US 20140154223A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0154223 A1 KANG et al. (43) Pub. Date: Jun. 5, 2014

(54) METHODS OF PEST CONTROL Publication Classification (71) Applicants: Beijing Dabeinong Technology Group (51) Int. Cl. Co., Ltd., Beijing (CN); Beijing Green AOIN 63/02 (2006.01) Agrosino Plant Protection Technology CI2N 5/82 (2006.01) Co., Ltd., Beijing (CN); Beijing (52) U.S. Cl. Dabeinong Technology Group Co., CPC ...... A0IN 63/02 (2013.01); C12N 15/8286 Ltd. Biotech Center, Beijing (CN) (2013.01) USPC ...... 424/93.21: 514/4.5: 800/302 (72) Inventors: Yuejing KANG, Beijing (CN); Jie PANG, Beijing (CN); Aihong ZHANG, Beijing (CN); Peng CHENG, Beijing (57) ABSTRACT (CN); Xu YANG, Beijing (CN); Lihong NIU, Beijing (CN); Zhiwei JIA, Beijing Certain embodiments of the present invention provide a (CN); Luoxu AN. Beijing (CN); Kangle method for controlling Athetis lepigone, which comprises TIAN, Beijing (CN); Ziqin JIANG, contacting Athetis lepigone with Cry1A protein. Aspects of Beijing (CN) the present invention can achieve control of Athetis lepigone by enabling plants to produce Cry1A protein in vivo, which (21) Appl. No.: 14/093,684 G be EE E. ch R other instances, the (22) Filed: Dec. 2, 2013 method can control Athetis lepigone throughout the growth period of the plants and provide the plants with a full protec (30) Foreign Application Priority Data tion. Additionally, the method, in certain embodiments, can be one or more of stable, complete, simple, convenient, eco Dec. 3, 2012 (CN) ...... 2012.105098,172 nomical, pollution-free or residue-free.

p(Et- \si.

s

8 -:

\ - \ * - ^ * Y -k x

Crick

883.

Patent Application Publication Jun. 5, 2014 Sheet 1 of 3 US 2014/O154223 A1

FIG. 1

p:Ext-I , tici

rat

888. Patent Application Publication Jun. 5, 2014 Sheet 2 of 3 US 2014/O154223 A1

FG, 2.

888.

ES3883:

Patent Application Publication Jun. 5, 2014 Sheet 3 of 3 US 2014/O154223 A1

F.G. 3

Cry1Ab-01 Cry1Ab-02

FIG. 4

CK Cry1Ab-01 Cry1Ab-02 CK US 2014/O 154223 A1 Jun. 5, 2014

METHODS OF PEST CONTROL the safety of local human and livestock; and as Athetis lepi gone prefers a moist and dark micro-habitat, it generally hides CROSS-REFERENCE TO RELATED under coverings such as wheat Straws or below the topsoil. APPLICATION making the direct contact between chemicals and Athetis lepigone difficult, which can render the chemical control 0001. This application claims priority under 35 U.S.C. ineffective. S119(a)-(d) of Chinese Patent Application No. 0007 To overcome one or more of the limitations of the 2012 105098.17.2 filed Dec. 3, 2012, entitled “Method of Pest agricultural control method and/or of the chemical control Control” which is herein incorporated by reference in its method, researchers have found that, in Some instances, entirety. inserting genes coding for pesticidal proteins into plant genome can produce pest-resistant plants. Pesticidal protein BACKGROUND Cry1A, among a large group of pesticidal proteins, is a 0002 Some embodiments of the present invention relate parasporal crystalliferous protein produced by a subspecies to methods for pest control. Such as methods for preventing of Bacillus thuringiensis (Bacillus thuringiensis Subsp. Athetis lepigone from damaging plants by expressing Cry1A kurstaki, B.t.k). protein therein. 0008 Cry1A protein, ifingested by pests, can be dissolved 0003 Athetis lepigone belongs to the order of Lepidoptera in the alkaline environment of the pests midgut and releases and the family of Noctuidae. As an omnivorous pest, it some protoxin, a precursor to a toxin. Further, alkaline protease times feeds on maize. It can inhabit, in the Summer, maize digests the protoxin at its N- and C-terminus and can produce agricultural district of Huang-Huai-Hai region in China, and an active fragment, which can Subsequently bind to a mem has also been found in other areas such as in Japan, Korea, brane receptor of epithelial cells of the pests midgut and can Russia and Europe. It can damage aerial roots of maize in insert itself into the intestinal membrane, resulting in delete topsoil, can eat out maize brace roots and stems, can distort or rious effects to the pest, such as one or more of cell membrane even kill maize plants. The damaged maize field can show perforation, disequilibrating the pH homeostasis and/or large empty areas or even become sterile if under severe osmotic pressure across the cell membrane; this can disturb attacks. the digestion of the pest, and sometimes eventually lead to the 0004 Maize is a major food crop in China. On Jul.9 2011, death of the pest. the CCTV's “News Broadcast” reported outbreaks of Athetis 0009. There are no reports on controlling Athetis lepigone lepigone in China. From the autumn of 2011 until May 31 by generating transgenic plants producing a Cry1A protein. 2012, several field surveys conducted by the Pest Prevention and Control Laboratory of National Maize Industry found SUMMARY that 2012’s Athetis lepigone included a large number of large 0010 Some embodiments of the present invention include size wintering populations with a high density of larvae, providing a pest control method by using transgenic plants indicating that the outbreak of Athetis lepigone is likely to expressing Cry1A protein to, for example, control damage flare up again in Huang-Huai-Hai region. Two methods that caused by Athetis lepigone. In certain embodiments, the can be used to control Athetis lepigone are the agricultural method can overcome one or more limitations of the agricul control method and the chemical control method. tural control method and the chemical control method. 0005. The agricultural control method is an integrated and 0011. In other embodiments, the method controls (e.g., coordinated management of multiple factors for the entire limits growth or kills) Athetis lepigone, by, for example, ecosystem of farmland, which regulates crops, pests and envi contacting (e.g., eating) Athetis lepigone with the Cry1A ronmental factors and establishes a farmland ecosystem con protein. In certain instances, the Cry1A protein is Cry1Ab ducive to crop growth but unfavorable to Athetis lepigone. For protein. example, the prompt removals of Straw, weeds and other 0012. In certain aspects, the transgenic plant expresses coverings from the roots of maize seedlings to a bigger space Cry1A protein in one or more plant parts, including but not between maize lines far away from the plants so as to expose limited to reproductive material. Such as seeds, seedlings, and the ground, is commonly used, in order to make Sure the next the like. step of pesticide spray can directly contact Athetis lepigone. 0013 The Cry1Ab protein can be present in a plant cell However, since the agricultural control must obey the require expressing the protein, and it can be, in some instances, con ments for crop layout and increasing production, Such this tacted with Athetis lepigone by ingestion of the plant cell. method has limited applications and cannot be used as an 0014 Further, in certain embodiments, the Cry1Ab pro emergency measure when Athetis lepigone outbreaks. tein is present in a transgenic plant expressing the Cry1Ab 0006. The chemical control method, also known as the protein, and Athetis lepigone contacts with the Cry1Ab pro pesticide control method, kills pests by using pesticides. As a tein by ingestion of a tissue of the transgenic plant. means for the comprehensive management of controlling, it 0015. In some embodiments, Athetis lepigone is detrimen can be a fast, convenient, simple and highly cost-effective tally effected, such as, but not limited to the inhibition of method. Particularly, it can be used as an emergency practice growth of Athetis lepigone or death of Athetis lepigone, dam to reduce the density of Athetis lepigone before damage has age to the plant resulting from Athetis lepigone can, in some occurred. Currently, the Some measures of the chemical con instances, be controlled. trol include poisoned bait, poisoned soil, as well as pesticide 0016. In certain embodiments, the transgenic plant can be drenching and spraying. However, the chemical control has in any growth period. In other aspects, the tissue of the trans its limitations: its improper use can cause devastating conse genic plant can be roots, leaves, stems, tassels, ears, anthers or quences, such as poisoning crops, pest resistance, killing filaments. predators and polluting the environment so as to destroy 0017. The control of the damage of Athetis lepigone to the farmland ecosystems; pesticide residues can pose a threat to plant may or may not depend on planting location. US 2014/O 154223 A1 Jun. 5, 2014

