CYP3A43 Pro Ala Polymorphism and Prostate Cancer Risk in African Americans and Caucasians

CYP3A43 Pro Ala Polymorphism and Prostate Cancer Risk in African Americans and Caucasians

Cancer Epidemiology, Biomarkers & Prevention 1257 CYP3A43 Pro340Ala Polymorphism and Prostate Cancer Risk in African Americans and Caucasians Angie Stone,1 Luke D. Ratnasinghe,1,3,4 Ginny L. Emerson,1 Rama Modali,6 Terri Lehman,6 Gail Runnells,3 Alindria Carroll,3 Weleetka Carter,3 Samuel Barnhart,3 Al A. Rasheed,3 Graham Greene,3 Don E. Johnson,2 Christine B. Ambrosone,5 Fred F. Kadlubar,1 and Nicholas P. Lang 2,3,4 1Division of Molecular Epidemiology, National Center for Toxicological Research, Jefferson, Arkansas; 2 Central Arkansas Veteran’s Health Care System; 3Arkansas Cancer Research Center; and 4Department of Surgery, College of Medicine, University of Arkansas for Medical Sciences, Little Rock, Arkansas; 5Department of Epidemiology, Roswell Park Cancer Institute, Buffalo, New York; and 6BioServe Biotechnologies, Inc., Laurel, Maryland Abstract The human cytochrome P450 3A subfamily of enzymes is Ala genotype (odds ratio, 3.0; 95% confidence interval, 1.2- involved in the metabolism of steroid hormones, carcino- 7.2) compared with those with the CYP3A43-Pro/Pro gens, and many drugs. A cytosine-to-guanine polymor- genotype after adjusting for age, race, and smoking. The phism in CYP3A43 results in a proline-to-alanine prevalence of the polymorphism was significantly higher in substitution at codon 340. Although the functional signif- African Americans than Caucasians (45% versus 13%). In icance of this polymorphism is unknown, we postulate that African Americans, there was a 2.6-fold increase in prostate the substitution of proline, an A-imino acid, with alanine, cancer risk among individuals with the CYP3A43-Ala/Ala an amino acid, could be of biochemical significance. In a genotype (odds ratio, 2.6; 95% confidence interval, 1.0-7.0) case-control study with 490 incident prostate cancer cases compared with those with the CYP3A43-Pro/Pro genotype. (124 African Americans and 358 Caucasians) and 494 Among Caucasians, the small number of homozygotes controls (167 African Americans and 319 Caucasians), we precluded computing risk estimates; there were only three examined the association between CYP3A43 Pro340Ala individuals with the CYP3A43-Ala/Ala genotype. Our polymorphism and prostate cancer risk. When all subjects results suggest that the CYP3A43-Pro340Ala polymorphism were considered, there was a 3-fold increase in risk of contributes to prostate cancer risk. (Cancer Epidemiol prostate cancer among individuals with the CYP3A43-Ala/ Biomarkers Prev 2005;14(5):1257–61) Introduction In the United States, prostate cancer is the most common form cortisol) and xenobiotics (12). The CYP3A family is composed of cancer and is the second leading cause of cancer-related of four known CYP3A genes in humans: CYP3A4, CYP3A5, death among men (1). African American men have the world’s CYP3A7, and CYP3A43. Each gene contains 13 exons and is highest incidence of prostate cancer and more than twice the located on chromosome 7q21-22.1, with CYP3A43 in an death rate compared with Caucasian men; they also have unusual head-to-head orientation with CYP3A4, CYP3A5, significantly higher rate of disease severity at diagnosis (2-7). and CYP3A7 (13, 14).CYP3A43shares DNA sequence Epidemiologic evidence indicates that steroid hormones play a homologies of 84%, 83%, and 82% and amino acid homologies major role in prostate carcinogenesis and may partially explain of 76%, 76%, and 72% with CYP3A4, CYP3A5, and CYP3A7, the risk disparity between African Americans and Caucasians. respectively (13, 15). Previous population-based studies have addressed the hy- Distribution of CYP3A43 mRNA in various tissues (liver, pothesis that functional polymorphisms in genes involved in kidney, pancreas, prostate, etc.) by PCR amplification has testosterone metabolism might be associated with the differ- shown that the expression level of CYP3A43 is considerably ences in prostate cancer risk among various ethnic popula- lower than CYP3A4, CYP3A5, and CYP3A7, although the level tions; however, results have been inconsistent and of expression of CYP3A43 does not necessarily reflect the extent contradictory (8-11). of its actual role in xenobiotic metabolism (15). Westlind et al. Members of the cytochrome P450 (CYP) family of enzymes, found that CYP3A43 and CYP3A4 mRNA are expressed in which are responsible for >50% of drug metabolism, are prostate, colon, breast, lung, and pancreatic carcinoma; there is heme-containing mono-oxygenases that catalyze hydroxyl- also some evidence of hepatic coexpression of all four mRNAs ation of steroids (including testosterone, progesterone, and (12). Three different transcript variants are formed from alternate splicing of this gene. Interestingly, there are several hybrid