Genomic and Transcriptional Analyses of Novel Parvoviruses Identified

Virology 539 (2020) 80–91

Contents lists available at ScienceDirect

Virology

journal homepage: www.elsevier.com/locate/virology

Genomic and transcriptional analyses of novel parvoviruses identiﬁed from dead peafowl T

Xiaoping Liua,b, Hanzhong Wanga, Xiaoqian Liua,b, Yong Lic, Jing Chenc, Jun Zhangc, Xi Wanga,b, ∗∗ ∗ Shu Shena, Hualin Wanga, Fei Denga, Manli Wanga, Wuxiang Guana, , Zhihong Hua, a State Key Laboratory of Virology, Wuhan Institute of Virology, Center for Biosafety Mega-Science, Chinese Academy of Sciences, Wuhan, 430071, China b University of Chinese Academy of Sciences, Beijing, 100049, China c Hubei Wildlife Rescue Center, China

ARTICLE INFO ABSTRACT

Keywords: To identify potential pathogens responsible for a disease outbreak of cultured peafowls in China in 2013, me- Parvovirus tagenomic sequencing was conducted. The genomes of two closely related parvoviruses, namely peafowl par- Peafowl vovirus 1 (PePV1) and PePV2, were identified with size of 4428 bp and 4348 bp, respectively. Phylogenetic fi Transcriptional pro le analysis revealed that both viruses are novel parvoviruses, belonging to the proposed genus Chapparvovirus of Metagenomics Parvoviridae. The transcriptional profile of PePV1 was analyzed by transfecting a nearly complete PePV1 genome Virus evolution into HEK-293T cells. Results revealed that PePV1 employs one promoter and two polyadenylation sites to start and terminate its transcriptions, with one donor site and two acceptor sites for pre-mRNA splicing. PePV1 DNA and structural protein were detected in several tissues of a dead peafowl, which appeared to have suffered enteritis, pneumonia and viremia. These results provide novel information of chapparvoviruses, and call for attention to the potential pathogens.

1. Introduction expression patterns to maximize their coding potential, including alternative pre-RNA splicing, polyadenylation (Guan et al., 2011; Qiu Parvoviruses are icosahedral, non-enveloped, single-stranded linear et al., 2006), leaky scanning and non-consensus translational initiation DNA viruses, with 4–6 kb genomes (Cotmore et al., 2019). These viruses (Fasina and Pintel, 2013). The pre-RNA processing generates 1–3 dif- commonly infect fetal and neonatal hosts, causing lethal or pathoge- ferent sized non-structural proteins and 2 or 3 capsid proteins. At pre- netic infections; infections in adult hosts are generally clinically silent sent, the transcriptional profiles of many parvoviruses have been de- or persistent (Cotmore and Tattersall, 2007). The pathological char- scribed in detail (Chen et al., 2010; Kapelinskaya et al., 2011; Li and acteristics of parvovirus infection vary depending on the specific tissue Pintel, 2012; Liu et al., 2011; Lou et al., 2012; Qiu et al., 2002, 2006, tropisms of different viruses. Parvovirus B19, for instance, causes leu- 2007; Stutika et al., 2016; Vashisht et al., 2004; Yoto et al., 2006; Zhao kopenia and thrombocytopenia (Heegaard et al., 1999), while goose et al., 1995). In general, within a single parvovirus genus, similar pre- parvovirus induces hepatitis and myocarditis (Schettler, 1971) and in- RNA processing patterns are adopted, although viruses may develop fection with Aleutian mink disease virus results in vasculitis, nephritis unique characteristics. Therefore, transcriptional analysis is helpful for and interstitial pneumonitis (Bloom et al., 1994). However, enteritis is a understanding the biological characteristics of parvoviruses and their common pathological feature observed following infection with many evolutionary relationship. parvoviruses (Bloom and Kerr, 2006). According to the International In recent years, a group of parvoviruses belonging to a newly pro- Committee on Virus Taxonomy (ICTV), Parvoviridae is comprised of 2 posed genus, Chapparvovirus of the subfamily Parvovirinae, have been subfamilies, namely Parvovirinae and Densovirinae, the viruses of which identified by metagenomic sequencing. Specifically, the red-crowned infect vertebrates and invertebrates, respectively (Cotmore et al., crane parvovirus (RcPV) have been isolated from red-crowned crane 2019). The Parvovirinae subfamily is further divided into 8 genera and fecal samples (Wang et al., 2019); the Turkey parvovirus 1 (TP1) has the Densovirinae subfamily is divided into 5 genera. been obtained from the feces of Turkeys (Reuter et al., 2014); the Due to a small genome, parvoviruses have adapted complex Desmodus rotundus parvovirus 1 (DrPV-1) from kidney samples of the

∗ Corresponding author. ∗∗ Corresponding author. E-mail addresses: [email protected] (W. Guan), [email protected] (Z. Hu). https://doi.org/10.1016/j.virol.2019.10.013 Received 5 July 2019; Received in revised form 30 September 2019; Accepted 26 October 2019 Available online 31 October 2019 0042-6822/ © 2019 Elsevier Inc. All rights reserved. X. Liu, et al. Virology 539 (2020) 80–91

