DOCSLIB.ORG

Villa Kalvos Region: Rhodes Sleeps: 10

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Villa Kalvos Region: Rhodes Sleeps: 10 Villa Kalvos Region: Rhodes Sleeps: 10 Overview For a real rockstar retreat, escape to Villa Kalvos, a family-friendly 5 bedroomed villa in Kolimpia – an idyllic sun-soaked resort on the east coast of Rhodes, Greece. Perfectly located in-between the mountains and the sea, onshore and aquatic adventures beckon, including top-notch snorkelling or sailing. It’s in the lush four-acre garden, Mediterranean-modern interiors and inviting five-bedrooms that you’ll find the quintessence of luxury at Villa Kalvos. The entrance sets the tone of this villa – with a fountain and gated grounds sprinkled with native trees and fauna for your utmost privacy and tranquillity. There’s a private outdoor pool for taking a cooling dip after a day of exploring, BBQ facilities and an outdoor seating area for dining al fresco while soaking in the breath-taking views. Stepping inside, you’re greeted by a fully-equipped kitchen, dining area and main living room with a plasma TV. The rooms are all equally seductive, stylish and serene, and you have the choice of one king, two doubles and two twin rooms to enjoy your peaceful night’s rest. We love the decadent bathrooms with cream tiles and the large hot tub – ideal for a spa-like feel. Comfortable beds, inviting chairs and dreamy wardrobe space up the 'luxe' factor, while the light colour palette picks up on the sea views, visible through the windows or one of the balconies. During your stay, children can use the on-site indoor playroom or play hide and seek in the extensive enclosed grounds, where there’s also a football net. There’s also a picnic area and table tennis table. With parking, Wi-Fi and pool towels available for your convenience, the owners at Villa Kalvos have thought of everything to make sure your stay is the most relaxing and pleasant one. With cafés, restaurants and supermarkets all within a short 400m walk and the renowned Kolimpia Beach – a kilometre-long ribbon of soft sand set in a horseshoe bay – 2.5km away, Villa Kalvos provides the perfect setting for exploring more of what this beautiful part of Greece has to offer. Page 1 Facilities Recommended • Private Pool • Beach Nearby • Ideal for Kids • Ideal for Teens • Wi-Fi/Internet • Air-Con • <1hr to Airport • BBQ • Cable TV • Table Tennis • DVD • Cot(s) • High Chair(s) • Fenced Grounds • Golf Nearby • Tennis Nearby • Fishing • Outstanding Landscapes • Outdoor Pursuit & Activities • Tourist Towns & Villages • Historical Sites Page 2 Interior & Grounds Gated entry to large drive with water pool and parking for several cars Ground Floor - Fully equipped kitchen - Large open plan living area - Kitchen table for 4 - Dining area for 6 - Patio doors to pool terrace - Double bedroom with terrace First Floor - Master bedroom,with cot, en-suite bathroom with Jacuzzi bath and twin basins, doors to balcony - Double bedroom with balcony - Twin bedroom with balcony - Twin bedroom - 2 Shower rooms Pool Terrace - Barbecue - Dining area - Sunbeds - Large inside barbecue area - Shower room Other facilities: - Washing Machine - Dishwasher - Microwave - Coffee Machine - Iron and ironing board - Local satellite TV - CD/DVD - Wii Games console - Hairdryer - Microwave - WiFi - Air-conditioning - Cot - Highchair - Safe deposit box - Roof Terrace with sea views Page 3 Location & Local Information Located 25km east of the city of Rhodes, and midway between lively Faliraki and ancient Lindos, Kolimpia is a beautiful resort known for its charming character, Blue Flag beach and striking natural scenery. With a peaceful and welcoming atmosphere and plenty of things to see and do, including a handful of cafés, bars and restaurants, it’s an ideal choice for families and couples alike. Perhaps the most distinctive landmark at Kolimpia is the main straight road with eucalyptus trees, lined on both sides that connects the main street with the beach. If you have a family with small children, this stretch of coastline is perfect for its shallow waters and fine soft sand. The water is clear – ideal for swimming and snorkelling – and there are