0018. The control of the damage of Athetis lepigone to the larvae per individual seedling. When maize seedlings are at plant may or may not depend on planting time. 3-leaf to 5-leaf stage, larvae feed mainly on its stalk base and 0019. The plant can be any suitable plant, including but leave behind round or oval holes of 3-4 mm in size, resulting not limited to maize. in the disruption of nutrition transport to leaves and eventu 0020. In some instances, prior to the step of contacting ally the wilting and death of interior leaves above ground. Athetis lepigone, a transgenic seedling containing a poly When targeting maize seedlings of 8-leaf to 10-leaf stage, nucleotide encoding the Cry1Ab protein is planted. larvae mainly feed on roots, including aerial roots and main 0021. In some embodiments, the amino acid sequence of roots, resulting in lodging or even death of the plants. The the Cry1Ab protein comprises an amino acid sequence of damaged plants count for 1% to 5% generally and reach up to SEQ ID NO:1 or SEQID NO:2. In still other embodiments, 15%-20% in more seriously damaged plots. Larvae of Agro the nucleotide sequence encoding the Cry1Ab protein com tis ypsilon Rotternberg around instars 1-2 can cluster at the prises a nucleotide sequence of SEQ ID NO: 3 or SEQ ID top leaves of seedlings day and night and feed on them, but NO:4. will disperse after instar 3. The larvae are agile and can feign death. They are sensitive to light, and will huddle themselves BRIEF DESCRIPTION OF THE DRAWINGS up when disturbed. During the day they lurk between the layers of wet and dry topsoil, whereas they can excavate from 0022 FIG. 1 is a flow diagram for constructing recombi the ground at night to bite seedling plants and drag the injured nant cloning vector DBN01-T comprising the nucleotide plants into underground holes, orbite unearthed seeds. Upon sequence of Cry1Ab-01 in the pest control method of the the stalk of seedlings becomes harder, they will feed on fresh present invention; leaves and growing points. However, when lack of food or 0023 FIG. 2 is a flow diagram for constructing recombi finding next overwintering sites, migration occurs to them. nant expression vector DBN1001 24 comprising the nucle 0030. 4. Different morphological features otide sequence of Cry1Ab-01 in the pest control method of 0031, 1) Different morphology of eggs: Athetis lepigone's the present invention; eggs are steam-bun-shaped with a longitudinal ridge. Newly 0024 FIG. 3 shows damages to leaves of the transgenic laid eggs are yellow-green and turn into khaki at later stages. maize plants with inoculation of Athetis lepigone in the pest Agrotis ypsilon Rotternberg's eggs are also steam-bun control method of the present invention; shaped but with cross carina. The newly laid eggs are creamy 0025 FIG. 4 shows the development of Athetis lepigone white and gradually becoming yellow, and a black spot would larvae that are inoculated to the transgenic maize plants in the emerge on one top of the eggs before hatch. pest control method of the present invention. 0032. 2) Different morphology of larvae: Athetis lepi gone’s mature larvae are about 20 mm long with pale yellow DETAILED DESCRIPTION body and brown head. Newly hatched larvae are 14-18 mm in 0026. Although both Athetis lepigone and Agrotis psilon length and yellow-gray or dark-brown in colour. The salient Rottemberg belong to the order Lepidoptera and are of the features thereof are a dark brown speckle in inverted triangle family Noctuidae, and they have similar targets and close shape on individual somites and two brown dorsal lines from morphology, they are different species in biology. Below dorsal abdomen to the thoracic segment. By contrast, the include examples of Some aspects of Athetis lepigone and larvae of Agrotis 'psilon Rotternberg are cylinder-shaped, Agrotis ypsilon Rottenberg, the descriptions are not neces and the mature larvae thereof are 37-50 mm long and brown sarily complete and may not be representative of all Athetis headed with irregular dark brown reticulate stripes. They have lepigone and/or Agrotis ypsilon Rottenberg. taupe or fuscous body and rough surface dotted with differ 0027 1. Different feeding habits. In addition to severe ent-sized particles. Their dorsal line, Sub dorsal line and spi damage to Summer maize, Athetis lepigone also poses a threat racular line are all black brown, the prothorax is fuscous, the to peanut and soybean. Whereas Agrotis ypsilon Rotternberg, pygidium is tawny with two distinct dark brown vertical as a polyphagous pest, not only harms maize, Sorghum and bands, and the baenopoda and prolegs are tawny. millet, but also causes damage to a broad range of seedlings 0033 3) Different morphology of pupae: the pupae of including larch, pine, Chinese ash and Manchurian walnut in Athetis lepigone are about 10 mm in length, having a fawn the northeast, Masson pine, fir, mulberry and tea in the South, body color at early stage then gradually turning brown, and as well as Chinese red pine, oleaster and other fruit trees in the mature larvae pupate underground in the cocoon. By contrast, northwest. Agrotis psilon Rotternberg's pupae are 18-24 mm in length 0028 2. Different geographical habitations. Currently and bright auburn in color. The mouthpart is lined up with the Athetis lepigone has been primarily found in Huang-Huai end of wing buds, both reaching the end of the fourth abdomi Hai Summer maize district including six provinces of Hebei, nal segment. The central of the fore part of 4-7 abdominal Shandong, Henan, Shanxi, Jiangsu and Anhui, a total of 47 segments is dark brown with coarse speckles, and has tinny cities and 297 towns. Whereas Agrotis psilon Rotternberg bilateral speckles extended to the spiracle. The anterior part of can be found in places with humid climate and abundant 5-7 abdominal segments also has tinny Speckles. The end of rainfall in China, Such as the Changjiang River Valley, South abdomen has a pair of short butt-spines. east coast, and easternand Southern humid areas of the North 0034 4) Different morphology of imago: adult Athetis east China. lepigone is 10-12 mm long and 20 mm with wingspan. The 0029. 3. Different infestation habits. Athetis lepigone female is slightly larger than the male. Its head, thorax and causes a problem in some of Hebei Summer maize districts, abdomen are taupe. Its forewings are also taupe but with particularly in fields interplanted with wheat. Its larvae hide darker markings, fuscous interior and exterior borderlines, underneath the Surrounding crushed wheat Straw of maize annular markings of a black spot and Small reniform patterns. seedlings or burrow into 2-5 cm of the topsoil to damage Black dots are present on the edge of the outer concave with maize seedlings. There are normally 1-2 and up to 10-20 a white spot. The exterior borderline is wavy; the edge of US 2014/O 154223 A1 Jun. 5, 2014

wings has a black spot. Its hindwings are white and slightly north of the Yellow River, 4 generations in the area between brown, and gradually becomes fuscous at the edge. Its abdo the south of Yellow River and Yangtze River, 4-5 generations men is taupe. The valvae of male genitalia is half-wide open in the south of Yangtze River, and 6-7 generations in the ing, the dorsal margin is concave with a protruding uncus at tropical area in south Asia. However, regardless of the differ the middle, and the aedaeagus has inside spiny needles. By ence in the number of generations in one year, the severest contrast, adult Agrotis ypsilon Rotternberg is 17-23 mm in damage is always caused by the larvae of the first generation. length, 40-54 mm with wingspan. Its head and the back of Imagoes of southern overwintering generation appearin Feb thorax are fuscous, and the feet are brown. The forefoot tibia ruary. However, the eclosion peak normally occurs from the and tarsus edge are taupe, and the terminus of every segment end of March to the middle of April in most of the country of mid- and meta-legs has taupe annular bands. Its brown except Ningxia and Inner Mongolia, in which it occurs at the forewings have black brown anterior areas, fuscous outer end of April. The Imagoes of Agrotisypsilon Rottermberg are borders, light brown base lines and double-lined black wavy more likely to start eclosion from 15:00 to 22:00. They lurk endo-transverse lines. There is one round gray speck within under debris and crack during the day and become active after black annular bands. Reniform annular shape is black and has dusk, flying and foraging. After 3-4 days, they start mating black edge. The middle of outside of the reniform annular and laying eggs. The eggs are mainly laid on the short, high shape has wedge-shaped black annular shape, which reaches density weeds and seedlings and sometimes in dead leaves external transverse lines. The mid-transverse line is fuscous and cracks. Most eggs are near the ground. Each female can wavy shape. The double-lined wavy external transverse lines lay 800-1000 eggs, or even up to 2000 during their oviposi are brown. The sub-external borderline is irregular saw-tooth tion period of about 5 days. The larval stage consists of 6 shape and gray, the middle of the inner border of which has instars, and some individuals can reach 7-8 instars. The larval three pointed teeth. There are small black dots on each vein stage varies at different places, but normally takes 30-40 days between sub-external borderline and external transverse line. for the first generation. Once fully matured, they develop into The outer borderline is black. The color between external pupae in a Soiled chamber around 5 cm underground and the transverse line and sub-external borderline is light brown. pupal stage is 9-19 days. High temperature is harmful for the The color out of sub-external borderline is black brown. The development and reproduction of Agrotis ypsilon Rottem hindwings are hoar. The longitudinal vein and borderline are berg, thus fewer of them appear during the Summer. The brown. The back of abdomen is gray. optimum survival temperature is 15° C. -25°C. The mortality of Agrotis ypsilon Rottenberg's larvae increases when the 0035. 5. Different growth habit and breakout pattern. temperature of winter is too low, and decreases at places Athetis lepigone’s larvae have 6 instars lasting about 18 days where is low terrain, humid and have abundant rainfall. Addi and they have a strong stress resistance. The breakout of tionally, conditions conducive to oviposition and larval feed adults has two distinct peaks. The first one occurs before the ing Such as abundant autumn rainfall, high soil moisture and beginning of July while the second one is from the mid-July overgrown weed may lead to an outbreak in the next year. to mid-August. The adults have a strong reproductive capac However, excessive rainfall and too much moisture are bad ity: each female has a production of 300-500 eggs in average for larval development as first-instar larvae can drown very and the egg-laying period lasts 3-7 days, while the hatching easily in such environment. Regions having 15-20% soil rate can reach up to 100%. They cause more damage in maize moisture content during the peak period of oviposition would field rotating planting after cotton than continuous planting, Suffer severer damages. Sandy loam soil is more adapted than covered with wheat branthan without wheat bran, late sowing clay soil and sandy Soil to the reproduction of Agrotis ypsilon than early sowing, and having highfield humidity than having Rottemberg, due to its better water permeability and quick low field humidity. Athetis lepigone favours dark and moist draining. environment and often hides under the Straw or soil, causing a great inconvenience for pesticides spraying. In contrast, 0036 Collectively, it is evident that Athetis lepigone and Agrotis ypsilon Rotternberg has 3-4 generations in one year. Agrotis 'psilon Rottenberg are two distinct species of pests Mature larvae or pupae overwinter in the soil and imagoes and cannot crossbreed. Moreover, it has been reported that the start to appear in March. Generally, two moth peaks will pesticidal pattern of Cry1Ab gene does not include Agrotis occur: one in late March and the other in mid-April. Adults are Ypsilon Rottenberg. inactive during the day and become active at dusk till mid 0037. In the present disclosure, the genome of plants, plant night. They have phototaxis and favour sour, Sweet, winy tissues or plant cells refers to any genetic material in the fermentations, and various kinds of nectars. The larvae go plants, tissues or cells, including nucleus, plastid and mito through six instars: at instars 1 and 2, larvae hide inside the chondrial genome. weeds or interior leaves of plants, feeding themselves day and 0038. In the present disclosure, polynucleotides and/or night but with little appetite, and thus cause little damages; nucleotides constitute a complete gene', and encode a pro after instar 3, they hide under the topsoil during the day and tein or polypeptide in desired host cells. The skilled person in come out for food at the night; at instars 5 and 6, larvae start the art would readily recognize that the polynucleotides and/ to have an significantly-increased appetite and each indi or nucleotides can, in Some instances, be placed under the vidual can break down 4-5 seedlings in average, up to 10 in control of regulatory sequences of target hosts. extreme cases; and since instar 3, their pesticide resistance 0039 DNA normally exists in a form known as double significantly increases. The severest damage caused by the Stranded structure. In this arrangement, one strand is comple first generation of larvae occurs between the end of March mentary with another strand, and vice versa. DNA generates and the mid-April. Generations occur from October to April other complementary Strands during replication in plants, of the next year and do damages. The number of generations thus the present invention includes use of the polynucleotides in a year varies geographically: 2-3 generations in the north exemplified in the sequence list and their complementary east, 2-3 generations in the north of the Great Wall, 3 genera strands. “Coding strand commonly used in the art refers to tions in the area between the south of the Great Wall and the the strand binding to the antisense strand. In order to express US 2014/O 154223 A1 Jun. 5, 2014 proteins in vivo, one strand of DNA is typically transcribed 0042. Therefore, sequences having pest-resistant activity into a complementary Strand as mRNA, which is used as a and capable of hybridizing with SEQID template to be translated into protein. In fact, mRNA is tran 0043) NO:3 and/or SEQID NO: 4 under stringent condi scribed from the “antisense Strand of DNA. “Sense’ or tions are encompassed by Some embodiments of the present "encoding strand has a series of codons (one codon contains invention. These sequences are at least of about 40%-50% three nucleotides, which encodes a specific amino acid), and homology to the sequences of the present invention, about the strand can be used as an open reading frame (ORF) and be 60%. 65% or 70% homology, or even at least of about 75%, transcribed into a protein or peptide. The present invention 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, also encompasses RNA and peptide nucleic acid (PNA), 98%, 99% or greater homology to the sequences of the which have considerable functions as the exemplified DNA. present invention. 0044. The genes and proteins encompassed by some 0040. In some embodiments, the nucleic acid molecules or embodiments of the present invention include not only the fragments thereof hybridize to Cry1Ab gene of the present specifically exemplified sequences described herein, but also invention under stringent conditions. Any conventional the portions and/fragments (including those having internal nucleic acid hybridization or amplification method can be and/or terminal deletions in comparison with the full-length used to identify the presence of the Cry1Ab gene. The nucleic proteins), variants, mutants, Substitutes (proteins with Substi acid molecules or fragments thereof in certain cases can spe tuted amino acids), chimeric and fusion proteins thereofhav cifically hybridize to other nucleic acid molecules. In certain ing the pesticidal activity of the exemplified proteins instances, if two nucleic acid molecules can form an antipar allel double-stranded nucleic acid structure, then these two described herein. The “mutants' or “variants’ refer to nucle nucleic acid molecules can specifically hybridize to each otide sequences encoding the same protein or equivalent pro other. If two nucleic acid molecules exhibit complete comple tein with the pesticidal activity. The “equivalent protein’ mentarity, one nucleic acid molecule is called the “comple refers to a protein presenting the same or Substantially the ment of the other nucleic acid molecule. When every nucle same biological activity of resistance to Athetis lepigone as otide of one nucleic acid molecule is complementary to the the claimed proteins. corresponding nucleotide of another nucleic acid molecule, 0045. The “fragment” or “truncation” of the DNA or pro the two nucleic acid molecules are called to exhibit “complete tein sequences described in the present invention refers to a complementarity'. If two nucleic acid molecules can hybrid part or an artificially modified form (such as sequences Suit ize to each other at an efficiently stable status, and bind to able for plant expression) of the original DNA or protein each other after annealing under at least conventional “low sequences (nucleotides or amino acids). The length of the stringency conditions, these two nucleic acid molecules are above sequences can be variable, but it should be sufficient to called “minimal complementarity”. Likewise, if two nucleic ensure the protein (encoded) as a pest toxin. acid molecules can hybridize to each other at an efficiently 0046 Genes can be modified as gene variants by standard stable status, and bind to each other after annealing under techniques. For example, the technology of point mutation is conventional “high Stringency' conditions, these two nucleic well known in the art. Another example based on U.S. Pat. acid molecules are called to have “complementarity'. Devia No. 5,605,793 (which is herein incorporated by reference in tion from complete complementarity is acceptable as long as its entirety) describes a method that DNA can be reassembled Such deviation does not completely prevent the two mol to generate other molecular diversity after random fracture. ecules from forming a double-stranded structure. In order to Commercially manufactured endonucleases can be used to ensure that a nucleic acid molecule can be used as a primer or make fragments of full-length genes, and exonucleases can be probe, its sequence must have sufficient complementarity so used according to standard procedures. For example, that it can form a stable double-stranded structure in particu enzymes such as Bal31 or site-directed mutagenesis can be lar solvents and salt concentrations. used to systematically remove nucleotides from the end of 0041. In the present disclosure, a substantially homolo these genes. A variety of restriction endonucleases can also be gous sequence is a nucleic acid molecule, which, under used to obtain genes that encode active fragments. Proteases highly stringent conditions, can specifically hybridize with can also be used to obtain active fragments of these toxins the matched complementary Strand of the other nucleic acid directly. molecule. The stringent conditions suitable for DNA hybrid 0047. In certain embodiments of the present invention, ization, e.g., processing with 6.0xsodium chloride/sodium equivalent proteins and/or genes encoding these equivalent citrate (SSC) at about 45°C., and then washing with 2.0xSSC proteins can be derived from B. t. isolates and/or DNA librar at 50°C., would be well known to the skilled person in the art. ies. There are various ways to obtain the pesticidal proteins of For example, during the wash step the salt concentration can the present invention. For example, antibodies of pesticidal be selected from a low stringency condition of about 2.0xSSC proteins disclosed and claimed by the present invention can to a highly stringent condition of about 0.2xSSC at 50° C. In be used to identify and isolate other proteins from a mixture of addition, the temperature in the wash step can be selected proteins. In particular, antibodies may be produced by the from a low stringency condition of room temperature about most constant and the most different parts from other B.t. 22°C. to a highly stringent condition of about 65° C. Both proteins. By immunoprecipitation, enzyme-linked immun temperature and salt concentration can be changed, or one can osorbent assay (ELISA) or western blot, these antibodies can remain intact while another one is changed. In some embodi be used to specifically identify equivalent proteins with char ments, the stringent conditions according to the invention are: acteristic activities. Standard procedures in the art can be used specific hybridization with SEQID NO: 3 or SEQID NO: 4 to prepare antibodies of the proteins or equivalents or frag in a 6xSSC, 0.5% SDS solution at 65°C., and then membrane ments thereof disclosed in the present invention. Also, the washing with 2xSSC, 0.1% SDS and 1xSSC, 0.1% SDS once genes encoding these proteins can be obtained from micro each. organisms. US 2014/O 154223 A1 Jun. 5, 2014

