DOCSLIB.ORG

CYP3A43 Pro Ala Polymorphism and Prostate Cancer Risk in African Americans and Caucasians

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
CYP3A43 Pro Ala Polymorphism and Prostate Cancer Risk in African Americans and Caucasians Cancer Epidemiology, Biomarkers & Prevention 1257 CYP3A43 Pro340Ala Polymorphism and Prostate Cancer Risk in African Americans and Caucasians Angie Stone,1 Luke D. Ratnasinghe,1,3,4 Ginny L. Emerson,1 Rama Modali,6 Terri Lehman,6 Gail Runnells,3 Alindria Carroll,3 Weleetka Carter,3 Samuel Barnhart,3 Al A. Rasheed,3 Graham Greene,3 Don E. Johnson,2 Christine B. Ambrosone,5 Fred F. Kadlubar,1 and Nicholas P. Lang 2,3,4 1Division of Molecular Epidemiology, National Center for Toxicological Research, Jefferson, Arkansas; 2 Central Arkansas Veteran’s Health Care System; 3Arkansas Cancer Research Center; and 4Department of Surgery, College of Medicine, University of Arkansas for Medical Sciences, Little Rock, Arkansas; 5Department of Epidemiology, Roswell Park Cancer Institute, Buffalo, New York; and 6BioServe Biotechnologies, Inc., Laurel, Maryland Abstract The human cytochrome P450 3A subfamily of enzymes is Ala genotype (odds ratio, 3.0; 95% confidence interval, 1.2- involved in the metabolism of steroid hormones, carcino- 7.2) compared with those with the CYP3A43-Pro/Pro gens, and many drugs. A cytosine-to-guanine polymor- genotype after adjusting for age, race, and smoking. The phism in CYP3A43 results in a proline-to-alanine prevalence of the polymorphism was significantly higher in substitution at codon 340. Although the functional signif- African Americans than Caucasians (45% versus 13%). In icance of this polymorphism is unknown, we postulate that African Americans, there was a 2.6-fold increase in prostate the substitution of proline, an A-imino acid, with alanine, cancer risk among individuals with the CYP3A43-Ala/Ala an amino acid, could be of biochemical significance. In a genotype (odds ratio, 2.6; 95% confidence interval, 1.0-7.0) case-control study with 490 incident prostate cancer cases compared with those with the CYP3A43-Pro/Pro genotype. (124 African Americans and 358 Caucasians) and 494 Among Caucasians, the small number of homozygotes controls (167 African Americans and 319 Caucasians), we precluded computing risk estimates; there were only three examined the association between CYP3A43 Pro340Ala individuals with the CYP3A43-Ala/Ala genotype. Our polymorphism and prostate cancer risk. When all subjects results suggest that the CYP3A43-Pro340Ala polymorphism were considered, there was a 3-fold increase in risk of contributes to prostate cancer risk. (Cancer Epidemiol prostate cancer among individuals with the CYP3A43-Ala/ Biomarkers Prev 2005;14(5):1257–61) Introduction In the United States, prostate cancer is the most common form cortisol) and xenobiotics (12). The CYP3A family is composed of cancer and is the second leading cause of cancer-related of four known CYP3A genes in humans: CYP3A4, CYP3A5, death among men (1). African American men have the world’s CYP3A7, and CYP3A43. Each gene contains 13 exons and is highest incidence of prostate cancer and more than twice the located on chromosome 7q21-22.1, with CYP3A43 in an death rate compared with Caucasian men; they also have unusual head-to-head orientation with CYP3A4, CYP3A5, significantly higher rate of disease severity at diagnosis (2-7). and CYP3A7 (13, 14).CYP3A43shares DNA sequence Epidemiologic evidence indicates that steroid hormones play a homologies of 84%, 83%, and 82% and amino acid homologies major role in prostate carcinogenesis and may partially explain of 76%, 76%, and 72% with CYP3A4, CYP3A5, and CYP3A7, the risk disparity between African Americans and Caucasians. respectively (13, 15). Previous population-based studies have addressed the hy- Distribution of CYP3A43 mRNA in various tissues (liver, pothesis that functional polymorphisms in genes involved in kidney, pancreas, prostate, etc.) by PCR amplification has testosterone metabolism might be associated with the differ- shown that the expression level of CYP3A43 is considerably ences in prostate cancer risk among various ethnic popula- lower than CYP3A4, CYP3A5, and CYP3A7, although the level tions; however, results have been inconsistent and of expression of CYP3A43 does not necessarily reflect the extent contradictory (8-11). of its actual role in xenobiotic metabolism (15). Westlind et al. Members of the cytochrome P450 (CYP) family