DOCSLIB.ORG

Efficacy of QCDCR Formulated Cpg ODN 2007 in Nile Tilapia Against Streptococcus Iniae and Identification of Upregulated Genes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Efficacy of QCDCR Formulated Cpg ODN 2007 in Nile Tilapia Against Streptococcus Iniae and Identification of Upregulated Genes Veterinary Immunology and Immunopathology 145 (2012) 179–190 Contents lists available at SciVerse ScienceDirect Veterinary Immunology and Immunopathology j ournal homepage: www.elsevier.com/locate/vetimm Research paper Efficacy of QCDCR formulated CpG ODN 2007 in Nile tilapia against Streptococcus iniae and identification of upregulated genes a,∗ a a b Julia W. Pridgeon , Phillip H. Klesius , Xingjiang Mu , Robert J. Yancey , b b Michele S. Kievit , Paul J. Dominowski a Aquatic Animal Health Research Unit, USDA-ARS, 990 Wire Road, Auburn, AL 36832, United States b Pfizer Inc., Veterinary Medicine Research and Development, 333 Portage Street, Kalamazoo, MI 49007, United States a r t i c l e i n f o a b s t r a c t Article history: The potential of using a QCDCR (quilA:cholesterol:dimethyl dioctadecyl ammonium bro- Received 26 August 2011 mide:carbopol:R1005 glycolipid) formulated CpG oligodeoxynucleotide (ODN), ODN 2007, Received in revised form 31 October 2011 to confer protection in Nile tilapia against Streptococcus iniae infection was evaluated in Accepted 3 November 2011 this study. At two days post treatment, QCDCR formulated ODN 2007 elicited significant (P < 0.05) protection to Nile tilapia, with relative percent survival of 63% compared to fish Keywords: treated by QCDCR alone. To understand the molecular mechanisms involved in the protec- Streptococcus iniae tive immunity elicited by ODN 2007, suppression subtractive cDNA hybridization technique Oreochromis niloticus was used to identify upregulated genes induced by ODN 2007. A total of 69 expressed Subtractive hybridization Upregulation sequence tags (ESTs) were identified from the subtractive cDNA library. Quantitative PCR CpG oligodeoxynucleotide revealed that 44 ESTs were significantly (P < 0.05) upregulated by ODN 2007, including 29 highly (>10-fold) and 15 moderately (<10-fold) upregulated ESTs. Of all ESTs, putative peroxisomal sarcosine oxidase was upregulated the highest. The 69 ESTs only included six genes that had putative functions related to immunity, of which only two (putative glutaredoxin-1 and carboxypeptidase N catalytic chain) were confirmed to be significantly upregulated. Our results suggest that the protection elicited by ODN 2007 is mainly through innate immune responses directly or indirectly related to immunity. © 2011 Published by Elsevier B.V. 1. Introduction et al., 2010). This bacterium has also been identified as a potential zoonotic pathogen. An outbreak in Toronto traced Streptococcus iniae is a significant worldwide fish back to S. iniae infected tilapia was called “mad fish dis- pathogen causing significant economic losses to the aqua- ease” by the local press (Weinstein et al., 1996). To date, at culture industry worldwide. Originally isolated in 1976 least 25 cases of human infection by S. iniae has been con- from Amazon freshwater dolphin (Inia geoffrensis) (Pier and firmed (Weinstein et al., 1997; Koh et al., 2004; Agnew and Madin, 1976), S. iniae has become a major aetiological agent Barnes, 2007; Sun et al., 2007). Estimated economic impact of streptococcosis in farmed and wild finfish worldwide. on aquaculture industry due to infections caused by S. iniae Streptococcosis affects more than 30 species of fish, includ- is approximately $ 10 million in the USA alone and more ing trout, yellowtail, tilapia, barramundi, and hybrid striped than US $ 100 million globally (Shoemaker et al., 2010). bass (Bromage et al., 1999; Eldar et al., 1999; Ferguson et al., Methods to prevent streptococcal diseases in fish 2000; Agnew and Barnes, 2007; Eyngor et al., 2008; Cheng include the use of antibiotics-medicated food (Darwish, 