Efficacy of QCDCR Formulated Cpg ODN 2007 in Nile Tilapia Against Streptococcus Iniae and Identification of Upregulated Genes

Veterinary Immunology and Immunopathology 145 (2012) 179–190

Contents lists available at SciVerse ScienceDirect

Veterinary Immunology and Immunopathology

j ournal homepage: www.elsevier.com/locate/vetimm

Research paper

Efﬁcacy of QCDCR formulated CpG ODN 2007 in Nile tilapia against

Streptococcus iniae and identiﬁcation of upregulated genes

a,∗ a a b

Julia W. Pridgeon , Phillip H. Klesius , Xingjiang Mu , Robert J. Yancey ,

b b

Michele S. Kievit , Paul J. Dominowski

Aquatic Animal Health Research Unit, USDA-ARS, 990 Wire Road, Auburn, AL 36832, United States

Pﬁzer Inc., Veterinary Medicine Research and Development, 333 Portage Street, Kalamazoo, MI 49007, United States

a r t i c l e i n f o a b s t r a c t

Article history: The potential of using a QCDCR (quilA:cholesterol:dimethyl dioctadecyl ammonium bro-

Received 26 August 2011

mide:carbopol:R1005 glycolipid) formulated CpG oligodeoxynucleotide (ODN), ODN 2007,

Received in revised form 31 October 2011

to confer protection in Nile tilapia against Streptococcus iniae infection was evaluated in

Accepted 3 November 2011

this study. At two days post treatment, QCDCR formulated ODN 2007 elicited signiﬁcant

(P < 0.05) protection to Nile tilapia, with relative percent survival of 63% compared to ﬁsh

Keywords:

treated by QCDCR alone. To understand the molecular mechanisms involved in the protec-

Streptococcus iniae

tive immunity elicited by ODN 2007, suppression subtractive cDNA hybridization technique

Oreochromis niloticus

was used to identify upregulated genes induced by ODN 2007. A total of 69 expressed

Subtractive hybridization

Upregulation sequence tags (ESTs) were identiﬁed from the subtractive cDNA library. Quantitative PCR

CpG oligodeoxynucleotide revealed that 44 ESTs were signiﬁcantly (P < 0.05) upregulated by ODN 2007, including

29 highly (>10-fold) and 15 moderately (<10-fold) upregulated ESTs. Of all ESTs, putative

peroxisomal sarcosine oxidase was upregulated the highest. The 69 ESTs only included

six genes that had putative functions related to immunity, of which only two (putative

glutaredoxin-1 and carboxypeptidase N catalytic chain) were conﬁrmed to be signiﬁcantly

upregulated. Our results suggest that the protection elicited by ODN 2007 is mainly through

innate immune responses directly or indirectly related to immunity.

1. Introduction et al., 2010). This bacterium has also been identiﬁed as a

potential zoonotic pathogen. An outbreak in Toronto traced

Streptococcus iniae is a significant worldwide fish back to S. iniae infected tilapia was called “mad fish dis-

pathogen causing signiﬁcant economic losses to the aqua- ease” by the local press (Weinstein et al., 1996). To date, at

culture industry worldwide. Originally isolated in 1976 least 25 cases of human infection by S. iniae has been con-

from Amazon freshwater dolphin (Inia geoffrensis) (Pier and ﬁrmed (Weinstein et al., 1997; Koh et al., 2004; Agnew and

Madin, 1976), S. iniae has become a major aetiological agent Barnes, 2007; Sun et al., 2007). Estimated economic impact

of streptococcosis in farmed and wild ﬁnﬁsh worldwide. on aquaculture industry due to infections caused by S. iniae

Streptococcosis affects more than 30 species of ﬁsh, includ- is approximately $ 10 million in the USA alone and more

ing trout, yellowtail, tilapia, barramundi, and hybrid striped than US $ 100 million globally (Shoemaker et al., 2010).

bass (Bromage et al., 1999; Eldar et al., 1999; Ferguson et al., Methods to prevent streptococcal diseases in ﬁsh

2000; Agnew and Barnes, 2007; Eyngor et al., 2008; Cheng include the use of antibiotics-medicated food (Darwish,

2007), vaccines (Shoemaker et al., 2010), and immunos-

timulatory oligonucleotides (Li et al., 2004). Unmethylated

∗ cytosine–phosphate–guanine (CpG) dinucleotides ﬂanked

Corresponding author. Tel.: +1 334 887 3741; fax: +1 334 887 2983.

E-mail address: [email protected] (J.W. Pridgeon). by speciﬁc bases in bacterial DNA are recognized by the

180 J.W. Pridgeon et al. / Veterinary Immunology and Immunopathology 145 (2012) 179–190

immune system of vertebrates as danger signals, thus 2.2. Oligonucleotide and formulations

inducing favorable immune responses in the host against

infection (Krieg, 2002). Synthetic oligodeoxynucleotides ODN 2007 (TCGTCGTTGTCGTTTTGTCGTT; CpG motifs

(ODNs) containing CpG motifs have been reported to are underlined) containing unmethylated CpG dinu-

be capable of inducing protection against different dis- cleotides was synthesized by Qiagen-GmbH (Hilden,

eases in various ﬁsh species, including S. iniae infection Germany). A stock of ODN 2007 was prepared in sterile

in hybrid striped bass (Morone chrysops × Morone saxatilis) 10 mM phosphate buffered saline (PBS) at concentration

(Li et al., 2004), Edwardsiella tarta in olive ﬂounder (Par- of 20 mg/ml. The ODN 2007 was then diluented in QCDC

␮

alichthys olivaceus) (Lee et al., 2003), amoebic gill diseases carrier/adjuvant solution containing quilA (20 g/ml),

in Atlantic salmon (Salmo salar) (Bridle et al., 2003), and cholesterol (20 ␮g/ml), dimethyl dioctadecyl ammonium

␮

Aeromonas salmonicida in rainbow trout (Oncorhynchus bromide (10 g/ml), carbopol (0.05%, v/v) or QCDCR (QCDC

␮

mykiss) (Carrington and Secombes, 2007). Mechanisms plus R1005 glycolipid (100 g/ml). As negative control, a

of protection induced by ODNs in ﬁsh include increased non-CpG ODN 21 (TTTAGTGAGGTCCTCGGATCA) was also

serum lysozyme activity (Carrington and Secombes, 2007), included in this study to determine whether the non-CpG

elevated respiratory burst activity of kidney phagocytes ODN has any protective effect in Nile tilapia against S. iniae

(Lee et al., 2003), upregulation of TLR9 (Skjaeveland et al., infection.

2008), IL-1beta, Mx, TGFbeta, and Gal8 (Cuesta et al., 2008).

However, whether synthetic ODNs are also capable of

2.3. Protective effect of ODN 2007 in Nile tilapia against

inducing protection in Nile tilapia (Oreochromis niloticus)

S. iniae infection

against S. iniae infection has not been previously reported.

ODN 2007, a B-class ODN, has been previously demon-

All Nile tilapia were acclimated for at least 14 days

strated to be able to induce a strong and balanced immune

before the experiments. Fish were divided into nine groups

response in cattle (Ioannou et al., 2002). Adjuvant such as

in trial I and trial II (1: PBS control; 2: PBS + ODN 21; 3:

QCDC has been reported to be able to enhance the pro-

PBS + ODN 2007; 4: QCDC adjuvant control; 5: QCDC + ODN

tective immunity of recombinant protein vaccine proﬁlin

21; 6: QCDC + ODN 2007; 7: QCDCR adjuvant control; 8:

in chicken against Eimeria maxima infection compared to

QCDCR + ODN 21; 9: QCDCR + ODN 2007) (20 ﬁsh/group,

animals immunized with proﬁlin alone (Lee et al., 2010).

three replicates per group) to determine which formu-

However, it is currently unknown whether ODN 2007 by

lation provided the best protection. In trial III, ﬁsh were

itself or with an adjuvant such as QCDC could be used to

divided into three groups (1: QCDCR adjuvant control; 2:

protect Nile tilapia against S. iniae infections. Therefore, the

QCDCR + ODN 21; 3: QCDCR + ODN 2007) (20 ﬁsh/group,

objectives of this study were: (1) To determine whether

three replicates per group). For CpG treatment group,

ODN 2007 itself was capable of inducing protection in Nile

100 ␮g of CpG (5 ␮l of ODN stock) mixed with 95 ␮l of

tilapia against S. iniae infection; (2) To determine whether

diluents (PBS or QCDC or QCDCR) was intraperitoneally (IP)