of enzymes, found that CYP3A43 and CYP3A4 mRNA are expressed in which are responsible for >50% of drug metabolism, are prostate, colon, breast, lung, and pancreatic carcinoma; there is heme-containing mono-oxygenases that catalyze hydroxyl- also some evidence of hepatic coexpression of all four mRNAs ation of steroids (including testosterone, progesterone, and (12). Three different transcript variants are formed from alternate splicing of this gene. Interestingly, there are several hybrid CYP3A43/CYP3A4 and CYP3A43/CYP3A5 genes that have been formed by splicing CYP3A43 exon 1 to various Received 7/19/04; revised 11/4/04; accepted 12/2/04. CYP3A4 or CYP3A5 exons, resulting in hybrid mRNA products Grant support: Arkansas Bioscience Institute, National Cancer Institute grant R01CA55751, (13). The chimeric proteins formed from these transgenic National Institute on Aging grant R01AG15722-02, NIH GCRC grant M01RR14288, and National Center for Toxicological Research-Food and Drug Administration protocol E0702101. splicing variants are not always enzymatically active; how- G.L. Emerson was supported as a postdoctoral research associate through the Oak Ridge ever, the longest chimeric isoform, encoded by the (1)CYP3A43- Institute for Science and Education. (2-13) cDNA, can hydroxylate testosterone (13). The costs of publication of this article were defrayed in part by the payment of page charges. CYP3A4 This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Xenobiotics and endogenous substances, such as steroid Section 1734 solely to indicate this fact. hormones, can activate the pregnane X receptor, a human Requests for reprints: Angie Stone, Central Arkansas Veteran’s Health Care System, Research orphan nuclear receptor, resulting in the induction of CYP3A Service Slot 151, 4301 West 7th Street, Little Rock, AR 72205. Phone: 501-257-4850; Fax: 501-257- 4822. E-mail: [email protected] genes. Two drugs known to induce CYP3A activity in primary Copyright D 2005 American Association for Cancer Research. hepatocytes are rifampicin and dexamethasone; however, the Cancer Epidemiol Biomarkers Prev 2005;14(5). May 2005 Downloaded from cebp.aacrjournals.org on October 2, 2021. © 2005 American Association for Cancer Research. 1258 CYP3A43 and Prostate Cancer four CYP3A isoforms differed in expression levels when other and serum creatinine >1.8 mg/dL). Covariate data for the drugs were used, indicating that the four isoforms are current study were obtained by conducting in-person inter- differentially regulated (14-16). In addition, there is very little views with cases and controls at the time of enrollment to the sequence similarity among the 5Vuntranslated regions of case-control study. Each study participant also provided a CYP3A43 and CYP3A4, CYP3A5, and CYP3A7 genes; regula- blood sample for DNA analyses. The appropriate institutional tory elements in the 5V region of CYP3A43 have not been review board approvals were obtained for the study protocol. found, although CYP3A4 has several known regulatory Signed informed consent was obtained for the interview, blood regions and binding sites in the 5Vuntranslated region (17). collection, and analyses of polymorphisms. Several studies have addressed the hypothesis that func- Genotyping. DNA was extracted from lymphocytes of study tional polymorphisms in the CYP3A4 and CYP3A5 genes participants using a commercial kit (Qiagen, Inc., Valencia, CA) could be associated with prostate cancer risk among different and the samples were genotyped for the CYP3A43*3 polymor- ethnic populations. Rebbeck et al. found that an A-to-G phism at a commercial laboratory (BioServe Biotechnologies mutation within the nifedipine-specific element, À293 bp from Ltd., Laurel, MD) by high-throughput, chip-based matrix- the transcription start site of the CYP3A4 gene, was associated assisted laser desorption time-of-flight mass spectrometry with higher grade and stage in Caucasians with prostate (Sequenom, Inc., San Diego, CA) using the MassEXTEND cancer (18). Additional studies found evidence that African reaction (Sequenom). PCR primers and extension primers were Americans possess the CYP3A4*1B (variant allele) at 6 to 10 designed using SpectroDESIGNER software (Sequenom) and times the frequency found in Caucasians; limited data support synthesized at BioServe Biotechnologies. Oligonucleotide the hypothesis that the variant allele alters testosterone sequences of the primers and probe were forward primer metabolism (19-21). The CYP3A5 6986 G > A (CYP3A5*3) ACGTTGGATGCATTCTTGCTGAGGC, reverse primer variant correlates with function of the CYP3A5 enzyme and is ACGTTGGATGCCTGATGTCCAGCAGAAAC, and extension in linkage disequilibrium with the CYP3A4 promoter variant primer TCATCCCCTTACCTTATTGG. and possibly other alleles (22). Plummer et al. found that the All laboratory personnel were blinded to case-control status. CYP3A4*1B/CYP3A5*3 haplotype (which is more common in Forty-four blinded duplicates were included in the genotype African Americans than Caucasians) is positively associated analyses and were 100% concordant. with prostate cancer, but the CYP3A4*1B variant is inversely associated with risk among Caucasians with less aggressive Statistical Analysis. The Wilcoxon rank-sum test was used disease (23).
Load more

Recommended publications
  • 4Β-Hydroxycholesterol As Biomarker for Variation in CYP3A Activity
    ȕ-Hydroxycholesterol as biomarker for variation in CYP3A activity Dissertation for the Degree of Philosophiae Doctor (Ph.D.) Kristine Hole 2018 Center for Psychopharmacology Diakonhjemmet Hospital Oslo Department of Pharmaceutical Biosciences School of Pharmacy Faculty of Mathematics and Natural Sciences University of Oslo © Kristine Hole, 2018 Series of dissertations submitted to the Faculty of Mathematics and Natural Sciences, University of Oslo No. ISSN 1501-7710 All rights reserved. No part of this publication may be reproduced or transmitted, in any form or by any means, without permission. Cover: Hanne Baadsgaard Utigard. Print production: Reprosentralen, University of Oslo. TABLE OF CONTENTS ACKNOWLEDGEMENTS ...................................................................................................... II LIST OF PUBLICATIONS ..................................................................................................... III ABBREVIATIONS..................................................................................................................IV ABSTRACT.............................................................................................................................. V 1 INTRODUCTION.............................................................................................................. 1 1.1 Variability in drug response ....................................................................................... 1 1.2 Drug metabolism .......................................................................................................
    [Show full text]
  • Pharmacogenomic Characterization in Bipolar Spectrum Disorders
    pharmaceutics Review Pharmacogenomic Characterization in Bipolar Spectrum Disorders Stefano Fortinguerra 1,2 , Vincenzo Sorrenti 1,2,3 , Pietro Giusti 2, Morena Zusso 2 and Alessandro Buriani 1,2,* 1 Maria Paola Belloni Center for Personalized Medicine, Data Medica Group (Synlab Limited), 35131 Padova, Italy; [email protected] (S.F.); [email protected] (V.S.) 2 Department of Pharmaceutical & Pharmacological Sciences, University of Padova, 35131 Padova, Italy; [email protected] (P.G.); [email protected] (M.Z.) 3 Bendessere™ Study Center, Solgar Italia Multinutrient S.p.A., 35131 Padova, Italy * Correspondence: [email protected] Received: 25 November 2019; Accepted: 19 December 2019; Published: 21 December 2019 Abstract: The holistic approach of personalized medicine, merging clinical and molecular characteristics to tailor the diagnostic and therapeutic path to each individual, is steadily spreading in clinical practice. Psychiatric disorders represent one of the most difficult diagnostic challenges, given their frequent mixed nature and intrinsic variability, as in bipolar disorders and depression. Patients misdiagnosed as depressed are often initially prescribed serotonergic antidepressants, a treatment that can exacerbate a previously unrecognized bipolar condition. Thanks to the use of the patient’s genomic profile, it is possible to recognize such risk and at the same time characterize specific genetic assets specifically associated with bipolar spectrum disorder, as well as with the individual response to the various therapeutic options. This provides the basis for molecular diagnosis and the definition of pharmacogenomic profiles, thus guiding therapeutic choices and allowing a safer and more effective use of psychotropic drugs. Here, we report the pharmacogenomics state of the art in bipolar disorders and suggest an algorithm for therapeutic regimen choice.