2007), vaccines (Shoemaker et al., 2010), and immunos- timulatory oligonucleotides (Li et al., 2004). Unmethylated ∗ cytosine–phosphate–guanine (CpG) dinucleotides flanked Corresponding author. Tel.: +1 334 887 3741; fax: +1 334 887 2983. E-mail address: [email protected] (J.W. Pridgeon). by specific bases in bacterial DNA are recognized by the 0165-2427/$ – see front matter © 2011 Published by Elsevier B.V. doi:10.1016/j.vetimm.2011.11.001 180 J.W. Pridgeon et al. / Veterinary Immunology and Immunopathology 145 (2012) 179–190 immune system of vertebrates as danger signals, thus 2.2. Oligonucleotide and formulations inducing favorable immune responses in the host against infection (Krieg, 2002). Synthetic oligodeoxynucleotides ODN 2007 (TCGTCGTTGTCGTTTTGTCGTT; CpG motifs (ODNs) containing CpG motifs have been reported to are underlined) containing unmethylated CpG dinu- be capable of inducing protection against different dis- cleotides was synthesized by Qiagen-GmbH (Hilden, eases in various fish species, including S. iniae infection Germany). A stock of ODN 2007 was prepared in sterile in hybrid striped bass (Morone chrysops × Morone saxatilis) 10 mM phosphate buffered saline (PBS) at concentration (Li et al., 2004), Edwardsiella tarta in olive flounder (Par- of 20 mg/ml. The ODN 2007 was then diluented in QCDC ␮ alichthys olivaceus) (Lee et al., 2003), amoebic gill diseases carrier/adjuvant solution containing quilA (20 g/ml), in Atlantic salmon (Salmo salar) (Bridle et al., 2003), and cholesterol (20 ␮g/ml), dimethyl dioctadecyl ammonium ␮ Aeromonas salmonicida in rainbow trout (Oncorhynchus bromide (10 g/ml), carbopol (0.05%, v/v) or QCDCR (QCDC ␮ mykiss) (Carrington and Secombes, 2007). Mechanisms plus R1005 glycolipid (100 g/ml). As negative control, a of protection induced by ODNs in fish include increased non-CpG ODN 21 (TTTAGTGAGGTCCTCGGATCA) was also serum lysozyme activity (Carrington and Secombes, 2007), included in this study to determine whether the non-CpG elevated respiratory burst activity of kidney phagocytes ODN has any protective effect in Nile tilapia against S. iniae (Lee et al., 2003), upregulation of TLR9 (Skjaeveland et al., infection. 2008), IL-1beta, Mx, TGFbeta, and Gal8 (Cuesta et al., 2008). However, whether synthetic ODNs are also capable of 2.3. Protective effect of ODN 2007 in Nile tilapia against inducing protection in Nile tilapia (Oreochromis niloticus) S. iniae infection against S. iniae infection has not been previously reported. ODN 2007, a B-class ODN, has been previously demon- All Nile tilapia were acclimated for at least 14 days strated to be able to induce a strong and balanced immune before the experiments. Fish were divided into nine groups response in cattle (Ioannou et al., 2002). Adjuvant such as in trial I and trial II (1: PBS control; 2: PBS + ODN 21; 3: QCDC has been reported to be able to enhance the pro- PBS + ODN 2007; 4: QCDC adjuvant control; 5: QCDC + ODN tective immunity of recombinant protein vaccine profilin 21; 6: QCDC + ODN 2007; 7: QCDCR adjuvant control; 8: in chicken against Eimeria maxima infection compared to QCDCR + ODN 21; 9: QCDCR + ODN 2007) (20 fish/group, animals immunized with profilin alone (Lee et al., 2010). three replicates per group) to determine which formu- However, it is currently unknown whether ODN 2007 by lation provided the best protection. In trial III, fish were itself or with an adjuvant such as QCDC could be used to divided into three groups (1: QCDCR adjuvant control; 2: protect Nile tilapia against S. iniae infections. Therefore, the QCDCR + ODN 21; 3: QCDCR + ODN 2007) (20 fish/group, objectives of this study were: (1) To determine whether three replicates per group). For CpG treatment group, ODN 2007 itself was capable of inducing protection in Nile 100 ␮g of CpG (5 ␮l of ODN stock) mixed with 95 ␮l of tilapia against S. iniae infection; (2) To determine whether diluents (PBS or QCDC or QCDCR) was intraperitoneally (IP) QCDC adjuvant or