QCDC adjuvant or modiﬁed QCDC formulation was capa-

injected to each ﬁsh. For adjuvant control group, 5 ␮l of PBS

ble of enhancing the protective activity of ODN 2007 in

mixed with 95 ␮l of diluents (PBS or QCDC or QCDCR) was

Nile tilapia against S. iniae infection; and (3) To identify

IP injected to each ﬁsh. All ﬁsh were challenged with S. iniae

upregulated genes induced by formulated ODN 2007 in Nile

at two days post treatment. A virulent strain of S. iniae ARS-

tilapia if the formulated ODN 2007 was able to enhance the

60 (Pridgeon and Klesius, 2011b), originally isolated from

protection to Nile tilapia against S. iniae infection.

diseased hybrid striped bass (M. saxatilis × M. chrysops) in

2004 and conﬁrmed to be S. iniae by FAME analysis, was

2. Materials and methods used for the challenge assay. The archived S. iniae ARS-

60 strain was recovered from frozen stocks (2 ml aliquots

◦

−

2.1. Experimental ﬁsh stored at 80 C) and grown in tryptic soy broth (TSB)

◦

(Fisher Scientiﬁc, Pittsburgh, PA) for 24 h at 28 C. An optical

Nile tilapia (22 ± 4 g) were obtained from stocks main- density (OD) of 1.0 of overnight S. iniae culture was mea-

tained at USDA-ARS, Aquatic Animal Health Research sured at 540 nm using a spectrophotomer (Fisher Scientiﬁc,

␮

Laboratory (Auburn, AL, USA). All ﬁsh were maintained Pittsburgh, PA). A total of 100 l of the bacterial culture

in dechlorinated city water in 340 l tanks. All ﬁsh were at approximately 2 10 colony forming unit (CFU) per

remained naïve to S. iniae infections, which was conﬁrmed ml was IP injected to each ﬁsh. Mortalities were recorded

as culture negative using both anterior kidney and pos- daily for 15 days post exposure to S. iniae. The presence

terior kidney tissue samples randomly collected from the or absence of S. iniae in challenged ﬁsh (dead ﬁsh when

fish stock. Prior to experiments, fish were acclimated in discovered or live fish at the end of experiments) was deter-

−1

ﬂow-through 57 l aquaria supplied with ∼0.5 l h dechlo- mined from bacterial culture derived from the kidney sam-

rinated water for 14 days. A 12:12 h light:dark period was ples on blood agar plates followed by fatty acid methyl ester

maintained and supplemental aeration was supplied by (FAME) analysis through MIDI microbial identiﬁcation gas

−1

∼

an air stone. Mean dissolved oxygen was 5.6 mg l at chromatography system (MIDI, Newark, Delaware). Results

◦

water temperature ∼27 C, with pH ∼7.1 and hardness of S. iniae challenge were presented as relative percent of

−1

∼100 mg l . survival (RPS) (Amend, 1981). RPS was calculated according

∼ { −

Fish were fed 3% body weight daily with commercial to the following formula: RPS = 1 (vaccinated mortal-

− } ×

dry ﬁsh food. ity control mortality) 100.

J.W. Pridgeon et al. / Veterinary Immunology and Immunopathology 145 (2012) 179–190 181

2.4. Sample collection, RNA extraction, and cDNA USDA-ARS Mid South Genomic Laboratories in Stoneville,

synthesis MS for plasmid DNA extraction and DNA sequencing

with an ABI 3730 Genetic Analyzer (Applied Biosys-

Of the nine different treatments, the QCDCR + ODN 2007 tems, Foster City, CA). Sequences were analyzed using

provided the highest protection to Nile tilapia against S. the National Center for Biotechnology Information (NCBI)

iniae challenge. Therefore, this group was chosen to deter- BLAST program to search for sequence similarities. The

mine which genes were induced by ODN 2007. A total of transcripts were then classiﬁed into categories according to

30 ﬁsh were divided to two tanks. One tank of ﬁsh was their putative functions through PubMed literature search

IP injected with QCDCR alone, whereas the other tank of (http://www.ncbi.nlm.nih.gov/pubmed).

ﬁsh was IP injected with QCDCR + ODN 2007 as described

earlier. At two days post treatment, posterior kidney tis-

sues from ﬁve ﬁsh were collected and pooled. Total RNA

was isolated from Nile tilapia posterior kidney samples 2.7. Primer design and quantitative PCR

using TRIzol Reagent (Invitrogen, Carlsbad, CA) following

the manufacturer’s protocol. All RNAs were treated with Sequencing results of different clones were

DNase provided by the DNA-free kit (Ambion, Austin, TX) used to design gene-speciﬁc primers by using

and quantiﬁed on a Nanodrop ND-1000 spectrophotome- Primer3 program (http://frodo.wi.mit.edu/cgi-

ter (Nanodrop Technologies, Rockland, DE). The ﬁrst strand bin/primer3/primer3 www.cgi). QPCR was performed

cDNAs used for quantitative PCR were synthesized using using Applied Biosystems 7300 Real-Time PCR System

AMV reverse transcriptase and Oligo-dT primer provided (Applied Biosystems, Foster City, CA). For each cDNA sam-

by the cloned AMV ﬁrst strand cDNA synthesis kit (Invit- ple, Nile tilapia 18S ribosomal RNA primers were included

rogen, Carlsbad, CA). For subtractive library construction, as an internal control to normalize the variation of cDNA

total RNA were pooled from ODN 2007 + QCDCR treated or amount. Primers used for the ampliﬁcation of the 18S rRNA

QCDCR-treated ﬁsh. cDNAs were then synthesized from the gene were 18S-F (5 -TTTAGTGAGGTCCTCG GATCA-3 ) and

pooled total RNAs using PCR-select cDNA Subtraction Kit 18S-R (5 -GATCCTTCCGCAGGTTCAC-3 ). The two primers

(Clontech, Palo Alto, CA). were designed based on Nile tilapia 18S ribosomal RNA

gene sequence (GenBank accession no DQ397879). The

2.5. Construction of subtractive cDNA library stability of 18S rRNA as reference gene has been conﬁrmed

by QPCR using both control cDNA samples and ODN 2007

Two-step subtractive hybridizations were per- treated cDNA samples as templates (standard deviation

formed according to procedures described previously of Ct values between all samples were less than 0.22). All

® ®

(Pridgeon et al., 2010). Brieﬂy, two primary hybridiza- QPCR was performed using Platinum SYBR Green qPCR

tion reactions (A and B) were formed by adding SuperMix-UDG with ROX (Invitrogen, Carlsbad, CA) in a

␮

excess amounts of unmodiﬁed QCDCR control cDNA total volume of 12.5 l. The QPCR mixture consisted of

␮ ␮ ␮

(driver) to QCDCR + ODN 2007 cDNA (tester) sam- 1 l of cDNA, 0.5 l of 5 M gene-speciﬁc forward primer,

␮ ␮ ␮

ples at a 50:1 ratio. The samples were denatured for 0.5 l of 5 M gene-speciﬁc reverse primer and 10.5 l

◦ ◦

2 min at 98 C and allowed to anneal for 8 h at 68 C. of 1 SYBR Green SuperMix. The QPCR thermal cycling

◦ ◦

The remaining single-stranded, adaptor-ligated tester parameters were 50 C for 2 min, 95 C for 10 min followed

◦ ◦

cDNAs were substantially enriched in each hybridiza- by 40 cycle of 95 C for 15 s and 60 C for 1 min. All QPCR

tion reaction for overexpressed sequences because was run in duplicate for each cDNA sample and three

non-target cDNAs present in the tester and driver pooled ﬁsh cDNA samples were analyzed by QPCR.

formed hybrids. After ﬁlling in the adapter ends with

DNA polymerase, over-expressed sequences (tester

cDNA) had different annealing sites on their 3 - and

2.8. QPCR data analysis

5 -ends. The molecules were then subjected to suppres-

sion subtraction PCR. The PCR products were then

The relative transcriptional levels of different genes

cloned into pGEM-T easy vector (Promega, Madi-

® were determined by subtracting the cycle threshold (C )

son, WI). Plasmids were transformed into One Shot t

of the sample by that of the 18S rRNA, the calibrator or

TOP10 competent cells (Invitrogen, Carlsbad, CA).

internal control, as per the formula: C = C (sample) − C

Transformed cells were plated on Luria-Bertani (LB) t t t

(calibrator). The relative expression level of a speciﬁc

plates containing ampicillin (100 ␮g/ml) and X-Gal (5-

bromo-4-chloro-3-indolyl-beta-d-galactopyranoside) gene in CpG + QCDCR treated ﬁsh compared to that of

QCDCR-treated control ﬁsh was calculated by the formula (40 ␮g/ml).

