Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations

1-1-2001

Turtles through time: exploring historical relationships among turtle families using DNA sequence data from a nuclear gene

James Gerald Krenz Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/rtd

Recommended Citation Krenz, James Gerald, "Turtles through time: exploring historical relationships among turtle families using DNA sequence data from a nuclear gene" (2001). Retrospective Theses and Dissertations. 21411. https://lib.dr.iastate.edu/rtd/21411

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Turtles through time: Exploring historical relationships among turtle families using

DNA sequence data from a nuclear gene

by

James Gerald Krenz

A thesis submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

MASTER OF SCIENCE

Major: Ecology and Evolutionary Biology

Major Professor: Fredric J. Janzen

Iowa State University

Ames, Iowa

2001

Copyright © James Gerald Krenz, 2001. All rights reserved. ii

Graduate College Iowa State University

This is to certify that the Master's thesis of

James Gerald Krenz has met the thesis requirements of Iowa State University

Signatures have been redacted for privacy iii

TABLE OF CONTENTS

CHAPTER 1. GENERAL INTRODUCTION 1 Thesis Organization 1 A Brief History of Turtle Systematics 1 Literature Cited 6

CHAPTER 2. TURTLE PHYLOGENY REVISITED: RESULTS FROM A NUCLEAR GENE 9 Abstract 9 Introduction 1O Materials and Methods 12 Choice of Taxa 12 Data Collection 13 Data Analysis 16 Results 17 RAG-1 Relative to Cytochrome b 17 Sequence Variation and Base Composition 18 Saturation Analysis 19 Phylogenetic Analysis 20 Discussion 23 Turtle Phylogeny 23 The Case Against (Chelydra, Platysternon) 25 Divergence Dates 28 Acknowledgments 32 Literature Cited 32

CHAPTER 3. GENERAL CONCLUSIONS 50 Recommendations for Future Research 51 Literature Cited 53 1

CHAPTER 1: GENERAL INTRODUCTION

Thesis Organization

The thesis that follows is composed of three chapters. The first chapter presents a general introduction to the history of turtle systematics. The second chapter is a manuscript to be submitted to the journal Molecular Phylogenetics and

Evolution detailing the systematics of turtles on an order-encompassing level and the novel insights provided by RAG-1 DNA sequence data. The final chapter summarizes the study and proposes areas for future research.

A Brief History of Turtle Systematics

The understanding of relationships among groups of turtles has developed extensively over time. This is due to discoveries of new turtle species, refinements in cladistic and phylogenetic theory, and the ever increasing variety and quantity of systematic characters available for evaluation. In the eighteenth century, all then known turtles (fifteen species) were grouped in one genus, Testudo (Linnaeus

1766). Today, turtles can be divided into roughly thirteen families, over 85 genera, and several hundred species (Ernst and Barbour 1989, Shaffer et al. 1997). Gaffney

( 1984) provided a detailed and thorough analysis of the history of turtle systematics; what follows is a summary of the main developments in turtle systematics as described by Gaffney ( 1984 ), as well as the major developments since that time.

The sole genus named by Linnaeus (1766) received substantial revision early in the nineteenth century. Efforts primarily divided turtles into taxonomic groups 2 based on their habitat preferences, such as marine, freshwater, or terrestrial (e.g.,

Brongniart 1805, Cuvier 1817, Wagler 1830). These endeavors typically made no attempt at assessing the hierarchical relationships among the various groups. Also, because divisions were usually habitat based, the two largest natural turtle groups, side-necked turtles (Pleurodira) and hidden-necked turtles (Cryptodira), went largely unnoticed and members of the two now well-recognized suborders were often grouped together.

As the nineteenth century progressed, a greater emphasis for systematic classification was put on natural groups (in the sense of groups that share a common ancestor), rather than ecological or behavioral similarities. Some investigators began to recognize the mode of neck retraction as defining natural groups of turtles (Gray 1831 ), and eventually those with horizontal neck retraction were named pleurodires and those with vertical neck retraction were named cryptodires (Dumeril and Bibron 1835). However, although true hidden-necked turtles, softshell turtles and sea turtles remained separate groups of equal status outside of the cryptodires until Cope (1871) placed almost all turtles with vertical neck retraction within the cryptodires. As fossil turtles were found with increasing frequency in the years that followed, greater emphasis was put on understanding ancestral groups and conditions and how the fossils could assist in the recognition of natural groups (e.g., Boulenger 1889, Nopsca 1923). However misinterpretations of fossil characters or incomplete fossils often led to the placement of many extinct taxa into their own taxonomic group, regardless of their natural lineage. 3

The mid-twentieth century produced a turtle classification system with increased attention toward inclusion of extinct and extant taxa as well as the hierarchical relationships among lineages (Williams 1950). This system endured for several decades with little modification (Romer 1966) and has been regarded as the first modern analysis of turtle phylogeny (Shaffer et al. 1997). This classification system is very similar to current hypotheses of turtle relationships. Cryptodira and

Pleurodira are recognized as suborders. Pleurodira contains the two families that are recognized to this day, Pelomedusidae and Chelidae. The division of the

Cryptodira into five superfamilies and nine families (and even more subfamilies) provided a degree of hierarchy that was hitherto unseen. However, except for the morphologically radical marine turtles, most fossil specimens were still grouped in an entirely separate suborder.

Modern cladistic methods were introduced to turtle systematics in the 1970s

(Gaffney 1972). These methods exposed the linkage between fossil and extant forms and were applied to all turtle families, as well as to questions of relationships within turtle families (e.g., Gaffney 1975a, b, Whetstone 1978, Archibald and

Hutchinson 1979). Gaffney and collaborators continued their discoveries of phylogenetically meaningful morphological characters, further developing ideas regarding turtle phylogeny. These efforts brought stability to turtle phylogeny at the time, and Gaffney and Meylan ( 1988) is often cited as the working knowledge of turtle relationships to this day.

Although dominated by studies looking at purely morphological characters, turtle classification hypotheses have also been put forth using non-morphological 4 methods. Studies using immunological distances (Chen et al. 1980) and karyological variation (Bickham and Carr 1983) suggested alternative relationships to those based on morphology. However, little credence was given to these alternative viewpoints due to the small amount of information in the immunological and karyological data sets (relative to a large morphological data set). Turtle phylogeny, as was common to virtually all groups of living organisms, continued to be dictated by morphology and paleontology.

The advent of molecular phylogenetics has greatly increased opportunities to reconstruct the evolutionary history of organisms. DNA sequences have the power to yield a large number of phylogenetically informative characters that are easy to obtain relative to the limits inherent to morphology. However, DNA sequences may tell a story different from that indicated by morphology, leading to conflicts and potential controversies (e.g., Shaffer et al. 1991 ). Turtles have been no exception.

Shaffer et al. (1997) proposed a turtle phylogeny based on a large mitochondrial

DNA data set combined with a morphological data set. This combined analysis resulted in an additional degree of stability to turtle phylogenetics, but low levels of statistical support in some areas left key relationships uncertain.

Given the ever-increasing wealth of DNA sequences being accumulated, we now have the ability to make informed decisions about the molecule we choose in a molecular phylogenetic study. Formerly, molecules were chosen based on the ability to readily obtain sequence data. For example, the discovery of "universal"

PCR primers for the mitochondrial cytochrome b (Kocher et al. 1989) gene prompted a flood of phylogenies based on cytochrome b sequences. However, different 5 genetic loci have properties making them useful for resolution at different phylogenetic levels (e.g., intraspecific relationships vs. interfamilial relationships); cytochrome b does not resolve relationships at all levels of divergence.

Several characteristics of DNA sequences may affect the outcome of phylogenetic analyses. Among them is the degree to which the sequences are saturated at the level of divergence for which phylogenetic resolution is sought.

Among taxa of ancient divergence, homologous genes may experience multiple substitutions at the same site (i.e., the gene is saturated) (Li 1997). Rapidly evolving genes, such as those from the mitochondrion, lose their phylogenetic signal due to saturation much more quickly than slowly evolving genes, such as single-copy coding genes in animal nuclei. If sequences are highly saturated, high levels of homoplasy can be reached, and the results obtained from their phylogenetic analysis may not reflect the true evolutionary history of the organisms in question.

Nucleotide base composition in the sequences being analyzed must also be considered (Page and Holmes 1998). Many algorithms used to reconstruct phylogenetic relationships assume equal frequencies among the four DNA bases, however, this is rarely the case. Therefore, using DNA sequences showing as little base composition bias as possible is intuitively preferable. DNA sequences of taxa in a given study should also display significantly similar base compositions to each other, that is, base composition stationarity is desirable. The large number of DNA sequences from a great variety of genetic loci publicly available in databases such as GenBank allows us to make a priori evaluations of genes that should perform well 6 at the desired level of phylogenetic resolution. This thesis describes the use of such a gene, and how it performed relative to one with less desirable characteristics.

Literature Cited

Archibald, J. D. and J. H. Hutchison. 1979. Revision of the genus Palatobaena

(Testudines, Baenidae), with the description of a new species. Postilla 177: 1-

19.

Bickham, J. W. and J. L. Carr. 1983. Taxonomy and phylogeny of the higher

categories of cryptodiran turtles based on cladistic analysis of chromosomal

data. Copeia 1983: 918-932.

