US 2006O198824A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2006/0198824 A1 Malcolm et al. (43) Pub. Date: Sep. 7, 2006
(54) TREATMENTS FOR FLAVIVIRIDAE VIRUS Related U.S. Application Data INFECTION (60) Provisional application No. 60/658,006, filed on Mar. (75) Inventors: Bruce A. Malcolm, Westfield, NJ (US); 2, 2005. Robert Palermo, New York, NY (US); Xiao Tong, East Brunswick, NJ (US); Publication Classification Boris Feld, New Milford, NJ (US); Hung Le, Rockaway, NJ (US) (51) Int. Cl. A 6LX 3L/7072 (2006.01) Correspondence Address: A6II 38/2 (2006.01) SCHERING-PLOUGH CORPORATION (52) U.S. Cl...... 424/85.7: 514/49; 514/50: PATENT DEPARTMENT (K-6-1, 1990) 514743 2000 GALLOPNG HILL ROAD KENILWORTH, NJ 07033-0530 (US) (57) ABSTRACT (73) Assignee: Schering Corporation The present invention provides methods for treating infec (21) Appl. No.: 11/365,008 tions, in a host, by viruses belonging to the Flaviviridae family, such as HCV, comprising administering an Ara-C (22) Filed: Mar. 1, 2006 homologue to the host. US 2006/0198824 A1 Sep. 7, 2006
TREATMENTS FOR FLAVIVRIDAE VIRUS 73:1649-1654 (1999)), and the natural product cerulenin INFECTION (Lohmann V. et al., Virology, 249: 108-118 (1998)); 0001. This application claims the benefit of U.S. provi 0014 (10) Antisense phosphorothioate oligodeoxynucle sional patent application No. 60/658,006; filed Mar. 2, 2005 otides (S-ODN) complementary to sequence stretches in which is herein incorporated by reference in its entirety. the 5' non-coding region (NCR) of the virus, or nucle otides 326-348 comprising the 3' end of the NCR and FIELD OF THE INVENTION nucleotides 371-388 located in the core coding region of 0002 The present invention comprises methods for treat the HCV RNA; ing or preventing a viral infection in Subject. 0.015 (11) Inhibitors of IRES-dependent translation: 0016 (12) Nuclease-resistant ribozymes; and BACKGROUND OF THE INVENTION 0017 (13) Miscellaneous compounds including 1-amino 0003 Viruses belonging to the Flaviviridae family alkyloyclohexanes (U.S. Pat. No. 6,034,134 to Gold et include the hepatitis C virus (HCV). The Flavivirus genus al.), alkyl lipids (U.S. Pat. No. 5,922,757 to Chokier et includes more than 68 members separated into groups on the al.), vitamin E and other antioxidants (U.S. Pat. No. basis of serological relatedness. Clinical symptoms vary and 5,922,757 to Chojkier et al.), squalene, amantadine, bile include fever, encephalitis and hemorrhagic fever. Flavivi acids (U.S. Pat. No. 5,846,964 to Ozeki et al.), ruses of global concern that are associated with human N-(phosphonoacetyl)-L-aspartic acid, (U.S. Pat. No. disease include the dengue hemorrhagic fever viruses 5,830.905 to Diana et al.), benzenedicarboxamides (U.S. (DHF), yellow fever virus, shock syndrome and Japanese Pat. No. 5,633.388 to Diana et al.), polyadenylic acid encephalitis virus. derivatives (U.S. Pat. No. 5,496,546 to Wang et al.), 2',3' dideoxyinosine (U.S. Pat. No. 5,026,687 to Yarchoan et 0004 Examples of antiviral agents that have been iden al.), and benzimidazoles (U.S. Pat. No. 5,891,874 to tified as active against the flavivirus or pestiviruses include: Colacino et al.). 0005 (1) Interferon and ribavirin; 0018. Although there are several treatments available for flaviviral infections, some flaviviral infections fail to 0006 (2) Substrate-based NS3 protease inhibitors (WO respond adequately to currently available treatments. Hence, 98/22496); there is a need to provide additional, effective methods for 0007 (3) Non-substrate-based inhibitors such as 2.4.6- treating and/or preventing Such an infection comprising trihydroxy-3-nitro-benzamide derivatives (Sudo K. et al., administration of various analogues of Ara-C. Biochemical and Biophysical Research Communications, 0.019 Ara-C ( 238:643-647 (1997); Sudo K., et al. Antiviral Chemistry and Chemotherapy, 9:186 (1998)), including RD3-4082 and RD3-4078, the former substituted on the amide with a 14 carbon chain and the latter processing a para phenoxyphenyl group; 0008 (4) Thiazolidine derivatives, which show relevant inhibition in a reverse-phase HPLC assay with an NS3/4A fusion protein and NS5A/5B substrate (Sudo K. et al., HO O Antiviral Research, 32: 9-18 (1996)), especially com pound RD-1-6250, possessing a fused cinnamoyl moiety substituted with a long alkyl chain, RD4 6205 and RD4 6193; HO ), 0009 (5) Thiazolidines and benzanilides, identified in Kakiuchi N. et al. J. FEBS Letters 421, 217-220; and an arabinofuranosylcytosine nucleoside analogue, and pro Takeshita N. et al. Analytical Biochemistry, 247: 242-246 drug analogues of Ara-C, including fosteabine (1-3-D-ara (1997); binofuranosylcytosine-5'-stearylphosphate. YNKO1), have been used effectively to treat acute myelogenous leukemia 0010 (6) A phenanthrenequinone, which possesses activ and lymphocytic leukemias (Gahrton et al., Adv. Cancer ity against protease in a SDS-PAGE and autoradiography Res. 40:255-329 (1983); Keating et al., JAMA 248:2481 assay and is isolated from the fermentation culture broth 2486 (1982): Plunkett et al., Semin. Oncol. 20:50-63 (1993); of Streptomyces sp., Sch 68631 (Chu M. et al., Tetrahe Maloisel, et al., Leukemia 16(4): 573-80 (2002); Kuhr et al., dron Letters, 37: 7229-7232 (1996)), and Sch 351633, Leuk. Res. 24(7): 583-587 (2000); Inaba et al., Gan To isolated from the fungus Penicillium griscofiuluum, which Kagaku Ryoho. 21(4): 535-538 (1994)). Moreover, Ara-C demonstrates activity in a Scintillation proximity assay; homologues, including N'-(dialkylamino)methylene deriva 0011 (7) Selective NS3 inhibitors based on the macro tives of 2'-dC have been shown in the past to be effective in molecule elgin c, isolated from leech (Qasim M. A. et al., the treatment of infections from retroviruses, including HIV Biochemistry, 36: 1598-1607 (1997)); (see e.g., Kerr et al., J. Med. Chem. 35:1996-2001 (1992); Kerr et al., J. Pharm Sci. 83(4): 582-586 and U.S. Pat. No. 0012 (8) Helicase inhibitors (U.S. Pat. No. 5,633,358); 5,051.498 and 5,886,162). 0013 (9) Polymerase inhibitors, such as nucleotide ana 0020. This invention addresses the need to identify addi logues, gliotoxin (Ferrari E. et al. Journal of Virology, tional, effective methods for treating or preventing Flaviviri US 2006/0198824 A1 Sep. 7, 2006 dae infections by providing methods using ara-C analogue Cls to Cao alkylphosphate group; R is a Cls to Cao alky compounds for the effective treatment or prevention of lphosphate group; R is a Cls to Cao alkenylphosphate Flaviviridae virus (e.g., hepatitis C virus) infections. group; or R is —OPOH ClsH7. SUMMARY OF THE INVENTION 0026. The present invention also provides a method for 0021. The present invention provides a method for (i) (i) treating a host having hepatitis C virus infection (e.g., treating a host infected with a virus which is a member of the chronic infection or acute infection) or for (ii) preventing Flaviviridae family of viruses (e.g., hepatitis C virus) or for infection of a host, with hepatitis C virus, for example, (ii) preventing infection of a host, with a virus which is a following transplantation of a liver into said host or trans member of the Flaviviridae family of viruses (e.g., hepatitis fusion of blood into said host that comprises administering, C virus), for example, following, transplantation of a liver to the host, a therapeutically effective amount of a com into said host or transfusion of blood into said host, which pound represented by structural formula II: comprises administering to said host a therapeutically effec tive amount of a compound of formula I: II
or a pharmaceutically acceptable salt thereof. 0027 in association with a therapeutically effective or a pharmaceutically acceptable salt thereof; wherein R amount of an interferon for a treatment time period and R are independently —OH or a pharmaceutically sufficient to eradicate detectable hepatitic C virus-RNA acceptable leaving group which is capable of being con and to maintain no detectable hepatitic C virus -RNA for verted into —OH, F or —CH, when the compound repre at least twelve weeks after the end of the treatment time sented by formula I is administered in vivo, and R is a period; straight or branched chain C to C alkylphosphate or a straight or branched chain Co. to Calkenylphosphate group 0028 wherein R and R are independently -OH or a or a pharmaceutically acceptable leaving group which is pharmaceutically acceptable leaving group which is capable of being converted into —OH or phosphate when capable of being converted to —OH, F or —CH, when the compound represented by formula I is administered in the compound represented by formula 11 is administered V1VO. in vivo. 0022. In an embodiment of the invention, the compound 0029. In an embodiment of the invention, a compound represented by structural formula I is administered to a host represented by structural formula 11 is administered to a in association with any other anti-viral agent as set forth in host in association with any other anti-viral agent as set forth the “Pharmaceutical Compositions' section below, for in the “Pharmaceutical Compositions' section below, for example, an