DOCSLIB.ORG

A Grounded Theory of Florida Aquarium Retailers

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Grounded Theory of Florida Aquarium Retailers GROUNDED THEORY OF FLORIDA AQUARIUM RETAILERS’ ACCEPTANCE OF THE GLOFISH By BRIAN PEDDIE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008 1 © 2008 Brian Peddie 2 To my wife, Susannah, in memory of her father, Phillip Herndon. 3 ACKNOWLEDGMENTS I thank my supervisory committee, my wife Susannah, my parents, Edward and Pat, and the ornamental fish retailers who participated in the study. 4 TABLE OF CONTENTS Page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES...........................................................................................................................9 LIST OF FIGURES .......................................................................................................................10 GLOSSARY OF TERMS..............................................................................................................11 ABSTRACT...................................................................................................................................13 CHAPTER 1 INTRODUCTION ..................................................................................................................15 2 MATERIALS AND METHODS ...........................................................................................21 Statement of Purpose and Research Questions.......................................................................21 Research Questions .........................................................................................................21 Qualitative Methods: Grounded Theory..........................................................................22 Grounded Theory Styles..................................................................................................23 Statement of Purpose.......................................................................................................24 Sampling.................................................................................................................................24 Implementation.......................................................................................................................25 Strengths and Weaknesses......................................................................................................27 Research Design: Quality, Reliability, and Validity ..............................................................28 Ethical Considerations and Publication Concerns..................................................................29 3 LITERATURE REVIEW .......................................................................................................31 Qualitative Research...............................................................................................................31 Theoretical Framework ...................................................................................................31 The Challenge of Social Scientific Research ..................................................................33 Qualitative Research Issues.............................................................................................36 Grounded Theory.............................................................................................................36 Present Theories......................................................................................................................42 Sociocultural and Cognitive Science Theories................................................................47 Theory of Reasoned Action.............................................................................................51 Decision-Making Theories ..............................................................................................53 Diffusion of Innovation Theories ....................................................................................56 Conclusions .....................................................................................................................58 4 RESULTS...............................................................................................................................64 Interview 1 (Pilot): The Early Adopter...................................................................................65 5 Overview .........................................................................................................................65 Location...........................................................................................................................66 Emergent Themes............................................................................................................66 Conclusions .....................................................................................................................68 Interview 2: The Well Informed Employee............................................................................70 Overview .........................................................................................................................70 Emergent Themes............................................................................................................71 Conclusions .....................................................................................................................75 Interview 3: The Aquarium Manufacturer..............................................................................77 Overview .........................................................................................................................77 Developing Families........................................................................................................78 “Playing God.”...................................................................................................... 78 Ethics..................................................................................................................... 79 Product attributes .................................................................................................. 80 Invasive species—Environmental degradation..................................................... 81 Regulation............................................................................................................. 82 Public awareness................................................................................................... 82 Conclusions .....................................................................................................................83 Interview 4: The Laconic Employee.......................................................................................84 Overview .........................................................................................................................84 Families ...........................................................................................................................85 Painted fish............................................................................................................ 85 Product attributes .................................................................................................. 86 Ethics..................................................................................................................... 88 Comparative Analysis .....................................................................................................89 Conclusions .....................................................................................................................90 Interview 5: The Marine Enthusiast ......................................................................................91 Overview .........................................................................................................................91 Product Attributes Family ...............................................................................................93 Ethics Family...................................................................................................................93 Jurassic Park Effect Family.............................................................................................95 Regulation........................................................................................................................96 Comparative Analysis .....................................................................................................97 Interview 6: The Flamboyant GloFish™ Lover .....................................................................98 Overview .........................................................................................................................98 Product Attributes Family ...............................................................................................99 Ethics Family.................................................................................................................100 Jurassic Park Effect Family...........................................................................................101 Comparative Analysis ...................................................................................................102 Interview 7: The Centrist......................................................................................................103 Overview .......................................................................................................................103
Load more

Recommended publications
  • University of Florida Thesis Or Dissertation Formatting Template
    MOTIVATIONS FOR SOCIAL MEDIA ADOPTION ALONG THE PRODUCT LIFE CYCLE By DENNIS DIPASQUALE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2017 © 2017 Dennis DiPasquale To both of my parents, for all the reasons, but especially for the support and patience as I forged a path in life different from anything either may have expected when I was born, and for the patience I suspect I inherited and that allowed me to persevere when this task became frustrating in ways it was never meant to be ACKNOWLEDGMENTS This document represents work well beyond the research toiled over to create it. It should go without saying that the patience and mentorship of my advisor Dr. Amy Jo Coffey was instrumental not only in creating this body of work, but helping me find my path as a researcher as she truly polished a rough and rusty academic. I would also like to thank Dr. Gregory Webster for sitting on an idle committee for the better part of the past five years, as well as his assistance with some of the statistical questions in forging this work. I also need to acknowledge Dr. Richard Lutz and the Marketing Department of the Warrington College of Business Administration for taking me in as one of their own and creating a new professional path that I did not expect yet absolutely relish. Finally, to the many friends, coaches, and family for being a supporting element in my life, acting as a counterbalance to the sweat and stress involved with pursuing this path.