0048. Due to the redundancy of genetic codes, a variety of 0053. Therefore, amino acid sequences with certain different DNA sequences can encode the same amino acid homology to SEQ ID NO: 1 and/or 2 are also included in sequence. The skilled person in the art would be able to Some aspects of the present invention. The homology/simi generate alternative DNA sequences to encode the same or larity/identity of these sequences to the sequences of some substantially the same protein. These different DNA aspects of the present invention can, in Some instances, be sequences are included within the scope of certain embodi greater than 60%, greater than 75%, greater than 80%, greater ments of the present invention. The “substantially the same' than 90% or can be greater than 95%. Also, polynucleotides sequences including fragments with pesticidal activity, refer and proteins of certain aspects of the present invention can be to sequences with amino acid substitution, deletion, addition defined by a more particular range of identity and/or similar orinsertion but the pesticidal activity thereof is not essentially ity and/or homology, for example, 49%, 50%, 51%, 52%, affected. 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 0049. In some embodiments of the present invention, the 63%, 64%. 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, Substitutions, deletions or additions in amino acid sequences 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, can be obtained using any Suitable technique, Such as con 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, ventional techniques in the art. In some instances, the alter 93%, 94%. 95%, 96%, 97%, 98% or 99% identity and/or ations of amino acid sequences are: a slight change of char similarity and/or homology to the exemplified sequences of acteristics, i.e., conservative amino acid Substitutions that do certain aspects of the present invention. not significantly affect folding and/or activity of proteins; a 0054 The regulatory sequences described in some short deletion, usually of 1-30 amino acids; a small amino- or embodiments of the present invention include, but are not carboxyl-terminal extension, such as an amino-terminal limited to, promoters, transit peptides, terminators, enhanc extension of a methionine residue; a small peptide linker with ers, leader sequences, introns and other regulatory sequences a length of about 20-25 residues for example. that can sometimes be operatively linked to the Cry1A pro 0050 Examples of conservative substitutions can be tein. selected from the following groups of amino acids: basic 0055. The promoters can include those expressible in amino acids, Such as arginine, lysine and histidine; acidic plants; the “promoters expressible in plants' refer to the pro amino acids, such as glutamic acid and aspartic acid; polar moters that ensure expression of the coding sequences con amino acids, such as glutamine, asparagine; hydrophobic nected thereto in plant cells. The promoters expressible in amino acids. Such as leucine, isoleucine and Valine; aromatic plants can be constitutive promoters. Examples of the pro amino acids, such as phenylalanine, tryptophanand tyrosinel; moters directing constitutive expression in the plants include, and Small-molecule amino acids, such as glycine, alanine, but are not limited to, 35S promoter from the cauliflower serine, threonine and methionine. Sometimes, the amino acid mosaic virus, Ubi promoter, promoter of rice GOS2 gene, etc. Substitutions without changing specific activities are known Alternatively, the promoters expressible in plants can be tis in the art, and they have been, for example, described in Sue-specific, i.e., the expression of coding sequences directed “Protein' by N. Neurath and R. L. Hill in 1979, published by by Such promoters in some plant tissues, such as green tissues, Academic Press, New York. Some substitutions are Ala? Ser, is higher than that in other tissues, as determined by routine Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/ RNA tests, e.g., PEP carboxylase promoter. Alternatively, the Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/ASn, Leu/Ile, Leu/Val, promoters expressible in plants can be wound-inducible pro Ala/Glu and Asp/Gly, and opposite substitutions thereof. moters. Wound-inducible promoters or promoters directing 0051. These substitutions can, in some instances, occur wound-induced expression patterns refer to that the expres outside the regions that play important roles on the molecular sion of coding sequences regulated by Such promoters is functions but still produce an active polypeptide. For the significantly higher in the plants that Suffer from mechanical polypeptides according to some aspects of the present inven wound or wound caused by pest chewing than in plants under tion, amino acid residues that are necessary for their activity normal growth conditions. Examples of the wound inducible and thus are selected not to be substituted can be identified promoters include, but are not limited to, promoters of pro through any suitable method known in the art, Such as site tease inhibitor genes of potato and tomato (pin I and pin II) directed mutagenesis oralanine scanning mutagenesis (refer and of protease inhibitor gene of maize (MPI). ring to Cunningham and Wells, 1989, Science 244: 1081 1085). The latter technique is to introduce mutation(s) to each 0056. The transit peptides, also known as secretory signal positive charged residue in a molecule and detect pest-resis sequences or guide sequences, direct transgenic products to tant activity of the resulting mutants, and then to determine specific organelles or cellular compartments. The transit pep which amino acid residues are important for the activity of the tides can be heterologous for the target proteins. For example, molecule. Substrate-enzyme interaction sites can be identi the sequences encoding the chloroplast transit peptide are fied by the analysis of their three-dimensional structures used to target chloroplast, or KDEL retaining sequences are which can be determined by nuclear magnetic resonance used to target endoplasmic reticulum, or CTPP of barley analysis, crystallography or photoaffinity labeling, etc (refer lectin gene are used to target vacuoles. ring to de Vos et al., 1992, Science 255:306–312; Smith et al., 0057 The leader sequences include, but are not limited to, 1992, J. Mol. Biol 224: 899-904: Wlodaver et al., 1992, FEBS leadersequences of small RNA viruses, such as EMCV leader Letters 309: 59-64). sequence (5'-terminal noncoding region of EMCV (encepha 0052. In some embodiments of the present invention, the lomyocarditis virus)); potyvirus leader sequences, such as Cry1A proteins include, but are not limited to, Cry1Ab. MDMV (maize dwarf mosaic virus) leader sequence; human Cry1Ab.105 and Cry1Ac proteins, pesticidal fragments or immunoglobulin heavy-chain binding protein (BiP); untrans functional regions that are at least 70% homologous to the lated leader sequence of mRNA of coat protein of alfalfa amino acid sequences of the above-mentioned proteins and mosaic virus (AMV RNA4); and tobacco mosaic virus have the pesticidal activity to Athetis lepigone. (TMV) leader sequence. US 2014/O 154223 A1 Jun. 5, 2014