2 where Ct = Ct (CpG + QCDCR) − Ct (QCDCR) as

described previously (Pridgeon et al., 2010). The relative

2.6. Plasmid DNA isolation and sequencing

expression data of a speciﬁc gene in control or CpG treated

ﬁsh were ﬁrst examine by unpaired t-test. If normality

From the library, a total of 356 colonies were sub-

failed, the data were then subjected to Mann–Whitney

sequently picked to grow overnight in LB broth in the

◦

rank sum test using SigmaStat statistical analysis software

presence of ampicillin (100 ␮g/ml) at 37 C and 235 rpm

TM (Systat Software, San Jose, CA) and the differences were

in Innova 4000 Incubator Shaker (New Brunswick Sci-

considered signiﬁcant when P value is less than 0.05.

entiﬁc, Edison, NJ). Overnight cultures were then sent to

182 J.W. Pridgeon et al. / Veterinary Immunology and Immunopathology 145 (2012) 179–190

Table 1

Fifteen day cumulative mortality of Nile tilapia after challenge with virulent S. iniae ARS-60 at two days post treatment.

Treatment Trial I mortality (%) Trial II mortality (%) Trial III mortality (%) Mean (±S.D.) (%) RPS (%)

PBS 70 90 – 80 (±14) −

PBS ± ODN 18S 70 90 – 80 (±14) 0

PBS ± ODN 2007 60 80 – 70 (±14) 13

QCDC 70 90 – 80 (±14) −

± A

QCDC ODN 18S 70 90 – 80 (±14) 0

± A

± QCDC ODN 2007 70 90 – 80 ( 14) 0

QCDCR 80 90 70 80 (±10) −

QCDCR ± ODN 18S 80 90 70 80 (±10) 0

QCDCR ± ODN 2007 30 40 20 30 (±10) 63

RPS stands for relative percent of survival.

Same letter indicates not signiﬁcantly different (P > 0.05); different letter indicates they are signiﬁcantly different (P < 0.05).

3. Results 3.3. Expression of the 69 ESTs in QCDCR + ODN 2007

treated Nile tilapia

3.1. Protective effect of ODN 2007 in Nile tilapia against

S. iniae infection To determine whether the transcriptional levels of the

69 ESTs isolated from the subtractive library were induced

After all ODN treatments, no ﬁsh died before chal- by QCDCR + ODN 2007 treatment in Nile tilapia, gene-

lenge. After challenge by virulent S. iniae, all challenged speciﬁc primers (Table 3) were designed for relative QPCR

ﬁsh were culture positive for S. iniae by FAME analysis. experiments. QPCR results conﬁrmed that all 69 ESTs were

Among the three replicates, standard error of mortality upregulated in ODN 2007 treated Nile tilapia (Fig. 1). A total

data were all less than 10%, therefore, mortality was pre- of 32 ESTs were highly upregulated (>10-fold) (Fig. 1A).

sented as total dead ﬁsh out of total number of sixty ﬁsh Of the 32 highly upregulated ESTs, all but three were

challenged (Table 1). In trial I, at two days post treat- signiﬁcantly (P < 0.05) induced, with EST 12F06 (putative

ment, when ﬁsh were challenged by 2 10 CFU of S. iniae peroxisomal sarcosine oxidase) upregulated the highest,

ARS-60, the 15-day cumulative mortality of PBS, PBS + ODN followed by 11B02 (putative glutaredoxin-1) (Fig. 1A). A

21, and PBS + ODN 2007 treated ﬁsh was 70%, 70%, and total of 37 ESTs were moderately upregulated (2–10-fold)

60%, respectively. Similarly, the 15-day cumulative mor- (Fig. 1B). Of the 37 moderately upregulated ESTs, ﬁf-

tality of QCDC, QCDC + ODN 18S, and QCDC + ODN 2007 teen were signiﬁcantly (P < 0.05) induced, with EST 11D02

treated ﬁsh was all 70%. However, the 15-day cumulative (putative cytochrome c oxidase subunit II) upregulated the

mortality of QCDCR, QCDCR + ODN 18S, and QCDCR + ODN highest (Fig. 1B).

2007 was 80%, 80%, and 20%, respectively. Similar results

were obtained from trial II (Table 1). Of the nine treat- 3.4. Classiﬁcation of the 69 upregulated ESTs identiﬁed

ment groups, only PBS + ODN 2007 and QCDCR + ODN 2007 from the subtractive library

treatments provided protection to Nile tilapia, with average

RPS of 13% and 63%, respectively (Table 1). After challenge, The 69 upregulated ESTs were classiﬁed in terms of

cumulative mortality of QCDCR + ODN 2007 treated ﬁsh their putative functions (Table 4) based on literature search

was signiﬁcantly (P < 0.05) lower than all other treatments results. Immunity-related ESTs included putative genes of

(Table 1). microﬁbrillar-associated protein 3, MHC class IA antigen,

cathepsin B precursor, carboxypeptidase N catalytic chain,

glutaredoxin-1, and NLR family pyrin domain containing

3.2. Characteristics of the subtractive cDNA library

1-like proteins (Table 4). The largest percentage (34.7%)

of upregulated ESTs had putative functions in metabolism

A total of 356 clones were obtained from the subtrac-

and energy production (Fig. 2). The functions of the sec-

tive cDNA library of tilapia posterior kidney treated by

ond largest percentage (15.9%) of the 69 upreglated ESTS

QCDCR + ODN 2007 vs QCDCR. Sequencing results revealed

were unknown. The 69 upregulated ESTs included 8.7%

that these 356 ESTs represented 69 unique genes (Table 2).

related to immune response, protein synthesis, and signal

All ESTs listed in (Table 2) have been deposited in the Gen-

transduction, respectively (Fig. 2). The upregulated ESTs

Bank EST database under accession numbers JG772307 to

also included 5.8% related to DNA processing or repair,

JG772375. Of the 69 unique ESTs identiﬁed from the sub-

4.4% related to homeostasis or transcription/translation,

tractive library, ﬁfteen shared similarities with deposited

and 2.9% related to cell structure, apoptosis, and endocyto-

zebra ﬁsh (Danio rerio) proteins, twelve shared similar-

sis/exocytosis, respectively (Fig. 2).

ities with deposited Atlantic salmon (S. salar) proteins,

and eight shared similarities with deposited tilapia (Ore-

4. Discussion

ochromis spp.) proteins (Table 2). The biggest insert size

was 1103 bp (clone 10H01) and the smallest insert size was

Streptococcosis caused by S. iniae is a world-wide

137 bp (clone 12A11). The average insert size of the 28 ESTs

problem for aquaculture. Many vaccines have been devel-

was 418 bp (Table 2).

oped to protect ﬁsh from S. iniae infections (Locke et al.,

J.W. Pridgeon et al. / Veterinary Immunology and Immunopathology 145 (2012) 179–190 183

Table 2

List of the 69 genes isolated from the ODN 2007 treated vs non-CpG treated Nile tilapia posterior kidney subtractive cDNA library.

Clone No. Blast search similarity (putative gene name) Accession number Organism Identities (%) e-Value Insert size (bp)

9A10 Microﬁbrillar-associated protein 3-like isoform 3 XP 686013 Danio rerio 97 2e−23 179

9B09 MHC class IA antigen UBA1, UBA2, UAA1 AB270897 Oreochromis niloticus 99 4e−163 322

9B10 Actin related protein 2/3 complex subunit 2 ACH70809 Salmo salar 97 1e−111 712

9B11 Cathepsin B precursor ACH73069 Epinephelus coioides 87 2e−69 404

−

9C08 SOS response Ada system protein AAY79308 Siniperca chuatsi 82 2e 48 423

9C10 Carboxypeptidase N catalytic chain NP 001135201 Salmo salar 83 2e−65 441

9F11 Endonuclease III-like AY522626 Oreochromis mossambicus 98 0 539

9G12 Cytochrome P450 aromatase type II AF472621 Oreochromis niloticus 99 2e−171 334

10A03 Unnamed protein product CAF98538 Tetraodon nigroviridis 73 5e−89 720

10A06 Eukaryotic translation initiation factor 3 subunit 3 ACO08967 Osmerus mordax 99 3e−15 191

10A07 Unnamed protein product CAG09328 Tetraodon nigroviridis 86 8e−17 188

10A12 Receptor for activated protein kinase C AAQ91574 Oreochromis mossambicus 99 1e−52 338

10B01 Casein kinase 1, alpha 1 XP 002194893 Taeniopygia guttata 100 8e−65 653

10B04 Quinone oxidoreductase NP 001134320 Salmo salar 82 5e−46 433

10B07 NADH dehydrogenase subunit 4YP003406699 Oreochromis aureus 91 7e−88 704

10B09 Glyceraldehyde 3-phosphate dehydrogenase isoform 1 ACF35052 Oplegnathus fasciatus 97 5e−31 472