Desmodus rotundus, vampire bat (Souza et al., 2017); and the porcine (Grabherr et al., 2011). The annotation of the assembled contigs was parvovirus 7 (PPV7) was isolated from rectal swabs of healthy adult run by local BLASTX based on the NCBI non-redundant protein data- − pigs (Palinski et al., 2016). Since these specimens were obtained largely base with an E-value of 10 4. The mapping of the reads to reference via fecal collection or swabs, it remains unclear whether these viruses sequences was accomplished using the bowtie 2 program (Langmead are disease-causing agents in these animals. Furthermore, a recent and Salzberg, 2012) and extracted with sequence alignment/map study showed that a novel chapparvovirus (the mouse kidney parvo- (SAM) tools (Li et al., 2009) and seqtk (https://github.com/lh3/seqtk). virus, MKPV) is associated with development of kidney tubulointer- The RPKM (reads per kilobase per million mapped reads) value of stitial fibrosis in mice (Roediger et al., 2018). However, to date, the PePV1 and PePV2 were measured according to previous publication molecular biological features of the chapparvoviruses remain largely (Wagner et al., 2012). The genome sequences of PePV1 and PePV2 were unknown. deposited in GenBank (MK988619 and MK988620, respectively). Herein we report on 2 novel chapparvovirus genomes identified from a dead peafowl during a disease outbreak. Peafowl breeding has 2.2. Prediction of terminal secondary structure and phylogenetic analysis become popular in China during the past 10 years following an in- creased demand for peafowls to be used for animal exhibitions and for The secondary terminal hairpin structures of the genomes were peafowl feathers to be used as decorations. However, several viral predicted using the Mfold Web Server with default parameters (Zuker, diseases, including Newcastle disease, influenza, avian pox, and hy- 2003). The hypothetical open reading frames (ORFs) of the viral gen- dropericardium syndrome, have been seen to occur during peafowl omes were predicted using Softberry software (http://www.softberry. breeding (Ismail et al., 2010; Khan et al., 2009; Kumar et al., 2013; com/berry.phtml?topic=virus0&group=programs&subgroup= Manzoor et al., 2013). In 2013, a large number of peafowl on a breeding gfindv). In addition, amino acid (aa) sequence alignment was per- farm in Wuhan, central China were reported to have loss of appetite and formed using MEGA-ClustalW with default parameters; and a phylo- diarrhea, and some of the young peafowls on this farm died after dis- genetic tree was constructed with MEGA 5.0 using the Maximum playing these symptoms. Likelihood method with the substitution model of Poisson and rates of In the current study, we identified 2 novel parvoviruses, termed Gamma Distributed, while the support for the node was obtained with peafowl parvovirus 1 (PePV1) and PePV2, from a dead peafowl at the 500 bootstrap iterations. Wuhan farm by metagenomic sequencing. As phylogenetic analysis showed that PePV1 and PePV2 clustered with chapparvoviruses, tran- 2.3. PCR verification and construction of a PePV1 nearly complete duplex scriptional analyses were also conducted to elucidate the molecular genome features of these novel viruses. Molecular detection of the PePVs spe- fi ci c DNA and protein in the tissues of the dead peafowl were also All primers used for verification and plasmid construction are pre- performed. sented in Table 1. The PePV1 genome was confirmed via polymerase chain reaction (PCR) using 5 sets of primers. A nearly full-length 2. Materials and methods genome for PePV1 (nt 64–4339) was amplified by PCR using two sets of primers, namely, XhoI–64F/2085R and NotI–1943F/4339R. The re- 2.1. Metagenomic sequencing analysis sulting fragments were bridged onto a 4276 nucleotide product via overlap extension PCR. The product was cloned into a pTOPO-Blunt In August 2013, more than 10 young peafowls died within 1 week at vector (Aidlab, Beijing, China) and confirmed by Sanger sequencing. the Hubei Wildlife Rescue Center in Wuhan, China. The tissues (liver, heart, intestine and stomach) from one of these birds were collected and Table 1 ground in phosphate buffered saline (PBS). The samples were then Primers used for PCR verification, RACE and RT-PCR. centrifuged at 12,000×g and 4 °C for 10 min. The suspensions obtained primer name sequence (5′-3′)a from the different tissues were collected and combined for subsequent experiments. XhoⅠ-64F gcgctcgagCCCGGGGCGGAGATTGCTGCCCGC We next performed 454 sequencing on the samples by first digesting 1289R GCTTGTTTGCAGCAATCGTTC them and removing free nucleic acids with DNase and RNase. We then 1163F TGGACAGCAATGCACTATGGA 2085R GGCTTGCTGTGCAATAACGG extracted viral DNA and RNA using the QIAamp Viral RNA Mini Elute 1943F ACCCTGGAGATTCTGTAGTGC Kit (QIAGEN, Düsseldorf, Germany). The extracted nucleic acids were 2898R AGTCCATTGAGCAGGTGTGG reverse transcribed via M-MLV Reverse Transcriptase (Promega, 2670F TCTGTTCCTACCAAACAGGAC Madison, WI, USA) with random primer meta-M (5′-GCCGGAGCTCTG 3126R TTCTCTCATAGCTAGATCAGG CAGATATCNNNNNNNN-3′), following the manufacturer's instructions. 2878F ACCACACCTGCTCAATGGAC NotⅠ-4339R gaatgcggccgcCTTGCCCACTTCCGCCCCC The cDNAs of the reverse transcription products as well as those of the R2777 GCATTGTTGATATAAGCCATG DNA samples were then synthesized using the Klenow fragment with R3797 GGGATGTTAGCAGTAATGTTTAC the same random primer. The synthesized double-stranded DNA pro- R4280 GATGTGATATGTGTAGACACAG ducts were amplified using the barcode-primer Ma (5′-GCCGGAGCTC F64 CCCGGGGCGGAGATTGCTGC R1170 GCTGTCCAAACATTAGTATCC TGCAGATATC-3′)(Djikeng et al., 2008). The DNA band that was de- R2457 TATCATGGCCATCACCTCG fi termined to be approximately 500 bp was puri ed using a Gel Extrac- R3284 TTGCTGGAAGCAGTTAAGGG tion Kit (Omega, Norcross, GA, USA), according to manufacturer's in- 5P3Nadaptor CAGTACTAGTCGACGCGTGGCCTA structions and was sequenced on a 454 sequencer at the 454 High-Seq adaptor GGCCACGCGTCGACTAGTAC Lab, Wuhan Institute of Virology. nR1048 CTGTCAGGATTATACTCGCC fl nR2330 TGTGGTGCTGGAGCTGACTGG Illumina sequencing was also performed. Brie y, DNA was ex- nR3050 TTGTCAGTGTATCCTAGAGC tracted from the tissue samples using the PureLink™ Viral RNA/DNA F3250 TCCTACGGTGTTTATCCCTTAA Mini Kit (Invitrogen, Carlsbad, CA, USA), according to the manufac- PePV1-F CCAATACCGGAAAGTCTGCT turer's instructions. The DNA was then sequenced on an Illumina HiSeq PePV1-R CTCCAGGGTTTATGGTTAGT PePV2-F GCAATACTGGGAAATCTGCT 3000 sequencer in HuaZhong Agriculture University. PePV2-R CTCCAGGGATAATGATTGGT The data obtained from 454 sequencing were assembled using 454 GS De Novo Assembler and software DNAStar-SeqMan, while the F, forward; R, reverse. Illumina sequencing data were assembled using the program Trinity a Restriction enzyme site is displayed in lowercase.

81 X. Liu, et al. Virology 539 (2020) 80–91

The resultant clone was termed pT-PePV1. Later, the correct fragment 2.8. Immunohistochemical assay was cloned into a pCAGGS vector using XhoI and NotI restriction en- zymes and the resulting clone was named pC-PePV1. The immunohistochemistry assays were performed on the tissues (heart, intestine, liver and lung) of the same dead peafowl which was 2.4. Transfection and RNA extraction used for PCR and qPCR detection, according to the literature (XING et al., 2016). To detect the viral structural protein 1 (VP1) of PePV1, the HEK-293T cells were maintained in Dulbecco's modified Eagle's gene encoding the truncated VP1 (1–195 aa) of PePV1 was cloned into medium (DMEM, Invitrogen) supplemented with 10% fetal bovine prokaryotic expression vector pET-28a, the protein was expressed, serum (FBS) in 5% CO2 at 37 °C. Four micrograms of pC-PePV1 DNA purified and immune to mice. The generated mouse polyclonal anti- was transfected into HEK-293T cells cultured on 60-mm dishes using body was named anti-PePV1-VP1, and the specificity of the antibody Lipofectamine 3000 reagent (Invitrogen), according to manufacturer's was confirmed by Western blot (data not shown). The tissues were fixed instructions. Total RNA was extracted at 48 h post transfection using in 4% paraformaldehyde and embedded in paraffin, then sectioned at 3 TRIzol regent (Ambion, Foster City, CA), according to manufacturer's μm. The slides were placed in xylene to remove paraffin and then in instructions. graded alcohols to dehydrate. After micro-wave based antigen retrieval and 5% bovine serum albumin blocking, the slides were incubated with 2.5. Rapid amplification of cDNA ends (RACE) and reverse transcription anti-PePV1-VP1 (1:1000) or pre-immune control serum (1:1000) at 4 °C