interferon-alfa or a pegylated interferon-alfa: example, pegylated or unpegylated interferon alfa, e.g. including, but not limited to interferon alfa-2a, interferon selected from the group consisting of pegylated interferon alfa-2b, interferon alfa-2c, interferon alfa n-1, interferon alfa alfa-2a, pegylated interferon alfa-2b, pegylated interferon n-3, consensus interferon, pegylated interferon alfa-2a, alfa-2c, pegylated interferon alfa n-1, pegylated interferon pegylated interferon alfa-2b, pegylated interferon alfa-2c, alfa n-3, pegylated consensus interferon, interferon alfa-2a, pegylated interferon alfa n-1, pegylated interferon alfa n-3, interferon alfa-2b, interferon alfa-2c, interferon alfa n-1, pegylated consensus interferon or albumin-interferon-alpha. interferon alfa n-3, consensus interferon and albumin-inter 0023. In an embodiment, a compound comprising struc feron-alpha. tural formula I is administered to the host in association with 0030. In another embodiment of the invention a com ribavirin and/or a pegylated or unpegylated interferon. pound represented by structural formula 1 1 is administered 0024 Triple combination therapies are also within the to a host in association with ribavirin and/or a pegylated or Scope of the invention wherein a compound represented by unpegylated interferon. structural formula I is administered to a host in association 0031 Triple combination therapies are also within the with ribavirin and one or more of the interferons (pegylated Scope of the invention wherein a compound represented by or unpegylated) mentioned herein (e.g., pegylated or unp structural formula 1 1 is administered to a host in association egylated interferon alfa-2a or pegylated or unpegylated with ribavirin and one or more of the interferons (pegylated interferon alfa-2b). or unpegylated) mentioned herein (e.g., pegylated or unp 0025. In an embodiment of the invention, in a compound egylated interferon alfa-2a or pegylated or unpegylated comprising structural formula I, R=R'= OH: R is a interferon alfa-2b). US 2006/0198824 A1 Sep. 7, 2006
0032. A further embodiment of the invention comprises structural formula III is administered to a host in association administering a compound comprising structural formula 11 with ribavirin and one or more of the interferons (pegylated to a host wherein, in structural formula II, R=R'= OH. or unpegylated) mentioned herein (e.g., pegylated or unp 0033 Yet another embodiment of the invention com egylated interferon alfa-2a or pegylated or unpegylated prises methods wherein the host who is administered a interferon alfa-2b). compound comprising a structural formula II is infected 0038. The present invention provides a method for treat with multiple hepatitis C virus genotypes (e.g., genotype 1 ing a host infected with a virus which is a member of the and/or genotype 2 and/or genotype 3). Flaviviridae family of viruses (e.g., hepatitis C virus) or for preventing the infection, comprising administering to said 0034. The present invention provides a method for (i) host a therapeutically effective amount of a compound treating a host having hepatitis C virus infection (e.g., represented by formula IV chronic infection or acute infection) or for (ii) preventing infection of a host, with hepatitis C virus, for example, following transplantation of a liver into said host or trans fusion of blood into said host that comprises administering IV to the patient a therapeutically effective amount of a com pound represented by structural formula III (fosteabine; 1-B-D-arabinofuranosylcytosine-5'-stearylphosphate: YNKO1):
III
or a pharmaceutically acceptable salt thereof; wherein R and R are independently —OH or a pharmaceutically acceptable leaving group which is capable of being con verted to phosphate, —OH, For —CH, when the compound represented by formula IV is administered in vivo, wherein R is -OH, a straight or branched chain Co to C2a alky lphosphate (e.g., —OPO CH 7) or a straight or or a pharmaceutically acceptable salt thereof, optionally in branched chain Co. to C alkenylphosphate group or a association with a therapeutically effective amount of any pharmaceutically acceptable leaving group which is capable other anti-viral agent as set forth in the “Pharmaceutical of being converted into —OH, phosphate. For —CH when Compositions' section below, for example, unpegylated or the compound represented by formula IV is administered in pegylated interferon alfa (e.g., unpegylated or pegylated vivo; and wherein R' and R are independently C, to Co interferon alfa-2a, unpegylated or pegylated interferon alfa alkyl or wherein R' and R taken together with N form a C, 2b, unpegylated or pegylated interferon alfa-2c, unpegylated to C, ring represented by the following structural formula: or pegylated interferon alfa n-1, unpegylated or pegylated interferon alfa n-3 or unpegylated or pegylated consensus interferon) for a treatment time period sufficient to eradicate detectable hepatitis C virus-RNA and to maintain no detect able hepatitis C virus-RNA for at least twelve weeks after the end of the treatment time period. 0035) In one embodiment of the present invention, the pegylated interferon alfa that is administered to the host in association with a compound represented by structural for whereinn and mare independently 0, 1, 2 or 3 and Q is CH, mula III is a pegylated interferon alfa-2b wherein the NR, O, S, SO or SO; and R is independently H, C to C. amount of pegylated interferon alfa-2b that is administered alkyl or C to C acyl or wherein R' and R, taken together in the treatment time period is about 0.5 to 1.5 micrograms with the N, are represented by the structural formula: per kilogram body weight of pegylated interferon alfa-2b protein per week on a weekly basis for at least twenty-four weeks. CH 0036). In another embodiment of the invention, pegylated interferon alfa that is administered in association with com pound represented by structural formula III is a pegylated interferon alfa-2b, wherein the pegylated interferon alfa-2b is administered on a weekly basis for about forty-eight CH weeks. 0037 Triple combination therapies are also within the 0039. In an embodiment of the invention, the compound Scope of the invention wherein a compound represented by represented by structural formula IV is administered in US 2006/0198824 A1 Sep. 7, 2006
association with interferon-alfa, pegylated interferon-alfa or sufficient to eradicate detectable hepatitic C virus-RNA albumin-interferon-alpha, an interferon-alfa selected from and to maintain no detectable hepatitic C virus RNA for the group consisting of interferon alfa-2a, interferon alfa-2b. at least twelve weeks after the end of the treatment time interferon alfa-2c, interferon alfa n-1, interferon alfa n-3 and period; consensus interferon, a pegylated interferon-alfa selected from the group consisting of pegylated interferon alfa-2a, 0044) wherein R is -OH, a straight or branched chain pegylated interferon alfa-2b, pegylated interferon alfa-2c, C, to C alkylphosphate (e.g., -OPO, Cis.H.) or a pegylated interferon alfa n-1, pegylated interferon alfa n-3, straight or branched chain Co. to C alkenylphosphate or pegylated consensus interferon or any combination group or a pharmaceutically acceptable leaving group thereof. which is capable of being converted into —OH, phos 0040. In an embodiment of the invention, the compound phate, F or —CH, when the compound represented by represented by formula IV is further administered in asso formula V is administered in vivo, and wherein R' and R' ciation with ribavirin. are independently C, to Clo alkyl or wherein R' and R' 0041. In an embodiment of the invention, in the com taken together with N form a C to C, ring represented by pound of structural formula IV, R=R=R= -OH: R' and Rare C-C alkyl; R and Rare isopropyl; R and R' the following structural formula: taken together with N are represented by the structural formula: r"),(CH2) N (CH2) l/ whereinn and mare independently 0, 1, 2 or 3 and Q is CH, NR, O, S, SO or SO; and R is independently H, C to C. wherein n and mare independently 0, 1, 2 or 3 and Q is CH, alkyl or C to Coacyl or wherein RandR, taken together NR, O, S, SO or SO; and R is independently H, C to C. with the N, are represented by the structural formula: alkyl or C, to C acyl: or R' and R taken together with N are represented by the following structural formula: CH3 CH3
CH3 CH3 0045. In an embodiment of the invention, the interferon 0042. The present invention provides a method for treat that is administered is pegylated interferon alfa and is ing a host having a hepatitis C virus infection or for selected from the group consisting of pegylated interferon preventing the infection that comprises administering, to the alfa-2a, pegylated interferon alfa-2b, pegylated interferon host, a therapeutically effective amount of a compound alfa-2c, pegylated interferon alfa n-1, pegylated interferon represented by structural formula V: alfa n-3, pegylated consensus interferon, interferon alfa-2a, interferon alfa-2b, interferon alfa-2c, interferon alfa n-1, interferon alfa n-3 and consensus interferon.