usually water sports on offer here. From Kolimpia, you’re well placed to explore Rhodes’ coast by boat or do a spot of island-hopping. The boat trip to Symi, one of Greece’s most photogenic islands, takes in towering churches and silent monasteries. If luxury is more your thing, a yacht from the harbour can whisk you off to Charaki Bay for some first-class snorkelling and swimming in the turquoise waters. If you have a car, Rhodes City Centre is a 30-minute drive from the villa, and even closer is the natural beauty of the Seven Springs – with forests for walking and natural lakes – and many other mountain destinations of Rhodes. You could also head to Lindos, a 40-minute drive, which has quaint houses clinging to a steep rock. The main attraction there is the Acropolis, the millennia-old temple to Athena, with its Doric columns and breath-taking 360- degree views. Local Amenities Nearest Airport Rhodes international (30km) Nearest Town/City Rhodes Town (23km) Nearest Beach Kolympia - Drive (3.2km) Nearest Restaurant Anthoula tavern (500 metres) Nearest Supermarket Mama Litsa (300 metres) Page 4 Sightseeing Paramythea Monastery (5.9 km) Sightseeing Artistic Village (1.2km) Nearest Bar/Pub super mases cafe (400 metres) Nearest Village Kolympia (600m) Page 5 What Oliver loves… What you should know… Glorious sea and mountainous views from the balconies and a seaview from There’s fishing and a tennis court available off-site for an extra charge. the roof terrace The upper floors are accessible by steps only, but there are ground floor rooms. Extensive and private grounds, including plenty of places for you to relax in the The nearby waterpark will not be available for the 2020 season sun or shade. The facilities here are fantastic – including an outdoor pool, hot tub and picnic area. Page 6 Terms & Conditions - Arrival time: Check in is anytime from 14:00 onwards - Departure time: Please checkout by 10:00 - Energy costs included?: Energy costs are included in the rental cost - Linen & towels included?: Linen and towels are included in the rental price - Smoking Allowed?: There are designated smoking areas outside the main building - Insurance: It is recommended that all guests take out insurance to cover against potential cancellation and any accidental damage caused during your stay at the property. - Internet access?: Complimentary WiFi connection is provided at the house. - Security deposit: No security deposit is required at this property however clients must be aware that they will be liable for any damage or breakages. Page 7.
Load more

Recommended publications
  • Lindos Wedding Reception Venues 2021.Cdr
    Lindos Wedding Receptions Venues Unforgettable Greek Weddings INDEX Page 3: Argo - Charaki Page 4: Lindian Jewel - Vlicha Bay Lindos Page 6: Tambakio -St Pau's Bay Page 7: Kalypso - Lindos Village Page 8: Nefeli - Lindos Beach Page 9: Mythos - Lindos Village & Square Page 10: Philosophia -Peos Page 11: Cesar’s- Lindos Village Page 12: Elia - Peos Page 13: Med East Lindos Main Square Page 14: Skala - Lindos Argo Restaurant, Charaki Situated at the end of the beautiful bay of Charaki, Argo taverna boasts some of the best views on the island. Surrounded by the sea you can relax and enjoy the sunset whilst indulging in some of the finest food to be found on the island. Argo truly is a special treat and we are privileged to be able to oer you such a unique venue accompanied with exquisite mouthwatering menus. A very popular choice with locals. The Argo is also perfect if you wish to arrive by boat from your ceremony location(Tender required). Additional Information · Veranda seating area · Indoor seating area · Chair Covers and white table linen included · Dance area available · Suitable for wedding groups up to 80 · Sea Views · Arrival by boat small tender may be required Lindian Jewel, Vlicha The Lindian Jewel is an amazing venue to hold your Lindos wedding reception. This stunning venue is located on two levels – The 'Azzurro' lounge bar on the lower level and the 'Lindian Jewel,' a wedding dining area on the upper level. The pre-dinner drinks and evening entertainment are held in the Al Fresco 'Azzurro' lounge bar on the lower level.