    [Show full text]
  • Redalyc.Acceptability Engineering: the Study of User Acceptance Of€Innovative€Technologies
    Journal of Applied Research and Technology ISSN: 1665-6423 [email protected] Centro de Ciencias Aplicadas y Desarrollo Tecnológico México Kim, Hee-Cheol Acceptability engineering: the study of user acceptance of innovative technologies Journal of Applied Research and Technology, vol. 13, núm. 2, 2015, pp. 230-237 Centro de Ciencias Aplicadas y Desarrollo Tecnológico Distrito Federal, México Available in: http://www.redalyc.org/articulo.oa?id=47439895008 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative Disponible en www.sciencedirect.com Journal of Applied Research and Technology Journal of Applied Research and Technology 13 (2015) 230-237 www.jart.ccadet.unam.mx Original Acceptability engineering: the study of user acceptance of innovative technologies Hee-Cheol Kim Department of Computer Engineering, u-Healthcare & Anti-aging Research Center, Inje University, Gimhae, Gyeong-Nam, Korea Received 19 April 2014; accepted 18 August 2014 Abstract The discipline of human-computer interaction (HCI) has been vital in developing understandings of users, usability, and the design of user- centered computer systems. However, it does not provide a satisfactory explanation of user perspectives on the specialized but important domain of innovative technologies, instead focusing more on mature technologies. In particular, the success of innovative technologies requires attention to be focused on early adopters of the technology and enthusiasts, rather than general end-users. Therefore, user acceptance should be considered more important than usability and convenience.
    [Show full text]
  • THE CASE for FIRST AMENDMENT PROTECTION of BIOART in 2000
    FREEDOM TO EXPRESS A BIOLOGICAL CONSTRUCT: THE CASE FOR FIRST AMENDMENT PROTECTION OF BIOART KEITH SYVERSON INTRODUCTION In 2000, contemporary artist Eduardo Kac made international headlines by partnering with scientists at the Institut National de la Recherche Agronomique (INRA), France where together they genetically engineered an albino rabbit to express an enhanced green fluorescent protein (GFP)1 so that the rabbit would glow green when exposed to blue light.2 The entire project from its conception to the final display was intended as an artistic experiment to challenge society’s views on animal experimentation and the selective breeding of pets.3 This type of work that merges art and biology is called “BioArt.” According to Eduardo Kac, BioArt “employs one or more of the following approaches: (1) the coaching of biomaterials into specific inert shapes or behaviors; (2) the unusual or subversive use of biotech tools and processes; (3) the invention or transformation of living organisms with or without social environmental integration."4 BioArt has arguably existed for centuries.5 For example, some commentators have described the primitive methods of brewing beer in the Old Kingdom as form of BioArt.6 Similarly, the artificial selection involved in agriculture has been viewed by some as a form of 1 Frances Stracey, Bio-art: The Ethics Behind the Aesthetics, 10 NATURE REVIEWS: MOLECULAR CELL BIOLOGY 496, 499 (2009). 2 Id. 3 Id. 4 Eduardo Kac, Art That Looks You in the Eye: Hybrids, Clones, Mutants, Synthetics, and Transgenics, in SIGNS OF LIFE 1, 18 (Eduardo Kac ed., MIT Press, 2007). 5 See Edgar DaSilva, Art, Biotechnology and the Culture of Peace, 7 ELECTRONIC JOURNAL OF BIOTECHNOLOGY 130, 131-32 (2004) (arguing that the brewing reliefs in Egypt during the Old Kingdom from 2650 BC are an example of BioArt).
