Are Infectious (Infectious Bursal Disease Virus/Double-Stranded RNA Virus/Infectious RNA/Reverse Genetics) EGBERT MUNDT*T and VIKRAM N

Proc. Natl. Acad. Sci. USA Vol. 93, pp. 11131-11136, October 1996 Microbiology

Synthetic transcripts of double-stranded Birnavirus genome are infectious (infectious bursal disease virus/double-stranded RNA virus/infectious RNA/reverse genetics) EGBERT MUNDT*t AND VIKRAM N. VAKHARIAt§ *Federal Research Center for Virus Disease of Animals, Friedrich-Loeffler-Institutes, Institute of Molecular and Cellular Virology, D-17498 Insel Riems, Germany; and tCenter for Agricultural Biotechnology, University of Maryland Biotechnology Institute and Virginia-Maryland Regional College of Veterinary Medicine, University of Maryland, College Park, MD 20742 Communicated by Edwin D. Kilbourne, New York Medical College, Valhalla, NY July 24, 1996 (received for review February 29, 1996)

ABSTRACT We have developed a system for generation of nucleotides. The 3'-noncoding terminal sequences of both infectious bursal disease virus (IBDV), a segmented double- segments are unrelated, but they are conserved among IBDV stranded RNA virus of the Birnaviridae family, with the use of strains of the same serotype (2). These terminii may contain synthetic transcripts derived from cloned cDNA. Independent sequences important in packaging and in the regulation of full-length cDNA clones were constructed that contained the IBDV gene expression, as demonstrated for other dsRNA- entire coding and noncoding regions of RNA segments A and containing viruses such as mamamlian and plant reoviruses B of two distinguishable IBDV strains of serotype I. Segment and rotaviruses (8-10). A encodes all of the structural (VP2, VP4, and VP3) and In recent years, a number of infectious animal RNA viruses nonstructural (VP5) proteins, whereas segment B encodes the have been generated from cloned cDNA using transcripts RNA-dependent RNA polymerase (VP1). Synthetic RNAs of produced by DNA-dependent RNA polymerase (11). For both segments were produced by in vitro transcription of example, poliovirus (a plus-stranded RNA virus), influenza linearized plasmids with T7 RNA polymerase. Transfection of virus (a segmented negative-stranded RNA virus), and rabies Vero cells with combined plus-sense transcripts of both virus (a nonsegmented negative-stranded RNA virus) all were segments generated infectious virus as early as 36 hr after recovered from cloned cDNAs of their respective genomes transfection. The infectivity and specificity of the recovered (12-14). For reovirus, it was shown that transfection of cells chimeric virus was ascertained by the appearance of cyto- with a combination of single-stranded (ss)RNA, dsRNA, and pathic effect in chicken embryo cells, by immunofluorescence in vitro translated reovirus products generated infectious re- staining of infected Vero cells with rabbit anti-IBDV serum, ovirus when complemented with a helper virus of a different and by nucleotide sequence analysis of the recovered virus, respectively. In addition, transfectant viruses containing ge- serotype (15). However, to date, there is no report of a netically tagged sequences in either segment A or segment B recovered infectious virus with a segmented dsRNA genome of IBDV were generated to confirm the feasibility of this derived from synthetic RNAs only. system. The development of a reverse genetics system for In an effort to develop a reverse genetics system for IBDV, double-stranded RNA viruses will greatly facilitate studies of we constructed two independent full-length cDNA clones that the regulation of viral gene expression, pathogenesis, and contain segment A of serotype I strain D78 and segment B of design of a new generation of live vaccines. strain P2, respectively. Furthermore, these cDNA clones were modified by oligonucleotide-directed mutagenesis to generate Infectious bursal disease virus (IBDV), a member of the the tagged sequences in each segment. Synthetic RNAs of Birnaviridae family, is the causative agent of a highly immu- segments A and B were produced by in vitro transcription nosuppressive disease in young chickens (1). Two distinct reactions on linearized plasmids with T7 RNA polymerase. serotypes of IBDV, designated as serotype I and serotype II, Transcripts of these segments, either untreated or treated with have been identified. The IBDV genome consists of two DNase or RNase, were evaluated for the generation of infec- segments of double-stranded (ds)RNA that vary from 2827 tious virus by transfecting Vero cells. (segment B) to 3261 (segment A) nucleotide base pairs (2). The larger segment A encodes a polyprotein that is cleaved by MATERIALS AND METHODS autoproteolysis to form mature viral proteins VP2, VP3, and VP4 (3). VP2 and VP3 are the major structural proteins of the Viruses and Cells. Two serotype I strains of IBDV, the virion. VP2 is the major host-protective immunogen of IBDV attenuated P2 strain from Germany and the vaccine strain D78 and contains the antigenic regions responsible for the induc- (Intervet, Millsboro, DE), were propagated in chicken embryo tion of neutralizing antibodies (4). A second open reading cells (CEC) and purified as described (2, 16). Vero cells were frame (ORF), preceding and partially overlapping the polypro- grown in M199 medium supplemented with 5% fetal calf tein gene, encodes a protein (VP5) of unknown function that serum and used for transfection experiments. Further propa- is present in IBDV-infected cells (5). The smaller segment B gation of the recovered virus and immunofluorescence studies encodes VP1, a 90-kDa multifunctional protein with polymer- were carried out in Vero cells as described (5). For plaque ase and capping enzyme activities (6, 7). assay, monolayers of secondary CEC were prepared and used Although the nucleotide sequences for genome segments A as described (17). and B ofvarious IBDV strains have been published, it was only recently that the complete 5'- and 3'-noncoding sequences of Abbreviations: ds, double stranded; ss, single stranded; CEC, chicken both segments were determined. The 5'-noncoding region of embryo cells; CPE, cytopathic effect; RT, reverse transcription; IBDV, IBDV segments A and B contains a consensus sequence of 32 infectious bursal disease virus. tVisiting scientist at: University of Maryland, College Park, MD 20742. The publication costs of this article were defrayed in part by page charge §To whom reprint requests should be addressed at: Center for payment. This article must therefore be hereby marked "advertisement" in Agricultural Biotechnology, College of Veterinary Medicine, Uni- accordance with 18 U.S.C. §1734 solely to indicate this fact. versity of Maryland, College Park, MD 20742.