0046. In an embodiment of the invention, the compound represented by formula V is administered in association with ribavirin. In an embodiment of the invention, R= -OH.7 0047. In an embodiment of the invention, the host is infected with multiple hepatitis C virus genotypes (e.g., hepatitis C virus genotype 1 and/or hepatitis C virus geno type 2 and/or hepatitis C virus genotype 3). 0048. The present invention provides a method for treat ing a host having a hepatitis C virus infection or for preventing the infection that comprises administering to the or a pharmaceutically acceptable salt thereof. host a therapeutically effective amount of a compound 0.043 in association with a therapeutically effective represented by a structural formula selected from the group amount of an interferon for a treatment time period consisting of: US 2006/0198824 A1 Sep. 7, 2006
-continued
VI e X
b >'sN N HO O 21 HO 1. O N HO HO O HO VII 1N N 1N s
u) XI
N VIII 2 es N HO O N21 HO 1, HO HO Q O XII 1N1\1\-1N, IX O s e e es 1s. US 2006/0198824 A1 Sep. 7, 2006
-continued -continued XIII XVII N-1-1-1 s
N2 dir N21
O O1. N HO-P-O O HO O HO O HO
HO HO XVIII XIV 1N1\1\-1a s
N 2 N s dir N21 Ne O O1. N N21 HO-P-O O | HO es. O HO O HO HO XIX
HO >1 s XV
N1 N e 2 N dir N21
O O1. N t N21 HO-P-O O | HO O O1. N O HO-P-O O | HO O HO XX HO XVI 1n 1 O
N e N e dir N21 ir N21
O O1. N O O1. N HO-P-O O HO-P-O O | HO | HO O
HO HO US 2006/0198824 A1 Sep. 7, 2006
0049. In an embodiment of the invention, a compound -continued selected from structural formulas VI-XXIII is administered XXI to the host in association ribavirin. 0050. The present invention provides a method for pre venting infection of a host, with a virus which is a member of the Flaviviridae family of viruses (e.g., hepatitis C virus), CN following transplantation of a liver into said host or trans fusion of blood into said host or for treating the infection in N2 the host comprising administering to said host a therapeu tically effective amount of a compound represented by C18H37 N21 structural formula IV: O O1. N IV HO-P-O O | HO O
HO XXII
and N
N2
C18H37 N21 or a pharmaceutically acceptable salt thereof; wherein R O and R are independently —OH or a pharmaceutically O1. N acceptable leaving group which is capable of being con HO-P-O O HO verted to phosphate, —OH, For —CH, when the compound O represented by formula IV is administered in vivo, wherein R is -OH, a straight or branched chain Co to C2a alky HO lphosphate (e.g., —OPO CH 7) or a straight or XXIII branched chain Co. to C alkenylphosphate group or a pharmaceutically acceptable leaving group which is capable of being converted into —OH, phosphate. For —CH when the compound represented by formula IV is administered in N vivo and wherein R' and R are independently C, to Co alkyl or wherein R' and R taken together with N form a C, N2 to C, ring represented by the following structural formula:
C18H37 N21 O O N HO-P-O O | HO O whereinn and mare independently 0, 1, 2 or 3 and Q is CH, HO NR, O, S, SO or SO; and R is independently H, C to C. alkyl or C to C acyl or wherein R' and R, taken together with the N, are represented by the structural formula: or a pharmaceutically acceptable salt thereof. In an embodi ment of the invention, a compound selected from structural formulas VI-XXIII is administered to the host in association CH with any other anti-viral agent as set forth in the “Pharma ceutical Compositions' section below, for example, one or more members selected from the group consisting of pegy lated interferon alfa-2a, pegylated interferon alfa-2b, pegy lated interferon alfa-2c, pegylated interferon alfa n-1, pegy lated interferon alfa n-3, pegylated consensus interferon, CH interferon alfa-2a, interferon alfa-2b, interferon alfa-2c, interferon alfa n-1, interferon alfa n-3 and consensus inter 0051. In an embodiment of the invention, the compound feron. represented by formula IV is administered in association US 2006/0198824 A1 Sep. 7, 2006
with any other anti-viral agent as set forth in the “Pharma alkylphosphate or a straight or branched chain Co. to Ca ceutical Compositions' section below, for example, inter alkenylphosphate group or a pharmaceutically acceptable feron-alfa, pegylated interferon-alfa, albumin-interferon-al leaving group which is capable of being converted into pha, interferon alfa-2a, interferon alfa-2b, interferon alfa-2c, —OH, phosphate, F or —CH when the compound repre interferon alfa n-1, interferon alfa n-3, consensus interferon, pegylated interferon alfa-2a, pegylated interferon alfa-2b. sented by formula IV is administered in vivo and wherein R' pegylated interferon alfa-2c, pegylated interferon alfa n-1, and Rare independently C to Co alkyl or wherein R' and pegylated interferon alfa n-3, or pegylated consensus inter R taken together with N form a C to C, ring represented by feron. the following structural formula: 0.052 In an embodiment of the invention, the compound represented by formula IV is administered in association with ribavirin. (CH2)m 0053. In an embodiment of the invention, in the com pound represented by formula IV: R=R= -OH: r"), R=R=R= -OH: R and Rare C-C alkyl; R and R. N (CH2) l/ are isopropyl; R' and R taken together with N are repre sented by the structural formula: whereinn and mare independently 0, 1, 2 or 3 and Q is CH, NR, O, S, SO or SO; and R is independently H, C to C. (CH2) alkyl or C to Ce acyl or wherein R' and R, taken together ?y with the N, are represented by the structural formula: N (CH2) l/ wherein n and mare independently 0, 1, 2 or 3 and Q is CH, CH3 NR, O, S, SO or SO; and R is independently H, C to C. alkyl or C to C acyl: or R' and R taken together with N are represented by the following structural formula:
CH3 CH optionally in association with any other anti-viral agent as set forth in the “Pharmaceutical Compositions' section below, for example, one or more members selected from the CH group consisting of pegylated interferon alfa-2a, pegylated interferon alfa-2b, pegylated interferon alfa-2c, pegylated interferon alfa n-1, pegylated interferon alfa n-3, pegylated 0054 The present invention provides a composition rep consensus interferon, interferon alfa-2a, interferon alfa-2b. resented by formula IV interferon alfa-2c, interferon alfa n-1, interferon alfa n-3 and consensus interferon. In an embodiment of the invention, the compound is represented by a structural formula selected IV from the group consisting of:
XV N1
N2
C18H37 N21 O O1. N or a pharmaceutically acceptable salt thereof; wherein R HO-P-O O and R are independently —OH or a pharmaceutically HO acceptable leaving group which is capable of being con O verted to phosphate, —OH, - F or —CH when the com pound represented by formula IV is administered in vivo, HO wherein R is —OH, a straight or branched chain C to C. US 2006/0198824 A1 Sep. 7, 2006
-continued -continued XX
XVI 11N, N
N2 N2 dir N21 dir N21 O N HO-P-O O O O1. N | HO HO-P-O O O | HO O HO XXI XVII HO O N-1-1-1 2 N N N2 dir N21 ir N21
O N O O1. N HO-P-O O HO-P-O O | HO | HO O O
HO HO XXII XVIII 1N1-1N1-S and e N N N2 ir N21 als N21
O N O O1. N HO-P-O O HO-P-O O | HO | HO O O
HO HO XXIII >1 XIX N s
N e N2 dir Na ir N21 O 1. O N O 1. HO-P-O O O N HO HO-P-O O O | HO O HO HO US 2006/0198824 A1 Sep. 7, 2006 10