0.058. The enhancers include, but are not limited to, cau genomes contain exogenous DNA comprising nucleotide liflower mosaic virus (CaMV) enhancer, figwort mosaic virus sequences encoding Cry1A protein, can lead to growth Sup (FMV) enhancer, carnation efflorescence ring virus (CERV) pression and eventual death of Athetis lepigone by their con enhancer, cassava Vein mosaic virus (CSVMV) enhancer, tact with the protein after ingestion of plant tissues. Growth mirabilis mosaic virus (MMV) enhancer, cestrum yellow leaf Suppression can be lethal or Sub-lethal. In some embodi curl virus (CmYLCV) enhancer, cotton leaf curl Multan virus ments, the plants can be morphologically normal and can be (CLCuMV) enhancer, commelina yellow mottle virus cultured by conventional methods for the consumption and/or (CoyMV) enhancer and peanut chlorotic leaf streak virus generation of products. In some instances, the transgenic (PCLSV) enhancer. plants can basically terminate the usage of chemical or bio 0059 For applications in the monocotyledon, introns logical pesticides that are Cry1A-targeted for Athetis lepi include, but are not limited to, maize hsp70 intron, maize gOne. ubiquitin intron, Adh intron 1. Sucrose synthase intron or rice 0064. The expression level of pesticidal crystal proteins Actl intron. For applications in the dicotyledon, introns (ICP) in plant tissues can be determined by any suitable include, but are not limited to, CAT-1 intron, pKANNIBAL methods in the art, e.g., quantification of mRNA encoding the intron, PIV2 intron and “super ubiquitin' intron. pesticidal proteins by specific primers, or direct quantifica 0060. The terminators may be signal sequences suitable for tion of pesticidal proteins. polyadenylation and functioning in plants, include but are not 0065 Various tests can be applied for determining the limited to, polyadenylation signal sequences derived from pesticidal effects of ICP in plants. One target of some embodi nopaline synthase (NOS) gene of Agrobacterium tumefa ments of the present invention is Athetis lepigone. ciens, from protease inhibitor II (pin II) gene, from pea 0066. In certain aspects of the present invention, the ssRUBISCO E9 gene and from C-tubulin gene. Cry1A protein may have the amino acid sequences shown as 0061 The “effective connections' described in the present SEQ ID NO: 1 and/or SEQID NO: 2 in the sequence list. In invention means the connections of nucleic acid sequences addition to the Cry1A protein coding region, other compo and the connections allow sequences to provide desired func nents can also be included, such as but not limited to one or tions for connected sequences. The “effective connections' more of regions encoding additional pesticidal protein(s), described in the present invention may be the connection selection marker protein(s) or herbicide resistance protein(s). between promoters and sequences of interest, and whereby 0067. In other aspects of the present invention, Cry1A the transcription of the sequences of interest is controlled and protein can be simultaneously expressed with one or more regulated by the promoters. When the sequences of interest Vip- and/or Cry-like pesticidal proteins in a transgenic plant. encode proteins and the expression of the proteins is desired, This simultaneous expression of more than one pesticidal the “effective connections' means the promoters are con protein in one transgenic plant can be achieved by allowing nected with the sequences in Such a way that makes the the plant to contain the desired genes using genetic engineer resulting transcripts translated with a high efficiency. If the ing. Additionally, one plant expressing Cry1A protein (the connections of the promoters and the coding sequences result first parent, P1) and the other plant expressing Vip- and/or in fusion transcripts and the expression of the encoded pro Cry-like pesticidal proteins (the second parent, P2) can be teins is desired. Such connections allow that the start codon of obtained by genetic engineering, and then the cross between the resulting transcripts is the initial codon of the coding P1 and P2 can generate offsprings with all genes introduced in sequences. Alternatively, if the connections of promoters and P1 and P2. coding sequences result infusion translations and the expres 0068 Moreover, the expression cassette comprising the sion of the proteins is desired. Such connections allow the first nucleotide sequence encoding Cry1A protein can, in certain start codon contained in the 5' untranslated sequences to be aspects, additionally express at least one more gene encoding connected with the promoters, and the resulted translation herbicide resistance proteins. The herbicide resistance genes can include, but are not limited to, glufosinate resistance products to be in frame relative to the open reading frames of genes, such as bar gene and pat gene; phenmedipham resis the desired proteins. Nucleic acid sequences for “effective tance genes, such as pmph gene; glyphosate resistance genes, connections' include, but are not limited to, sequences pro such as EPSPS gene; bromoxynil resistance genes; sulfony viding genes with expression function, i.e., gene expression lurea resistance genes; herbicide dalapon resistance genes; elements, such as promoters, 5' untranslated region, introns, cyanamide resistance genes; or glutamine synthetase inhibi protein-coding regions, 3' untranslated regions, polyadenyla torresistance genes such as PPT, thereby obtaining transgenic tion sites and/or transcription terminators; sequences provid plants having both high pesticidal activity and herbicide resis ing DNA transfer and/or integration, i.e., T-DNA border tance. sequences, recognition sites of site-specific recombinase, 0069. In some embodiments, foreign DNA is introduced integrase recognition sites; sequences providing selection, into plants, for example, genes or expression cassettes or i.e., antibiotic resistance markers, biosynthetic genes; recombinant vectors encoding the Cry1A protein are intro sequences providing a scoring markers and assisting opera duced into plant cells. Conventional transformation methods tions in vitro or in Vivo, i.e., multilinker sequences, site include, but are not limited to, Agrobacterium-mediated specific recombination sequences; and sequences providing transformation, micro-emitting bombardment, direct DNA replication, i.e., bacterial origins of replication, autono uptake of protoplasts, electroporation, or silicon whisker mously replicating sequences and centromere sequences. mediated DNA introduction. 0062. The “pesticide' described in the present invention 0070. Some embodiments of the present invention provide means that it is toxic to crop pests, including but not limited to a method for controlling pests, with one or more of the fol Athetis lepigone. lowing advantages: 0063. In some embodiments of the present invention, 0071 1. Internal control. Existing technologies are mainly Cry1A protein exhibits cytotoxicity to Athetis lepigone. For through external actions, i.e. external factors to control the example, the transgenic plants, such as maize, in which their infestation of Athetis lepigone, such as the agricultural con US 2014/O 154223 A1 Jun. 5, 2014

trol method and the chemical control method. While some sequence list; the nucleotide sequence (2457 nucleotides) of embodiments of the present invention is through Cry1A pro Cry1Ab-01 encoding said amino acid sequence (818 amino duced in plants to kill Athetis lepigone and Subsequently acids) of pesticidal protein Cry1Ab-01 is shown as SEQ ID control Athetis lepigone, i.e., through internal factors to con NO: 3 in the sequence list. trol. I0082. The amino acid sequence (615 amino acids) of pes 0072 2. No pollution and no residue. The chemical con ticidal protein Cry1Ab-02 is shown as SEQID NO: 2 in the trol method in the art plays a certain role in the control of sequence list; the nucleotide sequence (1848 nucleotides) of Athetis lepigone, but it brings pollution, destruction and resi Cry1Ab-02 encoding the amino acid sequence (615 amino dues to people, livestock and farmland ecosystem. The acids) of pesticidal protein Cry1Ab-02 is shown as SEQ ID method for controlling Athetis lepigone of Some embodi NO. 4 in the sequence list. ments of the present invention can eliminate the above I0083 II. Synthesizing the Nucleotide Sequences of adverse consequences. Cry1Ab 0073. 3. Control throughout the growth period. The meth I0084. The nucleotide sequences of Cry1Ab-01 (shown as ods for controlling Athetis lepigone in the art are staged, while SEQID NO:3 in the sequence list) and Cry1Ab-02 (shown as Some embodiments of the present invention provides plants SEQ ID NO. 4 in the sequence list) were synthesized by with the protection throughout their growth period. That is, Nanjing GenScript Ltd. The synthesized nucleotide sequence the transgenic plants (with Cry1A) from germination, of Cry1Ab-01 (SEQ ID NO: 3) is further connected with a growth, until flowering, fruiting can, in Some instances, avoid restriction site of Ncol at its 5' end and a restriction site of Spel the damage from Athetis lepigone. at its 3'end. Also, the synthesized nucleotide sequence of 0074. 4. Control of whole individual plants. The methods for controlling Athetis lepigone in the art, for example foliar Cry1Ab-02 (SEQ ID NO: 4) is further connected with a spray, are mostly localized. While some embodiments of the restriction site of Ncol at its 5' end and a restriction site of present invention provides a protection for the whole indi BamHI at its 3'end. vidual plants, for example, the roots, leaves, stems, tassels, ears, anthers, filaments, etc. of the individual transgenic Example 2 plants (with Cry1A) are resistant to Athetis lepigone. 0075 5. Stable effects. The current methods of pesticide Construction of Recombinant Expression Vectors spray require direct spraying to the Surface of the crops, that and Transformation the Same into Agrobacterium is likely to cause heterogeneous spray or no spray. Some I0085 I. Constructing Recombinant Cloning Vectors Com embodiments of the present invention generate plants prising Cry1Ab Gene expressing the Cry1A protein with constantly level in vivo. I0086. As shown in FIG. 1, the synthesized nucleotide Also, the transgenic plants (Cry1A protein) can, in some sequence of Cry1Ab-01 was ligated with cloning vector instances, have a consistently stable effect of controlling in pGEM-T (Promega, Madison, USA, CAT: A3600) according different locations, different time and different genetic back to manufacturer's protocol to generate the recombinant clon grounds. ing vector DBNO1-T. (Note: Amp represents Ampicillin 0076 6. Simple, convenient and economical. Due to the resistance gene; fl ori represents the replication origin of particular stealth occurrence and damage of Athetis lepigone, phage fl; Lacz is the start codon of Lacz; SP6 is the promoter its monitoring and prevention is difficult, causing a Substan of SP6 RNA polymerase: T7 is the promoter of T7 RNA tially increased planting cost. In contrast, Some embodiments polymerase; Cry1Ab-01 is the nucleotide sequence of of the present invention only need transgenic plants that Cry1Ab-01 (SEQ ID NO:3); and MCS is a multi-cloning express Cry1A protein, thus it saves a lot of manpower, mate site). rials and financial resources. I0087. The next step was to transform the recombinant 0077 7. Complete effect. Methods for controlling Athetis lepigone in the art are not completely efficient, and only cloning vector DBN01-T into competent cells T1 of E. coli slightly reduce the damage. In contrast, the transgenic plants (Transgen, Beijing, China, CAT: CD501) through a heat (with Cry1A) in some embodiments of the present invention shock method. Specifically, 50 ul competent cells T1 of E. can lead to 100% death of the newly hatched larvae of Athetis coli were mixed with 10 ul plasmid DNA (the recombinant lepigone. For example, the rare larvae can Survive, but they cloning vector DBNO1-T), incubated in a water bath at 42°C. are very small due to obvious underdevelopment or even for 30 seconds and then in a water bath at 37°C. for 1 hour (in stopping development and hardly cause any damage to the a shaker at 100 rpm). The mixture was then grown overnight maize plants. on a LB plate (tryptone 10 g/L, yeast extract 5 g/L, NaCl 10 0078 Some embodiments of the present invention will be g/L, agar 15 g/L, the pH value was adjusted to 7.5 with described in details through the following drawings and NaOH) with Ampicillin (100 mg/l), of which the surface was examples. coated with IPTG (isopropyl-thio-f-D-galactoside) and X-gal (5-bromo-4-chloro-3-indolyl-B-D-galactoside). White EXAMPLES colonies were picked up and cultured further at 37° C. over night in LB medium (tryptone 10 g/L, yeast extract 5 g/L. 007.9 The following examples illustrate some embodi NaCl 10 g/L, amplicillin 100 mg/L, pH value was adjusted to ments of the present invention of the methods for pest control. 7.5 with NaOH). Example 1 I0088. The plasmids were extracted by analkaline method. Specifically, the cultured bacteria in the medium were centri Acquisition and Synthesis of Cry1Ab Gene fuged at 12000 rpm for 1 min. The supernatant was discarded and the precipitated cells were resuspended in 100 ul ice-cold 0080 I. Acquiring the Nucleotide Sequences of Cry1Ab solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediamine 0081. The amino acid sequence (818 amino acids) of pes tetraacetic acid), 50 mM glucose, pH8.0). Following the addi ticidal protein Cry1Ab-01 is shown as SEQID NO: 1 in the tion of 150 uloffreshly prepared solution II (0.2MNaOH, 1% US 2014/O 154223 A1 Jun. 5, 2014