    [Show full text]
  • Die Molluskenfauna Der Insel Rhodos 1
    ©Naturhistorisches Museum Wien, download unter www.biologiezentrum.at Ann. Naturhistor. Mus. Wien 80 681-780 Wien, November 1976 Die Molluskenfauna der Insel Rhodos 1. Teil In der Serie: Ergebnisse der von Dr. 0. PAGET und Dr. E. KRITSCHER auf Rhodos durchgeführten zoologischen Sammelreisen. XVII. Mollusca I Von OLIVER E. PAGET X) (Mit 1 Karte, 2 Abbildungen und 7 Tafeln) Manuskript eingelangt am 1. März 1976 Die Molluskenfauna der Insel Rhodos hat schon vor langer Zeit die Mala- kologen interessiert. Da Rhodos seinem geologischen Aufbau nach dem kleinasiatischen Fest- land zuzurechnen ist, zeigt es darin wesentliche Unterschiede zu Mittel- griechenland und auch zu vielen anderen Inseln des ägäischen Raumes. Es war daher zu erwarten, daß zumindest ein Teil der Fauna dieser Insel ebenfalls eher dem kleinasiatischen als dem mittelgriechischen Gebiet angenähert sein wird. Diese Vermutung wurde durch die Aufsammlungen auch zum Teil be- stätigt, so daß die einige Jahre später im Gebiet der östlichen und südlichen Türkei durchgeführten Aufsammlungen, an denen vom Wiener Naturhistori- schen Museum neben dem Autor noch Dr. E. KRITSCHER und Oberpräparator K. BILEK teilnahmen, sicherlich weitere Bestätigungen dieser Vermutung bringen werden. Die Publikation der bei dieser Reise gefundenen Ergebnisse wird ent- sprechende Unterlagen dafür liefern. So wechselvoll die Geschichte der Insel Rhodos war, so wechselvoll waren auch die Untersuchungen, die die Erforschung der Molluskenfauna dieser Insel zum Ziel hatten. Aus der Zeit der Besetzung durch die Türken, die von 1523—1912 dauerte, stammen die wohl ersten publizierten Aufsammlungen. FORSKAL (1786), der bei einem kurzen Aufenthalt die Stadt Rhodos besuchte, fand Eobania vermiculata (0. F. MÜLLER) und veröffentlichte diese Mitteilung im Conchylien-Cabinet, v.
    [Show full text]
  • The Legacy of the Crusaders: Complex History of Colonization and Anthropochory in the Land Snails Levantina
    ZOBODAT - www.zobodat.at Zoologisch-Botanische Datenbank/Zoological-Botanical Database Digitale Literatur/Digital Literature Zeitschrift/Journal: Zoosystematics and Evolution Jahr/Year: 2015 Band/Volume: 91 Autor(en)/Author(s): Ketmaier Valerio, Glaubrecht Matthias Artikel/Article: The legacy of the Crusaders: Complex history of colonization and anthropochory in the land snails Levantina (Gastropoda, Pulmonata) in the Eastern Mediterranean 81-89 Creative Commons Attribution 4.0 licence (CC-BY); original download https://pensoft.net/journals Zoosyst. Evol. 91 (1) 2015, 81–89 | DOI 10.3897/zse.91.4693 museum für naturkunde The legacy of the Crusaders: Complex history of colonization and anthropochory in the land snails Levantina (Gastropoda, Pulmonata) in the Eastern Mediterranean Valerio Ketmaier1, Matthias Glaubrecht2 1 Department of Biology and Biotechnology “Charles Darwin”, University of Rome “La Sapienzaî” V.le dell’Università 32, I-00185 Roma, Italy 2 Centre of Natural History, Zoological Museum, University Hamburg, Martin-Luther-King-Platz 3, 20146 Hamburg, Germany http://zoobank.org/48A24139-3151-42FB-9EB4-5B31BD523800 Corresponding author: Valerio Ketmaier ([email protected]) Abstract Received 7 February 2015 The Eastern Mediterranean land snails Levantina display a disjunct distribution spanning Accepted 28 March 2015 the Middle East (Levant), Cyprus, few locations along the Aegean Turkish coast between Published 22 April 2015 Bodrum and Datça and on the islands of Rhodes, Karpathos and a few surrounding islets (Dodecanese). These land snails are strictly bound to limestone; shell variability is no- Academic editor: ticeable with a pair of umbilicate and non-umbilicate forms parapatrically distributed in Carsten Lüter the Levant and along the Aegean Turkish coast; they overlap on the Dodecanese islands.