Boulenger, G. A. 1889. Catalogue of the chelonians, rhynchocephalians and

crocodiles in the British Museum (Natural History). British Museum Natural

History, London.

Brongniart, A. 1805. Essay d'une classification naturelle des reptiles. Paris.

Chen, 8. Y., S. H. Mao, and Y. H. Ling. 1980. Evolutionary relationships of turtles

suggested by immunological cross-reactivity of albumins. Comparative

Biochemistry and Physiology 668: 421-425.

Cope, E. D. 1871. On the homologies of some of the cranial bones of the Reptilia,

and on the systematic arrangement of this class. Proc. Am. Assoc. Adv. Sci.,

pp. 194-247.

Cuvier, G. 1817. Le regne animal distribue d'apres son organisation. Tome 2.

Deterville Libraire, Paris. 7

Dumeril, A. M. C. and G. Bibron. 1835. Erpetologie general ou histoire naturelle

complete des reptiles. Paris.

Ernst, C. H., and R. W. Barbour. 1989. Turtles of the world. Smithsonian Institution

Press, Washington, D. C.

Gaffney, E. S. 1972. The systematics of the North American family Baenidae

(Reptilia, Cryptodira). Bulletin of the American Museum of Natural History

147: 241-320.

Gaffney, E. S. 1975a. A phylogeny and classification of the higher categories of

turtles. Bulletin of the American Museum of Natural History 155: 387-436.

Gaffney, E. S. 1975b. Phylogeny of the chelydrid turtles: a study of shared derived

characters in the skull. Fieldiana Geology 33: 157-178.

Gaffney, E. S. 1984. Historical analysis of theories of chelonian relationship.

Systematic Zoology 33: 283-301.

Gaffney, E. S., and P.A. Meylan. 1988. A phylogeny of turtles. Pages 157-219 in

The phylogeny and classification of tetrapods (M. J. Benton, ed.). Clarendon

Press, Oxford, England.

Gray, J. E. 1831. Synopsis reptilium or short descriptions of the species of reptiles. I.

Cataphracta, tortoises, crocodiles and enaliosaurians. London.

Kocher, T. D., W. K. Thomas, A. Meyer, S. V. Edwards, S. Paabo, F. X. Villablanca,

and A. C. Wilson. 1989. Dynamics of mitochondrial DNA evolution in animals:

amplification and sequencing with conserved primers. Proceedings of the

National Academy of Sciences (USA) 86: 6196-6200.

Li, W.-H. 1997. Molecular Evolution. Sinauer, Sunderland, MA. 8

Linnaeus, C. 1766. Systema Naturae. Edition duodecima. Holmiae.

Nopsca, F. van. 1923. Die Familien der Reptilien. Fortschr. Geol. Palaont., 2: 1-10.

Page, R. D. M. and E.· C. Holmes. 1998. Molecular Evolution: A Phylogenetic

Approach. Blackwell Science, Oxford.

Romer, A S. 1966. Vertebrate paleontology. Third edition. University of Chicago

Press, Chicago.

Shaffer, H. 8., J. M. Clark, and F. Kraus. 1991. \/vhen molecules and morphology

clash: a phylogenetic analysis of the North American ambystomatid

salamanders (Caudata: Ambystomatidae). Systematic Zoology 40: 284-303.

Shaffer, H. 8., P. Meylan, and M. L. McKnight. 1997. Tests of turtle phylogeny:

molecular, morphological, and paleontological approaches. Systematic

Biology 46: 235-268.

Wagler, J. 1830. Naturliches System der Amphibian, mit vorangehender

Classification der Saugetiere and Vogel-Ein Beitrag zur vergleichenden

Zoologie. J. G. Catta'sche Buchhandlung.

Williams, E. E. 1950. Variation and selection in the cervical articulations of living

turtles. Bulletin of the American Museum of Natural History 94: 505-562. 9

CHAPTER 2: TURTLE PHYLOGENY REVISITED: RESULTS FROM A

NUCLEAR GENE

A paper to be submitted to Molecular Phylogenetics and Evolution

James G. Krenz And Fredric J. Janzen

ABSTRACT

Turtle phylogeny remains uncertain despite a recent effort that analyzed a

large data set combining mitochondrial DNA (mtDNA) sequence data from two

genes and a suite of morphological and fossil characters (Shaffer et al. 1997).

Existing uncertainties could represent the actual history of turtle evolution, or they

may be inherent to the data themselves. To address this critical issue, we

sequenced nearly all of the nuclear recombination activase gene 1 (RAG-1 ). RAG-1

provided a very "clean" data set in comparison to cytochrome b (the source of the

majority of characters in Shaffer et al. (1997)) in terms of saturation, base composition bias, and base composition stationarity. Most of the relationships suggested by mtDNA/morphology analysis are also supported by RAG-1, though with a much higher level of support from RAG-1. RAG-1 and mtDNA/morphology disagree strongly in the placement of Chelydra and Platysternon; RAG-1 highly supports separation of the two taxa, while mtDNA/morphology strongly supports their sister relationship. Key morphological characters also support the separation of 10

these two taxa, as do other sources of information, such as chromosomal features

and biochemical properties. A combined analysis of the available nuclear DNA,

mtDNA, and morphological characters (excluding Chelydra and Platysternon)

provides a very robust evolutionary tree for turtles, with only one branch receiving

<95% bootstrap proportion support. Using RAG-1 to estimate dates of divergence

within the tree has a high degree of error, but is largely concordant with the

sequence of appearance of taxa in the fossil record and indicates rapid radiations at

the end of the Jurassic and in the middle of the Cretaceous. Almost all extant turtle

families appear to have diverged prior to the Cretaceous-Tertiary boundary. RAG-1

exhibits a high degree of utility in resolving deep phylogenetic relationships among

turtle families, as it has with other taxa.

INTRODUCTION

Turtles have a long and successful evolutionary history, dating back over 200

million years (Ernst and Barbour 1989, Gaffney 1990). Our understanding of

relationships among turtle families has undergone repeated revisions with advances

in paleontology and morphology (Gaffney 1984, Gaffney and Meylan 1988, Gaffney et al. 1991 ). With the advent of molecular techniques (Hillis et al. 1996, Li 1997,

Page and Holmes 1998), turtles have become frequent subjects of molecular

phylogenetic studies. Such studies have explored biogeographic issues at the

species and family level (e.g., Weisrock and Janzen 2000, Lenk et al. 1999, Lamb et al. 1994), higher order relationships among taxa in families or suborders (e.g., 11

Georges et al. 1998), and even broader systematic questions involving reptile and

amniote evolution (Hedges and Poling 1999, Cao et al. 2000). Nonetheless, only

one molecular systematics study sampling all extant turtle families has been

conducted (Shaffer et al. 1997).

The most inclusive phylogenetic survey of turtles carried out to date (Figure 1)

involved a combined analysis of 892 nucleotides of the mitochondrial cytochrome b gene, 325 nucleotides of the mitochondrial 12S rDNA gene, and 115 morphological characters (Shaffer et al. 1997). This tree was fairly well resolved in several aspects. The monophyly of both the Cryptodira (hidden-necked turtles) and

Pleurodira (side-necked turtles) were recovered with strong statistical support, as were all of the currently recognized turtle families. However, relationships within the diverse Cryptodira remained ambiguous. Statistical support for branches between families was low (bootstrap proportion support (BP) ranging from <50% to 74%).

Without a high degree of statistical support for these branches, we cannot be confident in the branching pattern suggested by the combined analysis of morphology and mtDNA.

The ambiguity detected in the branching pattern between cryptodire families could be explained by two alternative hypotheses. First, the observed lack of resolution in the cryptodires could represent the actual history of the organisms.

That is, cryptodiran lineages may have diverged so rapidly that an unresolved polytomy could be the most accurate representation of their evolutionary history.

This idea has some support from the fossil record, which suggests that cryptodires radiated rapidly about 100 million years ago (Shaffer et al. 1997). Alternatively, the 12 observed lack of resolution could be a result of data sampling. Quickly-evolving mitochondrial genes can become saturated with multiple substitutions at the same position, thus masking evolutionary change in the observed sequence (Li 1997). A large number of saturated characters combined with a smaller set of slowly evolving characters (i.e., morphological traits in Shaffer et al., 1997) could result in lack of phylogenetic resolution among the deep nodes of the tree.

To resolve this issue, we used sequences from a nuclear gene, recombination activase gene-1 (RAG-1 ). RAG-1 is a single-copy, protein-coding gene roughly three kilobases in length. RAG-1 occurs throughout higher vertebrates and contains no intrans (Schatz et al. 1989, Carlson et al. 1991, Bernstein et al.

1996). The utility of RAG-1 as a phylogenetic tool for resolving higher order relationships has been demonstrated in birds (Groth and Barrowclough 1999), mammals (Murphy et al. 2001 ), and sharks (G. Naylor, pers. comm.). We demonstrate that this gene is also valuable for understanding relationships among turtle families across the entire order, thereby clarifying and illuminating the evolutionary history of this important and globally-imperiled group (Klemens 2000).