10B10 Multidrug and toxin extrusion protein 1-like XP 688576 Danio rerio 77 2e−64 541

10B12 Alanine-glyoxylate aminotransferase 2 ACI33568 Salmo salar 87 4e−44 660

10C08 Cytochrome c oxidase subunit I YP 003406692 Oreochromis aureus 96 3e−151 918

−

10D03 Vacuolar protein sorting protein 18 AAI71720 Danio rerio 92 4e 68 414

10D12 Ferritin heavy subunit ABI95136 Epinephelus awoara 94 3e−88 700

10E12 Hypothetical protein LOC549215 NP 001016461 Xenopus (Silurana) tropicalis 68 9e−12 459

10F02 ATP synthase F0 subunit 6 YP 003587626 Oreochromis sp. ‘red tilapia’ 93 7e−27 456

10F04 si:dkey-33c12.4 NP 001155071 Danio rerio 44 8e−33 681

10F11 60S ribosomal protein L5 ACO09827 Osmerus mordax 99 9e−43 264

10G11 Unnamed protein product CAG04404 Tetraodon nigroviridis 94 7e−40 261

10H01 Myristoylated alanine-rich C-kinase substrate NP 990811 Gallus gallus 91 6e−07 1103

10H05 40S ribosomal protein S27 ABJ98653 Psetta maxima 99 1e−36 527

10H10 Cytochrome P450 CYP2Y3 AY927850 Danio rerio 71 1e−76 621

11A04 Two pore channel 3 NP 001170916 Danio rerio 77 2e−32 345

11A08 Sodium/nucleoside cotransporter-like XP 002925849 Ailuropoda melanoleuca 77 4e−05 512

11B02 Glutaredoxin-1 ACO13836 Esox lucius 87 3e−11 209

11B12 PDZ domain-containing protein 1 NP 001133562 Salmo salar 69 4e−80 657

11C02 Cytochrome P450 2K5 NP 001118214 Oncorhynchus mykiss 69 2e−54 447

11C03 F1 ATP synthase beta subunit ACO57570 Gillichthys seta 100 1e−53 372

11C06 Spermine oxidase CAX14161 Danio rerio 89 3e−27 210

11C09 Rho GTPase-activating protein 15 ACN10539 Salmo salar 83 6e−44 539

11C11 Growth hormone-inducible transmembrane protein ABF06675 Sparus aurata 98 5e−43 273

11D02 Cytochrome c oxidase subunit II YP 003595295 Thunnus maccoyii 95 1e−30 255

11D04 Epoxide hydrolase 2 ACI33129 Salmo salar 71 7e−70 532

11D12 Voltage-dependent anion-selective channel protein 2 ACI32932 Salmo salar 91 4e−15 652

11F04 Echinoderm microtubule-associated protein-like 5-like XP 002199679 Taeniopygia guttata 70 3e−21 198

11F08 Acetyl-CoA acetyltransferase, mitochondrial precursor NP 001003746 Danio rerio 91 2e−30 221

11G03 Hydroxyacid oxidase 2 NP 001134549 Salmo salar 94 2e−27 318

11H01 Hemoglobin subunit beta-A Q9PVM2.2 Seriola quinqueradiata 87 6e−68 463

12A11 Cytochrome b ADF55406 Atherinason hepsetoides 98 9e−16 137

12C03 Cytosolic sulfotransferases SULT2 ST3 ABG35925 Danio rerio 67 9e−19 192

12C04 NLR family, pyrin domain containing 1-like XP 001338550 Danio rerio 54 2e−09 375

12C05 Mitogen-activated protein kinase scaffold protein 1 Q6Y228 Pagrus major 95 2e−58 372

12C06 Gag-Pol polyprotein-like XP 002663820 Danio rerio 84 2e−34 262

12D07 Acyl-coenzyme A thioesterase 5 NP 001133328 Salmo salar 40 7e−37 676

12D08 Phenazine biosynthesis-like domain-containing protein 1 ACQ58826 Anoplopoma ﬁmbria 89 4e−32 233

12E06 Mitochondrial ATP synthase beta subunit-like NP 001019600 Danio rerio 100 2e−22 265

12E08 Polyprotein AAN12398 Tetraodon nigroviridis 37 1e−11 720

12F06 Peroxisomal sarcosine oxidase XP 686922 Danio rerio 74 1e−26 210

12G04 Forkhead box protein C1 NP 001133703 Salmo salar 88 9e−59 487

12H05 PL-5283 protein XP 002200092 Taeniopygia guttata 88 6e−08 275

13A03 60S ribosomal protein L22 AAY79217 Siniperca chuatsi 96 7e−29 257

13B05 QM-like protein ACS93603 Sciaenops ocellatus 97 2e−29 194

13B06 Aldehyde dehydrogenase CAC24485 Platichthys ﬂesus 75 1e−23 224

13C10 Cytosolic alanine aminotransferase 2 ABC59812 Sparus aurata 90 1e−39 269

13E02 60S ribosomal protein L8 XP 001511396 Ornithorhynchus anatinus 97 5e−19 160

13E06 Unnamed protein product BAC26203 Mus musculus 85 2e−80 575

13E09 40S ribosomal protein S17 ACN12213 Salmo salar 100 3e−41 255

13E10 Ornithine decarboxylase antizyme small isoform AAP82032 Paralichthys olivaceus 92 3e−30 285

13F08 60S ribosomal protein L19 ACQ58958 Anoplopoma ﬁmbria 99 2e−32 208

13G07 EF-hand domain-containing protein 1 NP 957261 Danio rerio 67 1e−63 521

13G08 Spectrin repeat containing, nuclear envelope 1-like XP 001920330 Danio rerio 86 4e−63 472

13G09 NADH dehydrogenase subunit 4L YP 003406698 Oreochromis aureus 99 4e−44 368

GenBank accession number of putative genes.

184 J.W. Pridgeon et al. / Veterinary Immunology and Immunopathology 145 (2012) 179–190

Table 3

Gene-speciﬁc primers used in qPCR.

Clone Number Forward primer (5 to 3 ) Reverse primer (5 to 3 )