0.055 The present invention also provides a compound of 0057 hepatitis C virus (isolate 1) formula I: 0.058 hepatitis C virus (isolate BK) 0059) hepatitis C virus (isolate EC1) 0060 hepatitis C virus (isolate EC10) 0061 hepatitis C virus (isolate HC-J2) 0062) hepatitis C virus (isolate HC-J5) 0063 hepatitis C virus (isolate HC-J6) 0064 hepatitis C virus (isolate HC-J7) 0065 hepatitis C virus (isolate HC-J8) 0.066 hepatitis C virus (isolate HC-JT) 0067 hepatitis C virus (isolate HCT18) or a pharmaceutically acceptable salt thereof; wherein R 0068 hepatitis C virus (isolate HCT27) and R are independently –OH or a pharmaceutically 0069 hepatitis C virus (isolate HCV-476) acceptable leaving group which is capable of being con 0070 hepatitis C virus (isolate HCV-KF) verted into —OH, F or —CH, when the compound repre sented by formula I is administered in vivo, and R is a 0071 hepatitis C virus (isolate Hunan) straight or branched chain Co. to C alkylphosphate or a 0072 hepatitis C virus (isolate Japanese) straight or branched chain Co. to Calkenylphosphate group or a pharmaceutically acceptable leaving group which is 0073 hepatitis C virus (isolate Taiwan) capable of being converted into —OH or phosphate when 0074 hepatitis C virus (isolate TH) the compound represented by formula I is administered in Vivo: in association with any other anti-viral agent as set 0075 hepatitis C virus isolate H forth in the "Pharmaceutical Compositions” section below, 0.076 hepatitis C virus type 1 for example, one or more members selected from the group 0.077 hepatitis C virus type 1 a consisting of pegylated interferon alfa-2a, pegylated inter feron alfa-2b, pegylated interferon alfa-2c, pegylated inter 0078 hepatitis C virus strain H77 feron alfa n-1, pegylated interferon alfa n-3, pegylated 0079 hepatitis C virus type 1b consensus interferon, interferon alfa-2a, interferon alfa-2b. interferon alfa-2c, interferon alfa n-1, interferon alfa n-3 and 0080 hepatitis C virus type 1c consensus interferon. In an embodiment, the compound 0081 hepatitis C virus type 1d represented by structural formula I is represented by the 0082) hepatitis C virus type 1e following structural formula: NH 0.083 hepatitis C virus type 1 f 0084 hepatitis C virus type 10 III 0085 hepatitis C virus type 2
0.086 hepatitis C virus type 2a 0087 hepatitis C virus type 2b 0088 hepatitis C virus type 2c 0089 hepatitis C virus type 2d 0090 hepatitis C virus type 2f 0.091 hepatitis C virus type 3 0092 hepatitis C virus type 3a 0093 hepatitis C virus type 3b DETAILED DESCRIPTION OF THE 0094 hepatitis C virus type 3g INVENTION 0.095 hepatitis C virus type 4 0056. The present invention provides compositions and 0.096 hepatitis C virus type 4a methods or treating or preventing an infection by a virus 0097 hepatitis C virus type 4c which is a member of the Flaviviridae family in a host. For example, the present invention includes, but is not limited to 0.098 hepatitis C virus type 4d methods for treating or preventing infections caused by 0099 hepatitis C virus type 4f members of the Hepacivirus genus which includes the hepatitis C virus (HCV). HCV includes several types, sub 0100 hepatitis C virus type 4h types and isolates: 0101 hepatitis C virus type 4k US 2006/0198824 A1 Sep. 7, 2006 11
0102) hepatitis C virus type 5 0116 (a) elevated ALT, 0103 hepatitis C virus type 5a 0117 (b) positive test for anti-HCV antibodies, 0104 hepatitis C virus type 6 0118 (c) presence of HCV as demonstrated by a positive 0105 hepatitis C virus type 6a test for HCV-RNA, 0106 hepatitis C virus type 7 0119) (d) clinical stigmata of chronic liver disease, 0107 hepatitis C virus type 7a 0120 (e) hepatocelluar damage. 0108) hepatitis C virus type 7b 0121 A patient or host suffering from an infection by a Flaviviridae virus, such as HCV (e.g., a chronic or acute 0109) hepatitis C virus type 8 HCV infection), can be treated by administering to the patient a compound represented by structural formula I: 0110 hepatitis C virus type 8a 0111. The present invention also includes methods for treating or preventing infection caused by members of the Flavivirus genus. The Flavivirus genus includes Yellow fever virus; Tick-borne viruses such as the Gadgets Gully virus, Kadam virus, Kyasanur Forest disease virus, Langat virus, Omsk hemorrhagic fever virus, Powassan virus, Royal Farm virus, Karshi virus, Tick-borne encephalitis virus, Neudoerfl virus, Sofin virus, Louping ill virus and the Negishi virus; seabird tick-borne viruses such as the Meaban virus, Saumarez Reef virus, and the Tyuleniy virus; mos quito-borne viruses such as the Aroa virus, BuSSuquara virus, Iguape virus and the Naranjal virus; Dengue viruses Such as the Dengue virus and the Kedougou virus; Japanese encephalitis viruses such as the Cacipacore virus, Koutango virus, Japanese encephalitis virus, Murray Valley encepha or a pharmaceutically acceptable salt thereof. litis virus, Alfuy virus, St. Louis encephalitis virus. Usutu 0122) Rand Rare independently —OH or a pharma virus, West Nile virus, Kunjin virus and the Yaounde virus: ceutically acceptable leaving group which is capable of Kokobera viruses such as the Kokobera virus and the being converted to phosphate, —OH, - F or —CH when Stratford virus; Ntaya viruses such as the Bagaza virus, the compound represented by formula I is administered in Ilheus virus, Rocio virus, Israel turkey meningoencephalo V1VO. myelitis virus, Ntaya virus and the Tembusu virus; Spond weni viruses such as the Zika virus and the Spondweni virus: 0123 R is a straight or branched chain Co. to Ca Yellow fever viruses such as the Banzi virus, Bouboui virus, alkylphosphate (e.g., Co. Co, C1, C12, C1s, C14, C1s, C16. Edge Hill virus, Jugra virus, Saboya virus, Potiskum virus, C7, C8, C19. Co., C21, C22, C2s or C24 alkylphosphate, Sepik virus, Uganda S virus, Wesselsbron virus and the including C to Co alkylphosphate or Cs to Co alkylphos Yellow fever virus; Entebbe viruses such as the Entebbe bat phate) or straight or branched chain Co. to Calkenylphos virus, Sokoluk virus, and the Yokose virus; Modoc viruses phate (e.g., Co, Co: C, C12, C13, C14, C1s, C6, C7, Cls. Such as the Apoi virus, Cowbone Ridge virus, Jutiapa virus, C19. Co., C21, C22, C2s or C24 alkenylphosphate, including Modoc virus, Sal Vieja virus and the San Perlita virus; Rio Cs to Coalkenylphosphate) group or a pharmaceutically Bravo viruses such as the Bukalasa bat virus, Carey Island acceptable leaving group which is capable of being con virus, Dakar bat virus, Montana myotis leukoencephalitis verted to —OH or phosphate when the compound repre virus, Phnom Penh bat virus, Batu Cave virus, Rio Bravo sented by formula I is administered in vivo. virus, Tamana bat virus, and the Cell fusing agent virus. 0.124 For example, the compound can be represented by 0112 The present invention includes methods for treating structural formula II: or preventing infection caused by members of the Pestivirus genus. The Pestivirus genus includes, Border disease virus (sheep), Bovine viral diarrhea virus 1, Bovine viral diarrhea II virus 2, Classical swine fever virus, and Hog cholera virus. 0113 Moreover, the present invention includes methods for treating or preventing infections caused by Hepatitis G virus or Hepatitis GB virus-A, B or C. 0114. A “host”, “subject' or “patient may be any organ ism, Such as a mammal (e.g., primate, dog, cat, cow, horse, pig, goat, rat, mouse, bird), preferably a human. 0115) A person suffering from chronic hepatitis C infec tion may exhibit one or more of the following signs or symptoms: US 2006/0198824 A1 Sep. 7, 2006
0125 The compound represented by structural formula II is also known as Fosteabine and as YNK01. Fosteabine is an orally active derivative of cytarabine which is sold by Nippon Kayaku Co. Ltd. (Tokyo, Japan). VI 0126 Furthermore, a patient suffering from an infection by a flaviviridae virus, such as HCV (e.g., a chronic HCV infection), can be treated by administering to the patient a compound represented by structural formula IV:
IV HO O
HO
VII
or a pharmaceutically acceptable salt thereof. 0127 R and R are independently -OH or a pharma HO O ceutically acceptable leaving group which is capable of being converted to —F, —CH, OH or phosphate when the compound represented by formula IV is administered in HO vivo, wherein R is -OH, a straight or branched chain Co. to C alkylphosphate (e.g., —OPO CH, or as VIII described above) or a straight or branched chain C to Ca alkenylphosphate group (e.g., as described above) or a pharmaceutically acceptable leaving group which is capable of being converted into —OH, phosphate. For —CH when the compound represented by formula IV is administered in vivo and wherein R' and R are independently C, to Co alkyl or R' and R taken together with the N form a C, to C, ring represented by the following structural formula: HO O
?ity(CH2)m N (CH2) l/ wherein n and mare independently 0, 1, 2 or 3 and Q is CH, NR, S, SO or SO, and R is independently H, C, to C alkyl or acyl. Such compounds are discussed for example, in Kerr et al., J. Pharm Sci. 83(4):582-586 (1994). HO O 0128. In an embodiment of the invention, a compound represented by structural formula VI, VII, VIII, IX, X, XI, XII, XIII, XIV, XV, XVI, XVI, XVII, XVIII, XIX, XX, XXI, HO XXII or XXIII: US 2006/0198824 A1 Sep. 7, 2006 13
-continued -continued >1 XIV
N e
N es1) HO O HO
XI HO
XV N1
N2 dir N21
O O1. N HO-P-O O | HO O XII
HO XVI 1N1-S
N2 dir N21
O O1. N HO-P-O O | HO O
XIII HO XVII N-1a1n-1
N2
C18H37 N21 US 2006/0198824 A1 Sep. 7, 2006
-continued -continued XVIII
1-1-1N1-S XXII
Ne and N C18H37 N21 N2 O O1. N HO-P-O O C18H37 N21 | HO O O O1. N HO-P-O O HO | HO XIX O >1 HO
N2 XXIII C18H37 N21 O O1. N N HO-P-O O | HO 2 O N
HO C18H37 N21 XX O O N HO-P-O O | HO O O 2 N HO
C18H37 N21 can be administered to a host suffering from a Flaviviridae O O1. N (e.g., HCV) infection (e.g., chronic HCV infection). HO-P-O O | HO 0129. A compound represented by a structural formula O selected from I-XXIII can also be administered to a patient in association with one or more other anti-viral agents such HO XXI as pegylated or unpegylated interferon alfa-2a, pegylated or unpegylated interferon alfa-2b, pegylated or unpegylated interferon alfa-2c, pegylated or unpegylated interferon alfa n-i, pegylated or unpegylated interferon alfa n-3 or pegy ON lated or unpegylated consensus interferon. N2 0.130) “Phosphate” refers to - O POH, or any of its corresponding ions. C18H37 N21 0131 The term “alkyl as used herein means straight and O O1. N branched carbon chains of one to twenty four carbons (e.g., HO-P-O O C1, C2. Cs. C4. Cs. Cs. C7, Cs. C9, Co. C11. C12, C13. C14. | HO O Cls, C6, C7, C8, C19. Cao C21, C22, C2s or C24). 0132) “Alkylphosphate” is —O POH-alkyl or any of HO its corresponding ions. US 2006/0198824 A1 Sep. 7, 2006
0133) The term “alkenyl' or “alkene' as used herein means straight and branched chain alkyl groups containing at least one carbon-carbon double bond and two to twenty O O four carbons (e.g., C2, Cs, C4, Cs, Co., C7, C8, Co. Co. Cl inus +HN C12, C13, C14, C1s, C16, C7, C8, C19, C20. C2C22C23 or C24). 5 Y 0134) “Alkenylphosphate' is —O—POH-alkene or any of its corresponding ions. wherein Y=H, CH, CHCH. : CHCHCH : MeCH-; MeCHCH. : CHCH-CH(Me)-PhCH : 0135 The term “aryl' represents a carbocyclic group HOOCCHCH ; HSCH. ; HOOCCH : (e.g., monocyclic or multicyclic) containing from 6 to 15 MeSCHCH. : HOCH-; carbon atoms and having at least one aromatic ring (e.g., phenyl ring or naphthyl ring). CH o 0136. As used herein, the term "heteroaryl refers to an CH aryl group having one or more heteroatoms in the aromatic N Y rings (e.g., N, O or S). H s HO s 0137) The term “arylalkyl or “aralkyl as used herein CH means an alkyl group Substituted by an aryl group. HN N 0138. The term “cycloalkyl as used herein means car Na bocyclic rings of three to twelve carbons, preferably three to seven carbons and more preferably three to six carbons or Y is HN(CH) or CHCH(OH)—; or a pharmaceu optionally substituted by one or more double bonds. tically acceptable salt thereof; 0139 “Acyl' means a radical of a carboxylic acid having 0142 or Y taken together with the a carbon and N form the formula. alkyl-C(O)—, aryl-C(O)—, aralkyl-C(O)—, (C-C)cycloalkyl-C(O)—, (C-C)cycloalkyl-(C- OH C.)alkyl-C(O)—, and heteroaryl-C(O) , wherein alkyl, aralkyl and heteroaryl are as defined herein: aryl is phenyl or naphthyl; and aralkyl is aryl-(C-C)alkyl, wherein aryl is as defined above. O NH 0140 Methyl is —CH. Ethyl is —CH2—CH n-propyl O 4 N. O is —CHCHCH. i-propyl is —CH (CH). n-butyl is OH SH SH —CHCHCHCH. 0141. The term “pharmaceutically acceptable leaving group' refers to a leaving group which, when administered to a host in accordance with the invention, is non-toxic and 4\ O 4N includes amino acids residues, carbohydrate residues, pep tide residues and cholesterol residues or a pharmaceutically acceptable salt thereof. A pharmaceu tically acceptable peptide residue leaving group can be, for example, a combination of two or more of the amino acids set forth above (e.g., dipeptide or tripeptide). Fur thermore, a pharmaceutically acceptable carbohydrate residue leaving group can be, for example, a monosac charide Such as glucose
For example, an amino acid pharmaceutically acceptable leaving group can be a natural or unnatural C.-amino acid residue: US 2006/0198824 A1 Sep. 7, 2006 16 or galactose 0144. The scope of the present invention also includes compounds represented by structural formula IV:
IV
or a combination of two or more monosaccharides such as lactose or a pharmaceutically acceptable salt thereof; wherein R and R are independently —OH or a pharmaceutically acceptable leaving group which is capable of being con verted to phosphate, —OH, For —CH, when the compound OH represented by formula IV is administered in vivo, wherein OH H R is a straight or branched chain Co to C2a alkylphosphate O (e.g., —OPO CH7) or a straight or branched chain Co HHO to C alkenylphosphate group and wherein R' and R are H OH independently C, to Co alkyl or wherein R' and R taken H H together with N form a C to C, ring represented by the following structural formula:
O SUCOS
OH whereinn and mare independently 0, 1, 2 or 3 and Q is CH, NR, O, S, SO or SO; and R is independently H, C to C. O OH alkyl or C to Ce acyl or wherein R' and R, taken together HOHO with the N, are represented by the structural formula: OH OH O O O ) CH3 OH
Synthesis of the compounds of the invention, comprising CH3 Such leaving groups can be done by any practitioner of ordinary skill in the art (see, for example, Protective Groups in Organic Synthesis, by Theodora W. Greene, along with pharmaceutical compositions thereof which fur Peter G. M. Wuts; John Wiley & Sons, Inc. New York ther comprise a pharmaceutically acceptable carrier. Also (1991)). within the scope of the present invention is any compound represented by a structural formula selected from the group 0143) In a liver transplantation procedure, the donor liver consisting of XV-XXIII along with pharmaceutically accept can come from a living donor (i.e., living donor liver able salts thereof and pharmaceutical compositions thereof transplantation (LDLT)) wherein a portion of the donors further comprising a pharmaceutically acceptable carrier. liver is removed and introduced into the recipient. Alterna 0145 The scope of the present invention also includes tively, the transplant can be from a deceased donor wherein compositions comprising a compound represented by struc the entire liver is removed and transplanted. tural formula 1: US 2006/0198824 A1 Sep. 7, 2006 17