PCR (RT-PCR) overnight. Followed 3% H2O2 treated to inactivate endogenous perox- idase, the signal was amplified by SABC-POD kit (Boster Biological All primers used for RT-PCR and RACE are listed in Table 1. Total Technology, China) and stained by DAB-Kit-brown (Boster), according RNA extracted from the pC-PePV1-transfected HEK-293T cells was re- to the manufacturer's instructions. The slides were then counterstained verse transcribed following DNA digestion with RQ1 RNase-Free DNase with hematoxylin to visualize cell nucleus. And section images were (Promega). 5′ RACE was performed by reverse transcribing 2 μg of RNA captured by Panoramic MIDIScanner (3DHISTECH). using R1170, R2457 and R3284 primers following treatment with RNase H. The cDNA products were then purified by ethanol precipita- 3. Results tion and the purified cDNA was linked to the 5P3Nadaptor using T4 RNA ligase (Promega). The ligated products were then used as tem- 3.1. Metagenomic sequencing revealed novel parvovirus sequences in tissues plates for nested-PCR analysis (adaptor + nR1048/2330/3050). For 3’ of dead peafowl RACE, the RNA was reverse transcribed using an olig (dT) primer and was directly used as a template for nested PCR detection with the To identify potentially new pathogens, the tissues of one dead 1943F/F3250 primers and an adaptor. RT-PCR was performed by re- peafowl from a disease outbreak on a Wuhan farm in China, of un- verse transcribing RNA with R3797 and R4280 primers and detecting known etiology, were collected and subjected to exaction of DNA/RNA, the resultant cDNA with two primer sets F64 + R2777 and followed by metagenomic sequencing. Initially 454-sequencing was F64 + R4280, respectively. conducted using samples pretreated with DNase and RNase to avoid contamination of host nucleic acids. A total of 525 reads were gener- 2.6. Northern blot analysis ated with an average length of 238 bp, of which 65% of the reads were found to be homologous with parvoviruses according to the BLASTX Total RNA (20 μg) extracted from the pC-PePV1 transfected HEK- analysis (Fig. 1A). Following de novo assembly of the related reads, two 293T cells was subjected to electrophoresis in 1% agarose gel at con- fragments were generated that were 4089 bp and 2042 bp in length, stant voltage 35 V for 8 h. The RNA was subsequently, transferred onto respectively. Both fragments were found to contain a parvovirus NS a Hybond-N+ membrane (Amersham, Buckinghamshire, UK) and UV ORF, however, these genomic fragments encoded different aa sequences cross-linked (Pintel et al., 1983; Qiu et al., 2002). The blots were hy- with only 51% shared identity. According to the ICTV guidelines, dif- bridized using different probes (probe-1: nt 623–986; probe-2: nt ferent parvovirus species share < 85% aa identity in the NS proteins, 2023–2457 and probe-3: nt 3860–4254) that were synthesized using a and thus, we speculated that two new parvoviruses were identified. DIG High Prime DNA Labeling and detection Starter kitⅡ(Roche), ac- To obtain the full genome sequences, the Illumina sequencing cording to the manufacturer's instruction. Signals were developed using platform was employed. Since the samples that had been pretreated MicroChemi (DNR, Israel). with DNase and RNase did not meet the quality control standards re- quested for Illumina sequencing, we used samples that had not been 2.7. PCR and quantitative PCR (qPCR) detection of PePV in dead peafowl treated with nucleases for DNA extraction and subsequent sequencing. tissues A total of 35 million paired reads were generated, of which 0.5% were determined to be aligned to viruses (Fig. 1B). Of the total number of The tissue samples (heart, intestine, liver, and lung) of a dead viral reads, 19.2% belonged to parvoviruses, 33.6% to viruses in the peafowl were ground in 1x PBS at concentration of 0.1 g per milliliter, Myoviridae family and 47.2% to retroviruses. The viruses of the Myo- individually. Then tissue homogenate were centrifuged at 12,000×g viridae family are phages that naturally infect bacteria and archaea, and and 4 °C for 10 min. Two hundred μl of the supernatants were used for are thus, unlikely to be the pathogen causing death in peafowl. More- extracting the viral DNA through Takara MiniBEST Viral RNA/DNA over, since we only sequenced DNA in the Illumina sequence analysis, Extraction Kit according the manufacturer's instructions. The extracted the reads aligned to retroviruses most likely originated from viral viral DNA was resolved into 40 μl water, and 1 μl of DNA was used for fragments integrated into the host chromosome, because endogenous PCR detection with primer pairs PePV1-F + PePV1-R and PePV2- retroviruses are often found in animals including birds (Benkel and F + PePV2-R for PePV1 and PePV2, respectively (Table 1). The plasmid Rutherford, 2014; Cui et al., 2014). As our 454-sequencing data sug- pGEM-Teasy-PePV1 containing nt 1687–1932 of PePV1and pGEM- gested parvoviruses are likely to be the primary viral source within the Teasy-PePV2 containing nt 1650–1914 of PePV2 were used as positive sample, and we therefore, focused the remainder analyses on parvo- controls. Quantitative PCR was performed with the primers PePV1- viruses. Following de novo assembly, nearly complete genomes of two F + PePV1-R using the Takara TB Green Fast qPCR Mix according to parvoviruses, PePV1 and PePV2, were obtained that were 4428 bp and the manufacturer's instruction. The standard curve was generated by 4348 bp in length, respectively (Fig. 1C). Among the sequencing data, determining copies of serially diluted pGEM-Teasy-PePV1 DNA. The 25,873 reads mapped to PePV1 and 5735 reads mapped to PePV2, qPCR were conducted with three independent replicates. covering 15.7% and 3.5% of the total viral reads, respectively. The

82 X. Liu, et al. Virology 539 (2020) 80–91

Fig. 1. Two parvovirus genomes identified by metagenomic sequencing. A. The results of 454 sequencing. The samples were pretreated with DNase and RNase before viral nucleic acids extraction. The reads were classified into Bacteria, Virus and Unknown. B. The results of Illumina sequencing. The DNA extracted directly from the sample was used for sequencing. The reads were classified into Bacteria, Eukaryota, Virus and Unknown. The detailed information of viruses was also provided. C. The assembled genomes of PePV1 and PePV2. The hypothesized ORFs, including start and stop sites, and their orientation are indicated with arrows below the linear genome.

RPKM ratio of PePV1 to PePV2 is approximately 4.46, suggesting that avian sub-clade contains PePV1 and PePV2 from peafowl, RcPVs from there were many more PePV1 viral particles present in the dead tissues red-crowned crane (Wang et al., 2019), TP1 from turkey (Reuter et al., than PePV2. The corresponding sequencing depths of PePV1 and PePV2 2014), and chicken chapparvoviruses 1 and 2 (CchV1 and CchV2) were determined to be 865 x and 195 x, respectively. (GenBank, MG846441 and MG846443, respectively). The assembled PePV1 genome appears to be complete, however, ′ ′ that of PePV2 is lacking the 5 and 3 ends (Fig. 1C). Further genome 3.3. Characterization of the PePV1 genome analysis revealed that PePV1 and PePV2 contain similar genome structures and share approximately 63.9% homology in their nucleic We next analyzed the genome of PePV1 and compared it with that acids. Moreover, they both encode three major proteins, non-structural of PePV2 and other parvoviruses. The secondary structure predicted by protein 1 and 2 (NS1, NS2), and VP1, with aa identity of 50%, 63% and Mfold determined that PePV1 contains an arrow-like left-end hairpin 53%, respectively. (LEH, nt 1–71) and right-end hairpin (REH, nt 4333–4428) (Fig. 3A), which are similar to the LEH and REH found in MKPV (Fig. 3A) 3.2. PePV1 and PePV2 are novel parvoviruses belonging to the genus (Roediger et al., 2018), however, with some differences. For example, chapparvovirus both ends of PePV1 contain two copies of the GTTAAC bubble sequence, while the 5′ end of MKPV contains three copies of the GTTAAC Phylogenetic analysis based on the NS1 protein of 51 representative bubble but the motif was not found in its 3′ end. Furthermore, LEH and viruses in the family Parvoviridae revealed that the viruses from dif- REH sequences in MKPV are longer than those of PePV1, suggesting ferent genera of Parvovirinae and Densovirinae are well distinguished that the genome of PePV1 is missing nucleotides at its 5′ and 3′ ends. (Fig. 2). PePV1 and PePV2 are clustered into the proposed genus Although the LEH and REH were missing in PePV2, two copies of the Chapparvovirus of Parvovirinae. Two distinct sub-clades (Avian and GTTAAC motif were found at both ends of this viral genome. Mammalian) within Chapparvovirus have been identified and the The PePV1 NS1 protein is 665-aa in length and contains a conserved grouping was well supported by bootstrap analyses (Fig. 2). The replication initiator (endonuclease) motif as well as a helicase domain mammalian sub-clade contains viruses from different mammals, in- similar to other parvoviruses (Fig. 3B). The replication initiator motif is cluding MKPV (Roediger et al., 2018) and Murine chapparvovirus the minimum sequence required for NS proteins to exhibit nickase ac- (MchV) (Williams et al., 2018) from mice, rat parvovirus 2 (RPV2) from tivity (Ilyina and Koonin, 1992). It has two conserved clusters, namely, rats (Yang et al., 2016), DrPV-1 and bat parvovirus (BtPV) from bats the HuH motif (where u indicates a hydrophobic residue) which is (Yinda et al., 2018), and PPV7 from porcine (Palinski et al., 2016). The likely a Mg2+ binding site required for nicking activity; and the YxxxK