modified QCDC formulation was capa- injected to each fish. For adjuvant control group, 5 ␮l of PBS ble of enhancing the protective activity of ODN 2007 in mixed with 95 ␮l of diluents (PBS or QCDC or QCDCR) was Nile tilapia against S. iniae infection; and (3) To identify IP injected to each fish. All fish were challenged with S. iniae upregulated genes induced by formulated ODN 2007 in Nile at two days post treatment. A virulent strain of S. iniae ARS- tilapia if the formulated ODN 2007 was able to enhance the 60 (Pridgeon and Klesius, 2011b), originally isolated from protection to Nile tilapia against S. iniae infection. diseased hybrid striped bass (M. saxatilis × M. chrysops) in 2004 and confirmed to be S. iniae by FAME analysis, was 2. Materials and methods used for the challenge assay. The archived S. iniae ARS- 60 strain was recovered from frozen stocks (2 ml aliquots ◦ − 2.1. Experimental fish stored at 80 C) and grown in tryptic soy broth (TSB) ◦ (Fisher Scientific, Pittsburgh, PA) for 24 h at 28 C. An optical Nile tilapia (22 ± 4 g) were obtained from stocks main- density (OD) of 1.0 of overnight S. iniae culture was mea- tained at USDA-ARS, Aquatic Animal Health Research sured at 540 nm using a spectrophotomer (Fisher Scientific, ␮ Laboratory (Auburn, AL, USA). All fish were maintained Pittsburgh, PA). A total of 100 l of the bacterial culture 8 × in dechlorinated city water in 340 l tanks. All fish were at approximately 2 10 colony forming unit (CFU) per remained naïve to S. iniae infections, which was confirmed ml was IP injected to each fish. Mortalities were recorded as culture negative using both anterior kidney and pos- daily for 15 days post exposure to S. iniae. The presence terior kidney tissue samples randomly collected from the or absence of S. iniae in challenged fish (dead fish when fish stock. Prior to experiments, fish were acclimated in discovered or live fish at the end of experiments) was deter- −1 flow-through 57 l aquaria supplied with ∼0.5 l h dechlo- mined from bacterial culture derived from the kidney sam- rinated water for 14 days. A 12:12 h light:dark period was ples on blood agar plates followed by fatty acid methyl ester maintained and supplemental aeration was supplied by (FAME) analysis through MIDI microbial identification gas −1 ∼ an air stone.
Load more

Recommended publications
  • Polyamines and Transglutaminases: Biological, Clinical, and Biotechnological Perspectives
    Amino Acids (2014) 46:475–485 DOI 10.1007/s00726-014-1688-0 EDITORIAL Polyamines and transglutaminases: biological, clinical, and biotechnological perspectives Enzo Agostinelli Received: 3 January 2014 / Accepted: 27 January 2014 / Published online: 20 February 2014 Ó Springer-Verlag Wien 2014 Preface Europe. The ancient name of Istanbul was Bisantium, a city founded by Greeks in 659 B.C. on the banks of the The history of polyamines dates back to the fifteenth cen- Bosporus. Bisantium was renamed Constantinopolis in tury when spermine was discovered by Antoni van Leeu- honor of the Roman emperor Constantine I, becoming a wenhoek [born in Delft, Holland (1632–1723)], and yet it center of Greek culture and Christianity. Throughout its took many years before serious attention was given to long history, Istanbul (the old Constantinopolis) was the understanding the role of spermine or other polyamines in capital of three important empires: Roman, Byzantine, and the biology of living cells. It is now clear that regulation of Ottoman. Today, Istanbul as one of the largest cities in the polyamine homeostasis is complex and has excited poly- world is also one of the European capitals of culture while amine researchers who have continued to focus on this its historic areas are part of the UNESCO list of World productive area of research. Therefore, enough new Cultural Heritage. research findings have prompted to organize conferences This Special Issue of amino acids brings together 28 and congresses worldwide to disseminate the new knowl- peer-reviewed
