Diversity of Tall Fescue and Relationships Within Festuca

DIVERSITY OF TALL FESCUE AND RELATIONSHIPS WITHIN FESTUCA

SUBGENUS SCHEDONOURUS BASED ON NUCLEAR AND CHLOROPLAST

SIMPLE SEQUENCE REPEAT MARKERS

VINCENZO AVERELLO IV

A Thesis Submitted to the

School of Graduate Studies

Rutgers, The State University of New Jersey

In partial fulfillment of the requirements

For the Degree of

Master of Science

Graduate Program in Plant Biology

Written Under the Direction of

Stacy Bonos and William Meyer

And Approved By

______

New Brunswick, NJ

October, 2017

ABSTRACT OF THE THESIS

Diversity of tall fescue and relationships within Festuca subgenus Schedonourus based

on nuclear and chloroplast simple sequence repeat markers

By VINCENZO AVERELLO IV

Thesis Director:

Dr. Stacy A. Bonos and Dr. William A. Meyer

Tall fescue (Festuca arundinacea Schreb. syn. Lolium arundinaceaum [Schreb.] Darbysh. syn. Schedonourus arundinaceus [Schreb.] Dumort.) is an allohexaploid grass species that is found throughout Europe, much of Asia, and North Africa. As it is currently understood, there are two gene pools within Festuca subgenus, the Continental morphotype, which can be found in Europe and Asia, and the Mediterranean morphotype, which can be found in

Northern Africa. The aims of this thesis were to investigate the level of diversity present in a tall fescue germplasm collection from the center of origin for the species and recent cultivars and to determine the relationships between the collections and cultivars, as well as between the species and subspecies within the subgenus Schedonorus.

Sixteen individuals from ninety-eight collections, cultivars, and accessions of

Festuca and Lolium were genotyped using two tall fescue nuclear EST-SSRs, eleven tall fescue nuclear genomic SSRs, and eighteen tall fescue chloroplast SSRs. One chloroplast marker was used to assign each cultivars, collection, or accession to a morphotype. The nuclear SSR markers found that the turf-type cultivars of tall fescue were closely related

but still genetically distinct from each other, agreeing with known pedigree information.

The collections generally clustered by geographic origin. Bayesian cluster analysis showed that the cultivars and collections exhibit a high level of admixture. Chloroplast microsatellites were not capable of discriminating between cultivars and collections, as the nuclear satellites were. Both marker systems, separated the collections from North Africa from the other collections, as well as other species and subspecies from that region, suggesting they are not closely related. This work showed that nuclear SSRs were capable of distinguishing between cultivars and collections of tall fescue, while chloroplast SSRs were only capable of distinguishing between species and subspecies.

iii

Acknowledgements I cannot express enough gratitude for my amazing advisors, Stacy Bonos and

William Meyer, who have always pushed me to make sure that I am doing the best possible work I can. Their comments on this work and everything else I have done with them has been incredibly helpful, supportive, and motivating. Their dedication to me, their students, and all their work will serve to inspire me for years to come.

I want to thank for Josh Honig. He trained me on all the lab skills that I needed to complete this project. He was always available and helpful when problems arose with material and analyses. Working with him has allowed me to grow into a better person and a better scientist. I also want to thank Ning Zhang for serving on the thesis committee and her constructive comments on my work.

Jennifer Vaiciunnas and Christine Kubik were invaluable in the laboratory, assisting with everything from collecting and maintaining plant material to troubleshooting and maintaining an incredible work space for all. Everyone who helped collecting material or with field and greenhouse, Dirk Smith, Austin Grimshaw, Eric Weibel, Trent Tate, and many others. To Megan Muehlbauer, Stephanie Fong, Ariane Vasilatis, Robert Mattera,

Philip Vines, and many others, thank you for being helpful and supportive friends from my time here in Plant Biology.

I want to thank my family for their many years of support through all my academic endeavors. Their unwavering support has encouraged me through any rough times I have add during my studies.

Table of Contents Abstract of the thesis ...... ii Acknowledgements ...... iv Table of Figures ...... vii Table of Tables ...... viii Literature Review...... 1 Tall Fescue Biology, Use, and Breeding...... 1 Phylogeny and Systematics of Festuca and Lolium ...... 3 Tall Fescue Center of Origin and Within Species Diversity ...... 9 Use and Development of Nuclear Microsatellite (nuSSR) Markers in Other Species ...... 15 Use of Chloroplast Microsatellites (cpSSR) Markers for Diversity Research ...... 22 Tall Fescue Genomic Resources and Other Applications ...... 27 References ...... 33 Diversity of Tall Fescue and Relationships within Festuca subgenus Schedonorus ...... 39 Introduction ...... 39 Materials and Methods ...... 42 Plant Material ...... 42 Nuclear and Chloroplast SSR Markers ...... 54 SSR genotyping ...... 57 Allele scoring and SSR summary statistics ...... 58 Analysis of molecular variation (AMOVA) ...... 59 Genetic dissimilarity and neighbor joining dendrogram construction ...... 60 Bayesian model based clustering ...... 61 Results and Discussion ...... 61 nuSSR summary statistics ...... 61 cpSSR and haplotype summary statistics ...... 62 Festuca and Lolium species and sub-species relationships based on nuSSR AMOVA, Morphotype Assignment, Pairwise ΦPT Values, interpopulation pairwise genetic distance and neighbor joining tree analysis...... 65 Festuca and Lolium species and sub-species relationships based on cpSSR AMOVA, Morphotype Assignment, Pairwise ΦPT Values, interpopulation pairwise genetic distance and neighbor joining tree analysis...... 102 Continental Festuca arundinacea germplasm relationships ...... 138 Comparison of relationships based on nuSSRs and relationships based on cpSSRs ...... 139

Genetic diversity based on nuSSR markers, model based clustering analysis...... 140 Conclusion ...... 157 References ...... 159

Table of Figures Figure 1- Neighbor-Joining Tree based on nuclear SSR Markers. The shape to the left of the node name is the result of Chl045 marker to determine morphotype. An open circle represents that all 16 individuals have the continental allele, a filled circle represents that all individuals have the Mediterranean allele. An open square represents that 15 individuals has the continental allele while 1 individual has the Mediterranean allele. A filled square represents that that 15 individuals have the Mediterranean allele while 1 individual has the Continental allele. A filled triangle represents that there is mixture of the two alleles. Numbers at nodes are support values, only values great than 70 are shown...... 68

Figure 2- Neighbor-Joining Tree based on chloroplast SSR Markers. The shape to the left of the node name is the result of Chl045 marker to determine morphotype. An open circle represents that all 16 individuals have the continental allele, a filled circle represents that all individuals have the Mediterranean allele. An open square represents that 15 individuals has the continental allele while 1 individual has the Mediterranean allele. A filled square represents that that 15 individuals have the Mediterranean allele while 1 individual has the Continental allele. A filled triangle represents that there is mixture of the two alleles. Numbers at nodes are support values, only values great than 70 are shown...... 104

Figure 3- Output of Bayesian analysis performed in STRUCTURE 2.3.4 assuming there are 19 genetic groups [(K)=19]. Each vertical bar represents an individual. Individuals are grouped into the cultivars, collections, or accessions, which is reflected in the label. Each color represents a genetic group detected by STRUCTURE...... 141

Figure 4- Output of Bayesian analysis performed in STRUCTURE 2.3.4 assuming there are 28 genetic groups [(K)=28]. Each vertical bar represents an individual. Individuals are grouped into the cultivars, collections, or accessions, which is reflected in the label. Each color represents a genetic group detected by STRUCTURE...... 148

vii

Table of Tables Table 1- Entries Table and Breeding Histories ...... 43

Table 2- Nuclear Markers and Marker Summary Statistics...... 55

Table 3- Chloroplast SSR Markers and Marker Summary Statistics ...... 56

Table 5 - Nuclear SSR PhiPTP values. PhiPT values and probability P(rand >= data) based on 999 permutations is shown above diagonal. Numbers in top row and first column reference Table 1 for entry...... 70

Table 6- Chloroplast SSR PhiPTP values. PhiPT values and probability P(rand >= data) based on 999 permutations. Numbers in top row and first column reference Table 1 for entry...... 106

viii

Literature Review Tall Fescue Biology, Use, and Breeding

Tall fescue (Festuca arundinacea Schreb syn. Lolium arundinaceum [Schreb.]

Darbysh. syn. Schedonourus arundinaceus [Schreb.] Dumort. syn. Schedonourus phoenix

[Scop.] Holub. syn. Festuca eliator L.) is an allohexaploid species with 42 chromosomes

(2n=6x=42) and a genome size ranging from 5.27 to 5.83 Gb (Seal, 1983). Tall fescue contains 6 genomes (PPG1G1G2G2), with the P-genomes descending from the diploid

Festuca pratensis Huds. and the G-genomes descending from the tetraploid Festuca arundinacea ssp. glaucescens Boiss (Xu et al, 1991; Humpheys et al, 1995). Tall fescue is used as forage, turf, and utility grass (Turgeon, 2012). It is widely adapted to much of the

United States, being moderately to well-suited to much of the Eastern United States and the Northern Pacific Coast (Hannaway et al, 2009).

The earliest tall fescue varieties released in the United States were based on ecotype-selection. This consisted of collecting plants, screening those collections, followed by seed increase and release (Hopkins et al, 2009). An important event from this era is the release of Kentucky-31 in 1942, which was developed through the ecotype selection process based on material collected from western Kentucky in 1931 (Hopkins et al, 2009;

Bonos and Huff, 2013). Starting in 1962, C. Reed Funk began collecting germplasm for turf grass breeding focusing on the Northeast and Southeast United States (Samples et al,

2009). In the 1970s, the first turf-type cultivars ‘Rebel’, ‘Houndog’, ‘Olympic’, and

‘Falcon’ were developed and released, beginning with Rebel in 1981 (Funk et al, 1981). In the years since these were released, tall fescue breeding has led to cultivars with lower

vertical growth rate, darker green color, finer leaf blades, higher shoot density, improved disease resistance, and greater seed yield (Bonos and Huff, 2013).

Many diseases and some insect pests can damage tall fescue, however, there have been breeding efforts against these diseases. The most devastating disease in tall fescue is brown patch (caused by Rhizoctonia solani Kuhn.). Early work suggested that lower shoot density was related to increased resistance to brown patch (Giesler et al, 1996). However, breeding efforts have been able to separate these two traits (Bonos et al, 2006), while breeding efforts for red thread (Laetisaria fuciformis [McAlpine] Burds.) and net blotch

(Drechslera dictyoides [Drechsler] Shoemaker) have not had as much progress. There are few insect pests of tall fescue, many are kept away due to the fungal endophyte, however, under drought stress, grubs and billbugs can cause damage (Bonos and Huff, 2013).

Tall fescue has very good heat and drought tolerance. This is at least partially enabled by the deep root system and high shoot to root ratio (Carrow, 1996; Huang and

Fry, 1998; Huang and Goa, 2000). Additionally, the fine root production and increased production of heat shock proteins helps the heat and drought tolerance (Jiang and Huang,

2002). There has been little research on the salt tolerance of tall fescue but it is considered to have moderate salt tolerance (Bonos and Huff, 2013). There is a positive correlation between shoot density and wear tolerance in tall fescue, which is generally considered a wear tolerant turf species (Park et al, 2009 reviewed in Bonos and Huff, 2013).

Tall fescue can form a symbiotic relationship with Epichloë spp. as a fungal endophyte (Meyer et al., 2013). In 1977, this was found to be toxic to grazing cattle. It

was later found that this can have beneficial effects to the grass, such as improving disease resistance (Bacon et al., 1977). Currently, many of the top performing cultivars contain endophytic fungi (Meyer et al., 2013). Tall fescue that is infected with Epichloë can have enhanced turf quality, increased water use efficiency, survival under drought stress, enhanced growth and vigor, control sod webworms (family Crambidae) and billbugs

(Sphenophorus spp.) (Murphy et al., 1993). Since tall fescue is extensively used as a forage, there have been efforts to incorporate an endophyte that is non-toxic to grazing animals but retains other beneficial features, which was achieved in the MaxQ endophyte, a variety that contains an endophyte with low toxicity to mammals (Bouton et al, 2002).

Phylogeny and Systematics of Festuca and Lolium

Tall fescue is a member of the family Poaceae, subfamily Pooideae, and tribe

Poeae, subgenus Schedonorus (Clayton and Renvoize, 1986). Schedonorus includes

Festuca arundinacea Schreb, Festuca pratensis Huds., Festuca mairei (Lag.) St.-Yves., and Festuca scariosa (Lag.) Asch. & Greabn., among others (Craven et al., 2009). The

Festuca genus can be divided into two major taxonomic groups, the broad leaved fescues such as tall fescue (Festuca arundinacea) and meadow fescue (Festuca pratensis) and fine- leaved fescues like red fescue (Festuca rubra L.) and sheep fescue (Festuca ovina L.).

Lolium (the ryegrass genus) is closely related to the broad-leaved fescues (Charmet et al,

1997).

Random fragment-length polymorphism (RFLP) markers were used to determine the phylogeny of tall fescue and closely related species (F. pratensis, F. mairei, and Lolium perenne) (Xu and Sleper, 1994). Multiple individuals of each species were genotyped. F. pratensis and L. perenne formed a group, separate from F. arundinacea and F. arundinacea var. glaucescens, suggesting that F. pratensis may be more closely related to Lolium then to Festuca. Some samples of the octoploid F. arundinacea var. atlantigena grouped near

F. arundinacea var. glaucescens, suggesting the tetraploid tall fescue may be closely related to Mediterranean genotypes and species (Xu and Sleper, 1994).

Random amplified polymorphic DNA (RAPD) markers were used to investigate the relationships between Festuca and Lolium species (Stammers et al, 1995). A close affinity between the two genera was found, with Festuca pratensis grouping within Lolium, while tetraploid Festuca pratensis var. appenina was closer to Festuca arundinacea.

Festuca arundinacea var. glaucescens was more closely related to the Mediterranean species Festuca mairei and Festuca scariosa, suggesting that it may share an evolutionary history with the Mediterranean species of Festuca (Stammers et al, 1995).

Using the internal transcribed spacer region (ITS) sequence and cpDNA RFLP markers, the phylogeny of the Festuca genus was determined as well as its relation to

Lolium, with Poa trivialis and Vulpia myuros also analyzed for comparison (Charmet et al,

1997). Both marker systems found that Vulpia is closely related to the fine-leaved fescues.

Also in both marker systems, the Mediterranean tall fescues formed a group separated from the continental fescues within the broadleaved fescue group (Charmet et al, 1997). Using cpDNA markers, Lolium forms a monophyletic group, with F. pratensis sister to Lolium.

Hexaploid F. arundinacea and tetraploid F. arundinacea var. glaucescens formed a group that is sister to the Mediterranean fescues, F. mairei, F. arundinacea ssp. atlantigena, and

F. arudinacea ssp. letourneuxiana. The ITS sequence showed similar results, however, F. pratensis grouped with hexaploid F. arundinacea, with L. canariense sister to the two

(Charmet et al, 1997).

Further investigation into the phylogeny of Festuca and Lolium was done using ITS sequences (Gaut et al, 2000). Three different clades were found, Lolium and broad-leaved fescues, fine-leaved fescues, and a basal clade composed of F. scariosa, F. lasto, and F. drymeja. Lolium was found to be a monophyletic group however, individuals of the same species did not always group together. F. pratensis individuals often clustered closer to

Lolium than to other Festuca, suggesting it may be closer to the ryegrasses than the broad- leaved fescues (Gaut et al., 2000).

To validate and determine the utility of Expressed Sequence Tags-Simple Sequence

Repeat (EST-SSR) markers, Festuca arundinacea, Festuca arundinacea var. glaucescens,

Festuca pratensis, Lolium perenne, Oryza sativa, and Triticum aestivum were genotyped with eighty markers (Saha et al, 2004). Using these markers, Festuca pratensis and Lolium perenne clustered together, and Festuca arundinacea and Festuca arundinacea var. glaucescens grouped together. Fesuca and Lolium were closer to Triticum than to Orzya

(Saha et al., 2004).

Simple Sequence Repeat (SSR) markers were used to determine the composition of Festulolium cultivars (hybrids of Festuca and Lolium parents), these were genotyped

along with Lolium perenne, Lolium multiflorum, Festuca pratensis, and Festuca arundinacea (Momotaz et al, 2004). A UPGMA dendrogram grouped Lolium perenne and the Festuca species in one group while Lolium multiflorum was in another group alone.

This disagrees with other phylogenies that find Lolium to be monophyletic (Charmet et al,

1997; Gaut et al, 2000; Catalan et al, 2004; Inda et al 2008; Hand et al, 2012).

A series of papers were published using ITS sequence and the plastid trnL-F and trnT-L sequences to understand the phylogeny of Festuca and closely related genera

(Torrecilla and Catalán, 2002; Catalán et al., 2004; Inda et al., 2008). There are some notable differences between the nuclear ITS dendrogram, which presents both genotyped entries of tetraploid Festuca arundinacea with the Mediterranean species and subspecies, while the trnL-F sequence showed one of the tetraploids clustered close to the continental hexaploid tall fescue, while the other tetraploid was closer to Festuca mairei (Catalán et al., 2004). This work confirmed that there is a split between the fine-leaved fescues and the broad-leaved fescues, diverging approximately 10.5 MYA. Subgenus Schedonorus, which includes both the continental and Mediterranean fescues, as well as Lolium, diverged from this group approximately 6 MYA. The European clade radiated separately from the

Mediterranean clade around 3.5 MYA, with the Mediterranean clade radiating approximately 2.9 MYA. Lolium diverged from the broad-leaved Festuca approximately

2.1 MYA (Torrecilla and Catalán, 2002; Catalán et al., 2004; Inda et al., 2008).

Using whole plastome sequences, a phylogeny of Festuca and Lolium was generated (Hand et al., 2013). Lolium was found to be monophyletic, which Festuca

(including both broad-leaved and fine-leaved species) was found to be paraphyletic, with

F. pratensis the most closely related to Lolium, followed by F. arundinacea, F. altimissima, and F. ovina (Hand et al., 2013).

Using genome size data and the number of 5S rDNA and 35S rDNA copies in a genome, a new hypothesis was developed regarding the relationships between the

Mediterranean Festuca species (Ezquerro-López et al, 2017). Festuca mairei and Festuca arundinacea var. glaucescens were found to be closely related, aligning with earlier work that suggested they may share a genome (Catalan et al, 2004; Inda et al, 2008; Ezquerro-

López et al, 2017). This work also suggests that all morphotypes of tall fescue were the result of a crosses between Festuca arundinacea var. glaucescens and Festuca pratensis, however, they are not the result of the same hybridization event (Ezquerro-López et al,

2017).

To validate the utility of sequence related amplified polymorphism (SRAP) in

Festuca and Lolium, 169 accessions across 40 taxa were genotyped (Cheng et al., 2016).

This marker system found the expected split between fine-leaved fescues and broad-leaved fescues, with Vulpia being closely related to the fine-leaved fescues and Lolium being closely related to the broad-leaved fescues. These markers did not find a clear separation between Continental and Mediterranean tall fescue subspecies and relatives (Cheng et al,

2016).

It has been shown consistently that Festuca can be divided into two distinct groups, the broad-leaved fescues and the fine-leaved fescues (Charmet et al, 1997; Gaut et al, 2000;

Torrecilla and Catalán, 2002; Catalán et al., 2004; Inda et al., 2008; Cheng et al, 2016).

Molecular data has shown that these groups have been separated for many millions of years

(Torrecilla and Catalán, 2002; Catalán et al., 2004; Inda et al., 2008). Other genera have diverged from both the fine-leaved fescues (such as Dactyalis and Vulpia) and the broad- leaved fescues (such as Lolium) (Charmet et al, 1997; Torrecilla and Catalán, 2002; Catalán et al., 2004; Inda et al., 2008; Cheng et al, 2016). Meadow fescue, Festuca pratensis, has been found to cluster with Lolium as opposed to Festuca (Xu and Sleper, 1994; Stammers et al, 1995). Tetraploid tall fescue, Festuca arundinacea var. glaucescens, is closely related to Mediterranean fescues, than other Continental Festuca species are (Xu and Sleper, 1994;

Stammers et al, 1995; Charmet et al, 1997; Catalán et al, 2004).

There have been multiple changes made to subgenus Schedonorus and tall fescue in particular. Because of this the USDA Natural Resource Conservation Service lists a total of 8 scientific names in 3 genera for the species. Among the more common is Festuca arundinacea Schreb. This is reflected by the classification system used by Clayton and

Renvoize (1986). Based on the natural ability of subgenus Schedonorus and genus Lolium, the relatedness based on molecular markers, and morphological similarity if inflorescence is ignored, Schedonorus was aligned with Lolium as opposed to Festuca, this is also supported since there is little ability to hybridize with the fine-leaved fescues (Darbyshire,

1993). However, it was felt there was not enough difference between Schedonorus and

Lolium to elevate Schedonorus to the status of genus. Additionally, a suggestion was made that subgenus Montanae and section Scariosa could be subject to realignment in the future.

Of the species that were realigned were tall fescue, here known as Lolium arundinaceum, and meadow fescue, here known as Lolium pratense (Darbyshire, 1993).

A few years later an additional proposal was made, elevating Schedonorus to a genus. In this situation, tall fescue is Schedonorus arundinaceus and meadow fescue is

Schedonorus pratensis (Soreng and Terrell, 1997). This is the preferred nomenclature of the USDA. However, it is doubtful that this will be the last re-classification of tall fescue.

There has been discussion based on molecular evidence that the Mediterranean morphotype is based on a separate hybridization event than the continental (and with it the rhizomatous morphotype), suggesting that there are 2 separate species currently classified as hexaploid tall fescue (Hand et al, 2012b; Dierking, et al 2015). Festuca arundinacea was used here in part because of consistency with other recent phylogenetic work on tall fescue.

Tall Fescue Center of Origin and Within Species Diversity

Because tall fescue has been used widely for many years around the world, the diversity and relatedness within the species and closely related species and genera have been well-researched. Based on distribution, it has been suggested that Southern France and Spain is the center of origin for the species (Borrill et al, 1971; Hand et al, 2012b).

This wide useage has led to a robust understanding of tall fescue through use of cytology and molecular marker techniques.

Both hexaploid continental Festuca arundinacea and diploid Festuca pratensis can be found throughout Europe (Borrill et al, 1971; Borrill et al, 1976). In the western part of the Iberian Peninsula, rhizomatous hexaploid tall fescue occurs (Borrill et al, 1971).

Tetraploid Festuca arundinacea var. glaucescens can be found in the French Alps, western

Pyrenees, and western Cantabrian Mountains in Spain (Borrill et al, 1971). In Morocco,

diploid Festuca scariosa, tetraploid Festuca mairei, octoploid Festuca arundinacea ssp. atlantigena, and decaploid Festuca arudinacea ssp. letourneuxiana were found (Borrill et al., 1971).

In 1966 and 1967, a series of papers were published on Festuca and Lolium to help determine the evolutionary relationships between the different species and levels of ploidy

(Malik and Thomas, 1966a). Karyotypes from twenty-four species from Festuca and

Lolium were analyzed and compared, including diploid Lolium multiflorum, diploid Lolium perenne, diploid Festuca pratensis, tetraploid Festuca arundinacea var. glaucescens, hexaploid Festuca arundinacea, octoploid Festuca arundiancea var. letourneuxiana, and

Festuca mairei (Malik and Thomas, 1966a). Based on chromosome morphologies it was concluded that F. arundinacea var. glaucescens is not the result of doubling of F. pratensis, it is suggested that either or both F. arundinacea var. glaucescens and F. pratensis are involved in the evolution of continental F. arundinacea, and F. arundinacea var. glaucescens and F. mairei may have a genome in common (Malik and Thomas, 1966a). It was later confirmed that F. pratensis and F. arundinacaea var. glaucenscens are the ancestral progenitors of the hexaploid continental tall fescue by genomic in situ hybridization (Humphreys et al., 1995).

After finding a wide variety of chromosome morphologies in hexaploid tall fescue

(Malik and Thomas, 1966a), a series of crosses were made between S. 170, a cultivar used in the United Kingdom, and a wide range of tall fescue genotypes from different locations

(Malik and Thomas, 1966b). The progeny of crosses between S.170 and Algerian and

Tunisian tall fescue produced sterile progeny, while those crosses with Spanish,

Portuguese, Moroccan, or Israeli tall fescue produced fertile progeny. Based on this it was concluded there is a significant biological difference between tall fescue from Algerian and

Tunisia, and those from Europe and Asia (Malik and Thomas, 1966b).

Similar to previous work, crosses between European, American, and Tunisian tall fescue individuals were made to determine the ability to produce fertile progeny between diverse types (Hunt and Sleper, 1982). With the exception of one cross between an

American and Tunisian type, all progeny had the expected 42 chromosomes. There were extreme meiotic irregularities in the European x Tunisian and American x Tunisian hybrids. Germination rates of progeny of closely related individuals ranged from 35.9% to

93.6% while the germination rate of crosses of more divergent individuals ranged from

1.5% to 20.3%, suggesting that Continental types (here separated into European and

American populations) and Mediterranean types are distantly related, agreeing with Malik and Thomas, 1966b (Hunt and Sleper, 1982).

Seed proteins size and presence have been considered as a marker for cultivar identity (Abernathy et al, 1989; Krishnan and Sleper, 1997). There was not enough polymorphism found among the seed protein to be useful to investigate the diversity of tall fescue cultivars or be used to identify tall fescue cultivars (Abernathy et al, 1989; Krishnan and Sleper, 1997). An early DNA marker based diversity study of tall fescue germplasm was based on random fragment-length polymorphism (RFLP) genotypes of 20 cultivars (9 turf-type and 11 forage-type), each represented by 20 different plants, each genotyped individually (Xu et al, 1994). A dendrogram of these cultivars showed no clear subgroups,

but those that shared germplasm sources group closer together. Within cultivars, there was a high level of diversity between the individuals (Xu et al, 1994).

RFLP markers were used to genotype twelve varieties for the purpose of identification. Each variety was represented by two bulk samples of 100 plants (Busti et al., 2004). The two bulks of the same cultivar were identical. The RFLP markers were able to discriminate between the twelve cultivars. A dendrogram showed no clear sub-groups and no clustering based on pedigree, however, this may have been due to the bulking, which could have diluted minor alleles (Busti et al., 2004).

Tall fescue germplasm was studied using amplified fragment-length polymorphism

(AFLP) markers to understand the diversity available for breeding and molecular mapping

(Mian et al, 2002). Two experiments were performed, the first using individuals, the second using populations, similar to Xu et al (1994). The experiment based on individuals generally agreed with place of origin for the samples and found that the largest genetic distance occurred between continental types and Mediterranean types. Population based analysis was able to discriminate between the 18 populations and in a UPGMA dendrogram, the populations clustered by place of origin (Mian et al, 2002).

To understand the Festuca genus, the internal transcribed spacer (ITS) region and matK regions of many Festuca species were sequenced and compared, including representatives of each morphotype of hexaploid tall fescue (Hand et al, 2010). Based on these sequences, the Mediterranean individuals are genetically distinct from the

Continental and rhizomatous types, which are closely related to each other (Hand et al,

2010). Additionally, the data suggest that the Mediterranean hexaploid has a different polyploid origin from the Continental hexaploid. Festuca pratensis was confirmed as the paternal progenitor of the Continental hexploid and Festuca arundinacea var. glaucescens was confirmed as the maternal progenitor of the Continental hexaploid (Hand et al, 2010).

It was also found that Festuca mairei and Festuca arundinacea var. glaucescens are closely related based on nuclear gene sequence but distantly related based on chloroplast gene sequence (Hand et al, 2010).

A Diversity Arrays Technology (DArT) array was developed for broad-leaved

Festuca and Lolium (Kopecky et al, 2009). One of the experiments used to determine utility of the array was investigating the diversity and relatedness of forty genotypes of each five species, F. arundinacea, F. arundinacea var. glaucescens, F. pratensis, L. perenne, and L. multiflorum. Using these markers, the ryegrasses clustered by species separately from the fescues into two major groups, within the fescues, F. arundinacea and F. arundinacea var. glaucescens grouped together with F. pratensis sister to the other two. Within the species, samples were most related to other samples from the same country and cultivars from the same country showed little polymorphism (Kopecky et al, 2009). Overall, the ryegrasses were more diverse than the fescues (Kopecky et al, 2009).

The USDA-ARS collection of tall fescue (figure 1) (excluding those accessions from outside the natural range of tall fescue) was classified into three morphotypes

(continental, Mediterranean, or rhizomatous) based on matK and ITS sequence, with further genotyping with SSRs (Hand et al, 2012b). The continental morphotype was found in Europe and Asia, the Mediterranean morphotype was found in North Africa, the

rhizomatous type was exclusively found in Spain and Portugal (Hand et al, 2012b). A dendrogram grouped all continental tall fescue together separate from all Mediterranean tall fescue (Hand et al, 2012b). This grouping was supported by SSR genotyping of 133

USDA accessions and 28 populations from Argentina (Cuyeu et al, 2013). Analysis of

Molecular Variance (AMOVA) was performed on a subject of 22 populations and found that 71% of the variation was within populations and 29% was among populations (Cuyeu et al, 2013). Genotyping ninety-three turf-type cultivars of tall fescue by DArT markers found limited diversity between cultivars (Baird et al, 2012).

A set of single-nucleotide polymorphism (SNP) markers were developed for the three tall fescue morphotypes (Hand et al, 2012a). The SNPs were developed from twelve genotypes of tall fescue with representatives of each morphotype, six continental, five

Mediterranean, and one rhizomatous. Using Applied Biosystems SNaPshot chemistry system, a capillary electrophoresis based method, 64 SNPs were identified and validated by genotyping 48 accessions of tall fescue. The dendrogram based on the SNP markers showed a large separation between continental and rhizomatous from Mediterranean types, and a smaller separation between continental and rhizomatous types. This was the same divisions that was found using the SSR allele data from Hand et al (2012b), however there was less resolution using the SNP markers, most likely due to the lower number of markers used (Hand et al, 2012a).

To understand the patterns of diversity twenty-one tall fescue cultivar bulks were genotyped with fifteen SSR markers (Fu et al, 2016). A neighbor-joining tree based on the

SSR data generally agreed with known breeding history. STRUCTURE analysis of SSR

data found 3 populations, which was consistent with the neighbor joining tree, several cultivars showed a high level of admixture (Fu et al, 2016).

From these years of work, it is currently understood that continental Festuca arundinacea is the result of a hybridization between the diploid Festuca pratensis and the tetraploid Festuca arundinacea var. glaucescens (Malik and Thomas, 1966b; Humphreys et al., 1995). It is possible that tetraploid Festuca arundinacea var. glaucescens and tetraploid Festuca mairei share a genome (Malik and Thomas, 1966a). There are two different hexaploid species of Festuca arundinacea, one which includes both the continental and rhizomatous types, which is found in Europe and Asia, and the other

Mediterranean type found in North Africa (Borrill et al, 1971; Hand et al., 2010; Hand et al., 2012b). While there is high diversity within cultivars (Xu et al., 1994; Fu et al., 2016), it can be difficult to discriminate between cultivars or generate a meaningful dendrogram of elite cultivars (Busti et al., 2004; Baird et al., 2012).

Use and Development of Nuclear Microsatellite (nuSSR) Markers in Other Species

To generate microsatellite markers, also called simple sequence repeat (SSR) marker or simple tandem repeat (STR) markers, some form of nucleotide sequence data must be screened for the repeats. This type of marker has been very common and developed for many species. In the past 20 years, there have many improvements in the generation of sequence data, with these advances have been improvements in how SSRs have been developed.

Microsatellites were first detected in plants in 5 different tropical tree species from

4 families with Zea mays and Mirounga angustirostris (northern elephant seal) used for comparison. DNA libraries were generated and probed for (GT)10C6 and (AG)8. Poly-AC and poly-AG both appeared more than 1000 times in the plant genome. There were between

104 and 105 of these sites. AG was found to be 20-40% more abundant than AC expect in

Malmea where AG was 6 times more common than AC. This work showed that microsatellite repeat markers are abundant in plant genomes (Condit and Hubbell, 1991).

To determine if molecular markers could be generated from microsatellites in plants, DNA sequences in GenBank and EMBL were screened for di-nucleotide repeats with ten or more repeat units and trinucleotides with seven or more repeat units (Morgante and Olivieri, 1993). Seventy dinucleotide repeats were found in twenty-six species (twenty dicots from thirteen families and six monocots from four families) and forty-six trinucleotide repeats were found in twenty-three species (eighteen dicots from nine families and five monocots from two families). They found microsatellites have potential to be used as molecular markers in plants, also based on this data approximately one microsatellite was found every fifty kilobases, however, this could be an underestimate because most of the sequences were from cDNA, not from intergenic space (Morgante and Olivieri, 1993).

Microsatellites have been used to genotype many plant species and genera to investigate and understand the diversity and relationships present in germplasm collections, available cultivars, and experimental selections. In this section, particular focus will be given to species in Poaceae (the grass family) and other polyploid species.

To understand the efficacy of using SSRs and to understand the diversity present in perennial ryegrass cultivars (Lolium perenne L.) 30 SSRs were used to study 7 cultivars, each cultivar being represented by 30 individuals. This was done because ryegrass is propagated as a population, not as individual genotypes. The cultivars were selected to represent a broad germplasm base. AMOVA analysis found that 85.35% of variation occurred within cultivars and 14.56% of the variation occurred among the cultivars. All of the cultivars were found to be significantly different from each other. However, when a neighbor-joining tree was generated from the Fst values, it did not correlate to the breeding history of these cultivars (Kubik et al, 2001).

To build a population genetic framework and understand the diversity of rice, Oryza sativa L., 234 accessions were genotyped with 169 SSR markers. STRUCTURE analysis showed that there 5 groups of Orzya. All but 24 accessions of these were definitively assigned to one group (having a composition that is greater than 80% from one group), these 24 showed a higher level of admixture. Analysis of Molecular Variance (AMOVA) shows that 37.5% of diversity was found between groups, and 62.5% of variation is found within groups, corresponding to what is expected for an inbreeding species. A dendrogram was generated and the accessions grouped based on which subspecies they represented

(Garris et al, 2005).

Forty closely-related elite cultivars of bread wheat (Triticum aestivum L.) were genotyped using 23 microsatellite markers (Plaschke et al., 1995). These markers were able to discriminate between all but two of the cultivars that were genotyped, beyond this the cultivars grouped in a dendrogram by ploidy and then by region of origin. This work

showed the utility of microsatellites to discriminate between closely related elite cultivars

(Plaschke et al., 1995).

Avena species and oat cultivars were genotyped using SSR markers. The different species grouped by which genomes were present, AA, AABB, AACC, or AACCDD. There was lower polymorphism in the 20 cultivars genotyped than in the wild accessions. The cultivars grouped by breeding program and place of origin (Li et al, 2000).

Thirty spelt (Triticum aestivum (L.) Thell. ssp. spelta) and nine wheat (Triticum aestivum (L.) Thell. ssp. vulgare) accessions were genotyped with wheat SSRs to assess marker utility and investigate diversity (Bertin et al, 2001). In the UPGMA dendrogram, the accessions clustered by species, then geography and breeding history. The initial analysis was performed using 17 markers, the analysis was re-performed using the ten most polymorphic markers, and this analysis had similar results with a 0.91 correlation between the two distance matrices, indicating a smaller number of markers can be used for diversity research and discrimination between cultivars (Bertin et al, 2001).

Thirty-six landrace cultivars were genotyped to understand the diversity that was present in the wheat bulk seed samples that were housed at CIMMYT (Dreisigacker et al.,

2005). Cluster analysis did not show the accessions grouping based on country or continent of origin. A second set of landrace cultivars was tested, 5 Mexican landraces and 4 Turkish landraces. Based on AMOVA, 18.4% of diversity was found between groups, indicating separation between these groups (Dreisigacker et al., 2005). When using principle component analysis, the Mexican landraces were tightly grouped together while the

Turkish ones were less so, indicating that there has been little diversification of introduced wheat in Mexico (Dreisigacker et al., 2005).

In an effort to assess the level of diversity in darnel ryegrass (Lolium temulentum

L.) germplasm, researchers at the Noble Foundation genotyped 41 accessions of darnel ryegrass, as well as individuals of broad-leaved Festuca species (Kirigni et al, 2008). Thirty tall fescue EST-SSRs generated 319 fragments and 32 genomic-SSR markers generated

296 fragments. There was some clustering by country of origin for the accessions, notably for those from Ethiopia, however, otherwise similarity was not a function of country of origin (Kirigni et al, 2008). Darnel ryegrass clustered separately from the Festuca accessions (Kirigni et al, 2008).

To develop a consistent effective method of determining the genotype of polyploid species using SSRs, 54 individuals of the clonally propagating decaploid Mercurialis perennis were genotyped with 8 SSR markers (Pfeiffer et al., 2011). It was found in higher polyploid species, a smaller number of markers was needed to attain sufficient resolution, and in this case the low amount of markers was sufficient (Pfieffer et al, 2011). Two markers were all that was needed to unambiguously recognize clones (Pfieffer et al, 2011).

Eighty-eight accessions of timothy (Phleum pratense L.), a hexaploid out-crossing cool-season grass, were genotyped using 13 SSR markers (Tarhuanpää and Manninen,

2012). AMOVA analysis found that 94% of the variation was within accession, 5% to between accessions, and 1% between countries. When a dendrogram was generated, no clear clustering was found based country or breeding history, suggesting that while there

is a large amount of diversity within timothy, it is not viable to discriminate between accessions (Tarhuanpää and Manninen, 2012). It was suggested this inability to discriminate between entries could be due to the outcrossing and polyploid nature of the species and the differences between accessions are masked because they may be allele frequency differences, not allele presence or absence differences (Tarhuanpää and

Manninen, 2012).

Twenty-five microsatellite markers were used to investigate the diversity of 247 accessions of Kentucky bluegrass (Poa pratensis L.) (Honig et al, 2012). The UPGMA dendrogram corresponded to the known breeding history of the cultivars. STRUCTURE analysis found 14 groups. Using the UPGMA dendrogram, the STRUCTURE analysis, and previous morphology-based classification, 15 groups were used for AMOVA analysis, this found that 52% of the variation was within groups and 48% of the variation was between groups (Honig et al, 2012).

To further understand the diversity and population structure of Poa pratensis, 11 nuSSR markers (based on Poa pratensis, Poa alpine, and Poa arachnifera), along with 2 cpSSR markers and a CAPS marker based on the trnL-F region of the chloroplast were used to genotype 33 cultivated and wild accessions from 23 countries representing 4 continents (Reggi et al, 2015). Bayesian analysis of the nuSSRs in STRUCTURE found 2 groups using both ΔK and H’ methods. The bootstrap values of the nuSSR neighbor-joining tree showed no clear distinction between populations and a large reduction in the number of chloroplast alleles between the wild populations and the cultivated populations was

found. Most of the cultivated varieties belong to the same genetic group according to

STRUCTURE (Reggi et al, 2015).

