Boxerbaum, D. May, R. O. Walton, and M. R. Jacobs. 1992. The spread of multiply resistant Streptococcus pneumoniae at a day care center in Ohio. J Infect Dis 166:1346-1353. 255. Reizer, J., and M. H. Saier, Jr. 1997. Modular multidomain phosphoryl transfer proteins of bacteria. Curr Opin Struct Biol 7:407-415. 256. Roche, A. M., S. J. King, and J. N. Weiser. 2007. Live attenuated Streptococcus pneumoniae strains induce serotype-independent mucosal and systemic protection in mice. Infect Immun 75:2469-2475. 257. Rodriguez, M. A., A. V. Gonzalez, M. A. Gavin, F. M. Martinez, N. G. Marin, B. R. Blazquez, and J. C. Moreno. 2011. Invasive pneumococcal disease: association between serotype, clinical presentation and lethality. Vaccine 29:5740-5746. 258. Rohmer, L., D. Hocquet, and S. I. Miller. 2011. Are pathogenic bacteria just looking for food? Metabolism and microbial pathogenesis. Trends Microbiol 19:341-348.

170

259. Ronda, C., J. L. Garcia, E. Garcia, J. M. Sanchez-Puelles, and R. Lopez. 1987. Biological role of the pneumococcal amidase. Cloning of the lytA gene in Streptococcus pneumoniae. Eur J Biochem 164:621-624. 260. Rose, M. C., and J. A. Voynow. 2006. Respiratory tract mucin genes and mucin glycoproteins in health and disease. Physiol Rev 86:245-278. 261. Rosenberg, A. 2004. Pneumococcus virulence factor sialidase: a new direction in neuro-AIDS research? J Neuroimmunol 147:33-34. 262. Rosenow, C., M. Maniar, and J. Trias. 1999. Regulation of the alpha- galactosidase activity in Streptococcus pneumoniae: characterization of the raffinose utilization system. Genome Res 9:1189-1197. 263. Rosenow, C., P. Ryan, J. N. Weiser, S. Johnson, P. Fontan, A. Ortqvist, and H. R. Masure. 1997. Contribution of novel choline-binding proteins to adherence, colonization and immunogenicity of Streptococcus pneumoniae. Mol Microbiol 25:819-829. 264. Rovers, M. M. 2008. The burden of otitis media. Vaccine 26 Suppl 7:G2-4. 265. Roy, S., C. W. Douglas, and G. P. Stafford. 2010. A novel sialic acid utilization and uptake system in the periodontal pathogen Tannerella forsythia. J Bacteriol 192:2285-2293. 266. Rubins, J. B., D. Charboneau, C. Fasching, A. M. Berry, J. C. Paton, J. E. Alexander, P. W. Andrew, T. J. Mitchell, and E. N. Janoff. 1996. Distinct roles for pneumolysin's cytotoxic and complement activities in the pathogenesis of pneumococcal pneumonia. Am J Respir Crit Care Med 153:1339-1346. 267. Saier, M. H., R. N. Hvorup, and R. D. Barabote. 2005. Evolution of the bacterial phosphotransferase system: from carriers and enzymes to group translocators. Biochem Soc Trans 33:220-224. 268. Samanta, S., T. Ayvaz, M. Reyes, H. A. Shuman, J. Chen, and A. L. Davidson. 2003. Disulfide cross-linking reveals a site of stable interaction between C-terminal regulatory domains of the two MalK subunits in the maltose transport complex. J Biol Chem 278:35265-35271. 269. Saurin, W., M. Hofnung, and E. Dassa. 1999. Getting in or out: early segregation between importers and exporters in the evolution of ATP-binding cassette (ABC) transporters. J Mol Evol 48:22-41. 270. Schell, M. A., M. Karmirantzou, B. Snel, D. Vilanova, B. Berger, G. Pessi, M. C. Zwahlen, F. Desiere, P. Bork, M. Delley, R. D. Pridmore, and F. Arigoni. 2002. The genome sequence of Bifidobacterium longum reflects its adaptation to the human gastrointestinal tract. Proc Natl Acad Sci USA 99:14422-14427. 271. Schlosser, A. 2000. MsiK-dependent trehalose uptake in Streptomyces reticuli. FEMS Microbiol Lett 184:187-192. 272. Schlosser, A., T. Kampers, and H. Schrempf. 1997. The Streptomyces ATP- binding component MsiK assists in cellobiose and maltose transport. J Bacteriol 179:2092-2095. 273. Schmees, G., A. Stein, S. Hunke, H. Landmesser, and E. Schneider. 1999. Functional consequences of mutations in the conserved 'signature sequence' of the ATP-binding-cassette protein MalK. Eur J Biochem 266:420-430.