    [Show full text]
  • Defining Novel Plant Polyamine Oxidase Subfamilies Through
    Bordenave et al. BMC Evolutionary Biology (2019) 19:28 https://doi.org/10.1186/s12862-019-1361-z RESEARCHARTICLE Open Access Defining novel plant polyamine oxidase subfamilies through molecular modeling and sequence analysis Cesar Daniel Bordenave1, Carolina Granados Mendoza2, Juan Francisco Jiménez Bremont3, Andrés Gárriz1 and Andrés Alberto Rodríguez1* Abstract Background: The polyamine oxidases (PAOs) catabolize the oxidative deamination of the polyamines (PAs) spermine (Spm) and spermidine (Spd). Most of the phylogenetic studies performed to analyze the plant PAO family took into account only a limited number and/or taxonomic representation of plant PAOs sequences. Results: Here, we constructed a plant PAO protein sequence database and identified four subfamilies. Subfamily PAO back conversion 1 (PAObc1) was present on every lineage included in these analyses, suggesting that BC-type PAOs might play an important role in plants, despite its precise function is unknown. Subfamily PAObc2 was exclusively present in vascular plants, suggesting that t-Spm oxidase activity might play an important role in the development of the vascular system. The only terminal catabolism (TC) PAO subfamily (subfamily PAOtc) was lost in Superasterids but it was present in all other land plants. This indicated that the TC-type reactions are fundamental for land plants and that their function could being taken over by other enzymes in Superasterids. Subfamily PAObc3 was the result of a gene duplication event preceding Angiosperm diversification, followed by a gene extinction in Monocots. Differential conserved protein motifs were found for each subfamily of plant PAOs. The automatic assignment using these motifs was found to be comparable to the assignment by rough clustering performed on this work.
    [Show full text]
  • Cellular and Animal Model Studies on the Growth Inhibitory Effects of Polyamine Analogues on Breast Cancer
    medical sciences Review Cellular and Animal Model Studies on the Growth Inhibitory Effects of Polyamine Analogues on Breast Cancer T. J. Thomas 1,* ID and Thresia Thomas 2,† 1 Department of Medicine, Rutgers Robert Wood Johnson Medical School and Rutgers Cancer Institute of New Jersey, Rutgers, The State University of New Jersey, 675 Hoes Lane West, KTL Room N102, Piscataway, NJ 08854, USA 2 Retired from Department of Environmental and Occupational Medicine, Rutgers Robert Wood Johnson Medical School and Rutgers Cancer Institute of New Jersey, Rutgers, The State University of New Jersey, 675 Hoes Lane West, Piscataway, NJ 08854, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-732-235-5852 † Present address: 40 Caldwell Drive, Princeton, NJ 08540, USA. Received: 28 January 2018; Accepted: 6 March 2018; Published: 13 March 2018 Abstract: Polyamine levels are elevated in breast tumors compared to those of adjacent normal tissues. The female sex hormone, estrogen is implicated in the origin and progression of breast cancer. Estrogens stimulate and antiestrogens suppress the expression of polyamine biosynthetic enzyme, ornithine decarboxylate (ODC). Using several bis(ethyl)spermine analogues, we found that these analogues inhibited the proliferation of estrogen receptor-positive and estrogen receptor negative breast cancer cells in culture. There was structure-activity relationship in the efficacy of these compounds in suppressing cell growth. The activity of ODC was inhibited by these compounds, whereas the activity of the catabolizing enzyme, spermidine/spermine N1-acetyl transferase (SSAT) was increased by 6-fold by bis(ethyl)norspermine in MCF-7 cells. In a transgenic mouse model of breast cancer, bis(ethyl)norspermine reduced the formation and growth of spontaneous mammary tumor.
    [Show full text]
  • Vaginal Biogenic Amines: Biomarkers of Bacterial Vaginosis Or Precursors to Vaginal Dysbiosis?