    [Show full text]
  • Simulating the Impact of the Interplay Between Cyp2c19 Polymorphisms and Ethnicity on Response to Clopidogrel, Using Pbpk-Pd Models
    SIMULATING THE IMPACT OF THE INTERPLAY BETWEEN CYP2C19 POLYMORPHISMS AND ETHNICITY ON RESPONSE TO CLOPIDOGREL, USING PBPK-PD MODELS. Manoranjenni Chetty, Khaled Abduljalil. Certara UK, Simcyp Division, Level 2-Acero, 1 Concourse Way, Sheffield, United Kingdom. Background PBPK-PD Model: Lua scripting was used within the Simcyp simulator for the PBPK-PD model. A modified indirect response turnover model6, Clopidogrel is a prodrug that produces its anticoagulant effect after with maximum platelet aggregation (MPA%) as the PD marker was used conversion to Clopi-H4, the active metabolite. Clopi-H4 binds to simulate the response to Clopi-H4. % IPA was calculated as: irreversibly to the platelet P2Y12 adenosine diphosphate (ADP) % IPA = [MPApredose – MPApostdose / MPApredose] * 100% receptor, which inhibits platelet aggregation and reduces platelet Clopi-H4 concentrations from the PBPK model were used as the input to reactivity for the platelet’s life span1. the PD model. Clopidogrel is metabolized by two major metabolic pathways. An Model Performance Verification: The PBPK model was verified by esterase-dependent pathway leads to hydrolysis of clopidogrel into comparison of the predicted and clinically observed pharmacokinetic an inactive carboxylic acid derivative (85–92%) while a cytochrome parameters. P450 (CYP) dependent pathway leads to the formation of its active Following the verification of the performance of the PBPK-PD model, 2,3,4 metabolite (clopi-H4) . CYP2C19, CYP2B6, and CYP1A2 first convert simulations were repeated using healthy Chinese PM and Caucasian PM clopidogrel to the 2-oxo-clopidogrel intermediate, which is then populations. The change in % IPA was compared in the 4 groups to metabolised by esterases (about 50%) or converted to Clopi-H4 by determine the need for dosage adjustments.
    [Show full text]
  • Synonymous Single Nucleotide Polymorphisms in Human Cytochrome
    DMD Fast Forward. Published on February 9, 2009 as doi:10.1124/dmd.108.026047 DMD #26047 TITLE PAGE: A BIOINFORMATICS APPROACH FOR THE PHENOTYPE PREDICTION OF NON- SYNONYMOUS SINGLE NUCLEOTIDE POLYMORPHISMS IN HUMAN CYTOCHROME P450S LIN-LIN WANG, YONG LI, SHU-FENG ZHOU Department of Nutrition and Food Hygiene, School of Public Health, Peking University, Beijing 100191, P. R. China (LL Wang & Y Li) Discipline of Chinese Medicine, School of Health Sciences, RMIT University, Bundoora, Victoria 3083, Australia (LL Wang & SF Zhou). 1 Copyright 2009 by the American Society for Pharmacology and Experimental Therapeutics. DMD #26047 RUNNING TITLE PAGE: a) Running title: Prediction of phenotype of human CYPs. b) Author for correspondence: A/Prof. Shu-Feng Zhou, MD, PhD Discipline of Chinese Medicine, School of Health Sciences, RMIT University, WHO Collaborating Center for Traditional Medicine, Bundoora, Victoria 3083, Australia. Tel: + 61 3 9925 7794; fax: +61 3 9925 7178. Email: [email protected] c) Number of text pages: 21 Number of tables: 10 Number of figures: 2 Number of references: 40 Number of words in Abstract: 249 Number of words in Introduction: 749 Number of words in Discussion: 1459 d) Non-standard abbreviations: CYP, cytochrome P450; nsSNP, non-synonymous single nucleotide polymorphism. 2 DMD #26047 ABSTRACT Non-synonymous single nucleotide polymorphisms (nsSNPs) in coding regions that can lead to amino acid changes may cause alteration of protein function and account for susceptivity to disease. Identification of deleterious nsSNPs from tolerant nsSNPs is important for characterizing the genetic basis of human disease, assessing individual susceptibility to disease, understanding the pathogenesis of disease, identifying molecular targets for drug treatment and conducting individualized pharmacotherapy.