171

274. Schneider, E. 2001. ABC transporters catalyzing carbohydrate uptake. Res Microbiol 152:303-310. 275. Schwarz, F., and M. Aebi. 2011. Mechanisms and principles of N-linked protein glycosylation. Curr Opin Struct Biol 21:576-582. 276. Schwarzkopf, M., K. P. Knobeloch, E. Rohde, S. Hinderlich, N. Wiechens, L. Lucka, I. Horak, W. Reutter, and R. Horstkorte. 2002. Sialylation is essential for early development in mice. Proc Natl Acad Sci U S A 99:5267-5270. 277. Severi, E., A. H. Hosie, J. A. Hawkhead, and G. H. Thomas. 2010. Characterization of a novel sialic acid transporter of the sodium solute symporter (SSS) family and in vivo comparison with known bacterial sialic acid transporters. FEMS Microbiol Lett 304:47-54. 278. Severi, E., G. Randle, P. Kivlin, K. Whitfield, R. Young, R. Moxon, D. Kelly, D. Hood, and G. H. Thomas. 2005. Sialic acid transport in Haemophilus influenzae is essential for lipopolysaccharide sialylation and serum resistance and is dependent on a novel tripartite ATP-independent periplasmic transporter. Mol Microbiol 58:1173-1185. 279. Shafeeq, S., T. G. Kloosterman, and O. P. Kuipers. 2011. CelR-mediated activation of the cellobiose-utilization gene cluster in Streptococcus pneumoniae. Microbiology 157:2854-2861. 280. Shakhnovich, E. A., S. J. King, and J. N. Weiser. 2002. Neuraminidase expressed by Streptococcus pneumoniae desialylates the lipopolysaccharide of Neisseria meningitidis and Haemophilus influenzae: a paradigm for interbacterial competition among pathogens of the human respiratory tract. Infect Immun 70:7161-7164. 281. Siemieniuk, R. A., D. B. Gregson, and M. J. Gill. 2011. The persisting burden of invasive pneumococcal disease in HIV patients: an observational cohort study. BMC Infect Dis 11:314. 282. Silva, Z., M. M. Sampaio, A. Henne, A. Bohm, R. Gutzat, W. Boos, M. S. da Costa, and H. Santos. 2005. The high-affinity maltose/trehalose ABC transporter in the extremely thermophilic bacterium Thermus thermophilus HB27 also recognizes sucrose and palatinose. J Bacteriol 187:1210-1218. 283. Singh, K. D., M. H. Schmalisch, J. Stulke, and B. Gorke. 2008. Carbon catabolite repression in Bacillus subtilis: quantitative analysis of repression exerted by different carbon sources. J Bacteriol 190:7275-7284. 284. Skinner, J. M., L. Indrawati, J. Cannon, J. Blue, M. Winters, J. Macnair, N. Pujar, W. Manger, Y. Zhang, J. Antonello, J. Shiver, M. Caulfield, and J. H. Heinrichs. 2011. Pre-clinical evaluation of a 15-valent pneumococcal conjugate vaccine (PCV15-CRM197) in an infant-rhesus monkey immunogenicity model. Vaccine 29:8870-8876. 285. Song, J. H., K. S. Ko, J. Y. Lee, J. Y. Baek, W. S. Oh, H. S. Yoon, J. Y. Jeong, and J. Chun. 2005. Identification of essential genes in Streptococcus pneumoniae by allelic replacement mutagenesis. Mol Cells 19:365-374.