    [Show full text]
  • The Journal of the Catfish Study Group (UK)
    The Journal of the Catfish Study Group (UK) Planet's srnallest ~· tiSh · Js found! ,,. \nto wa\\ets · n\tor f\sh 5 "'n students turn la Microg/anis v. anegatus E· Jgenmann & H enn Volume 7 Issue Number 1 March 2006 CONTENTS 1 Committee 2 From The Chair 3 Louis Agassiz (1807- 1873) by A w Taylor. 4 Planet's smallest fish is found! 5 Breeding Scleromystax prionotus by A w Taylor 6 Meet Stuart Brown the Membership Secretary 7 Students turn janitor fish skin into wallets 7 Meet the Member 9 'What's New' March 2006 by Mark Waiters 1 0 Microglanis variegatus by Steven Grant 13 lt Seemed Mostly Normal To Me by Lee Finley 17 Map of new meeting venue - Darwen The Committee and I apologise for the late delivery of this journal but due to the lack of articles, there would have only been the advertisements to send to you. Without your information, photos or articles, there is no Cat Chat. Thank you to those of you who did contribute. Articles for publication in Cat Chat should be sent to: Bill Hurst 18 Three Pools Crossens South port PR98RA England Or bye-mail to: [email protected] with the subject Cat Chat so that I don't treat it as spam mail and delete it without opening it. car cttar March 2006 Vol 7 No 1 HONORARY COMMITTEE FOR THE CAJf,IJSIJ SlffiJIIF CltOfiJ, ffiJ•I 2005 PRESIDENT FUNCTIONS MANAGER Trevor (JT) Morris Trevor Morris trevorjtcat@aol. eo m VICE PRESIDENT Or Peter Burgess SOCIAL SECRETARY [email protected] Terry Ward [email protected] CHAIRMAN lan Fuller WEB SITE MANAGER [email protected] [email protected] VICE CHAIRMAN/TREASURER COMMITIEE MEMBER Danny Blundell Peter Liptrot [email protected] [email protected] SECRETARY SOUTHERN REP Adrian Taylor Steve Pritchard [email protected] S.
    [Show full text]
  • Genetically Modified, Red Fluorescent Zebrafish: Detection, Crossing
    Journal of Environmental Biotechnology Vol. 8, No. 2, 105–110, 2008 Original paper (regular paper) Genetically Modifi ed, Red Fluorescent Zebrafi sh: Detection, Crossing, Inheritance of Red Fluorescence, and Tolerance to Low Temperatures KIMIKO AMANUMA*, NOBUYOSHI NAKAJIMA, AKIKO H. HASHIMOTO and YASUNOBU AOKI National Institute for Environmental Studies, 16–2 Onogawa, Tsukuba, Ibaraki 305–8506, Japan * TEL: +81–(0)29–850–2390 FAX: +81–(0)29–850–2588 * E-mail: [email protected] (Received; 28 September, 2008/Accepted; 10 October, 2008) Under Cartagena Protocol domestic law, genetically modifi ed (GM) fi sh have not yet received permission to be imported or sold in Japan. However, it is anticipated that ornamental, fl uorescent GM fi sh will be imported and sold prior to any offi cial process for evaluating their eff ects on biological diversity as GM organisms (GMO). Therefore, we have devised a method for detecting GM fi sh that utilizes PCR for the detection of replication origins of plasmids that generally exist as transgenes integrated in the GMOs’ chromosomes. Using red fl uorescent zebrafi sh (rfZF), sold in Japan, and rpsL GM ZF established by us, we demonstrated the feasibility of this method for detecting GMO. Next, we examined the biological characteristics of the GM rfZF. They were able to cross with non-GM ZF; the red fl uorescence was inherited by their progeny according to expected outcomes, based on Mendelian genetics. Examination of the low temperature tolerance of rfZF and non-GM fi sh indicated that the lethal, minimum temperature was the same for both fi sh (5°C).
    [Show full text]
  • (Genetically Modified Organisms (Plants) Genetically Engineered Plants)) Why Create Transgenic Plants?