11131 Downloaded by guest on September 23, 2021 11132 Microbiology: Mundt and Vakharia Proc. Natl. Acad. Sci. USA 93 (1996) Construction of Full-Length cDNA Clones of IBDV Ge- respective cDNA templates. To construct plasmid nome. Full-length cDNA clones of IBDV segments A and B pUC19FLAD78mut, three primer pairs [RsrIIF, NheA(-); were independently prepared. The cDNA clones containing NheA(+), SpeA(-); and SpeA(+), SaclIR; see Table 1] were the entire coding region of RNA segment A of strain D78 were used to amplify the DNA fragments of 428, 655, and 623 bp, prepared using standard cloning procedures and methods as respectively. These fragments were combined and subse- described (16). By comparing the D78 terminal sequences with quently reamplified by PCR using the flanking primers (RsrIIF recently published terminal sequences of other IBDV strains and SacIIR) to produce a 17Q6-bp fragment. This fragment was (2), it was observed that D78 cDNA clones lacked the con- cloned into a pCRII vector to obtain plasmid pCRNhe-Spe. served first 17 nucleotides at the 5' end and the last 10 nucleotides This plasmid was digested with RsrII and Sacll enzymes, and at the 3' ends. Therefore, to construct a full-length cDNA clone the resulting 1557-bp fragment was subcloned into unique of segment A, two primer pairs (A5'-D78, A5-IPD78, and RsrII and SacII sites of plasmid pUC19FLAD78. Finally, a A3'D78, A3-4PD78) were synthesized and used for PCR ampli- mutant plasmid of segment A was obtained, which contains the fication (Table 1). The DNA segments were amplified according unique NheI and SpeI restriction sites (nucleotide positions 545 to the protocol of the supplier (New England Biolabs) using and 1180, respectively). Similarly, plasmid pUC18FLBP2 was DeepVent polymerase. Amplified fragments were cloned into the modified by PCR using an oligonucleotide primer containing EcoRI site of a pCRII vector (Invitrogen) to obtain plasmids three silent mutations. After amplification, the resulting frag- pCRD78A5' and pCRD78A3'. Each plasmid was digested with ment was digested with KpnI and BglII and cloned into EcoRI and SalI, and the resultant fragments were ligated into KpnI-BglII-cleaved pUC18FLBP2. A mutant plasmid of seg- EcoRI digested-pUC19, to obtain plasmid pUC19FLAD78. This ment B (pUC18FLBP2mut) was obtained, which contains the plasmid contains a full-length cDNA copy of segment A, which sequence tag (mutations at nucleotide positions 1770, 1773, encodes all of the structural proteins (VP2, VP4, and VP3), as and 1776). well as the nonstructural protein VP5 (Fig. 1). Transcription and Transfection of Synthetic RNAs. Plas- To obtain cDNA clones of segment B of P2 strain, two mids pUC19FLAD78, pUC18FLBP2, and their mutant cDNA primer pairs (B5'-P2, B5-IPP2, and B3'-P2, B3-IPP2) were clones were digested with BsrGI and PstI enzymes (Fig. 1), designed according to published sequences and used for respectively, and used as templates for in vitro transcription reverse transcription (RT)-PCR amplification (see Table 1). with T7 RNA polymerase (Promega). Briefly, restriction en- Using genomic dsRNA as template, cDNA fragments were zyme cleavage assays were adjusted to 0.5% SDS and incu- synthesized and amplified according to the supplier's protocol bated with proteinase K (0.5 mg/ml) for 1 hr at 37°C. The (Perkin-Elmer). Amplified fragments were blunt-end ligated linearized DNA templates (-3 ,tg) were recovered after into SmaI-cleaved pBS vector (Stratagene) to obtain clones ethanol precipitation, and were added separately to a tran- pBSP2B5' and pBSP2B3'. To construct a full-length clone of scription reaction mixture (50 ,l) containing 40 mM Tris HCl segment B, the 5'-end fragment of plasmid pBSP2B5' was first (pH 7.9), 10 mM NaCl, 6 mM MgCl2, 2 mM spermidine, 0.5 subcloned between EcoRI and PstI sites of the pUC18 vector mM ATP, 0.5 mM CTP, 0.5 mM UTP, 0.1 mM GTP, 0.25 mM to obtain pUCP2B5'. Then the 3'-end fragment of plasmid cap analog [m7G(5')ppp(5')G], 120 units RNasin, 150 units T7 pBSP2B3' was inserted between the unique BglII and PstI sites RNA polymerase (Promega), and incubated at 37°C for 1 hr. of plasmid pUCP2B5' to obtain a full-length plasmid Synthetic RNA transcripts were purified by phenol/ pUC18FLBP2, which encodes VP1 protein (Fig. 1). Plasmids chloroform extraction and ethanol precipitation. As controls, pUC18FLBP2 and pUC19FLAD78 were completely se- the transcription products were treated with either DNase or quenced by using the sequenase DNA sequencing system RNase (Promega) before the purification step. (United States Biochemical), and the sequence data was Vero cells were grown to 80% confluency in 60-mm dishes analyzed using either DNASIS (Pharmacia) or PC/GENE (Intel- and washed once with phosphate-buffered saline (PBS). Three liGenetics) software. The integrity of the full-length constructs milliliters of OPTI-MEM I (GIBCO/BRL) were added to the were tested by in vitro transcription and the translation- monolayers, and the cells were incubated at 37°C for 1 hr in a coupled reticulocyte lysate system using T7 RNA polymerase CO2 incubator. Simultaneously, 0.15 ml of OPTI-MEM I was (Promega). incubated with 12.5 jig of Lipofectin reagent (GIBCO/BRL) To introduce the sequence tags into segments A and B of for 45 min in a polystyrene tube at room temperature. Syn- IBDV, plasmids pUC19FLAD78mut and pUC18FLBP2mut thetic RNA transcripts of both segments resuspended in 0.15 were constructed by oligonucleotide-directed mutagenesis, ml of diethyl pyrocarbonate-treated water, were added to the using specific primer pairs and PCR amplification of their OPTI-MEM/Lipofectin mixture, mixed gently, and incubated Table 1. Oligonucleotides used for the construction of full-length cDNA clones of IBDV genomic segments A and B Nucleotide Nucleotide sequence Orientation Name no. TAATACGACTCACTATAGGATACGATCGGTCTGACCCCGGGGGAGTCA + A5'-D78 1-31 TGTACAGGGGACCCGCGAACGGATCCAATT - A3'-D78 3237-3261 CGTCGACTACGGGATTCTGG - A5-IPD78 1711-1730 AGTCGACGGGATTCTTGCTT + A3-IPD78 1723-1742 ATGACAAACCTGCAAGAT + RsrIIF 131-148 CTGACAGATGCTAGCTACAATGGG - + NheA(+) 536-559 GTCCCGTCACACTAGTGGCCTA + SpeA(+) 1170-1191 CCTCTCTTAACACGCAGTCG - SacIIR 1774-1793 AGAGAATTCTAATACGACTCACTATAGGATACGATGGGTCTGAC + B5'-P2 1-18 CGATCTGCTGCAGGGGGCCCCCGCAGGCGAAGG - B3'-P2 2807-2827 CTTGAGACTCTTGTTCTCTACTCC - B5-IPP2 1915-1938 ATACAGCAAAGATCTCGGG + B3-IPP2 1839-1857 Composition and location of the oligonucleotide primers used for cloning. T7 promoter sequences are marked with italic type, the virus specific sequences are underlined, and the restriction sites marked in boldface type. Orientation of the virus-specific sequence of the primer is shown for sense (+) and antisense (-). The positions where the primers bind (nucleotide number) are according to the published sequences of P2 strain (2). Downloaded by guest on September 23, 2021 Microbiology: Mundt and Vakharia Proc. Natl. Acad. Sci. USA 93 (1996) 11133