    Vaginal biogenic amines: biomarkers of bacterial vaginosis or precursors to vaginal dysbiosis? Citation: Nelson, Tiffanie M., Borgogna, Joanna-Lynn C., Brotman, Rebecca M., Ravel, Jacques, Walk, Seth T. and Yeoman, Carl J. 2015, Vaginal biogenic amines: biomarkers of bacterial vaginosis or precursors to vaginal dysbiosis?, Frontiers in physiology, vol. 6, Article number: 252, pp. 1-15. DOI: 10.3389/fphys.2015.00253 ©2015, The Authors Reproduced by Deakin University under the terms of the Creative Commons Attribution Licence Available from Deakin Research Online: http://hdl.handle.net/10536/DRO/DU:30089966 ORIGINAL RESEARCH published: 29 September 2015 doi: 10.3389/fphys.2015.00253 Vaginal biogenic amines: biomarkers of bacterial vaginosis or precursors to vaginal dysbiosis? Tiffanie M. Nelson 1, 2, Joanna-Lynn C. Borgogna 2, Rebecca M. Brotman 3, 4, Jacques Ravel 3, Seth T. Walk 2 and Carl J. Yeoman 1, 2* 1 Department of Animal and Range Sciences, Montana State University, Bozeman, MT, USA, 2 Department of Microbiology and Immunology, Montana State University, Bozeman, MT, USA, 3 Institute for Genome Sciences, University of Maryland School of Medicine, Baltimore, MD, USA, 4 Department of Epidemiology and Public Health, University of Maryland School of Medicine, Baltimore, MD, USA Bacterial vaginosis (BV) is the most common vaginal disorder among reproductive age women. One clinical indicator of BV is a “fishy” odor. This odor has been associated with increases in several biogenic amines (BAs) that may serve as important biomarkers. Within the vagina, BA production has been linked to various vaginal taxa, yet their genetic Edited by: capability to synthesize BAs is unknown.
    [Show full text]
  • Spermine Oxidase (SMO) Activity in Breast Tumor Tissues And
    Wayne State University Wayne State University Associated BioMed Central Scholarship 2010 Spermine oxidase (SMO) activity in breast tumor tissues and biochemical analysis of the anticancer spermine analogues BENSpm and CPENSpm Manuela Cervelli Dipartimento di Biologia, Università Roma Tre, [email protected] Gabriella Bellavia Dipartimento di Biologia, Università, [email protected] Emiliano Fratini Dipartimento di Biologia, Università, [email protected] Roberto Amendola Dipartimento BAS-BiotecMed, ENEA, [email protected] Fabio Polticelli Dipartimento di Biologia, Università, [email protected] See next page for additional authors Recommended Citation Cervelli et al.: Spermine oxidase (SMO) activity in breast tumor tissues and biochemical analysis of the anticancer spermine analogues BENSpm and CPENSpm. BMC Cancer 2010 10:555. 28. 27. Binda C, Coda A, Angelini R, Federico R, Ascenzi P, Mattevi A: A 30 Ã… long U-shaped catalytic tunnel in the crystal structure of polyamine oxidase. Structure 1999, 7:265-276. Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific ag p penalties and weight matrix choice. Nucleic Acids Res 1994, 22:4673-4680. Sali A, Blundell TL: Comparative protein modelling by satisfaction of spatial restraints. J Mol Biol 1993, 234:779-815. 29. 30. Huang Q, Liu Q, Hao Q: Crystal structures of Fms1 and its complex with spermine reveal substrate specificity. J Mol Biol 2005, 348:951-959. 31. Dixon M: The determination of enzyme inhibitor constants. Biochem J 1953, 55:170-171. 32. Cervelli M, Polticelli F, Federico F, Mariottini P: Heterologous expression and characterization of mouse spermine oxidase.