83 X. Liu, et al. Virology 539 (2020) 80–91

Fig. 2. Phylogenetic analysis of PePV1 and PePV2. The phylogenetic tree is constructed based on the NS proteins of 51 representative parvoviruses using the Maximum Likelihood method with 500 bootstrap replicates. Virus information and abbreviation are listed in Table S1. PePV1 and PePV2 are indicated with red dots and the number under the branch indicates the bootstrap values (values lower than 50 were hided). The scale bar means the genetic distance, number of substitutions per site. motif that contains an active tyrosine site for transesterification (Smith 32.1%–61.8%. and Kotin, 2000). In PePV1, the HuH and YxxK motifs are located at aa The VP1 of PePV1 was identified as 509 aa in length, which is si- 108–110 and 166–169, respectively. Furthermore, the conserved heli- milar to that of other chapparvoviruses (469–543 aa), however, was case domain of the helicase Ⅲ superfamily, including Walker A, B, B′ much shorter than the VP1 from viruses in other Parvovirinae genera and C boxes (James et al., 2003), were identified within the aa 308–401 (~700 aa). The members of other Parvovirinae genera encode additional region of the PePV1 NS1 protein. Walker A has conserved (G)x2(G)xGK ORF(s) (VP2/VP3) within the VP1. A putative in-frame VP2 (aa motif, which directly interact with NTP and form hydrogen bonds; 82–509) is found in the VP1 of PePV1 which appears to be conserved in Walker B is the catalytic core of hydrolytic action via Mg2+; Walker B’ all chapparvoviruses (Fig. 3C). The aa identity of PePV1 VP1 and VP2 function as ATP binding, and is involved in distinguishing ATP from among different chapparvoviruses are within the range of 34.7%–47%, ADP (James et al., 2003; Koonin, 1993). All of the above mentioned and 33.5%–46.7%, respectively. However, no obvious homology was motifs were also found to be conserved in the PePV2 NS1 protein. identified between the VP1/VP2 of chapparvoviruses to those of the An NS2 ORF was also identified in the same direction as NS1, other parvoviruses. In addition, the poly-glycine and the phospholipase however, located in a different reading frame. The predicted NS2 pro- A2 motifs, which are widely present in the VP1 proteins of many par- teins for PePV1 and PePV2 are 180 aa in length and share 60.3% aa voviruses (Zadori et al., 2001), are absent in the VP1 proteins of identity. BLASTP analysis of the NS2 protein of PePV1 determined that chapparvoviruses. The VP1 and VP2 of PePV2 were 507 aa and 426 aa it had 61.8% aa homology with the functional unknown NP protein of in length and shared 53.8% and 54.2% aa identity with that of PePV1, TP1 (Reuter et al., 2014). Although not previously annotated, the respectively. homologues of NS2 were found by scanning the genomes of all other chapparvoviruses using BLASTX, and their localization was determined 3.4. The transcriptional profile of PePV1 to be highly conserved (Fig. 3C), suggesting that NS2 is a common feature in all chapparvoviruses. Of note, the NS2 coding sequence for Initially, we attempted to isolate PePV1 and PePV2 directly from the fi RcPV11 and PPV7 were identi ed by homology analysis and were samples. However, both cell culture and embryo culture failed to pro- found to lack the translational start codon ATG (Fig. 3C, labeled with pagate the viruses, we, therefore, constructed a PePV1 clone and used it *), suggesting that these NS2 proteins may be generated from spliced to examine the transcriptional profile of PePV1. Total RNA from the mRNAs. Further, the aa homology between the NS2 chapparvovirus HEK-293T cells transfected with pC-PePV1, collected at 48 h post- protein and that of the PePV1 and PePV2 were within the range of transfection, was extracted. The results of the 5′/3′ RACE analysis are

84 X. Liu, et al. Virology 539 (2020) 80–91

(caption on next page)