    [Show full text]
  • 6Classic Islands Reveal Their Secrets in the Voices of the Islanders Who Love
    This is a caption for this photo. This is a caption for this photo. This is a caption for this photo. This is a caption for this photo. This is a caption for this photo. This is a caption for this photo. This is a caption for this photo. .Photographs by Tino Soriano Tino by .Photographs 6 classic Insider’s islands reveal their secrets in the voices of the islanders who love by Rachel Howard Rachel by them most. Greek Isles BULGARIA MACEDONIA TURKEY ALBANIA Thessaloniki Thassos Limnos GREECE A N o g r Corfu Igoumenista e t Skiathos a h I n A Patmos o g n S e i “Patmos has a magic you can’t quite put your finger on,” muses Ellen Sutton, a British writer who ran a a Skopellos e n n Lesvos a away to Patmos 20 years ago and never looked back. For centuries, Patmos has lured spiritual pilgrims. GREEK ISLES Cephalonia Chios S ’ Patras Athens With over 50 churches, chapels, and monasteries, the aroma of sacred incense lingers on the sea breeze. Pireas Samos Mikones Zakynthos But Patmos also attracts exclusive designers and reclusive much as a place of worship,” Sutton says.“The saving grace is rock stars. While fishermen in colorful caiques whisk sun- that the church has kept a restraining hand on bars and dis- Cyclades Patmos Leros INSIDER Serifos worshippers to far-flung beaches, black-robed monks go cos, so Patmos remains relatively unspoiled.” Kos about their devotions. It is this combination of glamour and Hike the 400-year-old path from Skala to the holy Cave of Folegandros Sikinos Nissiros Tilos spirituality that keeps converts faithful to Patmos.
    [Show full text]
  • Wonders of the Greek Isles Excursions
    AUGUST 13, 2021 ATLAS ASHORE – LAND EXCURSIONS 7-NIGHT WONDERS OF THE GREEK ISLES TO BOOK YOUR ATLAS ASHORE LAND EXCURSIONS, CALL OUR VOYAGE SPECIALISTS AT 1.844.44.ATLAS (28527) VISIT OUR WEBSITE TO ENSURE YOU HAVE THE LATEST VERSION BEFORE MAKING YOUR SELECTIONS. ACTIVITY LEVEL: MILD ACTIVITY LEVEL: MODERATE ACTIVITY LEVEL: VIGOROUS 04.14.21 EXPLORE BEYOND THE USUAL Find the adventures that are right for you with a selection of carefully curated land excursions. Plan your 2021 luxe-adventure journey with the bucket-list moments that speak to you, whether you’re looking for foodie adventures or exciting hikes through historical ruins. ISTANBUL, TURKEY IST510PRE: EXPLORING THE VALLEYS, CAVES AND EXTRAORDINARY ROCK FORMATIONS OF MAGICAL, MYSTICAL CAPPADOCIA - AUGUST 10-13, 2021 | $999PP 4 DAYS / 3 NIGHTS | MEALS: YES Come explore magical, mystical Cappadocia, with its fairy tale landscape of natural wonders and colorful history. After arriving in Istanbul, you will transfer to your overnight hotel and check-in. The remainder of the day and evening are at your leisure. Day 2 Wake up early and after breakfast, transfer to the airport to catch your flight to Kayseri in central Turkey – the gateway to the Cappadocia region. The area at times seems like something out of a dream, with its deep valleys, fissures, and slopes that were turned into cones and columns as mother nature carved away at the lava rock. The volcanic rock is also perfect for carving entire buildings and the area is famous for these carved homes, stables, churches, and small cells used by hermits and monks.