    [Show full text]
  • Polyamine Metabolism As a Therapeutic Target in Hedgehog-Driven Basal Cell Carcinoma and Medulloblastoma
    cells Review Polyamine Metabolism as a Therapeutic Target in Hedgehog-Driven Basal Cell Carcinoma and Medulloblastoma Sonia Coni 1,†, Laura Di Magno 2,†, Silvia Maria Serrao 1, Yuta Kanamori 3, Enzo Agostinelli 3,4,* and Gianluca Canettieri 1,4,5,* 1 Department of Molecular Medicine, Sapienza University, 00161 Rome, Italy; [email protected] (S.C.); [email protected] (S.M.S.) 2 Center for Life Nano Science@Sapienza, Istituto Italiano di Tecnologia, 00161 Rome, Italy; [email protected] 3 Department of Biochemical Sciences ‘A. Rossi Fanelli’, Sapienza University, 00185 Rome, Italy; [email protected] 4 International Polyamines Foundation—ONLUS—Via del Forte Tiburtino, 98, 00159 Rome, Italy 5 Pasteur Laboratory, Department of Molecular Medicine, Sapienza University, 00161 Rome, Italy * Correspondence: [email protected] (E.A.); [email protected] (G.C.); Tel.: +39-06-4991-0838 (E.A.); +39-06-4925-5130 (G.C.) † These Authors contributed equally to this work. Received: 11 January 2019; Accepted: 8 February 2019; Published: 11 February 2019 Abstract: Hedgehog (Hh) signaling is a critical developmental regulator and its aberrant activation, due to somatic or germline mutations of genes encoding pathway components, causes Basal Cell Carcinoma (BCC) and medulloblastoma (MB). A growing effort has been devoted at the identification of druggable vulnerabilities of the Hedgehog signaling, leading to the identification of various compounds with variable efficacy and/or safety. Emerging evidence shows that an aberrant polyamine metabolism is a hallmark of Hh-dependent tumors and that its pharmacological inhibition elicits relevant therapeutic effects in clinical or preclinical models of BCC and MB.
    [Show full text]
  • Semicarbazide-Sensitive Amine Oxidase and Vascular Complications in Diabetes Mellitus
    ! " # $% &'((% ()*+,- .-. (,/'*,-.-, 0.1,'(, 00.1. 2332 Dissertation for the Degree of Doctor of Philosophy (Faculty of Medicine) in Medical Pharmacology presented at Uppsala University in 2002 ABSTRACT Nordquist, J. 2002. Semicarbazide-sensitive amine oxidase and vascular complications in diabetes mellitus. Biochemical and molecular aspects. Acta Universitatis Upsaliensis. Comprehensive summaries of Uppsala Dissertations from the Faculty of Medicine 1174. 51 pp. Uppsala ISBN 91-554-5375-9. Plasma activity of the enzyme semicarbazide-sensitive amine oxidase (SSAO; EC.1.4.3.6) has been reported to be high in disorders such as diabetes mellitus, chronic congestive heart failure and liver cirrhosis. Little is known of how the activity is regulated and, consequently, the cause for these findings is not well understood. Due to the early occurrence of increased enzyme activity in diabetes, in conjunction with the production of highly cytotoxic substances in SSAO-catalysed reactions, it has been speculated that there could be a causal relationship between high SSAO activity and vascular damage. Aminoacetone and methylamine are the best currently known endogenous substrates for human SSAO and the resulting aldehyde- products are methylglyoxal and formaldehyde, respectively. Both of these aldehydes have been shown to be implicated in the formation of advanced glycation end products (AGEs). This thesis is based on studies exploring the regulation of SSAO activity and its possible involvement in the development of vascular damage. The results further strengthen the connection between high SSAO activity and the occurrence of vascular damage, since type 2 diabetic patients with retinopathy were found to have higher plasma activities of SSAO and lower urinary concentrations of methylamine than patients with uncomplicated diabetes.
    [Show full text]
  • The Development and Improvement of Instructions
    INITIAL CHARACTERIZATION OF HUMAN SPERMINE OXIDASE A Thesis by PAUL RAMON JUAREZ Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE December 2008 Major Subject: Biochemistry INITIAL CHARACTERIZATION OF HUMAN SPERMINE OXIDASE A Thesis by PAUL RAMON JUAREZ Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Approved by: Chair of Committee, Paul F. Fitzpatrick Committee Members, Dorothy Shippen J. Martin Scholtz Head of Department, Gregory D. Reinhart December 2008 Major Subject: Biochemistry iii ABSTRACT Initial Characterization of Human Spermine Oxidase. (December 2008) Paul Ramon Juarez, B.S.; B.A., Texas A&M University-Corpus Christi Chair of Advisory Committee: Dr. Paul F. Fitzpatrick The flavoprotein spermine oxidase catalyzes the oxidation of spermine and oxygen to spermidine, 3-aminopropanol, and hydrogen peroxide. To allow mechanistic studies of the enzyme, methods have been developed to obtain large amounts of purified recombinant protein. The enzyme requires co-expression with chaperone proteins GroEL and GroES to remain soluble and active. Purification requires the use of a Ni- NTA and size exclusion column. Human spermine oxidase is a monomer with an extinction coefficient of 14000 M-1cm-1. The kinetic mechanism is ping pong. Therefore, oxygen is bound to the enzyme before spermidine is released. N1-Acetyl spermine is a slow substrate with kcat and kcat/Km values 2 and 3 orders of magnitude smaller than the values for spermine. Spermidine is a competitive inhibitor, and 1,8- diaminooctane (DAO) is an uncompetitive inhibitor.