whereinn and mare independently 0, 1, 2 or 3 and Q is CH, NR, O, S, SO or SO; and R is independently H, C to C. alkyl or C to C acyl or wherein R' and R, taken together with the N, are represented by the structural formula: or a pharmaceutically acceptable salt thereof; wherein R CH and R are independently —OH or a pharmaceutically acceptable leaving group which is capable of being con verted into phosphate. —OH, F or —CH, when the com pound represented by formula I is administered in Vivo, and R" is a straight or branched chain Co to C2a alkylphosphate CH or a straight or branched chain Co. to C alkenylphosphate group or a pharmaceutically acceptable leaving group which is capable of being converted into —OH or phosphate when (e.g., any compound represented by a structural formula the compound represented by formula I is administered in selected from VI-XXIII) optionally in association with one Vivo: ) in association with one or more other anti-viral or more further anti-viral Substances (e.g., a kit) for Substances (e.g., a kit), for example, any other anti-viral example, any other anti-viral agent disclosed under the agent disclosed under the “Pharmaceutical Compositions' "Pharmaceutical Compositions' section below including, section below, including, but by no means limited to, rib but by no means limited to, ribavirin, PEG-interferon alfa avirin, PEG-interferon alfa-2a, PEG-interferon alfa-2b, 2a, PEG-interferon alfa-2b, interferon alfa-2a or interferon interferon alfa-2a or interferon alfa-2b or any other anti-viral alfa-2b or any other anti-viral substance described infra; Substance described infra; along with pharmaceutical com along with pharmaceutical compositions thereof further positions thereof further comprising a pharmaceutically comprising a pharmaceutically acceptable carrier. acceptable carrier or a compound represented by structural formula IV: Pharmaceutical Compositions 0146 The present invention includes methods for using a pharmaceutical composition comprising a compound of the IV present invention (e.g., compound represented by a formula selected from I-XXIII) and a pharmaceutically acceptable carrier for treating a Flaviviridae infection. The pharmaceu tical compositions may be prepared by any methods well known in the art of pharmacy; see, e.g., Gilman, et al., (eds.) (1990), The Pharmacological Bases of Therapeutics, 8th Ed., Pergamon Press: A. Gennaro (ed.), Remington's Phar maceutical Sciences, 18th Edition, (1990), Mack Publishing Co., Easton, Pa.; Avis, et al., (eds.) (1993) Pharmaceutical Dosage Forms. Parenteral Medications Dekker, New York; Lieberman, et al., (eds.) (1990) Pharmaceutical Dosage Forms. Tablets Dekker, New York; and Lieberman, et al., (eds.) (1990), Pharmaceutical Dosage Forms. Disperse or a pharmaceutically acceptable salt thereof; wherein R Systems Dekker, New York. and R are independently —OH or a pharmaceutically 0147 A pharmaceutical composition containing a com acceptable leaving group which is capable of being con pound of the present invention (e.g., represented by a verted to phosphate. —OH, For —CH when the compound formula selected from I-XXIII) can be prepared using con represented by formula IV is administered in vivo, wherein ventional pharmaceutically acceptable excipients and addi R is -OH, a straight or branched chain Co to C2a alky tives and conventional techniques. Such pharmaceutically lphosphate (e.g., —OPO CH 7) or a straight or acceptable excipients and additives include non-toxic com branched chain Co. to C alkenylphosphate group or a patible fillers, binders, disintegrants, buffers, preservatives, pharmaceutically acceptable leaving group which is capable anti-oxidants, lubricants, flavorings, thickeners, coloring of being converted into —OH, phosphate. For —CH, when agents, emulsifiers and the like. All routes of administration the compound represented by formula IV is administered in are contemplated including, but not limited to, parenteral vivo; and wherein R' and R are independently C to Co (e.g., Subcutaneous, intravenous, intraperitoneal, intramus alkyl or wherein R' and R taken together with N form a C, cular) and non-parenteral (e.g., oral, transdermal, intranasal, to C, ring represented by the following structural formula: intraocular, Sublingual, inhalation, rectal and topical). US 2006/0198824 A1 Sep. 7, 2006
0148 Unit forms of administration include oral forms acid, for example, together with trichlorofluoromethane, Such as tablets, capsules, powders, cachets, granules and dichlorofluoromethane, dichlorotetrafluoroethane or any Solutions or Suspensions, Sublingual and buccal forms of other biologically compatible propellant gas; it is also pos administration, aerosols, implants, Subcutaneous, intramus sible to use a system containing a compound of the present cular, intravenous, intranasal, intraocular, Subcutaneous or invention (e.g., represented by a formula selected from rectal forms of administration. I-XXIII), by itself or associated with an excipient, in powder 0149 When a solid composition is prepared in the form form. of tablets, e.g., a wetting agent such as sodium lauryl Sulfate 0159. A compound of the present invention (e.g., repre can be added to micronized or non-micronized compounds sented by a formula selected from I-XXIII) can also be and mixed with a pharmaceutical vehicle Such as silica, formulated as microcapsules or microspheres, e.g., lipo gelatin starch, lactose, magnesium Stearate, talc, gum arabic Somes, optionally with one or more carriers or additives. or the like. The tablets can be coated with Sucrose, various polymers, or other appropriate Substances. Tablets can be 0.160 Implants are among the prolonged release forms treated so as to have a prolonged or delayed activity and so which can be used in the case of chronic treatments. They as to release a predetermined amount of active principle can be prepared in the form of an oily suspension or in the continuously or at predetermined intervals, e.g., by using form of a suspension of microspheres in an isotonic medium. ionic resins and the like. 0.161 Methods of the present invention can include 0150. A preparation in the form of gelatin capsules may administration of a compound of the present invention (e.g., be obtained, e.g., by mixing a compound of the present represented by a formula selected from I-XXIII) in associa invention (e.g., represented by a formula selected from tion with, for example, one or more other anti-viral agents. I-XXIII) with a diluent, Such as a glycol or a glycerol ester, The administration and dosage of Such agents is typically as and incorporating the resulting mixture into soft or hard according to the schedule listed in the product information gelatin capsules. sheet of the approved agents, in the Physicians' Desk Reference 2003 (Physicians' Desk Reference, 57th Ed); 0151. A preparation in the form of a syrup or elixir can Medical Economics Company; ISBN: 1563634.457; 57th contain a compound of the present invention (e.g., repre edition (November 2002), as well as therapeutic protocols sented by a formula selected from I-XXIII), e.g., with a well known in the art. Furthermore, the present invention Sweetener, methylparaben and propylparaben as antiseptics, includes compositions comprising a compound represented flavoring agents and an appropriate color. by structural formula IV (e.g., as described herein) in 0152 Water-dispersible powders or granules can contain association with one or more other anti-viral agents (e.g., a compound of the present invention (e.g., represented by a any of those described herein); in an embodiment of the formula selected from I-XXIII) mixed, e.g., with dispers invention, the compound represented by structural formula ants, wetting agents or Suspending agents, such as polyvi IV is a compound represented by a structural formula nylpyrrolidone, as well as with Sweeteners and/or other selected from the group consisting of formulas VI-XXIII. flavoring agents. 