MATERIALS AND METHODS

Choice of Taxa

All 23 extant turtle taxa included by Shaffer et al. (1997) were used in this study to facilitate direct comparisons between results from morphological characters, mitochondrial DNA, and nuclear DNA data sets (Table 1). These taxa were 13 originally chosen because they represent all currently recognized turtle families

(Gaffney and Meylan 1988, Ernst and Barbour, 1989), and could address several issues regarding specific areas of turtle systematics (see Shaffer et al. 1997). RAG-

1 sequence from one additional taxon, Lissemys punctata, was included. The data listed as Lissemys punctata by Shaffer et al. ( 1997) actually came from a

Cyclanorbis senegalensis sample (H. 8. Shaffer, pers. comm.). Therefore, both L punctata and C. senegalensis were included here. Lissemys and Cyc/anorbis are two closely related softshell turtle genera (both are members of the softshell subfamily Cyclanorbinae) (Ernst and Barbour 1989), and the original misidentification had no fundamental misleading effects on the results presented by

Shaffer et al. ( 1997).

Data Collection

PCR primers were designed based on conserved regions found in an alignment of RAG-1 sequences available on GenBank for Gallus gal/us (M58530,

Carlson et al. 1991 ), Alligator mississippiensis (AF143724, Groth and Barrowclough

1999), and Gavia/is gangeticus (AF143725, Groth and Barrowclough 1999). RAG-1 was amplified and sequenced in three segments requiring a total of nine primers

(Figure 2). Each segment was approximately 1 kb in length and overlapped with its

neighboring sequence( s) at about 100 nucleotide bases.

In most cases the same individual, indeed, even the same DNA extraction,

used for mtDNA sequencing in Shaffer et al. (1997) was also used for RAG-1

sequencing. This DNA.was extracted from blood, liver, muscle, heart, or tail tips 14 following a standard SDS/proteinase K digestion followed by phenol/chloroform extraction (Palumbi 1996). Some DNA samples proved too degraded for consistent

RAG-1 amplification. When this occurred, new tissue for that taxon was obtained

(either muscle, liver, blood, tail tips, or skin snips), and total genomic DNA was extracted using the High Pure PCR Template Preparation Kit (Roche Molecular

Biochemicals) following the manufacturer's instructions. Templates were diluted with sterile, deionized water as needed for clean amplification of RAG-1.

Amplification of RAG-1 segments took place in a Perkin Elmer GeneAmp

PCR System 2400. PCR was conducted in 50 µL volu'mes with 0.5-1.0 µg of purified DNA, 1X PCR buffer (10mM Tris-HCI, 50 mM KCI, and 0.1% Triton X-100)

(Promega), 1.0-1.5 mM MgCb (Promega), 0.1 mM dNTPs (Promega), 0.5 µM forward and reverse primer, and 1 unit Taq polymerase (Boehringer Mannheim).

The thermocycling procedure consisted of an initial denaturation at 94°C for 5 minutes. This was followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 60 seconds, and extension at 72°C for 90 seconds. An additional extension at 72°C for 5 minutes followed the last cycle. Alternatively, a touchdown thermocycling procedure was used for templates that were difficult to amplify. The touchdown program began with an initial denaturation at 94°C for 5 minutes, followed by a phase consisting of two cycles of 94 °C denaturation for 30 seconds, 62°C annealing for 60 seconds, and 72°C extension for 90 seconds. This was followed by 4 identical cycle phases, with a 2°c reduction in annealing temperature for each phase (60°C, 58°C, 56°C, 54°C). The final phase consisted of 15

30 cycles identical to the previous cycles, but with a 52°C annealing temperature. A final extension at 72°C for 5 minutes ended the touchdown procedure.

Entire reactions were run on 1.5% low-melt TBE agarose gels in the presence of ethidium bromide. Bands were cut from gels, combined with 500 µL sterile, deionized water, and melted at 90°C for 5 minutes. These isolated templates were run in a second PCR, with conditions identical to the first, to generate ample DNA for sequencing. Products from this second PCR were concentrated and purified in

Microcon M-100 microconcentrators (Am icon). PCR products were resuspended with 12 µL sterile, deionized water, and their concentration was found through fluorometry. These products were cycle sequenced in both directions using the ABI

Prism BigDye Terminator Cycle Sequencing Ready Reaction Mix (PE Applied

Biosystems). Reactions were run in 20 µL volumes containing -80 ng cleaned PCR product, 0.04 M Tris-HCI (pH 9), 1 mM MgC'2, 0.3 mM primer, and 4 µL Terminator

Ready Reaction Mix. The thermocycling procedure consisted of 45 cycles of 96°C for 30 seconds, 50°C for 30 seconds, and 60°C for 4 minutes. Sequenced products were precipitated with isopropanol and dried following manufacturer's instructions.

Dried product was sent to the Iowa State University DNA Sequencing and Synthesis

Facility for gel run and data recording with an Applied Biosystems 377 automated sequencer. RAG-1 sequences are to be deposited in the GenBank database. 16

Data Analysis

Forward and reverse sequences were assembled into a contiguous fragment with Sequence Navigator vers. 1.0.1 (©Applied Biosystems 1994). -Sequence

Navigator was also used to assemble the three -1 kb fragments for a given taxon into one continuous -3 kb sequence. The complete sequences for each taxon were aligned manually using Sequence Alignment Program (Se-Al) vers. 1.d1 (Rambaut

1995).

Both maximum parsimony and maximum likelihood analyses were performed using PAUP* 4.0b3a (Swofford 2000). Cryptodira and Pleurodira were both assumed to be monophyletic (Gaffney 1975, Gaffney and Meylan 1988, Gaffney et a/. 1991, Shaffer et al. 1997); Pleurodira was designated as the outgroup. In maximum parsimony analyses, heuristic searches were performed with 10 replicates of random taxon addition, accelerated character transformation (ACCTRAN) optimization, tree bisection-reconnection (TBR) branch swapping, zero-length branches collapsed to yield polytomies, and gaps coded as missing data. Two parsimony searches were performed, one completely unweighted and the other incorporating a weighted step matrix based on the apparent transition/transversion ratio ( empirically estimated from the tree found in the unweighted search).

Transitions were scored as one step, while transversions were scored as 2.6 steps.

As an indication of the robustness of clades, we used bootstrapping (Felsenstein

1985) with 1,000 replicates and decay indices (Bremer 1996) calculated with

TreeRot.v2 (Sorenson 1999). Maximum likelihood analysis was performed using the 17

HKY85 model of DNA sequence evolution (Hasegawa et al. 1985), allowing for unique frequencies of the four nucleotide bases as well as different rates for transitional and transversional substitutions. The HKY85 model was used in conjunction with gamma (r) -distributed rates for variable sites (Swofford et al.

1996). For the HKY85 + r model, empirical base frequencies were used while the apparent transition/transversion ratio and gamma shape parameter ( a) for the data were estimated by PAUP*. The presence of a molecular clock in RAG-1 DNA sequence data was evaluated using likelihood ratio tests (Felsenstein 1981, Yang et al. 1995).

RESULTS

RAG-1 Relative to Cytochrome b

Throughout the Results, RAG-1 characteristics are compared to the characteristics of the cytochrome b data of Shaffer et al. (1997). In that study, cytochrome b contributed the most overall number of characters (cytochrome b: 894,

12S rDNA: 245, morphology: 115) to the mtDNA/morphology combined analysis, as well as the overwhelming majority of parsimony-informative characters ( cytochrome b: 413, 12S rDNA: 72, morphology: 93). The protein-coding nature of cytochrome b in turn allows for more direct comparisons with RAG-1, such as characteristics at various codon positions. Problematic alignment of 12S rDNA sequences at this level of divergence also renders comparisons of this gene to RAG-1 difficult. 18

Sequence Variation and Base Composition

Most of the 3 kb of RAG-1 was sequenced and aligned for all 24 turtle species included in this study, resulting in a sequence alignment 2,793 nucleotide bases in length. Overall, a high level of homology was observed, making sequence alignment straightforward and unambiguous. No intrans were discovered, while indels were infrequent and always occurred in multiples of three, thus not interrupting the reading frame. Trachemys and Graptemys shared an apparent nine base pair deletion, while a three base pair apparent deletion was found in

Carettochelys and a three base pair apparent insertion was found in Podocnemis.

Variation occurred at 727 (26.0%) sites, 436 of which were parsimony- informative. Within codons, 147 variable sites occurred at first positions (90 parsimony informative), 91 at second positions (44 parsimony informative), and 489 at third positions (302 parsimony informative). Uncorrected p-distances between taxa ranged from 0.40% (Graptemys vs. Trachemys) to 10.22% (Podocnemis vs.