SDS (sodium dodecyl sulfate)), the tube was inverted for four 0094. The plasmids were extracted by analkaline method. times and placed on ice for 3-5 min. 150 ul ice-cold solution Enzymatic digestion with NcoI and Spel was used to identify III (4M potassium acetate, 2 Macetic acid) was added to the the extracted plasmids, and positive clones were further veri mixture, mixed immediately and thoroughly and then placed fied by sequencing. The results showed that, the nucleotide on ice for 5-10 min, followed by a centrifuge at 12000 rpm for sequence inserted into the recombinant expression vector 5 min at 4°C. The supernatant was added into 2 volumes of DBN1001 24 between NcoI and Spel sites was Cry1Ab-01 anhydrous ethanol, mixed thoroughly and then incubated for shown as SEQID NO: 3 in the sequence list. 5 min at room temperature. The mixture was centrifuged at 0095. As the above method for the construction of the 12000 rpm for 5 min at 4° C. and the supernatant was dis recombinant expression vector DBN1001 24, the recombi carded. The pellet was washed with 70% (V/V) ethanol and nant cloning vector DBNO2-T was enzymatically digested then air dried, followed by adding 30 ul of TE (10 mM by Ncol and BamHI to generate the nucleotide sequence of Tris-HCl, 1 mM EDTA, PH8.0) containing RNase (20 g/ml) Cry1Ab-02, which was inserted into the expression vector to dissolve the pellet and digesting RNA in a water bath at 37° DBNBC-01 to obtain the recombinant expression vector C. for 30 min. The plasmids obtained were stored at -20°C. DBN100106. As verified by enzymatic digestion and before use. sequencing, the nucleotide sequence inserted into the recom 0089 KpnI and BglI were used to identify the extracted binant expression vector DBN100106 between NcoI and plasmids, and positive clones were further verified by BamHI sites was the nucleotide sequence of Cry1Ab-02. sequencing. The results showed that, the nucleotide sequence 0096 III. Recombinant Expression Vectors were Trans inserted into the recombinant cloning vector DBNO1-T was formed into Agrobacterium Cry1Ab-01 shown as SEQ ID NO: 3 in the sequence list, 0097. The correctly constructed recombinant expression indicating the proper insertion of the nucleotide sequence of vector, DBN100 124 or DBN100106, was transformed into Cry1Ab-01. Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat No: 18313-015) through a liquid nitrogen method. Specifically, 0090. As the above method for the construction of the 100LL Agrobacterium LBA4404 and 3 uI plasmid DNA (the recombinant cloning vector DBNO1-T, the synthesized nucle recombinant expression vector DBN100 124 or DBN100106) otide sequence of Cry1Ab-02 (shown as SEQID NO: 4) was were placed in liquid nitrogen for 10 minutes, followed by ligated with cloning vector pGEM-T to generate the recom incubation in a water bath at 37° C. for 10 minutes. The binant cloning vector DBNO2-T. Enzymatic digestion and transformed Agrobacterium LBA4404 were inoculated in a sequencing were used to Verify the proper insertion of the LB tube and then cultured at 28°C., 200 rpm for 2 hours. nucleotide sequence Cry1Ab-02 in the recombinant cloning Subsequently, the culture was applied to a LB plate contain vector DBNO2-T. ing 50 mg/L Rifampicin and 100 mg/L. Kanamycin until 0091 II. Constructing Recombinant Expression Vectors positive individual colonies grew. The individual colonies Comprising Cry1Ab Gene were picked for further culture to extract plasmids. The 0092 Methods for constructing vectors by conventional recombinant expression vectors were identified by enzymatic enzymatic digestion can be performed by any Suitable digestion, that is, the recombinant expression vector method. As shown in FIG. 2, the recombinant cloning vector DBN100 124 was digested with restriction enzymes AhdI and DBN01-T and expression vector DBNBC-01 (Vector back Aati I, and the recombinant expression vector DBN100106 bone: pCAMBIA2301 (available from CAMBIA institu was digested with restriction enzymes BglI and EcoRV, indi tion)) were digested respectively by the restriction enzymes cating the correct construction of the recombinant expression NcoI and Spel; and the resulting fragment of the nucleotide vectors, DBN1001 24 and DBN100106. sequence of Cry1Ab-01 was then inserted into the digested expression vector DBNBC-01 between NcoI and Spel sites to Example 3 generate the recombinant expression vector DBN100 124. (Note: Kan represents kanamycin gene; RB represents right Acquisition and Verification of Maize Plants border: Ubi represents the promoter of maize ubiquitin gene Transformed with Cry1Ab Genes (SEQ ID NO: 5); Cry1Ab-01 represents the nucleotide 0098. I. Generation and Identification of Maize Plants sequence of Cry1Ab-01 (SEQID NO:3): Nos represents the Transformed with Cry1Ab Genes terminator of nopaline synthase gene (SEQID NO: 6); PMI 0099. Using an Agrobacterium infection method, the ster represents Phosphomannose isomerase gene (SEQ ID NO: ile cultured immature embryos of Maize Z31 were cultured 7); and LB represents left border). with Agrobacterium strains obtained in III of Example 2, so as 0093. The recombinant expression vector DBN100 124 to transform T-DNA in the recombinant expression vectors was transformed into competent cells T1 of E. coli through a DBN1001 24 and DBN100106 (comprising the promoter heat-shock method. Specifically, 50 ul competent cells T1 of sequence of maize Ubiquitingene, the nucleotide sequence of E. coli were mixed with 10 ul plasmid DNA (the recombinant Cry1Ab-01 or Cry1Ab-02, PMI gene and the sequence of expression vector DBN1001 24), incubated in a water bath at terminator Nos, respectively) into the maize genome, gener 42°C. for 30 Seconds and then in a water bath at 37° C. for 1 ating the maize plants transformed with the nucleotide hour (in a shaker at 100 rpm). The mixture was then grown at sequence of Cry1Ab-01 and the maize plants transformed 37° C. for 12 hours on a LB plate (tryptone 10 g/L, yeast with Cry1Ab-02. The wild-type maize plants were used as extract 5 g/L, NaCl 10 g/L, agar 15 g/L, the pH value was control. adjusted to 7.5 with NaOH) with 50 mg/L Kanamycin. White 0100. The process of Agrobacterium-mediated transfor colonies were picked up and cultured further at 37° C. over mation of maize was performed, as briefly described as fol night in LB medium (tryptone 10 g/L, yeast extract 5 g/L. lows. The immature embryos, isolated from the maize, were NaCl 10 g/L, Kanamycin 50 mg/L, the pH value was adjusted contacted with the Agrobacterium Suspension, whereby the to 7.5 with NaOH). nucleotide sequence of Cry1Ab-01 and/or Cry1Ab-02 was US 2014/O 154223 A1 Jun. 5, 2014