9A10 TGGTCACCTTCACCATCATC ATGATGGGGATCCTCTTGG

9B09 GGCTCGAAAGCCTACTACCA CTGCATGCCTCTGCAAGATA

9B10 CCTCTGGAGCTGAAGGACAC TGTAGGCCTTGGAGCACTTT

9B11 GACTTCTGGGCAAGTGAAGG TGGCACGCTGTATGATGTTT 9C08 TTTGCGAGCTGGAAGAGTTT CACCACCTGAGAGCTGCATA

9C10 ATCAGCACTGCCGAGAGAAT AAGTGCCTGGCAACAGAAGT

9F11 AGCGTTTGTCTAGCGGTGAT AGGTTGATAATGGCCGTCAG

9G12 AAGATCCATTTGCAATGACTGA CGTGAGATTCTGTGGCTGAG

10A03 GCGGTCATCAAGTGTTTCCT CTGTAGAGGCGTGATGCAAA

10A06 TAATGTGGGAGCTGGAGGAC GGTTGCGGCTGTAGGTGTTA

10A07 CGTGTCTGTGGTCTCAAAGG TATCCCAGGCGTTTCTTGAT

10A12 GAGAAAGCCACGCTCAAAAC AACTGACCCGTGATGAAACC

10B01 CAGCGGCTCTAAAGCTGAGT GCCATACCACCTGATGTGTG

10B04 CATTGCAGCCTGTCAGTTGT TTGACGTTCGACAGCATCTC

10B07 CCTGTGAGAGCGATTGTTCA CTAACTTCCTCCGCCCTCTT

10B09 TACGACAGTTCAGCGACACC TGCCATTCATCCATCTTTGA

10B10 CCACAGCCAATGGAAATACC TTTAAAACTTGCGGGTCCTG

10B12 AGGCTTTCACAAAGGAAGCA TCTGCATTGCTGATGAGGTC

10C08 CAATTCCGGTTAGACCTCCA CTATCGGCCTCCTAGGGTTC

10D03 ACACGCCTCAGAGATCCACT CTCTGGGAGGTTAGCACAGG

10D12 TGCGATTGATGATGGAAAAA ACCATGAGTTCCCAGGTCAG

10E12 CCAGACTGCTGGAAGTGACA AGCATTTAAAGGCAGGCTGA

10F02 GTTGTGGGGGTGAAGGTGTA AATTCCCCTAATTGCCCTTG

10F04 AGCAACAGTGTGCCTTTGTG TGTCTGAAGGTGCAGTCGTC

10F11 TTGAGGTGACAGGTGACGAG GTGCTGTGTGGAATGGACAG

10G11 GCTTGCCTTGTCTGTGTCAA AACACCTTCCACCTCCACTG

10H01 GGTTTTCTCTGCCTCCTCCT GTTCTTTGTGGAGCGAAAGC

10H05 AAGACTTGTTGCACCCATCC GCTTCCTCCTGAATGAGCAC

10H10 CCTGGACAATAACGGCAACT TATGGTATCTGCAGGGCACA

11A04 AAAAAGATCCTGGCCGAAAT GCTCCACCAATCTAGCGAAG

11A08 TCTCCCTCTCAACACCTTCG ACCACACGAGATACCGATCC

11B02 TCATGTCACCAAACCTGGAC CGGTCCCACGAGTATTCATC

11B12 GCCCAGGGAGTAAACCTTTC TTTCTACGTTTTCCCCGTTG

11C02 GGATGGGCAAGAGATCATGT CAAATCTGCTGCCATAGACG

11C03 CCAAACAGACCGATCTTTCC TTGGGGAGCCTATTGATGAG

11C06 AAGCACCATGGGTAGTGGAA ACATCCGAGGCTCCTACTCC

11C09 TTCTTCACCGACATTGTGGA TCAGAATGCTCCAACACTCG

11C11 AGCATCCAAGCAAGGTGTTT TGTGAGTAGGACCCCAGCTT

11D02 CGTCCCAAGCCTAGGAGTAA GGGACTGCTTCTACCACGAT

11D04 GCCCCCTGACATAGAGGAAT AAAGCAGGAACCGAAGGATT

11D12 GGCCAGAAAGACAGACAAGC TGTGCTGCTTCCTTCAAGTG

11F04 TTCCTCACGCAGGGGAAG CTCCTGGAGTGGCGTGCT

11F08 GGGGCTGAAGAACGATGATA CACCATGTGACCCACAATTC

11G03 GGGCCAAGTGTGTTTTCATT CGGTCACAGCTTGGAAAACT

11H01 AGCATTGGTGGACAGGTCTC GTCGAGTGGACAGATGCTGA

12A11 TCCTATTTGCCTACGCCATC GTTAGGCCTCGTTGTTTGGA

12C03 CTCCCGCTGGTGCTGAAT GCATGAGGCTGTAGGGAAAA

12C04 TTCAGGAGTTTCTGGCTGCT GAACAGGTCCAGGTGTCCAT

12C05 GACCTGTGTTGGCAGTGTTG TGAGACCTGGCTTCCTGTCT

12C06 TGACTGCTGGACTGTTCGAC CGGTGCTGACACAGTGAAAT

12D07 CGACCAGAAACATTGGGAGT GCTTGCAGCACACAGATCAT

12D08 CCTCTCAGAAACGGCTTTCA TGACGCACAGATCTCCACTC

12E06 GAAACCATCAAGGGCTTCAA CAGGGCCTCTCTGCTTCTAC

12E08 CATCGTCAATGGCCACATAG AACAAATCCCAACAGCCAAG

12F06 CATATGGGCAGCAAGACAGA ATGGTCAGGCGTAAGCGTAT

12G04 GAGCTCAACTCCAGCCTCAC TGACTGAGCAATCTGGCAAC

12H05 TCACCTTGGGAAATGTTGTG GGATGTCCATTCTTGCTTGC

13A03 CTCCGATTAAGAGGCAGGTG TCCTCTCAATGGACACCACA

13B05 CACGGACATGATCACCTGAC TAAGGACGGTTTCCACATCC

13B06 TGAGGTCCCTGCTCTGTCTT GAGCAGTCCCACTTTGCTCT

13C10 AGAATGCGCTGTGCTCTTTT GCTGAAGGAGGGAGTGAAGA

13E02 AGCAATAAGACCGACCTTGC ACAAGGCCAAGAGGAACTGC

13E06 ACTGTGCTCCGTCAGGCTAT TCGCCATAGGTGGAAATGAT

13E09 TGACTGGACCCCTCTGAATC GACCAAGACGGTGAAAAAGG

13E10 GCTCCTCAAGAACCAGCAAC TCCAGTCCTCTGAGGTGCTC

13F08 CCCAATGAGACCAACGAGAT TCTCTTACCGTAGCCCGTGT

13G07 ATTCCTGAGCCTCCCAAAGT TACCAGAGTTGCGTGTGGTC

13G08 GACATGTCCCTCCAGTTGCT AGCAGACGACCAAGAGGAAA

13G09 GCTTTGGAGTCGGTCTGTTC TTCATTGCCCTCTCCCTATG

J.W. Pridgeon et al. / Veterinary Immunology and Immunopathology 145 (2012) 179–190 185

Table 4

Putative function of ODN 2007 upregulated genes.

Category Putative protein name Putative function related to infection

Immune-related protein (6)

Microﬁbrillar-associated protein 3-like isoform 3 Innate immunity

MHC class IA antigen UBA1, UBA2, UAA1 Immunity

Cathepsin B precursor Marker for macrophage activity

Carboxypeptidase N catalytic chain Regulator of inﬂammation

Glutaredoxin-1 Antioxidant protective role under normal and

inﬂammatory conditions

NLR family, pyrin domain containing 1-like Response to inﬂammation

Endocytosis and exocytosis (2)

Vacuolar protein sorting protein 18 Endocytosis

Myristoylated alanine-rich C-kinase substrate Exocytosis

Metabolism and energy production (24)

Cytochrome P450 aromatase type II Xenobiotics metabolism

Multidrug and toxin extrusion protein 1-like Xenobiotics metabolism

Cytochrome P450 CYP2Y3 Xenobiotics metabolism

Cytochrome P450 2K5 Xenobiotics metabolism

Cytochrome c oxidase subunit II Xenobiotics metabolism

Epoxide hydrolase 2 Converts epoxides to trans-dihydrodiols, which can be

excreted from the body

Cytosolic sulfotransferases SULT2 ST3 Bioactivation of xenobiotics

Cytochrome b Mitochondrial energy production

Alanine-glyoxylate aminotransferase 2 Mitochondrial energy production

Quinone oxidoreductase Mitochondrial energy production

NADH dehydrogenase subunit 4 Mitochondrial energy production

Glyceraldehyde 3-phosphate dehydrogenase isoform 1 Mitochondrial energy production

Cytochrome c oxidase subunit I Key enzyme in metabolism

F1 ATP synthase beta subunit Synthesize adenosine triphosphate from adenosine

diphosphate

Mitochondrial ATP synthase beta subunit-like Synthesize adenosine triphosphate from adenosine

diphosphate

Spermine oxidase Catabolic enzyme capable of the efﬁcient oxidation of

polyamines

Acetyl-CoA acetyltransferase, mitochondrial precursor Converts two units of acetyl-CoA to acetoacetyl CoA

Hydroxyacid oxidase 2 Participates in glyoxylate and dicarboxylate

metabolism

Hemoglobin subunit beta-A Oxygen transport and iron metabolism

Acyl-coenzyme A thioesterase 5 Lipid metabolism

Peroxisomal sarcosine oxidase Catalyze the oxidative demethylation of sarcosine in

the peroxisome

Aldehyde dehydrogenase Oxidation of aldehydes to carboxylic acids

Cytosolic alanine aminotransferase 2 Catalyzes the transfer of an amino group from alanine

to a-ketoglutarate

NADH dehydrogenase subunit 4L Catalyzes the transfer of electrons from NADH to

coenzyme Q

DNA-binding, DNA processing, or DNA repair (4)

SOS response Ada system protein DNA repair

Endonuclease III-like DNA processing

Sodium/nucleoside cotransporter-like Nucleoside transport

Ornithine decarboxylase antizyme small isoform Inhibitor of ornithine decarboxylase, an essential

enzyme for producing polyamines necessary for

stabilizing DNA structure and the DNA repair

Cell structure, growth and maintenance (2)

Actin related protein 2/3 complex subunit 2 Control of actin polymerization

Spectrin repeat containing, nuclear envelope 1-like Maintain cytoskeletal structure

Protein synthesis (6)

60S ribosomal protein L5 Ribosomal protein synthesis

40S ribosomal protein S27 Ribosomal protein synthesis

60S ribosomal protein L22 Ribosomal protein synthesis

60S ribosomal protein L8 Ribosomal protein synthesis

40S ribosomal protein S17 Ribosomal protein synthesis

60S ribosomal protein L19 Ribosomal protein synthesis

Transcription and translation related protein (3)

Eukaryotic translation initiation factor 3 subunit 3 Translation

Forkhead box protein C1 Transcription factor

QM-like protein Transcription factor regulation

186 J.W. Pridgeon et al. / Veterinary Immunology and Immunopathology 145 (2012) 179–190

Table 4 (Continued)

Category Putative protein name Putative function related to infection

Homeostasis (3)

