Genomic and Transcriptional Analyses of Novel Parvoviruses Identified

Virology 539 (2020) 80–91 Contents lists available at ScienceDirect Virology journal homepage: www.elsevier.com/locate/virology Genomic and transcriptional analyses of novel parvoviruses identified from dead peafowl T Xiaoping Liua,b, Hanzhong Wanga, Xiaoqian Liua,b, Yong Lic, Jing Chenc, Jun Zhangc, Xi Wanga,b, ∗∗ ∗ Shu Shena, Hualin Wanga, Fei Denga, Manli Wanga, Wuxiang Guana, , Zhihong Hua, a State Key Laboratory of Virology, Wuhan Institute of Virology, Center for Biosafety Mega-Science, Chinese Academy of Sciences, Wuhan, 430071, China b University of Chinese Academy of Sciences, Beijing, 100049, China c Hubei Wildlife Rescue Center, China ARTICLE INFO ABSTRACT Keywords: To identify potential pathogens responsible for a disease outbreak of cultured peafowls in China in 2013, me- Parvovirus tagenomic sequencing was conducted. The genomes of two closely related parvoviruses, namely peafowl par- Peafowl vovirus 1 (PePV1) and PePV2, were identified with size of 4428 bp and 4348 bp, respectively. Phylogenetic fi Transcriptional pro le analysis revealed that both viruses are novel parvoviruses, belonging to the proposed genus Chapparvovirus of Metagenomics Parvoviridae. The transcriptional profile of PePV1 was analyzed by transfecting a nearly complete PePV1 genome Virus evolution into HEK-293T cells. Results revealed that PePV1 employs one promoter and two polyadenylation sites to start and terminate its transcriptions, with one donor site and two acceptor sites for pre-mRNA splicing. PePV1 DNA and structural protein were detected in several tissues of a dead peafowl, which appeared to have suffered enteritis, pneumonia and viremia. These results provide novel information of chapparvoviruses, and call for attention to the potential pathogens. 1. Introduction expression patterns to maximize their coding potential, including al- ternative pre-RNA splicing, polyadenylation (Guan et al., 2011; Qiu Parvoviruses are icosahedral, non-enveloped, single-stranded linear et al., 2006), leaky scanning and non-consensus translational initiation DNA viruses, with 4–6 kb genomes (Cotmore et al., 2019). These viruses (Fasina and Pintel, 2013). The pre-RNA processing generates 1–3 dif- commonly infect fetal and neonatal hosts, causing lethal or pathoge- ferent sized non-structural proteins and 2 or 3 capsid proteins. At pre- netic infections; infections in adult hosts are generally clinically silent sent, the transcriptional profiles of many parvoviruses have been de- or persistent (Cotmore and Tattersall, 2007). The pathological char- scribed in detail (Chen et al., 2010; Kapelinskaya et al., 2011; Li and acteristics of parvovirus infection vary depending on the specific tissue Pintel, 2012; Liu et al., 2011; Lou et al., 2012; Qiu et al., 2002, 2006, tropisms of different viruses. Parvovirus B19, for instance, causes leu- 2007; Stutika et al., 2016; Vashisht et al., 2004; Yoto et al., 2006; Zhao kopenia and thrombocytopenia (Heegaard et al., 1999), while goose et al., 1995). In general, within a single parvovirus genus, similar pre- parvovirus induces hepatitis and myocarditis (Schettler, 1971) and in- RNA processing patterns are adopted, although viruses may develop fection with Aleutian mink disease virus results in vasculitis, nephritis unique characteristics. Therefore, transcriptional analysis is helpful for and interstitial pneumonitis (Bloom et al., 1994). However, enteritis is a understanding the biological characteristics of parvoviruses and their common pathological feature observed following infection with many evolutionary relationship. parvoviruses (Bloom and Kerr, 2006). According to the International In recent years, a group of parvoviruses belonging to a newly pro- Committee on Virus Taxonomy (ICTV), Parvoviridae is comprised of 2 posed genus, Chapparvovirus of the subfamily Parvovirinae, have been subfamilies, namely Parvovirinae and Densovirinae, the viruses of which identified by metagenomic sequencing. Specifically, the red-crowned infect vertebrates and invertebrates, respectively (Cotmore et al., crane parvovirus (RcPV) have been isolated from red-crowned crane 2019). The Parvovirinae subfamily is further divided into 8 genera and fecal samples (Wang et al., 2019); the Turkey parvovirus 1 (TP1) has the Densovirinae subfamily is divided into 5 genera. been obtained from the feces of Turkeys (Reuter et al., 2014); the Due to a small genome, parvoviruses have adapted complex Desmodus rotundus parvovirus 1 (DrPV-1) from kidney samples of the ∗ Corresponding author. ∗∗ Corresponding author. E-mail addresses: [email protected] (W. Guan), [email protected] (Z. Hu). https://doi.org/10.1016/j.virol.2019.10.013 Received 5 July 2019; Received in revised form 30 September 2019; Accepted 26 October 2019 