delivered into at least one cell of either immature embryo by 0104. The detailed protocol for determining the copy Agrobacterium (step 1: Infection). In this step, the immature numbers of Cry1Ab gene was as follows: embryos were, in some instances, immersed in Agrobacte rium suspension (ODo-0.4–0.6, infection medium (MS salt 0105 Step 11: 100 mg of the leaves of the maize plants 4.3 g/L, MS Vitamins, casein 300 mg/L, sucrose 68.5 g/L, transformed with the nucleotide sequence of Cry1Ab-01 or glucose 36 g/L, Acetosyringone (AS) 40 mg/L, 2,4-dichlo Cry1Ab-02 or that of the wild-type maize plants were rophenoxyacetic acid (2,4-D) 1 mg/L, pH 5.3)) to initiate sampled, and homogenized in a mortar with liquid nitrogen. inoculation. The immature embryos were cultured with Agro Each sample was taken in triplicate. bacterium for a period of time (3 days) (step 2: Co-culture). In 0106 Step 12: The genomic DNA of the above-mentioned Some instances, after the step of infection, the immature samples was extracted with DNeasy Plant Maxi Kit of embryos were cultured on a solid medium (MS salt 4.3 g/L, Qiagen, and the detailed method refers to the manufacturers MS Vitamins, casein 300 mg/L, sucrose 20 g/L glucose 10 protocol. g/L, Acetosyringone (AS) 100 mg/L, 2,4-dichlorophenoxy 0107 Step 13: NanoDrop 2000 (Thermo Scientific) was acetic acid (2,4-D) 1 mg/L, agar 8 g/L, pH 5.8). After the employed to measure genomic DNA concentrations of the co-culture step, a “recovery step was optional, wherein there above-mentioned samples. was at least an antibiotic known as inhibiting the growth of Agrobacterium (Cephalosporins) and no selection agents for 0.108 Step 14: The concentrations of genomic DNA of the plant transformants in the recovery medium (MS salt 4.3 g/L, above-mentioned samples were adjusted to the same concen MS Vitamins, casein 300 mg/L, sucrose 30 g/L, 2,4-dichlo trations in a range of 80-100 ng/ul. rophenoxyacetic acid (2,4-D) 1 mg/L, agar 8 g/L, pH 5.8) 0109 Step 15: The copy numbers of the samples were (step 3: Recovery). In some instances, the immature embryos determined by a fluorescence quantitative PCR method with were cultured on the solid medium with an antibiotic but Taqman probe. A sample that had a known copy number was without selection agents to eliminate Agrobacterium and pro used as standard, and a sample from the wild-type maize vide a recovery period for transformed cells. Next, the inocu plants was used as control. Each sample was taken in tripli lated immature embryos were cultured on the medium with a cate and the results were averaged. The primers and probes selection agent (mannose) and the growing transformed cal used in the fluorescence quantitative PCR method are as luses were selected (step 4: Selection). In some instances, the follows. immature embryos were cultured on a solid selection medium with a selection agent (MS salt 4.3 g/L, MS Vitamins, casein he following primers and probes were used for 300 mg/L. Sucrose 5 g/L, mannose 12.5g/L, 2,4-dichlo etecting the nucleotide sequence of Cry1Ab - 01: rophenoxyacetic acid (2,4-D) 1 mg/L, agar 8 g/L, pH 5.8), rimer 1 (CF1): which resulted in a selective growth of transformed cells. GAACTACGACTCCCGCAC, Further, the calluses regenerated into plants (step 5: Regen hown as SEQ ID NO: 8 in the sequence list; eration). In some instances, the calluses grown on the medium Primer 2 (CR1) : with the selection agent were cultured on a solid medium (MS GTAGATTTCGCGGGTCAGTTG, differentiation medium and MS rooting medium) to regener shown as SEQ ID NO: 9 in the sequence list; ate plants. Probe 1 (CP1) : CTACCCGATCCGCACCGTGTCC, 0101 The selected resistant calluses were transferred onto shown as SEQ ID NO : 10 in the sequence list. the MS differentiation medium (MS salt 4.3 g/L, MS Vita he following primers and probes were used for mins, casein 300 mg/L. Sucrose 30 g/L, 6-benzyladenine 2 etecting the nucleotide sequence of Cry1Ab - O2: mg/L, mannose 5g/L, agar 8 g/L, pH 5.8), and cultured under rimer 3 (CF2) : 25°C. for differentiation. The differentiated seedlings were GCGTATTCAATTCAACGACATG, transferred onto the MS rooting medium (MS salt 2.15g/L, hown as SEQ ID NO: 11 in the sequence list; MS Vitamins, casein 300 mg/L, sucrose 30 g/L, indole-3- rimer 4 (CR2) : acetic acid 1 mg/L, agar 8 g/L, pH 5.8), and cultured under CTTGGTAGTTCTGGACTGCGAAC, 25°C. till the height of about 10 cm. The seedlings were then shown as SEQ ID NO: 12 in the sequence list; transferred into a greenhouse and grew to fructify. During the Probe 2 (CP2) : culture in the greenhouse, the seedlings were incubated at 28° CAGCGCCTTGACCACAGCTATCCC, C. for 16 hours and then incubated at 20° C. for 8 hours each shown as SEQ ID NO : 13 in the sequence list. day. 0102 II. Verification of Maize Plants Transformed with 0110 PCR Reaction System: Cry1Ab Genes by TaqMan Method 0103 Using about 100 mg of leaves from the maize plants JumpStart TM Tad ReadyMix TM (Sigma) 10 ul transformed with the nucleotide sequence of Cry1Ab-01 or 50x mixture of primers probes 1 Ll Cry1Ab-02 as samples, the genomic DNA was extracted with Genomic DNA 3 ul DNeasy Plant Maxi Kit of Qiagen, and the copy numbers of Water (dd H2O) 6 ul Cry1Ab genes were determined by a fluorescence quantita tive PCR assay with Taqman probe. The wild-type maize plants were analyzed as control according to the above-men 0111. The 50xmixture of primers/probes, containing 45ul tioned method. The experiments were repeated for 3 times of 1 mM each primer, 50 ul of 100 uM probe and 860 ul of 1 x and the results were averaged. TE buffer, was stored in an amber tube at 4° C. US 2014/O 154223 A1 Jun. 5, 2014 10

0112. PCR conditions were as follows: mined as 8536.2 and 8234.7, respectively, indicating higher expression and stability for both Cry1Ab proteins in maize.

TABLE 1 Step Temperature Time 21 95° C. 5 min The averaged amount of the Cry1Ab protein expressed in the transgenic 22 95° C. 30 sec 23 60° C. 1 min maize plants 24 returning to step 22, repeating 40 times Amount of Cry1Ab protein Amount of Cry1Ab protein expressed in each plant (ng/g) expressed in each kind of lines 0113. The data were analyzed by SDS2.3 software (Ap (repeated six times per plant) (ng/g) plied Biosystems). 0114. As shown by the results, the nucleotide sequences of Line 1 2 3 Average amount (ng/g) Cry1Ab-01 and Cry1Ab-02 were both integrated into the genome of the detected maize plants; and the maize plants S1 716O.2 10444.4 9080.8 8536.2 transformed with the nucleotide sequence of Cry1Ab-01 as S2 8534.4 8581.2 7330.2 well as the maize plants transformed with the nucleotide sequence Cry1Ab-02 had obtained a single copy of Cry1Ab S3 8817.4 91.85.7 7691.2 gene in the respective transgenic maize plants. S4 7088.4 9837.S 10626.4 8234.7 S5 9866.7 6863.3 4222.4 Example 4 S6 9912.1 7724.1 7970.9 NGM -1.7 O -1.0 O Detection of Pesticidal Proteins in the Transgenic CK O -4.2 2.3 O Maize Plants 0115 I. Detection of the Pesticidal Protein Contents in the I0123 II. Detection of Pest Resistance of the Transgenic Transgenic Maize Plants Maize Plants 0116 Solutions involved in this experiment areas follows: 0.124. The maize plants transformed with the nucleotide 0117 Extraction buffer: 8 g/L NaCl, 0.2 g/L KHPO, 2.9 sequence of Cry1Ab-01 or Cry1Ab-02, the wild-type maize g/L NaHPO.12H2O, 0.2 g/L KC1, 5.5 ml/L Tween-20, pH plants and the non-transgenic maize plants identified by Taq 7.4: man were detected for their resistance to Athetis lepigone. 0118 Washing buffer PBST: 8 g/L NaCl, 0.2 g/L KHPO, 2.9 g/L NaHPO-12H2O, 0.2 g/L KC1, 0.5 ml/L. Tween-20, 0.125 Fresh leaves of maize plants transformed with the pH 7.4: nucleotide sequence of Cry1Ab-01 or Cry1Ab-02, of the wild-type maize plants and of the maize plants identified as 0119) Termination solution: 1M HCl. non-transgenic plants (V3-V4 stage) by Taqman were 0120. Three (3) mg of fresh leaves from the maize plants transformed with the nucleotide sequence of Cry1Ab-01 or sampled, respectively. The leaves were rinsed with sterile Cry1Ab-02 were sampled and homogenized with liquid water and the water on the leaves was dried up by gauze. The nitrogen, followed by the addition of 800 ul extraction buffer. veins of the leaves were removed, and the leaves were cut into The mixture was centrifuged at 4000 rpm for 10 min, then the stripes of approximately 1 cmx4 cm. Two stripes of the leaves supernatant was diluted 40-fold with the extraction buffer and were placed on filter paper wetted with distilled water on the 80 ul of diluted supernatant was used for ELISA test. ELISA bottom of round plastic Petri dishes. 10 heads of Athetis (enzyme-linked immunosorbent assay) kit (ENVIRLOGIX lepigone (newly hatched larvae) were placed into each dish, company, Cry1Ab/Cry1Ac kit) was employed to determine and the dishes with pests were covered with lids and placed at the ratio of the pesticidal protein (Cry1Ab protein) content 25-28°C., relative humidity of 70%–80% and photoperiod divided by the weight of the fresh leaves. The detailed method (light/dark) 16:8 for 3 days. According to three indicators, the refers to the manufacturer's protocol. developmental progress, mortality and leaf damage rate of the 0121 Meanwhile, the wild-type maize plants and the non Athetis lepigone's larvae, the resistance score was acquired: transgenic maize plants identified by Taqman were used as score=100xmortality+ 100xmortality+90x(the number of controls, and the determination followed the methods as newly hatched pests/the total number of inoculated pests)+ described above. For three lines transformed with Cry1Ab-01 60x(the number of newly hatched-the number of negative (S1, S2 and S3), three lines transformed with Cry1Ab-02 (S4, control pests/the total number of inoculated pests)+10x(the S5 and S6), one line identified as non-transgenic plant (NGM) number of negative control pests/the total number of inocu by Taqman and one line as wild type (CK), three plants for lated pests)+100x(1-leaf damage rate). For three lines trans each line were used and each plant was repeated six times. formed with the nucleotide sequence Cry1Ab-01 (S1, S2 and 0122 Experimental results of the pesticidal protein S3), three lines transformed with the nucleotide sequence (Cry1Ab protein) contents in the transgenic plants were Cry1Ab-02 (S4, S5 and S6), one line identified as non-trans shown in Table 1. The ratios of the averaged expressions of genic plants (NGM) by Taqman and one line as wild type the pesticidal protein (Cry1Ab) divided by the weight of the (CK), three plants for each line were used and each plant was fresh leaves in the maize plants transformed with the nucle repeated six times. The results were shown in Table 2 as well otide sequence of Cry1Ab-01 and Cry1Ab-02 were deter as FIGS. 3 and 4. US 2014/O 154223 A1 Jun. 5, 2014 11

TABLE 2 The pest resistance of the transgenic maize plants inoculated with Athetis lepigone Developmental progress Mortality of of Athetis lepigone Athetis lepigone each line each line Newly The total Leaf hatched- 2 number of Score damage Newly negative negative inoculated Mortality (each line rate (%) hatched control control pests (%) line) Average S1 O O O O 10 1OO 300 S2 O O O O 10 1OO 300 3OO S3 O O O O 10 1OO 300 S4 O O O O 10 1OO 300 S5 1 O.3 O O 10 97 296 297 S6 1 O.S O O 10 95 294 NGM 63 0.7 O 9.3 10 O 53 53 CK 50 2.3 O 7.4 10 3 84 84