Sixty-two genotypes of Zoysia analyzed with 50 SSR markers generated from enriched genomics libraries (Kimball et al, 2013). Five species of Zoysia were included as well as Zoysia japonica x Zoysia matrella hybrids. Three hundred and seventy-seven alleles were found (Kimball et al, 2013). A UPGMA tree based on DICE values was generated, however, there was no clear separation of the cultivars as evidenced by low bootstrap values. STRUCTURE found 3 groups when the genotypes were analyzed. These groups corresponded to species, with hybrid genotypes showing a high level of admixture.

AMOVA found that 78% of the variation was found within species and 22% was based on among species variation, when the hybrids were removed from the analysis, 32% of the variation was found to be among species variation (Kimball et al, 2013).

Microsatellites have been used to study the diversity and relatedness of bermudagrass (Cynodon spp.) cutlivars and accessions. The first study included triploid hybrids of C. dactylon and C. transvaalensis, as well as cultivars from mutation breeding

(Wang et al, 2010). Of the 32 genotypes tested, they were able to identify 22 genotypes, however, members of the mutation families were not able to be discriminated from other members of the same mutation family, which is not surprising since the mutation would have to occur in the microsatellites being genotyped. Overall, the cultivars tended to cluster by what breeding program developed the cultivar (Wang et al, 2010). To understand the diversity within a global collection of 33 wild Chinese accessions and 22 cultivars of C. dactylon from 4 countries on 3 continents were genotyped using SSR markers (Wang et al,

2013). The highest diversity was found in the Chinese accessions as opposed to the cultivars from other nations. The cultivars and accessions clustered by place of origin

(Wang et al, 2013).

Seventy-four cultivars or accessions of Agrostis species were genotyped using 23 nuclear SSR markers. AMOVA analysis found that 69% of the variation was found within populations and 31% was found between populations. The PhiPT scores were significant for all but one pairwise comparison of populations, suggesting that all populations were distinguishable for each other. In the UPGMA dendrogram, the species clearly separated from each other and the outgroup genera clustered where would be expected, the dendrogram followed breeding history of the cultivars. STRUCTURE analysis found 19 groups within the Agrostis populations investigated. This also found a high level of admixture in the improved cultivars (Honig et al, 2015).

It has become common practice to use microsatellite markers to understand the diversity present in elite cultivars, germplasm collections, and wild material. These markers are able to detect population structure, usually find that cultivars cluster by breeding history (which can be interpreted as breeding program if that program uses a limited set of germplasm), and plants of the same species or subspecies will cluster by place of origin.

Use of Chloroplast Microsatellites (cpSSR) Markers for Diversity Research

In addition to being common in the nuclear genome, microsatellites are known to also occur in the chloroplast genome (Wheeler et al., 2014). An individual only has one chloroplast genome, as opposed to the multiple nuclear genomes that an individual has, leading to a single allele for each loci in each individual. However, generally, there are fewer polymorphic loci, with each loci having fewer alleles, leading to less diversity identified than is found by nuclear SSRs. These are developed in the same way as nuclear

SSR markers, searching DNA sequences for short repeat regions (Wheeler et al., 2014).

Mononucleotide repeats are more common than dinucleotide repeats or trinucleotide repeats (Powell et al, 1995a). Additionally, because they are usually uniparentally inherited, they can produce a different phylogeny than nuclear SSRs, potentially representing reflecting the parentage in polyploid species or a chloroplast introgression event (Wheeler et al., 2014).

The earliest use of chloroplast microsatellites was in Pinus. While angiosperms inherit the chloroplast from the mother plant, gymnosperms inherit the chloroplast from the pollen parent. One primer pair was developed and tested, amplifying one mononucleotide repeat (Powell et al, 1995a). The diversity of 305 individuals of Pinus leucodermis from 7 populations from Greece and Italy. In total, 8 size variants were found for the SSR, this was confirmed by sequencing the PCR product to ensure that the size difference was due to a change in the number of repeats, not changes in the flanking region

(Powell et al, 1995a). Twenty-two percent of the diversity found was between populations of which 19% was between Greek and Italian populations, this work suggests that

chloroplast SSRs can be used to study the diversity of a species, even with a limited amount of markers (Powell et al, 1995a).

One-hundred and forty-nine accessions of soybean (Glycine) from 13 species were genotyped with one compound chloroplast SSR marker and one simple chloroplast SSR marker. (Powell et al, 1995b). From this, 10 variants were found, a high level of intraspecific diversity for a single chloroplast marker. Between 2 and 18 haplotypes were found for each species tested. The variants were distributed non-randomly when compared to geography. The dominant haplotype was found in 93 of the 149 individuals tested, 4 different haplotypes were found in samples from Northeast Asia, with 2 being private to that area. This high level of diversity suggests that this area is the center of origin for this species. 63% of the diversity that was found based on geography (Powell et al, 1995b).

The first chloroplast SSR markers used in a grass species was in rice (Oryza sativa

L.). The markers were tested on twenty rice accessions (Orzya species) that had been used in previous diversity studies in rice (Provan et al, 1996). Twelve mononucleotide repeat markers were generated from the complete chloroplast sequence of rice. Six of the twelve microsatellites were found to be polymorphic, generated between two and five alleles. Two loci were polymorphic in the japonica subspecies and four were polymorphic in the indica subspecies. Within these 20 accessions, 15 haplotypes were found. Five markers were used to investigate the diversity of 47 accessions representing the different subspecies of Orzya sativa. The variation in chloroplast SSRs correlated with subspecies variation. This work suggests chloroplast SSRs could be useful to study intraspecific diversity (Provan et al,

1996).

These markers were later used to investigate the between species diversity in genus

Oryza. Forty-two accessions from sixteen species were genotyped using the twelve cpSSRs from Provan et al. (1996), with seven loci showing polymorphism (Provan et al, 1997). A higher level of diversity was found in wild species than in cultivated ones. This work showed that cpSSRs can be effectively used to understand the relatedness between species and that cpSSRs can be used in interspecific diversity studies (Provan et al, 1997).

Thirty-seven maize and teosinte accessions were genotyped using 39 cpSSR markers (Provan et al, 1999). Almost all loci were found to conform to a stepwise mutation model. Fifteen loci were found to be polymorphic, generating between 2 and 9 alleles per locus with an average of 4.133 alleles per loci. Thirty-two haplotypes were found. Nine of the fifteen loci were specific to one of the two sections of mays. AMOVA found that 70% of the variation in the genus was found between sections (Provan et al, 1999). Phylogenetic analysis found that there were four clades, including a large split between section luxuriantes and section mays. Within section mays there were two groups of subspecies mays, separated by a group comprised of teosinte subspecies (Provan et al, 1999).

To understand the relatedness between wheat and its ancestral species, cpSSRs were used. Forty-three accessions from 10 species and 2 genera (Aegilops and Triticum) were genotyped using 24 markers (Ishii et al, 2001). Twenty-one of these were found to be polymorphic, generating between 2 and 7 alleles with an average of 4.33. Within these 43 accessions, a total of 24 haplotypes were found. Using a dendrogram, it was not possible to separate all the species from each other, limiting the utility of cpSSRs for Aegilops and

Triticum for the investigating diversity (Ishii et al, 2001).

To investigate the origins of Sorghum in China, 185 Chinese accessions of Sorghum and 70 accessions for the rest of the world were genotyped using 27 primer pairs that were designed from the published sequence of the sorghum chloroplast (Li et al, 2010). In all,

12 haplotypes were found, 1 of these was present in 197 accessions tested, 5 of these were private haplotypes, occurring in only 1 accession. The African accessions had the highest diversity, which would be expected as that is the center of origin, and China had the lowest, indicating a bottleneck and a recent introduction to China (Li et al, 2010).

In addition to using nuSSRs, Honig et al. (2016) used cpSSRs to investigate the diversity of bentgrass (Agrostis) cultivars and accessions. This method was not able to discriminate between close relatives as the nuSSRs were able to. The UPGMA tree had some notable differences from the UPGMA tree based on nuSSRs, particularly the nesting of Agrostis canina L. within Agrostis stolonifera L. It was suggested that chloroplast introgression may have occurred in the genus, leading to this difference in the place of species on the tree. This work showed that cpSSRs are useful for discriminating between closely related species, but do not have utility (at least in Agrostis) for determining intraspecific relationships, particularly among closely related cultivars (Honig et al, 2016).

Homoplasy has been a concern when using cpSSRs. Homoplasy occurs when a trait, here allele size variants, are the same but not do to a shared evolutionary history. This was first noted in Gylcine chloroplast microsatellites by comparing the results of Powell et al. (1995b) to previously generated haplotypes based on RFLPs (Doyle et al, 1998). They detected homoplasy in that dataset by comparing the results of the cpSSR with those of

RFLP markers that had been published earlier. The RFLP markers were used to generate a

phylogenetic tree, the SSR haplotypes were compared to this dendrogram. It was found that the same SSR haplotypes were found in different clusters of the RFLP dendrogram.

Based on this, it is concluded that two markers are not sufficient to understand the diversity of a species (Doyle et al, 1998).

Attempts to understand and control for homoplasy have been developed

(Navascués and Emerson, 2005). It was found that more loci and more samples will reduce the effects of homoplasy on measures of diversity (Navascués and Emerson, 2005). It was also found that if genetic diversity is found to be high, measures of homoplasy also tend to be high (Navascués and Emerson, 2005). These factors lead to the suggestion that investigating phylogeny with cpSSRs may not be advisable (Navascués and Emerson,

2005).

Homoplasy was found when using conserved chloroplast markers in Cucurbita pepo L. 5 wild accessions were genotyped using 23 cpSSR markers (Bang and Chung,

2015). All but 1 marker was found to be monomorphic (Bang and Chung, 2015). The PCR products from this marker were sequenced and the marker was found to be a compound

SSR with a T repeat and an A repeat (Bang and Chung, 2015). The suggestion based on this work is that compound microsatellites should be treated as multiple different characters instead of one, because that one band could mask multiple polymorphisms (Bang and

Chung, 2015).

Tall Fescue Genomic Resources and Other Applications

Because of tall fescue's widespread use around the globe, there has been consistent development of tools that can be used for genomic work, as well as using these tools to investigate the biology and diversity of tall fescue, usually with the goal of advancing tall fescue breeding.

Since 1994, three genetic linkage maps of tall fescue have been produced. The first of these was based on RFLP markers (Xu et al, 1995). A cross was made between two genetically distant individuals. Of the markers that were tested 70% were found to be polymorphic, with 73% of those markers showing Mendelian inheritance. Of the 108 markers that were analyzed, 95 were mapped, with a total map size of 1274 cM (Xu et al,

1995). The skewed markers showed no bias towards the male or female parents’ genome.

The RFLP markers were able to detect homeologous loci, those that share an evolutionary history but occur in different tall fescue genomes. Tall fescue was shown to have disomic inheritance (Xu et al, 1995).

Two sets of microsatellite markers were developed for tall fescue. The first set, composed of 157 primer pairs, was developed from expressed-sequence tags (ESTs) (Saha et al, 2004). Of these 145 amplified in tall fescue, 103 showed significant homology to sequences available in databases at the time, and 66% were polymorphic between parents of mapping populations in tall fescue (Saha et al, 2004). A set of 511 was developed from the genome sequence of an individual of ‘Kentucky 31’ (Saha et al, 2006). The primer pairs were tested in hexaploid tall fescue, meadow fescue, tetraploid tall fescue, perennial ryegrass, annual ryegrass, rice, and wheat. Thirty-six percent of the primer pairs amplified in all species tested. They were more polymorphic in turf species, highest in tall fescue

with 68% polymorphic in tall fescue, than in cereal species, lowest in rice (34% of primer pairs were polymorphic) (Saha et al, 2006).

The second map was made using AFLP markers and EST-SSR markers, based on a cross between two parents, one parent shared with Xu et al (1995) (Saha et al, 2005).

Seventeen integrated linkage groups were generated from 37 parental linkage groups (Saha et al, 2005). It contains 922 markers, 653 AFLP and 269 SSR markers, with a total distance of 1840.9 cM. SSR markers were used to find homeologous groups, 6 sets of homeologous groups were found, while some linkage groups could not be grouped together (Saha et al,

2005). Twenty-three percent of markers were skewed, approximately the same amount from each parent (Saha et al, 2005).

With the long-term goal of a marker-assisted selection program, a Diversity Arrays

Technologies (DArT) array was developed from broad-leaves fescues and ryegrasses. The array contains 3260 unique markers (Kopecký et al., 2009). To assess the utility of the array, grandparents of mapping populations were genotyped, this showed that there were enough markers from the array to effectively use for mapping, identified which markers were species specific, and mapped 160 markers in Festuca pratensis (Kopecký et al, 2009).

The third and most recent map was made using SSR markers and DArT markers.

Unlike the previous two maps, this map was based on the cross of a Mediterranean type and continental type (Dierking et al, 2015). A combined map was not able to be generated, instead two parental maps were published. The continental map contained 358 SSR markers and 235 DArT markers (with 97 markers unable to be mapped) across 22 linkage

groups, for a total length of 1577.3 cM. The Mediterranean map contained 93 SSR markers and 115 DArT markers (with 122 markers unable to be mapped) across 29 linkage groups.

In total, 45% of the markers skewed from Mendelian inheritance ratios. It was not possible to link all the homeologous groups in either map (Dierking, et al 2015).

A collection of single nucleotide polymorphisms (SNP) was detected from the sequencing of 13 total accessions from the 3 morphotypes of tall fescue (6 Continental accessions, 5 Mediterranean, and 1 rhizomatous) and one accession of tetraploid tall fescue

(Hand et al, 2012a). Within the continental tall fescue, 8,584 high-confidence SNPs were detected, and within the Mediterranean samples, 2,292 high-confidence SNPs were detected. They identified 3,004 sequence variants between Continental and Mediterranean tall fescue, and 1,481 variant between Continental and Rhizomatous tall fescue. 192 of these SNPs were validated by genotyping 48 accessions and determining within species relationships, these results were compared to SSR genotypes and found to be similar, suggesting these SNPs could be effective for future work (Hand el al 2012a).

While there is not yet a reference genome sequence for the nuclear genome of tall fescue, the chloroplast of tall fescue has been completely sequenced (Cahoon et al., 2010).

The total size of the genome is 136,048 base pairs. The chloroplast has the expected quadripartite structure of chloroplast genomes, the small single copy region, the large single copy region, separated by inverted repeat regions. The gene order was similar to that of other Poaceae species (Cahoon et al, 2010). Additionally, one chromosome, chromosome 4F, of Festuca pratensis has been completely sequenced (Kopecký et al

2013). Based on this sequencing, it is estimated that there are about 35,000 genes in the

Festuca genome. This sequencing can be useful for comparison work with hexaploid tall fescue, when sequencing is completed for that species (Kopecký et al 2013).

A series of studies compared and associated SSR marker data and agronomic and heat-tolerance related traits (Lou et al., 2015; Sun et al, 2015; Sun et al., 2016). 115 diverse accessions of tall fescue were genotyped using 90 SSR markers, additionally, 7 agronomic traits were measured for all accessions (Lou et al., 2015). Spurious associations were controlled for by measuring population structure, which found there were 3 subpopulations

(Lou et al., 2015). Significant variation was found for all traits. 41 alleles showed a single association with an agronomic trait (covering all seven traits) and 20 alleles were associated with multiple traits (Lou et al., 2015). 100 of these accessions were measured for heat- tolerance related traits, as well as genotyped with 102 SSR markers (Sun et al, 2015). A heat tolerance score was generated for each accession, and this was used to produce a

UPGMA tree. This tree did not correlate to geography. It was compared to a neighbor- joining tree generated from SSR data, a low-level but significant correlation was found between the two trees, this suggests that there are multiple mechanisms of heat-tolerance

(Sun et al, 2015). The same 100 accessions from Sun et al. (2015) and the 90 SSR markers from Lou et al. (2015) were used to associate SSR loci to heat-tolerance traits, a high level of diversity was found for all traits (Sun et al, 2016). The structure analysis of this found 2 sub-populations (Sun et al., 2016). 97 alleles were associated with a trait at 2 time points in green house experiments and 67 alleles were associated with traits in growth chamber trials. Some alleles were associated with multiple traits. Alleles would explain a low to moderate amount of trait variation (Sun et al, 2016).

Tall fescue has a strong base of research and many molecular techniques have been adapted to study tall fescue genomics that could someday be applied to plant breeding program. However, there is still work to be done, there is no reference genome for tall fescue, and the development of such will enable larger genomic work, such as association mapping. This future work will enable plant breeders to make improvements with full knowledge of the diversity of the germplasm that is being used, and make greater gains with each cycle of selection.

References

Abernethy, R. H., Steiner, J. J., Wofford, D. S., & Theil, D. S. (1989). Classification and pedigree verification of tall fescue cultivars utilizing the prolamin seed protein fraction. Crop Science, 29, 791-797. Bacon, C.W., Porter, J.K., Robins, J.D., Luttrell, E.S. (1977). Epichloë typhina from toxic tall fescue grasses. Applied and Environmental Microbiology, 34, 576-581. Baird, J. H., Kopecky, D., Lukaszewski, A. J., Green, R. L., Bartos, J., & Dolezel, J. (2012). Genetic diversity of turf-type tall fescue using diversity arrays technology. Crop Science, 52, 408-412. Bang, S. W., & Chung, S. (2015). One size does not fit all: The risk of using amplicon size of chloroplast SSR marker for genetic relationship studies. Plant Cell Reports, 34, 1681-1683. Barkley, N. A., Krueger, R. R., Federici, C. T., & Roose, M. L. (2009). What phylogeny and gene genealogy analyses reveal about homoplasy in citrus microsatellite alleles. Plant Systematics and Evolution, 282, 71-86. Beard, J. B.Origins of North American turfgrasses. In J. C. Stier, B. P. Horgan & S. A. Bonos (Eds.), Turfgrass: Biology, Use, and Management Madison, WI: ASA-CSSA- SSSA. Bertin, P., Grégoire, D., Massart, S., & de Froidmont, D. (2001). Genetic diversity among European cultivated spelt revealed by microsatellites. Theoretical and Applied Genetics, 102, 148-156 Bonos, S. A., Clarke, B. B., & Meyer, W. A. (2006). Breeding for disease resistance in the major cool-season turfgrasses.Annual Review of Phytopathology, 44, 213-234. Bonos, S., & Huff, D. R. (2013). Cool-season grasses: Biology and breeding. In J. C. Stier, B. P. Horgan & S. A. Bonos (Eds.), Turfgrass: Biology use and management (pp. 591- 661). Madison, WI: ASA-CSSA-SSSA. Borrill, M. (1972). Studies in Festuca III: The contribution of F. scariosa to the evolution of polyploids in sections Bovinae and Scariosae. New Phytologist, 71 Borrill, M., Tyler, B., & Lloyd-Jones, M. (1971). Studies in Festuca I: A chromosome atlas of bovinae and scariosae. Cytologia, 36 Borrill, M., Tyler, B., & Morgan, W. G. (1976). Studies in Festuca 7. Chromosome atlas (part 2) an appraisal of chromosome race distribution and ecology, including F. pratensis var. apennina (de not.) hack, - tetraploid. Cytologia, 41:219-236 Bouton, J. H., Latch, G. C. M., Hill, N. S., Hoveland, C. S., McCann, M. A., Watson, R. H., Parish, J. A., Hawkins, L.L., Thompson, F. N. (2002). Reinfection of tall fescue cultivars with non-ergot Alkaloid–Producing endophytes. Agronomy Journal, 94, 567. Busti, A., Caceres, M. E., Calderini, O., Arcioni, S., & Pupilli, F. (2004). RFLP markers for cultivar identification in tall fescue (Festuca arundinacea Schreb.). Genetic Resources and Crop Evaluation, 51, 443-448. Cahoon, A. B., Sharpe, R. M., Mysayphonh, C., Thompson, E. J., Ward, A. D., & Lin, A. (2010). The complete chloroplast genome of tall fescue (Lolium arundinaceum; Poaceae) and comparison of whole plastomes from the family Poaceae. American Journal of Botany, 97, 49-58.

Charmet, G., Ravel, C., & Balfourier, F. (1997). Phylogenetic analysis in the Festuca- Lolium complex using molecular markers and ITS rDNA. Theoretical Applied Genetics, 94, 1038-1046. Chatterjee, B. N. (1961). Analysis of ecotypic differences in tall fescue (Festuca arundinacea Schreb.). Annals of Applied Biology, 49(3), 560-562. Cheng, Y., Ma, X., Zhou, K., Humphreys, M., & Zhang, X. (2016). Phylogenetic analysis of Festuca–Lolium complex using SRAP markers. Genetic Resources and Crop Evolution, 63, 7-18. Chtourou-Ghorbel, N., Mheni, N. B., Elazreg, H., Ghariani, S., Chakroun, M., & Trifi- Farah, N. (2016). Genetic diversity in Tunisian perennial forage grasses revealed by inter-simple sequence repeats markers. Biochemical Systematics and Ecology, 66, 154-160. Clayton, W. D., & Renvoize, S. A. (1986). Genera graminum (1. publ. ed.). London: Her Majesty's Stationery Office. Condit, R., & Hubbell, S. P. (1991). Abundance and DNA sequence of two-base repeat regions in tropical tree genomes.Genome / National Research Council Canada = Génome / Conseil National De Recherches Canada, 34, 66-71. Craven, K. D., Clay, K., & Schardl, C. L. (2009). Systematics and morphology. In H. A. Fribourg, D. B. Hannaway & C. P. West (Eds.), Tall fescue for the twenty-first century (pp. 11-32) Cuyeu, R., Rosso, B., Pagano, E., Soto, G., Fox, R., & Ayub, N. D. (2013). Genetic diversity in a world germplasm collection of tall fescue. Genetics and Molecular Biology, 36, 327-242. Darbyshire, S. J. (1993). Realignment of Festuca subgenus Schedonorous with genus Lolium (Poaceae). Novon, 3, 239-243. Dierking, R., Azhaguval, P., Kallenbach, R., Saha, M. C., Bouton, J., & Chekhovskiy, K., Andrew. (2015). Linkage maps of a Mediterranean × Continental tall fescue population and their comparative analysis with other Poaceae species. The Plant Genome, 8 Doyle, J. J., Morgante, M., Tingey, S. V., & Powell, W. (1998). Size homoplasy in chloroplast microsatellites of wild perennial relatives of soybean (Glycine subgenus Glycine). Molecular Biology and Evolution, 15, 215. Dreisigacker, S., Zhang, P., Warburton, M. L., Skovmand, B., Hoisington, D., & Melchinger, A. E. (2005). Genetic diversity among and within CIMMYT wheat landrace accessions investigated with SSRs and implications for plant genetic resources management. Crop Science, 45(2), 653. Evans, G. M., Asay, K. H., & Jenkins, R. G. (1973). Meiotic irregularities in hybrids between diverse genotypes of tall fescue (festuca arundinacea, schreb.)1. Crop Science, 13(3), 376. Ezquerro-Lopez, D., Kopecky, D., & Inda, L. A. (2017). Cytogenetic relationships within the Maghrebian clade of Festuca subgen. Schedonourus (Poaceae), using flow cytometry and FISH. Anales Del Jardin Botanico De Madrid, 74 Fermanian, T. W., Haley, J. E., Wessels, K., Wilkinson, H. T., & Han, S. (1996). Characterization of tall fescue and perennial ryegrass cultivars. Journal of Turfgrass Management, 1, 63-79.

Fu, K., Guo, Z., Zhang, X., Fan, Y., Wu, W., Li, D., Peng, Y., Huang, L., Sun, M., Ma, X. (2016). Insight into the genetic variability analysis and cultivar identification of tall fescue by using SSR markers. Hereditas, 153. Funk, C. R., Engel, R. E., Dickson, W. K., & Hurley, R. H. (1981). Registration of rebel tall fescue. Crop Science, 21, 632. Garris, A. J., Tai, T. H., Coburn, J., Kresovich, S., & McCouch, S. (2005). Genetic structure and diversity in oryza sativa L.Genetics, 169(3), 1631-1638. Gaut, B. S., Tredway, L. P., Kubik, C., Gaut, R. L., & Meyer, W. A. (2000). Phylogenetic relationships and genetic diversity among members of the Festuca-Lolium complex (Poaceae) based on ITS sequence data. Plant Systematics and Evolution, 224, 33-53. Giesler, L. J., Yuen, G. Y., & Horst, G. L. (1996). Tall fescue canopy density effects on brown patch disease. Plant Disease, 80(4), 384. Hand, M. L., Cogan, N. O. I., & Forster, J. W. (2012a). Genome-wide SNP identification in multiple morphotypes of allohexaploid tall fescue (Festuca arundinacea schreb). BMC Genomics, 13(1), 219. Hand, M. L., Cogan, N. O. l., & Forster, J. W. (2012b). Molecular characterization and interpretation of genetic diversity within globally distributed germplasm collection of tall fescue (Festuca arundinacea Schreb.) and meadow feascue (F. pratensis Huds.). Theoretical Applied Genetics, 124, 1127-1137. Hand, M. L., Cogan, N. O. l., Stewart, A. V., & Forster, J. W. (2010). Evolutionary history of tall fescue morphotypes inferred from molecular phylogenetics of the Lolium- Festuca species complex. BMC Evolutionary Biology, 10, 303. Hand, M. L., Spangenberg, G. C., Forster, J. W., & Cogan, N. O. l. (2013). Plastome sequence determination and comparative analysis for members of the Lolium- Festuca Grass species complex. G3: Genes|Genomes|Genetics, 3, 607-616. doi:10.1534/g3.112.005264 Honig, J. A., Averello, V., Bonos, S. A., & Meyer, W. A. (2012). Classification of Kentucky bluegrass (Poa pratensis L.) cultivars and accessions based on microsatellite markers (simple sequence repeat) markers. HortScience, 47, 1356- 1366. Honig, J. A., Kubik, C., Averello, V., Vaiciunas, J., Meyer, W. A., & Bonos, S. A. (2015). Classification of bentgrass (Agrostis) cultivars and accessions based on microsatellite (SSR) markers. Genetic Resources and Crop Evaluation, doi:10.1007/s10722-015- 0307-6 Hoveland, C. S. (2009). Origin and history. In H. A. Fribourg, D. B. Hannaway & C. P. West (Eds.), Tall fescue for the twenty-first century (pp. 3-10). Madison, WI: American Society of Agronomy, Inc, Crop Science Society of America, Inc, Soil Science Society of America, Inc. Humphreys, M. W., Thomas, H. M., Morgan, W. G., Meredith, M. R., Harper, J. A., Thomas, H., Zwierzkyowski, Z., Ghesquiere, M. (1995). Discriminating the ancestral progenitors of hexaploid Festuca arundinacea using genomic in situ hybridization. Heredity, 75, 171-174. Hunt, K. L., & Sleper, D. A. (1981). Fertility of hybrids between two geographic races of tall fescue. Crop Science, 21, 400-404. Inda, L. A., Sanmartín, I., Buerki, S., & Catalán, P. (2014). Mediterranean origin and Miocene–Holocene old world diversification of meadow fescues and ryegrasses

(Festuca subgenus Schedonorus and Lolium). Journal of Biogeography, 41(3), 600- 614. Inda, L. A., Segarra-Moragues, J. G., Muller, J., Peterson, P. M., & Catalan, P. (2008). Dated historical biogeography of the temperate Loliinae (Poaceae, Pooideae) grasses in the northern and southern hemispheres. Molecular Phylogenetics and Evolution, 46, 932-957. Ishii, T., Mori, N., & Ogihara, Y. (2001). Evaluation of allelic diversity at chloroplast microsatellite loci among common wheat and its ancestral species. Theoretical and Applied Genetics, 103, 896-904 Jiang, Y., & Huang, B. (2002). Protein alterations in tall fescue in response to drought stress and abscisic acid. Crop Science, 42(1), 202. Kimball, J. A., Zuleta, M. C., Kenworthy, K. E., Lehman, V. G., Harris-Shultz, K. R., & Milla-Lewis, S. (2013). Genetic relationships in zoysia species and the identification of putative interspecific hybrids using simple sequence repeat markers and inflorescence traits. Crop Science, 53, 285. Kopeckỳ, D., Bartoš, J., Lukaszewski, A. J., Baird, J. H., Cernoch, V., Kolliker, R., Rognli, O.A., Blois, H., Caig, V., Lüdderstedt, T., Studer, B., Dolezel, J. & Kilian, A. (2009). Development and mapping of DArT markers within the Festuca- Lolium complex. BMC Genomics, 10, 473. Kopeckỳ, D., Bartos, J., Zwierzykowski, Z., & Dolezel, J. (2009). Chromosome pairing of individual genomes in tall fescue (Festuca arundinacea Schreb.), its progenitors, and hybrids with Italian ryegrass (Lolium multiflorum Lam.). Cytogenetics and Genome Research, 124, 170-178. Kopecký, D., Martis, M., Číhalíková, M., Hřibová, M., Vrána, J., Bartoš, J., Kopecka, J., Cattonaro, F., Stoces, S., Novak, P., Neumann, P., Macas, J., Simkova, H., Studer, B., Asp T., Baird, J.H., Navratil, P., Karafiatova, M., Kubalakova, M., Safar, J., Mayer, K., Doležel, J. (2013). Flow sorting and sequencing meadow fescue chromosome 4F. Plant Physiology, 163, 1323-1337. Krishnan, H. B., & Sleper, D. A. (1997). Identification of tall fescue cultivars by sodium dodecyl sulfate polyacrylamide gel electrophoresis of seed proteins. Crop Science, 37, 215-219. Kubik, C., Sawkins, M., Meyer, W. A., & Gaut, B. S. (2001). Genetic diversity in seven perennial ryegrass (L.) cultivars based on SSR markers. Crop Science, 41, 1565. Porter, H. L. (1958). Rhizomes in tall fescue. Agronomy Journal, 50, 493-494. Powell, W., Morgante, M., Andre, C., McNicol, J. W., Machray, G. C., Doyle, J. J., Tingey, S.V. Rafalski, J. A. (1995). Hypervariable microsatellites provide a general source of polymorphic DNA markers for the chloroplast genome. Current Biology, 5(9), 1023- 1029. Powell, W., Morgante, M., McDevitt, R., Vendramin, G. G., & Rafalski, J. A. (1995). Polymorphic simple sequence repeat regions in chloroplast genomes: Applications to the population genetics of pines. Proceedings of the National Academy of Sciences of the United States of America, 92, 7759-7763. Provan, J., Corbett, G., McNicol, J. W., & Powell, W. (1997). Chloroplast DNA variability in wild and cultivated rice (Oryza spp.) revealed by polymorphic chloroplast simple sequence repeats. Genome, 1997, 104-110.

Provan, J., Corbett, G., Waugh, R., McNicol, J. W., Morgante, M., & Powell, W. (1996). DNA fingerprints of rice (Oryza sativa) obtained from hypervariable chloroplast simple sequence repeats. Proceedings of the Royal Society of London B, 263, 1275- 1281. Provan, J., Lawrence, P., Young, G., Wright, F., Bird, R., Paglia, G., Cattonaro, F., Morgante, M. Powell, W. (1999). Analysis of the genus Zea (Poacea) using polymorphic chloroplast simple sequence repeats. Plant Systematics and Evolution, 218, 245-256. Provan, J., Powell, W., & Hollingsworth, P. M. (2001). Chloroplast microsatellites: New tools for studies in plant ecology and evolution. TRENDS in Ecology and Evolution, 16, 142-147. Raggi, L., Bitocchi, E., Russi, L., Marconi, G., Sharbel, T. F., Veronesi, F., & Albertini, E. (2015). Understanding genetic diversity and population structure of a Poa pratensis worldwide collection through morphological, nuclear and chloroplast diversity analysis. PLoS One, 10. Saha, M. C., Cooper, J. D., Mian, M. A. R., Chekhovskiy, K., & May, G. D. (2006). Tall fescue genomic SSR markers: Development and transferability across multiple grass species. Theoretical Applied Genetics, 113, 1449-1458. Saha, M. C., Hopkins, A. A., & Wang, Z. (2009). Genomic tools for improvement. In H. A. Fribourg, D. B. Hannaway & C. P. West (Eds.), Tall fescue for the twenty-first century (pp. 377-394). Madison, WI: American Society of Agronomy, Inc., Crop Science Society of America, Inc., Soil Science Society of America, Inc. Saha, M. C., Mian, M. A. R., Eujayl, I., Zwonitzer, J. C., Wang, L., & May, G. D. (2004). Tall fescue EST-SSR markers with transferability across several grass species. Theoretical Applied Genetics, 109, 783-791. Samples, T. J., Sorochan, J. C., Brilman, L. A., & Stier, J. C. (2009). Tall fescue as turf in the united states. In H. A. Fribourg, D. B. Hannaway & C. P. West (Eds.), Tall fescue for the twenty-first century (pp. 445-482) Seal, A. G. (1983). DNA variation in Festuca. Heredity, 50, 225-236. Seal, A. G., & Rees, H. (1982). The distribution of quantitative DNA changes associated with the evolution of diploid Festuceae. Heredity, 49(2), 179-190. Šiffelová, G., Pavelková, M., Klabouchová, A., Wiesner, I., & Našinec, V. (1997). Computer-aided RAPD fingerprinting of accessions from the ryegrass-fescue complex. Journal of Agricultural Science, Cambridge, 129, 257-265. Smarda, P., Bures, P., Horova, L., Foggi, B., & Rossi, G. (2008). Genome size and GC content evolution of Festuca: Ancestral expansion and subsequent reduction. Annals of Botany, 101, 421-433. Soreng, R. J., & Terrell, E. E. (1997). Taxonomic notes on Schedonorus, a segregate genus from Festuca or Lolium, with a new nothogenus, x Schedololium, and new combinations. Phytologia, 83, 85-88. Stammers, M., Harris, J., Evans, G. M., Hayward, M. D., & Forster, J. W. (1995). Use of random PCR (RAPD) technology to analyze phylogenetic relationships in the Lolium/Festuca complex. Heredity, 74, 19-27. Sun, X., Xie, Y., Bi, Y., Liu, J., Amombo, E., Hu, T., & Fu, J. (2015a). Comparative study of diversity based on heat tolerant-related morpho-physiological traits and molecular markers in tall fescue accessions. Scientific Reports, 5, 18213.

Sun, X., Du, Z., Ren, J., Amombo, E., Hu, T., & Fu, J. (2015b). Association of SSR markers with functional traits from heat stress in diverse tall fescue accessions. BMC Plant Biology, 15, 116. Talukder, S. K., Azhaguval, P., Chekhovskiy, K., Black, J., & Saha, M. C. (2014). Tall fescue morphotype differentiation using chloroplast DNA sequence variation and SSR diversity. Tanhuanpää, P., & Manninen, O. (2012). High SSR diversity but little differentiation between accessions of Nordic timothy (Phleum pratense L.). Hereditas, 149(4), 114- 127. Tehrani, M. S., Mardi, M., Saeidi, H., Gharehyazi, B., & Assadi, M. (2008). Transferability of genomic and EST-microsatellites from Festuca arundinacea Schreb. to Lolium persicum boiss. and hohen. ex boiss. International Journal of Botany, 4(4), 476-480. Tehrani, M. S., Mardi, M., Sahebi, J., Catalan, P., & Diaz-Perez, A. (2009). Genetic diversity and structure among Iranian tall fescue populations based on genomic-SSR and EST-SSR marker analysis. Plant Systematics and Evolution, 282, 57-70. Torrecilla, P., & Catalán, P. (2002). Phylogeny of broad-leaved and fine-leaved Festuca lineages (Poaceae) based on nuclear ITS sequences. Systematic Botany, 27(2), 241- 251. Turgeon, A. J. (2012). Turfgrass management (Ninth ed.). Upper Saddle River, NJ: Pearson Higher Ed. Veronesi, F., & Falcinelli, M. (1988). Evaluation of an Italian germplasm collection of Festuca arundinacea Schreb. through a multivariate analysis. Euphytica, 38, 211- 220. Wheeler, G. L., Dorman, H. E., Buchanan, A., Challagundla, L., & Wallace, L. E. (2014). A review of the prevalence, utility, and caveats of using chloroplast simple sequence repeats for studies of plant biology. Applications in Plant Sciences, 2 Xu, W. W., & Sleper, D. A. (1994). Phylogeny of tall fescue and related species using RFLPs. Theoretical and Applied Genetics., 88(6-7), 685-690. Xu, W. W., Sleper, D. A., & Krause, G. F. (1994). Genetic diversity of tall fescue germplasm based on RFLPs. Crop Science, 34, 246-252.

Diversity of Tall Fescue and Relationships within Festuca subgenus Schedonorus

Introduction

Tall fescue (Festuca arundinaea Schreb. syn. Lolium arundinaceum [Schreb.]

Darbysh. syn. Schedonourus phoenix [Scop.] Holub. syn. Schedonourous arundinaceaus

[Schreb.] Dumort.) is a cool-season grass (Family: Poaceae) that is widely used as forage, turf, and utility grass (Hopkins et al, 2009; Turgeon, 2012). Generally, it grows as a bunch- type grass, however, there are some individuals that spread by rhizomes (Porter, 1958).

Within the United States, it is well adapted to much of the Eastern half of the nation, as well as the West Coast (Hannaway et al 2009). Tall fescue is a member of genus Festuca subgenus Schedonourous (synonymous with section Bovinae). The subgenus natively can be found from Portugal in the west to Western China in the east, and Scandinavia in the north to North Africa in the South. The subgenus can be divided by a reproductive barrier between the continental types and the Mediterranean types (Malik and Thomas, 1966b;

Hunt and Sleper, 1982). Of the species and subspecies included in this project, the continental group includes diploids Festuca pratensis Huds., tetraploid Festuca arundinacea var. glaucescens Boiss (syn. Festuca arundinacaea subsp. fenas (Lag.)

Arcang.), and hexaploid Festuca arundinacaea. The Mediterranean species and subspecies represented in this study include the tetraploid Festuca mairei St.-Yves, hexaploid Festuca arundinacea, octoploid Festuca arundinacea subsp. atlantigena (St.-Yves) and decaploid

Festuca arundinacea subsp. letourneuxiana (St.-Yves) Torrec. & Catalán. Subgenus

Schedonourous is more closely related to the ryegrasses (genus Lolium) than it is to fine- leaved members of Festuca, with the fine-leaved fescues and the broad-leaved fescues

40 diverging 10.5 MYA (Torrecilla and Catalán, 2002; Catalán et al., 2004; Inda et al., 2008).

This relatedness to Lolium, as well as the ability to produce hybrids with outcrossing

Lolium species, has led to some to realigning subgenus Schedonourous to be part of Lolium instead of Festuca (Darbyshire, 1993). Additionally, there has been another realignment to elevate Schedonourous to a segregate genus, recognizing that there were major differences between broad-leaved fescues and both Lolium and the fine-leaved fescues (Soreng and

Terrell, 1997). However, neither of these treatments discuss the relationships between the

Continental and Mediterranean species, in both cases not adjusting the genus for those species. For this reason, and the reason that many recent papers discussing phylogeny still use the Festuca genus, the nomenclature of Festuca will be used for this study (Hand et al., 2012b; Ezquerro-López et al., 2017).