    [Show full text]
  • United States Patent (19) 11 Patent Number: 4,458,686 Clark, Jr
    United States Patent (19) 11 Patent Number: 4,458,686 Clark, Jr. 45) Date of Patent: Jul. 10, 1984 (54), CUTANEOUS METHODS OF MEASURING 4,269,516 5/1981 Lubbers et al. ..................... 356/427 BODY SUBSTANCES 4,306,877 12/1981 Lubbers .............................. 128/633 Primary Examiner-Benjamin R. Padgett 75) Inventor: Leland C. Clark, Jr., Cincinnati, Ohio Assistant Examiner-T. J. Wallen 73. Assignee: Children's Hospital Medical Center, Attorney, Agent, or Firm-Wood, Herron & Evans Cincinnati, Ohio 57 ABSTRACT (21) Appl. No.: 491,402 Cutaneous methods for measurement of substrates in 22 Filed: May 4, 1983 mammalian subjects are disclosed. A condition of the skin is used to measure a number of important sub - Related U.S. Application Data stances which diffuse through the skin or are present (62) Division of Ser. No. 63,159, Aug. 2, 1979, Pat. No. underneath the skin in the blood or tissue. According to 4,401,122. the technique, an enzyme whose activity is specific for a particular substance or substrate is placed on, in or 51). Int. Cl. ................................................ A61B5/00 under the skin for reaction. The condition of the skin is 52). U.S. Cl. .................................... 128/635; 128/636; then detected by suitable means as a measure of the 436/11 amount of the substrate in the body. For instance, the (58), Field of Search ............... 128/632, 635, 636, 637, enzymatic reaction or by-product of the reaction is 128/633; 356/41, 417, 427; 422/68; 23/230 B; detected directly through the skin as a measure of the 436/11 amount of substrate.
    [Show full text]
  • Interactions of Natural Polyamines with Mammalian Proteins
    Article in press - uncorrected proof BioMol Concepts, Vol. 2 (2011), pp. 79–94 • Copyright ᮊ by Walter de Gruyter • Berlin • New York. DOI 10.1515/BMC.2011.007 Review Interactions of natural polyamines with mammalian proteins Inge Schuster1 and Rita Bernhardt2,* ecules, such as phospholipids or nucleotides, thereby mas- 1 Institute for Theoretical Chemistry, University Vienna, sively affecting their structures and functions (9, 10). A-1090 Vienna, Austria Accordingly, polyamines were found to modulate numerous 2 Institute of Biochemistry, Saarland University, Campus regulatory processes in model systems that range from cel- B2.2, D-66123 Saarbru¨cken, Germany lular signaling to the control of gene expression and trans- lation and offer explanations for the obvious involvement of * Corresponding author polyamines in the regulation of cell growth, differentiation, e-mail: [email protected] and death wreviewed in (1, 11–14)x. The broad actions of polyamines on essential life functions are reflected by their effects on global gene expression. A recent study in a yeast Abstract mutant, an eukaryotic system comprising a three times small- er genome than mammalians, showed a significant regulation The ubiquitously expressed natural polyamines putrescine, of some 10% of the genome in (direct or indirect) response spermidine, and spermine are small, flexible cationic com- to spermidine or spermine (15). The essential requirement pounds that exert pleiotropic actions on various regulatory for polyamines and balanced levels of polyamines is under- systems and, accordingly, are essentially involved in diverse lined from studying knockouts that lack distinct genes life functions. These roles of polyamines result from their involved in polyamine synthesis and are not viable (10).