CYP3A43/CYP3A4 and CYP3A43/CYP3A5 genes that have been formed by splicing CYP3A43 exon 1 to various Received 7/19/04; revised 11/4/04; accepted 12/2/04. CYP3A4 or CYP3A5 exons, resulting in hybrid mRNA products Grant support: Arkansas Bioscience Institute, National Cancer Institute grant R01CA55751, (13). The chimeric proteins formed from these transgenic National Institute on Aging grant R01AG15722-02, NIH GCRC grant M01RR14288, and National Center for Toxicological Research-Food and Drug Administration protocol E0702101. splicing variants are not always enzymatically active; how- G.L. Emerson was supported as a postdoctoral research associate through the Oak Ridge ever, the longest chimeric isoform, encoded by the (1)CYP3A43- Institute for Science and Education. (2-13) cDNA, can hydroxylate testosterone (13). The costs of publication of this article were defrayed in part by the payment of page charges. CYP3A4 This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Xenobiotics and endogenous substances, such as steroid Section 1734 solely to indicate this fact. hormones, can activate the pregnane X receptor, a human Requests for reprints: Angie Stone, Central Arkansas Veteran’s Health Care System, Research orphan nuclear receptor, resulting in the induction of CYP3A Service Slot 151, 4301 West 7th Street, Little Rock, AR 72205. Phone: 501-257-4850; Fax: 501-257- 4822. E-mail: [email protected] genes. Two drugs known to induce CYP3A activity in primary Copyright D 2005 American Association for Cancer Research. hepatocytes are rifampicin and dexamethasone; however, the Cancer Epidemiol Biomarkers Prev 2005;14(5). May 2005 Downloaded from cebp.aacrjournals.org on October 2, 2021. © 2005 American Association for Cancer Research. 1258 CYP3A43 and Prostate Cancer four CYP3A isoforms differed in expression levels when other and serum creatinine >1.8 mg/dL). Covariate data for the drugs were used, indicating that the four isoforms are current study were obtained by conducting in-person inter- differentially regulated (14-16). In addition, there is very little views with cases and controls at the time of enrollment to the sequence similarity among the 5Vuntranslated regions of case-control study. Each study participant also provided a CYP3A43 and CYP3A4, CYP3A5, and CYP3A7 genes; regula- blood sample for DNA analyses. The appropriate institutional tory elements in the 5V region of CYP3A43 have not been review board approvals were obtained for the study protocol. found, although CYP3A4 has several known regulatory Signed informed consent was obtained for the interview, blood regions and binding sites in the 5Vuntranslated region (17). collection, and analyses of polymorphisms. Several studies have addressed the hypothesis that func- Genotyping. DNA was extracted from lymphocytes of study tional polymorphisms in the CYP3A4 and CYP3A5 genes participants using a commercial kit (Qiagen, Inc., Valencia, CA) could be associated with prostate cancer risk among different and the samples were genotyped for the CYP3A43*3 polymor- ethnic populations. Rebbeck et al. found that an A-to-G phism at a commercial laboratory (BioServe Biotechnologies mutation within the nifedipine-specific element, À293 bp from Ltd., Laurel, MD) by high-throughput, chip-based matrix- the transcription start site of the CYP3A4 gene, was associated assisted laser desorption time-of-flight mass spectrometry with higher grade and stage in Caucasians with prostate (Sequenom, Inc., San Diego, CA) using the MassEXTEND cancer (18). Additional studies found evidence that African reaction (Sequenom). PCR primers and extension primers were Americans possess the CYP3A4*1B (variant allele) at 6 to 10 designed using SpectroDESIGNER software (Sequenom) and times the frequency found in Caucasians; limited data support synthesized at BioServe Biotechnologies. Oligonucleotide the hypothesis that the variant allele alters testosterone sequences of the primers and probe were forward primer metabolism (19-21). The CYP3A5 6986 G > A (CYP3A5*3) ACGTTGGATGCATTCTTGCTGAGGC, reverse primer variant correlates with function of the CYP3A5 enzyme and is ACGTTGGATGCCTGATGTCCAGCAGAAAC, and extension in linkage disequilibrium with the CYP3A4 promoter variant primer TCATCCCCTTACCTTATTGG. and possibly other alleles (22). Plummer et al. found that the All laboratory personnel were blinded to case-control status. CYP3A4*1B/CYP3A5*3 haplotype (which is more common in Forty-four blinded duplicates were included in the genotype African Americans than Caucasians) is positively associated analyses and were 100% concordant. with prostate cancer, but the CYP3A4*1B variant is inversely associated with risk among Caucasians with less aggressive Statistical Analysis. The Wilcoxon rank-sum test was used disease (23).

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    6 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us