Most of the cultivars of tall fescue are the continental hexaploid form (Hopkins et al., 2009). It is an allohexaploid (2n=6x=42) with a genome constitution of PPG1G1G2G2.

The P-genomes were contributed by the diploid Festuca pratensis and the G-genomes were contributed by Festuca arundinacea var. glaucescens (Xu et al., 1991). There are reproductive barriers between the Continental and Mediterranean morphotypes (Malik and

Thomas, 1966; Hunt and Sleper, 1982). It is been suggested that the Mediterranean morphotype is the result of a different hybridization event, potentially between Festuca scariosa and Festuca mairei or a separate event between the same parents as the continental type, this is opposed to it being diverged from the Continental morphotype (Borrill et al,

1972; Hopkins et al., 2009; Hand et al., 2012; Dierking et al., 2015; Ezquerro-López et al.,

2017).

Previous investigations of tall fescue diversity have been completed using several different marker systems. It has been consistently found that the Continental and

Mediterranean morphotypes of tall fescue separate into distinct groups (Mian et al., 2002,

Hand et al, 2012a, Hand et al, 2012b). When cultivars were genotyped using random fragment length polymorphisms (RFLPs), no strong population structure was found, however there was a high level of diversity within cultivars (Xu et al., 1994). Baird et al.

(2012) found there was low diversity between cultivars, agreeing with earlier work that found it difficult to impossible to discriminate between cultivars based on seed proteins

(Abernathy et al., 1989; Krishnan and Sleper, 1997). Additionally, cultivars have been shown to have a high degree of admixture, suggesting that they have been bred using diverse sources of germplasm (Fu et al., 2016) which is expected in a cross pollinating species.

SSR markers have been shown to be effective for understanding the genetic variation present within a species at a finer scale than other marker types. SSR markers are highly polymorphic and heritable. These features have lead them to be the marker system of choice for studying plant genetic diversity (Pfieffer et al., 2011;

Tarhuanpää and Manninen, 2012; Hand et al., 2012; Teixeira et al., 2014; Honig et al,

2016). Additionally, microsatellites have been found in the chloroplast genome, which is inherited uniparentally, unlike the nuclear genome, which is inherited from both parents.

Like nuclear SSRs (nuSSRs), chloroplast SSRs (cpSSRs) can be amplified and used as molecular markers. Chloropast SSR markers have been used in Glycine to show variation correlated with geography, in Orzya, to show correlation between subspecies, and in

Agrostis showed grouping by species however, different relationships than showed by

42 nuSSRs, suggesting a chloroplast introgression event in the evolution of that genus (Powell et al, 1995; Provan et al, 1996; Honig et al, 2016).

The NJAES has been collecting tall fescue germplasm from the center of origin for some time. It is the goal to incorporate these collections into the tall fescue turfgrass breeding program, to develop new cultivars. Therefore, it is important to understand the diversity present in the collections in order to make informed decisions about what material will be useful in a breeding program. To this end, 98 populations of tall fescue cultivars, collections, and accessions were genotyped with nuSSR markers and cpSSR markers to assess the level of diversity present in the species as well as relatedness of the species and subspecies with the Festuca-Lolium complex, with emphasis on subgenus Schedonourous.

Materials and Methods Plant Material

Ninety-eight Festuca and Lolium cultivars, experimental selections, accessions, and collections (referred to as entries from this point) were evaluated in this study (Table

1). The source of entries varied and is listed in Table 1. Several plugs were collected from

91.44cm x 152.4cm turf plots at the Adelphia Research Farm, Freehold, NJ. From these plugs, twenty-four individuals were transplanted into one half of a 48-cell flat (53.34 cm x

27.94 cm). The perennial ryegrass cultivar 'Derby Xtreme' was collected as plugs from

Horticultural Research Farm II in North Brunswick, NJ similar to the tall fescue entries described above. For entries 79-90 (Table 1), seed was obtained from the USDA

Germplasm Resource Information Network – PI collection. Approximately 100 seeds were germinated in small pots containing Premier Pro-Mix BX (Premier Horticulture Inc.

Table 1- Entries Table and Breeding Histories

Entry Name Breeding History or Origin Chl045 Plant Haplotype Material Source 1 A11-1727 Collection from Agouti, Morocco 744 Turf Plots at Rutgers Research Farm 2 A11-1753 Collection from Tisi-n-Ouano, Morocco 744 Turf Plots at Rutgers Research Farm 3 A11-1768 Collection from Dolomiti, Italy Turf Plots at 694 in 15; Rutgers 744 in 1 Research Farm 4 A11-1777 Collection from Dolomiti, Italy Turf Plots at 694 in 15; Rutgers 744 in 1 Research Farm 5 A11-1781 Collection from Amelago, Morocco Turf Plots at Rutgers 694 Research Farm 6 A11-1783 Collection from Amelago, Morocco Turf Plots at 744 in 14, Rutgers 694 in 2 Research Farm 7 A11-1785 Collection from Amelago Morocco 694 in 7; Turf Plots at 744 in 4, Rutgers Missing in Research 5 Farm 8 A11-1790 Collection from Domnesti, Romania Turf Plots at Rutgers 694 Research Farm 9 A11-1793 Collection from Amelago, Morocco Turf Plots at Rutgers 744 Research Farm 10 A11-1803 Collection from Taddamout, Morocco Turf Plots at 694 in 8; Rutgers 744 in 8 Research Farm 11 A11-1805 Collection from Mirano, Italy Turf Plots at Rutgers 694 Research Farm 12 A11-1806 Collection from Mirano, Italy Turf Plots at Rutgers 694 Research Farm

13 A11-1808 Collection from Ait-Rhiat, Morocco Turf Plots at Rutgers 744 Research Farm 14 A11-1810 Collection from Aquelmorys, Morocco Turf Plots at Rutgers 744 Research Farm 15 A11-1811 Collection from Domnesti, Romania Turf Plots at Rutgers 694 Research Farm 16 A11-1813 Collection from Domnesti, Romania Turf Plots at Rutgers 694 Research Farm 17 A11-1814 Collection from Ait-Kermouss, Morocco Turf Plots at Rutgers 744 Research Farm 18 A11-1820 Collection from Ait-Kermouss, Morocco Turf Plots at Rutgers 744 Research Farm 19 A11-1822 Collection from Domnesti, Romania Turf Plots at Rutgers 694 Research Farm 20 A11-1846 Collection from Domnesti, Romania Turf Plots at Rutgers 694 Research Farm 21 A12-1104 Collection from Monti Mariella, Italy Turf Plots at Rutgers 694 Research Farm 22 A12-1106 Collection from Derebucak, Turkey Turf Plots at Rutgers 694 Research Farm 23 A12-1115 Collection from Roccadi Cambio, Italy Turf Plots at Rutgers 694 Research Farm 24 A12-1118 Collection from Assergi, Italy Turf Plots at Rutgers 694 Research Farm 25 A12-1124 Collection from Capitigano, Italy Turf Plots at Rutgers 694 Research Farm 26 A12-1133 Collection from Zoizor, Italy Turf Plots at 694 Rutgers

Research Farm 27 A12-1136 Collection from Zoizor, Italy Turf Plots at Rutgers 694 Research Farm 28 A12-1145 Collection from Yanigodan, Turkey Turf Plots at Rutgers 694 Research Farm 29 A12-1148 Collection from Tarasci, Turkey Turf Plots at Rutgers 694 Research Farm 30 A12-1149 Collection from Zoizor, Italy Turf Plots at Rutgers 649 Research Farm 31 A12-1152 Collection from Zoizor, Italy Turf Plots at Rutgers 694 Research Farm 32 A12-1162 Collection from Zoizor, Italy Turf Plots at Rutgers 744 Research Farm 33 A12-1163 Collection from Ibel Azourki, Morocco Turf Plots at Rutgers 744 Research Farm 34 A12-1168 Collection from Dolomiti, Italy Turf Plots at Rutgers 694 Research Farm 35 A12-1169 Collection from Kemeri, Latvia Turf Plots at Rutgers 694 Research Farm 36 A13-1511 Collection from Sarika, Turkey Turf Plots at Rutgers 694 Research Farm 37 A13-1514 Collection from Sarika, Turkey Turf Plots at Rutgers 694 Research Farm 38 A13-1521 Collection from Sarika, Turkey Turf Plots at Rutgers 694 Research Farm 39 A13-1524 Collection from Sarika, Turkey Turf Plots at Rutgers 694 Research Farm

40 A13-1533 Collection from Krusje, Macedonia Turf Plots at Rutgers 694 Research Farm 41 A13-1534 Collection from Debar, Macedonia Turf Plots at Rutgers 694 Research Farm 42 A13-1535 Collection from Debar, Macedonia Turf Plots at Rutgers 694 Research Farm 43 A13-1536 Collection from Korce, Albania Turf Plots at Rutgers 694 Research Farm 44 A13-1537 Collection from Xibracke, Albania Turf Plots at Rutgers 694 Research Farm 45 A13-1538 Collection from Xibracke, Albania Turf Plots at Rutgers 694 Research Farm 46 A13-1541 Collection from Xibracke, Albania Turf Plots at Rutgers 694 Research Farm 47 A13-1543 Collection from Karuk, Montenegro Turf Plots at Rutgers 694 Research Farm 48 A13-1546 Collection from Kolasm, Montenegro Turf Plots at Rutgers 694 Research Farm 49 A13-1549 Collection from Kolasm, Montenegro Turf Plots at Rutgers 694 Research Farm 50 A13-1552 Collection from Valikarda, Montenegro Turf Plots at Rutgers 694 Research Farm 51 A13-1554 Collection from Belcista, Montenegro Turf Plots at Rutgers 694 Research Farm 52 A13-1562 Collection from Belcista, Montenegro Turf Plots at Rutgers 694 Research Farm 53 A13-1563 Collection from Dusegubica, Macedonia Turf Plots at 694 Rutgers

Research Farm 54 A13-1566 Collection from Sribca, Macedonia Turf Plots at Rutgers 694 Research Farm 55 A13-1569 Collection from Tigveni, Romania Turf Plots at Rutgers 694 Research Farm 56 A13-1574 Collection from Sovata, Romania Turf Plots at Rutgers 694 Research Farm 57 A13-1580 Collection from Santioara, Romania Turf Plots at Rutgers 694 Research Farm 58 A13-1582 Collection from Luna, Romania Turf Plots at Rutgers 694 Research Farm 59 A13-1788 Collection from Zoizor, Italy Turf Plots at Rutgers 694 Research Farm 60 A13-1789 Collection from Zoizor, Italy Turf Plots at Rutgers 694 Research Farm 61 A13-783 Collection from Camlibel, Turkey Turf Plots at Rutgers 694 Research Farm 62 A13-785 Collection from Camlibel, Turkey Turf Plots at Rutgers 694 Research Farm 63 A13-792 Collection from Erciyes Dagi, Turkey Turf Plots at Rutgers 694 Research Farm 64 A13-795 Collection from Erciyes Dagi, Turkey Turf Plots at Rutgers 694 Research Farm 65 A13-799 Collection for Erciyes Dagi Turkey Turf Plots at Rutgers 694 Research Farm 66 Atlas Developed by Willamette Valley Plant Turf Plots at Breeders (Sherry Brown – Personal Rutgers 694 Communication) Research Farm

67 B23 Turf Plots at Rutgers 694 Research Farm 68 Bizem (Trinity) The 16 parents of BIZM trace to seven different maternal sources present within the New Jersey Agricultural Experiment Station germplasm pool. Twenty-six percent trace to plants related to Apache tall fescue. Nineteen percent traces to a few plants selected from the University of GA State Hospital in 1977. Another 19% trace to plants related to SR 8400. Twelve percent traces to a plant selected Turf Plots at from the Princeton University campus and Rutgers used in the development of Rebel. Several of 694 Research these plants were identified as having Farm rhizomes. Another twelve percent trace to a few plants utilized in an interspecific crossing program with perennial ryegrass (Lolium perenne L.) conducted in the early 1990’s. Six percent trace to several plants collected from Downer’s Grove, Illinois in the early 1980’s. Another six percent trace to plants collected from Bayonne Park in Bayonne, NJ in 1975. (Stacy Bonos – Personal Communication). 69 CCR2 (Amity) The 17 parents of CCR2 trace to five different maternal sources present within the New Jersey Agricultural Experiment Station germplasm pool. Twenty-nine percent trace to plants related to Rebel Jr. tall fescue. Twenty- Turf Plots at nine percent trace to plants collected from an Rutgers old turf area in Lexington, KY in 1979. 694 Research Eighteen percent trace to plants related to SR Farm 8400. Another eighteen percent trace to a tall fescue clone with crown rust resistance identified in 1988. Six percent trace to plants related to Duke tall fescue (Stacy Bonos – Personal Communication). 70 Derby Xtreme Derby Xtreme was selected from the maternal progeny of 23 plants. Approximately 60 percent of the germplasm used in the development of Derby Xtreme was collected from Eastern Europe in 1996. These plants were identified as a significant source of resistance to gray leaf spot disease in 2000. The original collections were backcrossed for Test Edge at at least four cycles with germplasm from the Hort Farm II 694 Rutgers Turfgrass Breeding program and in North evaluated in spaced-plant nurseries and single- Brunswick plot progeny turf plots for characteristics such as dark green color, low-growth habit, freedom from disease and acceptable mowing quality. Eighteen percent trace to several patches of perennial ryegrass plants that survived severe flood and Pythium (Pythium spp.) damage in 1989. Thirteen percent of the

germplasm traces to several plants selected for crown rust resistance in 1986 and related to 'Pinnacle' perennial ryegrass. Nine percent trace to a plant collected from Georgian Court College in Lakewood, NJ in 1992. (DLF International Seeds, 2007). 71 F711 The 10 clones of F711 trace to four different maternal sources present within the New Jersey Agricultural Experiment Station germplasm pool. Forty-four percent traces to a few plants selected from the University of GA State Hospital in 1977. Twenty-five percent trace to plants related to Apache tall fescue. Turf Plots at Nineteen percent trace to several plants Rutgers collected from Downer’s Grove, Illinois in the 694 Research early 1980’s. Six percent trace to plants Farm collected from Bayonne Park in Bayonne, NJ in 1975. Six percent traces to a plant selected from the Princeton University campus and used in the development of Rebel. Several of these plants were identified as having rhizomes (Stacy Bonos – Personal Communication). 72 Fawn The variety is an eight-clone synthetic. The 8 Turf Plots at clones were among the best in digestibility Rutgers 694 and crude proteins from 90 genotypes that Research were tested (Frakes and Cowan, 1974). Farm 73 JesupMaxQ Jesup tall fescue is a 15-clone synthetic cultivar. The 15 endophyte infected parent Turf Plots at originated from 32 clones collected in 1981 Rutgers 694 near Jesup, GA, that has been established with Research ‘Kentucky 31’ tall fescue in 1967 (Bouton et Farm al, 1997). 74 Kentucky 31 Kentucky 31 tall fescue is an ecotype Turf Plots at collected in 1931 on the mountain farm of Rutgers 694 William M. Suiter in Menifee County, KY Research (Fergus and Buckner, 1972). Farm 75 LSD (Rhambler 2 The 23 clones of LSD trace to four different SRP) maternal sources present within the New Jersey Agricultural Experiment Station germplasm pool. Thirty-six percent trace to plants related to Apache tall fescue. Eighteen percent traces to a few plants selected from the University of GA State Hospital in 1977. Turf Plots at Fourteen percent trace to plants related to Rutgers 694 Duke tall fescue. Ten percent trace to a few Research plants collected from Atlanta Ga, near Ga tech Farm in 1977. Nine percent trace to plants related to Mini Mustang tall fescue. Nine percent trace to plants related to Coyote tall fescue. Four percent trace to plants collected from Bayonne Park in Bayonne, NJ in 1975 (Stacy Bonos – Personal Communication). 76 MET1 The 17 clones of MET1 trace to three different Turf Plots at maternal sources present within the New 694 Rutgers Jersey Agricultural Experiment Station

germplasm pool. Fifty-nine percent trace to Research plants related to Duke tall fescue. Twenty-five Farm percent trace to plants collected from an old turf area in Lexington, KY in 1979. Sixteen percent trace to a few plants utilized in an interspecific crossing program with perennial ryegrass (Lolium perenne L.) conducted in the early 1990’s (Stacy Bonos – Personal Communication). 77 MET2 The 20 clones of MET2 trace to five different maternal sources present within the New Jersey Agricultural Experiment Station germplasm pool. Forty-one percent trace to a few plants utilized in an interspecific crossing program with perennial ryegrass (Lolium perenne L.) conducted in the early 1990’s. Turf Plots at Twenty-one percent trace to plants collected Rutgers 694 from an old turf area in Lexington, KY in Research 1979. Sixteen percent trace to plants related Farm to Apache tall fescue. Eleven percent trace to a few plants selected from the University of GA State Hospital in 1977. Another eleven percent trace to plants collected from Downer’s Grove, Illinois in the early 1980’s (Stacy Bonos – Personal Communication). 78 MET3 The 30 clones of MET3 trace to four different maternal sources present within the New Jersey Agricultural Experiment Station germplasm pool. Twenty-nine percent trace to plants related to Duke tall fescue. Twenty-five percent trace to a few plants utilized in an Turf Plots at interspecific crossing program with perennial Rutgers ryegrass (Lolium perenne L.) conducted in the 694 Research early 1990’s. Twenty-four percent trace to a Farm few plants selected from the University of GA State Hospital in 1977. Eleven percent trace to plants related to Rebel Jr. tall fescue. Another eleven percent trace to plants collected from an old turf area in Lexington, KY in 1979 (Stacy Bonos – Personal Communication). 79 PI193145 – Gulf - Gulf annual ryegrass is a direct increase of La Seed from Lolium multiflorum Estanzuela 284, an improved variety from 694 USDA-ARS Uruguay (Weihing, 1963). 80 PI198088 – Accession donated to USDA ARS GRIN by Festuca Centre Recherche Agronomique, Morocco, Seed from 744 arundinacea subsp. 1951 USDA-ARS letourneuxiana 81 PI208679 – Accession donated to USDA ARS GRIN by Festuca Station Centrale d'Essais de Semences, Seed from arundinacea subsp. Algeria, 1953 744 letourneuxiana USDA-ARS

82 PI255417 – Collection from Former Serbia and Seed from Festuca Pratensis Montenegro (Experimental Farm – Cesenik, 694 USDA-ARS 1959)

83 PI283313 – Accession was collected from France (CSIRO, Seed from 744 Festuca Mairei 1962) USDA-ARS 84 PI289651 – Accession was donated from Spain (Instituto Festuca Forestal de Investigaciones y Experiencias, Seed from 694 Arundinacea var. 1963) USDA-ARS Glaucescens 85 PI289654 - Festuca Accession was donated from Spain (Instituto Seed from Arundinacea var. Forestal de Investigaciones y Experiencias, 694 USDA-ARS Glaucescens 1963) 86 PI577096 – Accession was donated (Welsh Breeding Festuca Station, 1991). Seed from 744 arundinacea subsp. USDA-ARS Atlantigena 87 PI595048 - Festuca Accession was collected from France (Welsh Seed from Arundinacea var. Breeding Station, 1991). 694 USDA-ARS Glaucescens 88 PI610941 – Accession was collected from Morocco. Seed from 744 Festuca Mairei USDA-ARS 89 PI648355 – Linage of Floregon traces through a crown Seed from Floregon – Lolium rust resistance selection of the cultivar Surrey. 694 USDA-ARS MultiFlorum 90 PI662363 – Collected from Novgorod, Russian Seed from 694 Festuca Pratensis Federation. USDA-ARS 91 RZ-2 The 17 parental lines of RZ2 trace to six different maternal sources present within the New Jersey Agricultural Experiment Station germplasm pool. Twenty percent trace to a few plants selected from the University of GA State Hospital in 1977. Twenty percent traces to plants related to Apache tall fescue. Nineteen percent traces to plants related to Turf Plots at Gazelle tall fescue. Another 19 percent trace Rutgers 694 to plants collected from a farm in eastern Research North Carolina in 1975. Fourteen percent Farm trace to a few plants utilized in an interspecific crossing program with perennial ryegrass (Lolium perenne L.) conducted in the early 1990’s. Eight percent trace to a few plants collected from Holly Springs CC in Holly Springs, MS in 1976 (Stacy Bonos- Personal Communication). 92 T31 (Maestro) The 12 parental lines of T31 trace to five different maternal sources present within the New Jersey Agricultural Experiment Station germplasm pool. Thirty-four percent trace to plants related to Apache tall fescue. Twenty- five percent trace to plants related to Montauk Turf Plots at tall fescue. Twenty-five percent traces to a Rutgers 694 few plants selected from the University of GA Research State Hospital in 1977. Eight percent trace to Farm plants collected from an old turf area in Lexington, KY in 1979. Another eight percent trace to a plant identified as RR-11F (Rutgers, the State University of New Jersey and Novel Ag, 2016).

93 Teton Teton traces to 7 parent clones, two parents Turf Plots at from an unknown genepool source, one from Rutgers each of the varieties ‘Cajun,’ ‘Kentucky 31,’ 694 Research and ‘Phyter,’ and two from ‘Martin’ (Cascade Farm Seed Company, 2000). 94 Regenerate The 30 parents of LW trace to eight different maternal sources present within the New Jersey Agricultural Experiment Station germplasm pool. Twenty-three percent traces to several plants selected from the Princeton University campus and used in the development of Rebel tall fescue. Several of these plants were identified as having rhizomes in 1977. Twenty-three percent trace to plants collected from Bayonne Park in Bayonne, NJ in 1975 and 1976. Seventeen percent trace to several plants selected for Turf Plots at improved crown rust resistance from a mowed Rutgers 694 spaced-plant trial in 1988. Thirteen percent Research trace to several plants collected from Farm Downer's Grove Illinois in the early 1980's. Ten percent trace to a few plants utilized in an interspecific crossing program with perennial ryegrass (Lolium perenne L.) conducted in the early 1990' s. Eight percent trace to plants related to Apache tall fescue. Three percent trace to plants collected from the University of Georgia, Athens GA in 1977. Another three percent trace to a plant collected from Lexington, KY in 1979 (Rutgers, the State University of NJ, 2012). 95 U43 (4th The 19 parental lines of U43 trace to six Millenium SRP) different maternal sources present within the New Jersey Agricultural Experiment Station germplasm pool. Twenty-six percent trace to a few plants utilized in an interspecific crossing program with perennial ryegrass (Lolium perenne L.) conducted in the early 1990’s. Another 26% trace to plants related to Duke Turf Plots at tall fescue. Sixteen percent trace to plants Rutgers related to Coyote tall fescue. Another 16% 694 Research trace to plants collected from an old turf area Farm in Lexington, KY in 1979. Eleven percent trace to a few plants selected from the Princeton University Campus in Princeton, NJ and used in the development of Rebel tall fescue. These plants were identified as having rhizomes. Five percent trace to plants related to Apache tall fescue (Stacy Bonos – Personal Communication). 96 W41 The 15 parental lines of W41 trace to six different maternal sources present within Turf Plots at the New Jersey Agricultural Experiment Rutgers 694 Station germplasm pool. Forty percent trace to Research plants collected from an old turf area in Farm Lexington, KY in 1979. Twenty-seven percent

trace to plants related to Duke tall fescue. Twenty percent traces to a few plants selected from the University of GA State Hospital in 1977. Thirteen percent trace to a few plants selected from the Princeton University Campus in Princeton, NJ and used in the development of Rebel tall fescue. These plants were identified as having rhizomes (Stacy Bonos – Personal Communication). 97 W45 (Traverse 2 The 20 parental lines of W45 trace to six SRP) different maternal sources present within the New Jersey Agricultural Experiment Station germplasm pool. Thirty-five percent trace to plants related to Duke tall fescue. Twenty percent trace to plants related to Apache tall fescue. Fifteen percent trace to plants collected from an old turf area in Lexington, KY in 1979. Fifteen percent trace to plants collected from Bayonne Park in Bayonne, NJ Turf Plots at in 1975. Five percent traces to a few plants Rutgers 694 selected from the University of GA State Research Hospital in 1977. Five percent trace to a few Farm plants utilized in an interspecific crossing program with perennial ryegrass (Lolium perenne L.) conducted in the early 1990’s. Another five percent trace to a few plants selected from the Princeton University Campus in Princeton, NJ and used in the development of Rebel tall fescue. These plants were identified as having rhizomes (Stacy Bonos – Personal Communication). 98 ZW44 (Raptor III) The 20 parental lines of ZW44 trace to six different maternal sources present within the New Jersey Agricultural Experiment Station germplasm pool. Fifty-two percent trace to plants related to Apache tall fescue. Twenty- two percent traces to a few plants selected Turf Plots at from the University of GA State Hospital in Rutgers 1977. Twelve percent trace to plants related to 694 Research 5DE. Seven percent trace to plants related to Farm Coyote tall fescue. Seven percent trace to plant identified as BL1-5 which was selected in 1988, however the experimental selection never became a cultivar (Z Seeds, LLC and Rutgers, The State University of New Jersey, 2015).

Quakertown, PA, USA). Twenty-four of the germinated seedlings of each entry were transplanted into one half of a 48-cell flat (53.34 cm x 27.94 cm) and allowed to fully

54 establish in the greenhouse. Leaf tissue from 16 healthy individual transplants per entry was collected and stored at -80ºC before DNA isolation.

Nuclear and Chloroplast SSR Markers

Two nuclear EST-SSR markers were selected from Saha et al (2004) and eleven nuclear genomic SSR markers were selected from Saha et al (2006). These markers were selected based on their ability to amplify distinct and reproducible PCR products (Table

2). These thirteen markers were used to genotype 16 individuals of each entry. Because these primers amplified PCR products in all entries in the current study, we believe that these primers are amplifying orthologous loci in two or more genomes.

Chloroplast SSR markers were designed from the published complete Festuca arundinacea chloroplast genome sequence (NC_011713.2). Perfect mono-, di-, and trinucleotide repeats with a minimum total repeat length of 10 nucleotides were identified with the software SciRoKo 3.4 (Kofler et al, 2007). Thirty mono-, di-, and trinucleotide

SSR loci were identified in the complete genome. Primer pairs were designed to flank regions surrounding cpSSR motifs for 28 cpSSR loci using Primer3 (Rozen and Skaletsky,

1998). Eighteen of the twenty-eight primer pairs were found to produce distinct and reproducible PCR products in all of the entries in the current study. Further information on the cpSSR marker primer pairs can be found in Table 3.

The 5’ end of the forward primer of each primer pair was elongated with the M13(-

21) 18-bp sequence (5’–TGTAAAACGACGGCCAGT-3’) for economic fluorescent labeling (Schuelke, 2000). To reduce ambiguous results of “true” allele as opposed to “plus

A” allele, all reverse primers were elongated at the 5’ end with the sequence (5’–

GTTTCTT–3’), this is referred to as “PIG-tailing”, resulting in adenylation of the 3’ end of the forward strand of the PCR product, (Brownstein et al., 1996). All primers were synthesized by Integrated DNA Technologies (Coralville, IA).

Table 2- Nuclear Markers and Marker Summary Statistics Marker Forward Primer Reverse Primer N Genbank Motif Allel PIC Name Sequence 5' to 3' Sequence 5' to 3' Sequence e Value Accession Size Range Rang e NFA096 CAATGGTGGTG AGAGAGCAAGG 19 FA14G01LFGA 224- 0.001- CAAGAAATG AGGAAGAAACC 004* 261 0.486

NFA129 AACCTTGATGG GCCGGAGTAGG 29 FA42A07D GGC 176- 0.001- GGCGTAAG AGGATTTTC S049* 274 0.413

NFFG003 GCTGTGCTGGT CACATGCCAAA 36 CZ071531.1 GA 140- 0.001- GGATATGG ACAGTGGATAG 196 0.263

NFFG006 CTTTGGCATTT GGGTTAGGTCAA 73 CZ071535.1 GA 95- 0.001- CAGCACTGG CCATTCACTC 231 0.497

NFFG009 ACAAGCACACAGAGCCCTTCTGT 41 CZ071542.1 GA 178- 0.001- TCACAACATGA TCTGCAAC 243 0.491

NFFG016 TGTGGTGCAAT AAAGCCTCAACT 70 CZ071553.1 GA 171- 0.003- CGGTTAGATAG TAGTTCCAGAGA 248 0.258

NFFG023 TTTTGAGAACT CCGCTCTTCTAC 18 CZ071562.1 GA 217- 0.001- TCGATGTATTT ATAAGGACGA 258 0.359 TT

NFFG026 GCTCTTCCTCA GAGCAATAATC 57 CZ071568.1 GA 139- 0.001- CCAAGAGGAT GAAGCCAGAGT 241 0.475

NFFG048 TTCACCATGAC AAAAATGCATG 46 CZ071600.1 GA 227- 0.001- CTTGACGTTAG GAGGAGTTACA 325 0.348

NFFG106 CTACATAATGG AGAATGTTTTTA 60 CZ071681.1 GA 144- 0.001- TGGCAACATGC TCGGCTCGAA 243 0.465

NFFG110 GGGCTACATGA TTGTTATAGCAT 47 CZ071691.1 GA 139- 0.001- AAACTCCTTTG TTGCCGTGTC 213 0.420

NFFG111 CAATACTGTTG TTGCCTCGTAGG 44 CZ071692.1 GA 191- 0.001- CTCTCCCCATT TAACATTCAA 276 0.403

NFFG379 ACTAGCCACCA ATGAGTCGGTTT 33 CZ072277.1 GA 155- 0.001- GAGTGATGTGA GTGTTGTTGT 224 0.428

57* EST ID 3 from Saha et al, 2004

Table 3- Chloroplast SSR Markers and Marker Summary Statistics

SSR Size Marker Forward Primer Reverse Primer Start BP Ran Name Sequence 5' to 3' Sequence 5' to 3' N Motif Position ge FaChlS CCACTCTTCCC CGAAGAAGTA 215- (A) 6056 SR01 CAATAAATA CGGAAGTACG 6 10 249 FaChlS TTTCTACCCTT GTTTTTCCTTA 215- (A) 7309 SR02 CTGCACCTA CCACATGGA 4 11 219 FaChlS TCCAAATCAAA GGCCGATATT 212- (A) 7818 SR03 AGGTTTACG GGTTTTTAG 5 11 216 FaChlS ACTCCTTTCCG CAGCATTATTC 204- (A) 8364 SR04 CTACACATA CATGACTCC 5 13 208 FaChlS TATCTCTATGG CATAGCCATG 166- (A) 18696 SR05 GGAATCGTG CTTTTCTTTT 3 10 170 FaChlS ACTGGATCCTT CGGTATCTAG 239- (A) 20782 SR06 AGCAATTCA CTGGAACAAC 2 13 240 FaChlS AAGCGGTATTC ACTGCATATTT 258- (A) SR10 AAGCTCTTA TGCCAACTC 5 12 31530 262

FaChlS AGTGGATCGGC TCAGCTGTAG 244- (A) 42647 SR13 TCTATTACA GAAAGAAGGA 3 10 247 GGAATTTCATC FaChlS AAAATCTGTAT CATTTGTAATG (A)14 45911 226- SR14 T CGAGAGTCA 8 238 FaChlS AGCGGTGTCTC TAATTCCAGG 254- (A) 46807 SR16 TCAAATAGA GTTTCTCTGA 4 12 257 FaChlS ATGATGCACAA ATATGTATCCC 177- (A) 47923 SR17 GAAAAGGTC CACCCATCT 3 11 179 FaChlS GGGAAACTCA GCGCTAGTTTT 261- (A) 49790 SR18 ATCAAATTCA TGTTGTTTT 2 12 262 FaChlS AGCCTGTGGTA GTTTATGAAA 203- (A) 51003 SR19 ATGCTTTTA GAGCCCAATG 5 12 207 TCTTAGAAGG AATTGCTTGAC FaChlS AGGTATCCTG (A) 61322 211- TGGTTCAAT 10 SR21 AA 2 212 FaChlS AGGGACTCGTG TTCAAGCCAA 262- (A) 63663 SR22 TATCATCTG TAAAAAGAGC 3 14 264 FaChlS GGCTGGCTAAT TCCTTTTCTTT 222- (AAG) 65320 SR23 TAAATGAAA TTGGATTGA 4 12 230 FaChlS GGATATCGACA TGCATTCTGTC 272- (A) 79167 SR26 ATACGAAACA CAGTGATAG 9 10 281 FaChlS GATTCACCAAA GGAGAGCTGT 240- (A) 104732 SR29 CCAATTCTT TTCATCTTTG 7 10 249

SSR genotyping

Total plant genomic DNA was isolated from all individuals with either the Sigma

GenElute Plant Genomic DNA Miniprep Kit (St. Louis, MO, USA) or the Qiagen DNeasy

Plant Mini Kit (Valencia, CA, USA) following the respective manufacturer’s instructions.

Polymerase chain reaction (PCR) for genotyping was performed in 96-well plates, with a total reaction volume of 13μL with approximately 5 ng genome DNA, 1 x Immolase-Taq

PCR buffer (Bioline USA), 2mM MgCl2, 0.25 mM each dNTP (Bioline USA), 0.5 pmol forward primer with M13(-21) addition, 1 pmol reverse primer with “PIG-tailing” addition, and 1 pmol forward M13(-21) primer with FAM, NED, PET, or VIC fluorescent label in

58 each reaction. Thermal cycling conditions were an initial desaturation of 94ºC for 5 min, followed by 30 cycle of 94ºC for 30 s, 55ºC for 45 s, 72ºC for 45 s, followed by 20 cycles of 94ºC for 30 s, 53ºC for 45 s, 72ºC for 45 s, followed by a final extension of 72ºC for 10 min. Fifteen individuals ‘Falcon V’ tall fescue were used a reference samples, being placed on each 96-well plate as well as 1 samples of GeneScan Installation Standard DS-33

(Applied Biosystems). These were used to ensure consistency between reactions performed at different times. PCR product size was determined by using capillary electrophoresis, performed on an Applied Biosystems 3500xl Genetic Analyzer and sized with LIZ 600 size standard v2.0 (Applied Biosystems) and manually scored with Genemapper 5.0 software

(Applied Biosystems).

Allele scoring and SSR summary statistics

While SSR markers are normally thought of as codominant markers, this is not the case when genotyping polyploids, like tall fescue (Saha et al, 2004; Tahrani et al, 2009;

Tanhuanpää and Manninen, 2012; Honig et al, 2016). In a hexaploid, PCR might generate a banding pattern of allele 1, allele 2, and allele 3. This banding pattern could be caused by a genotype of 1 1 2 2 3 3, 1 1 2 2 2 3, 1 2 2 3 3 3, or many other combinations. Because of this, it can be excessively difficult to determine allelic dosage of those bands. Strictly, these bands are not necessarily alleles of the same loci, given the allopolyploid nature of tall fescue, these bands could better be described as allele phenotypes, additionally markers and bands were not assigned to particular genomes. With these concerns, each allele generated by the 13 nuSSR markers was scored as a dominant marker (akin to how AFLP makers would be scored) creating a binary data matrix (band presence=1, band absence

=0) for the nuSSR data set (Felberg and Ferguson, 2012; Honig et al, 2016). The Festuca species in this study that were polyploid included Festuca arundinacea, Festuca arudinacea var. glaucescens, Festuca mairei, Festuca arundinacea var. atlantigena, and

Festuca arundinacea var. letourneuxiana, while Lolium perenne, Lolium mutliflorum, and

Festuca pratensis are diploid.

To determine which allele phenotypes would be informative for analysis, polymorphism information content (PIC) of each individual nuSSR allele phenotype was

2 determined by the formula PIC = 1 − ∑ P푖 (Weir 1990) which can be reduced to PIC

=2P푖Q푖 for dominant markers are used, with P푖 is allele phenotype presence frequency and

Q푖 is the allele phenotype absence frequency (Tahrani et al, 2008). The PIC value ranges for each nuSSR marker was present in Table 2. When using dominant markers in a polyploid individual, the calculation of PIC is modified, this statistic is still useful however for selecting markers and allele phenotypes. In the current study only allele phenotypes with a PIC value greater or equal to 0.05 were for further analysis.

Haplotype Analysis (Eliades and Eliades, 2009) was used to determine fragment frequencies by population, number of haplotypes by population, effective number of haplotypes by population, private haplotypes by populations, intra-population haplotypic richness, intra-population genetic diversity, and mean genetic diversity between individuals, for this cpSSR marker alleles were coded as fragment size. For GenAlEx 6.5

(Peakall and Smouse, 2006, 2012) cpSSR alleles were scored as a binary matrix (presence

= 1, absence = 0).

Analysis of molecular variation (AMOVA)

Binary nuSSR data and binary haploid cpSSR data were input into GenAlEx 6.5

(Peakall and Smouse, 2006, 2012) to calculate pairwise genetic distance. GenAlEx was then used to perform Analysis of Molecular Variance (AMOVA) from these genetic distances. This partitioned the genetic variation into a within population component and a between populations component. Pairwise population ΦPT values (analog of FST for binary and haploid data) were calculated by AMOVA to assess inter-population pairwise distance.

999 independent data permutations were generated to determine the statistical significance of the AMOVA and pairwise population ΦPT values (Honig et al, 2016).

Genetic dissimilarity and neighbor joining dendrogram construction

To generate a dendrogram, dissimilarity values were calculated (Dice et al, 1945).

Dissimilarity values were calculated as Dxy = 1- (2Nm/Nx+Ny), where Nm is the number of marker bands that are shared between individuals x and y, and Nx and Ny are the total number of bands present in each respective individual. This calculation was selected because it only accounts for shared presence of alleles, not shared absence of alleles, meaning that missing data cannot contribute to this value, support values for nodes were generated by 500 random resampling of plants with replacement. The dissimilarity values were calculated by a script run in R (Bushman, 2011). Phylip v. 3.695 (Felsenstein, 1989) module ‘consense’ was used a consensus matrix from the 500 random resampling, and the module ‘neighbor’ was used to generate a neighbor-joining tree from this consensus matrix.

The neighbor-joining tree was visualized in MEGA7, node support values are only present when it is greater 0.70 (70%) (Kumar et al, 2015). The dendrograms were rooted to Lolium perenne cultivar ‘Derby Xtreme.’

Bayesian model based clustering

STRUCTURE 2.3.4 (Falush et al. 2003; Pritchard et al. 2000) was used to estimate the most likely number of tall fescue genetic groups (K), and the distribution of tall fescue individuals within and among those genetic groups. To find the most likely number of genetic groups, twenty replicates of each value of (K), for (K) = 2 through 30, were run with a burn-in of 20,000 iterations followed by 50,000 Markov chain Monte Carlo

(MCMC) iterations. All loci were assumed to independent and in linkage equilibrium, and we employed the admixture ancestry model with correlated allele frequencies. The

LOCPRIOR model was used with the 16 individuals of each tall fescue cultivar, collection, or accession serving as a natural group/population. The LOCPRIOR model of

STRUCTURE 2.3.4 was used because this model allows population structure to be detected in cases of weak population signal, but is not biased toward detected population structure when it does not exist (Hubisz et al. 2009). The most parsimonious value of (K) was determined using STRUCTURE HARVESTER 0.6.94 (Earl and vonHoldt, 2012) to determine the maximal value of the average estimated log probability of Pr(X|K) and the

Evanno ad hoc Δ(K) statistic (Evanno et al, 2005) across all replicates and runs of (K).