    [Show full text]
  • Dodecanese GREECE
    GREECE Dodecanese www.visitgreece.gr GREEK NATIONAL TOURISM ORGANISATION 04Patmos 34Kos 68Chalki 12Agathonisi 44Astypalaia 72Rhodes (Rodos) 14Leipsoi (Lipsi) 52Nisyros 86Karpathos 16Leros 60Tilos 96Kasos Kastellorizo 24Kalymnos 64Symi 100(Megisti) CONTENTS Cover Page: Approaching Armathia, an uninhabited islet, near Kasos. 1. Elaborate pebble mosaic floors, an integral part of the Dodecanesian tradition. 1. The Dodecanese 2. Dodecanese’s enchanting beaches are one of the main attractions for millions of tourists every year. The Dodecanese island group is in the southeastern part of the Aegean Sea, the sunniest corner of Greece; it comprises twelve large islands and numerous smaller ones, each one with a different character. You will find fantastic beaches, archeological sites of great historical impor- tance, imposing Byzantine and Medieval monuments, traditional villag- es and architectural gems that date to the Italian Occupation. The Do- decanese have long been one of the most popular tourist destinations in the Mediterranean. Rhodes and Kos, are among the largest islands of the group and the two most popular ones. Karpathos, Patmos, Leros, Symi, Kalymnos, and Astypalaia have managed to keep their traditional flavour despite the fact that large numbers of tourists visit them. The smaller islands, with lower rates of growth, like Tilos, Nisyros, Leipsoi, Chalki, Kasos, Kastel- lorizo, Agathonisi, Telendos and Pserimos are a fine choice for relaxed and peaceful holidays. These islands have a rich and very long history. They have known pirate raids and have been occupied by the Knights Hospitaller, the Turks, and the Italians, to be eventually integrated in Greece in 1948. PATMOS 3. Skala, Patmos’ port. Chora lies in the background.
    [Show full text]
  • Explore More in Rhodes South Route
    Explore More in Rhodes South Route... Highlights Pick Up Times Schedule 8:30 Plimmiry April to October: Tuesday - Thursday 8:45 Genadi 8:50 Kiotari Price Duration Distance 9:15 Lindos 7 - 8 Hrs Approx. 180 Km 9:25 Kalathos 95.00€Adults Aged 13-up 9:35 Charaki 75.00€Children aged from 12 and below 9:45 Archangelos The prices are for group participation with minimum of 4 pax to start Difficulty Altitude Dif: Price Includes 3.0 500 m Free hotel pick up and drop off Premium 7 seater off-road vehicles driven by multilingual escort-drivers Enjoy the best panoramic view of South Rhodes Lunch with traditional Greek food Embark on a semiprivate safari tour of up to 6 persons per vehicle Liability Insurance and local taxes Lunch with traditional Greek food Visit traditional villages, monasteries, chapels Gallery 1 Price Does Not Include Coffee or wine or beer or refreshments in tavern Gratuities Description Explore more of the island of the Knights, Rhodes, on a semiprivate safari tour for up to 6 persons per vehicle. Discover the southern non-tourist side of Rhodes Island from West to East far away from mass tourism and crowded places, marvel the natural beauty of the mountains and take in the best panoramic views of the sea. Starting our day with pickups from Plimmiri village and heading towards Archipelagos, we get to know each other until we reach a traditional village where our first stop and break takes place listening local stories from your escort. After our morning break we enter our premium off-road vehicles and our experienced drivers-escorts will follow an off- road route through Kalathos Mountain.
    [Show full text]
  • 7-Night Byzantine Wonders August 13, 2021
    AUGUST 13, 2021 ATLAS ASHORE – LAND EXCURSIONS 7-NIGHT BYZANTINE WONDERS TO BOOK YOUR ATLAS ASHORE LAND EXCURSIONS, CALL OUR VOYAGE SPECIALISTS AT 1.844.44.ATLAS (28527) VISIT OUR WEBSITE TO ENSURE YOU HAVE THE LATEST VERSION BEFORE MAKING YOUR SELECTIONS. ACTIVITY LEVEL: MILD ACTIVITY LEVEL: MODERATE ACTIVITY LEVEL: VIGOROUS 3.26.21 EXPLORE BEYOND THE USUAL Find the adventures that are right for you with a selection of carefully curated land excursions. Plan your 2021 luxe-adventure journey with the bucket-list moments that speak to you, whether you’re looking for foodie adventures or exciting hikes through historical ruins. ISTANBUL, TURKEY IST510PRE: EXPLORING THE VALLEYS, CAVES AND EXTRAORDINARY ROCK FORMATIONS OF MAGICAL, MYSTICAL CAPPADOCIA - AUGUST 10-13, 2021 | $999PP 4 DAYS / 3 NIGHTS | MEALS: YES Come explore magical, mystical Cappadocia, with its fairy tale landscape of natural wonders and colorful history. After arriving in Istanbul, you will transfer to your overnight hotel and check-in. The remainder of the day and evening are at your leisure. Day 2 Wake up early and after breakfast, transfer to the airport to catch your flight to Kayseri in central Turkey – the gateway to the Cappadocia region. The area at times seems like something out of a dream, with its deep valleys, fissures, and slopes that were turned into cones and columns as mother nature carved away at the lava rock. The volcanic rock is also perfect for carving entire buildings and the area is famous for these carved homes, stables, churches, and small cells used by hermits and monks. Many people still live in these rock formations, which are naturally cool in the summer.