    Transgenic Plants (Genetically modified organisms (plants) Genetically engineered plants)) Why create transgenic plants? When there is no naturally occurring genetic variation for the target trait. Examples: 1. Glyphosate herbicide resistance in soybean, corn 2.Vitamin A in rice 3.Blue roses What genes to transfer? 1. One gene to a few genes - the CP4 ESPS example 2. Multiple genes - Golden Rice and Applause rose 3. In principle, any gene (or genes) ORIGIN 1 cctttcctac tcactctgga caggaacagc tgtctgcagc cacgccgcgc ctgagtgagg 61 agaggcgtag gcaccagccg aggccaccca gcaaacatct atgctgactc tgaatgggcc 121 cagtcctccg gaacagctcc ggtagaagca gccaaagcct gtctgtccat ggcgggatgc 181 cgggagctgg agttgaccaa cggctccaat ggcggcttgg agttcaaccc tatgaaggag 241 tacatgatct tgagtgatgc gcagcagatc gctgtggcgg tgctgtgtac cctgatgggg 301 ctgctgagtg ccctggagaa cgtggctgtg ctctatctca tcctgtcctc gcagcggctc CP4 EPSPS: The gene conferring resistance to the herbicide Roundup The gene was found in Agrobacterium tumefaciens and transferred to various plants Coincidentally, this organism is also used for creating transgenic plants TGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAG ATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGA CGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGACAAG CTGACTCTAGCAGATCTTTCAAGAATGGCACAAATTAACAACATGGCACAAGGGATACAAACCCTTAATCCCAATTCCAATTTCCATAAACC CCAAGTTCCTAAATCTTCAAGTTTTCTTGTTTTTGGATCTAAAAAACTGAAAAATTCAGCAAATTCTATGTTGGTTTTGAAAAAAGATTCAATT
    [Show full text]
  • Genome As a Tool of Genetic Engineering: Application in Plant and Plant Derived Medicine
    International Journal of Biotech Trends and Technology (IJBTT) – Volume 8 Issue 1- Jan - March 2018 Genome as a Tool of Genetic Engineering: Application in Plant and Plant Derived Medicine A.B.M. Sharif Hossain1,2 Musamma M. Uddin2 1Department of Biology, Faculty of Science, Hail University, Hail, KSA 2Biotechnology Program, Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603, Kuala Lumpur, Malaysia introduce point mutations. Genetically modified Abstract organism (GMO) is considered as an organism that The study was conducted from different is generated through genetic engineering. The first modern research data to review the innovative GMOs were bacteria in 1973, GM mice were generated in 1974 [4]. Insulin-producing bacteria latest technology in the genomics and its were commercialized in 1982 and genetically application in Agriculture, biomedicinae and modified food has been sold since 1994. Glofish, the plant derived medicine. Application of genome first GMO designed as a pet, was first sold in the in genetic engineering and molecular United States December in 2003 [4]. Genetic biotechnology have been exhibited well. engineering biotechnology has been applied in Genetically Modified Organism (GMO), numerous fields including agriculture, industrial Agrobacterium mediated recombination (T- biotechnology, and medicine. Enzymes used in DNA) and genetic engineering using molecular laundry detergent and medicines such as insulin and Biotechnology in plant, medicine and human growth hormone are now manufactured in biomedicine have been highlighted from GM cells, experimental GM cell lines and GM animals such as mice or zebra fish are being used for technology based different research data. research purposes, and genetically modified Moreover, molecular biotechnology in crops have been commercialized [4].