Results and Discussion nuSSR summary statistics

SSR marker primer sequences and summary statistics for the 2 EST-SSRs and 11 nuclear genomic SSRs (13 total nuSSRs) markers used in the current study are presented in Table 2. All 13 nuSSR markers generated reproducible and discrete alleles, with well- defined peaks during data collection. The 13 nuSSR marker primer pairs amplified 573

62 alleles in the 98 study entries. The number of alleles for individual nuSSR marker ranged from 18 to 73, with an average of 44.1 alleles per SSR. The EST-SSRs generated between

19 and 29 alleles with an average of 24.0 alleles per SSR, while the genomic SSRs generated between 18 and 73 allele with an average of 47.7 alleles per SSR. The high number of alleles per nuSSR is likely due to the high number of individuals assessed (1568 individuals) and that the majority of individuals in our study were polyploid. The PIC values approached 0.50 (the maximum PIC value for dominant markers) for each allele in many of the nuSSR markers (Table 2), confirming that most nuSSR markers produced numerous, highly polymorphic alleles.

cpSSR and haplotype summary statistics

SSR marker primer sequences and summary statistics for the cpSSR markers used in the current study are presented in (Table 3). All cpSSR markers used in this study generated reproducible, well-defined, and discrete alleles during data collection.

Additionally, because of the haploid nature of the chloroplast genome, all cpSSR markers produce single peaks, as expected. The 18 cpSSR marker primer pairs amplified 80 alleles in the 98 study entries. The number of alleles for individual cpSSR markers ranged from 2 to 9 (Table 3), with an average of 4.4 alleles per cpSSR. The total number of haplotypes produced by the 18 cpSSR markers was 135, with a total of 107 private haplotypes in the

1568 individuals, here a private haplotype is defined as a haplotype that only occurs in 1 population. The number of haplotypes per entry ranged from 1 to 9, with an average of 2.6 haplotypes per population (Table 4).

Table 4- Chloroplast SSR Population Summary Statistics. N: Sample size in each population A: Number of haplotypes detected in each population P: Number of private haplotypes N_e: Effective number of haplotypes R_h: Haplotypic richness H_e: Genetic diversity D^2_sh: Mean genetic distance between individuals Population A P N_e R_h H_e D^2_sh A11-1727 Agouti, Morocco 3 1 1.471 2.000 0.342 0.044 A11-1753 Tisi-n-Ouano, Morocco 2 0 1.133 1.000 0.125 0.007 A11-1768 Dolomiti, Italy 4 2 1.488 3.000 0.350 8.419 A11-1777 Dolomiti, Italy 3 1 1.293 2.000 0.242 8.066 A11-1781 Amelago, Morocco 5 2 2.327 4.000 0.608 0.077 A11-1783 Amelago, Morocco 6 1 4.741 5.000 0.842 21.735 A11-1785 Amelago, Morocco 9 6 5.818 8.000 0.883 52.798 A11-1790 Domnesti, Romania 2 1 1.133 1.000 0.125 0.007 A11-1793 Amelago, Morocco 3 1 2.246 2.000 0.592 0.044 A11-1803 Taddamout, Morocco 5 4 2.783 4.000 0.683 45.170 A11-1805 Mirano, Italy 2 0 1.280 1.000 0.233 0.013 A11-1806 Mirano, Italy 3 0 1.855 2.000 0.492 0.581 A11-1808 Ait-Rhiat, Morocco 6 4 2.723 5.000 0.675 1.120 A11-1810 Aquelmorys, Morocco 3 1 2.246 2.000 0.592 0.044 A11-1811 Domnesti, Romania 2 0 1.133 1.000 0.125 0.007 A11-1813 Domnesti, Romania 1 0 1.000 0.000 0.000 0.000 A11-1814 Ait-Kermouss, Morocco 4 4 2.510 3.000 0.642 0.081 A11-1820 Ait-Kermouss, Morocco 3 3 1.855 2.000 0.492 0.057 A11-1822 Domnesti, Romania 1 0 1.000 0.000 0.000 0.000 A11-1846 Domnesti, Romania 3 1 1.293 2.000 0.242 0.067 A12-1104 Monti Mariella, Italy 2 2 1.133 1.000 0.125 0.007 A12-1106 Derebucak, Turkey 1 0 1.000 0.000 0.000 0.000 A12-1115 Roccadi Cambio, Italy 4 1 1.488 3.000 0.350 0.070 A12-1118 Assergi, Italy 3 0 1.293 2.000 0.242 0.037 A12-1124 Capitigano, Italy 1 0 1.000 0.000 0.000 0.000 A12-1133 Zorzoi, Italy 3 1 1.471 2.000 0.342 0.022 A12-1136 Zorzoi, Italy 1 0 1.000 0.000 0.000 0.000 A12-1145 Yanigodan, Turkey 2 1 1.133 1.000 0.125 0.007 A12-1148 Tarasci, Turkey 2 0 1.133 1.000 0.125 0.028 A12-1149 Zorzoi, Italy 2 0 1.280 1.000 0.233 0.013 A12-1152 Zorzoi, Italy 2 1 1.133 1.000 0.125 0.007 A12-1162 Zorzoi, Italy 4 4 3.122 3.000 0.725 0.225 A12-1163 Ibel Azourki, Morocco 3 3 2.246 2.000 0.592 0.240 A12-1168 Dolomiti, Italy 2 0 1.133 1.000 0.125 0.007 A12-1169 Kemeri, Latvia 3 2 1.471 2.000 0.342 0.131 A13-1511 Sarika, Turkey 2 0 1.133 1.000 0.125 0.007 A13-1514 Sarika, Turkey 3 0 1.293 2.000 0.242 0.037 A13-1521 Sarika, Turkey 3 1 1.471 2.000 0.342 0.022

A13-1524 Sarika, Turkey 2 0 1.133 1.000 0.125 0.063 A13-1533 Krusje, Macedonia 1 0 1.000 0.000 0.000 0.000 A13-1534 Debar, Macedonia 1 0 1.000 0.000 0.000 0.000 A13-1535 Debar, Macedonia 1 0 1.000 0.000 0.000 0.000 A13-1536 Korce, Albania 1 0 1.000 0.000 0.000 0.000 A13-1537 Xibracke, Albania 2 1 1.133 1.000 0.125 0.007 A13-1538 Xibracke, Albania 1 1 1.000 0.000 0.000 0.000 A13-1541 Xibracke, Albania 4 3 1.488 3.000 0.350 0.137 A13-1543 Karuk, Montenegro 4 1 2.169 3.000 0.575 0.533 A13-1546 Kolasm, Montenegro 1 0 1.000 0.000 0.000 0.000 A13-1549 Kolasm, Montenegro 1 0 1.000 0.000 0.000 0.000 A13-1552 Valikarda, Montenegro 1 0 1.000 0.000 0.000 0.000 A13-1554 Belcista, Montenegro 1 0 1.000 0.000 0.000 0.000 A13-1562 Belcista, Macedonia 1 0 1.000 0.000 0.000 0.000 A13-1563 Dusegubica, Macedonia 1 0 1.000 0.000 0.000 0.000 A13-1566 Sribca, Macedonia 2 0 1.133 1.000 0.125 0.007 A13-1569 Tigveni, Romania 2 1 1.133 1.000 0.125 0.028 A13-1574 Sovata, Romania 1 0 1.000 0.000 0.000 0.000 A13-1580 Santioara, Romania 2 1 1.133 1.000 0.125 0.007 A13-1582 Luna, Romania 1 0 1.000 0.000 0.000 0.000 A13-1788 Zorzoi, Italy 6 3 2.032 5.000 0.542 0.356 A13-1789 Zorzoi, Italy 2 0 1.133 1.000 0.125 0.007 A13-783 Camlibel, Turkey 2 1 1.133 1.000 0.125 0.028 A13-785 Camlibel, Turkey 1 0 1.000 0.000 0.000 0.000 A13-792 Erciyes Dagi, Turkey 2 0 1.133 1.000 0.125 0.028 A13-795 Erciyes Dagi, Turkey 4 0 2.370 3.000 0.617 0.188 A13-799 Erciyes Dagi, Turkey 1 0 1.000 0.000 0.000 0.000 Atlas 2 0 2.000 1.000 0.533 0.741 B23 2 0 1.882 1.000 0.500 0.028 Bizem 1 0 1.000 0.000 0.000 0.000 CCR2 3 0 1.471 2.000 0.342 0.044 F711 2 0 1.438 1.000 0.325 0.018 Fawn 3 2 1.471 2.000 0.342 0.322 JesupMaxQ 1 0 1.000 0.000 0.000 0.000 Kentucky 31 3 1 1.293 2.000 0.242 0.176 Lolium perenne - Derby Xtreme 7 7 2.844 6.000 0.692 0.422 LSD 1 0 1.000 0.000 0.000 0.000 MET1 2 0 1.438 1.000 0.325 0.018 MET2 2 0 1.280 1.000 0.233 0.013 MET3 1 0 1.000 0.000 0.000 0.000

PI193145 Lolium multiflorum - 7 4 3.368 6.000 0.750 1.346 Gulf PI198088 Festuca arundinacea 5 4 2.327 4.000 0.608 0.625 ssp. letourneuxiana PI208679 Festuca arundinacea 2 1 1.133 1.000 0.125 0.007 ssp. letourneuxiana PI255417 - Festuca pratensis 2 2 1.133 1.000 0.125 2.507 PI283313 Festuca mairei 4 4 2.510 3.000 0.642 1.166 PI289651 Festuca arundinacea 4 3 2.510 3.000 0.642 9.200 var. glaucescens PI289654 - Festuca arundinacea 1 1 1.000 0.000 0.000 0.000 var. glaucescens PI577096 Festuca arundinacea 2 1 1.280 1.000 0.233 0.013 ssp. atlantigena PI595048 Festuca arundinacea 5 3 2.560 4.000 0.650 0.798 var. glaucescens PI610941 Festuca mairei 3 3 1.293 2.000 0.242 0.033 PI648355 Lolium multiflorum - 5 2 3.200 4.000 0.733 3.598 Floregon PI662636 Festuca pratensis 5 5 3.765 4.000 0.783 0.348 Regenerate 2 0 1.133 1.000 0.125 0.007 RZ-2 1 0 1.000 0.000 0.000 0.000 T31 2 0 1.753 1.000 0.458 0.025 Teton 4 2 2.246 3.000 0.592 0.733 U93 1 0 1.000 0.000 0.000 0.000 W41 1 0 1.000 0.000 0.000 0.000 W45 3 0 1.293 2.000 0.242 0.037 ZW44 2 0 1.133 1.000 0.125 0.028 Mean 2.582 1.071 1.573 1.582 0.267 1.662

Festuca and Lolium species and sub-species relationships based on nuSSR AMOVA, Morphotype Assignment, Pairwise ΦPT Values, interpopulation pairwise genetic distance and neighbor joining tree analysis

AMOVA results for the nuSSR markers showed that a majority of the total nuSSR marker variation (75%) was due to within-population variance, however a significant portion (25%) was due to differences between populations. Within population variance based on nuSSR markers was spread relatively uniformly among the entries, ranging from

0.49% for A12-1106 from Derebucak, Turkey to 1.83% for A13-1554 from Belcistca,

Macedonia.

The nuSSR marker inter-population pairwise genetic-distance values (pairwise ΦPT values from AMOVA) between entries are presented in Table 5. All pairwise ΦPT were significant at P < 0.050, except between ‘Lolium multiflorum PI193145’ and ‘Lolium multiflorum PI648355’ (P=0.441). The Lolium mutliflorum populations being statistically indistinguishable suggests that this marker set may not be useful to discriminate between annual ryegrass populations. This is not surprising since this marker set was designed using tall fescue and screened to find polymorphism using tall fescue cultivars.

The neighbor-joining dendrogram (Figure 1) is a visual representation of the DICE genetic distances based on the nuSSR markers. The tree was rooted using the Lolium perenne cultivar ‘Derby Xtreme.’ Moving inward from the rooted population, the next most basal branches were both of the Festuca pratensis populations (PI662651 and

PI255417), followed by a group of Festuca arundinacea var. glaucescens (PI 289654 and

PI 289651). Finding the distance between hexaploid tall fescue and Festuca arundinacea var. glaucescens is less than the distance between Festuca pratensis and hexaploid tall fescue agrees with Cheng et al. (2016) who also found that the distance between hexaploid tall fescue and Festuca arundinacea var. glaucescens is less than the distance between hexaploid tall fescue and Festuca pratensis. Next most basal group is a group of the

Mediterranean polyploid Festuca species and subspecies containing two sister groups, one composed of Festuca maieri accessions and one composed of Festuca arundinacea subsp. atlantigena and Festuca arundinacea subsp. letourneuxiana, all individuals in this group had the Mediterranean allele from Chl045. The next most basal group was made up of

Mediterranean hexaploid tall fescue, as defined by the results of Chl045. The

Mediterranean Festuca entries forming a separate group from the Continental moprhotype is expected, and agrees with earlier phylogenies of Festuca using nuclear markers (Charmet et al, 1997; Gaut et al, 2000; Hand et al, 2012). The next most basal group is Lolium multiflorum. This separation of Lolium perenne and Lolium multiflorum agrees with previous work based on genomic Lolium perenne and Lolium mutliflorum SSRs (Momotaz et al, 2004) but disagrees with other phylogenies of Festuca and Lolium based on ITS sequence andgenomic Lolium perenne SSRs (Charmet et al, 1997; Gaut et al, 2000; Catalán et al, 2004; Inda et al 2008; Hand et al, 2012) which found Lolium forming a monophyletic group. This discrepancy could be an artifact of the markers selected in this study, which were mostly tall fescue genomic SSRs. The continental tall fescue populations form one group, with the exception of an accession of Festuca arundinacea var. glaucescens

(PI595048), which clusters close to ‘Kentucky 31’ and its derivative ‘JesupMaxQ’ (Bouton et al, 1997).

Figure 1- Neighbor-Joining Tree based on nuclear SSR Markers. The shape to the left of the node name is the result of Chl045 marker to determine morphotype. An open circle represents that all 16 individuals have the continental allele, a filled circle represents that all individuals have the Mediterranean allele. An open square represents that 15 individuals has the continental allele while 1 individual has the Mediterranean allele. A filled square represents that that 15 individuals have the Mediterranean allele while 1 individual has the Continental allele. A filled triangle represents that there is mixture of the two alleles. Numbers at nodes are support values, only values great than 70 are shown.

Table 5 - Nuclear SSR PhiPTP values. PhiPT values and probability P(rand >= data) based on 999 permutations is shown above diagonal. Numbers in top row and first column reference Table 1 for entry.

1 2 3 4 5 6 7 8 1 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.113 0.000 0.001 0.001 0.001 0.001 0.001 0.001 3 0.264 0.261 0.000 0.001 0.001 0.001 0.001 0.001 4 0.280 0.270 0.132 0.000 0.001 0.001 0.001 0.001 5 0.286 0.280 0.224 0.252 0.000 0.001 0.001 0.001 6 0.180 0.157 0.223 0.229 0.222 0.000 0.001 0.001 7 0.178 0.161 0.180 0.161 0.199 0.150 0.000 0.001 8 0.309 0.310 0.282 0.338 0.168 0.286 0.243 0.000 9 0.163 0.161 0.263 0.278 0.279 0.175 0.177 0.312 10 0.153 0.160 0.133 0.166 0.132 0.114 0.112 0.186 11 0.267 0.259 0.187 0.211 0.192 0.197 0.189 0.248 12 0.271 0.266 0.222 0.244 0.220 0.235 0.210 0.272 13 0.230 0.248 0.343 0.383 0.373 0.216 0.278 0.415 14 0.215 0.205 0.292 0.307 0.287 0.161 0.221 0.338 15 0.244 0.236 0.220 0.228 0.142 0.202 0.140 0.163 16 0.324 0.329 0.298 0.344 0.218 0.243 0.240 0.326 17 0.189 0.214 0.313 0.345 0.319 0.185 0.241 0.360 18 0.134 0.153 0.272 0.300 0.301 0.189 0.205 0.354 19 0.246 0.244 0.219 0.262 0.146 0.205 0.163 0.104 20 0.315 0.305 0.236 0.249 0.181 0.233 0.185 0.223

21 0.261 0.231 0.231 0.258 0.246 0.219 0.194 0.259 22 0.371 0.362 0.380 0.404 0.377 0.367 0.344 0.455 23 0.284 0.273 0.165 0.254 0.209 0.239 0.201 0.287 24 0.302 0.266 0.239 0.274 0.238 0.234 0.201 0.316 25 0.254 0.234 0.153 0.212 0.190 0.228 0.169 0.225 26 0.309 0.324 0.145 0.186 0.295 0.285 0.246 0.353 27 0.302 0.292 0.208 0.222 0.233 0.226 0.201 0.313 28 0.305 0.293 0.296 0.312 0.292 0.261 0.237 0.328 29 0.280 0.273 0.148 0.165 0.227 0.264 0.183 0.285 30 0.259 0.263 0.110 0.129 0.228 0.231 0.185 0.291 31 0.306 0.313 0.162 0.218 0.280 0.282 0.235 0.345 32 0.243 0.263 0.341 0.368 0.348 0.232 0.302 0.419 33 0.188 0.241 0.294 0.320 0.287 0.171 0.211 0.360 34 0.350 0.356 0.216 0.251 0.355 0.328 0.314 0.431 35 0.251 0.246 0.180 0.232 0.290 0.245 0.223 0.321 36 0.264 0.249 0.262 0.294 0.247 0.220 0.211 0.289 37 0.245 0.240 0.280 0.271 0.229 0.246 0.204 0.296 38 0.282 0.247 0.293 0.315 0.309 0.268 0.256 0.354 39 0.264 0.220 0.278 0.253 0.279 0.233 0.183 0.335 40 0.244 0.253 0.263 0.258 0.281 0.252 0.189 0.319 41 0.199 0.220 0.215 0.200 0.201 0.218 0.141 0.239 42 0.209 0.231 0.225 0.233 0.239 0.222 0.170 0.301 43 0.220 0.240 0.252 0.252 0.229 0.243 0.204 0.305 44 0.249 0.266 0.247 0.235 0.211 0.205 0.181 0.269 45 0.261 0.261 0.252 0.258 0.203 0.232 0.188 0.286 46 0.296 0.298 0.299 0.289 0.260 0.295 0.220 0.331 47 0.212 0.191 0.155 0.119 0.177 0.175 0.137 0.216 48 0.331 0.328 0.336 0.345 0.314 0.323 0.293 0.356 49 0.218 0.222 0.228 0.198 0.211 0.208 0.167 0.240 50 0.230 0.245 0.217 0.231 0.211 0.198 0.157 0.251 51 0.217 0.229 0.207 0.222 0.222 0.208 0.180 0.248 52 0.225 0.245 0.212 0.235 0.231 0.232 0.168 0.271 53 0.235 0.248 0.255 0.238 0.231 0.232 0.219 0.265 54 0.228 0.232 0.207 0.233 0.188 0.187 0.196 0.254 55 0.306 0.315 0.300 0.303 0.311 0.302 0.276 0.383 56 0.214 0.214 0.202 0.192 0.183 0.194 0.186 0.288 57 0.240 0.244 0.249 0.221 0.209 0.190 0.184 0.281 58 0.294 0.263 0.306 0.271 0.285 0.237 0.202 0.321 59 0.223 0.224 0.166 0.153 0.228 0.213 0.178 0.275 60 0.258 0.254 0.196 0.194 0.253 0.234 0.185 0.265 61 0.332 0.325 0.321 0.334 0.346 0.300 0.278 0.420 62 0.329 0.325 0.342 0.356 0.342 0.314 0.291 0.428 63 0.275 0.264 0.271 0.274 0.253 0.243 0.197 0.336 64 0.240 0.210 0.227 0.224 0.203 0.189 0.164 0.246 65 0.343 0.334 0.345 0.354 0.326 0.323 0.295 0.380

66 0.264 0.260 0.212 0.204 0.209 0.223 0.142 0.255 67 0.265 0.258 0.228 0.265 0.159 0.193 0.186 0.255 68 0.273 0.272 0.202 0.248 0.181 0.223 0.171 0.253 69 0.282 0.268 0.233 0.258 0.190 0.208 0.217 0.249 70 0.263 0.243 0.218 0.236 0.154 0.195 0.176 0.244 71 0.291 0.284 0.237 0.238 0.203 0.235 0.184 0.280 72 0.215 0.205 0.182 0.166 0.167 0.172 0.148 0.198 73 0.182 0.184 0.168 0.159 0.148 0.147 0.122 0.171 74 0.247 0.236 0.292 0.291 0.278 0.206 0.220 0.333 75 0.210 0.204 0.179 0.178 0.111 0.165 0.128 0.186 76 0.258 0.258 0.219 0.250 0.192 0.184 0.168 0.251 77 0.264 0.266 0.206 0.227 0.170 0.180 0.168 0.243 78 0.223 0.226 0.200 0.214 0.147 0.179 0.118 0.196 79 0.215 0.224 0.217 0.245 0.195 0.154 0.173 0.251 80 0.273 0.288 0.349 0.413 0.398 0.288 0.321 0.442 81 0.253 0.251 0.334 0.354 0.348 0.221 0.280 0.411 82 0.288 0.278 0.320 0.331 0.314 0.256 0.260 0.354 83 0.321 0.302 0.293 0.344 0.320 0.277 0.281 0.396 84 0.205 0.209 0.268 0.276 0.239 0.189 0.200 0.311 85 0.230 0.226 0.301 0.321 0.320 0.246 0.250 0.356 86 0.278 0.239 0.313 0.344 0.283 0.214 0.260 0.374 87 0.221 0.207 0.192 0.177 0.196 0.169 0.149 0.225 88 0.281 0.268 0.304 0.349 0.327 0.233 0.260 0.395 89 0.224 0.232 0.215 0.238 0.211 0.167 0.174 0.240 90 0.196 0.203 0.263 0.283 0.254 0.207 0.186 0.290 91 0.238 0.224 0.190 0.214 0.139 0.180 0.167 0.236 92 0.270 0.268 0.219 0.231 0.156 0.213 0.179 0.226 93 0.193 0.188 0.182 0.158 0.147 0.142 0.102 0.207 94 0.203 0.206 0.201 0.233 0.165 0.159 0.158 0.220 95 0.289 0.295 0.225 0.263 0.211 0.225 0.213 0.266 96 0.255 0.260 0.197 0.218 0.160 0.202 0.163 0.243 97 0.249 0.245 0.187 0.211 0.136 0.183 0.133 0.215 98 0.234 0.229 0.183 0.202 0.115 0.169 0.156 0.211

9 10 11 12 13 14 15 16 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 4 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.149 0.000 0.001 0.001 0.001 0.001 0.001 0.001 11 0.262 0.141 0.000 0.001 0.001 0.001 0.001 0.001 12 0.272 0.179 0.124 0.000 0.001 0.001 0.001 0.001 13 0.239 0.234 0.345 0.360 0.000 0.001 0.001 0.001 14 0.216 0.166 0.281 0.299 0.260 0.000 0.001 0.001 15 0.249 0.110 0.170 0.170 0.355 0.248 0.000 0.001 16 0.318 0.195 0.251 0.290 0.422 0.328 0.233 0.000 17 0.189 0.192 0.305 0.296 0.161 0.252 0.297 0.358 18 0.174 0.152 0.291 0.293 0.207 0.200 0.281 0.346 19 0.251 0.130 0.164 0.200 0.349 0.256 0.063 0.231 20 0.291 0.156 0.200 0.257 0.394 0.288 0.167 0.263 21 0.251 0.173 0.216 0.225 0.309 0.254 0.178 0.321 22 0.367 0.269 0.410 0.405 0.500 0.420 0.373 0.441 23 0.261 0.135 0.240 0.233 0.360 0.269 0.225 0.276 24 0.289 0.178 0.259 0.279 0.330 0.242 0.222 0.324 25 0.214 0.127 0.215 0.225 0.311 0.243 0.205 0.251 26 0.311 0.213 0.285 0.263 0.384 0.334 0.283 0.406 27 0.290 0.162 0.190 0.242 0.358 0.291 0.206 0.272 28 0.297 0.205 0.275 0.286 0.395 0.303 0.242 0.350 29 0.267 0.140 0.195 0.189 0.359 0.301 0.186 0.344 30 0.258 0.143 0.185 0.208 0.331 0.281 0.193 0.320 31 0.296 0.196 0.264 0.270 0.360 0.318 0.248 0.370 32 0.225 0.245 0.359 0.371 0.225 0.303 0.356 0.391 33 0.191 0.164 0.310 0.321 0.245 0.218 0.266 0.335 34 0.360 0.245 0.314 0.328 0.418 0.376 0.316 0.452 35 0.279 0.192 0.223 0.238 0.357 0.296 0.240 0.360 36 0.257 0.173 0.261 0.269 0.346 0.281 0.224 0.282 37 0.223 0.192 0.265 0.266 0.362 0.288 0.240 0.310 38 0.292 0.205 0.276 0.303 0.387 0.313 0.288 0.351 39 0.271 0.185 0.255 0.266 0.359 0.293 0.241 0.323 40 0.257 0.186 0.272 0.220 0.335 0.280 0.221 0.337 41 0.188 0.134 0.231 0.204 0.312 0.243 0.173 0.279 42 0.240 0.174 0.246 0.225 0.314 0.251 0.197 0.298 43 0.235 0.174 0.255 0.248 0.337 0.261 0.214 0.285 44 0.230 0.156 0.249 0.236 0.320 0.234 0.200 0.282 45 0.241 0.167 0.255 0.226 0.329 0.276 0.176 0.299 46 0.264 0.194 0.300 0.232 0.404 0.327 0.239 0.330 47 0.192 0.125 0.141 0.151 0.297 0.206 0.149 0.211 48 0.283 0.259 0.345 0.323 0.412 0.312 0.297 0.382

49 0.197 0.154 0.204 0.204 0.311 0.244 0.174 0.230 50 0.209 0.141 0.201 0.193 0.308 0.242 0.166 0.257 51 0.177 0.168 0.221 0.197 0.288 0.230 0.188 0.263 52 0.225 0.156 0.227 0.218 0.295 0.259 0.182 0.269 53 0.233 0.167 0.220 0.194 0.323 0.254 0.179 0.296 54 0.224 0.162 0.196 0.200 0.289 0.232 0.182 0.267 55 0.297 0.254 0.322 0.282 0.400 0.326 0.270 0.372 56 0.214 0.145 0.220 0.243 0.293 0.257 0.214 0.290 57 0.245 0.163 0.239 0.246 0.319 0.253 0.203 0.281 58 0.272 0.217 0.293 0.285 0.351 0.281 0.241 0.350 59 0.184 0.150 0.201 0.194 0.312 0.252 0.215 0.285 60 0.229 0.157 0.230 0.214 0.323 0.279 0.220 0.289 61 0.331 0.238 0.327 0.352 0.448 0.382 0.338 0.400 62 0.332 0.255 0.333 0.355 0.452 0.373 0.337 0.391 63 0.274 0.181 0.256 0.260 0.377 0.321 0.233 0.317 64 0.235 0.163 0.217 0.208 0.324 0.254 0.193 0.239 65 0.336 0.258 0.343 0.342 0.444 0.371 0.320 0.392 66 0.282 0.142 0.219 0.247 0.384 0.285 0.179 0.240 67 0.250 0.132 0.231 0.191 0.336 0.250 0.115 0.176 68 0.257 0.136 0.220 0.185 0.366 0.271 0.121 0.228 69 0.268 0.160 0.202 0.189 0.366 0.268 0.164 0.224 70 0.236 0.133 0.217 0.186 0.348 0.250 0.147 0.205 71 0.300 0.167 0.235 0.288 0.396 0.309 0.192 0.241 72 0.217 0.107 0.154 0.130 0.290 0.213 0.115 0.211 73 0.204 0.101 0.139 0.134 0.265 0.192 0.076 0.202 74 0.237 0.191 0.268 0.265 0.305 0.257 0.258 0.341 75 0.189 0.092 0.159 0.169 0.303 0.192 0.121 0.172 76 0.255 0.142 0.216 0.175 0.339 0.269 0.147 0.195 77 0.240 0.121 0.209 0.163 0.350 0.260 0.105 0.190 78 0.217 0.110 0.162 0.136 0.328 0.219 0.074 0.227 79 0.215 0.153 0.206 0.203 0.267 0.217 0.170 0.251 80 0.265 0.236 0.405 0.401 0.349 0.361 0.398 0.478 81 0.279 0.216 0.343 0.348 0.327 0.304 0.345 0.403 82 0.278 0.229 0.296 0.322 0.340 0.293 0.286 0.378 83 0.283 0.232 0.337 0.308 0.366 0.352 0.328 0.417 84 0.185 0.166 0.258 0.243 0.257 0.240 0.231 0.279 85 0.234 0.202 0.302 0.299 0.281 0.267 0.298 0.357 86 0.265 0.188 0.320 0.300 0.320 0.304 0.316 0.386 87 0.237 0.127 0.163 0.185 0.308 0.207 0.121 0.259 88 0.250 0.232 0.343 0.288 0.346 0.315 0.297 0.386 89 0.229 0.157 0.219 0.229 0.311 0.233 0.168 0.261

90 0.219 0.172 0.241 0.234 0.303 0.250 0.216 0.295 91 0.210 0.112 0.182 0.184 0.315 0.220 0.142 0.187 92 0.231 0.139 0.213 0.181 0.354 0.268 0.125 0.197 93 0.218 0.091 0.133 0.171 0.278 0.198 0.116 0.198 94 0.194 0.118 0.185 0.135 0.307 0.212 0.112 0.204 95 0.278 0.142 0.189 0.180 0.373 0.288 0.153 0.205 96 0.246 0.147 0.208 0.142 0.338 0.250 0.131 0.196 97 0.245 0.103 0.173 0.165 0.347 0.245 0.101 0.173 98 0.219 0.090 0.134 0.138 0.322 0.226 0.095 0.189

17 18 19 20 21 22 23 24 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 4 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 11 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.001 0.002 0.001 0.001 0.001 0.001 0.001 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.194 0.000 0.001 0.001 0.001 0.001 0.001 0.001 19 0.290 0.268 0.000 0.001 0.001 0.001 0.001 0.001 20 0.326 0.323 0.079 0.000 0.001 0.001 0.001 0.001 21 0.285 0.263 0.235 0.261 0.000 0.001 0.001 0.001 22 0.440 0.395 0.386 0.443 0.397 0.000 0.001 0.001 23 0.316 0.272 0.228 0.243 0.212 0.281 0.000 0.001 24 0.310 0.308 0.269 0.307 0.193 0.435 0.253 0.000 25 0.272 0.261 0.184 0.218 0.213 0.301 0.102 0.197 26 0.372 0.323 0.310 0.346 0.232 0.480 0.279 0.247 27 0.324 0.292 0.248 0.273 0.218 0.452 0.236 0.207 28 0.360 0.316 0.256 0.298 0.276 0.254 0.234 0.353 29 0.314 0.292 0.239 0.257 0.195 0.421 0.205 0.224 30 0.304 0.276 0.230 0.257 0.176 0.403 0.215 0.161

31 0.344 0.319 0.272 0.301 0.200 0.458 0.265 0.218 32 0.205 0.241 0.347 0.397 0.318 0.468 0.355 0.360 33 0.202 0.171 0.279 0.320 0.279 0.421 0.316 0.292 34 0.402 0.367 0.344 0.384 0.322 0.553 0.349 0.280 35 0.329 0.284 0.260 0.306 0.233 0.415 0.252 0.291 36 0.292 0.274 0.237 0.290 0.204 0.267 0.201 0.288 37 0.314 0.264 0.257 0.302 0.229 0.280 0.212 0.286 38 0.338 0.315 0.283 0.331 0.256 0.348 0.269 0.323 39 0.326 0.286 0.271 0.273 0.230 0.339 0.240 0.296 40 0.294 0.274 0.253 0.294 0.259 0.362 0.254 0.295 41 0.265 0.249 0.194 0.235 0.192 0.290 0.207 0.230 42 0.275 0.241 0.230 0.257 0.223 0.324 0.233 0.269 43 0.283 0.267 0.219 0.253 0.223 0.399 0.261 0.226 44 0.261 0.256 0.223 0.244 0.245 0.375 0.247 0.258 45 0.261 0.280 0.206 0.246 0.240 0.419 0.246 0.263 46 0.347 0.309 0.239 0.286 0.296 0.415 0.274 0.315 47 0.257 0.217 0.146 0.156 0.170 0.292 0.184 0.207 48 0.356 0.347 0.293 0.328 0.306 0.452 0.327 0.344 49 0.250 0.245 0.194 0.209 0.207 0.302 0.226 0.267 50 0.262 0.235 0.158 0.168 0.190 0.356 0.199 0.238 51 0.253 0.247 0.192 0.227 0.207 0.323 0.227 0.208 52 0.277 0.229 0.199 0.235 0.217 0.358 0.229 0.261 53 0.271 0.275 0.218 0.273 0.197 0.373 0.250 0.248 54 0.260 0.240 0.213 0.247 0.140 0.349 0.208 0.198 55 0.358 0.336 0.313 0.355 0.302 0.436 0.315 0.336 56 0.270 0.219 0.226 0.268 0.211 0.359 0.228 0.209 57 0.282 0.245 0.227 0.262 0.189 0.377 0.239 0.226 58 0.326 0.298 0.264 0.316 0.285 0.391 0.288 0.283 59 0.269 0.238 0.227 0.245 0.205 0.356 0.209 0.227 60 0.276 0.265 0.254 0.263 0.204 0.367 0.239 0.241 61 0.397 0.343 0.351 0.372 0.308 0.356 0.278 0.354 62 0.400 0.351 0.350 0.381 0.311 0.351 0.291 0.336 63 0.329 0.273 0.259 0.301 0.240 0.271 0.218 0.299 64 0.264 0.239 0.212 0.227 0.176 0.257 0.194 0.249 65 0.387 0.348 0.330 0.371 0.339 0.345 0.291 0.391 66 0.339 0.270 0.201 0.248 0.232 0.380 0.232 0.262 67 0.263 0.268 0.151 0.161 0.204 0.338 0.195 0.237 68 0.307 0.275 0.172 0.186 0.169 0.393 0.205 0.245 69 0.309 0.275 0.190 0.212 0.214 0.375 0.225 0.268 70 0.269 0.251 0.174 0.154 0.176 0.363 0.203 0.251 71 0.341 0.317 0.214 0.262 0.268 0.405 0.276 0.234

72 0.232 0.228 0.161 0.170 0.148 0.312 0.179 0.199 73 0.223 0.204 0.130 0.159 0.121 0.282 0.151 0.159 74 0.275 0.264 0.272 0.300 0.225 0.421 0.314 0.300 75 0.248 0.223 0.135 0.143 0.151 0.302 0.157 0.173 76 0.275 0.263 0.183 0.204 0.210 0.345 0.184 0.251 77 0.285 0.260 0.158 0.179 0.197 0.357 0.200 0.241 78 0.267 0.237 0.103 0.116 0.163 0.329 0.189 0.222 79 0.196 0.230 0.179 0.201 0.195 0.381 0.225 0.230 80 0.332 0.248 0.378 0.466 0.370 0.533 0.384 0.391 81 0.286 0.242 0.336 0.397 0.312 0.490 0.364 0.364 82 0.329 0.316 0.293 0.333 0.240 0.475 0.338 0.296 83 0.332 0.327 0.346 0.404 0.341 0.499 0.364 0.355 84 0.203 0.178 0.225 0.267 0.238 0.387 0.264 0.281 85 0.257 0.235 0.293 0.329 0.270 0.439 0.327 0.320 86 0.294 0.252 0.317 0.354 0.291 0.451 0.312 0.325 87 0.274 0.235 0.157 0.179 0.158 0.356 0.227 0.198 88 0.302 0.308 0.320 0.384 0.323 0.474 0.340 0.340 89 0.223 0.239 0.177 0.193 0.175 0.368 0.220 0.221 90 0.262 0.239 0.223 0.263 0.228 0.379 0.255 0.272 91 0.246 0.233 0.170 0.160 0.126 0.351 0.159 0.211 92 0.278 0.261 0.162 0.158 0.207 0.374 0.201 0.259 93 0.241 0.193 0.144 0.164 0.129 0.304 0.168 0.157 94 0.243 0.200 0.136 0.165 0.171 0.327 0.183 0.230 95 0.318 0.301 0.168 0.187 0.239 0.386 0.196 0.265 96 0.272 0.260 0.152 0.167 0.180 0.332 0.156 0.251 97 0.280 0.246 0.131 0.140 0.147 0.348 0.157 0.218 98 0.265 0.220 0.137 0.148 0.127 0.340 0.145 0.207

25 26 27 28 29 30 31 32 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 4 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 11 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 20 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 23 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 24 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 25 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 26 0.203 0.000 0.001 0.001 0.001 0.001 0.001 0.001 27 0.183 0.226 0.000 0.001 0.001 0.001 0.001 0.001 28 0.249 0.368 0.332 0.000 0.001 0.001 0.001 0.001 29 0.161 0.163 0.202 0.311 0.000 0.001 0.001 0.001 30 0.157 0.068 0.163 0.304 0.076 0.000 0.003 0.001 31 0.194 0.111 0.216 0.350 0.168 0.049 0.000 0.001 32 0.297 0.387 0.361 0.407 0.387 0.333 0.371 0.000 33 0.281 0.336 0.311 0.331 0.317 0.297 0.319 0.260 34 0.284 0.232 0.307 0.437 0.252 0.154 0.248 0.452 35 0.252 0.255 0.264 0.322 0.258 0.206 0.251 0.343 36 0.225 0.325 0.291 0.229 0.295 0.260 0.302 0.338 37 0.204 0.318 0.293 0.255 0.291 0.270 0.316 0.324 38 0.258 0.360 0.320 0.308 0.316 0.285 0.336 0.368 39 0.250 0.322 0.293 0.284 0.282 0.260 0.308 0.364 40 0.228 0.270 0.274 0.286 0.239 0.235 0.273 0.359 41 0.143 0.211 0.230 0.215 0.194 0.186 0.213 0.311 42 0.221 0.269 0.266 0.227 0.240 0.219 0.254 0.333 43 0.203 0.251 0.246 0.319 0.251 0.208 0.220 0.294 44 0.205 0.263 0.245 0.280 0.232 0.226 0.246 0.333 45 0.196 0.285 0.225 0.303 0.222 0.225 0.264 0.338 46 0.210 0.320 0.297 0.299 0.256 0.273 0.297 0.399 47 0.159 0.197 0.182 0.194 0.165 0.154 0.209 0.301 48 0.266 0.354 0.362 0.367 0.345 0.314 0.345 0.399 49 0.187 0.247 0.234 0.228 0.202 0.198 0.245 0.297 50 0.156 0.246 0.202 0.241 0.201 0.202 0.226 0.317 51 0.171 0.222 0.235 0.260 0.222 0.189 0.225 0.255 52 0.228 0.269 0.255 0.270 0.223 0.221 0.253 0.310 53 0.218 0.279 0.259 0.285 0.212 0.212 0.268 0.319