GAATTCGGCTTTAATACGACTCACTATAGGATACGATCGGTCTGAC P GTAGACAGGGTG-CC CTTAAGCCGAAATTATGCTGAGTGATATCCTATGCTAGCCAGACTG TTAACCTAGGCAAGCGCCCAGGGGACAGT-TP2ACCTAGGCAGCGGTCCCC TTTCGGCTTAAG EcoRI EcoRI Transcription BarGIT _ O

TTGCATGCCTGCA GGGGGCCCCCGCAGGCGAAG LTCGTATCCTATAGTGAGTCGTATTAGAATTC AACGTACGG ACGTCCCCCGGGGGCGTCCGCTTC I I AGCATAGGATATCACTCAGCATAATCTTA&G

Pst 1 Transcription EcoRI

FIG. 1. Schematic diagram of cDNA constructs used for synthesis of plus-sense ssRNAs of IBDV with T7 RNA polymerase. Construct pUC19FLAD78 contains the full-length cDNA of segment A of IBDV strain D78. Segment A of IBDV encodes the polyprotein (VP2-VP4-VP3) and the recently identified VP5 protein. Plasmid pUC18FLBP2 contains the cDNA of segment B of strain P2, which encodes the RNA-dependent RNA polymerase (VP1). Virus specific sequences are underlined and the T7 promoter sequences are italicized. Restriction sites are shown in boldface type and identified. The cleavage sites of the linearized plasmids are shown by vertical arrows and the transcription directions are marked by horizontal arrows.