Ferritin heavy subunit Iron storage

ATP synthase F0 subunit 6 Key component of the proton channel

Two pore channel 3 Establish and control the small voltage gradient across

the plasma membrane

Signal transduction (6)

Receptor for activated protein kinase C Responsible for the binding of active forms of the

protein kinase C

Casein kinase 1, alpha 1 Regulator of signal transduction pathways

PDZ domain-containing protein 1 Anchor transmembrane proteins to the cytoskeleton

and hold together signaling complexes

Rho GTPase-activating protein 15 G-protein signaling

Mitogen-activated protein kinase scaffold protein 1 Regulator of signal transduction pathways

EF-hand domain-containing protein 1 Calcium-binding

Proliferation or apoptosis (2)

Growth hormone-inducible transmembrane protein Anti-apoptosis

Voltage-dependent anion-selective channel protein 2 Regulation of mitochondrial apoptosis

Functionally unknown proteins (11)

Unnamed protein product CAF98538 Unknown

Unnamed protein product CAG09328 Unknown

Hypothetical protein LOC549215 Unknown

si:dkey-33c12.4 Unknown

Unnamed protein product CAG04404 Unknown

Echinoderm microtubule-associated protein-like 5-like Unknown

Gag-Pol polyprotein-like Unknown

Polyprotein Unknown

Phenazine biosynthesis-like domain-containing Unknown

protein 1

PL-5283 protein Unknown

Unnamed protein product BAC26203 Unknown

2010; Sun et al., 2010; Pridgeon and Klesius, 2011b; Zou serum lysozyme levels was observed in ﬁsh injected

␮

et al., 2011). However, vaccines depend on the ﬁsh host with CpG ODN 2133 at the highest dose (10 g per

to generate immunity to ﬁght infections, which typically ﬁsh) compared to lower doses (3.16, 1, 0.316, or 0.1 ␮g

requires several days or longer, thus leaving ﬁsh vulnera- per ﬁsh) (Carrington and Secombes, 2007). Similarly, we

ble to infections from the date of vaccination to the date observed that ODN 2007 at lower doses failed to pro-

they obtained immunity. Therefore, there is a need to vide higher protection than the dose of 100 ␮g per ﬁsh

explore alternative method to protect ﬁsh. The ability of (data not shown). Therefore, the dose of 100 ␮g per ﬁsh

CpG to increase resistance against bacterial infection in was chosen to study immune gene response under our

ﬁsh has been reported previously. For example, CpG-ODN experimental conditions for ODN 2007. However, CpG

4M intraperitoneally injected to Japanese ﬂounder (P. oli- ODNs have reported as becoming self-inhibitory in murine

vaceus) has been reported to increase resistance against macrophages at high concentrations (Sester et al., 2000),

bacterial infection at 48 h post treatment, with RPS of 50% suggesting that various animals may react differently to

and 40% against Aeromonas hydrophila AH1 and Edward- CpG ODNs.

siella tarda TX1, respectively (Liu et al., 2010a). Similarly, It has been observed that the protective effects of CpG

CpG ODN 205IP injected to turbot (Scophthalmus maximus) ODNs in ﬁsh are time dependent (Lee et al., 2003). For

has been reported to offer protection against E. tarda and example, 48 h post CpG ODN 205 treatment in turbot was

Vibrio harveyi at 48 h post treatment (Liu et al., 2010b). In the best time that produced the highest protection com-

the present study, we demonstrated that ODN 2007 admin- pared to 12 h or 24 h post treatment (Liu et al., 2010b).

istrated through IP injection also signiﬁcantly increased Similarly, the proportion of lymphocytes in rainbow trout

the resistance of Nile tilapia against S. iniae infection. head kidney at two days post CpG ODN 2133 treatment has

Taken together, our results further suggest that CpG ODNs been reported to be signiﬁcantly higher than that at 1, 4,

could be used as immunostimulants to protect ﬁsh against and 8 days post injection of CpG ODN 2133 (Carrington and

pathogens. Secombes, 2007). Prior to this study, we found no signiﬁ-

The dose of CpG-ODNs is an important factor to elicit cant difference in cumulative mortality between control

optimum immune responses. It has been reported that ﬁsh and ODN 2007 treated ﬁsh when challenged by viru-

␮

injection of CpG-ODN at doses of 50 and 100 g per lent S. iniae at 30 or 39 days post CpG treatment (data not

ﬁsh induced signiﬁcant protection in Atlantic salmon shown). Therefore, two days post injection was chosen as

against infectious pancreatic necrosis virus challenge, the time point to perform this study. Whether other time

␮

while 1 and 10 g failed to provide signiﬁcant pro- points post ODN 2007 treatment will elicit higher protec-

tection (Jørgensen et al., 2003). Signiﬁcant increase in tion merits further study.

J.W. Pridgeon et al. / Veterinary Immunology and Immunopathology 145 (2012) 179–190 187

Fig. 1. Transcriptional levels the 69 genes in the posterior kidney of Nile tilapia. The relative expression level of a speciﬁc gene in QCDCR + ODN 2007

treated ﬁsh was compared to that of QCDCR-treated control ﬁsh by the formula 2 where Ct = Ct (QCDCR + ODN 2007) − Ct (QCDCR). Data are

presented as mean ± S.D. from three replicates. (A) 32 highly upregulated genes (>10-fold); (B) 37 moderately upregulated genes (<10-fold).

Using suppression subtractive cDNA hybridization tech- has been reported to be capable of producing H2O2

nique, 69 ESTs were identiﬁed from the subtractive cDNA through oxidation in rabbit kidney (Reuber et al., 1997),

library. Quantitative PCR revealed that 44 ESTs were sig- whereas glutoredoxin is an important redox regulator that

niﬁcantly induced by the ODN 2007 treatment, including possesses antioxidant protective role under normal and

29 highly (>10-fold) induced ESTs and ﬁfteen moder- injured conditions to prevent apoptosis and necrosis (Nagy

ately (<10-fold) induced. Of the 29 highly upregulated et al., 2008). Hydrogen peroxide (H2O2), one of the reac-

ESTs, EST 12F06 (putative peroxisomal sarcosine oxi- tive oxygen species (ROS) generated during respiratory

dase) was upregulated the highest, followed by EST11B02 burst, is toxic to bacteria (Carrington and Secombes, 2007).

(putative glutaredoxin-1). Peroxisomal sarcosine oxidase Rapid generation of intracellular reactive oxygen species

188 J.W. Pridgeon et al. / Veterinary Immunology and Immunopathology 145 (2012) 179–190

Fig. 2. Classification of the differentially expressed genes identified from the subtractive library. Pie charts representing the distribution of the 69 identified

genes according to their putative biological function.

has been reported to be one of the early host responses to bases from DNA (Dizdaroglu et al., 1993; Hatahet et al.,

CpG DNA (Krieg, 2000). Mitochondria are the major intra- 1994; Thayer et al., 1995). In addition to its function in

cellular source of ROS, which are produced by complex DNA repair, endonuclease III has been demonstrated to

I and complex III during mitochondrial respiration (Indo have DNA binding motifs (Thayer et al., 1995). Ornithine

et al., 2007). Redox environment of the mitochondria is decarboxylase antizyme is an inhibitor of ornithine decar-

controlled by a variety of redox regulating systems that boxylase, the ﬁrst rate-limiting key enzyme for polyamine

include glutaredoxin. Taken together, the upregulations of biosynthesis (Yamamoto et al., 2010). It has been reported

putative peroxisomal sarcosine oxidase and glutaredoxin that the expression level of ornithine decarboxylase was

suggest that they might play important roles in the protec- elevated in alveolar macrophages and the number of alve-

tion elicited by ODN 2007 against S. iniae infection. olar macrophages that took up exogenous polyamines was

Of the 15 moderately upregulated ESTs, EST11D02 increased 20-fold during Pneumocystis pneumonia (PcP)

(putative cytochrome c oxidase subunit II) was upregu- (Liao et al., 2009). PcP is the most common opportunis-

lated the highest. Stimulation of immune cells can result tic disease in immunocompromised patients and alveolar

in altered cell function and metabolism, which must be macrophage is responsible for the clearance of Pneumo-

recognized by and coordinated with energy production cystis organisms (Liao et al., 2009). Taken together, our

from mitochondria (Kain et al., 2000). Increased activity results suggest that the upregulation of ornithine decar-

level of cytochrome c oxidase has been reported in pre- boxylase antizyme might play an important role in both

B-lymphocytes after stimulation with lipopolysaccharide the processing of ODN 2007 and its protection against S.