54 0.204 0.246 0.227 0.264 0.214 0.181 0.222 0.295 55 0.296 0.358 0.364 0.328 0.313 0.293 0.369 0.405 56 0.164 0.218 0.210 0.284 0.215 0.168 0.213 0.267 57 0.215 0.259 0.235 0.288 0.234 0.204 0.244 0.304 58 0.241 0.324 0.279 0.317 0.283 0.270 0.311 0.399 59 0.114 0.154 0.219 0.276 0.154 0.119 0.194 0.277 60 0.190 0.181 0.211 0.310 0.177 0.159 0.187 0.344 61 0.294 0.393 0.358 0.322 0.357 0.294 0.359 0.414 62 0.280 0.418 0.375 0.323 0.367 0.326 0.391 0.404 63 0.239 0.309 0.293 0.241 0.274 0.250 0.311 0.367 64 0.180 0.259 0.220 0.231 0.223 0.232 0.264 0.321 65 0.277 0.407 0.371 0.316 0.350 0.346 0.404 0.423 66 0.217 0.280 0.222 0.292 0.196 0.224 0.282 0.357 67 0.187 0.283 0.219 0.278 0.223 0.203 0.229 0.330 68 0.196 0.266 0.226 0.292 0.201 0.213 0.242 0.346 69 0.220 0.288 0.235 0.281 0.240 0.229 0.285 0.360 70 0.187 0.276 0.240 0.284 0.206 0.225 0.255 0.340 71 0.234 0.333 0.280 0.329 0.241 0.254 0.305 0.384 72 0.181 0.208 0.178 0.208 0.154 0.165 0.214 0.299 73 0.172 0.201 0.159 0.181 0.135 0.140 0.193 0.284 74 0.268 0.324 0.319 0.326 0.292 0.269 0.312 0.315 75 0.114 0.207 0.174 0.226 0.152 0.148 0.187 0.279 76 0.184 0.269 0.214 0.266 0.213 0.216 0.259 0.352 77 0.188 0.251 0.208 0.272 0.199 0.196 0.241 0.352 78 0.178 0.240 0.209 0.219 0.164 0.173 0.212 0.326 79 0.193 0.245 0.224 0.295 0.220 0.213 0.254 0.271 80 0.321 0.412 0.425 0.459 0.407 0.354 0.411 0.346 81 0.308 0.375 0.367 0.395 0.384 0.323 0.377 0.305 82 0.283 0.345 0.333 0.367 0.323 0.281 0.338 0.346 83 0.304 0.348 0.347 0.395 0.335 0.299 0.354 0.355 84 0.236 0.300 0.269 0.305 0.269 0.252 0.299 0.243 85 0.292 0.343 0.323 0.358 0.328 0.289 0.329 0.314 86 0.285 0.363 0.352 0.366 0.337 0.311 0.353 0.322 87 0.222 0.212 0.203 0.260 0.179 0.162 0.207 0.322 88 0.307 0.360 0.335 0.393 0.355 0.298 0.348 0.331 89 0.189 0.245 0.227 0.288 0.220 0.205 0.237 0.305 90 0.224 0.304 0.271 0.305 0.259 0.234 0.300 0.320 91 0.174 0.246 0.210 0.262 0.187 0.174 0.216 0.292 92 0.165 0.264 0.240 0.283 0.197 0.209 0.264 0.323 93 0.167 0.207 0.154 0.205 0.127 0.153 0.193 0.289 94 0.193 0.253 0.216 0.216 0.195 0.195 0.236 0.303

95 0.205 0.320 0.256 0.296 0.231 0.230 0.282 0.371 96 0.180 0.265 0.220 0.249 0.182 0.196 0.238 0.337 97 0.158 0.241 0.173 0.246 0.156 0.176 0.199 0.339 98 0.170 0.247 0.168 0.229 0.137 0.167 0.217 0.325

33 34 35 36 37 38 39 40 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 4 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 11 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 20 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 23 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 24 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 25 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 26 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 28 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 29 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 30 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 33 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.375 0.000 0.001 0.001 0.001 0.001 0.001 0.001 35 0.314 0.304 0.000 0.001 0.001 0.001 0.001 0.001

36 0.237 0.382 0.295 0.000 0.001 0.001 0.001 0.001 37 0.299 0.382 0.306 0.122 0.000 0.001 0.001 0.001 38 0.345 0.411 0.326 0.175 0.173 0.000 0.001 0.001 39 0.312 0.390 0.297 0.194 0.171 0.116 0.000 0.001 40 0.280 0.351 0.266 0.273 0.276 0.306 0.230 0.000 41 0.246 0.294 0.233 0.222 0.196 0.246 0.213 0.107 42 0.241 0.303 0.257 0.214 0.227 0.270 0.248 0.163 43 0.255 0.329 0.258 0.259 0.245 0.279 0.264 0.188 44 0.228 0.331 0.265 0.246 0.225 0.295 0.254 0.196 45 0.254 0.356 0.261 0.256 0.260 0.310 0.290 0.236 46 0.327 0.406 0.325 0.318 0.287 0.354 0.305 0.252 47 0.242 0.241 0.156 0.196 0.166 0.196 0.173 0.188 48 0.337 0.414 0.325 0.326 0.294 0.385 0.342 0.301 49 0.237 0.304 0.215 0.207 0.202 0.235 0.190 0.211 50 0.228 0.318 0.238 0.235 0.223 0.287 0.243 0.173 51 0.246 0.278 0.199 0.241 0.210 0.276 0.244 0.208 52 0.220 0.292 0.191 0.254 0.270 0.307 0.251 0.196 53 0.295 0.319 0.225 0.247 0.254 0.281 0.285 0.220 54 0.244 0.282 0.212 0.207 0.222 0.249 0.254 0.239 55 0.349 0.382 0.293 0.322 0.311 0.355 0.321 0.252 56 0.254 0.260 0.234 0.249 0.211 0.270 0.248 0.259 57 0.252 0.326 0.229 0.228 0.242 0.305 0.275 0.228 58 0.303 0.405 0.288 0.272 0.263 0.325 0.268 0.191 59 0.269 0.242 0.232 0.262 0.210 0.287 0.248 0.220 60 0.274 0.284 0.238 0.261 0.252 0.307 0.257 0.237 61 0.337 0.466 0.354 0.228 0.233 0.287 0.214 0.311 62 0.361 0.475 0.385 0.238 0.197 0.265 0.241 0.354 63 0.264 0.384 0.308 0.078 0.151 0.177 0.147 0.256 64 0.245 0.327 0.225 0.120 0.132 0.164 0.155 0.240 65 0.362 0.472 0.381 0.200 0.212 0.276 0.278 0.356 66 0.293 0.369 0.265 0.244 0.223 0.270 0.240 0.277 67 0.251 0.325 0.261 0.233 0.260 0.297 0.245 0.233 68 0.277 0.334 0.242 0.259 0.267 0.316 0.270 0.252 69 0.291 0.358 0.254 0.245 0.275 0.312 0.279 0.255 70 0.257 0.342 0.265 0.224 0.238 0.301 0.243 0.249 71 0.304 0.381 0.291 0.277 0.258 0.334 0.281 0.303 72 0.240 0.269 0.154 0.206 0.210 0.249 0.209 0.173 73 0.223 0.243 0.150 0.177 0.182 0.203 0.187 0.168 74 0.305 0.401 0.301 0.279 0.279 0.333 0.281 0.305 75 0.237 0.282 0.216 0.206 0.173 0.244 0.194 0.194 76 0.285 0.335 0.265 0.244 0.249 0.304 0.256 0.215

77 0.258 0.311 0.266 0.236 0.258 0.308 0.250 0.217 78 0.241 0.310 0.225 0.216 0.223 0.264 0.208 0.194 79 0.227 0.314 0.237 0.241 0.243 0.289 0.256 0.225 80 0.285 0.498 0.396 0.366 0.375 0.426 0.415 0.407 81 0.274 0.454 0.351 0.324 0.333 0.370 0.359 0.347 82 0.334 0.413 0.325 0.310 0.309 0.351 0.323 0.335 83 0.348 0.428 0.339 0.346 0.343 0.382 0.358 0.314 84 0.258 0.380 0.279 0.252 0.237 0.289 0.263 0.252 85 0.300 0.407 0.282 0.285 0.287 0.318 0.290 0.305 86 0.314 0.437 0.335 0.311 0.311 0.350 0.322 0.334 87 0.265 0.290 0.178 0.235 0.230 0.255 0.231 0.208 88 0.325 0.413 0.305 0.338 0.337 0.371 0.341 0.276 89 0.232 0.329 0.241 0.235 0.250 0.298 0.260 0.231 90 0.287 0.370 0.273 0.263 0.268 0.304 0.257 0.230 91 0.254 0.309 0.217 0.214 0.220 0.255 0.237 0.235 92 0.265 0.336 0.275 0.250 0.260 0.324 0.266 0.248 93 0.209 0.271 0.186 0.183 0.188 0.201 0.181 0.190 94 0.202 0.305 0.227 0.193 0.212 0.253 0.195 0.184 95 0.311 0.368 0.245 0.261 0.273 0.301 0.247 0.271 96 0.268 0.314 0.247 0.221 0.227 0.283 0.234 0.219 97 0.261 0.335 0.237 0.227 0.232 0.274 0.223 0.200 98 0.238 0.298 0.217 0.195 0.211 0.261 0.215 0.221

41 42 43 44 45 46 47 48 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 4 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 11 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 20 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 23 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 24 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 25 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 26 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 28 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 29 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 30 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 33 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 35 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 36 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 37 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 38 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 39 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 40 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 41 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 42 0.137 0.000 0.001 0.001 0.001 0.001 0.001 0.001 43 0.128 0.174 0.000 0.001 0.001 0.001 0.001 0.001 44 0.161 0.209 0.198 0.000 0.001 0.001 0.001 0.001 45 0.181 0.194 0.161 0.188 0.000 0.001 0.001 0.001 46 0.133 0.254 0.215 0.228 0.177 0.000 0.001 0.001 47 0.146 0.167 0.169 0.148 0.177 0.195 0.000 0.001 48 0.222 0.301 0.263 0.224 0.301 0.318 0.168 0.000 49 0.175 0.195 0.202 0.101 0.197 0.227 0.088 0.191 50 0.132 0.194 0.177 0.165 0.178 0.176 0.101 0.241 51 0.157 0.196 0.170 0.182 0.181 0.240 0.111 0.191 52 0.202 0.210 0.207 0.190 0.213 0.261 0.141 0.288 53 0.171 0.208 0.189 0.207 0.204 0.285 0.128 0.285 54 0.202 0.165 0.183 0.196 0.196 0.278 0.127 0.292 55 0.221 0.239 0.259 0.277 0.275 0.335 0.168 0.332 56 0.189 0.204 0.157 0.213 0.207 0.252 0.127 0.297 57 0.192 0.212 0.166 0.235 0.226 0.278 0.158 0.297 58 0.217 0.276 0.260 0.194 0.204 0.291 0.181 0.320

59 0.151 0.220 0.192 0.191 0.238 0.240 0.129 0.244 60 0.180 0.233 0.228 0.162 0.236 0.241 0.163 0.264 61 0.297 0.297 0.340 0.304 0.348 0.387 0.254 0.399 62 0.282 0.281 0.309 0.316 0.347 0.387 0.236 0.376 63 0.219 0.218 0.260 0.238 0.255 0.303 0.168 0.351 64 0.175 0.185 0.230 0.156 0.211 0.237 0.115 0.268 65 0.287 0.287 0.352 0.230 0.348 0.384 0.219 0.350 66 0.225 0.251 0.260 0.222 0.245 0.289 0.139 0.331 67 0.190 0.203 0.203 0.199 0.202 0.238 0.170 0.272 68 0.179 0.203 0.204 0.227 0.201 0.220 0.153 0.304 69 0.203 0.234 0.229 0.228 0.238 0.258 0.151 0.284 70 0.187 0.201 0.212 0.191 0.196 0.218 0.135 0.273 71 0.241 0.274 0.235 0.251 0.231 0.311 0.171 0.339 72 0.160 0.168 0.183 0.151 0.136 0.211 0.067 0.239 73 0.131 0.116 0.168 0.142 0.139 0.198 0.083 0.244 74 0.221 0.247 0.275 0.255 0.266 0.309 0.218 0.332 75 0.118 0.184 0.156 0.160 0.152 0.184 0.107 0.209 76 0.187 0.210 0.236 0.197 0.221 0.227 0.163 0.287 77 0.168 0.198 0.209 0.197 0.208 0.209 0.146 0.268 78 0.145 0.164 0.195 0.185 0.170 0.184 0.125 0.256 79 0.188 0.205 0.208 0.191 0.191 0.255 0.147 0.277 80 0.333 0.361 0.359 0.374 0.401 0.426 0.311 0.445 81 0.291 0.302 0.312 0.323 0.338 0.391 0.251 0.426 82 0.269 0.293 0.290 0.296 0.287 0.365 0.248 0.362 83 0.282 0.304 0.335 0.304 0.315 0.361 0.247 0.402 84 0.214 0.215 0.216 0.208 0.237 0.266 0.191 0.321 85 0.266 0.272 0.275 0.273 0.263 0.330 0.235 0.372 86 0.274 0.296 0.311 0.297 0.304 0.354 0.248 0.375 87 0.185 0.175 0.188 0.181 0.204 0.255 0.101 0.285 88 0.276 0.298 0.310 0.305 0.308 0.361 0.260 0.395 89 0.180 0.205 0.198 0.195 0.211 0.257 0.147 0.287 90 0.228 0.236 0.251 0.248 0.223 0.282 0.190 0.310 91 0.158 0.191 0.180 0.197 0.201 0.241 0.139 0.258 92 0.186 0.214 0.222 0.197 0.212 0.237 0.146 0.261 93 0.146 0.148 0.164 0.166 0.154 0.207 0.093 0.267 94 0.159 0.169 0.172 0.176 0.152 0.163 0.116 0.246 95 0.224 0.239 0.280 0.244 0.246 0.270 0.167 0.332 96 0.189 0.191 0.225 0.198 0.202 0.224 0.123 0.262 97 0.158 0.197 0.189 0.180 0.177 0.191 0.140 0.275 98 0.171 0.175 0.206 0.191 0.166 0.210 0.117 0.264

49 50 51 52 53 54 55 56 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 4 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 11 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 20 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 23 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 24 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 25 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 26 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 28 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 29 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 30 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 33 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 35 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 36 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 37 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 38 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 39 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 40 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

41 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 42 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 43 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 44 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 45 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 46 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 47 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 48 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 49 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 50 0.150 0.000 0.001 0.001 0.001 0.001 0.001 0.001 51 0.138 0.132 0.000 0.001 0.001 0.001 0.001 0.001 52 0.170 0.158 0.139 0.000 0.001 0.001 0.001 0.001 53 0.178 0.208 0.162 0.182 0.000 0.001 0.001 0.001 54 0.175 0.169 0.157 0.149 0.166 0.000 0.001 0.001 55 0.217 0.255 0.231 0.259 0.204 0.214 0.000 0.001 56 0.174 0.180 0.167 0.210 0.207 0.166 0.250 0.000 57 0.195 0.170 0.170 0.192 0.190 0.155 0.279 0.110 58 0.205 0.203 0.207 0.236 0.261 0.247 0.299 0.235 59 0.158 0.167 0.127 0.207 0.206 0.206 0.257 0.137 60 0.146 0.198 0.167 0.217 0.239 0.224 0.295 0.225 61 0.265 0.286 0.273 0.312 0.357 0.311 0.423 0.324 62 0.272 0.265 0.257 0.341 0.343 0.287 0.395 0.297 63 0.194 0.229 0.231 0.238 0.260 0.208 0.324 0.239 64 0.120 0.188 0.183 0.224 0.219 0.177 0.280 0.207 65 0.181 0.294 0.277 0.338 0.338 0.296 0.398 0.315 66 0.173 0.202 0.228 0.214 0.254 0.221 0.318 0.196 67 0.171 0.164 0.185 0.199 0.223 0.183 0.304 0.207 68 0.207 0.156 0.189 0.204 0.202 0.155 0.277 0.210 69 0.185 0.188 0.194 0.213 0.211 0.187 0.279 0.229 70 0.166 0.169 0.180 0.208 0.216 0.182 0.277 0.204 71 0.219 0.238 0.230 0.229 0.271 0.237 0.319 0.203 72 0.127 0.147 0.139 0.130 0.110 0.133 0.195 0.162 73 0.130 0.132 0.129 0.134 0.109 0.111 0.185 0.151 74 0.224 0.243 0.222 0.283 0.267 0.235 0.359 0.252 75 0.143 0.114 0.104 0.164 0.160 0.147 0.246 0.128 76 0.181 0.185 0.201 0.192 0.206 0.190 0.277 0.228 77 0.176 0.173 0.184 0.192 0.205 0.178 0.268 0.215 78 0.164 0.133 0.166 0.171 0.179 0.177 0.246 0.203 79 0.180 0.162 0.179 0.208 0.211 0.163 0.276 0.206 80 0.344 0.345 0.339 0.360 0.384 0.335 0.464 0.314 81 0.297 0.300 0.290 0.313 0.345 0.278 0.404 0.284

82 0.266 0.262 0.233 0.286 0.281 0.251 0.381 0.264 83 0.283 0.309 0.273 0.316 0.347 0.265 0.415 0.294 84 0.202 0.227 0.218 0.239 0.222 0.212 0.312 0.217 85 0.253 0.270 0.230 0.267 0.266 0.250 0.343 0.284 86 0.277 0.283 0.264 0.305 0.315 0.256 0.394 0.275 87 0.152 0.167 0.173 0.164 0.170 0.114 0.248 0.170 88 0.292 0.292 0.267 0.298 0.323 0.242 0.357 0.295 89 0.190 0.167 0.203 0.217 0.215 0.171 0.300 0.208 90 0.198 0.201 0.204 0.241 0.249 0.203 0.311 0.212 91 0.174 0.165 0.166 0.179 0.152 0.138 0.254 0.177 92 0.144 0.169 0.170 0.192 0.203 0.176 0.289 0.194 93 0.135 0.119 0.175 0.140 0.152 0.117 0.224 0.138 94 0.157 0.107 0.142 0.146 0.180 0.138 0.230 0.195 95 0.217 0.183 0.199 0.203 0.221 0.218 0.327 0.254 96 0.156 0.139 0.182 0.180 0.190 0.153 0.228 0.210 97 0.155 0.131 0.183 0.174 0.190 0.161 0.282 0.186 98 0.161 0.126 0.169 0.153 0.157 0.133 0.251 0.173

57 58 59 60 61 62 63 64 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 4 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 11 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 20 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

23 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 24 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 25 0.001 0.001 0.004 0.001 0.001 0.001 0.001 0.001 26 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 28 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 29 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 30 0.001 0.001 0.002 0.001 0.001 0.001 0.001 0.001 31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 33 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 35 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 36 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 37 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 38 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 39 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 40 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 41 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 42 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 43 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 44 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 45 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 46 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 47 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 48 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 49 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 50 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 51 0.001 0.001 0.004 0.001 0.001 0.001 0.001 0.001 52 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 53 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 54 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 55 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 56 0.001 0.001 0.004 0.001 0.001 0.001 0.001 0.001 57 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 58 0.215 0.000 0.001 0.001 0.001 0.001 0.001 0.001 59 0.189 0.247 0.000 0.001 0.001 0.001 0.001 0.001 60 0.238 0.230 0.116 0.000 0.001 0.001 0.001 0.001 61 0.335 0.324 0.297 0.301 0.000 0.001 0.001 0.001 62 0.334 0.358 0.283 0.328 0.124 0.000 0.001 0.001 63 0.245 0.266 0.250 0.263 0.211 0.231 0.000 0.001

64 0.224 0.223 0.204 0.145 0.216 0.203 0.112 0.000 65 0.352 0.351 0.302 0.258 0.294 0.271 0.199 0.095 66 0.185 0.249 0.207 0.204 0.329 0.334 0.228 0.172 67 0.192 0.257 0.213 0.191 0.306 0.320 0.244 0.170 68 0.183 0.276 0.213 0.211 0.356 0.337 0.261 0.184 69 0.176 0.253 0.198 0.203 0.346 0.339 0.268 0.189 70 0.201 0.252 0.199 0.163 0.312 0.314 0.229 0.121 71 0.213 0.249 0.242 0.242 0.359 0.344 0.272 0.219 72 0.140 0.191 0.158 0.153 0.281 0.295 0.195 0.133 73 0.143 0.192 0.157 0.162 0.257 0.257 0.188 0.122 74 0.271 0.309 0.246 0.256 0.370 0.369 0.298 0.216 75 0.159 0.211 0.112 0.162 0.245 0.227 0.206 0.144 76 0.198 0.259 0.192 0.173 0.327 0.340 0.240 0.172 77 0.184 0.262 0.184 0.182 0.331 0.343 0.236 0.177 78 0.188 0.221 0.189 0.186 0.271 0.284 0.210 0.159 79 0.179 0.227 0.201 0.191 0.332 0.324 0.245 0.160 80 0.373 0.418 0.311 0.348 0.481 0.479 0.389 0.352 81 0.335 0.357 0.301 0.317 0.422 0.419 0.349 0.283 82 0.268 0.310 0.267 0.309 0.420 0.397 0.331 0.283 83 0.335 0.353 0.286 0.296 0.432 0.440 0.339 0.271 84 0.208 0.281 0.218 0.249 0.348 0.340 0.253 0.188 85 0.278 0.318 0.279 0.287 0.379 0.382 0.301 0.252 86 0.310 0.352 0.277 0.299 0.413 0.404 0.337 0.267 87 0.146 0.237 0.178 0.183 0.315 0.326 0.224 0.161 88 0.307 0.301 0.286 0.295 0.407 0.416 0.339 0.273 89 0.167 0.235 0.207 0.201 0.317 0.312 0.239 0.153 90 0.232 0.240 0.202 0.236 0.344 0.340 0.260 0.227 91 0.155 0.263 0.148 0.181 0.312 0.294 0.231 0.169 92 0.186 0.279 0.157 0.196 0.344 0.337 0.258 0.173 93 0.114 0.177 0.161 0.169 0.258 0.262 0.167 0.120 94 0.176 0.213 0.177 0.182 0.265 0.269 0.182 0.156 95 0.250 0.286 0.222 0.224 0.319 0.328 0.268 0.191 96 0.175 0.236 0.186 0.186 0.307 0.306 0.222 0.167 97 0.160 0.234 0.186 0.184 0.298 0.301 0.218 0.149 98 0.150 0.234 0.166 0.185 0.273 0.270 0.194 0.147

5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 11 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 20 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 23 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 24 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 25 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 26 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 28 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 29 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 30 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 33 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 35 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 36 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 37 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 38 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 39 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 40 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 41 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 42 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 43 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 44 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 45 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

46 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 47 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 48 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 49 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 50 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 51 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 52 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 53 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 54 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 55 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 56 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 57 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 58 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 59 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 60 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 61 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 62 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 63 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 64 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 65 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 66 0.289 0.000 0.001 0.001 0.001 0.001 0.001 0.001 67 0.316 0.222 0.000 0.001 0.001 0.001 0.001 0.001 68 0.352 0.192 0.097 0.000 0.002 0.001 0.001 0.001 69 0.331 0.224 0.121 0.090 0.000 0.001 0.001 0.001 70 0.283 0.188 0.076 0.079 0.111 0.000 0.001 0.001 71 0.358 0.139 0.239 0.231 0.244 0.224 0.000 0.001 72 0.264 0.148 0.126 0.120 0.127 0.111 0.165 0.000 73 0.249 0.137 0.130 0.111 0.130 0.133 0.150 0.025 74 0.355 0.287 0.243 0.246 0.281 0.209 0.295 0.207 75 0.265 0.149 0.095 0.096 0.125 0.094 0.149 0.098 76 0.312 0.202 0.087 0.110 0.098 0.102 0.243 0.118 77 0.320 0.195 0.058 0.075 0.075 0.075 0.231 0.105 78 0.286 0.175 0.080 0.061 0.106 0.064 0.205 0.098 79 0.295 0.205 0.136 0.149 0.146 0.115 0.228 0.135 80 0.483 0.391 0.368 0.372 0.390 0.382 0.421 0.339 81 0.426 0.349 0.326 0.326 0.336 0.301 0.372 0.281 82 0.423 0.319 0.301 0.284 0.302 0.295 0.322 0.237 83 0.411 0.341 0.310 0.309 0.325 0.311 0.379 0.268 84 0.322 0.250 0.215 0.218 0.223 0.188 0.283 0.187 85 0.369 0.306 0.302 0.301 0.309 0.287 0.332 0.222 86 0.406 0.314 0.275 0.263 0.274 0.254 0.359 0.262

87 0.304 0.150 0.160 0.158 0.151 0.159 0.198 0.075 88 0.420 0.346 0.262 0.281 0.288 0.302 0.364 0.244 89 0.306 0.207 0.132 0.147 0.149 0.115 0.224 0.130 90 0.347 0.253 0.203 0.221 0.223 0.210 0.274 0.175 91 0.324 0.198 0.102 0.086 0.083 0.068 0.214 0.112 92 0.305 0.188 0.077 0.091 0.096 0.055 0.232 0.107 93 0.253 0.063 0.147 0.135 0.149 0.135 0.123 0.082 94 0.275 0.181 0.094 0.092 0.102 0.074 0.214 0.108 95 0.343 0.224 0.108 0.123 0.160 0.135 0.251 0.131 96 0.280 0.164 0.076 0.085 0.107 0.085 0.230 0.118 97 0.307 0.164 0.066 0.065 0.084 0.058 0.190 0.102 98 0.289 0.151 0.093 0.077 0.092 0.072 0.176 0.086

73 74 75 76 77 78 79 80 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 4 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 11 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 20 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 23 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 24 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 25 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 26 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

28 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 29 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 30 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 33 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 35 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 36 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 37 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 38 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 39 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 40 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 41 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 42 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 43 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 44 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 45 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 46 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 47 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 48 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 49 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 50 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 51 0.001 0.001 0.006 0.001 0.001 0.001 0.001 0.001 52 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 53 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 54 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 55 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 56 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 57 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 58 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 59 0.001 0.001 0.002 0.001 0.001 0.001 0.001 0.001 60 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 61 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 62 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 63 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 64 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 65 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 66 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 67 0.001 0.001 0.001 0.001 0.006 0.001 0.001 0.001 68 0.001 0.001 0.001 0.001 0.002 0.003 0.001 0.001

69 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 70 0.001 0.001 0.001 0.001 0.001 0.004 0.001 0.001 71 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 72 0.016 0.001 0.001 0.001 0.001 0.001 0.001 0.001 73 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 74 0.186 0.000 0.001 0.001 0.001 0.001 0.001 0.001 75 0.096 0.199 0.000 0.001 0.001 0.001 0.001 0.001 76 0.115 0.267 0.107 0.000 0.042 0.001 0.001 0.001 77 0.104 0.246 0.108 0.016 0.000 0.001 0.001 0.001 78 0.073 0.200 0.088 0.086 0.057 0.000 0.001 0.001 79 0.142 0.153 0.141 0.136 0.132 0.121 0.000 0.001 80 0.313 0.358 0.326 0.379 0.369 0.338 0.324 0.000 81 0.267 0.284 0.281 0.339 0.333 0.293 0.248 0.219 82 0.213 0.118 0.228 0.310 0.294 0.238 0.178 0.373 83 0.256 0.285 0.270 0.308 0.303 0.280 0.239 0.356 84 0.166 0.179 0.184 0.200 0.202 0.189 0.171 0.328 85 0.212 0.196 0.240 0.306 0.299 0.263 0.224 0.360 86 0.222 0.251 0.230 0.284 0.273 0.224 0.235 0.320 87 0.063 0.217 0.127 0.157 0.144 0.119 0.151 0.355 88 0.235 0.300 0.263 0.266 0.261 0.255 0.230 0.349 89 0.133 0.187 0.132 0.127 0.130 0.114 0.008 0.333 90 0.173 0.199 0.185 0.212 0.218 0.177 0.155 0.306 91 0.102 0.221 0.068 0.107 0.098 0.092 0.136 0.345 92 0.115 0.227 0.082 0.086 0.049 0.081 0.129 0.389 93 0.044 0.201 0.106 0.137 0.133 0.092 0.138 0.301 94 0.106 0.216 0.093 0.096 0.070 0.056 0.115 0.324 95 0.113 0.272 0.121 0.149 0.149 0.100 0.206 0.416 96 0.124 0.243 0.111 0.082 0.082 0.076 0.129 0.359 97 0.098 0.240 0.059 0.069 0.066 0.055 0.140 0.367 98 0.074 0.206 0.055 0.085 0.082 0.064 0.134 0.345

10 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 11 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 20 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 23 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 24 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 25 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 26 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 28 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 29 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 30 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 33 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 35 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 36 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 37 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 38 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 39 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 40 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 41 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 42 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 43 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 44 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 45 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 46 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 47 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 48 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 49 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 50 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

51 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 52 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 53 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 54 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 55 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 56 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 57 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 58 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 59 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 60 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 61 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 62 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 63 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 64 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 65 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 66 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 67 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 68 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 69 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 70 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 71 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 72 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 73 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 74 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 75 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 76 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 77 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 78 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 79 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 80 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 81 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 82 0.333 0.000 0.001 0.001 0.001 0.001 0.001 0.001 83 0.300 0.341 0.000 0.001 0.001 0.001 0.001 0.005 84 0.284 0.264 0.273 0.000 0.001 0.001 0.001 0.001 85 0.295 0.229 0.321 0.167 0.000 0.001 0.001 0.001 86 0.254 0.321 0.283 0.271 0.304 0.000 0.001 0.001 87 0.293 0.250 0.305 0.188 0.248 0.280 0.000 0.001 88 0.305 0.342 0.130 0.249 0.285 0.287 0.284 0.000 89 0.279 0.201 0.285 0.172 0.256 0.278 0.136 0.258 90 0.291 0.179 0.262 0.218 0.237 0.245 0.212 0.227 91 0.297 0.239 0.303 0.181 0.264 0.242 0.124 0.290

92 0.334 0.282 0.327 0.185 0.308 0.281 0.158 0.312 93 0.259 0.228 0.260 0.165 0.230 0.224 0.067 0.266 94 0.278 0.256 0.281 0.181 0.232 0.229 0.146 0.242 95 0.367 0.308 0.358 0.257 0.311 0.314 0.181 0.327 96 0.327 0.289 0.300 0.187 0.279 0.279 0.142 0.260 97 0.319 0.277 0.314 0.186 0.293 0.262 0.119 0.290 98 0.302 0.238 0.307 0.173 0.258 0.248 0.118 0.294

89 90 91 92 93 94 95 96 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 4 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 11 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 20 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 23 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 24 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 25 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 26 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 28 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 29 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 30 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

33 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 35 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 36 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 37 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 38 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 39 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 40 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 41 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 42 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 43 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 44 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 45 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 46 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 47 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 48 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 49 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 50 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 51 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 52 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 53 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 54 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 55 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 56 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 57 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 58 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 59 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 60 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 61 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 62 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 63 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 64 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 65 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 66 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 67 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.007 68 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 69 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 70 0.001 0.001 0.001 0.002 0.001 0.004 0.001 0.001 71 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 72 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 73 0.001 0.001 0.001 0.001 0.004 0.001 0.001 0.001

74 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 75 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 76 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.002 77 0.001 0.001 0.001 0.007 0.001 0.002 0.001 0.002 78 0.001 0.001 0.001 0.001 0.001 0.008 0.001 0.001 79 0.241 0.001 0.001 0.001 0.001 0.001 0.001 0.001 80 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 81 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 82 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 83 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 84 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 85 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 86 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 87 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 88 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 89 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 90 0.162 0.000 0.001 0.001 0.001 0.001 0.001 0.001 91 0.136 0.190 0.000 0.001 0.001 0.001 0.001 0.001 92 0.120 0.216 0.084 0.000 0.001 0.001 0.001 0.001 93 0.137 0.186 0.104 0.143 0.000 0.001 0.001 0.001 94 0.120 0.165 0.106 0.096 0.133 0.000 0.001 0.031 95 0.203 0.243 0.121 0.125 0.143 0.126 0.000 0.001 96 0.137 0.201 0.108 0.092 0.126 0.069 0.133 0.000 97 0.122 0.192 0.054 0.082 0.088 0.081 0.105 0.080 98 0.124 0.192 0.049 0.077 0.078 0.053 0.078 0.068

97 98 1 0.001 0.001 2 0.001 0.001 3 0.001 0.001 4 0.001 0.001 5 0.001 0.001 6 0.001 0.001 7 0.001 0.001 8 0.001 0.001 9 0.001 0.001 10 0.001 0.001 11 0.001 0.001 12 0.001 0.001 13 0.001 0.001

100

14 0.001 0.001 15 0.001 0.001 16 0.001 0.001 17 0.001 0.001 18 0.001 0.001 19 0.001 0.001 20 0.001 0.001 21 0.001 0.001 22 0.001 0.001 23 0.001 0.001 24 0.001 0.001 25 0.001 0.001 26 0.001 0.001 27 0.001 0.001 28 0.001 0.001 29 0.001 0.001 30 0.001 0.001 31 0.001 0.001 32 0.001 0.001 33 0.001 0.001 34 0.001 0.001 35 0.001 0.001 36 0.001 0.001 37 0.001 0.001 38 0.001 0.001 39 0.001 0.001 40 0.001 0.001 41 0.001 0.001 42 0.001 0.001 43 0.001 0.001 44 0.001 0.001 45 0.001 0.001 46 0.001 0.001 47 0.001 0.001 48 0.001 0.001 49 0.001 0.001 50 0.001 0.001 51 0.001 0.001 52 0.001 0.001 53 0.001 0.001 54 0.001 0.001

101

55 0.001 0.001 56 0.001 0.001 57 0.001 0.001 58 0.001 0.001 59 0.001 0.001 60 0.001 0.001 61 0.001 0.001 62 0.001 0.001 63 0.001 0.001 64 0.001 0.001 65 0.001 0.001 66 0.001 0.001 67 0.001 0.001 68 0.002 0.002 69 0.001 0.001 70 0.001 0.001 71 0.001 0.001 72 0.001 0.001 73 0.001 0.001 74 0.001 0.001 75 0.001 0.001 76 0.002 0.001 77 0.001 0.001 78 0.001 0.001 79 0.001 0.001 80 0.001 0.001 81 0.001 0.001 82 0.001 0.001 83 0.001 0.001 84 0.001 0.001 85 0.001 0.001 86 0.001 0.001 87 0.001 0.001 88 0.001 0.001 89 0.001 0.001 90 0.001 0.001 91 0.001 0.001 92 0.001 0.001 93 0.001 0.001 94 0.001 0.001 95 0.001 0.001

102

96 0.001 0.006 97 0.000 0.042 98 0.016 0.000

Festuca and Lolium species and sub-species relationships based on cpSSR AMOVA, Morphotype Assignment, Pairwise ΦPT Values, interpopulation pairwise genetic distance and neighbor joining tree analysis

AMOVA results for the cpSSR markers showed that a majority of the total cpSSR marker variation (67%) was due to between-population variance, with 33% due to differences within populations. It is possible that the uniparental inheritance and lack of recombination is a cause of the lower within population variance when compared to the nuSSRs (Birky, 1995; Cahoon et al, 2010; Ruhlman and Jansen, 2014; Honig et al, 2016).

Of the 4753 pairwise comparisons between entries, 324 pairwise comparisons were not significant at P < 0.05, suggesting that these markers are not effective at differentiating populations, unlike the nuSSR markers which differentiated all the tall fescue populations

(Table 6).

The neighbor-joining dendrogram (Fig. 2) is a visual representation of the DICE genetic distances based on the cpSSR markers. Like the nuSSR dendrogram, this tree was rooted using Lolium perenne cultivar ‘Derby Xtreme.’ The next most basal group after the outgroup on this tree is a group of Festuca pratensis accessions and Lolium multiflorum accessions. This was consistent with the nuSSR as a close relationship between Lolium and

Festuca pratensis was also found in that dendrogram as well. The remainder of the dendrogram is composed of two sister groups, one of continental tall fescue and Festuca arundinacea var. glaucescens and another group of Mediterranean tall fescue and Festuca

103 species and subspecies from North Africa, Festuca mairei, Festuca arundinacea subsp. atlantigena and Festuca arundinacea subsp. letourneuixiana. The Festuca mairei samples clustered together and the Festuca arundinacea subsp. letourneuixiana clustered together within the larger Mediterranean Festuca group. The other sister group was composed of continental tall fescue, basal to this group are two populations of tall fescue from Morocco that showed a mix of continental and Mediterranean haplotypes from Chl045. The next most basal group within the Continental tall fescue group is a group of three populations, including two of the Festuca arundinacea var. glaucescens and one collection from

Xibracke, Albania (A13-1538). The third accession of Festuca arundinacea var. glaucescens grouped close to forage-type cultivars ‘Fawn’ and ‘JesupMaxQ.’

104

105

106

Table 6- Chloroplast SSR PhiPTP values. PhiPT values and probability P(rand >= data) based on 999 permutations. Numbers in top row and first column reference Table 1 for entry.