Available online 31 October 2019 0042-6822/ © 2019 Elsevier Inc. All rights reserved. X. Liu, et al. Virology 539 (2020) 80–91 Desmodus rotundus, vampire bat (Souza et al., 2017); and the porcine (Grabherr et al., 2011). The annotation of the assembled contigs was parvovirus 7 (PPV7) was isolated from rectal swabs of healthy adult run by local BLASTX based on the NCBI non-redundant protein data- − pigs (Palinski et al., 2016). Since these specimens were obtained largely base with an E-value of 10 4. The mapping of the reads to reference via fecal collection or swabs, it remains unclear whether these viruses sequences was accomplished using the bowtie 2 program (Langmead are disease-causing agents in these animals. Furthermore, a recent and Salzberg, 2012) and extracted with sequence alignment/map study showed that a novel chapparvovirus (the mouse kidney parvo- (SAM) tools (Li et al., 2009) and seqtk (https://github.com/lh3/seqtk). virus, MKPV) is associated with development of kidney tubulointer- The RPKM (reads per kilobase per million mapped reads) value of stitial fibrosis in mice (Roediger et al., 2018). However, to date, the PePV1 and PePV2 were measured according to previous publication molecular biological features of the chapparvoviruses remain largely (Wagner et al., 2012). The genome sequences of PePV1 and PePV2 were unknown. deposited in GenBank (MK988619 and MK988620, respectively). Herein we report on 2 novel chapparvovirus genomes identified from a dead peafowl during a disease outbreak. Peafowl breeding has 2.2. Prediction of terminal secondary structure and phylogenetic analysis become popular in China during the past 10 years following an in- creased demand for peafowls to be used for animal exhibitions and for The secondary terminal hairpin structures of the genomes were peafowl feathers to be used as decorations. However, several viral predicted using the Mfold Web Server with default parameters (Zuker, diseases, including Newcastle disease, influenza, avian pox, and hy- 2003). The hypothetical open reading frames (ORFs) of the viral gen- dropericardium syndrome, have been seen to occur during peafowl omes were predicted using Softberry software (http://www.softberry. breeding (Ismail et al., 2010; Khan et al., 2009; Kumar et al., 2013; com/berry.phtml?topic=virus0&group=programs&subgroup= Manzoor et al., 2013). In 2013, a large number of peafowl on a breeding gfindv). In addition, amino acid (aa) sequence alignment was per- farm in Wuhan, central China were reported to have loss of appetite and formed using MEGA-ClustalW with default parameters; and a phylo- diarrhea, and some of the young peafowls on this farm died after dis- genetic tree was constructed with MEGA 5.0 using the Maximum playing these symptoms. Likelihood method with the substitution model of Poisson and rates of In the current study, we identified 2 novel parvoviruses, termed Gamma Distributed, while the support for the node was obtained with peafowl parvovirus 1 (PePV1) and PePV2, from a dead peafowl at the 500 bootstrap iterations. Wuhan farm by metagenomic sequencing. As phylogenetic analysis showed that PePV1 and PePV2 clustered with chapparvoviruses, tran- 2.3. PCR verification and construction of a PePV1 nearly complete duplex scriptional analyses were also conducted to elucidate the molecular genome features of these novel viruses. Molecular detection of the PePVs spe- fi ci c DNA and protein in the tissues of the dead peafowl were also All primers used for verification and plasmid construction are pre- performed. sented in Table 1. The PePV1 genome was confirmed via polymerase chain reaction (PCR) using 5 sets of primers. A nearly full-length 2. Materials and methods genome for PePV1 (nt 64–4339) was amplified by PCR using two sets of primers, namely, XhoI–64F/2085R and NotI–1943F/4339R. The re- 2.1. Metagenomic sequencing analysis sulting fragments were bridged onto a 4276 nucleotide product via overlap extension PCR. The product was cloned into a pTOPO-Blunt In August 2013, more than 10 young peafowls died within 1 week at vector (Aidlab, Beijing, China) and confirmed by Sanger sequencing. the Hubei Wildlife Rescue Center in Wuhan, China. The tissues (liver, heart, intestine and stomach) from one of these birds were collected and Table 1 ground in phosphate buffered saline (PBS). The samples were then Primers used for PCR verification, RACE and RT-PCR. centrifuged at 12,000×g and 4 °C for 10 min. The suspensions obtained primer name sequence (5′-3′)a from the different tissues were collected and combined for subsequent experiments. XhoⅠ-64F gcgctcgagCCCGGGGCGGAGATTGCTGCCCGC We next performed 454 sequencing on the samples by first digesting 1289R GCTTGTTTGCAGCAATCGTTC them and removing free nucleic acids with DNase and RNase. We then 1163F TGGACAGCAATGCACTATGGA

Load more