172

286. Song, X.-M., W. Connor, K. Hokamp, L. Babiuk, and A. Potter. 2008. Streptococcus pneumoniae early response genes to human lung epithelial cells. BMC Research Notes 1:64. 287. Speziali, C. D., S. E. Dale, J. A. Henderson, E. D. Vines, and D. E. Heinrichs. 2006. Requirement of Staphylococcus aureus ATP-binding cassette-ATPase FhuC for iron-restricted growth and evidence that it functions with more than one iron transporter. J Bacteriol 188:2048-2055. 288. Spiro, R. G. 1964. Periodate oxidation of the glycoprotein fetuin. J Biol Chem 239:567-573. 289. Spiro, R. G. 1962. Studies on fetuin, a glycoprotein of fetal serum. II. Nature of the carbohydrate units. J Biol Chem 237:382-388. 290. Spiro, R. G. 1962. Studies on the monosaccharide sequence of the serum glycoprotein fetuin. J Biol Chem 237:646-652. 291. Spiro, R. G., and V. D. Bhoyroo. 1974. Structure of the O-glycosidically linked carbohydrate units of fetuin. J Biol Chem 249:5704-5717. 292. Steenbergen, S. M., C. A. Lichtensteiger, R. Caughlan, J. Garfinkle, T. E. Fuller, and E. R. Vimr. 2005. Sialic Acid metabolism and systemic pasteurellosis. Infect Immun 73:1284-1294. 293. Stonestrom, A., R. D. Barabote, C. F. Gonzalez, and M. H. Saier, Jr. 2005. Bioinformatic analyses of bacterial HPr kinase/phosphorylase homologues. Res Microbiol 156:443-451. 294. Stulke, J., M. Arnaud, G. Rapoport, and I. Martin-Verstraete. 1998. PRD--a protein domain involved in PTS-dependent induction and carbon catabolite repression of catabolic operons in bacteria. Mol Microbiol 28:865-874. 295. Sung, C. K., H. Li, J. P. Claverys, and D. A. Morrison. 2001. An rpsL cassette, janus, for gene replacement through negative selection in Streptococcus pneumoniae. Appl Environ Microbiol 67:5190-5196. 296. Talbot, T. R., T. V. Hartert, E. Mitchel, N. B. Halasa, P. G. Arbogast, K. A. Poehling, W. Schaffner, A. S. Craig, and M. R. Griffin. 2005. Asthma as a risk factor for invasive pneumococcal disease. N Engl J Med 352:2082-2090. 297. Taylor, M. E., and K. Drickamer. 2003. Introduction to Glycobiology. Oxford University Press. 298. Tchieu, J. H., V. Norris, J. S. Edwards, and M. H. Saier, Jr. 2001. The complete phosphotransferase system in Escherichia coli. J Mol Microbiol Biotechnol 3:329-346. 299. Teplyakov, A., K. Lim, P. P. Zhu, G. Kapadia, C. C. Chen, J. Schwartz, A. Howard, P. T. Reddy, A. Peterkofsky, and O. Herzberg. 2006. Structure of phosphorylated enzyme I, the phosphoenolpyruvate:sugar phosphotransferase system sugar translocation signal protein. Proc Natl Acad Sci U S A 103:16218- 16223. 300. Tettelin, H., K. E. Nelson, I. T. Paulsen, J. A. Eisen, T. D. Read, S. Peterson, J. Heidelberg, R. T. DeBoy, D. H. Haft, R. J. Dodson, A. S. Durkin, M. Gwinn, J. F. Kolonay, W. C. Nelson, J. D. Peterson, L. A. Umayam, O. White, S. L. Salzberg, M. R. Lewis, D. Radune, E. Holtzapple, H. Khouri, A.