    [Show full text]
  • © Municipality of Rhodes
    Rhodes of Municipality © Rhodes of Municipality © Rhodes is the priceless jewel in the crown of Greek tourism – with incomparable beauty everywhere on the island, and with a centuries-long history that has left its cultural imprint through the ages – since antiquity, the Byzantine period, the era of the knights and to the present day. With constant improvements to hotel infrastructure to respond to the global market’s demands for quality, and above all, with its people who honour the tradition of authentic hospitality. As the new government of the Municipality of Rhodes, we are working diligently to ensure that our island, with the brilliance and glory it deserves, claims an even higher place on the list of world-wide preferences. We invite and are happy to welcome all friends of Rhodes to live the experience they have always dreamed of, right here on our island, where visitors are not just customers – they are friends that honour us by coming here, and Rhodes is at its best to receive them. Andonis V. Campourakis Mayor of Rhodes Rhodes of Municipality © Rhodes the island of the god Sun, of the god Apollo the island of Colossus and of the Knights an island with centuries of history, a crossway between nations and civilizations the homeland of many Olympic champions and philosophers Rhodes the emerald isle of unparalleled natural beauty, of superb light and unique hospitality a luxurious place for vacations, offering whatever you wish...of Municipality © 5 RhodesHistory Culture of Municipality © 6 www.rhodes.gr Tourist Guide Rhodes Rhodes is an island with 5000 years of flourished for centuries in Rhodes.
    [Show full text]
  • Med Bil På Rhodos På Egen Hånd
    2 Ixia Rhodos by Kremasti 1 Ialyssos 3 Sunwing Kallithea Airport Koskinou Maritsa Med bil på Rhodos Kamiros Kalithies Faliraki Psinthos Ladico Mandriko Afandou Anthony Quinn Bay på egen hånd Profitis Ilias Archipolis Epta Piges Kolimbia Rhodos er den største og frodigste av Tolvøyene og har i lang tid vært en av Embona 4 Tsambika Archangelos Hellas mest populære ferieøyer. En perfekt sol- og badeøy, med lange, fine Agios naturstrender og flest soldager av alle de greske øyene. Isidoros Lei en bil med AVIS og dra på oppdagelsesferd! Leiebil er komfortabelt og du for Siana Laerma Haraki muligheten til å oppleve Rhodos på egen hånd og i eget tempo. Du kan dra ut i naturen og besøke små landsbyer langt fra de store veiene. Hvem vet, kanskje Monolithos RHODOS finner du en helt egen strand? Med leiebil får du stor frihet og får mulighet til å Lardos Lindos Pefkos gjøre mange spennende oppdagelser. Kiotari Apolakia Bestill din leiebil hos Ving på servicetelefon +47 23115252. Messanagros Gennadi 1 – Naturopplevelser Vi fortsetter til venstre i landsbyen Kal- Filerimos, det grønne fjellet rett ovenfor avarda og kjører opp mot Salakos. Høyt landsbyen Ialyssos på vestkysten er et po- oppe i fjellet over byen er det en naturlig Lachania Katavia 5 FINE UTFLUKTER pulært sted å besøke. Ved det høye mar- vannkilde hvor en stor del av drikke- 1. Naturopplevelser morkorset oppe til høyre, får du fantastisk vannet i Rhodos by kommer fra. I dette 2. Sol og strand utsikt over havet, de tyrkiske fjellene samt området er det også en vakker dalgang 3.