    [Show full text]
  • Potential Anticancer Application of Polyamine Oxidation Products Formed by Amine Oxidase: a New Therapeutic Approach
    Amino Acids (2010) 38:353–368 DOI 10.1007/s00726-009-0431-8 REVIEW ARTICLE Potential anticancer application of polyamine oxidation products formed by amine oxidase: a new therapeutic approach E. Agostinelli • G. Tempera • N. Viceconte • S. Saccoccio • V. Battaglia • S. Grancara • A. Toninello • R. Stevanato Received: 10 August 2009 / Accepted: 20 October 2009 / Published online: 10 December 2009 Ó Springer-Verlag 2009 Abstract The polyamines spermine, spermidine and biocompatible hydrogel polymers. Since both wild-type and putrescine are ubiquitous cell components. These molecules MDR cancer cells after pre-treatment with MDL 72527, a are substrates of a class of enzymes that includes monoamine lysosomotropic compound, are sensitized to subsequent oxidases, diamine oxidases, polyamine oxidases and copper- exposure to BSAO/spermine, it is conceivable that combined containing amine oxidases. Amine oxidases are important treatment with a lysosomotropic compound and BSAO/ because they contribute to regulate levels of mono- and spermine would be effective against tumor cells. It is of polyamines. In tumors, polyamines and amine oxidases are interest to search for such novel compounds, which might be increased as compared to normal tissues. Cytotoxicity promising for application in a therapeutic setting. induced by bovine serum amine oxidase (BSAO) and spermine is attributed to H2O2 and aldehydes produced Keywords Polyamine Á Amine oxidases Á Tumor cells Á by the reaction. This study demonstrated that multidrug- Multidrug resistance Á Hyperthermia resistant (MDR) cancer cells (colon adenocarcinoma and melanoma) are significantly more sensitive than the corre- Abbreviations sponding wild-type (WT) ones to H O and aldehydes, the 2 2 ADR Adriamycin-resistant cells products of BSAO-catalyzed oxidation of spermine.
    [Show full text]
  • Kinetic and Structural Analysis of Human ALDH9A1
    Bioscience Reports (2019) 39 BSR20190558 https://doi.org/10.1042/BSR20190558 Research Article Kinetic and structural analysis of human ALDH9A1 Radka Koncit´ıkovˇ a´ 1,*, Armelle Vigouroux2,*, Martina Kopecnˇ a´ 1, Marek Sebelaˇ 1, Solange Morera´ 2 and David Kopecn´ˇ y1 1Department of Protein Biochemistry and Proteomics, Centre of the Region Hana´ for Biotechnological and Agricultural Research, Faculty of Science, PalackyUniversity,´ Slechtitelˇ u˚ 27, CZ-783 71 Olomouc, Czech Republic;2Institute for Integrative Biology of the Cell (I2BC), CNRS-CEA-Univ. Paris-Sud, Universite´ Paris-Saclay, Avenue de la Terrasse, F-91198, Gif-sur-Yvette, France Correspondence: David Kopecnˇ y(´ david.kopecny@upol) or Solange Morera´ ([email protected]) Aldehyde dehydrogenases (ALDHs) constitute a superfamily of NAD(P)+-dependent en- zymes, which detoxify aldehydes produced in various metabolic pathways to the corre- sponding carboxylic acids. Among the 19 human ALDHs, the cytosolic ALDH9A1 has so far never been fully enzymatically characterized and its structure is still unknown. Here, we report complete molecular and kinetic properties of human ALDH9A1 as well as three crystal forms at 2.3, 2.9, and 2.5 A˚ resolution. We show that ALDH9A1 exhibits wide sub- strate specificity to aminoaldehydes, aliphatic and aromatic aldehydes with a clear pref- erence for γ-trimethylaminobutyraldehyde (TMABAL). The structure of ALDH9A1 reveals that the enzyme assembles as a tetramer. Each ALDH monomer displays a typical ALDHs fold composed of an oligomerization domain, a coenzyme domain, a catalytic domain, and an inter-domain linker highly conserved in amino-acid sequence and folding. Nonetheless, structural comparison reveals a position and a fold of the inter-domain linker of ALDH9A1 never observed in any other ALDH so far.
    [Show full text]