173

M. Wolf, T. R. Utterback, C. L. Hansen, L. A. McDonald, T. V. Feldblyum, S. Angiuoli, T. Dickinson, E. K. Hickey, I. E. Holt, B. J. Loftus, F. Yang, H. O. Smith, J. C. Venter, B. A. Dougherty, D. A. Morrison, S. K. Hollingshead, and C. M. Fraser. 2001. Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science 293:498-506. 301. Tillett, W. S., and T. Francis. 1929. Cutaneous Reactions to the Polysaccharides and Proteins of Pneumococcus in Lobar Pneumonia. J Exp Med 50:687-701. 302. Tong, H. H., L. E. Blue, M. A. James, and T. F. DeMaria. 2000. Evaluation of the virulence of a Streptococcus pneumoniae neuraminidase-deficient mutant in nasopharyngeal colonization and development of otitis media in the chinchilla model. Infect Immun 68:921-924. 303. Tong, H. H., M. James, I. Grants, X. Liu, G. Shi, and T. F. DeMaria. 2001. Comparison of structural changes of cell surface carbohydrates in the eustachian tube epithelium of chinchillas infected with a Streptococcus pneumoniae neuraminidase-deficient mutant or its isogenic parent strain. Microb Pathog 31:309-317. 304. Tong, H. H., X. Liu, Y. Chen, M. James, and T. F. DeMaria. 2002. Effect of neuraminidase on receptor-mediated adherence of Streptococcus pneumoniae to chinchilla tracheal epithelium. Acta Otolaryngol 122:413-419. 305. Tong, H. H., M. A. McIver, L. M. Fisher, and T. F. DeMaria. 1999. Effect of lacto-N-neotetraose, asialoganglioside-GM1 and neuraminidase on adherence of otitis media-associated serotypes of Streptococcus pneumoniae to chinchilla tracheal epithelium. Microb. Pathog. 26:111-119. 306. Trappetti, C., A. Kadioglu, M. Carter, J. Hayre, F. Iannelli, G. Pozzi, P. W. Andrew, and M. R. Oggioni. 2009. Sialic acid: a preventable signal for pneumococcal biofilm formation, colonization, and invasion of the host. J Infect Dis 199:1497-1505. 307. Tyx, R. E., H. Roche-Hakansson, and A. P. Hakansson. 2011. Role of Dihydrolipoamide Dehydrogenase in Regulation of Raffinose Transport in Streptococcus pneumoniae. J Bacteriol 193:3512-3524. 308. Uchiyama, S., A. F. Carlin, A. Khosravi, S. Weiman, A. Banerjee, D. Quach, G. Hightower, T. J. Mitchell, K. S. Doran, and V. Nizet. 2009. The surface- anchored NanA protein promotes pneumococcal brain endothelial cell invasion. J Exp Med 206:1845-1852. 309. Umemoto, J., V. P. Bhavanandan, and E. A. Davidson. 1977. Purification and properties of an endo-alpha-N-acetyl-D-galactosaminidase from Diplococcus pneumoniae. J Biol Chem 252:8609-8614. 310. van Bueren, A. L., M. Higgins, D. Wang, R. D. Burke, and A. B. Boraston. 2007. Identification and structural basis of binding to host lung glycogen by streptococcal virulence factors. Nat Struct Mol Biol 14:76-84. 311. van den Bogaard, P. T., M. Kleerebezem, O. P. Kuipers, and W. M. de Vos. 2000. Control of lactose transport, beta-galactosidase activity, and glycolysis by CcpA in Streptococcus thermophilus: evidence for carbon catabolite repression by