    [Show full text]
  • Rhodes Island
    RHODES ISLAND Rhodes town is the largest settlement and capital city of the island. It is famous as the ancient site of the Colossus (c 280BC), one of the seven wonders of the ancient world, and as the oldest inhabited medieval town in Europe. Rhodes was declared a World Heritage City by UNESCO in 1988. Now about 6000 people live and work in the same buildings the Knights of St. John lived in six centuries ago. The total population of the city is roughly 100 000. Rhodes is one of the largest and most fertile of the Greek Islands, and is one of the most visited because of its combination of beaches, archaeological sites, and extensive medieval town. The climate is particularly good, with the weather typically sunny and mild. The island is usually counted as one of the Dodecanese, but due to its importance for travelers is considered separately here. The rock-rose is so prolific here that it has been named the 'Island of Roses,' though modern scholars doubt the ancient theory that the island's name comes from the Greek word for rose. While the northern coast is renowned for its lively tourist resorts the south offers tranquil beaches and a slower, simpler pace of life. Harbour gates in Rhodes city The Colossus of Rhodes was a statue of the Greek titan-god of the sun Helios, erected in the city of Rhodes, on the Greek island of the same name, by Chares of Lindos in 280 BC. One of the Seven Wonders of the Ancient World, it was constructed to celebrate Rhodes' victory over the ruler of Cyprus, Antigonus I Monophthalmus, whose son unsuccessfully besieged Rhodes in 305 BC.
    [Show full text]
  • Sequence Distances: Seq1 Seq2 Seq3 Seq4 Seq1 - Seq2 5 - Seq3 1 4 - Seq4 21 22 20
    Zoogeografia Dr. Valerio Ketmaier [email protected] Gene trees DNA sequences Can be used to infer phylogenies DNA sequence alignment Human GCGCTCGGGTCTAGCCTCT Chimp GCGATTCGGGTTAGCCTCT Gorilla GCGTCGCGTCTAGTCTCT Orangutan GGCTTTGGTCCAGCGCT DNA alignment Human GCGCT-CGGGTCTAGCCTCT Chimp GCGATTCGGGT-TAGCCTCT Gorilla GCG--TCGCGTCTAGTCTCT Orangutan -GGCTTTGG-TCCAG-CGCT Only aligned sequences can be analysed The sites at which the mutant allele is present at Informative sites least twice in the dataset 1 …GCGCTTCGGCTCCTGCGTGCTTAG… 2 …GCGCTTCGGCTCCTGCGTGCTTAG… 3 …GCGCTTCGGCTCCTGCGTGCTTAG… Unresolved tree 4 …GCGCTTCGGCTCCTGCGTGCTTAG… 1 …GCGCTTTGGCTCCTGCGTGCTTAG… 2 …GCGCTTCGGCTCTTGCGTGCTTAG… 3 …GCGCTTCGGCTCCTGCGTACTTAG… Unresolved tree 4 …GCGCTTCCGCTCCTGCGTGCTTAG… 1 …GCGCTTTGGCTCCTGAGTGCTTAG… 2 …GCGCTTCGGCTCTTGAGTGCTTAG… 3 …GCGCGTCGGCTCCTGCGTACTTAG… Resolved tree 4 …GCGCGTCCGCTCCTGCGTGCTTAG… Informative site Phylogeny reconstruction methods GCGCTTCGGCTCCT GCGATTCGGCTTCT GCGCTTCGCCTTCT ! Neighbor-joining (NJ) GGGATTTGGCCCCG ! Maximum parsimony (MP) ! Maximum likelihood (ML) ! Bayesian Distance-based phylogeny reconstruction (UPGMA, Least squares, Neighbour-joining) Seq1 Seq4 Seq3 Seq2 Sequence distances: Seq1 Seq2 Seq3 Seq4 Seq1 - Seq2 5 - Seq3 1 4 - Seq4 21 22 20 - Outgroup “Brackets notation”: (((Seq1,Seq3)Seq2)Seq4); Human How to calculate distances? (saturation problem) Saturation: The diff. is due to …GCGCTTCGGC… Expected saturation …GCGTTTCCGC… 2 Chimp …GCGTATTCGC… 4 …GCGCATTCGC… 5 Red Observed …ACCCATACGC… 8 Time Time colobus
    [Show full text]