1 2 3 4 5 6 7 8 1 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.765 0.000 0.001 0.001 0.001 0.001 0.001 0.001 3 0.780 0.792 0.000 0.004 0.001 0.001 0.001 0.001 4 0.878 0.894 0.147 0.000 0.001 0.001 0.003 0.001 5 0.819 0.847 0.501 0.652 0.000 0.001 0.001 0.317 6 0.159 0.516 0.630 0.715 0.684 0.000 0.001 0.001 7 0.525 0.477 0.236 0.294 0.329 0.331 0.000 0.001 8 0.900 0.927 0.623 0.794 0.011 0.762 0.419 0.000 9 0.549 0.099 0.705 0.786 0.753 0.401 0.412 0.824 10 0.532 0.478 0.303 0.422 0.314 0.334 0.080 0.389 11 0.895 0.909 0.607 0.755 0.279 0.748 0.371 0.499 12 0.740 0.793 0.445 0.550 0.194 0.600 0.309 0.281 13 0.135 0.688 0.729 0.824 0.771 0.125 0.488 0.847 14 0.546 0.636 0.722 0.818 0.787 0.249 0.429 0.868 15 0.915 0.932 0.598 0.777 0.228 0.767 0.361 0.462

107

16 0.895 0.917 0.667 0.808 0.288 0.759 0.444 0.439 17 0.605 0.560 0.743 0.836 0.784 0.447 0.481 0.859 18 0.664 0.595 0.689 0.779 0.757 0.457 0.380 0.833 19 0.892 0.906 0.587 0.738 0.250 0.743 0.354 0.455 20 0.875 0.891 0.514 0.700 0.159 0.728 0.328 0.332 21 0.931 0.950 0.586 0.785 0.468 0.774 0.366 0.713 22 0.856 0.871 0.340 0.558 0.448 0.705 0.311 0.611 23 0.837 0.852 0.301 0.537 0.418 0.687 0.303 0.570 24 0.825 0.835 0.476 0.608 0.151 0.673 0.275 0.273 25 0.862 0.875 0.037 0.050 0.617 0.716 0.307 0.755 26 0.878 0.892 0.274 0.301 0.668 0.740 0.362 0.792 27 0.875 0.889 0.295 0.341 0.679 0.727 0.364 0.804 28 0.820 0.833 0.301 0.558 0.446 0.684 0.320 0.599 29 0.829 0.842 0.012 0.262 0.570 0.692 0.328 0.702 30 0.819 0.827 0.174 0.089 0.578 0.673 0.300 0.688 31 0.895 0.931 0.458 0.581 0.694 0.751 0.450 0.837 32 0.257 0.637 0.707 0.787 0.741 0.218 0.475 0.812 33 0.763 0.764 0.745 0.850 0.784 0.504 0.429 0.876 34 0.847 0.858 0.155 0.022 0.609 0.699 0.311 0.731 35 0.778 0.785 0.199 0.195 0.550 0.633 0.288 0.648 36 0.889 0.904 0.465 0.626 0.501 0.732 0.339 0.679 37 0.898 0.915 0.447 0.632 0.481 0.740 0.331 0.675 38 0.844 0.858 0.447 0.596 0.488 0.689 0.328 0.636 39 0.887 0.903 0.456 0.616 0.485 0.728 0.325 0.660 40 0.888 0.903 0.575 0.727 0.201 0.739 0.345 0.367 41 0.881 0.896 0.535 0.704 0.191 0.731 0.327 0.372 42 0.930 0.947 0.628 0.809 0.266 0.782 0.369 0.531 43 0.843 0.856 0.006 0.076 0.586 0.699 0.298 0.720 44 0.860 0.872 0.510 0.666 0.190 0.710 0.313 0.330 45 0.898 0.916 0.535 0.717 0.675 0.741 0.388 0.826 46 0.811 0.822 0.045 0.042 0.560 0.664 0.279 0.677 47 0.797 0.804 0.092 0.090 0.407 0.637 0.188 0.541 48 0.875 0.888 0.158 0.012 0.642 0.727 0.319 0.781 49 0.760 0.767 0.387 0.518 0.161 0.614 0.255 0.249 50 0.890 0.906 0.088 0.011 0.657 0.742 0.338 0.800 51 0.895 0.909 0.584 0.741 0.219 0.747 0.335 0.438 52 0.890 0.904 0.560 0.725 0.195 0.741 0.331 0.390 53 0.838 0.850 0.481 0.635 0.147 0.690 0.303 0.301 54 0.898 0.914 0.587 0.746 0.211 0.749 0.354 0.390 55 0.852 0.863 0.505 0.655 0.170 0.702 0.309 0.329 56 0.881 0.894 0.547 0.708 0.186 0.731 0.319 0.375

108

57 0.768 0.775 0.176 0.274 0.538 0.639 0.299 0.634 58 0.881 0.894 0.563 0.710 0.217 0.731 0.329 0.386 59 0.820 0.831 0.014 0.035 0.534 0.670 0.251 0.665 60 0.828 0.840 0.008 0.053 0.568 0.683 0.291 0.693 61 0.865 0.878 0.447 0.589 0.547 0.711 0.347 0.688 62 0.865 0.879 0.401 0.574 0.531 0.713 0.339 0.685 63 0.849 0.861 0.415 0.547 0.435 0.690 0.300 0.577 64 0.787 0.796 0.330 0.456 0.235 0.629 0.232 0.341 65 0.770 0.776 0.336 0.434 0.370 0.614 0.247 0.480 66 0.833 0.843 0.315 0.432 0.426 0.683 0.288 0.560 67 0.877 0.905 0.623 0.763 0.083 0.741 0.412 0.095 68 0.907 0.923 0.633 0.785 0.376 0.762 0.396 0.555 69 0.906 0.922 0.588 0.752 0.237 0.755 0.345 0.429 70 0.852 0.865 0.515 0.663 0.184 0.704 0.317 0.325 71 0.853 0.864 0.538 0.670 0.344 0.709 0.355 0.486 72 0.938 0.955 0.672 0.844 0.456 0.801 0.446 0.700 73 0.875 0.888 0.602 0.736 0.458 0.735 0.402 0.618 74 0.871 0.874 0.783 0.869 0.817 0.744 0.577 0.893 75 0.916 0.932 0.645 0.804 0.373 0.767 0.385 0.614 76 0.881 0.894 0.573 0.717 0.241 0.732 0.344 0.408 77 0.870 0.885 0.507 0.689 0.180 0.724 0.326 0.348 78 0.880 0.895 0.570 0.722 0.251 0.732 0.348 0.408 79 0.753 0.739 0.661 0.734 0.704 0.631 0.468 0.773 80 0.393 0.528 0.692 0.768 0.725 0.312 0.430 0.791 81 0.428 0.547 0.714 0.794 0.748 0.352 0.448 0.818 82 0.864 0.876 0.765 0.851 0.775 0.737 0.570 0.858 83 0.687 0.759 0.755 0.838 0.760 0.557 0.513 0.838 84 0.790 0.799 0.521 0.621 0.550 0.639 0.355 0.656 85 0.857 0.872 0.608 0.747 0.710 0.694 0.428 0.828 86 0.505 0.284 0.704 0.786 0.741 0.410 0.439 0.809 87 0.834 0.844 0.532 0.646 0.328 0.689 0.343 0.461 88 0.661 0.688 0.734 0.817 0.767 0.543 0.493 0.838 89 0.760 0.749 0.671 0.752 0.720 0.640 0.481 0.792 90 0.821 0.829 0.720 0.796 0.737 0.703 0.550 0.811 91 0.942 0.961 0.647 0.837 0.301 0.795 0.387 0.588 92 0.865 0.878 0.541 0.688 0.199 0.716 0.326 0.357 93 0.784 0.791 0.292 0.404 0.303 0.630 0.228 0.422 94 0.938 0.956 0.641 0.828 0.286 0.791 0.384 0.567 95 0.907 0.923 0.587 0.763 0.250 0.759 0.357 0.453 96 0.909 0.925 0.590 0.765 0.224 0.760 0.355 0.438 97 0.898 0.914 0.585 0.745 0.195 0.748 0.341 0.400

109

98 0.931 0.949 0.629 0.812 0.284 0.782 0.373 0.540

9 10 11 12 13 14 15 16 1 0.001 0.001 0.001 0.001 0.004 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 4 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.002 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.045 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.405 0.000 0.001 0.001 0.001 0.001 0.002 0.001 11 0.814 0.351 0.000 0.001 0.001 0.001 0.008 0.001 12 0.695 0.342 0.384 0.000 0.001 0.001 0.001 0.001 13 0.520 0.471 0.848 0.693 0.000 0.001 0.001 0.001 14 0.503 0.413 0.838 0.740 0.456 0.000 0.001 0.001 15 0.832 0.333 0.207 0.414 0.866 0.866 0.000 0.001 16 0.806 0.456 0.604 0.284 0.845 0.871 0.615 0.000 17 0.337 0.470 0.859 0.722 0.500 0.598 0.878 0.845 18 0.463 0.388 0.804 0.711 0.607 0.443 0.830 0.839 19 0.809 0.330 0.000 0.366 0.845 0.836 0.102 0.576 20 0.796 0.279 0.247 0.370 0.827 0.827 0.040 0.518 21 0.841 0.374 0.589 0.487 0.878 0.879 0.591 0.767 22 0.778 0.329 0.562 0.450 0.807 0.804 0.544 0.673 23 0.761 0.291 0.533 0.437 0.788 0.784 0.501 0.648 24 0.746 0.251 0.146 0.311 0.781 0.771 0.000 0.406 25 0.781 0.426 0.720 0.529 0.812 0.807 0.736 0.775 26 0.798 0.480 0.762 0.584 0.831 0.827 0.780 0.806 27 0.790 0.486 0.773 0.553 0.825 0.831 0.793 0.795 28 0.751 0.329 0.581 0.466 0.772 0.773 0.559 0.654 29 0.756 0.384 0.663 0.505 0.781 0.772 0.678 0.737 30 0.732 0.394 0.653 0.483 0.774 0.760 0.659 0.709 31 0.823 0.562 0.845 0.464 0.836 0.876 0.872 0.828 32 0.482 0.476 0.812 0.663 0.226 0.451 0.830 0.809 33 0.584 0.380 0.850 0.745 0.675 0.572 0.876 0.880 34 0.761 0.416 0.696 0.513 0.800 0.789 0.706 0.751 35 0.701 0.374 0.620 0.479 0.734 0.717 0.620 0.675 36 0.803 0.375 0.589 0.474 0.838 0.833 0.602 0.722 37 0.811 0.364 0.587 0.462 0.846 0.843 0.597 0.727 38 0.762 0.380 0.585 0.421 0.795 0.801 0.582 0.631

110

39 0.801 0.361 0.563 0.456 0.836 0.831 0.576 0.705 40 0.807 0.321 0.171 0.374 0.841 0.838 0.000 0.520 41 0.801 0.291 0.145 0.369 0.834 0.829 0.000 0.536 42 0.845 0.358 0.308 0.439 0.880 0.883 0.000 0.655 43 0.764 0.407 0.694 0.507 0.794 0.790 0.699 0.744 44 0.778 0.271 0.204 0.350 0.814 0.808 0.011 0.479 45 0.805 0.436 0.794 0.625 0.842 0.840 0.820 0.842 46 0.734 0.376 0.637 0.479 0.765 0.750 0.648 0.707 47 0.717 0.299 0.490 0.363 0.750 0.736 0.468 0.588 48 0.790 0.452 0.741 0.547 0.825 0.819 0.762 0.794 49 0.683 0.196 0.189 0.275 0.719 0.706 0.089 0.361 50 0.804 0.444 0.767 0.566 0.839 0.836 0.786 0.817 51 0.814 0.342 0.268 0.397 0.847 0.847 0.082 0.546 52 0.809 0.316 0.224 0.382 0.842 0.841 0.000 0.530 53 0.760 0.256 0.103 0.319 0.794 0.783 0.005 0.456 54 0.816 0.331 0.247 0.378 0.850 0.851 0.032 0.531 55 0.773 0.272 0.136 0.346 0.807 0.798 0.014 0.482 56 0.800 0.308 0.221 0.373 0.833 0.831 0.006 0.511 57 0.695 0.373 0.604 0.470 0.726 0.712 0.607 0.662 58 0.799 0.318 0.219 0.385 0.834 0.831 0.021 0.519 59 0.741 0.367 0.636 0.461 0.771 0.763 0.635 0.695 60 0.748 0.379 0.659 0.487 0.781 0.771 0.665 0.723 61 0.781 0.384 0.630 0.496 0.816 0.808 0.637 0.717 62 0.783 0.380 0.630 0.484 0.815 0.810 0.640 0.716 63 0.767 0.328 0.497 0.423 0.801 0.791 0.479 0.634 64 0.706 0.226 0.267 0.287 0.742 0.729 0.191 0.440 65 0.689 0.291 0.422 0.329 0.726 0.717 0.395 0.498 66 0.756 0.327 0.509 0.417 0.787 0.778 0.483 0.621 67 0.803 0.393 0.455 0.283 0.828 0.846 0.432 0.407 68 0.826 0.377 0.384 0.466 0.860 0.860 0.382 0.631 69 0.822 0.329 0.238 0.402 0.857 0.857 0.012 0.576 70 0.773 0.275 0.191 0.359 0.808 0.801 0.027 0.474 71 0.776 0.335 0.384 0.427 0.809 0.802 0.344 0.572 72 0.858 0.419 0.585 0.534 0.891 0.895 0.575 0.761 73 0.799 0.414 0.550 0.448 0.831 0.838 0.536 0.604 74 0.765 0.598 0.875 0.771 0.820 0.826 0.894 0.889 75 0.830 0.402 0.456 0.399 0.866 0.875 0.420 0.585 76 0.797 0.315 0.233 0.395 0.835 0.830 0.068 0.537 77 0.792 0.277 0.235 0.377 0.824 0.821 0.033 0.521 78 0.801 0.321 0.200 0.394 0.834 0.830 0.130 0.532 79 0.647 0.476 0.744 0.668 0.721 0.690 0.765 0.782

111

80 0.329 0.434 0.795 0.659 0.350 0.444 0.813 0.786 81 0.367 0.466 0.818 0.685 0.402 0.475 0.838 0.813 82 0.781 0.561 0.831 0.744 0.817 0.808 0.855 0.861 83 0.597 0.512 0.838 0.704 0.634 0.695 0.858 0.833 84 0.711 0.366 0.608 0.529 0.746 0.726 0.623 0.683 85 0.762 0.468 0.801 0.637 0.800 0.805 0.821 0.820 86 0.065 0.427 0.813 0.678 0.468 0.540 0.831 0.791 87 0.757 0.329 0.321 0.388 0.792 0.780 0.320 0.526 88 0.519 0.507 0.839 0.704 0.610 0.665 0.858 0.834 89 0.658 0.505 0.768 0.673 0.725 0.720 0.786 0.789 90 0.748 0.543 0.784 0.709 0.779 0.767 0.804 0.816 91 0.856 0.367 0.348 0.461 0.892 0.896 0.000 0.708 92 0.784 0.291 0.151 0.363 0.820 0.813 0.023 0.500 93 0.707 0.253 0.363 0.340 0.740 0.725 0.306 0.504 94 0.852 0.364 0.323 0.454 0.888 0.891 0.000 0.691 95 0.824 0.320 0.277 0.415 0.858 0.858 0.030 0.600 96 0.826 0.326 0.191 0.406 0.860 0.860 0.000 0.593 97 0.815 0.328 0.147 0.373 0.850 0.847 0.000 0.549 98 0.845 0.350 0.314 0.446 0.881 0.883 0.000 0.670

17 18 19 20 21 22 23 24 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.001 0.001 0.001 0.001 0.001 0.002 0.001 4 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 5 0.001 0.001 0.001 0.003 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.001 0.001 0.001 0.003 0.001 0.001 0.001 0.002 11 0.001 0.001 0.325 0.001 0.001 0.001 0.001 0.002 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.001 0.078 0.261 0.001 0.001 0.001 0.493 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.582 0.000 0.001 0.001 0.001 0.001 0.001 0.001 19 0.855 0.800 0.000 0.001 0.001 0.001 0.001 0.017 20 0.840 0.791 0.181 0.000 0.001 0.001 0.001 0.301

112

21 0.889 0.839 0.528 0.470 0.000 0.001 0.001 0.001 22 0.821 0.768 0.532 0.435 0.464 0.000 0.285 0.001 23 0.803 0.748 0.503 0.376 0.441 0.000 0.000 0.001 24 0.792 0.736 0.070 0.014 0.299 0.372 0.348 0.000 25 0.825 0.773 0.704 0.660 0.737 0.497 0.477 0.585 26 0.841 0.793 0.748 0.712 0.787 0.602 0.575 0.632 27 0.835 0.797 0.762 0.727 0.803 0.613 0.595 0.647 28 0.790 0.743 0.558 0.443 0.528 0.088 0.060 0.417 29 0.795 0.740 0.649 0.598 0.679 0.422 0.375 0.556 30 0.783 0.720 0.631 0.601 0.651 0.485 0.469 0.522 31 0.859 0.844 0.836 0.803 0.895 0.725 0.703 0.724 32 0.516 0.571 0.809 0.796 0.838 0.777 0.761 0.751 33 0.693 0.602 0.846 0.827 0.911 0.831 0.808 0.763 34 0.809 0.750 0.675 0.642 0.702 0.513 0.496 0.559 35 0.743 0.684 0.602 0.569 0.601 0.457 0.443 0.498 36 0.850 0.794 0.557 0.526 0.505 0.119 0.208 0.392 37 0.858 0.805 0.547 0.496 0.512 0.063 0.147 0.372 38 0.807 0.767 0.560 0.507 0.519 0.238 0.265 0.413 39 0.848 0.792 0.526 0.499 0.479 0.122 0.205 0.366 40 0.851 0.802 0.086 0.081 0.476 0.505 0.477 0.000 41 0.845 0.793 0.064 0.016 0.468 0.465 0.419 0.000 42 0.891 0.846 0.178 0.120 0.681 0.588 0.551 0.000 43 0.807 0.757 0.675 0.623 0.697 0.458 0.436 0.557 44 0.825 0.771 0.105 0.013 0.387 0.430 0.391 0.000 45 0.855 0.798 0.780 0.732 0.840 0.668 0.629 0.640 46 0.775 0.714 0.621 0.583 0.632 0.432 0.407 0.520 47 0.760 0.702 0.458 0.411 0.448 0.272 0.275 0.337 48 0.836 0.783 0.725 0.693 0.766 0.559 0.546 0.604 49 0.731 0.668 0.128 0.040 0.268 0.302 0.263 0.010 50 0.850 0.798 0.750 0.704 0.798 0.560 0.530 0.619 51 0.858 0.813 0.171 0.137 0.520 0.516 0.498 0.007 52 0.853 0.806 0.125 0.041 0.480 0.490 0.455 0.000 53 0.805 0.748 0.038 0.008 0.360 0.394 0.353 0.005 54 0.860 0.815 0.136 0.087 0.523 0.528 0.499 0.001 55 0.816 0.763 0.071 0.046 0.401 0.433 0.392 0.025 56 0.844 0.796 0.130 0.052 0.455 0.474 0.446 0.000 57 0.738 0.678 0.587 0.551 0.601 0.436 0.405 0.502 58 0.845 0.795 0.128 0.092 0.453 0.485 0.461 0.000 59 0.783 0.729 0.614 0.562 0.630 0.412 0.396 0.497 60 0.793 0.735 0.640 0.591 0.664 0.435 0.406 0.531 61 0.827 0.771 0.598 0.571 0.586 0.360 0.378 0.446

113

62 0.828 0.774 0.600 0.561 0.599 0.290 0.312 0.462 63 0.812 0.754 0.461 0.427 0.355 0.111 0.172 0.302 64 0.754 0.691 0.213 0.149 0.184 0.106 0.110 0.087 65 0.737 0.681 0.383 0.355 0.297 0.091 0.137 0.258 66 0.795 0.744 0.469 0.413 0.529 0.396 0.376 0.350 67 0.838 0.812 0.434 0.347 0.642 0.600 0.568 0.263 68 0.870 0.825 0.395 0.329 0.670 0.594 0.573 0.215 69 0.868 0.820 0.157 0.079 0.556 0.531 0.497 0.000 70 0.817 0.765 0.131 0.015 0.387 0.426 0.390 0.000 71 0.817 0.769 0.333 0.303 0.515 0.494 0.469 0.218 72 0.900 0.860 0.521 0.447 0.831 0.670 0.632 0.309 73 0.839 0.807 0.512 0.470 0.672 0.587 0.566 0.367 74 0.822 0.765 0.871 0.856 0.914 0.848 0.830 0.804 75 0.877 0.841 0.397 0.367 0.722 0.625 0.594 0.217 76 0.845 0.792 0.171 0.102 0.462 0.506 0.471 0.004 77 0.836 0.787 0.171 0.000 0.453 0.432 0.375 0.010 78 0.844 0.795 0.195 0.137 0.508 0.498 0.475 0.081 79 0.709 0.637 0.740 0.731 0.784 0.725 0.708 0.681 80 0.384 0.495 0.792 0.778 0.820 0.762 0.746 0.732 81 0.415 0.528 0.817 0.803 0.846 0.784 0.769 0.757 82 0.829 0.775 0.828 0.816 0.887 0.821 0.802 0.755 83 0.659 0.612 0.835 0.819 0.886 0.823 0.805 0.768 84 0.752 0.692 0.597 0.567 0.610 0.513 0.496 0.501 85 0.814 0.769 0.790 0.756 0.833 0.711 0.677 0.680 86 0.257 0.511 0.810 0.795 0.839 0.776 0.759 0.749 87 0.799 0.748 0.291 0.295 0.476 0.481 0.463 0.214 88 0.574 0.543 0.836 0.821 0.868 0.803 0.787 0.774 89 0.716 0.674 0.765 0.750 0.805 0.743 0.725 0.705 90 0.787 0.739 0.781 0.769 0.833 0.774 0.756 0.719 91 0.903 0.858 0.205 0.136 0.780 0.621 0.576 0.000 92 0.830 0.776 0.114 0.039 0.413 0.464 0.426 0.000 93 0.749 0.691 0.325 0.265 0.397 0.342 0.313 0.207 94 0.899 0.854 0.195 0.121 0.743 0.611 0.567 0.000 95 0.870 0.821 0.172 0.077 0.567 0.535 0.495 0.000 96 0.872 0.823 0.096 0.042 0.560 0.530 0.491 0.000 97 0.860 0.812 0.042 0.097 0.521 0.517 0.491 0.000 98 0.892 0.845 0.182 0.118 0.696 0.590 0.549 0.000

25 26 27 28 29 30 31 32 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

114

3 0.097 0.001 0.001 0.001 0.251 0.001 0.001 0.001 4 0.103 0.001 0.001 0.001 0.002 0.093 0.001 0.001 5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 11 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 20 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.096 0.001 0.001 0.001 0.001 23 0.001 0.001 0.001 0.126 0.001 0.001 0.001 0.001 24 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 25 0.000 0.001 0.001 0.001 0.040 0.002 0.001 0.001 26 0.274 0.000 0.001 0.001 0.001 0.001 0.001 0.001 27 0.296 0.463 0.000 0.001 0.001 0.001 0.001 0.001 28 0.469 0.588 0.586 0.000 0.001 0.001 0.001 0.001 29 0.116 0.354 0.387 0.372 0.000 0.001 0.001 0.001 30 0.122 0.266 0.292 0.497 0.254 0.000 0.001 0.001 31 0.522 0.629 0.561 0.682 0.558 0.474 0.000 0.001 32 0.781 0.798 0.791 0.751 0.750 0.741 0.797 0.000 33 0.836 0.854 0.859 0.799 0.802 0.782 0.903 0.631 34 0.072 0.259 0.293 0.522 0.236 0.000 0.504 0.764 35 0.202 0.255 0.343 0.472 0.272 0.187 0.473 0.707 36 0.592 0.667 0.679 0.351 0.542 0.522 0.790 0.801 37 0.589 0.671 0.690 0.314 0.534 0.526 0.801 0.809 38 0.560 0.631 0.518 0.320 0.523 0.522 0.700 0.765 39 0.583 0.660 0.672 0.357 0.541 0.516 0.785 0.800 40 0.696 0.733 0.751 0.542 0.651 0.625 0.825 0.805 41 0.668 0.719 0.732 0.490 0.613 0.606 0.812 0.801 42 0.764 0.807 0.819 0.591 0.714 0.682 0.897 0.843 43 0.000 0.260 0.282 0.427 0.078 0.114 0.483 0.764

115

44 0.636 0.682 0.698 0.458 0.591 0.560 0.778 0.782 45 0.679 0.735 0.752 0.632 0.631 0.607 0.844 0.802 46 0.006 0.169 0.258 0.436 0.090 0.108 0.453 0.736 47 0.075 0.255 0.276 0.323 0.193 0.129 0.444 0.722 48 0.003 0.288 0.309 0.544 0.244 0.087 0.540 0.790 49 0.497 0.547 0.561 0.327 0.454 0.427 0.639 0.693 50 0.000 0.297 0.351 0.542 0.171 0.092 0.605 0.803 51 0.701 0.751 0.758 0.525 0.667 0.638 0.833 0.814 52 0.688 0.735 0.744 0.510 0.642 0.622 0.824 0.808 53 0.604 0.659 0.671 0.420 0.541 0.546 0.749 0.760 54 0.713 0.753 0.764 0.557 0.669 0.635 0.840 0.815 55 0.626 0.677 0.689 0.464 0.569 0.573 0.766 0.773 56 0.671 0.723 0.731 0.490 0.633 0.610 0.809 0.801 57 0.223 0.094 0.359 0.420 0.199 0.177 0.490 0.699 58 0.680 0.720 0.737 0.517 0.644 0.614 0.812 0.801 59 0.000 0.203 0.246 0.402 0.106 0.100 0.438 0.743 60 0.000 0.238 0.271 0.427 0.049 0.056 0.483 0.750 61 0.560 0.622 0.645 0.451 0.533 0.503 0.750 0.782 62 0.524 0.617 0.630 0.371 0.477 0.487 0.736 0.781 63 0.529 0.594 0.611 0.318 0.502 0.474 0.719 0.768 64 0.439 0.513 0.525 0.234 0.409 0.370 0.623 0.714 65 0.417 0.491 0.473 0.214 0.408 0.361 0.577 0.699 66 0.406 0.495 0.522 0.430 0.393 0.375 0.638 0.757 67 0.735 0.765 0.777 0.605 0.696 0.658 0.802 0.793 68 0.752 0.786 0.791 0.612 0.708 0.678 0.868 0.825 69 0.717 0.757 0.772 0.559 0.672 0.636 0.853 0.821 70 0.636 0.681 0.694 0.459 0.589 0.567 0.771 0.775 71 0.645 0.684 0.702 0.518 0.604 0.591 0.773 0.778 72 0.802 0.834 0.847 0.652 0.744 0.725 0.916 0.855 73 0.705 0.743 0.688 0.581 0.668 0.650 0.801 0.800 74 0.852 0.849 0.864 0.816 0.821 0.807 0.901 0.758 75 0.765 0.805 0.791 0.613 0.718 0.694 0.871 0.830 76 0.690 0.730 0.741 0.535 0.649 0.602 0.817 0.800 77 0.650 0.701 0.716 0.441 0.589 0.595 0.796 0.793 78 0.691 0.733 0.740 0.532 0.643 0.625 0.820 0.800 79 0.727 0.741 0.750 0.709 0.700 0.677 0.793 0.685 80 0.765 0.782 0.771 0.738 0.742 0.716 0.789 0.351 81 0.788 0.805 0.795 0.758 0.763 0.746 0.815 0.392 82 0.835 0.841 0.854 0.797 0.802 0.788 0.892 0.773 83 0.827 0.841 0.836 0.795 0.801 0.780 0.858 0.608 84 0.612 0.643 0.654 0.524 0.581 0.559 0.725 0.713

116

85 0.715 0.759 0.740 0.666 0.682 0.658 0.819 0.770 86 0.780 0.796 0.788 0.749 0.754 0.738 0.807 0.460 87 0.627 0.663 0.676 0.516 0.594 0.559 0.746 0.761 88 0.807 0.822 0.816 0.776 0.781 0.763 0.837 0.589 89 0.740 0.759 0.751 0.717 0.710 0.700 0.795 0.688 90 0.783 0.785 0.803 0.755 0.752 0.738 0.841 0.739 91 0.790 0.827 0.842 0.621 0.732 0.701 0.921 0.854 92 0.660 0.703 0.715 0.496 0.617 0.583 0.792 0.787 93 0.389 0.448 0.486 0.384 0.370 0.359 0.590 0.711 94 0.782 0.821 0.835 0.614 0.724 0.694 0.913 0.850 95 0.725 0.769 0.780 0.552 0.674 0.648 0.859 0.823 96 0.725 0.770 0.782 0.550 0.669 0.651 0.862 0.824 97 0.708 0.754 0.766 0.542 0.663 0.638 0.840 0.814 98 0.768 0.809 0.822 0.598 0.714 0.679 0.901 0.844

33 34 35 36 37 38 39 40 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.002 0.001 0.001 0.001 0.001 0.001 0.001 4 0.001 0.514 0.001 0.001 0.001 0.001 0.001 0.001 5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 11 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.011 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.497 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.040 20 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.040 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.026 0.161 0.002 0.032 0.001 23 0.001 0.001 0.001 0.004 0.036 0.001 0.003 0.001 24 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.448 25 0.001 0.064 0.001 0.001 0.001 0.001 0.001 0.001

117

26 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 28 0.001 0.001 0.001 0.002 0.002 0.001 0.001 0.001 29 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 30 0.001 0.330 0.001 0.001 0.001 0.001 0.001 0.001 31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 33 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.815 0.000 0.001 0.001 0.001 0.001 0.001 0.001 35 0.739 0.181 0.000 0.001 0.001 0.001 0.001 0.001 36 0.864 0.558 0.500 0.000 0.602 0.001 0.437 0.001 37 0.873 0.565 0.496 0.001 0.000 0.001 0.373 0.001 38 0.828 0.552 0.489 0.284 0.283 0.000 0.001 0.001 39 0.860 0.553 0.493 0.000 0.007 0.290 0.000 0.001 40 0.841 0.666 0.589 0.530 0.522 0.537 0.503 0.000 41 0.832 0.647 0.573 0.521 0.498 0.515 0.485 0.032 42 0.896 0.733 0.641 0.651 0.653 0.611 0.622 0.023 43 0.816 0.075 0.194 0.558 0.551 0.530 0.551 0.664 44 0.807 0.604 0.548 0.474 0.455 0.481 0.445 0.040 45 0.872 0.649 0.569 0.738 0.752 0.684 0.736 0.762 46 0.777 0.067 0.118 0.506 0.497 0.496 0.493 0.614 47 0.752 0.107 0.182 0.324 0.300 0.354 0.298 0.435 48 0.849 0.024 0.206 0.621 0.628 0.592 0.615 0.717 49 0.691 0.465 0.435 0.346 0.326 0.365 0.323 0.100 50 0.866 0.023 0.204 0.644 0.651 0.610 0.639 0.738 51 0.852 0.680 0.604 0.564 0.553 0.541 0.536 0.062 52 0.845 0.664 0.588 0.539 0.526 0.519 0.509 0.000 53 0.781 0.582 0.531 0.436 0.417 0.458 0.417 0.043 54 0.856 0.680 0.600 0.566 0.554 0.545 0.537 0.000 55 0.793 0.606 0.544 0.469 0.452 0.481 0.441 0.038 56 0.833 0.651 0.580 0.522 0.508 0.512 0.492 0.023 57 0.733 0.197 0.259 0.497 0.496 0.493 0.494 0.582 58 0.832 0.654 0.565 0.516 0.502 0.511 0.486 0.019 59 0.785 0.059 0.168 0.500 0.487 0.483 0.485 0.600 60 0.795 0.025 0.177 0.522 0.517 0.512 0.513 0.633 61 0.836 0.533 0.452 0.352 0.375 0.421 0.349 0.578 62 0.839 0.517 0.470 0.339 0.342 0.402 0.335 0.588 63 0.815 0.501 0.436 0.000 0.024 0.240 0.013 0.418 64 0.737 0.405 0.391 0.107 0.082 0.222 0.085 0.181 65 0.740 0.391 0.371 0.072 0.079 0.129 0.069 0.367 66 0.787 0.394 0.373 0.464 0.436 0.463 0.443 0.438

118

67 0.853 0.702 0.633 0.635 0.637 0.606 0.621 0.352 68 0.868 0.722 0.642 0.640 0.657 0.621 0.603 0.274 69 0.864 0.683 0.600 0.576 0.570 0.566 0.541 0.000 70 0.798 0.607 0.550 0.469 0.452 0.474 0.447 0.030 71 0.802 0.625 0.542 0.536 0.519 0.519 0.514 0.290 72 0.909 0.773 0.680 0.747 0.753 0.687 0.731 0.438 73 0.842 0.686 0.612 0.639 0.635 0.465 0.624 0.469 74 0.842 0.834 0.760 0.875 0.884 0.835 0.875 0.867 75 0.886 0.739 0.657 0.679 0.686 0.572 0.661 0.342 76 0.833 0.649 0.589 0.524 0.525 0.528 0.508 0.072 77 0.820 0.634 0.556 0.520 0.492 0.499 0.490 0.086 78 0.832 0.665 0.593 0.538 0.541 0.544 0.501 0.090 79 0.697 0.705 0.642 0.748 0.754 0.725 0.745 0.739 80 0.540 0.744 0.689 0.784 0.793 0.746 0.782 0.789 81 0.589 0.771 0.712 0.809 0.818 0.771 0.806 0.813 82 0.821 0.815 0.750 0.844 0.855 0.816 0.842 0.822 83 0.728 0.808 0.749 0.849 0.856 0.809 0.846 0.831 84 0.749 0.587 0.533 0.550 0.554 0.534 0.543 0.579 85 0.838 0.696 0.633 0.766 0.776 0.687 0.761 0.782 86 0.626 0.764 0.701 0.802 0.810 0.762 0.799 0.806 87 0.780 0.597 0.543 0.505 0.494 0.499 0.481 0.269 88 0.731 0.790 0.725 0.830 0.838 0.789 0.827 0.832 89 0.730 0.725 0.664 0.770 0.776 0.729 0.769 0.762 90 0.780 0.764 0.702 0.796 0.804 0.771 0.793 0.775 91 0.912 0.754 0.655 0.692 0.702 0.643 0.665 0.006 92 0.813 0.626 0.566 0.491 0.483 0.497 0.472 0.042 93 0.717 0.374 0.338 0.372 0.358 0.394 0.352 0.285 94 0.906 0.746 0.651 0.675 0.685 0.632 0.650 0.012 95 0.865 0.694 0.612 0.586 0.583 0.573 0.564 0.021 96 0.868 0.696 0.613 0.584 0.578 0.571 0.554 0.000 97 0.855 0.682 0.603 0.555 0.542 0.547 0.524 0.000 98 0.897 0.732 0.641 0.647 0.653 0.613 0.621 0.024

41 42 43 44 45 46 47 48 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.001 0.308 0.001 0.001 0.071 0.020 0.004 4 0.001 0.001 0.035 0.001 0.001 0.051 0.028 0.457 5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.004 0.001

119

8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.002 0.001 0.001 0.003 0.001 0.001 0.001 0.001 11 0.013 0.001 0.001 0.001 0.001 0.001 0.001 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.398 1.000 0.001 0.430 0.001 0.001 0.001 0.001 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.077 0.018 0.001 0.009 0.001 0.001 0.001 0.001 20 0.200 0.018 0.001 0.252 0.001 0.001 0.001 0.001 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 23 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 24 0.452 0.486 0.001 0.506 0.001 0.001 0.001 0.001 25 0.001 0.001 0.333 0.001 0.001 0.335 0.046 0.331 26 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 28 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 29 0.001 0.001 0.080 0.001 0.001 0.035 0.001 0.002 30 0.001 0.001 0.013 0.001 0.001 0.001 0.004 0.092 31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 33 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.001 0.001 0.036 0.001 0.001 0.011 0.010 0.359 35 0.001 0.001 0.001 0.001 0.001 0.004 0.001 0.001 36 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 37 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 38 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 39 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 40 0.139 0.227 0.001 0.032 0.001 0.001 0.001 0.001 41 0.000 0.118 0.001 0.270 0.001 0.001 0.001 0.001 42 0.048 0.000 0.001 0.114 0.001 0.001 0.001 0.001 43 0.635 0.726 0.000 0.001 0.001 0.210 0.047 0.207 44 0.013 0.043 0.603 0.000 0.001 0.001 0.001 0.001 45 0.744 0.854 0.641 0.708 0.000 0.001 0.001 0.001 46 0.586 0.676 0.015 0.564 0.588 0.000 0.018 0.039 47 0.405 0.489 0.075 0.385 0.515 0.077 0.000 0.027 48 0.696 0.790 0.037 0.660 0.710 0.048 0.089 0.000

120

49 0.071 0.122 0.469 0.000 0.558 0.440 0.297 0.521 50 0.713 0.820 0.005 0.672 0.733 0.004 0.106 0.011 51 0.091 0.013 0.668 0.080 0.781 0.632 0.434 0.723 52 0.000 0.000 0.653 0.009 0.765 0.609 0.418 0.712 53 0.000 0.079 0.573 0.000 0.672 0.535 0.370 0.629 54 0.061 0.042 0.679 0.038 0.784 0.632 0.450 0.735 55 0.000 0.078 0.595 0.039 0.691 0.551 0.378 0.650 56 0.005 0.000 0.638 0.023 0.745 0.601 0.404 0.695 57 0.561 0.632 0.198 0.522 0.562 0.171 0.228 0.262 58 0.041 0.000 0.649 0.041 0.750 0.601 0.418 0.700 59 0.572 0.660 0.000 0.543 0.584 0.000 0.015 0.013 60 0.602 0.696 0.000 0.568 0.613 0.000 0.080 0.056 61 0.569 0.669 0.531 0.522 0.730 0.471 0.355 0.586 62 0.570 0.675 0.490 0.522 0.734 0.455 0.327 0.566 63 0.414 0.510 0.502 0.387 0.643 0.447 0.271 0.555 64 0.161 0.218 0.410 0.104 0.548 0.382 0.199 0.465 65 0.357 0.408 0.395 0.306 0.553 0.371 0.219 0.438 66 0.415 0.518 0.379 0.390 0.626 0.343 0.200 0.435 67 0.382 0.482 0.705 0.320 0.794 0.664 0.531 0.752 68 0.327 0.444 0.720 0.287 0.823 0.668 0.519 0.773 69 0.044 0.031 0.682 0.040 0.797 0.628 0.440 0.740 70 0.039 0.074 0.605 0.000 0.697 0.567 0.392 0.658 71 0.286 0.379 0.619 0.277 0.692 0.574 0.429 0.666 72 0.448 0.667 0.766 0.388 0.881 0.717 0.578 0.826 73 0.466 0.566 0.677 0.436 0.775 0.641 0.511 0.725 74 0.861 0.908 0.834 0.838 0.883 0.801 0.786 0.862 75 0.339 0.470 0.732 0.302 0.844 0.688 0.533 0.787 76 0.094 0.100 0.659 0.015 0.756 0.615 0.442 0.707 77 0.000 0.109 0.614 0.015 0.724 0.572 0.401 0.683 78 0.123 0.189 0.660 0.119 0.760 0.611 0.445 0.713 79 0.733 0.780 0.712 0.714 0.730 0.677 0.660 0.736 80 0.784 0.825 0.749 0.762 0.785 0.720 0.705 0.773 81 0.808 0.851 0.772 0.789 0.811 0.742 0.727 0.797 82 0.818 0.872 0.817 0.794 0.854 0.783 0.758 0.845 83 0.825 0.872 0.810 0.803 0.843 0.780 0.760 0.836 84 0.574 0.648 0.592 0.553 0.396 0.548 0.472 0.626 85 0.765 0.843 0.687 0.731 0.759 0.648 0.598 0.737 86 0.801 0.844 0.764 0.780 0.803 0.732 0.719 0.790 87 0.283 0.357 0.603 0.260 0.664 0.563 0.420 0.644 88 0.827 0.871 0.791 0.806 0.821 0.757 0.745 0.817 89 0.755 0.801 0.724 0.737 0.760 0.694 0.678 0.751