0126. As shown in Table 2, the scores of the maize plants to, the Cry1A proteins shown in the specific sequences. The transformed with the nucleotide sequences of Cry1Ab-01 and transgenic plants can also generate at least one kind of addi Cry1Ab-02 were both around full mark 300, while the score tional pesticidal protein that is different from Cry1A, e.g., of the wild-type maize plants was generally about 80 or less. Vip-like and Cry-like proteins. 0.130. In conclusion, some embodiments of the present 0127. As shown in FIGS. 3 and 4, compared with the invention can control Athetis lepigone by enabling the plants wild-type maize plants, the maize plants transformed with the to produce Cry1A protein in vivo, which is toxic to Athetis nucleotide sequence of Cry1Ab-01 or Cry1Ab-02 killed lepigone. In comparison with current agricultural and chemi nearly 100% of the newly hatched Athetis lepigone larvae, cal control methods, the method described by some embodi and Suppressed the development of the Surviving larvae so ments of the present invention can control Athetis lepigone that the larvae remained in the newly hatched state after 3 throughout the growth period of the plants and provide a full days. Additionally, the maize plants transformed with the protection to the plants. Additionally, some aspects of the nucleotide sequence of Cry1Ab-01 or Cry1Ab-02 had little method can be one or more of stable, complete, simple, con damage, shown by a small number of pinholes in a few leaves Venient, economical, pollution-free or residue-free. which could only be observed under a magnifier. I0131 Finally, it should be noted that the above embodi 0128. Thus, the maize plants transformed with the nucle ments are merely to illustrate Some of the technical Solutions otide sequence of Cry1Ab-01 or Cry1Ab-02 showed resis of certain aspects of the present invention and do not limit the tance to Athetis lepigone and was sufficient to cause adverse Scope of the invention. Although some embodiments of the effects on the growth of Athetis lepigone. present invention have been described in detail, it should be 0129. The above results also appeared to show that, the appreciated that the technical Solutions of the present inven effective control of Athetis lepigone resulted from the Cry1A tion can be modified or equivalently replaced without depart protein produced by the maize plants. Cry1Ab proteins ing from the spirit of the invention and are within the scope of described in the present invention include, but are not limited the present invention.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS : 13

<21 Os SEQ ID NO 1 &211s LENGTH: 81.8 212s. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Cry1Ab-01 amino acid sequence

<4 OOs SEQUENCE: 1 Met Asp Asn. Asn. Pro Asn. Ile Asn. Glu. Cys Ile Pro Tyr Asn. Cys Lieu. 1. 5 1O 15

Ser Asn Pro Glu Val Glu Val Lieu. Gly Gly Glu Arg Ile Glu Thr Gly 2O 25 3 O

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Lieu. Thr Glin Phe Leu Lleu Ser 35 4 O 45 US 2014/O 154223 A1 Jun. 5, 2014 12

- Continued Glu Phe Val Pro Gly Ala Gly Phe Val Lieu. Gly Lieu Val Asp Ile Ile SO 55 6 O Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Glin Ile 65 70 7s 8O Glu Gln Lieu. Ile Asn Glin Arg Ile Glu Glu Phe Ala Arg Asin Glin Ala 85 90 95 Ile Ser Arg Lieu. Glu Gly Lieu. Ser Asn Lieu. Tyr Glin Ile Tyr Ala Glu 1OO 105 11 O Ser Phe Arg Glu Trp Glu Ala Asp Pro Thir Asn. Pro Ala Lieu. Arg Glu 115 12 O 125 Glu Met Arg Ile Glin Phe Asn Asp Met Asn. Ser Ala Lieu. Thir Thr Ala 13 O 135 14 O Ile Pro Leu Phe Ala Val Glin Asn Tyr Glin Val Pro Leu Lleu Ser Val 145 150 155 160 Tyr Val Glin Ala Ala Asn Lieu. His Lieu. Ser Val Lieu. Arg Asp Val Ser 1.65 17O 17s Val Phe Gly Glin Arg Trp Gly Phe Asp Ala Ala Thir Ile Asn. Ser Arg 18O 185 19 O Tyr Asn Asp Lieu. Thir Arg Lieu. Ile Gly Asn Tyr Thr Asp His Ala Val 195 2OO 2O5 Arg Trp Tyr Asn Thr Gly Lieu. Glu Arg Val Trp Gly Pro Asp Ser Arg 21 O 215 22O Asp Trp Ile Arg Tyr ASn Glin Phe Arg Arg Glu Lieu. Thr Lieu. Thr Val 225 23 O 235 24 O Lieu. Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro 245 250 255 Ile Arg Thr Val Ser Gln Lieu. Thr Arg Glu Ile Tyr Thr Asn Pro Val 26 O 265 27 O Lieu. Glu Asn. Phe Asp Gly Ser Phe Arg Gly Ser Ala Glin Gly Ile Glu 27s 28O 285 Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Lieu. Asn Ser Ile Thr 29 O 295 3 OO Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Glin 3. OS 310 315 32O Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro 3.25 330 335 Lieu. Tyr Gly. Thir Met Gly Asn Ala Ala Pro Glin Glin Arg Ile Val Ala 34 O 345 35. O Gln Leu Gly Glin Gly Val Tyr Arg Thr Lieu. Ser Ser Thr Lieu. Tyr Arg 355 360 365 Arg Pro Phe Asn. Ile Gly Ile Asn. Asn Glin Glin Lieu. Ser Val Lieu. Asp 37 O 375 38O Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Lieu Pro Ser Ala Val 385 390 395 4 OO Tyr Arg Llys Ser Gly Thr Val Asp Ser Lieu. Asp Glu Ile Pro Pro Glin 4 OS 41O 415 Asn Asn. Asn Val Pro Pro Arg Glin Gly Phe Ser His Arg Lieu. Ser His 42O 425 43 O Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile 435 44 O 445 Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn 450 45.5 460 US 2014/O 154223 A1 Jun. 5, 2014 13

- Continued

Ile Ile Pro Ser Ser Glin Ile Thr Glin Ile Pro Leu. Thir Lys Ser Thr 465 470 47s 48O Asn Lieu. Gly Ser Gly Thr Ser Val Val Lys Gly Pro Gly Phe Thr Gly 485 490 495 Gly Asp Ile Lieu. Arg Arg Thir Ser Pro Gly Glin Ile Ser Thr Lieu. Arg SOO 505 51O Val Asn. Ile Thr Ala Pro Lieu. Ser Glin Arg Tyr Arg Val Arg Ile Arg 515 52O 525 Tyr Ala Ser Thr Thr Asn Lieu. Glin Phe His Thr Ser Ile Asp Gly Arg 53 O 535 54 O Pro Ile Asin Glin Gly Asn Phe Ser Ala Thr Met Ser Ser Gly Ser Asn 5.45 550 555 560 Lieu. Glin Ser Gly Ser Phe Arg Thr Val Gly Phe Thr Thr Pro Phe Asn 565 st O sts Phe Ser Asn Gly Ser Ser Val Phe Thr Lieu Ser Ala His Val Phe Asn 58O 585 59 O Ser Gly Asn. Glu Val Tyr Ile Asp Arg Ile Glu Phe Val Pro Ala Glu 595 6OO 605 Val Thr Phe Glu Ala Glu Tyr Asp Lieu. Glu Arg Ala Gln Lys Ala Val 610 615 62O Asn Glu Lieu. Phe Thir Ser Ser Asn Glin Ile Gly Lieu Lys Thr Asp Wall 625 630 635 64 O Thir Asp Tyr His Ile Asp Glin Val Ser Asn Lieu Val Glu. Cys Lieu. Ser 645 650 655 Asp Glu Phe Cys Lieu. Asp Glu Lys Lys Glu Lieu. Ser Glu Lys Wall Lys 660 665 67 O His Ala Lys Arg Lieu. Ser Asp Glu Arg Asn Lieu. Lieu. Glin Asp Pro Asn 675 68O 685 Phe Arg Gly Ile Asn Arg Glin Lieu. Asp Arg Gly Trp Arg Gly Ser Thr 69 O. 695 7 OO Asp Ile Thir Ile Glin Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr Val 7 Os 71O 71s 72O Thr Lieu. Leu Gly Thr Phe Asp Glu. Cys Tyr Pro Thr Tyr Lieu. Tyr Glin 72 73 O 73 Lys Ile Asp Glu Ser Llys Lieu Lys Ala Tyr Thr Arg Tyr Glin Lieu. Arg 740 74. 7 O Gly Tyr Ile Glu Asp Ser Glin Asp Lieu. Glu Ile Tyr Lieu. Ile Arg Tyr 7ss 760 765 Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu Trp 770 775 78O Pro Leu Ser Ala Pro Ser Pro Ile Gly Lys Cys Ala His His Ser His 78s 79 O 79. 8OO His Phe Ser Lieu. Asp Ile Asp Val Gly Cys Thr Asp Lieu. Asn. Glu Asp 805 810 815 Phe Arg

<210s, SEQ ID NO 2 &211s LENGTH: 615 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Cry1Ab- O2 amino acid sequence US 2014/O 154223 A1 Jun. 5, 2014 14

- Continued <4 OOs, SEQUENCE: 2 Met Asp Asn. Asn Pro Asn. Ile Asn. Glu. Cys Ile Pro Tyr Asn. Cys Lieu. 1. 5 1O 15 Ser Asn Pro Glu Val Glu Val Lieu. Gly Gly Glu Arg Ile Glu Thr Gly 2O 25 3O Tyr Thr Pro Ile Asp Ile Ser Leu Ser Lieu. Thr Glin Phe Leu Lleu Ser 35 4 O 45 Glu Phe Val Pro Gly Ala Gly Phe Val Lieu. Gly Lieu Val Asp Ile Ile SO 55 6 O Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Glin Ile 65 70 7s 8O Glu Gln Lieu. Ile Asn Glin Arg Ile Glu Glu Phe Ala Arg Asin Glin Ala 85 90 95 Ile Ser Arg Lieu. Glu Gly Lieu. Ser Asn Lieu. Tyr Glin Ile Tyr Ala Glu 1OO 105 11 O Ser Phe Arg Glu Trp Glu Ala Asp Pro Thir Asn. Pro Ala Lieu. Arg Glu 115 12 O 125 Glu Met Arg Ile Glin Phe Asn Asp Met Asn. Ser Ala Lieu. Thir Thr Ala 13 O 135 14 O Ile Pro Leu Phe Ala Val Glin Asn Tyr Glin Val Pro Leu Lleu Ser Val 145 150 155 160 Tyr Val Glin Ala Ala Asn Lieu. His Lieu. Ser Val Lieu. Arg Asp Val Ser 1.65 17O 17s Val Phe Gly Glin Arg Trp Gly Phe Asp Ala Ala Thir Ile Asn. Ser Arg 18O 185 19 O Tyr Asn Asp Lieu. Thir Arg Lieu. Ile Gly Asn Tyr Thr Asp His Ala Val 195 2OO 2O5 Arg Trp Tyr Asn Thr Gly Lieu. Glu Arg Val Trp Gly Pro Asp Ser Arg 21 O 215 22O Asp Trp Ile Arg Tyr Asn Glin Phe Arg Arg Glu Lieu. Thir Lieu. Thr Val 225 23 O 235 24 O Lieu. Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro 245 250 255 Ile Arg Thr Val Ser Gln Lieu. Thr Arg Glu Ile Tyr Thr Asn Pro Val 26 O 265 27 O Lieu. Glu Asn. Phe Asp Gly Ser Phe Arg Gly Ser Ala Glin Gly Ile Glu 27s 28O 285 Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Lieu. Asn Ser Ile Thr 29 O 295 3 OO Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Glin 3. OS 310 315 32O Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro 3.25 330 335 Lieu. Tyr Gly. Thir Met Gly Asn Ala Ala Pro Glin Glin Arg Ile Val Ala 34 O 345 35. O Gln Leu Gly Glin Gly Val Tyr Arg Thr Lieu. Ser Ser Thr Lieu. Tyr Arg 355 360 365 Arg Pro Phe Asn. Ile Gly Ile Asn. Asn Glin Glin Lieu. Ser Val Lieu. Asp 37 O 375 38O Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Lieu Pro Ser Ala Val 385 390 395 4 OO US 2014/O 154223 A1 Jun. 5, 2014 15