    [Show full text]
  • ED198014.Pdf
    DOCUMENT RESUME ED 198 D14 SE 034 401 AUTHOR Mauldin, Lundie: Frankenberg, Dirk TITLE North Carolina Marine Education Manual: Appendices. INSTITUTION North Carolina state Unii., Raleigh. Sea Grant Coll. SPONS AGENCY National Oceanic and Atmospheric Administration FDOC), Rockville, Md. National Sea Grant Program.: North Carolina State Dept. of Administration, Raleigh. "'PORT NO UrC-SG-7B-14-D PUB DATE Aug 78 CANT NOAA-04-5158-44054 NOTE 42p.: For related docuoents, see SE 034 397-400. AVAILABLE FROM Ur:: Sea Grant, 105 1911 Building, North Carolina State Univ., Raleigh, NC 27647 4$1.00). EDES PRICE MF01/PC62 Plus Postage. DESCRIPTORS Audiovisual Aids: Elementary Secondary Education: Environmental Education: *Field Trips: *Marine Biology: *Oceanography: *Reference Materials; *Science Education: Science Materials; Social Studies APSTRACT Presented are appendices to a series of four manuals of marine education activiLies produced by NorthCarolina teachers and college faculty under a Sea Grant projectentitled "Man and the Seacoast. Information on relevant films,periodicals, federal and state resources, games, and marine careers isprovided. Also included are directions for keeping amaT'ire aquarium, and "Shifting Sands" which is a guide to field trips along the North Carolinacoast. (WT3) ************************************************************4:*****.***** * Reproductions supplied by EDRS are the best that can be made * * from the original document. * *********************************************************************** U.S DEPARTMENT OF HEALTH. EDUCATION & WELFARE NATIONAL INSTITUTE OF EDUCATION THIS DOCUMENT HAS BEEN REPRO- C.LICED EXACTLY AS RECEIVED FROM THE PERSON OR ORGANIZATION ORIGIN- ATING IT POINTS OF VIEW OR OPINIONS STATED DO NOT NECESSARILY REPRE SENT OFFICIAL NATIONAL INSTITUTE OF EDUCATION POSITION OR POLICY Appendices North Carolina Marine Education Manual 4.
    [Show full text]
  • Which of the 'Following Is True for Golden Rice' ? (A) It Has Yellow Grains, Because of a Gene Introduced from a Primitive Varie
    NEET REVISION SERIES BIOTECHNOLOGY AND ITS APPLICATIONS Revise Most Important Questions to Crack NEET 2020 Download Doubtnut Now Q-1 - 10761395 Which of the 'following is true for Golden rice' ? (A) It has yellow grains, because of a gene introduced from a primitive variety of rice (B) It is Vitamin A enriched, with a gene from daffodil (C) It is pest resistant, with a gene from Bacillus thuringiensis (D) It is drought tolerant, developed using Agrobacterium vector CORRECT ANSWER: B SOLUTION: Gene for β carotene is taken from daffodil plant and inserted in normal rice plant to make golden rice Watch Video Solution On Doubtnut App Q-2 - 26089157 The first clinical gene therapy was done for the treatment of (A) AIDS (B) Cancer (C) Cystic fibrosis (D) SCID (Severe Combined lmmuno Deficiency) resulting from the deficiency of ADA. SOLUTION: The first clinical gene therapy was done for the treatment of SCID (Severe Combined) immuno Deficiency resulting from the deficiency of ADA. The SCID patient has a defectiv e gene for the enzyme Adenosine Deaminase (ADA). Due to which he/she lacks functional T-lymphocytes and therefore fails to fight the infecting pathogen. Watch Video Solution On Doubtnut App Q-3 - 10761356 What triggers activation of protoxin to active toxin of Bacillus thuringiensis in boll worm (A) Acidic pH of stomach (B) Body temperature (C) Moist surface of midgut (D) Alkaline pH of gut CORRECT ANSWER: D Watch Video Solution On Doubtnut App Q-4 - 18928062 Which of the flowing has the ability to transform normal cell into cancerous cell in animal (A) Arbovirus (B) Rotavirus (C) Enterovirus (D) Retrovirus CORRECT ANSWER: C Watch Video Solution On Doubtnut App Q-5 - 40481518 In nematode resistance by RNA interference, some specific genes were introduced which form dsRNA.
    [Show full text]
  • The Bio Revolution: Innovations Transforming and Our Societies, Economies, Lives
    The Bio Revolution: Innovations transforming economies, societies, and our lives economies, societies, our and transforming Innovations Revolution: Bio The The Bio Revolution Innovations transforming economies, societies, and our lives May 2020 McKinsey Global Institute Since its founding in 1990, the McKinsey Global Institute (MGI) has sought to develop a deeper understanding of the evolving global economy. As the business and economics research arm of McKinsey & Company, MGI aims to help leaders in the commercial, public, and social sectors understand trends and forces shaping the global economy. MGI research combines the disciplines of economics and management, employing the analytical tools of economics with the insights of business leaders. Our “micro-to-macro” methodology examines microeconomic industry trends to better understand the broad macroeconomic forces affecting business strategy and public policy. MGI’s in-depth reports have covered more than 20 countries and 30 industries. Current research focuses on six themes: productivity and growth, natural resources, labor markets, the evolution of global financial markets, the economic impact of technology and innovation, and urbanization. Recent reports have assessed the digital economy, the impact of AI and automation on employment, physical climate risk, income inequal ity, the productivity puzzle, the economic benefits of tackling gender inequality, a new era of global competition, Chinese innovation, and digital and financial globalization. MGI is led by three McKinsey & Company senior partners: co-chairs James Manyika and Sven Smit, and director Jonathan Woetzel. Michael Chui, Susan Lund, Anu Madgavkar, Jan Mischke, Sree Ramaswamy, Jaana Remes, Jeongmin Seong, and Tilman Tacke are MGI partners, and Mekala Krishnan is an MGI senior fellow.