Ussemys). These results compare to 57.8% sites variable in cytochrome b (148 variable sites at first positions, 81 at second positions, and 288 at third positions), and p-distances ranging from 6.61 % to 30.27%. The much higher level of variability in cytochrome b coupled with a relatively shorter sequence length did produce a comparable number of parsimony-informative sites (413 from cytochrome b) to that from RAG-1. As with other RAG-1 data sets (e.g., Groth and Barrowclough 1999), the first -1 kb was markedly more variable than the final -2 kb: 31.4% sites were variable in the first 1,000 bases versus 23.0% sites variable in the final 1,793 bases. 19

RAG-1 nucleotide base composition shows a slight bias toward adenine, while the other three bases are present at similar frequencies, although with a small

deficiency of cytosine (30. 7% adenine, 21.5% cytosine, 24.1 % guanine, 23.8% thymine). This base composition remains stationary across the tax.a when all positions are considered (x2=8.34, df=69, p=1.00) and even when the highly variable third positions are tested alone (x2=13.40, df=69, p=1.00). Cytochrome b sequences have a higher degree of bias in base composition with high levels of adenine and cytosine and very low levels of guanine (30.2% adenine, 30.6% cytosine, 12.1 % guanine, 27.1 % thymine). Cytochrome b base composition is stationary when all codon positions are considered simultaneously (x2=49.03, df=66, p=0.94), however, the highly variable third positions of cytochrome b display significant heterogeneity in base composition among tax.a (x,2=149.65, df=66, p<<0.0001 ).

Saturation Analysis

The degree of saturation was assessed in the existing cytochrome b data set, as well as in RAG-1 (Figure 3). The observed numbers of transversions and transitions were plotted against patristic distance (i.e., steps along the tree) for all pairwise comparisons of taxa. Saturation is evident if the relationship between comparisons of taxa asymptotes as time since divergence (represented here by patristic distance) increases, indicating that all mutations are not being detected because some are occurring at the same site (multiple hits). Saturation is not evident in cytochrome b transversions; the relationship increases monotonically with patristic distance. However, the pattern observed in cytochrome b transitions is 20

nearly horizontal, indicating a high level of saturation at these sites. The degree of

saturation detected in cytochrome b transitions could potentially cause serious

problems in phylogenetic analyses (Li 1997). On the other hand, RAG-1 shows no

sign of saturation at either transversional or transitional sites. This result suggests

that any ambiguities found in the phylogenetic analyses of RAG-1 cannot be

attributed to saturation.

Phylogenetic Analysis

Unweighted maximum parsimony analysis revealed two most parsimonious

trees 1, 187 steps in length. These trees differed only on their placement of

Chelydra. One tree placed Che/ydra sister to the Chelonioidea ( sea turtles) while

the second tree placed Chelydra sister to the Kinosternoidae (mud turtles, musk

turtles, and dermatemydids ). A second maximum parsimony search, implementing

the step matrix defined by the apparent empirical transition/transversion ratio (2.6: 1),

revealed a single most-parsimonious tree (Figure 4 ). This tree was identical to one

of the two trees found in the original unweighted search (the one placing Chelydra

sister to the Kinosternoidae ).

A topology identical to that found by the transition/transversion ratio weighted

parsimony analysis was found using maximum likelihood (Figure 5). Branch lengths found under the HKY85 + r model are concordant with levels of statistical support for branches found under maximum parsimony and reveal substantial variation in evolutionary rates among lineages. Branches in the Trionychoidae are noticeably long, as are those in the Pelomedusidae, indicating an elevated rate of evolution in 21

these groups relative to other turtles. Branches joining Platysternon to the

Testudinoidae and Che/ydra to the Kinosternoidae are recognizably very short,

agreeing with the low level of statistical support for these branches in maximum

parsimony analyses.

The tree topologies found with RAG-1 are identical to those based on the

combined analysis of morphology and mtDNA sequences (Shaffer et al. 1997) in all

respects except 1) almost all nodes received greater statistical support with the

RAG-1 data and 2) the placement and relationship of Chelydra and Platysternon

differ considerably. The deep branches within the Cryptodira that received low

support (<75% BP) from the morphology/mtDNA data went up substantially with

RAG-1 analysis. The previously questionable branches attained levels of bootstrap

support commonly regarded as quite strong (>85% BP). However, some branches

near the tips of the RAG-1 tree exhibit lower support, such as those leading to

· (Heosemys, Chinemys) (71 % BP) and (Elseya, Chelodina) (57% BP); the

corresponding branches in the morphology/mtDNA tree have higher bootstrap

support at these more recent nodes-99% and 69%, respectively.

In the morphology/mtDNA based tree (Figure 1), Platysternon and Chelydra

group as sister taxa with 90% bootstrap support. In the RAG-1 tree (Figure 4 ), these

two taxa are strongly separated by branches with >85% bootstrap support.

Morphology/mtDNA also placed Platysternon and Chelydra at a relatively basal

position in the Cryptodira, although with low support (64% BP). RAG-1 places

neither Chelydra nor Platysternon in a position basal to the Procoelocryptodira,

rather Chelydra and Platysternon reside sister to the Kinosternoidae (mud and musk 22 turtles and allies) and the Testudinoidae (tortoises and Old World pond turtles), respectively. However, the branches leading to Chelydra and Platysternon both received low support (56% and 58% BP, respectively), making their exact relationships within their new respective groupings unclear.

A Templeton Test (Larson 1994, Templeton 1983) was conducted to determine if any significant signal could be detected in the RAG-1 data for either 1) the morphology/mtDNA topology of Shaffer et al. (1997) or 2) Chelydra/Platysternon monophyly anywhere in the tree. When the RAG-1 data (with the exclusion of

Lissemys) were constrained to fit the morphology/mtDNA topology, the tree (1,185 steps), was significantly longer (p=O. 0004) than the best tree found with RAG-1

(1,169 steps). To test for signal of Chelydra/Platysternon monophyly, trees were constructed for every possible monophyletic placement of Chelydra and

Platysternon, given that the topologies of the RAG-1 and morphology/mtDNA trees were identical in every other respect. The shortest tree found when constraining

RAG-1 to group Chelydra and Platysternon together was 1, 183 steps in length, again highly significant (p=0.0043) under the Templeton Test. The results of these tests indicate that RAG-1 holds no significant signal that would place Chelydra and

Platysternon together in a relatively basal position in the Cryptodira, or for the monophyletic placement of Chelydra and Platystemon anywhere else in the tree.

Because of conflicts regarding the placement of Chelydra and Platystemon among the data sets, these two taxa were excluded from a total evidence analysis.

For the rest of the taxa, DNA sequences from RAG-1 were combined with the mtDNA sequences and morphological characters into one 4,052 character data set 23 with 943 parsimony informative characters. Under maximum parsimony, this combined data set yielded a very robust tree (Figure 6), with only four branches receiving less than 100% bootstrap support and only one of those branches receiving less than 95% bootstrap support.

DISCUSSION

We sequenced nearly all of the 3 kb nuclear RAG-1 gene for turtles representing all currently recognized turtle families to resolve ambiguous areas of their evolutionary relationships. Despite a previous analysis of a large data set composed of morphological characters and mtDNA sequences, relationships deep within the suborder Cryptodira remained unclear (Shaffer et al. 1997). RAG-1 sequences are very "clean" compared to cytochrome b sequences from the same animals; RAG-1 is not saturated, has relatively low base composition bias, and has a very stationary base composition across the included taxa. The relatively larger, slowly evolving RAG-1 data set confirmed most of the uncertain relationships suggested by morphology/mtDNA, but contested a close relationship of two turtles,

Chelydra and Platysternon. Thus, our results reject the hypothesis that cryptodiran lineages diverged so rapidly as to best be represented as a polytomy.

Turtle Phylogeny

Barring issues regarding Platysternon and Chelydra, RAG-1 lends a great deal of stability to the overall knowledge of turtle phylogeny (Figure 6). RAG-1 splits 24 the Cryptodira into three major clades, the basal soft-shelled turtles and allies

(Trionychoidae), pond turtles and land tortoises (Testudinoidea), and an unnamed group composed of the sea turtles and the mud and musk turtles and their allies

(Chelonioidea + Kinosternoidae). Two major clades, the Chelidae and the

Pelomedusoides, are again supported in the Pleurodira. Most of the phylogenetic hypotheses tested by Shaffer et al. (1997) are strengthened by analysis of RAG-1: the Bataguridae is a monophyletic group and not paraphyletic with respect to the

Testudinidae, Staurotypus should indeed be included in the Kinosternoidae (not closer to the Testudinoidea), and both Australian and South American members of the Chelidae are monophyletic.

Prior to Shaffer et al. (1997), the Trionychoidae were regarded as the sister group of the Kinosternoidae for over twenty years (Gaffney 1975, Gaffney and

Meylan 1988). The discovery of this relationship was a great advancement over previous hypotheses of turtle phylogeny. However, RAG-1 provides strong support for the Trionychoidae as the basal lineage of the Cryptodira (Figures 4 and 5) The same relationship is seen with moderate support in mtDNA (65% BP) and combined mtDNA/morphology analyses (64% BP) (Shaffer et al. 1997). The position of the

Trionychoidae suggested by DNA sequences corresponds to findings in albumin cross-reactivity (Chen et al. 1980) as well as karyological analysis (Bickham and

Carr 1983)-Trionychoidae has a highly derived complement of chromosomes (2n =

66-68 vs. 2n = 50-56 for most other cryptodires) (Bickham and Carr 1983).

Maximum likelihood analysis of RAG-1 under the HKY85 + r suggests

Trionychoidae is a highly divergent group relative to other turtles and split from other 25

cryptodires at a relatively early date (Figure 5). This finding agrees with a high rate

of mtDNA evolution (relative to other turtles) found in members of the trionychoid

genus Apa/one (Weisrock and Janzen 2000). Perhaps the radical morphology

inherent to this superfamily (Ernst and Barbour 1989) reflects a massive genomic

overhaul in this lineage early in cryptodire evolution, which we detect as highly

elevated rates of molecular evolution. Based on the evidence from Shaffer et al.