85 X. Liu, et al. Virology 539 (2020) 80–91

Fig. 3. Characterization of the PePV1 genome. A. The predicted secondary structure of the terminal repeats of PePV1 compared with that of MKPV. LEH, left-end hairpin; REH, right-end hairpin. The GTTAAC motif is in green. B. Alignment of conservative domains of NS proteins from different parvoviruses. The HuH (u indicates hydrophobic residues) and YxxxK motifs of the endonuclease motif, and the A, B, B′ and C Walker box of helicase domains are marked. Adeno-associated virus-2, AAV2; Human bocavirus, HBoV; Minute virus of mice, MVM; Aleutian mink disease virus, AMDV; Chicken parvovirus, CPV; Human parvovirus B19, B19; Junonia coenia densovirus, JcDNV; Aedes aegypti densovirus, AaeDNV; Decapod penstyldensovirus, DpeDNV; Penaeus monodon hepandensovirus 1, PmDNV1; Bombyx mori densovirus 5, BmDNV5. C. The genome organization of chapparvoviruses. Turkey parvovirus TP1-2012/HUN, TP1; Parvoviridae sp. isolate yc-9/10/11/12, RcPV-9/10/11/12; Chicken chapparvovirus 1/2, CchV1/2; Mouse kidney parvovirus, MKPV; Murine chapparvovirus, MchV; Desmodus rotundus parvovirus, DrPV-1; Bat parvovirus, BtPV; Rat parvovirus 2, RPV2; Porcine parvovirus 7, PPV7. The predicted start and stop positions of NS2 and the start positions of VP2 are labeled. The number marked with * in front indicates a non-AUG start position. presented in Fig. 4A. Specifically, the 5′ RACE results revealed 3 mRNA polyadenylated at nt 3796. Moreover, the NS2 protein is encoded by the transcripts beginning at the promoter of the pCAGGS vector. These D1-A1 spliced mRNAs, which are polyadenylated at three sites (nt transcripts included a read through mRNA from nt 64 (the start of the 3796, nt 4278 and that of the vector SV40). Based on these splicing clone) to nt 1048, a spliced transcript that connected nt 393 to nt 2042, patterns for NS2 mRNA we have determined that the coding sequence and another spliced transcript that connected nt 393 to nt 2688. for this protein begins at nt 147 and ends at nt 2646, and involves the Moreover, the sequences around nt 393 (underlined) (AAG|GTA) match removal of an intron from nt 394–2041, thereby resulting in the en- the consensus 5′ splice motif G/AAG|GTA/G, while the sequences coding of a 283 aa NS2 protein. Finally, the VP1/VP2 is likely encoded around nt 2688 (CAG|GA) are similar to the consensus 3′ spliced motif by the D1-A2 spliced mRNA that is terminated at nt 4278 and is 2.1 kb CAG|G (Flint et al., 2000). Further, the sequence near nt 2042 in length, as well as by the D1-A2 spliced mRNA that is terminated by (TAG|AA) matched the AG dinucleotide located at the 3′ end of the the SV40 poly(A) site, with a length of 2.5 kb. introns (Flint et al., 2000). Therefore, nt 393, nt 2042, and nt 2688 within the genome of PePV1 are likely to be true splicing sites, which 3.5. PCR and qPCR detection of PePVs in the tissues of dead peafowl were designated as donor 1 (D1), acceptor 1 (A1) and acceptor 2 (A2), respectively. In order to know more about the relationship between the virus and 3′ RACE analysis revealed three polyadenylation [poly(A)] sites the disease, PCR detection and immunohistochemistry assay have been located at nt 3796, nt 4278, as well as at the SV40 poly(A) site in the performed to confirm the viral presence in the tissues of another dead pCAGGS vector. The nt 3796 and nt 4278 are, therefore, constitute a peafowl. Four tissues, that of heart, intestine, liver and lung, have been proximal poly(A) site [(pA)p] and a distal poly(A) site [(pA)d], re- detected. The PCR detection showed that all the four tissues were spectively. Furthermore, a consensus poly(A) signal (AATAAA) was PePV1 positive but PePV2 negative (Fig. 5A). Quantitative PCR detec- identified at nt 4252–4258 in the PePV1 genome, which can be used for tion showed that all the four tissues were PePV1 positive with the the (pA)d. However, no conventional poly(A) signal was identified quantity range from 5 × 105 to 1.4 × 107 DNA copies per milligram upstream of nt 3796. (Fig. 5B). Through RT-PCR analysis using primers F64 and R2777, we were able to confirm the donor site (nt 393) and acceptor sites (nt 2042 and 3.6. The immunohistochemical assay of the dead peafowl tissues nt 2688) for PePV1 pre-mRNA alternative splicing, as well as the read- through mRNA identified via RACE analysis (Fig. 4B). Moreover, se- The immunohistochemistry assays were performed on the tissues quence analysis of RT-PCR results using primers F64 and R4280 further (heart, intestine, liver and lung) of the same dead peafowl which was confirmed that donor (nt 393) and acceptor sites (nt 2042, 2688) of the used for PCR and qPCR detection with anti-PePV1-VP1 antibody spliced mRNAs, and indicated that spliced mRNAs are terminated (Fig. 6). In the heart tissue, the lymphocytes and monocytes in the downstream of nt 4280 (Fig. 4B). capillary were stained positive, while weak positive could also be de- To further understand the transcriptional profile of PePV1, northern tected in some myocardial cells. In the intestine, inflammation was blot analysis was performed using three probes (probe-1, probe-2 and observed in mucosa. Positive stained cells included lymphocytes and probe-3) (Fig. 4A). Hybridization of PePV1 mRNA (extracted from pC- some mucosal epithelia cells in the mucosa epithelia, as well as lym- PePV1-transfected HEK-293T cells) with probe-1 (spanning nt phocytes in the sub-mucosa. In the liver, the blood vessel in the portal 623–986) revealed two 3.9 kb and 2.4 kb (*) bands (Fig. 4C). The 3.9 kb area was strongly stained. In the lung, viral pneumonia with fibrosis band may correspond to the putative NS1 mRNA that is polyadenylated were observed, and monocytes and lymphocytes in the blood vessel at nt 3796 (~3.9 kb) (Fig. 4D), while the origin of the 2.4 kb remains were detected positive. The controls using pre-immune serum were unknown. Hybridization with probe-2 (spanning nt 2023–2457) iden- negative (Fig. 6). The above observations suggested that the peafowl tified 5 transcripts that were 3.9 kb, 3.1 kb, 2.7 kb, 2.4 kb and 2.2 kb in suffered enteritis, pneumonia and viremia before its death. size (Fig. 4C). Apart from the 3.9 kb and 2.4 kb transcripts, which were also detected by probe-1, the remaining transcripts were consistent 4. Discussion with the (D1-A1) spliced mRNA polyadenylated at the (pA)p (~2.2 kb), the (pA)d (~2.7 kb) and the SV40 polyA signal (~3.1 kb) sites. Probe-3 Metagenomic sequencing is a convenient and efficient method for (spanning nt 3860–4254) was designed to detect all the transcripts detecting potential pathogens (Schlaberg et al., 2017). In this study, we polyadenylated at nt 4278 or downstream of this site. The hybridization performed 454 sequencing on tissues obtained from a dead peafowl, the results for probe-3 revealed a weak 3.1 kb band, a smeared area with results revealed that 65% of reads were from parvoviruses PePV1 and the size of ~2.7 kb, and a band of ~2.5 kb (Fig. 4C). The 3.1 kb and PePV2 (Fig. 1A). PCR detection and immunohistochemical assay of 2.7 kb bands were also detected by probe-2, suggesting that the NS2 tissues (heart, intestine, liver and lung) from another dead peafowl mRNAs that are terminated at or after nt 4278. The 2.5 kb band may reveal that all of the four tissues were PePV1 positive (Figs. 5 and 6). represent the VP1/2 mRNA polyadenylated at the SV40 polyA site. Furthermore, the dead peafowl showed signals of enteritis, pneumonia The cumulative results from the 5′/3′ RACE, RT-PCR and northern and viremia, suggesting parvovirus is likely to be the primary patho- blot transcriptional profile analysis of pC-PePV1 in transfected HEK- gens responsible for the infectious epidemic on the peafowl breeding 293T cells are summarized in Fig. 4D. Together these results suggest farm in central China in 2013. that the mRNA transcripts are generated from a single promoter and The genomic organization of these two viruses is similar (Fig. 1C), that the NS1 protein is encoded by a 3.9 kb read-through mRNA however, the nucleic acid homology between PePV1 and PePV2 is only

86 X. Liu, et al. Virology 539 (2020) 80–91

Fig. 4. The transcription profile of PePV1. A. The location of northern blot probes and data analyses from 5′/3′RACE. The green rectangle represents the sequence of the pCAGGS vector. The regions covered by the northern blot probes are shown below the genome. The primers used for 5′ and 3′ RACE analysis are shown as green arrows. The identified splice sites and polyadenylation sites are shown in red. B. RT-PCR detection of mRNA transcripts. The cDNA was reverse transcribed using specific primer R3797 (upper panel) and R4215 (lower panel) and detected with primer sets F64 + R2708 and F64 + R4215, respectively. C. Results of northern blot analysis. 20 μg total RNA from pC- PePV1 transfected HEK-293T cells was used for northern blot analyses. The size of the band is labeled at right and the * indicated an unknown band. D. The summarized transcription map of pC-PePV1 in HEK-293T cells. The transcription landmarks, including the splice donor (D), acceptors (A) and polyadenylation sites (pA)p and (pA)d, are shown in the cloned genome. Models of mRNA splicing that encode different ORFs are depicted with their respective sizes at the left side and the boxed ORFs indicate the translation initiation and termination sites. The dashed boxes of the NS2 indicate the extended coding sequence predicted from the spliced mRNA. The sites of the splice donor, acceptors and polyadenylation are also indicated.

~63.9%, while the aa homology of different ORFs is approximately This group of viruses is distinctly related to the other 8 genera within 51%–60.3%. According to the RPKM ratio of Illumina sequencing, there the subfamily (Fig. 2). The Chapparvovirus genus now contains 15 appeared to be many more PePV1 viral particles present in the dead members with similar genomic organization, and can be further divided tissues than PePV2. PCR detection in another dead peafowl showed it into mammalian and avian sub-clades (Fig. 2). MKPV from the mam- was positive for PePV1 but not PePV2 (Fig. 5). It remains unclear malian sub-clade was reported to cause kidney fibrosis in mice whether PePV2 is also required for the pathogenesis. (Roediger et al., 2018), and in this study we demonstrated that PePV1 ICTV has divided the Parvovirinae subfamily into 8 genera (Cotmore and PePV2, from the avian sub-clade, are likely to be lethal pathogens et al., 2019). However, our results support the previous proposal for a in peafowl. Since most viruses designated as Chapparvovirus were new genus Chapparvovirus within Parvovirinae (Palinski et al., 2016). identified from fecal samples (Reuter et al., 2014; Yang et al., 2016),

87 X. Liu, et al. Virology 539 (2020) 80–91

Fig. 5. PCR and qPCR detection of PePV DNA in the tissues of a dead peafowl. A. PCR detection of PePV1 and PePV2. The tissue samples were indicated and the positive controls were pGEM-Teasy- PePV1 and pGEM-Teasy-PePV2 for PePV1 and PePV2, respectively. B. The result of qPCR assay of PePV1 in different tissues of the dead peafowl. Each column represents the mean ± standard error of mean, with three independent replicates.

swabs (Palinski et al., 2016) or asymptomatic tissues (Souza et al., results suggest a unique lineage of chapparvoviruses that has emerged 2017), it is important to investigate whether these viruses are actually during the evolution of parvoviruses. morbigenous. Our phylogenetic analysis based on NS1 proteins re- Pre-mRNA processing patterns for parvovirus gene expression are vealed that although chapparvoviruses belong to the Parvovirinae sub- characteristic of diﬀerent genera. For examples, adeno-associated virus family, they are divergent from the viruses belonging to rest genera of 2ofDependoparvovirus utilize three promoters to transcribe mRNAs, the subfamily as well as the viruses of Densovirinae subfamily. Thus, our which are terminated at the same polyadenylation site, and have

Fig. 6. The immunohistochemical assay of PePV1 VP1 protein in the dead peafowl tissues. The tissues were indicated at the left. The primary antibody was anti-PePV1-VP1, and the pre-immune serum was used for negative control (NC). Part of the positive region, marked with black box, was 100X magniﬁed at the right. The scale bar is 25 μm.