- Continued Tyr Arg Llys Ser Gly Thr Val Asp Ser Lieu. Asp Glu Ile Pro Pro Glin 4 OS 41O 415 Asn Asn. Asn Val Pro Pro Arg Glin Gly Phe Ser His Arg Lieu. Ser His 42O 425 43 O Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile 435 44 O 445 Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn 450 45.5 460 Ile Ile Pro Ser Ser Glin Ile Thr Glin Ile Pro Leu. Thir Lys Ser Thr 465 470 47s 48O Asn Lieu. Gly Ser Gly Thr Ser Val Val Lys Gly Pro Gly Phe Thr Gly 485 490 495 Gly Asp Ile Lieu. Arg Arg Thir Ser Pro Gly Glin Ile Ser Thr Lieu. Arg SOO 505 51O Val Asn. Ile Thr Ala Pro Lieu. Ser Glin Arg Tyr Arg Val Arg Ile Arg 515 52O 525 Tyr Ala Ser Thr Thr Asn Lieu. Glin Phe His Thr Ser Ile Asp Gly Arg 53 O 535 54 O Pro Ile Asin Glin Gly Asn Phe Ser Ala Thr Met Ser Ser Gly Ser Asn 5.45 550 555 560 Lieu. Glin Ser Gly Ser Phe Arg Thr Val Gly Phe Thr Thr Pro Phe Asn 565 st O sts Phe Ser Asn Gly Ser Ser Val Phe Thr Lieu Ser Ala His Val Phe Asn 58O 585 59 O Ser Gly Asn. Glu Val Tyr Ile Asp Arg Ile Glu Phe Val Pro Ala Glu 595 6OO 605 Val Thr Phe Glu Ala Glu Tyr 610 615

<210s, SEQ ID NO 3 &211s LENGTH: 2457 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Cry1Ab-01 nucleotide sequence <4 OOs, SEQUENCE: 3 atggacaa.ca acccaaac at caacgagtgc atc.ccgtaca act gcct cag caa.ccct gag 6 O gtcgaggtgc ticggcggtga gcgcatcgag accggittaca CCCC catcga Catct coctic 12 O t ccct cacgc agttcCtgct cagcgagttc gtgcc aggcg Ctggctt.cgt. Cctgggcct c 18O gtggaCat Catctggggg at Ctttggcc cc ticc cagtggg acgc.ct tcct ggtgcaaatc 24 O gaggagctica t calaccagag gat.cgaggag titcgc.cagga accaggc.cat cagcc.gc.ctg 3OO gagggcctica gcaaccticta C caaatctac gctgaga.gct tcc.gc.gagtg ggaggc.cgac 360

Cccact aacc cagctict cc caggagatg cgcatcCagt t caacga cat galacagcgc.c 42O ctgaccaccg ccatcc cact citt cqc.cgt.c cagaact acc aagtic cc.gct c ctdtcc.gtg 48O tacgtc.cagg cc.gc.ca acct gcacct cagc gtgctgaggg acgt.ca.gcgt gtttggc.ca.g 54 O aggtggggct tcgacgc.cgc cac catcaac agcc.gctaca acgacct cac Caggctgat C 6OO ggcaactaca ccaccacgc tigt cc.gctgg tacaiacactg gcctggagcg cgtctggggc 660

Cctgatticta gagactggat t cqct acaac Cagttcaggc gcgagctgac cct caccgt.c 72 O ctggacattg tdtccct citt cocqaactac gactic cc.gca cct accc.gat cogcaccgtg 78O

US 2014/O 154223 A1 Jun. 5, 2014 17

- Continued gaaggattga gcaatctota C caaatct at gcagaga.gct t cagaga.gtg ggaag.ccgat 360 cc tact aacc cagct citccg cdaggaaatg cqtattolaat t caacgacat gaacagogcc 42O ttgaccacag citatico catt gttcgcagtic cagaact acc aagttcct ct cittgtc.cgtg 48O tacgttcaag cagctaatct t cacct cagc gtgct tcgag acgttagcgt gtttgggcaa. 54 O aggtggggat t catgctgc aac catcaat agc.cgttaca acgacct tac taggctgatt 6OO ggaalactaca ccaccacgc tigttctgttgg tacaiacactg gCttggagcg ttctggggit 660 cctgatticta gagattggat tagatacaac cagttcagga gagaattgac cct cacagtt 72 O ttggacattg tdt citct citt cocqaactat gactic cagaa cct acccitat cog tacagtg 78O t cccaactta ccagagaaat citatactaac ccagttctitg agaactt.cga cqgtagcttic 84 O cgtggttctg. cccalaggt at Caaggct Co. at Caggagcc cacacttgat gga Catcttg 9 OO alacagcataa citatct acac catgcticac agaggagagt attactggit C tdgacaccag 96.O at catggcct citccagttgg attcagoggg ccc.gagttta cctitt cotct c tatggaact O2O atgggaaacg cc.gctic caca acaacgtatic gttgct Caac taggit caggg tetct acaga O8O accttgtc.tt coaccttgta cagaagaccc ttcaatat cq gitat caacaa ccagdaactt 14 O tcc.gttcttg acggaacaga gttcgccitat ggaac ct citt ctaacttgcc atcc.gctgtt 2OO tacagaaaga gcggalaccgt tatt cottg gacgaaatcc caccacagala Caacaatgtg 26 O ccacccaggc aaggattctic ccacaggttg agccacgtgt C catgttc.cg titc.cggattic 32O agcaa.cagtt cogtgagcat catcagagct c ctatgttct catggattica togtag togct 38O gagttcaa.ca atat catt co titcct citcaa at cacccaaa toccattgac caagttctact 44 O alaccttggat Ctggaact tc titcgtgaaa ggaccaggct t cacaggagg tatatt Ctt SOO agaagaactt citcctggcca gattagcacc ct cagagitta acat cactgc accactittct 560 caaagatat c gtgtcaggat t cqttacgca totaccacta acttgcaatt coacaccitcc 62O atcgacggaa ggcctatcaa t cagggtaac ttct ccdcaa C catgtcaag C9gcagcaac 68O ttgcaatc.cg gcagottcag aaccotcggit tt cactactic ctittcaactt citctaacgga 74 O t caag.cgttt to accct tag cqct catgtg ttcaattctg gcaatgaagt gtacattgac 8OO cg tattgagt ttgttgcctgc cgaagttacc titcgaggctgagtactga 848

<210s, SEQ ID NO 5 &211s LENGTH: 1992 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Promoter of Maize Ubiquitin gene <4 OOs, SEQUENCE: 5 Ctgcagtgca gcgtgacccg gtcgtgcc cc tict ctagaga taatgagcat tdatgtcta 6 O agittataaaa aattaccaca tatttitttitt gtcacacttig tittgaagtgc agitttatcta 12 O t ctittataca tatatttaaa citt tacticta cqaataatat aatctatagt act acaataa 18O tat cagtgtt ttagagaatc atataaatga acagttagac atggit ctaaa gogacaattga 24 O gtattittgac aac aggactic tacagttitta t ctittittagt gtgcatgtgt tot cotttitt 3OO ttittgcaaat agctt cacct atataatact tcatc cattt tattagtaca to catttagg 360 gtttagggitt aatggtttitt atagactaat tttitt tagta catct attitt attct attitt 42O agcct ctaaa ttaagaaaac taaaacticta ttt tagttitt tittatttaat aatttagata 48O

US 2014/O 154223 A1 Jun. 5, 2014 20

- Continued

<4 OOs, SEQUENCE: 10 ctaccc.gatc cqcaccgtgt cc 22

SEQ ID NO 11 LENGTH: 23 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer 3

< 4 OOs SEQUENCE: 11 tgcg tatt.ca attcaacgac atg 23

SEQ ID NO 12 LENGTH: 23 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer 4

<4 OOs, SEQUENCE: 12

Cttgg tagtt Ctggactg.cg aac 23

SEQ ID NO 13 LENGTH: 24 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Probe 2

<4 OOs, SEQUENCE: 13 cagogc ctitg accacagota t ccc 24

What is claimed is: 8. The method of claim 4, wherein the control of the dam 1. A method for controlling Athetis lepigone, wherein the age of Athetis lepigone to the plant does not depend on plant method comprises contacting Athetis lepigone with Cry1A ing time. protein. 9. The method of claim 4, wherein the plant is maize. 2. The method of claim 1, wherein the Cry1A protein is 10. The method of claim 3, wherein prior to the step of Cry1Ab protein. contacting, the method comprises a step to plant a transgenic 3. The method of claim 2, wherein the Cry1Ab protein is seedling that comprises a polynucleotide encoding the present in a cell that expresses the Cry1Ab protein of a plant, Cry1Ab protein. and Athetis lepigone contacts with the Cry1Ab protein by ingestion of the cell. 11. The method of claim 2, wherein the amino acid 4. The method of claim 3, wherein the Cry1Ab protein is sequence of the Cry1Ab protein comprises an amino acid present in a transgenic plant that expresses the Cry1Ab pro sequence of SEQID NO: 1 or SEQID NO: 2. tein, and Athetis lepigone contacts with the Cry1Ab protein 12. The method of claim 11, wherein the nucleotide by ingestion of a tissue of the transgenic plant; thereafter, the sequence encoding the Cry1Ab protein comprises a nucle growth of Athetis lepigone is Suppressed, and that eventually otide sequence of SEQID NO: 3 or SEQID NO: 4. leads to Athetis lepigone’s death and achieves controlling 13. A method of growth suppression of Athetis lepigone, damage of Athetis lepigone to the plant. wherein the method comprises contacting Athetis lepigone 5. The method of claim 4, wherein the transgenic plant is in with Cry1A protein. any growth periods. 14. A transgenic plant that expresses Cry1A protein. 6. The method of claim 4, the tissue of the transgenic plant is roots, leaves, stems, tassels, ears, anthers or filaments. 15. A method of growth suppression of Athetis lepigone, 7. The method of claim 4, wherein the control of the dam wherein the method comprises contacting Athetis lepigone age of Athetis lepigone to the plant does not depend on plant with the transgenic plant of claim 14 or tissues thereof. ing location. k k k k k