(1997) and the current study, Trionychoidae and Kinosternoidae do not form a

natural group; revision of the Trionychoidea should be considered. Clearly this

group of turtles demands more attention.

The Case Against (Chelydra, Platysternon)

The data set of Shaffer et .al. (1997) groups Chelydra and Platysternon as sister taxa with strong statistical support (90% BP). However, the strength of this seemingly high level of support is misleading because it lies primarily in the morphological data set. While an analysis of the morphological data set alone yielded 94% bootstrap support for (Chelydra, Platysternon), neither the cytochrome b nor the 12S rDNA data sets alone yielded this relationship. However, a combined analysis of the two mitochondrial data sets did imply a sister relationship between

Chelydra and Platysternon, but with very low statistical support (<50% BP) (Shaffer et al. 1997). This result could possibly be a result of the great deal of saturation, base composition bias, and lack of base comp_osition stationarity present in the cytochrome b sequences. On the other hand, RAG-1 contributes strong evidence that Che/ydra and Platysternon are both more closely related to other groups of 26

turtles than to each other. Platysternon falls within the Testudinoidea (88% BP)

sister to the Testudinoidae (58% BP) while Che/ydra groups together with the

Chelonioidea and the Kinosternoidae (93% BP) as the sister group to the

Kinosternoidae ( 56% BP) (Figures 4 and 5).

Although there is apparent strong disagreement between RAG-1 and

morphology regarding these two taxa, the placement of Platysternon near the

testudinoids is similar to a classical view of turtle phylogeny (Williams 1950). This

classical position is bolstered by several independent lines of evidence derived from

morphology, karyology, and protein electrophoresis. Morphological features

indicating a close relationship between Platysternon and Che/ydra have recently

been regarded as either primitive to the extant groups of cryptodires or

homoplasious (Danilov 1998). Additionally, Platysternon has two biconvex cervical

vertebrae, a trait regarded as derived (\/Vhetstone 1978) and which is shared by

testudinoids and emydids. Systematic evaluation of karyotype characteristics also

supports this placement-only one event is required to explain the difference in

chromosome number and pattern between Platysternon and testudinoid karyologies, while several chromosomal events would be needed to explain a closer relationship

of Platysternon to the Chelydridae (Haiduk and Bickham 1982). Furthermore, turtle

serum electrophoresis indicates that Platysternon is more similar to emydids and testudinoids than it is to Chelydra and kinosternids (Frair 1972). This evidence

supports the notion that Platysternon should be regarded as the single extant

member of the Platysternidae, and should not be included as a member of the

Chelydridae. Our RAG-1 results lead us to conclude that the morphological 27 similarity between Chelydra and Platysternon likely derives from convergent evolution related to similarity between natural histories, a scenario found in molecular phylogenetic studies of other major groups of animals (e.g., Madsen et al.

2001 ).

Although RAG-1 DNA sequence data, as well as results from previous studies, furnish strong evidence that Chelydra and Platysternon do not form a natural group, their exact placement within their "new" groups remains vague. The branch supporting a sister relationship between Platysternon and the Testudinoidae has only 58% bootstrap support and a decay index of 1. An analysis performed using the morphological characters of Shaffer et al. (1997), but including only

Platysternon, the Testudinoidae, and the Emydidae, suggested Platysternon was the basal member of this group, as did karyology analyses (Haiduk and Bickham 1982).

The branch supporting a sister relationship between Chelydra and the

Kinosternoidae has bootstrap support of only 56% and a decay index of 0.

Reanalysis of the morphological characters from Shaffer et al. (1997), this time including only Chelydra, the Chelonioidea, and the Kinosternoidae, supported a sister relationship between Chelydra and the Chelonioidea. A classical morphological view linked Chelydra and the Kinosternidae, even placing them in the same family, the Chelydridae (Williams 1950).

Clearly, there is no convincing evidence for the exact position of either

Chelydra or Platysternon. The inability of RAG-1 to firmly place these two taxa lies in the fact that there are too few synapomorphic characters to render a strongly supported placement ( as opposed to a great deal of homoplasious characters 28 contributing noise and thus disrupting a clean signal). This finding suggests that the addition of another platysternid and another chelydrid may result in a greater number of key synapomorphies being recovered. Unfortunately, this is impossible within the

Platysternidae, because Platysternon megacephalum is the sole extant member of this family (although several subspecies have been recognized) (Ernst and Barbour

1989). However, Macroclemys temminckii, the only other living chelydrid, can potentially provide the necessary information for the Chelydridae. Alternatively, another gene with characteristics similar to RAG-1 may produce positive results for this question.

Divergence Dates

When constrained to fit a molecular clock, RAG-1 produces a significantly longer tree than when branch lengths are free to vary under the likelihood ratio test

(Table 2). This pattern holds true when all nucleotides are included as well as when each of the codon positions are tested separately. Clearly, there is no order- encompassing RAG-1 molecular clock for turtles. In lieu of the presence of a strict molecular clock, we calculated approximate rates of RAG-1 evolution (under the

HKY85 + r model) for each taxon. This approach was conducted by adding the branch lengths from the root, assumed to be the mid point on the branch separating the Pleurodira from the Cryptodira, to each terminal taxon (Table 3 and Figure 7).

These branch lengths were then divided by the date for the root of the extant turtle phylogeny estimated from the fossil record. The root calibration date was estimated at 21 O million years ago (mya), the age of the oldest known fossil turtle, 29

Proganochelys (Gaffney 1990), a turtle regarded as the sister taxon to both the

Cryptodira and the Pleurodira. This date corresponds closely to the first fossil appearance of a cryptodire, Kayentache/ys, as well as to the first appearance of a pleurodire, Proterochersis, suggesting 210 mya as an appropriate calibration date for the root of this phylogeny (although the actual date of divergence between pleurodires and cryptodires may be earlier).

Average rates of RAG-1 evolution were calculated for four subsets of turtle taxa, the Trionychoidea, non-trionychoid cryptodires, the pleurodire family Chelidae, and the pleurodire family Pelomedusidae. These groups were formed based on their members' relatively similar rates of RAG-1 evolution, as indicated by the maximum likelihood phylogram (Figure 5). Dates corresponding to nodes within the tree were calculated by dividing the branch length from the root to each node (Table 3) by the appropriate average rate. For any give node, several date estimates could be calculated depending on the number of terminal taxa corresponding to that node. All available date estimates for a node were averaged to arrive at the single date estimate reported for each node (Figure 7). For example, the date of the split separating the Chelydridae from the Kinosternoidae (node 34) is estimated at 105 mya. This is an average of four date estimates, 60 mya, 136 mya, 94 mya, and 129 mya calculated from the branch lengths leading to the four terminal taxa corresponding to node 34, Chelydra, Staurotypus, Sternotherus, and Dermatemys, respectively. Confidence intervals in these estimates are undoubtedly quite wide.

Each branch length has a corresponding standard error, rates of RAG.:1 evolution within each of the four taxa subsets are variable, and wide variation in date 30 estimates for each node was also observed. The degree of confidence in our calibration point also has inherent error; we only know that pleurodires and cryptodires had a common ancestor sometime before 200 mya. Efforts are currently being made to formulate confidence intervals taking into account as many sources of error as possible.

Despite unquestionably large sources of error, the dates calculated from

RAG-1 DNA sequence data agree remarkably well with those found through the fossil record (Ernst and Barbour 1989, Gaffney 1990, Gaffney and Meylan 1988,

Shaffer et al. 1997, and references therein). Trionychids are known from the late

Jurassic, about 150 mya; RAG-1 places the trionychid split from the carettochelids at

152 mya. The oldest fossil testudinoid is roughly 95 million years old; under RAG-1 dating, the testudinoids split from Chelydridae + Kinosternoidae + Chelonioidea roughly 100 mya. Fossil batagurids as old as 70 million years have been found, much older than the 45 million years suggested by RAG-1. Fossil testudinids date to around 60 mya, again slightly older than the molecular based estimate of 45 mya.

Fossil emydids appear around 50 mya, RAG-1 places this event at 61 mya. The oldest chelydrid fossil is about 90 million years old, and fossil evidence places the appearance of the Kinosternoidae at about 95 mya--RAG-1 dates the Chelydridae split from the Kinosternoidae at 105 mya. The oldest chelonioid fossil is about 110

mill ion years old; RAG-1 places the split of the Chelonioidea from Chelydridae +

Kinosternoidae at 107 mya. Pelomedusids appear in the fossil record in the mid-

Cretaceous, about 100 mya. However, RAG-1 suggests a much earlier split of the

pelomedusids from the chelids at 156 mya. Likewise, fossil chelids first appear only 31

about 50 mya. However, the South American and Australian chelids are both

monophyletic and have probably been isolated from each other since South America

and Australia had a contiguous connection (via Antarctica) in the Jurassic over 100

mya, strongly suggesting chelids have been around at least that long and earlier fossils have merely not been discovered.