121

90 0.772 0.820 0.767 0.752 0.821 0.733 0.711 0.792 91 0.056 0.000 0.750 0.046 0.883 0.693 0.514 0.816 92 0.043 0.073 0.631 0.007 0.722 0.587 0.416 0.680 93 0.247 0.336 0.363 0.248 0.528 0.327 0.180 0.414 94 0.053 0.000 0.743 0.046 0.873 0.688 0.509 0.808 95 0.043 0.065 0.690 0.039 0.797 0.641 0.463 0.751 96 0.000 0.000 0.689 0.010 0.807 0.639 0.458 0.751 97 0.014 0.000 0.676 0.044 0.784 0.629 0.441 0.731 98 0.047 0.000 0.730 0.017 0.855 0.676 0.494 0.793

49 50 51 52 53 54 55 56 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.025 0.001 0.001 0.001 0.001 0.001 0.001 4 0.001 0.440 0.001 0.001 0.001 0.001 0.001 0.001 5 0.001 0.001 0.001 0.001 0.004 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.001 0.001 0.001 0.001 0.002 0.001 0.002 0.001 11 0.001 0.001 0.001 0.003 0.025 0.001 0.008 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.048 0.001 0.118 0.501 0.445 0.219 0.312 0.522 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.011 0.001 0.002 0.009 0.135 0.012 0.033 0.012 20 0.190 0.001 0.003 0.080 0.394 0.055 0.141 0.076 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 23 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 24 0.337 0.001 0.230 0.509 0.404 0.454 0.113 0.433 25 0.001 0.320 0.001 0.001 0.001 0.001 0.001 0.001 26 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 28 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 29 0.001 0.011 0.001 0.001 0.001 0.001 0.001 0.001 30 0.001 0.094 0.001 0.001 0.001 0.001 0.001 0.001

122

31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 33 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.001 0.351 0.001 0.001 0.001 0.001 0.001 0.001 35 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 36 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 37 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 38 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 39 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 40 0.013 0.001 0.089 0.371 0.128 0.469 0.089 0.228 41 0.074 0.001 0.015 0.403 0.521 0.015 0.414 0.474 42 0.015 0.001 0.342 0.482 0.044 0.214 0.004 0.224 43 0.001 0.419 0.001 0.001 0.001 0.001 0.001 0.001 44 0.411 0.001 0.008 0.362 0.485 0.126 0.100 0.254 45 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 46 0.001 0.472 0.001 0.001 0.001 0.001 0.001 0.001 47 0.001 0.011 0.002 0.001 0.001 0.001 0.001 0.001 48 0.001 0.422 0.001 0.001 0.001 0.001 0.001 0.001 49 0.000 0.001 0.005 0.042 0.313 0.020 0.035 0.030 50 0.517 0.000 0.001 0.001 0.001 0.001 0.001 0.001 51 0.130 0.753 0.000 0.459 0.006 0.082 0.002 0.329 52 0.080 0.734 0.004 0.000 0.214 0.215 0.379 0.410 53 0.009 0.639 0.102 0.023 0.000 0.009 0.396 0.104 54 0.102 0.758 0.065 0.025 0.075 0.000 0.004 0.111 55 0.072 0.663 0.098 0.004 0.000 0.073 0.000 0.213 56 0.088 0.719 0.000 0.000 0.044 0.032 0.029 0.000 57 0.406 0.239 0.600 0.579 0.505 0.597 0.533 0.574 58 0.089 0.723 0.025 0.000 0.069 0.042 0.062 0.000 59 0.422 0.000 0.604 0.589 0.518 0.614 0.536 0.574 60 0.432 0.000 0.648 0.626 0.539 0.648 0.564 0.615 61 0.389 0.604 0.601 0.584 0.503 0.598 0.532 0.567 62 0.384 0.582 0.602 0.587 0.491 0.607 0.527 0.571 63 0.293 0.570 0.455 0.428 0.372 0.446 0.385 0.411 64 0.057 0.464 0.211 0.175 0.121 0.186 0.167 0.175 65 0.214 0.450 0.367 0.356 0.308 0.375 0.343 0.348 66 0.297 0.438 0.457 0.438 0.370 0.446 0.377 0.428 67 0.247 0.772 0.415 0.385 0.316 0.362 0.346 0.373 68 0.215 0.795 0.367 0.326 0.277 0.350 0.292 0.315 69 0.100 0.764 0.092 0.009 0.070 0.033 0.072 0.034 70 0.029 0.670 0.079 0.033 0.013 0.033 0.039 0.047 71 0.221 0.680 0.319 0.304 0.257 0.300 0.252 0.298

123

72 0.285 0.851 0.483 0.466 0.356 0.468 0.372 0.442 73 0.341 0.746 0.469 0.457 0.413 0.467 0.418 0.450 74 0.741 0.877 0.874 0.868 0.817 0.878 0.829 0.860 75 0.246 0.815 0.335 0.304 0.270 0.368 0.290 0.297 76 0.058 0.726 0.124 0.067 0.057 0.088 0.094 0.081 77 0.042 0.693 0.128 0.027 0.010 0.099 0.021 0.039 78 0.116 0.732 0.185 0.124 0.103 0.157 0.116 0.132 79 0.622 0.747 0.750 0.745 0.694 0.749 0.704 0.737 80 0.670 0.786 0.797 0.792 0.746 0.797 0.759 0.784 81 0.699 0.811 0.820 0.816 0.771 0.822 0.782 0.807 82 0.691 0.858 0.835 0.827 0.770 0.838 0.782 0.818 83 0.706 0.850 0.839 0.834 0.784 0.840 0.796 0.824 84 0.448 0.639 0.600 0.591 0.530 0.592 0.539 0.579 85 0.595 0.761 0.785 0.776 0.705 0.796 0.723 0.762 86 0.688 0.803 0.814 0.809 0.763 0.815 0.775 0.801 87 0.207 0.659 0.305 0.298 0.247 0.270 0.253 0.291 88 0.714 0.831 0.839 0.835 0.788 0.841 0.800 0.826 89 0.648 0.763 0.769 0.764 0.716 0.771 0.727 0.757 90 0.658 0.804 0.788 0.781 0.730 0.788 0.739 0.775 91 0.125 0.847 0.114 0.000 0.086 0.055 0.087 0.032 92 0.052 0.697 0.102 0.044 0.029 0.053 0.062 0.047 93 0.194 0.412 0.314 0.267 0.231 0.301 0.216 0.262 94 0.122 0.837 0.107 0.000 0.068 0.044 0.066 0.030 95 0.103 0.773 0.111 0.025 0.061 0.037 0.070 0.008 96 0.083 0.774 0.077 0.000 0.005 0.033 0.014 0.006 97 0.113 0.757 0.006 0.000 0.040 0.008 0.039 0.000 98 0.106 0.822 0.099 0.004 0.070 0.047 0.080 0.028

57 58 59 60 61 62 63 64 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.001 0.269 0.248 0.001 0.001 0.001 0.001 4 0.001 0.001 0.110 0.085 0.001 0.001 0.001 0.001 5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.002 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.002 11 0.001 0.002 0.001 0.001 0.001 0.001 0.001 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

124

13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.497 0.001 0.001 0.001 0.001 0.001 0.001 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.001 0.010 0.001 0.001 0.001 0.001 0.001 0.001 20 0.001 0.010 0.001 0.001 0.001 0.001 0.001 0.002 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.001 0.001 0.001 0.011 0.017 23 0.001 0.001 0.001 0.001 0.001 0.001 0.003 0.013 24 0.001 0.341 0.001 0.001 0.001 0.001 0.001 0.007 25 0.001 0.001 0.275 0.342 0.001 0.001 0.001 0.001 26 0.007 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 28 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.002 29 0.001 0.001 0.024 0.150 0.001 0.001 0.001 0.001 30 0.014 0.001 0.007 0.112 0.001 0.001 0.001 0.001 31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 33 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.001 0.001 0.028 0.316 0.001 0.001 0.001 0.001 35 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 36 0.001 0.001 0.001 0.001 0.001 0.001 0.449 0.001 37 0.001 0.001 0.001 0.001 0.001 0.001 0.171 0.013 38 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 39 0.001 0.001 0.001 0.001 0.001 0.001 0.306 0.015 40 0.001 0.288 0.001 0.001 0.001 0.001 0.001 0.001 41 0.001 0.046 0.001 0.001 0.001 0.001 0.001 0.001 42 0.001 0.478 0.001 0.001 0.001 0.001 0.001 0.001 43 0.001 0.001 0.352 0.343 0.001 0.001 0.001 0.001 44 0.001 0.061 0.001 0.001 0.001 0.001 0.001 0.011 45 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 46 0.001 0.001 0.431 0.384 0.001 0.001 0.001 0.001 47 0.001 0.001 0.316 0.026 0.001 0.001 0.001 0.001 48 0.001 0.001 0.219 0.043 0.001 0.001 0.001 0.001 49 0.001 0.034 0.001 0.001 0.001 0.001 0.001 0.072 50 0.001 0.001 0.365 0.333 0.001 0.001 0.001 0.001 51 0.001 0.201 0.001 0.001 0.001 0.001 0.001 0.001 52 0.001 0.527 0.001 0.001 0.001 0.001 0.001 0.001 53 0.001 0.028 0.001 0.001 0.001 0.001 0.001 0.004

125

54 0.001 0.105 0.001 0.001 0.001 0.001 0.001 0.001 55 0.001 0.007 0.001 0.001 0.001 0.001 0.001 0.001 56 0.001 0.620 0.001 0.001 0.001 0.001 0.001 0.001 57 0.000 0.001 0.002 0.005 0.001 0.001 0.001 0.001 58 0.579 0.000 0.001 0.001 0.001 0.001 0.001 0.001 59 0.183 0.585 0.000 0.376 0.001 0.001 0.001 0.001 60 0.152 0.623 0.000 0.000 0.001 0.001 0.001 0.001 61 0.485 0.550 0.479 0.504 0.000 0.054 0.001 0.001 62 0.458 0.572 0.444 0.466 0.050 0.000 0.001 0.001 63 0.463 0.398 0.444 0.473 0.264 0.300 0.000 0.006 64 0.376 0.176 0.358 0.373 0.247 0.230 0.083 0.000 65 0.370 0.340 0.354 0.372 0.223 0.208 0.066 0.047 66 0.390 0.439 0.312 0.350 0.480 0.461 0.396 0.266 67 0.621 0.372 0.652 0.677 0.656 0.658 0.548 0.322 68 0.629 0.313 0.660 0.685 0.668 0.676 0.531 0.295 69 0.595 0.027 0.614 0.648 0.616 0.625 0.452 0.181 70 0.535 0.064 0.545 0.571 0.530 0.526 0.389 0.130 71 0.560 0.271 0.561 0.592 0.559 0.570 0.447 0.285 72 0.666 0.447 0.708 0.736 0.739 0.740 0.630 0.390 73 0.611 0.456 0.625 0.657 0.645 0.647 0.553 0.399 74 0.731 0.859 0.810 0.820 0.852 0.854 0.837 0.776 75 0.644 0.315 0.674 0.706 0.690 0.692 0.570 0.338 76 0.572 0.079 0.599 0.624 0.578 0.584 0.434 0.154 77 0.547 0.063 0.554 0.583 0.560 0.557 0.417 0.160 78 0.581 0.140 0.598 0.624 0.592 0.595 0.442 0.200 79 0.644 0.735 0.687 0.693 0.726 0.729 0.711 0.649 80 0.682 0.784 0.727 0.733 0.766 0.766 0.751 0.691 81 0.707 0.808 0.749 0.757 0.789 0.790 0.773 0.719 82 0.729 0.816 0.790 0.799 0.822 0.825 0.803 0.732 83 0.740 0.824 0.785 0.794 0.827 0.829 0.812 0.744 84 0.537 0.583 0.547 0.568 0.566 0.569 0.489 0.424 85 0.613 0.767 0.643 0.669 0.729 0.722 0.705 0.607 86 0.698 0.800 0.741 0.748 0.780 0.782 0.766 0.710 87 0.541 0.296 0.548 0.574 0.539 0.541 0.433 0.255 88 0.722 0.825 0.767 0.776 0.806 0.809 0.793 0.736 89 0.664 0.757 0.700 0.708 0.750 0.749 0.736 0.675 90 0.683 0.772 0.740 0.749 0.777 0.778 0.762 0.695 91 0.642 0.018 0.684 0.716 0.698 0.708 0.538 0.230 92 0.553 0.063 0.571 0.596 0.548 0.553 0.399 0.141 93 0.350 0.267 0.296 0.335 0.403 0.413 0.295 0.192 94 0.639 0.027 0.677 0.709 0.688 0.697 0.529 0.223

126

95 0.602 0.054 0.626 0.658 0.615 0.630 0.447 0.200 96 0.601 0.020 0.625 0.656 0.624 0.627 0.465 0.183 97 0.597 0.010 0.611 0.647 0.600 0.603 0.444 0.188 98 0.629 0.022 0.664 0.696 0.669 0.678 0.506 0.200

65 66 67 68 69 70 71 72 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 4 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 5 0.001 0.001 0.005 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.009 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 10 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 11 0.001 0.001 0.001 0.001 0.002 0.001 0.001 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.001 0.001 0.001 0.362 0.199 0.001 0.001 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.001 0.001 0.001 0.001 0.005 0.001 0.001 0.001 20 0.001 0.001 0.001 0.001 0.085 0.304 0.001 0.001 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.010 0.001 0.001 0.001 0.001 0.001 0.001 0.001 23 0.003 0.001 0.001 0.001 0.001 0.001 0.001 0.001 24 0.001 0.001 0.001 0.001 0.528 0.422 0.001 0.001 25 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 26 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 28 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 29 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 30 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 33 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 35 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

127

36 0.003 0.001 0.001 0.001 0.001 0.001 0.001 0.001 37 0.005 0.001 0.001 0.001 0.001 0.001 0.001 0.001 38 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 39 0.006 0.001 0.001 0.001 0.001 0.001 0.001 0.001 40 0.001 0.001 0.001 0.004 0.420 0.123 0.001 0.001 41 0.001 0.001 0.001 0.001 0.078 0.117 0.001 0.001 42 0.001 0.001 0.001 0.002 0.228 0.003 0.001 0.001 43 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 44 0.001 0.001 0.001 0.001 0.069 0.369 0.001 0.001 45 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 46 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 47 0.001 0.006 0.001 0.001 0.001 0.001 0.001 0.001 48 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 49 0.001 0.001 0.001 0.001 0.012 0.165 0.001 0.001 50 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 51 0.001 0.001 0.001 0.001 0.024 0.016 0.001 0.001 52 0.001 0.001 0.001 0.001 0.312 0.126 0.001 0.001 53 0.001 0.001 0.001 0.002 0.024 0.296 0.001 0.001 54 0.001 0.001 0.001 0.001 0.141 0.123 0.001 0.001 55 0.001 0.001 0.001 0.001 0.005 0.118 0.001 0.001 56 0.001 0.001 0.001 0.001 0.110 0.084 0.001 0.001 57 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 58 0.001 0.001 0.001 0.001 0.182 0.001 0.001 0.001 59 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 60 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 61 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 62 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 63 0.009 0.001 0.001 0.001 0.001 0.001 0.001 0.001 64 0.112 0.001 0.001 0.001 0.001 0.001 0.001 0.001 65 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 66 0.336 0.000 0.001 0.001 0.001 0.001 0.008 0.001 67 0.456 0.551 0.000 0.001 0.001 0.001 0.001 0.001 68 0.445 0.549 0.496 0.000 0.013 0.001 0.001 0.001 69 0.379 0.463 0.400 0.250 0.000 0.042 0.001 0.001 70 0.324 0.370 0.285 0.238 0.049 0.000 0.001 0.001 71 0.393 0.203 0.474 0.457 0.339 0.237 0.000 0.058 72 0.513 0.363 0.644 0.667 0.547 0.323 0.059 0.000 73 0.444 0.362 0.592 0.596 0.522 0.402 0.251 0.408 74 0.756 0.817 0.873 0.891 0.885 0.833 0.832 0.917 75 0.425 0.566 0.567 0.567 0.409 0.301 0.474 0.713 76 0.350 0.454 0.314 0.315 0.084 0.000 0.328 0.472

128

77 0.355 0.401 0.365 0.315 0.082 0.022 0.275 0.427 78 0.378 0.462 0.384 0.005 0.056 0.088 0.347 0.501 79 0.650 0.652 0.753 0.762 0.756 0.704 0.672 0.767 80 0.666 0.742 0.768 0.803 0.802 0.757 0.763 0.839 81 0.694 0.765 0.796 0.825 0.827 0.782 0.786 0.863 82 0.734 0.787 0.835 0.847 0.844 0.786 0.794 0.886 83 0.739 0.790 0.813 0.850 0.847 0.796 0.800 0.885 84 0.438 0.419 0.629 0.619 0.599 0.527 0.451 0.606 85 0.558 0.679 0.800 0.823 0.805 0.725 0.730 0.867 86 0.693 0.757 0.789 0.820 0.820 0.775 0.778 0.856 87 0.368 0.218 0.417 0.381 0.310 0.214 0.058 0.098 88 0.718 0.781 0.816 0.849 0.847 0.800 0.800 0.881 89 0.666 0.674 0.773 0.785 0.778 0.725 0.701 0.790 90 0.698 0.709 0.789 0.797 0.794 0.739 0.721 0.812 91 0.430 0.541 0.522 0.500 0.024 0.082 0.404 0.762 92 0.338 0.422 0.282 0.262 0.052 0.000 0.296 0.418 93 0.281 0.267 0.424 0.405 0.299 0.258 0.316 0.459 94 0.425 0.533 0.498 0.468 0.027 0.061 0.396 0.727 95 0.393 0.477 0.435 0.388 0.063 0.066 0.346 0.551 96 0.386 0.473 0.420 0.315 0.000 0.026 0.334 0.545 97 0.369 0.451 0.382 0.354 0.030 0.045 0.299 0.480 98 0.405 0.518 0.477 0.453 0.024 0.052 0.380 0.681

129

18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.001 0.001 0.001 0.007 0.005 0.001 0.001 0.001 20 0.001 0.001 0.001 0.028 0.262 0.011 0.001 0.001 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 23 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 24 0.001 0.001 0.001 0.280 0.282 0.014 0.001 0.001 25 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 26 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 28 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 29 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 30 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 33 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 35 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 36 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 37 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 38 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 39 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 40 0.001 0.001 0.001 0.106 0.011 0.071 0.001 0.001 41 0.001 0.001 0.001 0.023 0.300 0.017 0.001 0.001 42 0.001 0.001 0.001 0.211 0.063 0.019 0.001 0.001 43 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 44 0.001 0.001 0.001 0.304 0.226 0.009 0.001 0.001 45 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 46 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 47 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 48 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 49 0.001 0.001 0.001 0.089 0.165 0.009 0.001 0.001 50 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 51 0.001 0.001 0.001 0.025 0.008 0.002 0.001 0.001 52 0.001 0.001 0.001 0.168 0.199 0.015 0.001 0.001 53 0.001 0.001 0.001 0.105 0.318 0.015 0.001 0.001 54 0.001 0.001 0.001 0.051 0.015 0.007 0.001 0.001 55 0.001 0.001 0.001 0.010 0.261 0.008 0.001 0.001 56 0.001 0.001 0.001 0.114 0.132 0.008 0.001 0.001 57 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 58 0.001 0.001 0.001 0.100 0.051 0.006 0.001 0.001

130

59 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 60 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 61 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 62 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 63 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 64 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 65 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 66 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 67 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 68 0.001 0.001 0.001 0.001 0.001 0.484 0.001 0.001 69 0.001 0.001 0.001 0.074 0.070 0.129 0.001 0.001 70 0.001 0.001 0.001 0.356 0.217 0.018 0.001 0.001 71 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 72 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 73 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 74 0.855 0.000 0.001 0.001 0.001 0.001 0.001 0.001 75 0.508 0.894 0.000 0.001 0.001 0.001 0.001 0.001 76 0.487 0.859 0.361 0.000 0.023 0.005 0.001 0.001 77 0.453 0.851 0.351 0.111 0.000 0.007 0.001 0.001 78 0.502 0.863 0.398 0.151 0.129 0.000 0.001 0.001 79 0.720 0.704 0.779 0.733 0.726 0.735 0.000 0.001 80 0.783 0.734 0.812 0.779 0.776 0.780 0.642 0.000 81 0.806 0.761 0.837 0.806 0.801 0.802 0.660 0.016 82 0.829 0.821 0.865 0.815 0.810 0.815 0.660 0.767 83 0.823 0.802 0.858 0.822 0.816 0.823 0.681 0.555 84 0.555 0.780 0.663 0.584 0.563 0.573 0.571 0.694 85 0.766 0.847 0.819 0.767 0.750 0.776 0.724 0.726 86 0.799 0.768 0.830 0.799 0.792 0.797 0.654 0.290 87 0.257 0.812 0.437 0.289 0.286 0.295 0.644 0.740 88 0.823 0.783 0.853 0.825 0.818 0.825 0.656 0.483 89 0.724 0.701 0.779 0.755 0.746 0.757 0.157 0.652 90 0.762 0.774 0.816 0.769 0.764 0.769 0.567 0.734 91 0.606 0.920 0.562 0.114 0.122 0.213 0.791 0.836 92 0.453 0.845 0.321 0.000 0.045 0.105 0.718 0.767 93 0.433 0.762 0.414 0.302 0.240 0.314 0.643 0.697 94 0.594 0.916 0.532 0.086 0.108 0.185 0.786 0.832 95 0.519 0.886 0.420 0.111 0.069 0.171 0.759 0.806 96 0.523 0.888 0.398 0.071 0.035 0.078 0.760 0.807 97 0.483 0.878 0.351 0.088 0.095 0.144 0.748 0.797 98 0.577 0.910 0.502 0.057 0.111 0.192 0.779 0.825

131

81 82 83 84 85 86 87 88 1 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 2 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 3 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 4 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 5 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 6 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 7 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 8 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 9 0.001 0.001 0.001 0.001 0.001 0.069 0.001 0.001 10 0.001 0.001 0.001 0.001 0.001 0.001 0.002 0.001 11 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 12 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 13 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 14 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 15 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 16 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 17 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 18 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 19 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 20 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 21 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 22 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 23 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 24 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 25 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 26 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 28 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 29 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 30 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 33 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 35 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 36 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 37 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 38 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 39 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 40 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

132

41 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 42 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 43 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 44 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 45 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 46 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 47 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 48 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 49 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 50 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 51 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 52 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 53 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 54 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 55 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 56 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 57 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 58 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 59 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 60 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 61 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 62 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 63 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 64 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 65 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 66 0.001 0.001 0.001 0.001 0.001 0.001 0.002 0.001 67 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 68 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 69 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 70 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 71 0.001 0.001 0.001 0.001 0.001 0.001 0.027 0.001 72 0.001 0.001 0.001 0.001 0.001 0.001 0.004 0.001 73 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 74 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 75 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 76 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 77 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 78 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 79 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 80 0.203 0.001 0.001 0.001 0.001 0.001 0.001 0.001 81 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001

133

82 0.789 0.000 0.001 0.001 0.001 0.001 0.001 0.001 83 0.592 0.806 0.000 0.001 0.001 0.001 0.001 0.001 84 0.716 0.733 0.741 0.000 0.001 0.001 0.001 0.001 85 0.755 0.839 0.802 0.625 0.000 0.001 0.001 0.001 86 0.296 0.783 0.577 0.711 0.762 0.000 0.001 0.001 87 0.764 0.769 0.780 0.389 0.704 0.759 0.000 0.001 88 0.502 0.809 0.399 0.718 0.777 0.477 0.781 0.000 89 0.670 0.684 0.693 0.616 0.735 0.664 0.673 0.673 90 0.755 0.357 0.770 0.687 0.786 0.750 0.695 0.771 91 0.862 0.885 0.885 0.665 0.865 0.854 0.378 0.882 92 0.792 0.800 0.807 0.553 0.745 0.786 0.245 0.811 93 0.719 0.702 0.736 0.477 0.566 0.711 0.337 0.735 94 0.858 0.881 0.881 0.657 0.858 0.851 0.362 0.878 95 0.830 0.847 0.850 0.610 0.810 0.824 0.331 0.850 96 0.832 0.848 0.852 0.613 0.811 0.825 0.313 0.852 97 0.821 0.836 0.840 0.594 0.793 0.815 0.282 0.841 98 0.851 0.873 0.873 0.644 0.845 0.844 0.358 0.871

134

23 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 24 0.001 0.001 0.482 0.380 0.001 0.498 0.333 0.496 25 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 26 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 27 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 28 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 29 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 30 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 31 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 32 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 33 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 34 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 35 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 36 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 37 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 38 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 39 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 40 0.001 0.001 0.589 0.077 0.001 0.417 0.219 0.487 41 0.001 0.001 0.123 0.150 0.001 0.124 0.184 0.410 42 0.001 0.001 1.000 0.051 0.001 1.000 0.228 1.000 43 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 44 0.001 0.001 0.112 0.366 0.001 0.113 0.123 0.402 45 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 46 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 47 0.001 0.001 0.001 0.001 0.003 0.001 0.001 0.001 48 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 49 0.001 0.001 0.013 0.101 0.001 0.009 0.028 0.054 50 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 51 0.001 0.001 0.101 0.002 0.001 0.102 0.023 0.107 52 0.001 0.001 0.464 0.038 0.001 0.471 0.143 0.518 53 0.001 0.001 0.045 0.220 0.001 0.043 0.063 0.454 54 0.001 0.001 0.233 0.053 0.001 0.239 0.223 0.213 55 0.001 0.001 0.006 0.020 0.001 0.025 0.015 0.304 56 0.001 0.001 0.471 0.063 0.001 0.492 0.432 0.472 57 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 58 0.001 0.001 0.484 0.024 0.001 0.456 0.117 0.478 59 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 60 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 61 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 62 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 63 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

135

64 0.001 0.001 0.001 0.002 0.001 0.001 0.001 0.001 65 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 66 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 67 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 68 0.001 0.001 0.001 0.002 0.001 0.001 0.001 0.006 69 0.001 0.001 0.366 0.037 0.001 0.356 0.057 0.226 70 0.001 0.001 0.001 0.404 0.001 0.032 0.030 0.204 71 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 72 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 73 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 74 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 75 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 76 0.001 0.001 0.208 0.347 0.001 0.207 0.051 0.221 77 0.001 0.001 0.050 0.106 0.001 0.096 0.068 0.179 78 0.001 0.001 0.017 0.017 0.001 0.026 0.006 0.084 79 0.002 0.001 0.001 0.001 0.001 0.001 0.001 0.001 80 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 81 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 82 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 83 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 84 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 85 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 86 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 87 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 88 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 89 0.000 0.001 0.001 0.001 0.001 0.001 0.001 0.001 90 0.592 0.000 0.001 0.001 0.001 0.001 0.001 0.001 91 0.812 0.831 0.000 0.050 0.001 1.000 0.221 1.000 92 0.739 0.756 0.082 0.000 0.001 0.127 0.107 0.207 93 0.665 0.666 0.350 0.273 0.000 0.001 0.001 0.001 94 0.807 0.826 0.000 0.055 0.343 0.000 0.205 0.454 95 0.780 0.801 0.080 0.050 0.292 0.074 0.000 0.216 96 0.781 0.798 0.000 0.032 0.299 0.000 0.028 0.000 97 0.770 0.787 0.029 0.054 0.303 0.027 0.060 0.000 98 0.801 0.820 0.000 0.048 0.335 0.000 0.067 0.000

97 98 1 0.001 0.001 2 0.001 0.001 3 0.001 0.001 4 0.001 0.001

136

5 0.001 0.001 6 0.001 0.001 7 0.001 0.001 8 0.001 0.001 9 0.001 0.001 10 0.001 0.001 11 0.011 0.003 12 0.001 0.001 13 0.001 0.001 14 0.001 0.001 15 0.231 1.000 16 0.001 0.001 17 0.001 0.001 18 0.001 0.001 19 0.238 0.014 20 0.019 0.046 21 0.001 0.001 22 0.001 0.001 23 0.001 0.001 24 0.514 0.498 25 0.001 0.001 26 0.001 0.001 27 0.001 0.001 28 0.001 0.001 29 0.001 0.001 30 0.001 0.001 31 0.001 0.001 32 0.001 0.001 33 0.001 0.001 34 0.001 0.001 35 0.001 0.001 36 0.001 0.001 37 0.001 0.001 38 0.001 0.001 39 0.001 0.001 40 0.372 0.184 41 0.304 0.115 42 0.505 1.000 43 0.001 0.001 44 0.033 0.436 45 0.001 0.001

137

46 0.001 0.001 47 0.001 0.001 48 0.001 0.001 49 0.003 0.035 50 0.001 0.001 51 0.378 0.097 52 0.513 0.463 53 0.110 0.045 54 0.307 0.240 55 0.087 0.005 56 0.213 0.459 57 0.001 0.001 58 0.393 0.475 59 0.001 0.001 60 0.001 0.001 61 0.001 0.001 62 0.001 0.001 63 0.001 0.001 64 0.001 0.001 65 0.001 0.001 66 0.001 0.001 67 0.001 0.001 68 0.002 0.002 69 0.105 0.383 70 0.041 0.118 71 0.001 0.001 72 0.001 0.001 73 0.001 0.001 74 0.001 0.001 75 0.001 0.001 76 0.054 0.219 77 0.016 0.040 78 0.010 0.021 79 0.001 0.001 80 0.001 0.001 81 0.001 0.001 82 0.001 0.001 83 0.001 0.001 84 0.001 0.001 85 0.001 0.001 86 0.001 0.001

138

87 0.001 0.001 88 0.001 0.001 89 0.001 0.001 90 0.001 0.001 91 0.255 1.000 92 0.044 0.245 93 0.001 0.001 94 0.244 1.000 95 0.047 0.236 96 0.241 1.000 97 0.000 0.328 98 0.017 0.000

Continental Festuca arundinacea germplasm relationships

Because the cpSSRs did not show separation of cultivars or collections from each other, the relationships between populations of continental hexaploid tall fescue are based on nuSSRs. Within the continental tall fescue germplasm, there are three clear subgroups.

The most basal of these, is dominated by collections from Balkan states. This group also included ‘Kentucky-31,’ and ‘JesupMaxQ’ which is derived from a pasture seeded with

‘Kentucky-31’ (Bouton et al, 1997). The other two subgroups are sister to each other. One of these is dominated by collections from Turkey. At the base of this group, there are two collections from Italy. At the top of this group is a separate group of cultivars, ‘Teton,’

‘Atlas,’ and ‘Fawn,’ all of which were developed in Oregon for forage use (Cascade Seed

Company, 2000; Brown – personal communication; Frakes and Cowan, 1974). Within this group there are two collections from Morocco, some individuals in these collections had the Mediterranean haplotype based on Chl045 and two other individuals had the

Continental haplotype. These two collections were basal to all Continental tall fescue accessions in the cpSSR dendrogram. The third subgroup in this dendrogram contains turf-

139 type tall fescue cultivars developed at the New Jersey Agricultural Experiment Station with a common germplasm pool (see Table 1 for breeding histories). This subgroup also includes collections from Italy, Romania, and Turkey. The turf-type cultivars and a collection from Romania, formed a single monophyletic group. Interestingly, those collections from Romania has similar morphology, i.e. dark green color, low growth habit and increased tillering, to the other turf-type accessions in that group. However, based on the dendogram they do appear to be genetically distinct from those US turf-type populations.The Rutgers germplasm is based on collections of tall fescue made from the

Eastern part of the United States in the early 1970s. Since, tall fescue is not native to the

United States this must have been introduced. While the exact date is unknown it has been suggested it was intentionally imported in the 1880s (Hoveland, 2009; Beard, 2013).

Comparison of relationships based on nuSSRs and relationships based on cpSSRs

Both dendrograms agree that Festuca pratensis shares a close affinity with Lolium perenne. Festuca pratensis being closely related to Lolium has been shown in earlier work based on the ITS region (Gaut et al, 2000), EST-SSRs (Saha et al, 2004), trnL-F plastid gene (Catalán et al, 2004). Both methods separated the Continental tall fescue from the

Mediterranean tall fescue. The Festuca arundinacea var. glaucescens accession PI595048 was found to be closely related to forage-type cultivar ‘JesupMaxQ.’ Within the continental tall fescue, the collections from Turkey form a single group in both dendrograms.

Collection A12-1124 from Capitigano, Italy grouped with the Turkish collections with both nuSSRs and cpSSRs. In both dengrograms, the forage cultivars ‘Teton’ and ‘Atlas’ were closely related to this Turkish/Italian group. In both dendrograms, Romanian collections are the most closely related to the turf-type cultivars, however, in the cpSSR dendogram,

140 the turf-type cultivars do not form a single group like they do in the nuSSR dendrogram, instead they form a group mixed with collections from Romania, Macedonia, Montenegro,

Albania, and Italy. There is low boot-strap support for divisions within this group. With the exception of Turkey, there is no clear grouping of collections by geography based on cpSSRs.

The placement of Festuca arundinacea var. glaucescens (accessions PI289651 and

PI289654) differs in two dendrograms. In the nuSSR dendrogram, glaucescens is basal to all entries except Festuca pratensis and Lolium perenne suggesting it could be related to both the Continental type and the Mediterranean type of tall fescue. In the cpSSR tree, glaucescens is basal it to all continental tall fescue (except the collection A13-1538 from

Xibracke, Albania, to which is groups closely to). This suggests that the chloroplast lineage is more related to the continental morphotype, agreeing with previous suggestions that this is the maternal parent (Hand et al, 2012). A discrepancy has been seen in earlier work, with

ITS, a nuclear gene, showing Festuca arundinacea var. glaucescens closer to

Mediterranean species but with the trnL-F plastid gene Festuca arundinacea var. glaucescens was closer to the continental type (Catalán et al, 2004). This difference is reflected here, however, the nuSSR genotyping did not find the Festuca arundinacea var. glaucescens was part of the Mediterranean group but a group basal to both Continental and

Mediterranean broad-leaved fescues, suggesting that it may be related to both morphotypes of tall fescue (Ezquerro-López et al, 2017).

Genetic diversity based on nuSSR markers, model based clustering analysis

The output of the nuSSR Bayesian model-based clustering analysis (STRUCTURE

2.3.4) are presented in Figure 3 and Figure 4. Individual numbers below each colored bar

141 in Figure 3 and Figure 4 correspond to the entry numbers at the end of the entry name in the nuSSR NJ diagram (Fig 1). The colors in Figure 3 do not correspond to the colors in

Figure 4. The most parsimonious number of genetic divisions/populations (K) in this dataset based on the maximal value of the first plateau of the average estimated log probability Pr(X|K) occurred at K=19, however, the Evanno Δ(K) ad hoc statistic found the most parsimonious value of K to be K=28. There is some evidence to support both K values so both scenarios will be discussed.

At K=19 (Figure 3), the genetic clusters identified by STRUCTURE agreed with much of the nuSSR neighbor-joining tree. This analysis identified one cluster for Lolium perenne (genotypes 1553-1568) that is shared with Festuca pratensis (genotypes 1521-

1536 and genotypes 1537-1552), Festuca arundinacea var. glaucescens (genotypes 1489-

1504 and genotypes 1505-1520), and Lolium multiflorum (genotypes 1217-1532 and genotypes 1233-1248), even though annual ryegrass did not group with perennial ryegrass in the NJ tree there is a relationship between the two species here. Within Lolium multiflorum, in addition to the group that is shared with Lolium perenne and Festuca pratensis, there is a contribution from a genetic group that is common in turf-type cultivars of tall fescue (genotypes 1-16, genotypes 17-32, genotypes 33-48, genotypes 49-64, genotypes 65-80, genotypes 81-96, genotypes 97-112, genotypes 113-128, genotypes 129-

144, genotypes 145-160, genotypes 161-176, genotypes 177-192, genotypes 209-224, genotypes 224-240, and genotypes 241-256). When (K)=28 (Figure 4), there is still one main genetic group within the individuals of Lolium perenne, this group is also shared with all individuals of Festuca pratensis and Lolium multiflorum, with a contribution from a

142

143

144

145

genetic group this is common in turf-type tall fescue. The similarity between Festuca pratensis and Lolium agrees with previous research (Xu and Sleper, 1994; Charmet et al,

1997). When (K)=19, the Mediterranean Festuca species, Festuca mairei (genotypes 1457-

1472 and genotypes 1473-1488), Festuca arundinacea subsp. atlantigena (genotypes

146

1441-1472), and Festuca arundinacea subsp. letourneuxiana (genotypes 1409-1424 and genotypes 1425-1440) share one genetic cluster, which also appears in some of the

Mediterranean hexaploid Festuca arundinacea (genotypes 1249-1264, genotypes 1265-

1280, genotypes 1281-1296, genotypes 1297-1312, genotypes 1313-1328, genotypes

1329-1344, genotypes 1345-1360, genotypes 1361-1376, genotypes 1377-1392, genotypes

1393-1408). When (K)=28, the octoploid Festuca arundinacea subsp. altantigena is not composed of a single group, like when (K)=19, but it composed of several groups, including the one common in Festuca mairei and another genetic group which is a constituent group of A11-1781 from Amelago, Morocco (genotypes 305-320). The decaploid Festuca arundinacea subsp. letourexiana individuals show a contribution from the genetic group that is the main contributor to Festuca mairei as well as a contribution from a genetic group that is common in the Mediterranean hexaploids. Both of these species have been proposed as progenitor species of the decaploid, the similarities to both the tetraploid and the hexaploid might support both these hypotheses of the decaploid’s origin (Malik and Thomas, 1967; Ezquerro-López et al, 2017). Among the Mediterranean hexaploids, there are two genetic clusters that comprise the majority of most individuals.

The Festuca arundinacea var. glaucescens accession PI595048 (genotypes 881-896), which grouped with 'Kentucky 31’ (genotypes 865-880) and ‘JesupMaxQ’ (genotypes 849-

864) in the NJ dendrogram, shows a similar composition of genetic groups in the

STRUCTURE results as those cultivars, explaining its close proximity in the nuSSR dendogram.