    [Show full text]
  • Distribution of Drug-Metabolizing Enzymes Coding Genes CYP2D6
    Turk J Biochem 2019; 44(2): 142–146 Research Article İsmail Ün*, İ. Ömer Barlas, Nisa Uyar, Bahar Taşdelen and Naci Tiftik Distribution of drug-metabolizing enzymes coding genes CYP2D6, CYP3A4, CYP3A5 alleles in a group of healthy Turkish population Bir grup sağlıklı Türk populasyonunda ilaç metabolize edici CYP2D6, CYP3A4, CYP3A5 enzimlerinin allelik dağılımı https://doi.org/10.1515/tjb-2017-0226 Conclusion: Screening of low frequency alleles by phar- Received August 16, 2017; accepted June 7, 2018; previously macogenetic testing must not be omitted to optimize published online July 9, 2018 pharmacotherapy and avoid severe drug toxicities. Fre- Abstract quency distributions of the identified polymorphisms in the present study may contribute to the personalized drug Objective: Variant alleles in specific ethnic groups are therapy regimens and prediction of possible adverse drug important for personalized drug therapy regimens and reactions in the Turkish population. adverse drug reactions. Therefore, the aim of this study Keywords: CYP2D6; CYP3A4; CYP3A5; Drug metabolism; was to investigate allelic frequencies of the CYP2D6*1, Polymorphism. CYP3A4*5, CYP3A4*18, CYP3A5*2 and CYP3A5*4 in a group of Turkish population. Materials and methods: Three hundred and six unrelated Öz healthy subjects who were accepted as blood donors to the Mersin University Blood Bank were included in Amaç: Etnik gruplardaki varyant alleller, kişiselleşti- the study after informed consent. Allelic frequencies rilmiş ilaç tedavi rejimleri ve istenmeyen ilaç reaksi- of the CYP2D6*1 (rs3892097), CYP3A4*5 (rs55901263), yonları açısından önemlidir. Bu çalışmanın amacı bir CYP3A4*18 (rs28371759), CYP3A5*2 (rs28365083) and grup Türk gönüllüde CYP2D6*1, CYP3A4*5, CYP3A4*18, CYP3A5*4 (rs56411402) were determined by using poly- CYP3A5*2 ve CYP3A5*4′ genlerinin allelik frekanslarını merase chain reaction-restriction fragment length poly- araştırmaktır.
    [Show full text]
  • NIH Public Access Author Manuscript Pharmacogenet Genomics
    NIH Public Access Author Manuscript Pharmacogenet Genomics. Author manuscript; available in PMC 2013 August 08. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Pharmacogenet Genomics. 2012 July ; 22(7): 555–558. doi:10.1097/FPC.0b013e328351d47f. PharmGKB summary: very important pharmacogene information for CYP3A5 Jatinder Lambaa, Joan M. Hebertb, Erin G. Schuetzd, Teri E. Kleinb, and Russ B. Altmanc aDepartment of Experimental and Clinical Pharmacology, College of Pharmacy, Institute of Human Genetics, University of Minnesota, Minnesota bDepartment of Genetics, Stanford University, Stanford, California cDepartments of Genetics, Bioengineering, Stanford University, Stanford, California dDepartment of Pharmaceutical Sciences, St. Jude Children’s Research Hospital, Memphis, TN, USA Keywords CYP3A5; CYP3A5*2; CYP3A5*3; CYP3A5*6; CYP3A5*7; pharmacogenomics; rs10264272; rs28365083; rs76293380; rs776746 Introduction The aim of a PharmGKB VIP summary is to provide a simple overview of a gene with respect to drug effects. In some cases, there may be extensive evidence of variants that have known pharmacogenomic relevance, whereas in other cases, the summary may serve to highlight the gaps in knowledge where further study would aid the field. This summary points to the PharmGKB website to provide an interactive version that is linked to annotated publications and to related drugs, diseases, and pathways. The human CYP3A subfamily, CYP3A4, CYP3A5, CYP3A7, and CYP3A43, is one of the most versatile of the biotransformation systems that facilitate the elimination of drugs (37% of the 200 most frequently prescribed drugs in the US [1]). Together, CYP3A4 and CYP3A5 account for ~30% of hepatic cytochrome P450, and approximately half of the medications that are oxidatively metabolized by P450 are CYP3A substrates.