RAG-1 dating shows slight inconsistencies in several areas; the dates calculated for some nodes were more ancient than nodes nearer the root of the tree that should have been older. For example, the split between Platysternon and the

Testudinoidae is dated at 78 mya, while the next node back (the split between the

Testudinoidae + Platysternon and the Emydidae) was dates at only 61 mya. This inconsistency can be explained by a slow rate of evolution in the E mydidae (Figure

5), causing a relatively low estimate for node 31; if only the Testudinoidae +

Platysternon are used for this calculation, the split would be estimated at having occurred about 78 mya. Another inconsistency can be seen in the three nodes going back from the split between Che/ydra and the Kinosternoidae; these nodes date to 105 mya, 107 mya, and 100 mya respectively (Figure 7). However, these discrepancies are relatively small and are almost certainly within the realm of error for these estimates.

RAG-1 dating indicates a rather rapid radiation of major turtle lineages near the end of the Jurassic. The Trionychoidea split from the rest of the cryptodires about 162 mya and split further into the Trionychoidae and the Carettochelyidae 152 mya. Likewise, the Pleurodira split into its two main groups, the Pelomedusoides and the Chelidae, about 156 mya. Another rapid radiation can be observed 90-100 32 mya years ago, as suggested by Shaffer et al. (1997). Based on RAG-1 dating, the cataclysmic events of the Cretaceous-Tertiary boundary (65 mya) did not play a big role in the radiation of extant turtle families. Only one family, the Bataguridae, appears to have originated within the last 65 my.

ACKNOWLEDGEMENTS

We would like to thank Gavin Naylor for encouraging the use of RAG-1 as a potentially informative gene at this level of turtle systematics. Julie Ryburn was especially helpful and patient with assistance in early molecular work. Brad Shaffer and Dave Starkey kindly located and supplied most of the tissues used in this study.

James Parham was instrumental in locating key literature regarding Platysternon.

Support for this research was provided by a Theodore Roosevelt Memorial Fund

Grant from the American Museum of Natural History (JGK), a Grant-in-Aid of

Research from Sigma Xi (JGK), and NSF grant DEB-9629529 (FJJ). JGK was supported by fellowships from the Graduate College and the Ecology and

Evolutionary Biology Program at Iowa State University.

LITERATURE CITED

Bernstein, R. M., S. F. Schluter, H. Bernstein, and J. J. Marchalonis. 1996.

Primordial emergence of the recombination activating gene 1 (RAG1 ):

Sequence of the complete shark gene indicates homology to microbial 33

integrases. Proceedings of the National Academy of Sciences USA 93: 9454-

9459.

Bickham, J. W. and J. L. Carr. 1983. Taxonomy and phylogeny of the higher

categories of cryptodiran turtles based on a cladistic analysis of chromosomal

data. Copeia 1983: 918-932.

Bremer, K. 1996. Branch support and tree stability. Cladistics 10: 295-304.

Cao, Y., M. D. Sorenson, Y. Kumazawa, D. P. Mindell, and M. Hasagawa. 2000.

Phylogenetic position of turtles among amniotes: evidence from mitochondrial

and nuclear genes. Gene 259: 139-148.

Carlson, L. M., M.A. Gettinger, D. G. Schatz, E. L. Masteller, E. A. Hurley, W. T.

McCormack, D. Baltimore, and C. Thompson. 1991. Selective expression of

RAG-2 in chicken B cells undergoing immunoglobulin gene conversion. Cell

64: 201-208.

Chen, B.-Y., S.-H. Mao, and Y.-H. Ling. 1980. Evolutionary relationships of turtles

suggested by immunological cross-reactivity of albumins. Comparative

Biochemistry and Physiology 668: 421-425.

Danilov, I. 1998. Phylogenetic relationships of platysternid turtles. Third Asian

Herpetological Meeting Abstracts, pg. 14.

Ernst, C. H., and R. W. Barbour. 1989. Turtles of the world. Smithsonian Institution

Press, Washington, D. C.

Felsenstein, J. 1981. Evolutionary trees from DNA sequences: a maximum likelihood

approach. Journal of Molecular Evolution 17: 368-376. 34

Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the

bootstrap. Evolution 39: 783-791.

Frair, W. 1972. Taxonomic relationships among chelydrid and kinosternid turtles

elucidated by serological tests. Copeia 1972: 97-108.

Gaffney, E. S. 1975. A phylogeny and classification of the higher categories of

turtles. Bulletin of the American Museum of Natural History 155: 387-436.

Gaffney, E. S. 1984. Historical analyses of theories of chelonian relationship.

Systematic Zoology 33: 283-301.

Gaffney, E. S. 1990. The comparative osteology of the Triassic turtle Proganochelys.

Bulletin of the American Museum of Natural History 194: 1-263.

Gaffney, E. S., and P.A. Meylan. 1988. A phylogeny of turtles. Pages 157-219 in

The phylogeny and classification of tetrapods (M. J. Benton, ed.). Clarendon

Press, Oxford, England.

Gaffney, E. S., P.A. Meylan, and A. R. Wyss. 1991. A computer assisted analysis of

the relationships of the higher categories of turtles. Cladistics 7: 313-335.

Georges, A, J. Birrell, K. M. Saint, W. McCord, and S. C. Donnellan. 1998. A

phylogeny for side-necked turtles (Chelonia: Pleurodira) based on

mitochondrial and nuclear gene sequence variation. Biological Journal of the

Linnean Society 67: 213-246.

Groth, J. G., and G. F. Barrowclough. 1999. Basal divergences in birds and the

phylogenetic utility of the nuclear RAG-1 gene. Molecular Phylogenetics and

Evolution 12: 115-123. 35

Haiduk, M. W., and J. W. Bickham. 1982. Chromosomal homologies and evolution of

testudinoid turtles with emphasis on the systematic placement of

Platysternon. Copeia 1982: 60-66.

Hasegawa, M., H. Kishino, and T. Yano. 1985. Dating of the human-ape splitting by

a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 21:

160-174.

Hedges, S. B., and L. Poling. 1999. A molecular phylogeny of reptiles. Science 283:

998-1001.

Hillis, D. M., C. Moritz, and B. K. Mable (eds.). 1996. Molecular Systematics, 2nd ed.

Sinauer, Sunderland, MA.

Klemens, M. W. (Ed.). 2000. Turtle Conservation. Smithsonian Institution Press,

Washington, DC.

Lamb, T., C. Lydeard, R. B. Walker, and J. W. Gibbons. 1994. Molecular

systematics of map turtles (Graptemys): a comparison of mitochondrial

restriction site versus sequence data. Systematic Biology 43: 543-559.

Larson, A. 1994. The comparison of morphological and molecular data in

phylogenetic systematics. In "Molecular Ecology and Evolution: Approaches

and Applications" (B Schierwater, B. Streit, G. P. Wagner, and R. DeSalle,

eds.), pp. 371-390. Birkhauser, Basel.

Lenk, P ., U. Fritz, U. Jager, and M. Wink. 1999. Mitochondrial phylogeography of

the European pond turtle, Emys orbicularis (Linnaeus 1758). Molecular

Ecology 8: 1911-1922.

Li, W.-H. 1997. Molecular Evolution. Sinauer, Sunderland, MA. 36

Madsen, 0., M. Scally, C. J. Douady, D. J. Kao, R. W. DeBry, R. Adkins, H. M.

Amrine, M. J. Stanhope, W. W. de Jong, and M. S. Springer. 2001. Parallel

adaptive radiations in two major clades of placental mammals. Nature 409:

610-614.

Meylan, P. A. 1996. Morphology and relationships of the early Cretaceous side-

necked turtle, Araripemys barretoi (Testudines: Pelomedusoides:

Araripemydidae) from the Santana Formation on Brazil. Journal of Vertebrate

Paleontology 16: 20-33.

Murphy, W. J., E. Eizirik, W. E. Johnson, Y. P. Zhang, 0. A. Ryder, and S. J.

O'Brien. 2001. Molecular phylogenetics and the origin of placental mammals.

Nature 409: 614-618.

Page, R. D. M. and E. C. Holmes. 1998. Molecular Evolution: A Phylogenetic

Approach. Blackwell Science, Oxford.

Palumbi, S. R. 1996. Nucleic acids II: The polymerase chain reaction. In "Molecular

Systematics" (D. M. Hillis, C. Moritz, and B. K. Mable, Eds.), 2nd ed., pp. 205-

247. Sinauer, Sunderland, MA.

Rambaut, A. 1995. Sequence Alignment Program v1 .d1. University of Oxford.

Schatz, D. G., M.A. Gettinger, and D. Baltimore. 1989. The V(D)J recombination

activating gene, RAG-1. Cell 59: 1035-1048.

Shaffer, H.B., P. Meylan, and M. L. McKnight. 1997. Tests of turtle phylogeny:

molecular, morphological, and paleontological approaches. Systematic

Biology 46: 235-268. 37

Sorenson, M. D. 1999. TreeRot, version 2. Boston University, Boston,

Massachusetts.

Swofford, D. L., G. J. Olsen, P. J. Waddell, and D. M. Hillis. 1996. Phylogenetic

inference. In "Molecular Systematics" (D. M. Hillis, C. Moritz, and B. K. Mable,

Eds.), 2nd ed., pp. 407-514. Sinauer, Sunderland, MA.

Templeton, A. R. 1983. Phylogenetic inference from restriction endonuclease

cleavage site maps with particular reference to the evolution of humans and

the apes. Evolution 37: 221-244.