on ice for 5 min. After removing the OPTI-MEM from the tomycin, 0.25 ,tg/ml fungizone, 0.005% neutral red, and monolayers in the 60-mm dishes and replacing it with a fresh 0.0015% phenol red. The cells were incubated at 37°C for 2-3 1.5 ml of OPTI-MEM, the nucleic acid-containing mixture was days until plaques could be observed and counted (17). added drop-wise to the Vero cells and swirled gently. After 2 hr of incubation at 37°C, the mixture was replaced with M199 RESULTS medium containing 5% FCS (without rinsing the cells), and the cells were further incubated at 37°C for desired time intervals. Construction of Full-Length cDNA Clones of IBDV Ge- Identification of Generated IBDV. CEC were infected with nome. To develop a reverse genetics system for the dsRNA the supernatant from Vero cells transfected with transcripts of virus IBDV, two independent cDNA clones were constructed either pUC18FLAD78, pUC18FLBP2, and/or their mutant that contain segment A of strain D78 and segment B of strain plasmids. About 16 hr after infection, the whole cell nucleic P2 (Fig. 1). Each plasmid encoded either the precursor of acids were isolated as described (2). Specific primers of structural proteins (VP2, VP4, VP3) and VP5 or only VP1 segments A and B were used for RT of genomic RNA derived protein (RNA-dependent RNA polymerase). Plasmid from these transfectant viruses. Following RT, the reaction pUC18FLBP2, upon digestion with PstI and transcription in products were amplified by PCR using specific primer pairs of vitro by T7 RNA polymerase, would yield RNA containing the segments A and B. Resulting PCR fragments were either correct 5' and 3' ends. Similarly, upon digestion with BsrGI cloned and sequenced as described before, or digested with and transcription, plasmid pUC19FLAD78 would yield RNA appropriate restriction enzymes to identify the tagged sequences. containing the correct 5' end, but with an additional four Immunofluorescence. Vero cells, grown on coverslips to nucleotides at the 3' end. Coupled transcription and transla- 80% confluency, were infected with the supernatants derived tion of the above plasmids in a rabbit reticulocyte system from transfected Vero cells (after freeze thawing) and incu- yielded protein products that were correctly processed. These bated at 37°C for 2 days. The cells were then washed, fixed with products comigrated with the marker IBDV proteins after acetone, and treated with polyclonal rabbit anti-IBDV serum. fractionation on SDS/polyacrylamide gel and autoradiogra- After washing, the cells were treated with fluorescein labeled phy (data not shown). goat anti-rabbit antibody (Kirkegaard & Perry Laboratories) Transcription, Transfection, and Generation of a Chimeric and examined by fluorescence microscopy. Infectious Virus. Plus-sense transcripts of serotype I IBDV Plaque Assay. Monolayers of secondary CEC, grown in segments A and B were synthesized separately in vitro with T7 60-mm dishes, were inoculated with the supernatants derived RNA polymerase, using linearized full-length cDNA plasmids from transfected Vero cells. One hour after infection, the cells as templates (Fig. 2). Although two species of RNA transcripts were washed once with PBS, and overlaid with 0.8% noble were observed for segment B on a neutral gel (lanes 1 and 5), Agar (Difco) containing 10% tryptose phosphate broth, 2% fractionation of these samples on a denaturing gel yielded only FCS, 0.112% NaHCO3, 103 units penicillin, 103 ,tg/ml strep- one transcript-specific band (data not shown). To show that Downloaded by guest on September 23, 2021 11134 Microbiology: Mundt and Vakharia Proc. Natl. Acad. Sci. USA 93 (1996) Table 2. Generation of infectious IBDV from synthetic RNAs of 1 2 3 4 5 6 M kbp segments A and B Material transfected CPE Immunofluorescence ssRNA A + B, DNase treated + + ssRNA A + B, RNase treated - - ssRNA A + B, untreated + + ssRNA A, untreated ssRNA B, untreated Lipofectin only 21.0 Vero cells were transfected with synthetic RNAs of segments A and B, derived from transcription reactions, that were either untreated or treated with DNase or RNase. After 5 days, the supernatants were collected, clarified by centrifugation, and analyzed for the presence of 1.6 virus. The infectivity of the recovered virus was detected in CEC by the appearance of CPE 1-2 days after inoculation. The specificity of the recovered virus was determined by immunofluorescence staining of infected Vero cells with rabbit anti-IBDV serum. 0.83 transfected with combined RNA transcripts of segments A and 0.56 B. At 4, 8, 16, 24, 36, and 48 hr after transfection, the supernatants were examined for the presence of transfectant virus by infectivity and plaque assays, as shown in Table 3. Our results indicate that the virus could be recovered as early as 36 hr after transfection. Virus titer was 2.3 x 102 plaque-forming units/ml, and appeared to drop in samples obtained later than 48 hr after transfection. However, after a second passage in CEC, the rescued chimeric virus grew to titers comparable to FIG. 2. Analysis of the transcription reaction products that were those of "natural" serotype I IBDVs. used for transfection of Vero cells. Synthetic RNAs transcribed in vitro using T7 RNA polymerase and linearized plasmids pUC19FLAD78 Identification of Sequence Tags. To demonstrate the utility containing the cDNA of segment A of IBDV strain D78 (lanes 2,4, and of the reverse genetics system, two recombinant IBDVs were 6) and pUC18FLBP2 containing the cDNA of segment B of strain P2 generated, which contain sequence tags in segments A and B, (lanes 1, 3, and 5), respectively. After transcription, the reaction respectively. In plasmid pUC19FLAD78mut, the IBDV nucle- mixtures were either treated with DNase (lanes 1 and 2), RNase (lanes otide sequence was altered by oligonucleotide-directed mu- 3 and 4), or left untreated (lanes 5 and 6). The reaction products (2 LIi) tagenesis to create unique NheI and SpeI restriction sites in the were analyzed on 1% agarose gel. A DNA, digested with Hindllll VP2 gene. Synthetic transcripts of this modified segment A of EcoRI, was used as a marker (lane M). strain D78 and segment B of strain P2 were then used to in RNA of both are needed for transfect Vero cells. To verify that these sites were present plus-sense transcripts segments was from the the generation of infectious virus, the transcription mixtures the recovered virus, the genomic RNA purified

were with different as shown in 2. virions and analyzed after RT-PCR or PCR amplifications incubated nucleases, Fig. The of the Synthetic RNAs recovered after treatment of the transcription using segment A specific primers. presence genetic tag in the transfectant virus was confirmed by digestion of the products with DNase (lanes 1 + 2), RNase (lanes 3 + 4), or

without treatment 5 + were used for the transfection PCR products with the appropriate restriction enzymes, as (lanes 6) from mock-infected Vero cells and of Vero cells. As mock control, alone was used. Five shown in Fig. 3. Sequences Lipofectin and without the genetic tag in days after transfection, cytopathic effect (CPE) was only transfectant viruses (with visible in Vero cells transfected with combined transcripts of segment A) were reverse transcribed and amplified in parallel.