174

a non-phosphoenolpyruvate-dependent phosphotransferase system sugar. J Bacteriol 182:5982-5989. 312. van Mens, S. P., S. C. Meijvis, H. Endeman, H. van Velzen-Blad, D. H. Biesma, J. C. Grutters, B. J. Vlaminckx, and G. T. Rijkers. 2011. Longitudinal analysis of pneumococcal antibodies during community-acquired pneumonia reveals a much higher involvement of Streptococcus pneumoniae than estimated by conventional methods alone. Clin Vaccine Immunol 18:796-801. 313. van Opijnen, T., K. L. Bodi, and A. Camilli. 2009. Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nat Methods 6:767-772. 314. Varki, A. 1992. Diversity in the sialic acids. Glycobiology 2:25-40. 315. Varki, A. 1998. Factors controlling the glycosylation potential of the Golgi apparatus. Trends Cell Biol 8:34-40. 316. Varki, A. 2008. Sialic acids in human health and disease. Trends Mol Med 14:351-360. 317. Varki, N. M., and A. Varki. 2007. Diversity in cell surface sialic acid presentations: implications for biology and disease. Lab Invest 87:851-857. 318. Vasoo, S., K. Singh, L. Y. Hsu, Y. F. Chiew, C. Chow, R. T. Lin, and P. A. Tambyah. 2011. Increasing antibiotic resistance in Streptococcus pneumoniae colonizing children attending day-care centres in Singapore. Respirology 16:1241-1248. 319. Viasus, D., C. Garcia-Vidal, J. M. Cruzado, J. Adamuz, R. Verdaguer, F. Manresa, J. Dorca, F. Gudiol, and J. Carratala. 2011. Epidemiology, clinical features and outcomes of pneumonia in patients with chronic kidney disease. Nephrol Dial Transplant 26:2899-2906. 320. Vila-Corcoles, A., E. Salsench, T. Rodriguez-Blanco, O. Ochoa-Gondar, C. de Diego, A. Valdivieso, I. Hospital, F. Gomez-Bertomeu, and X. Raga. 2009. Clinical effectiveness of 23-valent pneumococcal polysaccharide vaccine against pneumonia in middle-aged and older adults: a matched case-control study. Vaccine 27:1504-1510. 321. Vimr, E., C. Lichtensteiger, and S. Steenbergen. 2000. Sialic acid metabolism's dual function in Haemophilus influenzae. Mol Microbiol 36:1113-1123. 322. Vimr, E. R., K. A. Kalivoda, E. L. Deszo, and S. M. Steenbergen. 2004. Diversity of microbial sialic acid metabolism. Microbiol Mol Biol Rev 68:132- 153. 323. Vimr, E. R., and F. A. Troy. 1985. Identification of an inducible catabolic system for sialic acids (nan) in Escherichia coli. J Bacteriol 164:845-853. 324. Walker, J. E., M. Saraste, M. J. Runswick, and N. J. Gay. 1982. Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J 1:945-951. 325. Walsh, R. L., and A. Camilli. 2011. Streptococcus pneumoniae is desiccation tolerant and infectious upon rehydration. MBio 2:e00092-11.

175

326. Wani, J. H., J. V. Gilbert, A. G. Plaut, and J. N. Weiser. 1996. Identification, cloning, and sequencing of the immunoglobulin A1 protease gene of Streptococcus pneumoniae. Infect Immun 64:3967-3974. 327. Ward, R. E., M. Ninonuevo, D. A. Mills, C. B. Lebrilla, and J. B. German. 2007. In vitro fermentability of human milk oligosaccharides by several strains of bifidobacteria. Mol Nutr Food Res 51:1398-1405. 328. Watt, J. P., K. L. O'Brien, S. Katz, M. A. Bronsdon, J. Elliott, J. Dallas, M. J. Perilla, R. Reid, L. Murrow, R. Facklam, M. Santosham, and C. G. Whitney. 2004. Nasopharyngeal versus oropharyngeal sampling for detection of pneumococcal carriage in adults. J Clin Microbiol 42:4974-4976. 329. Webb, A. J., K. A. Homer, and A. H. Hosie. 2008. Two closely related ABC transporters in Streptococcus mutans are involved in disaccharide and/or oligosaccharide uptake. J Bacteriol 190:168-178. 330. Weigel, P. H., and J. H. Yik. 2002. Glycans as endocytosis signals: the cases of the asialoglycoprotein and hyaluronan/chondroitin sulfate receptors. Biochim Biophys Acta 1572:341-363. 331. Weiser, J. N. 2010. The pneumococcus: why a commensal misbehaves. J Mol Med 88:97-102. 332. Weiser, J. N., R. Austrian, P. K. Sreenivasan, and H. R. Masure. 1994. Phase variation in pneumococcal opacity: relationship between colonial morphology and nasopharyngeal colonization. Infect Immun 62:2582-2589. 333. Wessels, M. R., A. E. Moses, J. B. Goldberg, and T. J. DiCesare. 1991. Hyaluronic acid capsule is a virulence factor for mucoid group A streptococci. Proc Natl Acad Sci U S A 88:8317-8321. 334. Weycker, D., D. Strutton, J. Edelsberg, R. Sato, and L. A. Jackson. 2010. Clinical and economic burden of pneumococcal disease in older US adults. Vaccine 28:4955-4960. 335. Whatmore, A. M., V. A. Barcus, and C. G. Dowson. 1999. Genetic diversity of the streptococcal competence (com) gene locus. J. Bacteriol. 181:3144-3154. 336. Widdowson, C. A., and K. P. Klugman. 1999. Molecular mechanisms of resistance to commonly used non-beta lactam drugs in Streptococcus pneumoniae. Semin Respir Infect 14:255-268. 337. Wiertsema, S. P., L. A. Kirkham, K. J. Corscadden, E. N. Mowe, J. M. Bowman, P. Jacoby, R. Francis, S. Vijayasekaran, H. L. Coates, T. V. Riley, and P. Richmond. 2011. Predominance of nontypeable Haemophilus influenzae in children with otitis media following introduction of a 3+0 pneumococcal conjugate vaccine schedule. Vaccine 29:5163-5170. 338. Wong, A., T. J. Marrie, S. Garg, J. D. Kellner, and G. J. Tyrrell. 2010. Increased risk of invasive pneumococcal disease in haematological and solid- organ malignancies. Epidemiol Infect 138:1804-1810. 339. World Health Organization. 2008. The global burden of disease: 2004 update. 340. Xu, G., M. J. Kiefel, J. C. Wilson, P. W. Andrew, M. R. Oggioni, and G. L. Taylor. 2011. Three Streptococcus pneumoniae Sialidases: Three Different Products. J Am Chem Soc 133:1718-1721.