88 X. Liu, et al. Virology 539 (2020) 80–91 splicing forms consisting of one splice donor and two splice acceptors assays confirmed the presents of PePV1 in the dead peafowl tissues. Our (Green and Roeder, 1980; Qiu et al., 2002); while pre-mRNAs of bovine study highlighted the importance of chapparvoviruses in the evolution parvovirus of Bocaparvovirus are generated from one promoter and of parvoviruses and also suggests that efforts should be made to further terminated at two different polyadenylation sites, with multiple donors investigate this largely unknown group of viruses, which are potential and multiple acceptors to form diverse combinations of spliced mRNAs pathogens for a diverse range of mammalian and avian species. (Qiu et al., 2007). Recently, the transcriptome data of MKPV was reported (Roediger et al., 2018) and were found to be similar to our Declaration of competing interest transcriptional profiles for PePV1 (Fig. 4D) yet with minor differences. Specifically, both PePV1 and MKPV use one promoter to initiate tran- None. scription and two polyadenylation sites to terminate it. Additionally, both viruses use the same donor and different acceptors for splicing of Table S1 NS2 and VP coding mRNAs. However, the splicing of the NS1-coding The information of the viruses used for the phylogenetic analysis. mRNA in MKPV, is not detected in PePV1. Hence, the transcriptional genus/species accession abbreviation analysis of PePV1, performed following transfection of a nearly complete viral genome, may not fully reflect the transcriptional profile of Amdoparvovirus the virus during infection. We also performed the RT-PCR detection of Aleutian mink disease virus NC_001662 ADV-G mRNAs from pT-PePV1 (nt 64–4339 of PePV1 cloned into pTOPO- Raccoon dog amdovirus NC_025825 RDV Aveparvovirus Blunt, which does not contain any promoter) transfected HEK-293T Chicken parvovirus ABU-P1 NC_024452 CPV-ABU-P1 cells and the results were identical to that of the pC-PePV1 (data now Bocaparvovirus shown), therefore, we think the splicing patterns of pC-PePV1 likely Bovine parvovirus NC_001540 BPV reflects to that of the real virus. Nevertheless, the transcription patterns Canine bocavirus 1 NC_020499 CBoV1 of PePV1 and MKPV are largely alike and might be representative for Feline bocavirus NC_017823 FBoV Human bocavirus NC_007455 HBoV chapparvoviruses. Porcine bocavirus NC_023673 PBoV A TATA box (TATAA, nt 93–97) and an enhancer like element Copiparvovirus GGGCGG (nt 68–73) (Blundell et al., 1987) are present in the PePV1 Bovine parvovirus - 2 NC_006259 BPV2 genome, suggesting that these regions may function as the promoter. Porcine parvovirus 4 NC_014665 PPV4 However, our 5′ RACE and RT-PCR results suggest that the promoter of Dependoparvovirus Adeno-associated virus - 2 NC_001401 AAV2 the pCAGGS vector was used in our experimental system. Moreover, Adeno-associated virus - 5 NC_006152 AAV5 transient expression of enhanced green fluorescent protein (EGFP) Goose parvovirus NC_001701 GPV driven by a series of truncated potential promoter regions in DF1 cells Muscovy duck parvovirus NC_006147 MDPV showed only moderate difference (data not shown), therefore, the in- Snake adeno-associated virus NC_006148 SAAV Erythroparvovirus trinsic promoter for the PePV1 genome remains elusive. Human erythrovirus V9 NC_004295 V9 Our analysis revealed a previously unannotated NS2-coding se- Human parvovirus B19 NC_000883 B19 quence, which is present at a similar position in the genomes of all Protoparvovirus members of the Chapparvovirus genus (Fig. 3C). Furthermore, our re- Canine parvovirus NC_001539 CPV sults suggest that the NS2-coding mRNA of PePV1 is transcribed, and H-1 parvovirus NC_001358 H-1 Minute virus of mice NC_001510 MVM that its spliced form (Fig. 4D) is similar to that of MKPV (Fig. 5H) Porcine parvovirus NC_001718 PPV (Roediger et al., 2018). As previously mentioned, the NS2 protein of Tetraparvovirus RcPV11 and PPV7 may also be generated through mRNA splicing, Eidolon helvum (bat) parvovirus NC_016744 EhPV suggesting that Chapparvovirus NS2 genes may share similar transcrip- Human parvovirus 4 G1 NC_007018 HPV4-G1 Chapparvovirus tion patterns. In MVM, the NS2 protein was presumed to regulate the Turkey parvovirus TP1-2012/HUN KF925531 TP1 subcellular localization and post-translational modification of NS1 and Parvoviridae sp. isolate yc-9 KY312548 RcPV-9 to contribute to the replication of viral DNA, virus growth and trans- Parvoviridae sp. isolate yc-10 KY312549 RcPV-10 lation of viral mRNA (Naeger et al., 1990 , 1993). In addition, NS2 of Parvoviridae sp. isolate yc-11 KY312550 RcPV-11 MVM has a nuclear export signal and interacts with the nuclear export Parvoviridae sp. isolate yc-12 KY312551 RcPV-12 Chicken chapparvovirus 1 MG846441 CchV1 factor, chromosome region maintenance 1 (CRM1), which is required Chicken chapparvovirus 2 MG846443 CchV2 for nuclear egress of progeny virions (Bodendorf et al., 1999; Eichwald Mouse kidney parvovirus MH670587 MKPV et al., 2002). On the other hand, the NP1 of bocaparvovirus has been Murine chapparvovirus MF175078 MchV shown to play a critical role in pre-mRNA processing and VP expression Desmodus rotundus parvovirus NC_032097 DrPV-1 Bat parvovirus MG693107 BtPV (Fasina et al., 2017; Zou et al., 2016). In addition, NP1 interacts with Rat parvovirus 2 KX272741 RPV2 interferon regulatory factor 3 (IRF3) thereby inhibiting the IFN-β Porcine parvovirus 7 KU563733 PPV7 pathway of host immunity (Zhang et al., 2012). It will, therefore, be Ambidensovirus interesting to examine the function of the NS2 protein of chapparvo- Culex pipiens densovirus NC_012685 CpDNV viruses. Galleria mellonella densovirus NC_004286 GmDNV Junonia coenia densovirus NC_004284 JcDNV Brevidensovirus 5. Conclusions Aedes aegypti densovirus 2 NC_012636 AaeDNV2 Anopheles gambiae densovirus NC_011317 AgDNV We identified two novel parvoviruses, PePV1 and PePV2, as the Aedes albopictus densovirus 2 NC_004285 AalDNV2 Mosquito densovirus BR/07 NC_015115 MdDNV probable lethal pathogens that caused a peafowl infectious outbreak in Hepandensovirus central China in 2013. And the phylogenetic analyses showed that Fenneropenaeus chinensis hepandensovirus NC_014357 FcDNV PePV1 and PePV2 were two novel viruses belong to the proposed new Penaeus monodon hepandensovirus 1 NC_007218 PmDNV1 parvovirus genus, Chapparvovirus. Furthermore, the transcriptional Penaeus monodon hepandensovirus 4 NC_011545 PmDNV4 analysis of PePV1 displayed that the mRNAs of PePV1 start transcrip- Iteradensovirus Bombyx mori densovirus 5 NC_004287 BmDNV5 tion at one promoter and terminate at two polyadenylation sites. The Sibine fusca densovirus NC_018399 SfDNV specific donor and acceptor sites for alternative splicing of mRNAs of Penstyldensovirus NS2 and VP1/VP2 were identified. PCR and immunohistochemical Decapod penstyldensovirus 1 NC_002190 DpeDNV