untreated or DNase-treated but not An 1184-bp fragment was obtained from both transfectant transcription products, No with RNase-treated transcription mixtures or mock- viruses (lanes 5 and 6) but not from Vero cells (lane 4).

transfected control. No CPE was detected when Vero cells product was obtained when reverse transcriptase was omitted that the were transfected with RNA of only segment A or segment B from the reactions before PCR (lanes 1-3), indicating (data not shown). These results show that replication of IBDV PCR product was derived from RNA, not from contaminating ensued after transfection of Vero cells with plus-sense ssRNAs DNA. After digestion with NheI and Spel, expected fragments of both segments of IBDV. To verify that the agent causing the of 769 bp and 415 bp (lane 8), and 1049 bp (lane 10; 135 bp not

was cells CPE in Vero cells indeed IBDV, transfected Vero Table 3. Recovery of virus at various times after transfection were freeze-thawed, and cell-free supernatants were used to infect CEC or Vero cells. CEC infected with the supernatants Time in hours derived from Vero transfected cells of untreated or DNase- after transfection CPE Immunofluorescence pfu/ml treated mixtures CPE in 1 after transcription produced day 4 - - 0 inoculation (Table 2). However, no CPE could be detected in 8 - - 0 CEC with the supernatants from either transfected Vero cells 16 - - 0 of RNase-treated transcription mixtures, untreated segments 24 - - 0 A or B transcription mixtures, or mock-transfected Vero cells, 36 + + 2.3 x 102 even 5 days after infection. Similarly, when Vero cells on 48 + + 6.0 x 101 coverslips were infected with the same supernatants as de- Vero cells were transfected with synthetic RNAs of segments A and scribed above and examined by immunofluorescence staining B as described. The infectivity and specificity of the recovered virus after 2 days, only supernatants derived from transfected Vero was detected by CPE in CEC and immunofluorescence staining in cells of untreated or DNase-treated transcription mixtures Vero cells, respectively. Monolayers of secondary CEC were used for gave a positive immunofluorescence signal (Table 2). plaque assay after inoculating the cells with the supernatants derived Recovery of Transfectant Virus. To determine the time from transfected Vero cells. Approximate titer of the virus was point for the recovery of infectious virus, Vero cells were calculated as plaque forming units per ml (pfu/ml). Downloaded by guest on September 23, 2021 Microbiology: Mundt and Vakharia Proc. Natl. Acad. Sci. USA 93 (1996) 11135 -RT +Rr BP2 BP2mut II .., ,.. ^_. '' Nhel Spel9 , W ......

9 10 Xl ,j,¢ ._ . . i ... . £ NI 1 2 3 4 5 6 7 8 .. ,¢, .. , kbp ...... - ...... _:Ft. .. * : 21.0 ..... jiS.' :: ._w.. _ ...... _S. XS .. ,....;,.... * $i-ii-- ...,,,, ...... jtt4Stit ...... BM 5.0 _. _ii P.t j i ._ vi_t ...... ::!.::-

i tid:J$. .. ,pj.}. .i...$. *. WF. ....it # *...... _St 2.0 ." _: ...... *: :. ::.::.: :_. 1.6 tii,,:::.>}8!E ...... <,. t.4b: ... < 1.3 ., t. .:-:': t .. ::: :io!w. *,.,. Xbt: Ct:: 0.98 :=...... it,p,,jUni. 0.83 .L

...... la, wr *t, t' 0.56 :_w.