    [Show full text]
  • Comprehensive Bioinformatics Analysis of Lncrnas in Gastric Cancer
    ONCOLOGY LETTERS 17: 1279-1291, 2019 Comprehensive bioinformatics analysis of lncRNAs in gastric cancer DONGDONG QI1, QIANG WANG2, MEIQING WU3 and XIONG ZHANG4 1Department of Clinical Laboratory, Hulunbuir Mental Health Center; 2Department of General Surgery; 3Dermatological Department, Inner Mongolia Forestry General Hospital; 4Hulunbuir Mental Health Center, Hulunbuir, Inner Mongolia 022150, P.R. China Received November 26, 2017; Accepted July 3, 2018 DOI: 10.3892/ol.2018.9707 Abstract. Long non-coding RNAs (lncRNAs) have been of tumor cells and developing into the terminal stage of cancer. generally considered to serve important roles in various Nowadays, lack of efficient biomarkers for early diagnosis, types of cancer, including gastric cancer. However, a comprehensive treatment and cancer monitoring has been comprehensive understanding of lncRNAs in gastric cancer considered as one of the main obstacles for better prognosis requires further study. The present study performed an of gastric cancer (2). As a result, it is of great importance to in-depth study revealed 50 differently expressed lncRNAs. further explore the molecular mechanism during the occur- The changed cellular pathways and biological process in rence and development of gastric cancer, hoping to provide gastric cancer were determined. To further confirm the func- new strategy for diagnosis, prognosis and treatment (3). tions of the differently expressed lncRNAs, co-expression During the recent years, non-coding RNAs have been networks were constructed between the lncRNAs and generally concerned because of their diverse roles in the mRNA; this lead to the identification of 6 modules, which post-transcriptional regulation and they are considered to have participated in various cellular pathways.
    [Show full text]
  • Consequences of Exchanging Carbohydrates for Proteins in the Cholesterol Metabolism of Mice Fed a High-Fat Diet
    Consequences of Exchanging Carbohydrates for Proteins in the Cholesterol Metabolism of Mice Fed a High-fat Diet Fre´de´ ric Raymond1.¤a, Long Wang2., Mireille Moser1, Sylviane Metairon1¤a, Robert Mansourian1, Marie- Camille Zwahlen1, Martin Kussmann3,4,5, Andreas Fuerholz1, Katherine Mace´ 6, Chieh Jason Chou6*¤b 1 Bioanalytical Science Department, Nestle´ Research Center, Lausanne, Switzerland, 2 Department of Nutrition Science and Dietetics, Syracuse University, Syracuse, New York, United States of America, 3 Proteomics and Metabonomics Core, Nestle´ Institute of Health Sciences, Lausanne, Switzerland, 4 Faculty of Science, Aarhus University, Aarhus, Denmark, 5 Faculty of Life Sciences, Federal Institute of Technology, Lausanne, Switzerland, 6 Nutrition and Health Department, Nestle´ Research Center, Lausanne, Switzerland Abstract Consumption of low-carbohydrate, high-protein, high-fat diets lead to rapid weight loss but the cardioprotective effects of these diets have been questioned. We examined the impact of high-protein and high-fat diets on cholesterol metabolism by comparing the plasma cholesterol and the expression of cholesterol biosynthesis genes in the liver of mice fed a high-fat (HF) diet that has a high (H) or a low (L) protein-to-carbohydrate (P/C) ratio. H-P/C-HF feeding, compared with L-P/C-HF feeding, decreased plasma total cholesterol and increased HDL cholesterol concentrations at 4-wk. Interestingly, the expression of genes involved in hepatic steroid biosynthesis responded to an increased dietary P/C ratio by first down- regulation (2-d) followed by later up-regulation at 4-wk, and the temporal gene expression patterns were connected to the putative activity of SREBF1 and 2.