Weisrock, D. W. and F. J. Janzen. 2000. Comparative molecular phylogeography of

North American softshell turtles (Apa/one): implications for regional and wide-

scale historical evolutionary forces. Molecular Phylogenetics and Evolution

14: 152-164.

Whetstone, K. N. 1978. Additional record of the fossil snapping turtle Macroclemys

schmidti from the Marshland Formation (Miocene) of Nebraska with notes on

interspecific skull variation within the genus Macroclemys. Copeia 1978: 159-

162.

Williams, E. E. 1950. Variation and selection of the cervical central articulations of

living turtles. Bulletin of the American Museum of Natural History 94: 505-

562.

Yang, Z., N. Goldman, and A. Friday. 1995. Maximum likelihood trees from DNA

sequences: A peculiar statistical estimation problem. Systematic Biology 44:

384-399. 38

Table 1. Twenty-four turtle species for which RAG-1 was sequenced and analyzed for this study. Taxonomic designations follow those used by Shaffer et al. (1997) which in turn were based primarily on Gaffney and Meylan (1988) and Meylan (1996). Numbers refer to taxa in Figure 1. Testudines Pleurodira ( 1) Pelomedusoides (2) Pelomedusidae (3) Pelusios williamsi Pelomedusa subrufa Podocnem idae (4) Podocnemis expansa Chelidae (5) Chelodina longicollis Che/us fimbriata Elseya latisternum Phrynops gibbus Cryptodira (6) Chelydridae (7) Chelydra serpentina Platysternon megacephalum Procoelocryptodira Chelonioidea (8) Cheloniidae (9) Chelonia mydas Dermochelyidae (10) Dermochelys coriacea Chelomacryptodira · Trionychoidea T rionychoidae ( 11 ) Trionychidae (12) Apa/one spinifera Cyclanorbis senegalensis Lissemys punctata Carettochelyidae (13) Carettochelys insculpta Kinosternoidae ( 14) Ki nos tern idae ( 15) Stemotherus odoratus Staurotypus triporcatus Dermatemydidae (16) Dermatemys mawii 39

Table 1 . (continued) Testudinoidea (17) Emydidae (18) Emydinae ( 19) Clemmys marmorata Deirochelyinae (20) Graptemys pseudogeographica Trachemys scripta Testudinoidae (21) Bataguridae (22) Heosemys spinosa Chinemys reevesii Testudinidae (23) Geochelone pardalis 40

Table 2. Likelihood ratio test results for RAG-1 DNA sequence data.

Gene Avg genetic -Ln likelihood -Ln likelihood -2i\Ln p distance (molecular (molecular (p-distance) clock not clock enforced) enforced) total 0.05525 10,751.01 10,839.45 176.86 <0.0001 position 1 0.03394 2,772.15 2,794.08 43.86 0.0055 position 2 0.01842 2,137.04 2,158.70 43.32 0.0063 position 3 0.11340 5,515.99 5,581.25 130.52 <0.0001 41

Table 3: Branch length and linkages for RAG-1 turtle phylogeny (Figure 1) found under the HKY85 + r model of DNA sequence evolution.

Node Connected to Branch length Standard error node 44 43 0.01950 0.00310 45 44 0.01093 0.00265 45 45 0.01919 0.00327 1 46 0.01767 0.00297 25 46 0.03411 0.00408 2 25 0.00629 0.00165 3 25 0.00494 0.00148 4 45 0.05941 0.00558 37 44 0.00979 0.00225 31 37 0.00393 0.00133 28 31 0.00018 0.00038 5 28 0.00831 0.00179 27 28 0.00744 0.00171 12 27 0.01320 0.00228 26 27 0.00073 0.00055 13 26 0.00560 0.00147 14 26 0.00360 0.00118 30 31 0.00231 0.00095 29 30 0.00335 0.00113 15 29 0.00157 0.00079 16 29 0.00246 0.00097 17 30 0.00280 0.00104 36 37 0.00228 0.00108 34 36 0.00096 0.00072 6 34 0.01061 0.00206 33 34 0.00523 0.00158 32 33 0.00822 0.00185 9 32 0.01063 0.00206 11 32 0.00321 0.00119 10 33 0.01752 0.00269 35 36 0.00779 0.00180 7 35 0.00944 0.00195 8 35 0.01022 0.00202 40 43 0.00637 0.00188 38 40 0.00810 0.00188 18 38 0.00686 0.00165 19 38 0.00657 0.00161 39 40 0.00199 0.00103 20 39 0.01075 0.00212 21 39 0.01797 0.00274 42 43 0.01251 0.00258 41 42 0.01774 0.00295 22 41 0.00432 0.00137 23 41 0.00643 0.00163 24 42 0.04088 0.00445 42

FIGURE LEGENDS

Fig. 1. Single most parsimonious tree for 23 turtles based on 892 nucleotides from

cytochrome b, 325 nucleotides from 12s rDNA, and 115 morphological characters

(Shaffer et al. 1997). Numbers above branches are bootstrap percentages out of

1,000 bootstrap replicates, those below branches are decay indices. Tree length=

2,793 steps, consistency index= 0.407, retention index= 0.418. Numbers in parentheses refer to taxonomic designations in Table 1.

Fig. 2. Names, positions, and sequences of oligonucleotide primers used for amplification and sequencing of RAG-1. Sequences are given in the 5' to 3' direction.

Fig. 3. Plots of absolute number of transition (ti) and transversion (tv) substitutions plotted against patristic distance for cytochrome b and RAG-1. Dots represent pairwise comparisons among all 23 turtle species used.

Fig. 4. Single most parsimonious tree for 2,793 nucleotides of RAG-1 from 23 turtles species found when using a step matrix incorporating apparent transition/transversion ratio. Numbers above branches are bootstrap percentages out of 1,000 bootstrap replicates, those below branches are decay indices. Tree length = 1187 steps, consistency index = 0. 72, retention index = 0. 77. 43

Fig. 5. Maximum likelihood phylogram found using the HKY85 + r model of DNA sequence evolution. Branches are proportional to genetic distances found by the model.

Fig. 6. Single most parsimonious tree based on combined analysis of 2,793 nucleotides from RAG-1, 892 nucleotides from cytochrome b, 325 nucleotides from

12S rDNA, and 115 morphological characters. Chelydra and Platysternon were excluded from this analysis due to conflicts between the data sets. Numbers above branches are bootstrap percentages out of 1,000 bootstrap replicates, those below branches are decay indices. Tree length = 3,691 steps, consistency index = 0.53, retention index = 0.53.

Fig. 7. Molecular dates of divergence among turtle lineages in this study in millions of years (mya). Dates for nodes were calculated using HKY85 + r branch lengths, numbers in parentheses correspond to nodes numbers in Table 3. 44

(12) 100 Apa/one (11) 97 22 Lissemys 14 (13) Carettochelys

Platysternon (7) 90 (6) 12 Chelydra (9) (8) 98 Chelonia (10) 18 Dermochelys 64 <50 6 2 (15) 100 Staurotypus 19 (14) 86 Sternotherus 8 (16) Dermatemys <50 (23) 2 I Geochelone (21) 94 11 (22) 991 Heosemys 100 151 (17) 7 4 Chinemys 27 4 (20) 100 I Trachemys (18) 97 23 l Graptemys 9 (19) Clemmys

Che/us 58 I 7 I (5) 98 Phrynops 17 Elseya 69 I 8 (1) I Chelodina

Pelomedusa (3) 100 I (2) 100 39 I Pelusios 21 (4) Podocnemis Figure 1 45

RAGF1 RAGF2 RAGF3 RAGFS

•• • RAG-1 • RAGR2•• RAGR1 RAGR4•• RAGR3 RAGR5•

RAGF1 CCWGAWGARATTCAGCAYCC RAGR1 GCAAGATCTCTTCATCRCATTC RAGF2 GAGATCATTYGAAAAGGCACC RAGR2 GATGTTCAGGAAGGATTTCACT RAGF3 AGAACCTGCATCCTRAAGTGC RAGR3 CTCAGGATGGCTGTCAGAGTC RAGR4 TGCAACACAGCTCTGAATTGG RAGFS GAGATGTCAGYGAGAAGCATG RAGRS GACATCCTCCATTTCATAGC Figure 2

16 15n.------, cytochrome b tv '•• • ·,·: cytochrome b ti 12 • ...... w---. • 12 . .., _ ...... ,,"' .. .¥... . ~ .. 8 •: .· .-~l-,,. ' 8 ·~· ~ en .. ~. .,,,. .. - ·' .. .. C 0 -. ... ,,,. • +:. 4 .,...... ~·--· 4 ::J \ +:.en • .c- 0 0 ::J 0 20 40 60 80 100 120 140 o 20 40 60 80 100 120 140 en '+- 0 .._ 25 25•------, Q) .c RAG-1 tv RAG-1 ti E 20 20 ::::, z 15 15 10 10 5

50 1 00 150 200 250 300 100 150 200 250 300 Patristic Distance Figure 3 46

Apa/one 100 29 Lissemys 100 I 100 68 l 14 Cyclanorbis Carettoche/ys

Platysternon 58 1 Geochelone 100 Heosemys 14 71 I 88 1 l Chinemys 1 Trachemys 99 I 93 7 I Graptemys 5 100 Clemmys 17 Chelydra