S.g _: _ A* C G T A ...... Cz .. ::'' G T FIG. 3. Analysis of the RT-PCR products for identification of the FIG. 4. Autoradiogram showing the nucleotide sequences of sequence tags in segment A of the transfectant viruses. Genomic RNA cloned RT-PCR fragments from segment B of the unmodifed (BP2) isolated from transfectant viruses was amplified by RT-PCR using and modified (BP2mut) transfectant viruses.vX'.' fi::Ct;:Silent .jj#mutations at segment A-specific primers 5'-ATGACAAACCTGCAAGAT-3' (nu- nucleotide positions 1770 (G -* C), 1773 (T -> C), and 1776 (G -> C) cleotide positions 131-148) and 5'-CATGGCTCCTGGGT- are indicated by arrows. CAAATCG-3' (nucleotide positions 1295-1315); the products were analyzed on 1% agarose. An 1184-bp fragment was obtained from both DNA, corresponding to the entire genome of a segmented samples containing transfectant viruses (lanes 5 and 6), but not from dsRNA animal virus, can give rise to a replicating virus. The the Vero cells (lane 4) or the controls in which reverse transcriptase recovery of infectious virus after transfecting cells with syn- was omitted from the reaction (lanes 1-3). Purified RT-PCR frag- thetic plus-sense RNAs, derived from cloned cDNA of a virus ments, derived from the transfectant viruses, were digested with NheI with dsRNA genome (IBDV), completes the quest of gener- and SpeI restriction enzymes, as indicated (lanes 7-10). Only the DNA reverse infectious for RNA viruses. A number of fragment derived from the tagged virus was able to be digested, thus ating systems verifying the presence of these two restriction sites (lanes 8 and 10), investigators have generated infectious RNA viruses from whereas the one derived from the control transfectant virus remains cloned cDNA using synthetic transcripts (11). Racaniello and undigested (lanes 7 and 9). A DNA, digested with HindIll/EcoRI, was Baltimore were first to rescue poliovirus, a plus-stranded RNA used as a marker (lane M). virus, using cloned cDNA (12). Later, van der Werf et al. (18) generated infectious poliovirus using synthetic RNA produced shown) were obtained from the tagged-viral RNA segment A, whereas the PCR product derived from the unmodified viral by T7 RNA polymerase on a cloned cDNA template. Enami RNA remained undigested (lanes 7 and 9). et al. (13) rescued influenza virus, a segmented negative- Similarly, the IBDV nucleotide sequence in segment B was stranded RNA virus; and Schnell et al. (14) generated rabies altered by oligonucleotide-directed mutagenesis to introduce virus, a nonsegmented negative-stranded RNA virus, from three silent mutations at nucleotide positions 1770 (G -> C), cloned cDNAs of their respective genomes. Chen et al. (19) 1773 (T -- C), and 1776 (G -- C) in the VP1 gene. Vero cells demonstrated that the electroporation of fungal spheroplasts were transfected with the synthetic transcripts derived from with synthetic plus-sense RNA transcripts, which correspond plasmids pUC18FLBP2mut and pUC19FLAD78, and the to the nonsegmented dsRNA hypovirus, an uncapsidated transfectant virus was recovered as described. Simultaneously, fungal virus, yields mycelia that contain cytoplasmic- the unmodified transfectant virus was also recovered. After replicating dsRNA. Roner et al. (15) developed an infectious two passages in CEC, the genomic RNA of these viruses was system for a segmented dsRNA reovirus by transfecting cells cloned by RT-PCR using a specific primer pair of segment B, with a combination of ssRNA, dsRNA, in vitro translated and then sequenced. No product was obtained when reverse reovirus products, and complemented with a helper virus of transcriptase was omitted from the reactions before PCR, different serotype. The resulting virus was discriminated from indicating that the derived RT-PCR product was not the result in the DNA of the helper virus by plaque assay. However, this system, of contaminating (data not shown). Sequence analysis use of a virus was necessary. In contrast, the described the cloned fragment of transfectant viruses exhibits the ex- helper not a pected nucleotide mutations, as shown in Fig. 4. These results reverse genetics system of IBDV does require helper unequivocally show that the sequence tags are present in the virus or other viral proteins. Transfection of cells with plus- genomic RNA of the recovered viruses. sense RNAs of both segments was sufficient to generate infectious virus (IBDV). In this regard, the system was com- parable to other rescue systems of plus-stranded poliovirus and DISCUSSION double-stranded hypovirus (18, 19). The fate of the additional In this report, we demonstrate for the first time, to the best of one and four nucleotides, respectively, transcribed at the 3' end our knowledge, that synthetic transcripts