There is a large amount of diversity within the continental tall fescue. Among the turf-type cultivars (genotypes 1-16, genotypes 17-32, genotypes 33-48, genotypes 49-64,

147 genotypes 65-80, genotypes 81-96, genotypes 97-112, genotypes 113-128, genotypes 129-

144, genotypes 145-160, genotypes 161-176, genotypes 177-192, genotypes 209-224, genotypes 224-240, and genotypes 241-256) the same genetic group makes up a large amount of each individual with several other groups also contributing both when (K)=19 and when (K)=28. In the nuSSR tree, A11-1813 from Domnesti, Romania (genotypes 193-

208) clustered with these cultivars, in Fig 3 this collection shares genetic groups with the turf-types but the main cluster that made up the turf-types is a minor contributor to this collection, the same being true when (K)=28. All of the turf-type tall fescue share germplasm sources that were collected in the United States. Because tall fescue is not native to the United States, this material would have been introduced and naturalized with the genetic diversity reduced due to a founder effect (Table 1). In the nuSSR dendrogram, collection A11-1822 from Domnesti, Romania (genotypes 257-272), A11-1790 from

Domnesti, Romania (genotypes 273-288), A11-1846 from Domnesti, Romania (genotypes

289-304), A11-1781 from Amelago, Morocco (genotypes 305-320), and A11-1811 from

Domnesti, Romania (genotypes 321-336) formed a group, in the STRUCTURE analysis these collections share a genetic group that is a major contributor to each individual, these individuals are also composed partially of the genetic group that is prominent in the turf- type cultivars. The collections from Domensti, Romania were noted as dark turf-type tall fescue where they were collected, traits that have long been goals of tall fescue breeding

(Meyer, personal communication). The two collections from Italy, A11-1806 and A11-

1805, (genotypes 337-352 and genotypes 353-368) are mainly composed of the same genetic group as each other, separating them as they were in the nuSSR dendrogram. When

(K)=19, this group is shared with ‘Kentucky 31,’ ‘JesupMaxQ,’ PI595048, Festuca

148

Figure 4- Figure 5- Output of Bayesian analysis performed in STRUCTURE 2.3.4 assuming there are 28 genetic groups [(K)=28]. Each vertical bar represents an individual. Individuals are grouped into the cultivars, collections, or accessions, which is reflected in the label. Each color represents a genetic group detected by STRUCTURE.

149

150

151

arundinacea var. glaucescens, and A12-1169 from Kemeri, Latvia (genotypes 849-864, genotypes 865-880, genotypes 881-896, genotypes 1121-1136). When (K)=28, the two

Italian collections share a genetic group with each other but this genetic group is not present the other cultivars and collections.

152

The next group of collections in the nuSSR dendrogram was strongly composed of collections from Italy, A11-1788, A11-1789, A12-1133, A12-1136, A12-1149, and A12-

1152 from Zorzoi, Italy, A12-1168, A11-1777, and A11-1768 from Dolomiti, Italy A12-

1104 from Monti Mariella, Italy, and A12-1118 from Assergi, Italy also in this cluster on the nuSSR dendrogram is one collection from Tarasci, Turkey, A11-1148. At both (K)=19 and (K)=28, A13-1789, A13-1788, A12-1148, A12-1149, A12-1133, A12-1152, A12-

1168, A11-1777, and A11-1768 (genotypes 369-384, genotypes 385-400, genotypes 401-

416, genotypes 417-432, genotypes 433-448, genotypes 449-464, genotypes 465-480, genotypes 481-496, and genotypes 497-512), share a genetic group, agreeing with the dendrogram. The three remaining collections in this group, A12-1104, A12-1118, and A12-

1136 (genotypes 513-528, genotypes 529-544, and genotypes 545-560), form a separate subgroup. All the individuals in this subgroup share the same major group as the other collections in this group, at both possible values of (K), however for these three collections of that group are a minor component. A12-1118 and A12-1136 share several of the same genetic groups at both levels of (K), with A12-1104 having a different genetic group present in its individuals.

The next large group of the nuSSR dendrogram includes three forage-type cultivars,

‘Teton,’ ‘Fawn,’ and ‘Atlas,’ two collections from Morocco, two collections from Italy, and eleven collections from Turkey. The three forage-type cultivars, ‘Teton,’ ‘Atlas,’ and

‘Fawn,’ (genotypes 561-576, genotypes 577-592, genotypes 593-608) grouped together, suggesting they are related, potentially developed from the same or related genetic material, which is plausible, as they were all developed from material collected in the

United States (Cascade Seed Company, 2000; Brown – personal communication; Frakes

153 and Cowan, 1974). At both (K)=19 and (K)=28, these three collections shared a genetic group with each other, with ‘Teton’, a collection from Amelago, Morocco, and A11-1785

(genotypes 609-624), a collection in which some individuals were defined as

Mediterranean and some as Continental based on Chl045. At (K)=19, some individuals in the collection share a genetic group with the forage cultivars that it grouped with, however, the same is not true when (K)=28. When (K)=19, some individuals in this collection are also composed of groups that are common in Italian collections, common in Macedonian collections, and other individuals are composed of groups that are common in collections from Morocco which have the Chl045 Mediterranean allele. When (K)=28, the individuals in this collection continue to share groups in common with Italian collections, while the same individuals that shared genetic groups with Mediterranean collections at (K)=19 share groups with the Mediterranean collections at (K)=28. Much of this cluster of collections on the nuSSR dendrogram is composed of collections from Turkey, A13-1811 from Sarika,

Turkey (genotypes 625-540), A13-792 from Erciyes Dagi, Turkey (genotypes 641-656),

A13-1514, A13-1524, and A13-1521 from Sarika, Turkey (genotypes 657-672, genotypes

673-688, genotypes 689-704), A13-785 and A13-783 from Camlibel, Turkey (genotypes

705-720 and genotypes 721-736), and A13-795 and A13-799 from Erciyes Dagi, Turkey

(genotypes 737-752 and genotypes 753-768). At both values of (K), all of these collections share a genetic group as a major contributor to their genetic make-up, agreeing with the nuSSR dendrogram. When (K)=28, there is support for some of the subgroups, with A13-

785 and A13-783 both from Camlibel sharing another genetic group beyond the one that is common in all individuals in this group. Similarly, also when (K)=28, A13-795 and A13-

799, both from Erciyes Dagi, share a genetic group. Both of these support the clustering

154 found on the nuSSR dendrogram and it is supported by geographic origin. Basal to this larger group, two collections, A12-1145 from Yanigodan, Turkey and A12-1106 from

Derebucak, Turkey (genotypes 769-784 and genotypes 785-800), at both values of (K) these collections share a genetic group with each other, which is also a component of collections A13-1511 and A13-792. Sister to all the Turkish collections (genotypes 625-

816) are two collections from Italy, A12-1115 from Roccadi Cambio, Italy and A12-1124 from Capitano, Italy. When (K)=19, these collections are connected by a shared genetic group, which is also common in some individuals of A11-1785, similar results are found when (K)=28, however, there is clearer relationship between A12-1115 and A12-1124 with other collections in this cluster, such as A12-1145 and A12-1106. The final collection in this larger cluster is a collection from Taddamout, Morocco, A11-1803. This collection does not clearly belong with the other collections in this group as it shares genetics groups with other collections from Morocco as well as collections for Romania (A11-1822, A11-

1790, A11-1846, and A11-1781) this pattern is maintained between (K)=19 and (K)=28.

The next group on the nuSSR dengrogram was made of collections from the Balkan region of Europe as well as one collection from Latvia. Also, in this group, ‘Jesup’

(genotypes 849-864) and ‘Kentucky 31’ (genotypes 865-880) formed a group with

PI595048, Festuca arundinacea var. glaucescens (genotypes 881-896). ‘Jesup’ was developed from ‘Kentucky 31,’ explaining why they are grouped adjacent on the dendrogram. All three of these share a similar profile at both (K)=19 and (K)=28. They are all composed of the same several genetic groups. The next subgroup of the Balkans group on the nuSSR dendrogram, is composed of five collections, one from Karuk, Montenegro,

A13-1543 (genotypes 897-912), two from Kolasm, Montenegro, A13-1546 (genotypes

155

919-928) and A13-1549 (genotypes 929-944), one from Xibracke, Albania, A13-1537

(genotypes 945-960) and one from Luna, Romania, A13-1582 (genotypes 961-976). When

(K)=19, the grouping of A13-1543, A13-1546, A13-1549, A13-1537 is supported as all these share a genetic group. However, A13-1549 shows a high level of admixture, with contributions from several groups including the genetic group that was the common in the turf-type cultivars (‘W45,’ ‘ZW44,’ ‘LSD,’ W41,’ ‘BIZM,’ ‘F711,’ ‘T31,’ ‘B23,’ ‘MET1,’

MET2,’ ‘CCR2,’ ‘RZ2,’ ‘U43,’ ‘Regenerate,’ and ‘MET3’) and the group that was a major contributor to A11-1806 and A11-1805 both from Italy. The last group in this sub-group of five collections is A13-1582 from Luna Romania, which is composed of a genetic group that is shared with the forage-type cultivars ‘Teton’, ‘Atlas’, and ‘Fawn,’ as well as one of the groups that was part of A13-1549. When (K)=28, these five collections are divided further. There is a genetic group that is present in all individuals of these five collections.

A13-1543 still shows high admixture. A13-1546 here shows a genetic group that is not common in another cultivar, collection, or accession. A13-1549 and A13-1537 share a genetic group at both (K)=19 and (K)=28.

The next subgroup of the Balkans group is composed of seven collections, one from

Xibracke, Albania, A13-1538 (genotypes 977-992), one from Sarika, Turkey, A13-1541

(genotypes 993-1008), one from Krusje, Macedonia, A13-1533, two from Debar,

Macedonia, A13-1534 and A13-1535 (genotypes 1009-1024 and genotypes 1025-1040), one from Korce, Albania, A13-1536 (genotypes 1057-1072), and one from Valikarda,

Albania, A13-1552 (genotypes 1073-1088). At both (K)=19 and (K)=28, the grouping of the nuSSR dendrogram are supported as these collections share a genetic group for both possible values of (K). It should be noted that at (K)=28, there is a higher level of admixture

156 present in those collections, with contributions from the group that was a major contributor to A13-1582 and the group that was major contributor to A13-1546.

There are two final subgroups within the Balkan group. The first of these subgroups is composed of two collections from Belcista, Montenegro, A13-1554 and A13-1562

(genotypes 1089-1104 and genotypes 1105-1120), one from Kemeri, Latvia, A12-1169

(genotypes 1121-1136), one from Tigveni, Romania, A13-1569 (genotypes 1137-1152), and one from Dusegubica, Macedonia, A13-1563 (genotypes 1153-1168). When (K)=19,

A13-1554, A13-1562, A13-1569, and A13-1563, shared a single genetic group, supporting their grouping together in the nuSSR NJ dendrogram. While the collection from Latvia,

A12-1169, showed a different genetic group, the genetic group that was common in A11-

1806 and A11-1805 from Italy, as well as the forage type cultivars ‘JesupMaxQ’ and

‘Kentucky 31.’ A Latvian collection and two Italian collections sharing a genetic group is surprising, particularly as most of the genetic groups are connected to geography or possibly a crossing-block effect based on what year they were collected, this material could also have been moved by migration or travel before collection, as Latvia is far from the center of origin of tall fescue. At (K)=28, the genetic groups based on STRUCTURE are different than what was present at (K)=19 for the two Balkan subgrougs. The two collections from Belcista, Montenegro, A13-1554 and A13-1562, shared a genetic group, as they did at (K)=19, this group is not shared by A13-1569 and only a component of A13-

1563. A13-1563 and A13-1569 still share a genetic group as they did at (K)=19. Similarly,

A12-1169 still does not share a genetic group with those it clustered with on the nuSSR dendrogram and here only shares a genetic group with the forage cultivars ‘JesupMaxQ’ and ‘Kentucky 31.’ Among the final three collections in the Balkans group are one

157 collection from Santioara, Romania, A13-1580 (genotypes 1169-1184), one from Sovata,

Romania, and one from Sribca, Macedonia, A13-1556 (genotypes 1201-1216). When

(K)=19, these collections share a genetic group, agreeing with the clustering of the nuSSR dendrogram, while when (K)=28, this group still shares a genetic group with A13-1580 while A13-1574 shares an additional genetic group, still agreeing with the nuSSR dendrogram.

The two methods of determining the appropriate value of (K) gave different results, suggesting there are either 19 or 28 genetic groups present in the material genotyped. Both of these show little difference in the relationships that they present between individuals and populations with the key difference being some splits within other species and some groups being divided. Based on Pritchard et al.’s (2000) suggestion, in a situation like this, these methods are only a guide and should be compared with what would be a sensible solution.

Because these both show the same relationships with continental tall fescue, the (K) value of 19 is probably the “best” value.

Conclusion

This work represents the first large scale molecular investigation into the Rutgers tall fescue germplasm collection as well as the first use of cpSSRs in tall fescue. This work is in agreement with previous research based on molecular markers. Tall fescue was found to have two separate genepools, one from north of the Mediterranean Sea and one from south of the Mediterranean Sea (Borill et al, 1971; Mian et al, 2002; Hand et al, 2012). This separation was present in the neighbor-joining diagrams of both nuSSRs (Fig 1) and cpSSRs (Fig 2). The cpSSRs helped to confirm that of the two parents (Festuca pratensis

158 and Festuca arundinacea var. glaucescens) of the common hexaploid tall fescue Festuca arundinacea var. glaucescens was the maternal parent. Both marker sets used were able to discriminate between the continental and Mediterranean morphotypes of tall fescue, with the data from this work, a quick PCR based assay could be developed to determine the morphotype of an individual.

The turf-type cultivars genotyped were only a small number of recently developed cultivars, however, they were all closely related and shared a common genetic group.

Genotyping shows there is a wide range of diversity present in the tall fescue that has been collected from near the center of origin. Based on the neighbor-joining, there are three distinct groups of tall fescue germplasm based on their geographic origin. STRUCTURE found there were a large number of genetic groups within the individuals genotyped, additionally STRUCTURE found that all developed cultivars have a significant amount of admixture, which is expected for an obligate outcrossing species (Fig 3 and Fig 4). This also showed there are genetic groups that are not currently being used in turf-type cultivars that may be useful in future breeding work to bring in alleles that have not been exploited yet.

159

References Abernethy, R. H., Steiner, J. J., Wofford, D. S., and Theil, D. S. (1989). Classification and pedigree verification of tall fescue cultivars utilizing the prolamin seed protein fraction. Crop Science, 29, 791-797. Baird, J. H., Kopecky, D., Lukaszewski, A. J., Green, R. L., Bartos, J., and Dolezel, J. (2012). Genetic diversity of turf-type tall fescue using diversity arrays technology. Crop Science, 52, 408-412. Bang, S. W., and Chung, S. (2015). One size does not fit all: The risk of using amplicon size of chloroplast SSR marker for genetic relationship studies. Plant Cell Reports, 34, 1681-1683. Beard, J. B. (2013). Origins of North American turfgrasses. In J. C. Stier, B. P. Horgan and S. A. Bonos (Eds.), Turfgrass: Biology, Use, and Management (pp. 1-35). Madison, WI: ASA-CSSA-SSSA. Bertin, P., Grégoire, D., Massart, S., and de Froidmont, D. (2001). Genetic diversity among European cultivated spelt revealed by microsatellites. TAG Theoretical and Applied Genetics, 102, 148-156. Birky C.W. (1995) Uniparental inheritance of mitochondrial and chloroplast genes: mechanisms and Evolution. Proceedings of National Academy of Science USA 92:11331–11338. Bonos, S., and Huff, D. R. (2013). Cool-season grasses: Biology and breeding. In J. C. Stier, B. P. Horgan and S. A. Bonos (Eds.), Turfgrass: Biology use and management (pp. 591-661). Madison, WI: ASA-CSSA-SSSA. Borrill, M. (1972). Studies in Festuca III: The contribution of F. scariosa to the evolution of polyploids in sections Bovinae and Scariosae. New Phytologist, 71, 523-532. Borrill, M., Tyler, B., and Lloyd-Jones, M. (1971). Studies in Festuca I: A chromosome atlas of bovinae and scariosae. Cytologia, 36, 1-14. Borrill, M., Tyler, B., and Morgan, W. G. (1976). Studies in Festuca 7. Chromosome atlas (part 2) an appraisal of chromosome race distribution and ecology, including F. pratensis var. apennina (de not.) hack, - tetraploid. Cytologia, 41, 219-236. Bouton, J. H., Duncan, R. R., Gates, R. N., Hoveland, C. S., and Wood, D. T. (1997). Registration of ‘Jesup’ tall fescue. Crop Science, 37, 1011. Brownstein MJ, Carpten JD, Smith JR (1996) Modulations of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping. Biotechniques 20:1004–1010 Bushman, B.S., Larson, S.R., Tuna, M., West, M.S., Hernandez, A.G., Vullaganti, D., Gong, G., Robins, J.G., Jensin, K.B., Thimmapuram, J. (2011). Orchardgrass (Dactylis glomerata L.) EST and SSR marker development, annotation, and transferability. Theoretical and Applied Genetics 123, 119-129. Busti, A., Caceres, M. E., Calderini, O., Arcioni, S., and Pupilli, F. (2004). RFLP markers for cultivar identification in tall fescue (Festuca arundinacea Schreb.). Genetic Resources and Crop Evaluation, 51, 443-448. Cahoon, A. B., Sharpe, R. M., Mysayphonh, C., Thompson, E. J., Ward, A. D., and Lin, A. (2010). The complete chloroplast genome of tall fescue (Lolium arundinaceum; Poaceae) and comparison of whole plastomes from the family Poaceae. American Journal of Botany, 97, 49-58.

160

Cascade Seed Company. (2004). Tall Fescue ‘Teton’ US Plant Variety Protection Certification 200000310. Date Issued 10 September 2004. Charmet, G., Ravel, C., and Balfourier, F. (1997). Phylogenetic analysis in the Festuca- Lolium complex using molecular markers and ITS rDNA. Theoretical Applied Genetics, 94, 1038-1046. Chatterjee, B. N. (1961). Analysis of ecotypic differences in tall fescue (Festuca arundinacea Schreb.). Annals of Applied Biology, 49, 560-562. Cheng, Y., Ma, X., Zhou, K., Humphreys, M., and Zhang, X. (2016). Phylogenetic analysis of Festuca–Lolium complex using SRAP markers. Genetic Resources and Crop Evolution, 63, 7-18. Chtourou-Ghorbel, N., Mheni, N. B., Elazreg, H., Ghariani, S., Chakroun, M., and Trifi- Farah, N. (2016). Genetic diversity in Tunisian perennial forage grasses revealed by inter-simple sequence repeats markers. Biochemical Systematics and Ecology, 66, 154-160. Clayton, W. D., and Renvoize, S. A. (1986). Genera graminum (1. publ. ed.). London: Her Majesty's Stationery Office. Condit, R., and Hubbell, S. P. (1991). Abundance and DNA sequence of two-base repeat regions in tropical tree genomes. Genome / National Research Council Canada = Génome / Conseil National De Recherches Canada, 34,66-71. Craven, K. D., Clay, K., and Schardl, C. L. (2009). Systematics and morphology. In H. A. Fribourg, D. B. Hannaway and C. P. West (Eds.), Tall fescue for the twenty-first century (pp. 11-32). Madison, WI: ASA-CSSA-SSSA. Cuyeu, R., Rosso, B., Pagano, E., Soto, G., Fox, R., and Ayub, N. D. (2013). Genetic diversity in a world germplasm collection of tall fescue. Genetics and Molecular Biology, 36, 327-242. Darbyshire, S. J. (1993). Realignment of Festuca subgenus Schedonorous with genus lolium (Poaceae). Novon, 3, 239-243. Dierking, R., Azhaguval, P., Kallenbach, R., Saha, M. C., Bouton, J., and Chekhovskiy, K., Andrew. (2015). Linkage maps of a Mediterranean × Continental tall fescue population and their comparative analysis with other Poaceae species. The Plant Genome, 8 DLF International Seeds. (2013). Perennial Ryegrass ‘Derby Xtreme’ US Plant Variety Protection Certificate 200700422. Date Issued 19 June 2013. Doyle, J. J., Morgante, M., Tingey, S. V., and Powell, W. (1998). Size homoplasy in chloroplast microsatellites of wild perennial relatives of soybean (Glycine subgenus glycine). Molecular Biology and Evolution, 15, 215-218. Dreisigacker, S., Zhang, P., Warburton, M. L., Skovmand, B., Hoisington, D., and Melchinger, A. E. (2005). Genetic diversity among and within CIMMYT wheat landrace accessions investigated with SSRs and implications for plant genetic resources management. Crop Science, 45, 653-661. Eliades NG, Eliades DG (2009). Haplotype analysis: software for analysis of haplotype data. Forest genetics and forest tree breeding, Georg-August University, Goettingen, Germany. http://www.uni-goettingen.de/en/134935.html. Accessed June 16, 2017. Evans, G. M., Asay, K. H., and Jenkins, R. G. (1973). Meiotic irregularities in hybrids between diverse genotypes of tall fescue (Festuca arundinacea, Schreb.) Crop Science, 13, 376-379.

161

Ezquerro-Lopez, D., Kopecky, D., and Inda, L. A. (2017). Cytogenetic relationships within the Maghrebian clade of Festuca subgen. Schedonourus (Poaceae), using flow cytometry and FISH. Anales Del Jardin Botanico De Madrid, 74, 1-9. Falush, D., Stephens, M., and Pritchard, J.K. (2003). Inference of population structure using multilocus genotype data: linked loci and correlated allele frequency. Genetics 164 1567-1587. Felsenstein, J. (2005). PHYLIP (Phylogeny Inference Package) version 3.6. Distributed by the author. Department of Genome Sciences, University of Washington, Seattle. Fergus, E. N., & Buckner, R. C. (1972). Registration of Kentucky 31 Tall Fescue (Reg. No. 7). Crop Science, 12 714-714. Frakes, R. V., and Cowan, J.R. (1974) Registration of Fawn Tall Fescue (Reg. No. 8). Crop Science 14 338-338. Fu, K., Guo, Z., Zhang, X., Fan, Y., Wu, W., Li, D., Yan, P., Huang, L., Sun, M., Bai, S. and Ma, X. (2016). Insight into the genetic variability analysis and cultivar identification of tall fescue by using SSR markers. Hereditas, 153 Garris, A. J., Tai, T. H., Coburn, J., Kresovich, S., and McCouch, S. (2005). Genetic structure and diversity in Oryza sativa L. Genetics, 169, 1631-1638. Garza, J. C., and Freimer, N. B. (1996). Homoplasy for microsatellite size at loci in humans and chimpanzees. Genome Research, 6, 211-217. Gaut, B. S., Tredway, L. P., Kubik, C., Gaut, R. L., and Meyer, W. A. (2000). Phylogenetic relationships and genetic diversity among members of the Festuca-Lolium complex (Poaceae) based on ITS sequence data. Plant Systematics and Evolution, 224, 33-53. Hand, M. L., Cogan, N. O. I., and Forster, J. W. (2012a). Genome-wide SNP identification in multiple morphotypes of allohexaploid tall fescue (Festuca arundinacea Schreb). BMC Genomics, 13, 219. Hand, M. L., Cogan, N. O. l., and Forster, J. W. (2012b). Molecular characterisation and interpretation of genetic diversity within globally distributed germplasm collection of tall fescue (Festuca arundinacea Schreb.) and meadow fescue (F. pratensis huds.). Theoretical Applied Genetics, 124, 1127-1137. Hand, M. L., Cogan, N. O. l., Stewart, A. V., and Forster, J. W. (2010). Evolutionary history of tall fescue morphotypes inferred from molecular phylogenetics of the Lolium-Festuca species complex. BMC Evolutionary Biology, 10, 303. Hand, M. L., Spangenberg, G. C., Forster, J. W., and Cogan, N. O. l. (2013). Plastome sequence determination and comparative analysis for members of the Lolium- Festuca Grass species complex. G3: Genes|Genomes|Genetics, 3, 607-616. Honig, J. A., Averello, V., Bonos, S. A., and Meyer, W. A. (2012). Classification of kentucky bluegrass (poa pratensis L.) cultivars and accessions based on microsatellite markers (simple sequence repeat) markers. HortScience, 47, 1356-1366. Honig, J. A., Kubik, C., Averello, V., Vaiciunas, J., Meyer, W. A., and Bonos, S. A. (2016). Classification of bentgrass (Agrostis) cultivars and accessions based on microsatellite (SSR) markers. Genetic Resources and Crop Evolution, 63, 1139-1160. Hoveland, C. S. (2009). Origin and history. In H. A. Fribourg, D. B. Hannaway and C. P. West (Eds.), Tall fescue for the twenty-first century (pp. 3-10). Madison, WI: ASA, CSSA, SSSA.

162

Hubisz, M. J., Falush, D., Stephens, M., and Pritchard, J. K. (2009). Inferring weak population structure with the assistance of sample group information. Molecular Ecology Resources, 9, 1322-1332. Humphreys, M. W., Thomas, H. M., Morgan, W. G., Meredith, M. R., Harper, J. A., Thomas, H., Zwierzykowski, Z., Ghesquiere, M. (1995). Discriminating the ancestral progenitors of hexaploid Festuca arundinacea using genomic in situ hybridization. Heredity, 75, 171-174. Hunt, K. L., and Sleper, D. A. (1981). Fertility of hybrids between two geographic races of tall fescue. Crop Science, 21, 400-404. Inda, L. A., Sanmartín, I., Buerki, S., and Catalán, P. (2014). Mediterranean origin and Miocene–Holocene old world diversification of meadow fescues and ryegrasses (Festuca subgenus Schedonorus and Lolium). Journal of Biogeography, 41, 600-614. Inda, L. A., Segarra-Moragues, J. G., Muller, J., Peterson, P. M., and Catalan, P. (2008). Dated historical biogeography of the temperate Loliinae (Poaceae, Pooideae) grasses in the northern and southern hemispheres. Molecular Phylogenetics and Evolution, 46, 932-957. Ishii, T., Mori, N., and Ogihara, Y. (2001). Evaluation of allelic diversity at chloroplast microsatellite loci among common wheat and its ancestral species. TAG Theoretical and Applied Genetics, 103(6), 896-904. Kimball, J. A., Zuleta, M. C., Kenworthy, K. E., Lehman, V. G., Harris-Shultz, K. R., and Milla-Lewis, S. (2013). Genetic relationships in Zoysia species and the identification of putative interspecific hybrids using simple sequence repeat markers and inflorescence traits. Crop Science, 53, 285-295. Kofler R, Schlotterer C, Lelley T (2007) SciRoKo: a new tool for whole genome microsatellite search and investigation. Bioinformatics 23: 1683–1685 Kopecky, D., Bartos, J., Lukaszewski, A. J., Baird, J. H., Cernoch, V., Kolliker, R., Rogli, O.A., Blois, H., Caig, V.,Lubberstedt, T., Studer, B., Shaw, P, Dolezel, J., and Kilian, A. (2009). Development and mapping of DArT markers within the Festuca- Lolium complex. BMC Genomics, 10, 473. Kopecky, D., Bartos, J., Zwierzykowski, Z., and Dolezel, J. (2009). Chromosome pairing of individual genomes in tall fescue (Festuca arundinacea Schreb.), its progenitors, and hybrids with Italian ryegrass (Lolium multiflorum Lam.). Cytogenetics and Genome Research, 124, 170-178. Kopecký, D., Martis, M., Číhalíková, M., Hřibová, M., Vrána, J., Bartoš, J., Kopecká, J., Cattonaro, J., Stočes, S., Novák, P., Neumann, P., Macas, J., Šimková, H., Studer, B., Asp, T., Baird, J., Navrátil, P., Karafiátová, M., Kubaláková, M., Šafář, J., Mayer, K., Doležel, J. (2013). Flow sorting and sequencing meadow fescue chromosome 4F. Plant Physiology, 163, 1323-1337. Krishnan, H. B., and Sleper, D. A. (1997). Identification of tall fescue cultivars by sodium dodecyl sulfate polyacrylamide gel electrophoresis of seed proteins. Crop Science, 37, 215-219. Kubik, C., Sawkins, M., Meyer, W. A., and Gaut, B. S. (2001). Genetic diversity in seven perennial ryegrass (L.) cultivars based on SSR markers. Crop Science, 41(5), 1565- 1572.

163

Kumar, S., Stecher, G., and Tamura, K. (2015) MEGA7: Molecular Evolutionary Genetics Analysis version 7.0. Molecular Biology and Evolution (submitted). (Publication PDF at http://www.kumarlab.net/publications). Lou, Y., Hu, L., Chen, L., Sun, X., Yang, Y., Liu, H., and Xu, Q. (2015). Association analysis of simple sequence repeat (SSR) markers with agronomic traits in tall fescue (Festuca arudinacea Schreb.). PLoS One 10. Malik, C. P., and Thomas, P. T. (1966a). Karyotypic studies in some Lolium and Festuca species. Caryologia: International Journal of Cytology, Cytosystematics and Cytogenetics, 19, 167-196. Malik, C. P., and Thomas, P. T. (1966b). Chromosomal polymorphism in Festuca arundinacea. Chromosoma, 18, 1-18. Malik, C. P., and Thomas, P. T. (1967). Cytological relationships and genome structure of some Festuca species. Caryologia: International Journal of Cytology, Cytosystematics and Cytogenetics, 20, 1-39. Meyer, W. A., Torres, M. S., and White, J. F. (2013). Biology and application of fungal endophytes in turfgrasses. In J. C. Steir, B. P. Horgan and S. A. Bonos (Eds.), Turfgrass: Biology, use, and management (pp. 713-733). Madison, WI: ASA- CSSA-SSSA. Mian, M. A. R., Hopkins, A. A., and Zwonitzer, J. C. (2002). Determination of genetic diversity in tall fescue with AFLP markers. Crop Science, 42, 944-950. Mian, M. A. R., Saha, M. C., Hopkins, A. A., and Wang, Z. (2005). Use of tall fescue EST- SSR markers in phylogenetic analysis of cool-season forage grasses. Genome, 48, 637-647. Momotaz, A., Forster, J. W., and Yamada, T. (2004). Identification of cultivars and accessions of Lolium, Festuca and Festulolium hybrids through the detection of simple sequence repeat polymorphism. Plant Breeding, 123(4), 370-376. Morgan, W. G., King, I. P., Koch, S., Harper, J. A., and Thomas, H. M. (2001). Introgression of chromosomes of Festuca arudinacea var. glaucescens into Lolium multiflorum revealed by genomic in situ hybridization (GISH). Theoretical Applied Genetics, 103, 696-701. Morgante, M., and Olivieri, A. M. (1993). PCR-amplified microsatellites as markers in plant genetics. The Plant Journal, 3, 175-182. Paäakinskiene, I., Griffiths, C. M., Bettany, A. J. E., Paplauskiene, V., and Humphreys, M. W. (2000). Anchored simple-sequence repeats as primers to generate species-specific DNA markers in Lolium and Festuca grasses. TAG Theoretical and Applied Genetics, 100(3), 384-390. Peak Plant Genetics and Rutgers, the State University of New Jersey. (2016). Tall Fescue ‘Trinity’ U.S. Plant Variety Protection Certificate 201600068. Date issued 27 June 2016. Peakall, R., and Smouse, P. E. (2006). GENALEX 6: Genetic analysis in excel. population genetic software for teaching and research. Molecular Ecology Notes, 6, 288-295. Peakall, R., and Smouse, P. E. (2012). GENALEX 6: Genetic analysis in excel. Population genetic software for teaching and research - an update. Bioinformatics, 28, 2537-2539. Pfeiffer, T., Roschanski, A. M., Pannell, J. R., Korbecka, G. y., and Schnittler, M. (2011). Characterization of microsatellite loci and reliable genotyping in a polyploid plant, Mercurialis perennis (Euphorbiaceae). Journal of Heredity, 102(4), 479-488.

164

Pirnajmadin, F., Majidi, M. M., Mirlohi, A., and Noroozi, A. (2016). Application of EST- derived microsatellite markers for analysis of genetic variation in tall fescue and its comparison with morphological markers. Biochemical Systematics and Ecology, 65, 225-233. Plaschke, J., Ganal, M. W., and Röder, M. S. (1995). Detection of genetic diversity in closely related bread wheat using microsatellite markers. TAG. Theoretical and Applied Genetics. Theoretische Und Angewandte Genetik, 91, 1001-1007. Powell, W., Morgante, M., McDevitt, R., Vendramin, G. G., and Rafalski, J. A. (1995a). Polymorphic simple sequence repeat regions in chloroplast genomes: Applications to the population genetics of pines. Proceedings of the National Academy of Sciences of the United States of America, 92(17), 7759-7763. Powell, W., Morgante, M., Andre, C., McNicol, J. W., Machray, G. C., Doyle, J. J., Tingey, S. V., Rafalski, J. A. (1995b). Hypervariable microsatellites provide a general source of polymorphic DNA markers for the chloroplast genome. Current Biology, 5, 1023-1029. Pritchard, J.K., Stephens, M., Donnelly, P. (2000). Inference of population structure using multilocus genotype data. Genetics, 155, 945-959. Provan, J., Corbett, G., McNicol, J. W., and Powell, W. (1997). Chloroplast DNA variability in wild and cultivated rice (Oryza spp.) revealed by polymorphic chloroplast simple sequence repeats. Genome, 1997, 104-110. Provan, J., Corbett, G., Waugh, R., McNicol, J. W., Morgante, M., and Powell, W. (1996). DNA fingerprints of rice (Oryza sativa) obtained from hypervariable chloroplast simple sequence repeats. Proceedings of the Royal Society of London B, 263, 1275- 1281. Provan, J., Lawrence, P., Young, G., Wright, F., Bird, R., Paglia, G., Cattonaro, F., Morgante, M., Powell, W. (1999). Analysis of the genus Zea (Poacea) using polymorphic chloroplast simple sequence repeats. Plant Systematics and Evolution, 218, 245-256. Provan, J., Powell, W., and Hollingsworth, P. M. (2001). Chloroplast microsatellites: New tools for studies in plant ecology and evolution. TRENDS in Ecology and Evolution, 16, 142-147. Raggi, L., Bitocchi, E., Russi, L., Marconi, G., Sharbel, T. F., Veronesi, F., and Albertini, E. (2015). Understanding genetic diversity and population structure of a Poa pratensis worldwide collection through morphological, nuclear and chloroplast diversity analysis. PLoS One, 10. Rohlf, F. J. (2008). NTSYSpc: Numerical taxonomy system, ver. 2.20. Exeter publishing, ltd.: Setauket, NY. Rozen S, Skaletsky HJ (1998) Primer3. Code available at http://bioinfo.ut.ee/primer3/. Verified 27 July 2015 Rutgers, the State University of New Jersey. (2014). Tall Fescue ‘Regenerate’ US Plant Variety Protection 201200119. Date Issued 11 March 2014. Saha, M. C., Cooper, J. D., Mian, M. A. R., Chekhovskiy, K., and May, G. D. (2006). Tall fescue genomic SSR markers: Development and transferability across multiple grass species. Theoretical Applied Genetics, 113, 1449-1458.

165

Saha, M. C., Hopkins, A. A., and Wang, Z. (2009). Genomic tools for improvement. In H. A. Fribourg, D. B. Hannaway and C. P. West (Eds.), Tall fescue for the twenty-first century (pp. 377-394). Madison, WI: ASA, CSSA, SSSA. Saha, M. C., Mian, M. A. R., Eujayl, I., Zwonitzer, J. C., Wang, L., and May, G. D. (2004). Tall fescue EST-SSR markers with transferability across several grass species. Theoretical Applied Genetics, 109, 783-791. Samples, T. J., Sorochan, J. C., Brilman, L. A., and Stier, J. C. (2009). Tall fescue as turf in the United States. In H. A. Fribourg, D. B. Hannaway and C. P. West (Eds.), Tall fescue for the twenty-first century (pp. 445-482). Madison, WI: ASA, CSSA, SSSA. Schuelke M. (2000). An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology 18:233–234 Seal, A. G. (1983). DNA variation in Festuca. Heredity, 50, 225-236. Šiffelová, G., Pavelková, M., Klabouchová, A., Wiesner, I., and Našinec, V. (1997). Computer-aided RAPD fingerprinting of accessions from the Ryegrass-Fescue complex. Journal of Agricultural Science, Cambridge, 129, 257-265. Smarda, P., Bures, P., Horova, L., Foggi, B., and Rossi, G. (2008). Genome size and GC content evolution of Festuca: Ancestral expansion and subsequent reduction. Annals of Botany, 101, 421-433. Soreng, R. J., and Terrell, E. E. (1997). Taxonomic notes on Schedonorus, a segregate genus from Festuca or Lolium, with a new nothogenus, x Schedololium, and new combinations. Phytologia, 83, 85-88. Stammers, M., Harris, J., Evans, G. M., Hayward, M. D., and Forster, J. W. (1995). Use of random PCR (RAPD) technology to analyse phylogenetic relationships in the Lolium/Festuca complex. Heredity, 74, 19-27. Sun, X., Xie, Y., Bi, Y., Liu, J., Amombo, E., Hu, T., and Fu, J. (2015a). Comparative study of diversity based on heat tolerant-related morpho-physiological traits and molecular markers in tall fescue accessions. Scientific Reports, 5. Sun, X., Du, Z., Ren, J., Amombo, E., Hu, T., and Fu, J. (2015b). Association of SSR markers with functional traits from heat stress in diverse tall fescue accessions. BMC Plant Biology, 15, 116. Talukder, S. K., Azhaguval, P., Chekhovskiy, K., Black, J., and Saha, M. C. (2014). Tall fescue morphotype differentiation using chloroplast DNA sequence variation and SSR diversity. Poster presented at ASA, CSSA, SSSA International Annual Meeting, November 2-5, 2014. Tanhuanpää, P., and Manninen, O. (2012). High SSR diversity but little differentiation between accessions of Nordic timothy (Phleum pratense L.). Hereditas, 149(4), 114- 127. Tehrani MS, Mardi M, Saeidi H, Gharehyazi B, Assadi M (2008). Transferability of genomic and EST-microsatellites from Festuca arundinacea Schreb. to Lolium persicum Boiss. et Hohen. ex Boiss. Int J Bot 4:476–480 Tehrani, M. S., Mardi, M., Sahebi, J., Catalan, P., and Diaz-Perez, A. (2009). Genetic diversity and structure among Iranian tall fescue populations based on genomic-SSR and EST-SSR marker analysis. Plant Systematics and Evolution, 282, 57-70. Torrecilla, P. and Catalán, P. (2002). Phylogeny of broad-leaved and fine-leaved Festuca lineages (Poaceae) based on nuclear ITS sequences. Systematic Botany, 27, 241-251.

166

Turgeon, A. J. (2012). Turfgrass Management (Ninth ed.). Upper Saddle River, NJ: Pearson Higher Ed. Weihing, R. (1963). Registration of gulf annual ryegrass. Crop Science, 3, 366. Weir, B. S. (1990). Genetic data analysis: Methods for discrete population genetic data. Sunderland, Mass: Sinauer Assoc. Wheeler, G. L., Dorman, H. E., Buchanan, A., Challagundla, L., and Wallace, L. E. (2014). A review of the prevalence, utility, and caveats of using chloroplast simple sequence repeats for studies of plant biology. Applications in Plant Sciences, 2 Xu, W. W., & Sleper, D. A. (1994). Phylogeny of tall fescue and related species using RFLPs. Theoretical and Applied Genetics, 88, 685-690. Xu, W. W., Sleper, D. A., & Krause, G. F. (1994). Genetic diversity of tall fescue germplasm based on RFLPs. Crop science, 34, 246-252. Z-Seeds LLC and Rutgers, the State University of New Jersey. (2017). Tall Fescue ‘Raptor III’ US Plant Variety Protection Certificate 201500367. Date Issued 27 June 2017.