89 X. Liu, et al. Virology 539 (2020) 80–91

W.V.P.A 38, 65–70. Acknowledgments Koonin, E.V., 1993. A common set of conserved motifs in a vast variety of putative nucleic acid-dependent ATPases including MCM proteins involved in the initiation of eu- karyotic DNA replication. Nucleic Acids Res. 21 (11), 2541–2547. We thank Guang Chen from Hubei Wildlife Rescue Center for col- Kumar, A., Maan, S., Mahajan, N.K., Rana, V.P., Jindal, N., Batra, K., Ghosh, A., Mishra, lecting peafowl associated samples; Lei Zhang from Wuhan Institute of S.K., Kapoor, S., Maan, N.S., 2013. Detection and molecular characterization of Newcastle disease virus in peafowl (Pavo cristatus) in Haryana State, India. Indian J. Virology for technical assistance in 454 sequencing; Prof. Dr. Yiwu Virol. : Off. Organ Indian Virol. Soc. 24, 380–385. Zhou from Tongji Medical college of Huazhong University of Science Langmead, B., Salzberg, S.L., 2012. Fast gapped-read alignment with Bowtie 2. Nat. and Technology for instruction of immunohistochemical assay. This Methods 9, 357–359. work was supported by the Intergovernmental Special Program of State Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R., 2009. The sequence alignment/map format and SAMtools. Key Research and Development Plan from the Ministry of Science and Bioinformatics 25, 2078–2079. Technology of China (NO. 2016YFE0113500); the Science and Li, L., Pintel, D.J., 2012. Splicing of goose parvovirus pre-mRNA influences cytoplasmic – Technology Basic Work Program from the Ministry of Science and translation of the processed mRNA. Virology 426, 60 65. ’ Liu, K., Li, Y., Jousset, F.X., Zadori, Z., Szelei, J., Yu, Q., Pham, H.T., Lepine, F., Bergoin, Technology of China (NO. 2013FY113500); the European Union s M., Tijssen, P., 2011. The Acheta domesticus densovirus, isolated from the European Horizon 2020 Research and Innovation Programme (NO. 653316); and house cricket, has evolved an expression strategy unique among parvoviruses. J. – the National Science Foundation of China (NO. 31621061). Virol. 85, 10069 10078. Lou, S., Xu, B., Huang, Q., Zhi, N., Cheng, F., Wong, S., Brown, K., Delwart, E., Liu, Z., Qiu, J., 2012. Molecular characterization of the newly identified human parvovirus 4 References in the family Parvoviridae. Virology 422, 59–69. Manzoor, S., Hussain, Z., Rahman, S.U., Hussain, I., 2013. Identification of antibodies against hydropericardium syndrome in wild birds. Br Poult Sci 325–328. https://doi. Benkel, B., Rutherford, K., 2014. Endogenous avian leukosis viral loci in the Red Jungle org/10.1080/00071668.2013.791384. – Fowl genome assembly. Poult. Sci. 93, 2988 2990. Naeger, L.K., Cater, J., Pintel, D.J., 1990. The small nonstructural protein (NS2) of the fi Bloom, M.E., Kanno, H., Mori, S., Wol nbarger, J.B., 1994. Aleutian mink disease: puzzles parvovirus minute virus of mice is required for efficient DNA replication and in- – and paradigms. Infect. Agents Dis. 3, 279 301. fectious virus production in a cell-type-specific manner. J. Virol. 64, 6166–6175. Kerr, J.R., Bloom, M.E., 2006. Pathogenesis of parvovirus infections. In: Fyfe, J.K. (Ed.), Naeger, L.K., Salome, N., Pintel, D.J., 1993. NS2 is required for efficient translation of – Parvoviruses. Hodder Arnold, Great Britain, pp. 323 336. viral mRNA in minute virus of mice-infected murine cells. J. Virol. 67, 1034–1043. fi Blundell, M.C., Beard, C., Astell, C.R., 1987. In vitro identi cation of a B19 parvovirus Palinski, R.M., Mitra, N., Hause, B.M., 2016. Discovery of a novel Parvovirinae virus, – promoter. Virology 157, 534 538. porcine parvovirus 7, by metagenomic sequencing of porcine rectal swabs. Virus Bodendorf, U., Cziepluch, C., Jauniaux, J.C., Rommelaere, J., Salome, N., 1999. Nuclear Genes 52, 564–567. export factor CRM1 interacts with nonstructural proteins NS2 from parvovirus Pintel, D.J., Dadachanji, D., Astell, C.R., Ward, D.C., 1983. The genome of minute virus of – minute virus of mice. J. Virol. 73, 7769 7779. mice, an autonomous parvovirus, encodes two overlapping transcription units. Chen, A.Y., Cheng, F., Lou, S., Luo, Y., Liu, Z., Delwart, E., Pintel, D., Qiu, J., 2010. Nucleic Acids Res. 11, 1019–1038. fi Characterization of the gene expression pro le of human bocavirus. Virology 403, Qiu, J., Cheng, F., Burger, L.R., Pintel, D., 2006. The transcription profile of Aleutian – 145 154. mink disease virus in CRFK cells is generated by alternative processing of pre-mRNAs Cotmore, S.F., Agbandje-McKenna, M., Canuti, M., Chiorini, J.A., Eis-Hubinger, A.M., produced from a single promoter. J. Virol. 80, 654–662. Hughes, J., Mietzsch, M., Modha, S., Ogliastro, M., Penzes, J.J., Pintel, D.J., Qiu, J., Qiu, J., Cheng, F., Johnson, F.B., Pintel, D., 2007. The transcription profile of the boca- Soderlund-Venermo, M., Tattersall, P., Tijssen, P., Ictv Report, C., 2019. ICTV virus virus bovine parvovirus is unlike those of previously characterized parvoviruses. J. fi – Taxonomy pro le: Parvoviridae. J. Gen. Virol. 100, 367 368. Virol. 81, 12080–12085. Cotmore, S.F., Tattersall, P., 2007. Parvoviral host range and cell entry mechanisms. Adv. Qiu, J., Nayak, R., Tullis, G.E., Pintel, D.J., 2002. Characterization of the transcription – Virus Res. 70, 183 232. profile of adeno-associated virus type 5 reveals a number of unique features com- Cui, J., Zhao, W., Huang, Z., Jarvis, E.D., Gilbert, M.T., Walker, P.J., Holmes, E.C., Zhang, pared to previously characterized adeno-associated viruses. J. Virol. 76, fi G., 2014. Low frequency of paleoviral in ltration across the avian phylogeny. 12435–12447. Genome Biol. 15, 539. Reuter, G., Boros, A., Delwart, E., Pankovics, P., 2014. Novel circular single-stranded DNA Djikeng, A., et al., 2008. Viral genome sequencing by random priming methods. BMC virus from Turkey faeces. Arch. Virol. 159, 2161–2164. Genomics 9, 5. Roediger, B., Lee, Q., Tikoo, S., Cobbin, J.C.A., Henderson, J.M., Jormakka, M., O'Rourke, ffl Eichwald, V., Dae er, L., Klein, M., Rommelaere, J., Salome, N., 2002. The NS2 proteins M.B., Padula, M.P., Pinello, N., Henry, M., Wynne, M., Santagostino, S.F., Brayton, ffi of parvovirus minute virus of mice are required for e cient nuclear egress of progeny C.F., Rasmussen, L., Lisowski, L., Tay, S.S., Harris, D.C., Bertram, J.F., Dowling, J.P., – virions in mouse cells. J. Virol. 76, 10307 10319. Bertolino, P., Lai, J.H., Wu, W., Bachovchin, W.W., Wong, J.J., Gorrell, M.D., Shaban, Fasina, O., Pintel, D.J., 2013. The adeno-associated virus type 5 small rep proteins ex- B., Holmes, E.C., Jolly, C.J., Monette, S., Weninger, W., 2018. An atypical parvovirus – pressed via internal translation initiation are functional. J. Virol. 87, 296 303. drives chronic tubulointerstitial nephropathy and kidney fibrosis. Cell 175, 530–543 Fasina, O.O., Stupps, S., Figueroa-Cuilan, W., Pintel, D.J., 2017. Minute virus of canines e524. NP1 protein governs the expression of a subset of essential nonstructural proteins via Schettler, C.H., 1971. Isolation of a highly pathogenic virus from geese with hepatitis. its role in RNA processing. J. Virol. 91. Avian Dis. 15, 323–325. Flint, S.J.E., Enquist, L.W., Racniello, V.R., Skalka, A.M., 2000. Processing of Viral Pre- Schlaberg, R., Chiu, C.Y., Miller, S., Procop, G.W., Weinstock, G., 2017. Validation of – mRNA, Principles of Virology. United States of America, pp. 335 372. metagenomic next-generation sequencing tests for universal pathogen detection. Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I., Adiconis, Arch. Pathol. Lab Med. 141, 776–786. X., Fan, L., Raychowdhury, R., Zeng, Q., Chen, Z., Mauceli, E., Hacohen, N., Gnirke, Smith, R.H., Kotin, R.M., 2000. An adeno-associated virus (AAV) initiator protein, Rep 78, A., Rhind, N., di Palma, F., Birren, B.W., Nusbaum, C., Lindblad-Toh, K., Friedman, catalyzes the cleavage and ligation of single-stranded AAV ori DNA. J. Virol. 74, N., Regev, A., 2011. Full-length transcriptome assembly from RNA-Seq data without a 3122–3129. – reference genome. Nat. Biotechnol. 29, 644 652. Souza, W.M., Romeiro, M.F., Fumagalli, M.J., Modha, S., de Araujo, J., Queiroz, L.H., Green, M.R., Roeder, R.G., 1980. Transcripts of the adeno-associated virus genome: Durigon, E.L., Figueiredo, L.T., Murcia, P.R., Gifford, R.J., 2017. Chapparvoviruses – mapping of the major RNAs. J. Virol. 36, 79 92. occur in at least three vertebrate classes and have a broad biogeographic distribution. Guan, W., Huang, Q., Cheng, F., Qiu, J., 2011. Internal polyadenylation of the parvovirus J. Gen. Virol. 98, 225–229. B19 precursor mRNA is regulated by alternative splicing. J. Biol. Chem. 286, Stutika, C., Gogol-Doring, A., Botschen, L., Mietzsch, M., Weger, S., Feldkamp, M., Chen, – 24793 24805. W., Heilbronn, R., 2016. A comprehensive RNA sequencing analysis of the adeno- Heegaard, E.D., Kerndrup, G.B., Carlsen, N.T., Schmiegelow, K., Hornsleth, A.K., 1999. associated virus (AAV) type 2 transcriptome reveals novel AAV transcripts, splice Thrombocytopenia caused by Parvovirus B19 infection in a child with acute lym- variants, and derived proteins. J. Virol. 90, 1278–1289. – phatic leukemia. Ugeskr. Laeg. 161, 6501 6502. Vashisht, K., Faaberg, K.S., Aber, A.L., Brown, K.E., O'Sullivan, M.G., 2004. Splice junc- Ilyina, T.V., Koonin, E.V., 1992. Conserved sequence motifs in the initiator proteins for tion map of simian parvovirus transcripts. J. Virol. 78, 10911–10919. rolling circle DNA replication encoded by diverse replicons from eubacteria, eu- Wagner, G.P., Kin, K., Lynch, V.J., 2012. Measurement of mRNA abundance using RNA- – caryotes and archaebacteria. Nucleic Acids Res. 20, 3279 3285. seq data: RPKM measure is inconsistent among samples. Theor. Biosci. = Theor. fi Ismail, M.M., Khan, O.A., Cattoli, G., Lu, H., 2010. Isolation and identi cation of highly Biowiss. 131, 281–285. fl pathogenic avian in uenza virus subtype H5N1 in peafowl (Pavo cristatus). Avian Wang, Y., Yang, S., Liu, D., Zhou, C., Li, W., Lin, Y., Wang, X., Shen, Q., Wang, H., Li, C., – Dis. 54, 357 360. Zong, M., Ding, Y., Song, Q., Deng, X., Qi, D., Zhang, W., Delwart, E., 2019. The fecal James, J.A., Escalante, C.R., Yoon-Robarts, M., Edwards, T.A., Linden, R.M., Aggarwal, virome of red-crowned cranes. Arch. Virol. 164, 3–16. A.K., 2003. Crystal structure of the SF3 helicase from adeno-associated virus type 2. Williams, S.H., Che, X., Garcia, J.A., Klena, J.D., Lee, B., Muller, D., Ulrich, W., Corrigan, – Structure 11, 1025 1035. R.M., Nichol, S., Jain, K., Lipkin, W.I., 2018. Viral diversity of house mice in New Kapelinskaya, T.V., Martynova, E.U., Schal, C., Mukha, D.V., 2011. Expression strategy of York city. mBio 9. densonucleosis virus from the German cockroach, Blattella germanica. J. Virol. 85, XING, J., LIU, D., SHEN, S., et al., 2016. Pathologic studies of fatal encephalomyelitis in – 11855 11870. children caused by enterovirus 71. Am. J. Clin. Pathol. 146, 95–106. Khan, A., Yousaf, A., Khan, M.Z., Siddique, M., Gul, S.T., Mahmood, F., 2009. Cutaneous Yang, S., Liu, Z., Wang, Y., Li, W., Fu, X., Lin, Y., Shen, Q., Wang, X., Wang, H., Zhang, W., form of pox infection among captive peafowl (Pavo cristatus) chicks. Avian Pathol. J. 2016. A novel rodent Chapparvovirus in feces of wild rats. Virol. J. 13, 133.