56 Staurotypus 0 100 I 100 17 l Sternotherus 100 95 9 30 3 Dermatemys Chelonia 100 I 14 I Dermochelys

100 I Che/us 14 I 100 Phrynops 8 Elseya 57 I 1 1 Chelodina

Pelomedusa 100 I 100 37 1 Pelusios 17 Podocnemis Figure 4 47

------Apa/one

-- Lissemys

Cyclanorbis

L.------Carettochelys

--- Platysternon

Geochelone

Heosemys

Chinemys

Trachemys

Graptemys

Clemmys

---- Chelydra

---- Staurotypus

Sternotherus

L------Dermatemys

Chelonia

Dermochelys

Che/us

--- Phrynops

Elseya

'------Chelodina

Pelomedusa

Pelusios

'------Podocnemis Figure 5 48

Apa/one 100 53 100 Cyclanorbis 28 Carettochelys

100 Chelonia 36 Dermochelys 82 4 100 Staurotypus 40 100 Sternotherus 24 Dermatemys 100 25 Geochelone 100 Heosemys 26 100 19 97 Chinemys 8 100 100 Trachemys 58 32 100 - Graptemys 14 Clemmys

- 99 Che/us 21 - 100 Phrynops 25 - 99 Elseya 16 Chelodina

100 Pelomedusa 74 100 p elusios 43 Podocnemis Figure 6 49

Apa/one (1) _____. (46), 92 mya ;---- Lissemys (2) 25 16 ,------J(46), 152 m_y_a _ ____.< ), mya Cyclanorbis (3)

Carettochelys (4)

Platysternon (5) -----i(28), 78 m',_.1a______Geochelone ( 12)

(27), 45 m'a (44), 162 mya ~-- Heosemys (13) (26), 26 mya ----1(31), 61 mya Chinemys ( 14)

Trachemys (15) ______. (29), 12 mya

------' (30), 26 mya Graptemys (16) Clem mys ( 17) -----1 (37), 100 mya Chelydra (6)

-----'(34), 105 mya --- Staurotypus (9) I(32), 39 mya O(root), 210 mya ....__ ___. (33), 90 mya Sternotherus ( 11 ) ------i(36), 107 mya Dermatemys ( 10)

I Chelonia (7) ..______----JI (35), 56 mya Dermochelys (8)

Che/us ( 18) ,-.--~ 1(38), 45 mya 1 Phrynops (19) (40), 103 mya Elseya (20) -----11(39), 95 mya 1 Chelodina (21) ------...J(43), 156 mya I Pelomedusa (22) ______.I (41 ), 22 mya ....__---1 (42), 119 mva Pelusios (23)

------Podocnemis (24) Figure 7 50

CHAPTER 3: GENERAL CONCLUSIONS

RAG-1 DNA sequence data has contributed a great deal of stability to the working knowledge of the evolutionary relationships of turtle families. Relationships suggested by the most recent hypothesis (Shaffer et al. 1997) with low statistical support have for the most part been solidified by the addition of this data set from the nuclear genome. However, RAG-1 provides new insight on the relationship between Chelydra and Platysternon. Though considered closely related and members of a single family, Chelydridae, in recent phylogenetic hypotheses

(Gaffney and Meylan 1988, Shaffer et al. 1997), RAG-1 puts forth strong evidence that these taxa have been on separate evolutionary tracks for a very long time. The evidence suggests that Platysternon should indeed be the monotypic representative of its own family, the Platysternidae. The view concerning Chelydra and

Platysternon put forth by RAG-1 is not completely novel, however; it is merely reaffirming evidence from morphology, immunology, and karyology (Danilov 1988,

Chen et al. 1980, Haiduk and Bickham 1982). In fact, Platysternidae has been historically recognized in older phylogenetic hypotheses (Williams 1950). There appears to be some degree of morphological convergence between Chelydra and

Platysternon; RAG-1 provides an example of how molecules can teach us something about morphology, and vice versa. Through molecular dating, RAG-1 also provides us with insights into evolutionary events shaping turtle phylogeny.

There appears to have been a rather rapid radiation in turtle lineages about 150 million years ago and again 100 million years ago. 51

Recommendations for Future Research

The addition of RAG-1 DNA sequences from several key taxa would be of great value both for clarifying some turtle relationships and providing more exact dates for evolutionary events. The addition of Macroclemys temminckii, the undisputed sister taxon to Chelydra serpentina (Ernst and Barbour 1989), may shed light on the low level of statistical support for the branch leading to Chelydra in RAG-

1 analyses. Questions have also been raised regarding the relationships within the subfamily Emydinae ( Clemmys, Emys, Emydoidea, Terrapene) (Lenk et al. 1999); indications are that Clemmys is a polyphyletic genus. Due to its slow evolution,

RAG-1 by itself will probably not provide a great deal of information resolving emydine relationships, but it may prove useful when combined with existing mitochondrial DNA sequences.

This robust turtle phylogeny may also be used for rigorous comparative analyses, for example, looking at the evolution of sex determining mechanisms in turtles. Turtles provide an excellent system for the study of sex determination because they display a remarkably wide variety of sex-determining mechanisms. the offspring sex in most turtle taxa is determined by the temperature experienced by the eggs during incubation (temperature-dependent sex determination or TSO).

However, some turtles exhibit varying forms of genotypic sex determination (GSD) including male heterogamety (XY, e.g., Staurotypus triporcatus), female heterogamety (ZW, e.g., Kachuga smithii), and homogamety (e.g., Apa/one spinifera). While theories have been proposed and tested for the adaptive significance of TSO, actually demonstrating its adaptiveness has been difficult 52

(Charnov and Bull 1977, Janzen and Paukstis 1991 ). Platemys radio/ala, Clemmys

insculpta, Kachuga smithii, and Siebenrockiella crassicollis are all turtles exhibiting

genotypic sex determination but were not sequenced as part of this study. Their

inclusion would provide more insight into the evolution of sex determination in

turtles, as well as more precise estimates for the dates of these transitions.

RAG-1 can also be used to address issues of amniote evolution. Some

recent molecular studies have proposed hypotheses of amniote evolution that

contrast sharply with traditional, well-grounded morphological views of the

relationships among amniote lineages (Hedges and Poling 1999, Cao et al. 2000).

The classical view places turtles as the most basal reptile, with birds (i.e., highly

divergent reptiles) and crocodilians sister to each other and derived (Benton 1997)

relative to other reptile groups. The recent hypotheses of Hedges and Poling (1999)

and Cao et al. (2000) place turtles in a much more derived position (sister to birds

and crocodilians) than morphology suggests. Both of these studies used large data

sets combining sequences from a great variety of genes. However, more data do

not necessarily make for a better phylogeny. A gene (or a combination of genes) with demonstrated properties of high phylogenetic utility at deep levels, such as

RAG-1, should be used to investigate this issue and either embrace the new view or

bolster the classical view of amniote relationships. 53

Literature Cited

Benton, M. J. 1997. Vertebrate Paleontology, 2nd Ed. University of Chicago Press,

Chicago.

Cao, Y., M. D. Sorenson, Y. Kumazawa, D. P. Mindell, M. Hasagawa. 2000.

Phylogenetic position of turtles among amniotes: evidence from mitochondrial

and nuclear genes. Gene 259: 139-148.

Charnov, E. L. and J. Bull. 1977. When is sex environmentally determined? Nature

266: 828-830.

Chen, 8.-Y., S.-H. Mao, and Y.-H. Ling. 1980. Evolutionary relationships of turtles

suggested by immunological cross-reactivity of albumins. Comparative

Biochemistry and Physiology 668: 421-425.

Danilov, I. 1998. Phylogenetic relationships of platysternid turtles. Third Asian

Herpetological Meeting Abstracts, pg. 14.

Ernst, C.H., and R. W. Barbour. 1989. Turtles of the world. Smithsonian Institution

Press, Washington, D. C.

Gaffney, E. S., and P. A. Meylan. 1988. A phylogeny of turtles. Pages 157-219 in

The phylogeny and classification of tetrapods (M. J. Benton, ed.). Clarendon

Press, Oxford, England.

Haiduk, M. W., and J. W. Bickham. 1982. Chromosomal homologies and evolution of

testudinoid turtles with emphasis on the systematic placement of

Platysternon. Copeia 1982: 60-66. 54

Hedges, S. 8. and L. L. Poling. 1999. A molecular phylogeny of reptiles. Science

283: 998-1001.

Janzen, F. J. and G. L. Paukstis. 1991. A preliminary test of the adaptive

significance of environmental sex determination in reptiles. Evolution 45: 435-

440).

Lenk, P., U. Fritz, U. Jager, and M. Wink. 1999. Mitochondrial phylogeography of the

European pond turtle, Emys orbicularis (Linnaeus 1758). Molecular Ecology

8: 1911-1922.

Shaffer, H. 8., P. Meylan, and M. L. McKnight. 1997. Tests of turtle phylogeny:

molecular, morphological, and paleontological approaches. Systematic

Biology 46: 235-268.

Williams, E. E. 1950. Variation and selection of the cervical central articulations of

living turtles. Bulletin of the American Museum of Natural History 94: 505-

562.