0162 Suitable other anti-viral agents include, but are not 0153. Rectal administration may be provided by using limited to, pegylated or unpegylated interferon alfa-2a, Suppositories which may be prepared, e.g., with binders pegylated or unpegylated interferon alfa-2b, pegylated or melting at the rectal temperature, for example cocoa butter unpegylated interferon alfa-2c, pegylated or unpegylated or polyethylene glycols. interferon alfa n-1, pegylated or unpegylated interferon alfa 0154 Parenteral, intranasal or intraocular administration n-3 and pegylated, unpegylated consensus interferon or may be provided by using, e.g., aqueous Suspensions, iso albumin-interferon-alpha. tonic saline solutions or sterile and injectable solutions 0.163 The term “interferon alpha' as used herein means containing pharmacologically compatible dispersants and/or the family of highly homologous species-specific proteins solubilizers, for example, propylene glycol or polyethylene that inhibit viral replication and cellular proliferation and glycol. modulate immune response. Typical Suitable interferon 0155 Thus, to prepare an aqueous solution for intrave alphas include, but are not limited to, recombinant interferon nous injection, it is possible to use a co-solvent, e.g., an alpha-2b, recombinant interferon alpha-2a, recombinant alcohol Such as ethanol or a glycol such as polyethylene interferon alpha-2c, alpha 2 interferon, interferon alpha-n1 glycol or propylene glycol, and a hydrophilic Surfactant Such (INS), a purified blend of natural alpha interferons, a con as Tween R 80. An oily solution injectable intramuscularly sensus alpha interferon such as those described in U.S. Pat. can be prepared, e.g., by Solubilizing the active principle Nos. 4, 897,471 and 4,695,623 (especially Examples 7, 8 or with a triglyceride or a glycerol ester. 9 thereof), or interferon alpha-n3, a mixture of natural alpha 0156 Topical administration can be provided by using, interferons. e.g., creams, ointments or gels. 0164) Interferon alfa-2a is sold as ROFERON-AR) by 0157 Transdermal administration can be provided by Hoffmann-La Roche (Nutley, N.J). using patches in the form of a multilaminate, or with a 0.165 Interferon alfa-2b is sold as INTRON-AR) by reservoir, containing an a compound of the invention (e.g., Schering Corporation (Kenilworth, N.J.). Interferon alfa-2b represented by a formula selected from I-XXIII) and an is also sold, in combination with ribavirin, as REBETRONR) appropriate solvent. by Schering Corporation (Kenilworth, N.J.). The manufac 0158) Administration by inhalation can be provided by ture of interferon alpha2b is described, for example, in U.S. using, e.g., an aerosol containing Sorbitan trioleate or oleic Pat. No. 4,530,901. US 2006/0198824 A1 Sep. 7, 2006
0166 Interferon alfa-n3 is a mixture of natural interfer Sodium phosphate buffer, and pharmaceutically acceptable ons sold as ALFERON NINJECTIONR) by Hemispherx excipients (e.g., Sucrose), carriers (e.g. human plasma albu Biopharma, Inc. (Philadelphia, Pa.). min), toxicity agents (e.g., NaCl), preservatives (e.g., 0167 Interferon alfa-n1 (INS) is a mixture of natural thimerosol, cresol or benzyl alcohol), and Surfactants (e.g., interferons sold as WELLFERONR by Glaxo-Smith-Kline tween or polysorbates) in sterile water for injection. The (Research Triangle Park, N.C.). pegylated interferon alpha can be stored as lyophilized powders under refrigeration at 2-8°C. The reconstituted 0168 Consensus interferon is sold as INFERGENR) by aqueous solutions are stable when stored between 2° and 8° Intermune, Inc. (Brisbane, Calif.). C. and used within 24 hours of reconstitution. See for 0169 Interferon alfa-2c is sold as BEROFOR(R) by Boe example U.S. Pat. Nos, 4,492,537; 5,762.923 and 5,766,582. hringer Ingelheim Pharmaceutical, Inc. (Ridgefield, Conn.). The reconstituted aqueous Solutions may also be stored in 0170 A purified blend of natural interferons is sold as prefilled, multi-dose syringes such as those useful for deliv SUMIFERONR) by Sumitomo; Tokyo, Japan. ery of drugs such as insulin. Typical, Suitable syringes 0171 Pegylated interferon alpha may also be adminis include systems comprising a prefilled vial attached to a tered in association with a compound of the invention (e.g., pen-type syringe such as the NOVOLETR Novo Pen avail represented by a formula selected from I-XXIII). The term able from Novo Nordisk or the REDIPENR), available from “pegylated interferon alpha' as used herein means polyeth Schering Corporation, Kenilworth, N.J. Other syringe sys ylene glycol modified conjugates of interferon alpha, pref tems include a pen-type syringe comprising a glass cartridge erably interferon alpha-2a and alpha-2b. The preferred poly containing a diluent and lyophilized pegylated interferon ethylene-glycol-interferon alpha-2b conjugate is PEG alpha powder in a separate compartment. 12000-interferon alpha-2b. The phrases “12,000 molecular weight polyethylene glycol conjugated interferon alpha' and 0177. In an embodiment of the invention, one or more “PEG 12000-IFN alpha' as used herein include conjugates other anti-viral substances may be administered with one or Such as are prepared according to the methods of Interna more compounds of the invention (e.g., represented by a tional Application No. WO95/13090 and containing ure structural formula selected from I-XXIII). For example, a thane linkages between the interferon alpha-2a or -2b amino groups and polyethylene glycol having an average molecular compound of the invention (e.g., represented by a formula weight of 12000. The pegylated inteferon alpha, PEG selected from I-XXIII) may be administered with interferon 12000-IFN-alpha-2b is available from Schering-Plough alfa, pegylated interferon-alfa or albumin-interferon. Research Institute, Kenilworth, N.J. 0.178 Other types of compounds which may be admin 0172. The preferred PEG 12000-interferon alpha-2b can istered with a compound of the invention (e.g., represented be prepared by attaching a PEG polymer to the epsilon by a structural formula selected from I-XXIII) include amino group of a lysine residue in the interferon alpha-2b ribonucleoside analogues, IMPDH inhibitors, N-glycosyla molecule. A single PEG 12000 molecule can be conjugated tion inhibitors, N3 protease inhibitors, NS5B inhibitors, to free amino groups on an IFN alpha-2b molecule via a immunomodulatory compounds and CTP synthase inhibi urethane linkage. This conjugate is characterized by the tors, thiazolidine derivatives, benzanilides, phenanthrene molecular weight of PEG 12000 attached. The PEG 12000 IFN alpha-2b conjugate can be formulated as a lyophilized quinones, helicase inhibitors, polymerase inhibitors, anti powder for injection. sense phosphothioate oligodeoxynucleotides, IRES dependent translation inhibitors, nuclease resistant 0173 Pegylated interferon alfa-2b is sold as PEG-IN ribozymes, 1-amino-alkyloyclohexanes, alkyl lipids, anti TRONR) by Schering Corporation (Kenilworth, N.J.). oxidants, squalene, amantadine, bile acids, N-(phospho 0174 Pegylated interferon-alfa-2a is sold as PEGA noacetyl)-L-aspartic acid, benzenedicarboxamides, polyade SYS(R) by Hoffmann-La Roche (Nutley, N.J). nylic acid derivatives, 2',3' dideoxyinosine and 0175 Other interferon alpha conjugates can be prepared benzimidazoles. by coupling an interferon alpha to a water-soluble polymer. 0179 In an embodiment of the present invention, ribavi A non-limiting list of Such polymers include other polyalky lene oxide homopolymers such as polypropylene glycols, rin ( polyoxyethylenated polyols, copolymers thereof and block copolymers thereof. As an alternative to polyalkylene oxide based polymers, effectively non-antigenic materials such as dextran, polyvinylpyrrolidones, polyacrylamides, polyvinyl alcohols, carbohydrate-based polymers and the like can be used. Such interferon alpha-polymer conjugates are described, for example, in U.S. Pat. No. 4,766,106, U.S. Pat. HO N No. 4,917,888, European Patent Application No. 0236987 or 0.593 868 or International Publication No. WO95/13090. 0176 Pharmaceutical compositions of pegylated inter feron alpha Suitable for parenteral administration can be OH OH formulated with a suitable buffer, e.g., Tris-HCl, acetate or phosphate such as dibasic sodium phosphate/monobasic US 2006/0198824 A1 Sep. 7, 2006 20