(Kain et al., 2000). Signiﬁcantly upregulation of cytochrome iniae infection.

c oxidase subunit II has also been reported in Nile tilapia In human, three distinct classes of CpG oligodeoxynu-

vaccinated with killed S. iniae vaccine (Pridgeon and cleotides have been well characterized: (1) A-class ODN

Klesius, 2011a). Upregulation of cytochrome c oxidase has (a phosphodiester/phosphorothioate backbone with a poly

also been reported in epithelial cells after invasion by group G tail) triggers maturation of antigen-presenting cells and

A Streptococcus pyogenes (Nakagawa et al., 2004), suggest- directly induces the secretion of high levels of IFN␣, (2)

ing that upregulation of cytochrome c oxidase might be an B-class ODN (multiple CpG motifs on a phosphorothioate

immediate immune response to CpG treatment. However, backbone) induces little or no IFN␣, and (3) C-class ODN

overexpression of cytochrome c oxidase subunit I and II has (hexameric CpG motif [5 -TCGTCGTT-3 ] linked by a T

also been reported in rat liver cells induced by gossypol spacer to GC rich palindromic sequences) has the func-

acetic acid (Hutchinson et al., 1998). It is currently unclear tional properties of both A and B class ODN (Weiner, 2009).

whether the upregulation of cytochrome c oxidase subunit Since ODN 2007 is a B-class ODN, it is expected that lit-

II is an immune response or a reaction induced by xenobi- ter or no IFN␣ should be induced. As expected, none of

otics such as CpGs. the 69 ESTs identiﬁed was IFN␣. In fact, majority of the

Of the 29 signiﬁcantly upregulated ESTs, two ESTs upregulated ESTs had putative functions in metabolism

were related to DNA processing and DNA repair: EST9F11, or energy production or others, with only six genes were

a putative endonuclease III, and EST13E10, a putative related to immunity. Of the six immune-related genes, only

ornithine decarboxylase antizyme. Endonuclease III plays two (putative glutaredoxin-1 and carboxypeptidase N cat-

an important role in DNA base excision repair by remov- alytic chain) were conﬁrmed to be signiﬁcantly induced

ing numerous forms of modiﬁed thymine and cytosine by ODN 2007. The possible role of glutaredoxin in the

J.W. Pridgeon et al. / Veterinary Immunology and Immunopathology 145 (2012) 179–190 189

protection has been discussed earlier. Carboxypeptidase challenge in rainbow trout (Oncorhynchus mykiss). Fish Shellﬁsh

Immunol. 23, 781–792.

N (CPN), a 280 kDa tetrameric enzyme consisting of two

Cheng, S., Hu, Y.H., Jiao, X.D., Sun, L., 2010. Identiﬁcation and immuno-

83 kDa regulatory subunits and two catalytic 50 kDa sub-

protective analysis of a Streptococcus iniae subunit vaccine candidate.

units, is a key regulator of inﬂammation (Willemse and Vaccine 28, 2636–2641.

Cuesta, A., Salinas, I., Esteban, M.A., Meseguer, J., 2008. Unmethylated

Hendriks, 2006). CPN has been reported to be the pri-

CpG motifs mimicking bacterial DNA triggers the local and systemic

mary inactivator of the C3a, C4a, and C5a anaphylatoxins

innate immune parameters and expression of immune-relevant genes

released during complement activation (Mathews et al., in gilthead seabream. Fish Shellﬁsh Immunol. 25, 617–624.

Darwish, A.M., 2007. Laboratory efﬁcacy of ﬂorfenicol against Streptococ-

2004), suggesting that CPN might play an important role

cus iniae infection in sunshine bass. J. Aquat. Anim. Health 19, 1–7.

in the protection of Nile tilapia elicited by ODN 2007

Dizdaroglu, M., Laval, J., Boiteux, S., 1993. Substrate speciﬁcity of the

against S. iniae infection. However, the relative low number Escherichia coli endonuclease III: excision of thymine- and cytosine-

of immunity-related genes signiﬁcantly induced by ODN derived lesions in DNA produced by radiation-generated free radicals.

Biochemistry 32, 12105–12111.

2007 suggested that the protection elicited by ODN 2007 is

Eldar, A., Perl, S., Frelier, P.F., Bercovier, H., 1999. Red drum Sciaenops

mainly through innate immune responses directly or indi-

ocellatus mortalities associated with Streptococcus iniae infection. Dis.

rectly related to immunity. Aquat. Organ. 36, 121–127.

Eyngor, M., Tekoah, Y., Shapira, R., Hurvitz, A., Zlotkin, A., Lublin, A., Eldar,

In summary, the potential of using ODN 2007 to confer

A., 2008. Emergence of novel Streptococcus iniae exopolysaccharide-

protection to Nile tilapia against S. iniae infection was eval-

producing strains following vaccination with nonproducing strains.

uated in this study. When adjuvanted with QCDCR, ODN Appl. Environ. Microbiol. 74, 6892–6897.

Ferguson, H.W., St John, V.S., Roach, C.J., Willoughby, S., Parker, C., Ryan,

2007 provided Nile tilapia signiﬁcant protection against S.

R., 2000. Caribbean reef ﬁsh mortality associated with Streptococcus

iniae infection. Of all ESTs, putative peroxisomal sarcosine

iniae. Vet. Rec. 147, 662–664.

oxidase was upregulated the highest, followed by puta- Hatahet, Z., Kow, Y.W., Purmal, A.A., Cunningham, R.P., Wallace, S.S.,

1994. New substrates for old enzymes: 5-hydroxy-2 -deoxycytidine

tive glutaredoxin-1. Of the total 69 ESTs identiﬁed by SSH,

and 5-hydroxy-2 -deoxyuridine are substrates for Escherichia coli

only six had putative functions in immunity, of which only

endonuclease III and formamidopyrimidine DNA N-glycosylase,

two were conﬁrmed to be signiﬁcantly induced by ODN while 5-hydroxy-2 -deoxyuridine is a substrate for uracil DNA N-

glycosylase. J. Biol. Chem. 269, 18814–18820.

2007, suggesting that the protection elicited by ODN 2007

Hutchinson, R.W., Ing, N.H., Burghardt, R.C., 1998. Induction of c-fos, and

is mainly through innate immune responses directly or

cytochrome c oxidase subunits I and II by gossypol acetic acid in rat

indirectly related to immunity. liver cells. Cell Biol. Toxicol. 14, 391–399.

Indo, H.P., Davidson, M., Yen, H.C., Suenaga, S., Tomita, K., Nishii, T.,

Higuchi, M., Koga, Y., Ozawa, T., Majima, H.J., 2007. Evidence of ROS

Acknowledgments generation by mitochondria in cells with impaired electron transport

chain and mitochondrial DNA damage. Mitochondrion 7, 106–118.

Ioannou, X.P., Gomis, S.M., Karvonen, B., Hecker, R., Babiuk, L.A., Van

We thank Drs. Dehai Xu (USDA-ARS) and Victor

Drunen Littel-Van Den Hurk, S., 2002. CpG-containing oligodeoxynu-

Panangala (USDA collaborator) for critical reviews of the cleotides, in combination with conventional adjuvants, enhance the

magnitude and change the bias of the immune responses to a her-

manuscript. We thank Dr. Brian Schefﬂer and Fanny

pesvirus glycoprotein. Vaccine 21, 127–137.

Liu (USDA-ARS-Catﬁsh Genetics Research Unit) for their

Jørgensen, J.B., Johansen, L.H., Steiro, K., Johansen, A., 2003. CpG DNA

excellent sequencing work. We thank Beth Peterman induces protective antiviral immune responses in Atlantic salmon

(Salmo salar L.). J. Virol. 77, 11471–11479.

(USDA-ARS) for her excellent technical support. We also

Kain, K.H., Popov, V.L., Herzog, N.K., 2000. Alterations in mitochondria and

thank the management team of the Aquatic Animal Health

mtTFA in response to LPS-induced differentiation of B-cells. Biochim.

Research Unit for daily care and management of the ﬁsh. Biophys. Acta 1494, 91–103.

Koh, T.H., Kurup, A., Chen, J., 2004. Streptococcus iniae discitis in Singapore.

This study was supported by USDA/ARS CRIS project No.

Emerg. Infect. Dis. 10, 1694–1696.

6420-32000-024-00D and trust agreement between Pﬁzer

Krieg, A.M., 2000. Immune effects and mechanisms of action of CpG motifs.

Animal Health and ARS (ARIS No. 420798). Xingjiang Mu Vaccine 19, 618–622.

Krieg, A.M., 2002. CpG motifs in bacterial DNA and their immune effects.

was supported by China Scholarship Council. The use of

Annu. Rev. Immunol. 20, 709–760.

trade, ﬁrm, or corporate names in this publication is for the

Lee, C.H., Jeong, H.D., Chung, J.K., Lee, H.H., Kim, K.H., 2003. CpG motif in

information and convenience of the reader. Such use does synthetic ODN primes respiratory burst of olive ﬂounder Paralichthys

not constitute an ofﬁcial endorsement or approval by the olivaceus phagocytes and enhances protection against Edwardsiella

tarda. Dis. Aquat. Organ. 56, 43–48.