176

341. Xu, J., M. A. Mahowald, R. E. Ley, C. A. Lozupone, M. Hamady, E. C. Martens, B. Henrissat, P. M. Coutinho, P. Minx, P. Latreille, H. Cordum, A. Van Brunt, K. Kim, R. S. Fulton, L. A. Fulton, S. W. Clifton, R. K. Wilson, R. D. Knight, and J. I. Gordon. 2007. Evolution of symbiotic bacteria in the distal human intestine. PLoS Biol 5:e156. 342. Yamada, K., S. Hyodo, Y. K. Matsuno, M. Kinoshita, S. Z. Maruyama, Y. S. Osaka, E. Casal, Y. C. Lee, and K. Kakehi. 2007. Rapid and sensitive analysis of mucin-type glycans using an in-line flow glycan-releasing apparatus. Anal Biochem 371:52-61. 343. Yesilkaya, H., S. Manco, A. Kadioglu, V. S. Terra, and P. W. Andrew. 2008. The ability to utilize mucin affects the regulation of virulence gene expression in Streptococcus pneumoniae. FEMS Microbiol Lett 278:231-235. 344. Yother, J. 2011. Capsules of Streptococcus pneumoniae and other bacteria: paradigms for polysaccharide biosynthesis and regulation. Annu Rev Microbiol 65:563-581. 345. Yu, J., G. Carvalho Mda, B. Beall, and M. H. Nahm. 2008. A rapid pneumococcal serotyping system based on monoclonal antibodies and PCR. J Med Microbiol 57:171-178. 346. Zahner, D., and R. Hakenbeck. 2000. The Streptococcus pneumoniae beta- galactosidase is a surface protein. J Bacteriol 182:5919-5921. 347. Zhang, J. R., K. E. Mostov, M. E. Lamm, M. Nanno, S. Shimida, M. Ohwaki, and E. Tuomanen. 2000. The polymeric immunoglobulin receptor translocates pneumococci across human nasopharyngeal epithelial cells. Cell 102:827-837. 348. Zhou, L., F. M. Hui, and D. A. Morrison. 1995. Characterization of IS1167, a new insertion sequence in Streptococcus pneumoniae. Plasmid 33:127-138. 349. Zuniga, M., I. Comas, R. Linaje, V. Monedero, M. J. Yebra, C. D. Esteban, J. Deutscher, G. Perez-Martinez, and F. Gonzalez-Candelas. 2005. Horizontal gene transfer in the molecular evolution of mannose PTS transporters. Mol Biol Evol 22:1673-1685. 350. Zwijnenburg, P. J., T. van der Poll, S. Florquin, S. J. van Deventer, J. J. Roord, and A. M. van Furth. 2001. Experimental pneumococcal meningitis in mice: a model of intranasal infection. J Infect Dis 183:1143-1146.

177