derived from cloned of segment A, was not determined. Obviously, this did not Downloaded by guest on September 23, 2021 11136 Microbiology: Mundt and Vakharia Proc. Natl. Acad. Sci. USA 93 (1996) prevent the replication of the viral dsRNA. Similar effects have and pathogenesis, and help in the design of a new generation been observed in plus-stranded RNA viruses by different of live IBDV vaccines. investigators (1 1). Transfection of plus-sense RNAs from both segments into We thank Drs. Donald L. Nuss, Thomas Mettenleiter, and Dieter the same cell was necessary for the successful recovery of Lutticken for reviewing the manuscript and Kun Yao, Gerard H. RNAs of both segments had to be trans- Edwards, and Peter K. Savage for technical assistance. This work was IBDV. Transfected supported by a grant from Intervet International, B.V., Boxmeer, The lated by the cellular translation machinery. The polyprotein of Netherlands to V.N.V. segment A was presumably processed into VP2, VP3, and VP4 proteins, which form the viral capsid. The translated protein 1. Becht, H. (1980) Curr. Top. Microbiol. Immunol. 90, 107-121. VP1 of segment B probably acted as an RNA-dependent RNA 2. Mundt, E. & Muiller, H. (1995) Virology 209, 10-18. polymerase and transcribed minus-strands from synthetic plus- 3. Hudson, P. J., McKern, N. M., Power, B. E. & Azad, A. A. (1986) strands of both segments, and the reaction products formed Nucleic Acids Res. 14, 5001-5012. dsRNA. Recently, Dobos reported that in vitro transcription by 4. Azad, A. A., Jagadish, M. N., Brown, M. A. & Hudson, P. J. RNA of infectious (1987) Virology 161, 145-152. the virion RNA-dependent polymerase 5. Mundt, E., Beyer, J. & Muller, H. (1995) J. Gen. Virol. 76, pancreatic necrosis virus, a prototype virus of the Birnaviridae 437-443. family, is primed by VP1 and then proceeds via an asymmetric, 6. Spies, U., Muller, H. & Becht, H. (1987) Virus Res. 8, 127-140. semiconservative, strand-displacement mechanism to synthe- 7. Spies, U. & Muller, H. (1990) J. Gen. Virol. 71, 977-981. size only plus-strands during replication of the viral genome 8. Anzola, J. B., Xu, Z., Asamizu, T. & Nuss, D. L. (1987) Proc. (20). Our system showed that synthesis of minus strands must Natl. Acad. Sci. USA 84, 8301-8305. proceed on the plus strands. Whether the resulting transcribed 9. Zou, S. & Brown, E. G. (1992) Virology 186, 377-388. minus-strand RNA serves as a template for the transcription of 10. Gorziglia, M. I. & Collins, P. L. (1992) Proc. Natl. Acad. Sci. USA 89, 5784-5788. plus-strands or not remains the subject of further investigations. 11. Boyer, J. C. & Haenni, A. L. (1994) Virology 198, 415-426. To unequivocally prove that the infectious virus (IBDV) 12. Racaniello, V. R. & Baltimore, D. (1981) Science 214, 916-919. contained in supernatants of transfected cells was indeed 13. Enami, M., Luytjes, W., Krystal, M. & Palese, P. (1990) Proc. derived from the synthetic transcripts, two recombinant vi- Natl. Acad. Sci. USA 87, 3802-3805. ruses were generated containing sequence tags in either 14. Schnell, M. J., Mebatsion, T. & Conzelmann, K. K. (1994) EMBO segment A of strain D78 or segment B of strain P2. Restriction J. 13, 4195-4205. enzyme digests of the RT-PCR products and sequence analysis 15. Roner, M. R., Sutphin, L. A. & Joklik, W. K. (1990) Virology 179, 845-852. of the cloned DNA fragments verified the presence of these 16. Vakharia, V. N., He, J., Ahamed, B. & Snyder, D. B. (1994) Virus sequence tags in the genomic RNA segments. Res. 31, 265-273. The recovery of infectious virus (IBDV) demonstrated that 17. Muller, H., Lange, H. & Becht, H. (1986) Virus Res. 4, 297-309. only the plus-strand RNAs of both segments were sufficient to 18. van der Werf, S., Bradley, J., Wimmer, E., Studier, F. W. & Dunn, initiate replication of dsRNA. Thus, results are in agreement J. J. (1986) Proc. Natl. Acad. Sci. USA 83, 2330-2334. with the general features of reovirus and rotavirus replication, 19. Chen, B., Choi, G. H. & Nuss, D. L. (1994) Science 264, 1762- where the plus-strand RNAs serve as a template for the 1764. 20. Dobos, P. (1995) Virology 208, 10-25. synthesis of progeny minus-strands to yield dsRNA (21-23). 21. Schonberg, M., Silverstein, S. C., Levin, D. H. & Acs, G. (1971) However, the semiconservative strand displacement mecha- Proc. Natl. Acad. Sci. USA 68, 505-508. nisms proposed by Spies et al. (6) and Dobos (20) could not be 22. Patton, J. T. (1986) Virus Res. 6, 217-233. excluded. The development of a reverse genetics system for 23. Chen, D., Zeng, C. Q.-Y., Wentz, M. J., Gorziglia, M., Estes, IBDV will greatly facilitate future studies of gene expression M. K. & Ramig, R. F. (1994) J. Virol. 68, 7030-7039. Downloaded by guest on September 23, 2021