    [Show full text]
  • From Disagreements to Dialogue: Unpacking the Golden Rice Debate
    Sustainability Science https://doi.org/10.1007/s11625-018-0577-y REVIEW ARTICLE From disagreements to dialogue: unpacking the Golden Rice debate Annika J. Kettenburg1,2 · Jan Hanspach1 · David J. Abson1 · Joern Fischer1 Received: 20 May 2017 / Accepted: 4 May 2018 © The Author(s) 2018 Abstract Transgenic Golden Rice has been hailed as a practical solution to vitamin A deficiency, but has also been heavily criticized. To facilitate a balanced view on this polarized debate, we investigated existing arguments for and against Golden Rice from a sustainability science perspective. In a structured literature review of peer-reviewed publications on Golden Rice, we assessed to what extent 64 articles addressed 70 questions covering different aspects of sustainability. Using cluster analysis, we grouped the literature into two major branches, containing two clusters each. These clusters differed in the range and nature of the sustainability aspects addressed, disciplinary affiliation and overall evaluation of Golden Rice. The ‘biotechnological’ branch (clusters: ‘technical effectiveness’ and ‘advocacy’) was dominated by the natural sciences, focused on biophysi- cal plant-consumer interactions, and evaluated Golden Rice positively. In contrast, the ‘socio-systemic’ branch (clusters: ‘economic efficiency’ and ‘equity and holism’) was primarily comprised of social sciences, addressed a wider variety of sustainability aspects including participation, equity, ethics and biodiversity, and more often pointed to the shortcomings of Golden Rice. There were little to no integration efforts between the two branches, and highly polarized positions arose in the clusters on ‘advocacy’ and ‘equity and holism’. To explore this divide, we investigated the influences of disciplinary affiliations and personal values on the respective problem framings.
    [Show full text]
  • Identifying Early Adopters for Emerging Digital Travel Services
    Phocuswright White Paper Identifying Early Adopters for Emerging Digital Travel Services Written and Researched by Julien Beresford and Norm Rose Phocuswright White Paper: Identifying Early Adopters for Emerging Digital Travel Services January 2016 Phocuswright thanks Cognizant for Identifying Early Adopters for Emerging Digital Travel Services. Without their active support, this research would not have been possible. About Cognizant Travel & Hospitality A leader in travel and hospitality consulting, Cognizant has developed the Cognizant Travel Ribbon® as a tool to assist airlines and other indus- try players in broadening their thinking about when and how to engage with customers. Cognizant defines the Travel Ribbon by eight essential stages of the overall travel experience, including: 1) Inspiration, 2) Plan- ning, 3) Booking, 4) Purchase, 5) Pre-trip, 6) Departure, 7) In-flight and 8) Post-trip. Learn more at: http://www.cognizant.com/travel-hospitality and http://www.cognizant.com/InsightsWhitepapers/own-the-travel-rib- bon-for-ultimate-customer-engagement.pdf. Cognizant (NASDAQ: CTSH) is a leading provider of information technol- ogy, consulting, and business process out-sourcing services, dedicated to helping the world’s leading companies build stronger businesses. Head- quartered in Teaneck, New Jersey (U.S.), Cognizant combines a passion for client satisfaction, technology innovation, deep industry and business process expertise, and a global, collaborative workforce that embod- ies the future of work. With over 100 development and delivery centers worldwide and approximately 219,300 employees as of September 30, 2015, Cognizant is a member of the NASDAQ-100, the S&P 500, the Forbes Global 2000, and the Fortune 500 and is ranked among the top performing and fastest growing companies in the world.
    [Show full text]