90 X. Liu, et al. Virology 539 (2020) 80–91

Yinda, C.K., Ghogomu, S.M., Conceicao-Neto, N., Beller, L., Deboutte, W., Vanhulle, E., blocking association of IFN regulatory factor 3 with IFNB promoter. J. Immunol. 189, Maes, P., Van Ranst, M., Matthijnssens, J., 2018. Cameroonian fruit bats harbor di- 1144–1153. vergent viruses, including rotavirus H, bastroviruses, and picobirnaviruses using an Zhao, Q., Gersappe, A., Pintel, D.J., 1995. Eﬃcient excision of the upstream large intron alternative genetic code. Virus. Evol. 4 vey008. from P4-generated pre-mRNA of the parvovirus minute virus of mice requires at least Yoto, Y., Qiu, J., Pintel, D.J., 2006. Identiﬁcation and characterization of two internal one donor and the 3' splice site of the small downstream intron. J. Virol. 69, cleavage and polyadenylation sites of parvovirus B19 RNA. J. Virol. 80, 1604–1609. 6170–6179. Zadori, Z., Szelei, J., Lacoste, M.C., Li, Y., Gariepy, S., Raymond, P., Allaire, M., Nabi, I.R., Zou, W., Cheng, F., Shen, W., Engelhardt, J.F., Yan, Z., Qiu, J., 2016. Nonstructural Tijssen, P., 2001. A viral phospholipase A2 is required for parvovirus infectivity. Dev. protein NP1 of human bocavirus 1 plays a critical role in the expression of viral Cell 1, 291–302. capsid proteins. J. Virol. 90, 4658–4669. Zhang, Z., Zheng, Z., Luo, H., Meng, J., Li, H., Li, Q., Zhang, X., Ke, X., Bai, B., Mao, P., Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization prediction. Hu, Q., Wang, H., 2012. Human bocavirus NP1 inhibits IFN-beta production by Nucleic Acids Res. 31, 3406–3415.