    [Show full text]
  • Endogenous Biomarkers of CYP3A Activity
    Endogenous Biomarkers of CYP3A Activity Tara C. Sherry A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science University of Washington 2013 Committee: Yvonne S. Lin Kenneth E. Thummel Edward Kelly Program authorized to Offer Degree: Pharmaceutics 1 ©Copyright 2013 Tara C. Sherry 2 University of Washington Abstract Endogenous Biomarkers of CYP3A Activity Tara C. Sherry Chair of the Supervisory Committee: Dr. Yvonne S. Lin Department of Pharmaceutics The activity of the drug-metabolizing enzyme cytochromes P450 3A (CYP3A) varies up to 20-fold between individuals. The interindividual variability may be due to both genetic variations and factors such as age, diet, concurrent use of multiple medications, disease, pregnancy, and environmental constituents. Phenotyping using endogenous CYP3A biomarkers would allow for direct individual assessments of CYP3A activity. Our goal was to explore the utility of endogenous biomarkers (metabolites of cortisol, cholesterol and vitamin D3) in predicting CYP3A activity as determined by oral midazolam clearance. We found moderate correlations between midazolam oral clearance and plasma 4ȕ-hydroxycholesterol/cholesterol, urinary 6ȕ-hydroxycortisol/cortisol ratios, and urinary 6ȕ-hydroxycortisone/cortisone ratios. We found a poor correlation between midazolam oral clearance and plasma 4ȕ,25-dihydroxyvitamin D3/25-hydroxyvitamin D3 ratios. Although these markers were sensitive to CYP3A induction, they were poorly predictive of the fold-change of midazolam oral clearance following rifampin treatment. A better endogenous marker for CYP3A activity is needed. 3 Acknowledgements ǡǤǡ ǤǤǯ ǡǤ Ǥ Ǥǡ ǡǡǤ ǡǦ ǡ ǡǡ ǡǡ ǡǡ ǡǡ Ǧ ǡ ǡ Ǥ Ǥ ǡǡǤ ǡ Ǥ Ǥ Ǥ ǡ Ǧ Ǥ ǡ ǡǡ Ǥ ǡǡ Ǥǡ ǡ ǡ Ǥ 4 Chapter 1 Introduction 5 1.1 Background and Importance of CYP3A Drug metabolizing enzymes are the major determinant of non-renal drug clearance in humans.
    [Show full text]
  • Genetic Variation in CYP3A43 Explains Racial Difference in Olanzapine Clearance
    Molecular Psychiatry (2011) 16, 620–625 & 2011 Macmillan Publishers Limited All rights reserved 1359-4184/11 www.nature.com/mp IMMEDIATE COMMUNICATION Genetic variation in CYP3A43 explains racial difference in olanzapine clearance KL Bigos1, RR Bies2, BG Pollock3,4, JJ Lowy1, F Zhang1 and DR Weinberger1,5 1Genes, Cognition, and Psychosis Program, National Institute of Mental Health, NIH, Bethesda, MD, USA; 2Division of Clinical Pharmacology, Department of Medicine, Indiana University School of Medicine, Indianapolis, IN, USA; 3Rotman Research Institute, University of Toronto, Toronto, ON, Canada; 4Centre for Addiction and Mental Health, University of Toronto, Toronto, ON, Canada and 5Clinical Brain Disorders Branch, National Institute of Mental Health, NIH, Bethesda, MD, USA The antipsychotic drug, olanzapine, one of the most widely used drugs in clinical medicine, has a high rate of discontinuation due to inefficacy and/or adverse effects. We identified a single nucleotide polymorphism in the drug metabolizing enzyme, cytochrome P450 3A43 (CYP3A43; rs472660), that highly significantly predicted olanzapine clearance in the Clinical Antipsychotic Trials of Intervention Effectiveness trial (P = 5.9eÀ7). Moreover, at standard antipsychotic doses, 50% of individuals with the high clearance genotype (AA) have trough blood levels below the therapeutic range. Interestingly, a much higher proportion of African Americans carry the A allele compared with Caucasians (allele frequency 67 vs 14%). After accounting for CYP3A43 genotype, race is no longer a significant predictor of olanzapine clearance. Olanzapine clearance was associated with measures of clinical response. Patients with greater clearance had higher symptom ratings and were more likely to discontinue treatment due to an inadequate response. Our data identify a genetic mechanism for variation in olanzapine response and demonstrate that blood level monitoring of olanzapine treatment is advisable.