United States Department of Agriculture or the Agricultural

Lee, S.H., Lillehoj, H.S., Jang, S.I., Hong, Y.H., Min, W., Lillehoj, E.P., Yancey,

Research Service of any product or service to the exclusion

R.J., Dominowski, P., 2010. Embryo vaccination of chickens using a

of others that may be suitable. novel adjuvant formulation stimulates protective immunity against

Eimeria maxima infection. Vaccine 28, 7774–7778.

Li, P., Lewis, D.H., Gatlin 3rd., D.M., 2004. Dietary oligonucleotides from

References yeast RNA inﬂuence immune responses and resistance of hybrid

striped bass (Morone chrysops × Morone saxatilis) to Streptococcus iniae

infection. Fish Shellﬁsh Immunol. 16, 561–569.

Agnew, W., Barnes, A.C., 2007. Streptococcus iniae: an aquatic pathogen of

Liao, C.P., Lasbury, M.E., Wang, S.H., Zhang, C., Durant, P.J., Murakami,

global veterinary signiﬁcance and a challenging candidate for reliable

Y., Matsufuji, S., Lee, C.H., 2009. Pneumocystis mediates overexpres-

vaccination. Vet. Microbiol. 122, 1–15.

sion of antizyme inhibitor resulting in increased polyamine levels and

Amend, D.F., 1981. Potency testing of ﬁsh vaccines. Dev. Biol. Stand. 49,

apoptosis in alveolar macrophages. J. Biol. Chem. 284, 8174–8184.

447–454.

Liu, C.S., Sun, Y., Hu, Y.H., Sun, L., 2010a. Identiﬁcation and analysis of

Bridle, A.R., Butler, R., Nowak, B.F., 2003. Immunostimulatory CpG

the immune effects of CpG motifs that protect Japanese ﬂounder (Par-

oligodeoxynucleotides increase resistance against amoebic gill dis-

alichthys olivaceus) against bacterial infection. Fish Shellﬁsh Immunol.

ease in Atlantic salmon, Salmo salar L. J. Fish Dis. 26, 367–371.

29, 279–325.

Bromage, E.S., Thomas, A., Owens, L., 1999. Streptococcus iniae, a bacte-

Liu, C.S., Sun, Y., Hu, Y.H., Sun, L., 2010b. Identiﬁcation and analysis of a CpG

rial infection in barramundi Lates calcarifer. Dis. Aquat. Organ. 36,

motif that protects turbot (Scophthalmus maximus) against bacterial

177–181.

challenge and enhances vaccine-induced speciﬁc immunity. Vaccine

Carrington, A.C., Secombes, C.J., 2007. CpG oligodeoxynucleotides up-

28, 4153–4161.

regulate antibacterial systems and induce protection against bacterial

190 J.W. Pridgeon et al. / Veterinary Immunology and Immunopathology 145 (2012) 179–190

Locke, J.B., Vicknair, M.R., Ostland, V.E., Nizet, V., Buchanan, J.T., 2010. Shoemaker, C.A., Lafrentz, B.R., Klesius, P.H., Evans, J.J., 2010. Protection

Evaluation of Streptococcus iniae killed bacterin and live attenuated against heterologous Streptococcus iniae isolates using a modiﬁed bac-

vaccines in hybrid striped bass through injection and bath immersion. terin vaccine in Nile tilapia Oreochromis niloticus (L.). J. Fish Dis. 33,

Dis. Aquat. Organ. 89, 117–123. 537–544.

Mathews, K., Mueller-Ortiz, S., Wetsel, R., 2004. Carboxypeptidase Skjaeveland, I., Iliev, D.B., Zou, J., Jørgensen, T., Jørgensen, J.B., 2008. A TLR9

N: a pleiotropic regulator of inﬂammation. Mol. Immunol. 40, homolog that is up-regulated by IFN-gamma in Atlantic salmon (Salmo

785–793. salar). Dev. Comp. Immunol. 32, 603–607.

Nagy, N., Malik, G., Tosaki, A., Ho, Y.S., Maulik, N., Das, D.K., 2008. Sun, Y., Hu, Y.H., Liu, C.S., Sun, L., 2010. Construction and analysis

Overexpression of glutaredoxin-2 reduces myocardial cell death by of an experimental Streptococcus iniae DNA vaccine. Vaccine 28,

preventing both apoptosis and necrosis. J. Mol. Cell. Cardiol. 44, 3905–3912.

252–260. Sun, J.R., Yan, J.C., Yeh, C.Y., Lee, S.Y., Lu, J.J., 2007. Invasive infection with

Nakagawa, I., Nakata, M., Kawabata, S., Hamada, S., 2004. Transcriptome Streptococcus iniae in Taiwan. J. Med. Microbiol. 56, 1246–1249.

analysis and gene expression proﬁles of early apoptosis-related genes Thayer, M.M., Ahern, H., Xing, D., Cunningham, R.P., Tainer, J.A., 1995.

in Streptococcus pyogenes-infected epithelial cells. Cell. Microbiol. 6, Novel DNA binding motifs in the DNA repair enzyme endonuclease

939–952. III crystal structure. EMBO J. 14, 4108–4120.

Pier, G.B., Madin, S.H., 1976. Streptococcus iniae sp. nov., a beta-hemolytic Weiner, G.J., 2009. CpG oligodeoxynucleotide-based therapy of lymphoid

Streptococcus isolated from an Amazon freshwater dolphin Inia geof- malignancies. Adv. Drug Deliv. Rev. 61, 263–267.

frensis. Int. J. Syst. Bacteriol. 26, 545–553. Weinstein, M., Low, D., McGeer, A., Willey, B., Rose, D., Coulter, M.,

Pridgeon, J.W., Klesius, P.H., 2011a. Identiﬁcation and expression pro- Wyper, P., Borczyk, A., Lovgren, M., Facklam, R., 1996. Invasive infec-

ﬁle of multiple genes in Nile tilapia in response to formalin killed tion due to Streptococcus iniae: a new or previously unrecognized

Streptococcus iniae vaccination. Vet. Immunol. Immunopathol. 142, disease—Ontario, 1995–1996. Can. Commun. Dis. Rep. 22, 129–131.

201–206. Weinstein, M.R., Litt, M., Kertesz, D.A., Wyper, P., Rose, D., Coulter, M.,

Pridgeon, J.W., Klesius, P.H., 2011b. Development and efﬁcacy of a McGeer, A., Facklam, R., Ostach, C., Willey, B.M., Borczyk, A., Low, D.E.,

novobiocin-resistant Streptococcus iniae as a novel vaccine in Nile S. iniae Study Group, 1997. Invasive infections due to a ﬁsh pathogen,

tilapia (Oreochromis niloticus). Vaccine 29, 5986–5993. Streptococcus iniae. N. Engl. J. Med. 337, 589–594.

Pridgeon, J.W., Shoemaker, C.A., Klesius, P.H., 2010. Identiﬁcation and Willemse, J.L., Hendriks, D.F., 2006. A rapid and sensitive assay for the

expression proﬁle of multiple genes in the anterior kidney of chan- quantitation of carboxypeptidase N, an important regulator of inﬂam-

nel catﬁsh induced by modiﬁed live Edwardsiella ictaluri vaccination. mation. Clin. Chim. Acta 371, 124–129.

Vet. Immunol. Immunopathol. 134, 184–198. Yamamoto, D., Shima, K., Matsuo, K., Nishioka, T., Chen, C.Y., Hu, G.F.,

Reuber, B.E., Karl, C., Reimann, S.A., Mihalik, S.J., Dodt, G., 1997. Cloning Sasaki, A., Tsuji, T., 2010. Ornithine decarboxylase antizyme induces

and functional expression of a mammalian gene for a peroxisomal hypomethylation of genome DNA and histone H3 lysine 9 dimethyla-

sarcosine oxidase. J. Biol. Chem. 272, 6766–6776. tion (H3K9me2) in human oral cancer cell line. PLoS ONE 5, e12554.

Sester, D.P., Naik, S., Beasley, S.J., Hume, D.A., Stacey, K.J., 2000. Phospho- Zou, L., Wang, J., Huang, B., Xie, M., Li, A., 2011. MtsB, a hydrophobic mem-

rothioate backbone modiﬁcation modulates macrophage activation brane protein of Streptococcus iniae, is an effective subunit vaccine

by CpG DNA. J. Immunol. 165, 4165e73. candidate. Vaccine 29, 391–394.