    [Show full text]
  • Biodiversity of P-450 Monooxygenase: Cross-Talk
    Cytochrome P450: Oxygen activation and biodiversty 1 Biodiversity of P-450 monooxygenase: Cross-talk between chemistry and biology Heme Fe(II)-CO complex 450 nm, different from those of hemoglobin and other heme proteins 410-420 nm. Cytochrome Pigment of 450 nm Cytochrome P450 CYP3A4…. 2 High Energy: Ultraviolet (UV) Low Energy: Infrared (IR) Soret band 420 nm or g-band Mb Fe(II) ---------- Mb Fe(II) + CO - - - - - - - Visible region Visible bands Q bands a-band, b-band b a 3 H2O/OH- O2 CO Fe(III) Fe(II) Fe(II) Fe(II) Soret band at 420 nm His His His His metHb deoxy Hb Oxy Hb Carbon monoxy Hb metMb deoxy Mb Oxy Mb Carbon monoxy Mb H2O/Substrate O2-Substrate CO Substrate Soret band at 450 nm Fe(III) Fe(II) Fe(II) Fe(II) Cytochrome P450 Cys Cys Cys Cys Active form 4 Monooxygenase Reactions by Cytochromes P450 (CYP) + + RH + O2 + NADPH + H → ROH + H2O + NADP RH: Hydrophobic (lipophilic) compounds, organic compounds, insoluble in water ROH: Less hydrophobic and slightly soluble in water. Drug metabolism in liver ROH + GST → R-GS GST: glutathione S-transferase ROH + UGT → R-UG UGT: glucuronosyltransferaseGlucuronic acid Insoluble compounds are converted into highly hydrophilic (water soluble) compounds. 5 Drug metabolism at liver: Sleeping pill, pain killer (Narcotic), carcinogen etc. Synthesis of steroid hormones (steroidgenesis) at adrenal cortex, brain, kidney, intestine, lung, Animal (Mammalian, Fish, Bird, Insect), Plants, Fungi, Bacteria 6 NSAID: non-steroid anti-inflammatory drug 7 8 9 10 11 Cytochrome P450: Cysteine-S binding to Fe(II) heme is important for activation of O2.
    [Show full text]
  • Characterisation of Equine Cytochrome P450s Catherine Orr
    Characterisation of Equine Cytochrome P450s Catherine Orr, BSc, MRes Thesis submitted to the University of Nottingham for the degree of Doctor of Philosophy October 2015 Abstract Cytochrome P450s (CYPs) are a superfamily of enzymes involved in the phase I metabolism of endogenous and exogenous substances. They are present in almost all forms of life and have been studied extensively, particularly in relation to human medicine, where knowledge of their activities is essential for predicting drug-drug interactions. In the horse, little is currently known about CYP-specific drug metabolism, which holds importance for animal welfare and for doping control within the horseracing industry where drug-specific metabolites are tested for on race days. Recently the first recombinant equine CYPs have been produced, allowing specific data on equine P450 activity to be gathered for the first time. During the current study,46 full-length P450 sequences were identified from the equine genome. RT- PCR analysis was then carried out on equine liver in order to detect hepatic expression of P450s across various families. After this, cold-induction (pCold) E. coli were used for production of recombinant P450 proteins for subsquent functional testing. Four recombinant equine P450s were successfully expressed (CYP1A1, CYP2A13, CYP2C92 and CYP2D50). Due to being the isoforms most likely to be involved in drug metabolism, rCYP2D50 and rCYP2C92 were selected to be screened against ten of the most commonly used horse drugs to identify potential substrates. rCYP2C92 appeared to metabolise all four NSAIDs tested (flunixin, ketoprofen, phenylbutazone and diclofenac), however presence of the known hydroxylated metabolites of diclofenac and phenylbutazone (4-hydroxydiclofenac and oxyphenbutazone, respectively) could not be confirmed despite being present within equine liver microsome and human recombinant CYP2C9 samples.
    [Show full text]