1-B-D-ribofuranosyl-1H-1 2,4-triazole-3-carboxamide) is 0183 Another embodiment comprises administering administered in association with a compound of the present EICAR ( invention (e.g., represented by a formula selected from I-XXIII). Ribavirin is sold as REBETOL(R) by Schering Corporation; Kenilworth, N.J. Its manufacture and formu lation is described, for example, in U.S. Pat. No. 4,211,771. A combination of ribavirin and recombinant interferon alfa 2b (REBETRONR); Schering Corporation; Kenilworth, N.J.) may also be administered in association with a com pound of the invention (e.g., represented by a formula HO O selected from I-XXIII). 0180 In another embodiment of the invention, gemcit abine ( HO OH
5-ethynyl-1-beta-D-ribofuranosylimidazole-4-carboxamide: Balzarini et al., J. Biol. Chem. 268(33): 24591-24598 (1993)) in association with a compound of the invention (e.g., represented by a formula selected from I-XXIII). 0.184 An embodiment of the present invention comprises administering tiazofurin (
s NH2: is administered in association with a compound of the present invention (e.g., represented by a formula selected from I-XXIII). Gemcitabine is sold as GEMZARR) by Eli HO O Lilly and Co. (Indianapolis, Ind.). 0181. A further embodiment of the present invention comprises administering a compound of the invention (e.g., HO OH represented by a formula selected from I-XXIII) in associa tion with VX497 ( Balzarini et al., J. Biol. Chem. 268(33): 24591-24598 (1993)) in association with a compound of the invention (e.g., represented by a formula selected from I-XXIII). 0185. Another embodiment of the invention comprises administering deoxynoirimycin and/or derivatives thereof, such as N-nonyl-deoxynojirimycin (De Clercq et al., Mini Rev Med Chem. 2(2):163-75 (2002)) or n-butyl deoxynojiri mycin (nB-DNJ: Ouzounov et al., Antiviral Res. 55(3):425 35 (2002)), in association with a compound of the invention (e.g., represented by a formula selected from I-XXIII). 0186 In one embodiment, a compound of the present Vertex Pharmaceuticals; Cambridge, Mass.). invention (e.g., represented by a formula selected from 0182 An embodiment of the invention comprises admin I-XXIII) is administered in association with albumin-inter istering mycophenolate mofetil (MMF; 2-morpholinoethyl feron alpha (ALBUFERONTM). Albumin-interferon alpha is (E)-6-(1,3-dihydro-4-hydroxy-6-methoxy-7-methyl-3-oxo interferon-a fused to human serum albumin. ALBUF 5-isobenzofuranyl)-4-methyl-4-hexenoate) in association ERONTM is available from Human Genome Sciences, Rock with a compound of the invention (e.g., represented by a ville, Md. ALBUFERONTM has been shown to be effective formula selected from I-XXIII). MMF is sold as CellCeptR) for treatment of hepatitis C virus infections (Blaire et al., J. by Roche Laboratories; Nutley, N.J. Pharm and Exp. Therap. 303(2): 540-548 (2002)). US 2006/0198824 A1 Sep. 7, 2006
0187. In another embodiment, BILN-2061 ( is administered in association with an NS5B inhibitor such as NM283 or NM107 (Idenix Pharmaceuticals; Cambridge, Mass.). 0191 In another embodiment, a compound of the inven MeO tion (e.g., represented by a formula selected from I-XXIII) is administered in association with SCH68631 (
HO O;
Chu et al., Tetrahedron Letters 37(40): 7229-7232 (1996)) or SCH351633 ( Lamarre et al., Nature 426(6963): 129-31 (2003)), is admin istered in association with a compound of the present OMe OH invention (e.g., represented by a formula selected from HO Me: I-XXIII).
0188 In another embodiment, thymalfasin (e.g., O ZADAXINTM) is administered in association with a com pound of the invention (e.g., represented by a formula MeOOC O OH selected from I-XXIII). ZADAXINTM is available from SciClone Pharmaceuticals International, Ltd., San Mateo, Calif. Biorg. Med. Chem. Lett. 9(14): 1949-1952 (1999)). 0189 In yet another embodiment, isatoribine ( 0.192 In a further embodiment, a compound of the inven tion (e.g., represented by a formula selected from I-XXIII) is administered in association with any of the P. variants of Elgin c disclosed in Qasim et al., Biochemistry 36: 1598 1607 (1997). 0193 In yet another embodiment, a compound of the NH OH: invention (e.g., represented by a formula selected from 0-{ I-XXIII) is administered in association with gliotoxin (
ANA245; 5-Amino-3-beta-D-ribofuranosylthiazolo(4.5- d)pyrimidine-2.7(3H,6H)-dione monohydrate; Thiazolo(4. 5-d)pyrimidine-2.7(3H4H)-dione, 5-amino-3-beta-D-ribo furanosyl-, monohydrate) is administered in association with Ferrari et al., J. Virology 73(2): 1649-1654 (1999)). a compound of the invention (e.g., represented by a formula selected from I-XXIII). 0194 Other embodiments of the invention include administering a compound of the present invention (e.g., 0190. In another embodiment, a compound of the inven represented by a formula selected from I-XXIII) in associa tion (e.g., represented by a formula selected from I-XXIII) tion with RD3-4082 ( US 2006/0198824 A1 Sep. 7, 2006 22
-continued
C
O C SONH O O
H
ch C O C OH O
N H
HO OH NO C O OH O Sudo et al., Anti-viral Chem. & Chemother. 9: 186 (1998)) N Cl; or with RD3-4078 ( H
cC O Kakiuchi et al., FEBS Letters 421: 217-220 (1998)) or any N other proteinase inhibitor disclosed in Kakiuchi et al. H 0196. Another embodiment of the present invention com prises administering a compound of the present invention (e.g., represented by a structural formula C.NO2
Sudo et al., Anti-viral Chem. & Chemother. 9: 186 (1998)) or any other protease inhibitor disclosed in Sudo et al. sc 1, 0.195 A further embodiment of the invention comprises administering a compound of the present invention (e.g., / \ represented by a structural formula selected from I-XXIII) in association with "Y O
selected from I-XXIII) in association with RD4-6205 (Sudo et al., Biochem. Biophys. Res. Comm. 238: 643-647 (1997)) or any other protease inhibitor disclosed in Sudo et al. 0.197 An embodiment of the present invention comprises administering a compound of the present invention (e.g., ON O Cl, represented by a structural formula selected from I-XXIII) in association with cerulenin US 2006/0198824 A1 Sep. 7, 2006 23
0201 Yet another embodiment of the present invention comprises administering a compound of the present inven tion (e.g., represented by a structural formula selected from I-XXIII) in association with naphthoquinone, 2-methyl naphthoduinone, 2-hydroxynaphthoduinone, 5-hydrox ynaphthoquinone, 5,8-dihydroxynaphthoduinone, alkannin or shikonin (Takeshita et al., Analytical Biochem. 247: 242-246 (1997)). CAS Registry No. 17397-89-6; Lohmann et al., Virology 249: 108-118 (1998)) or any other HCV RNA-dependent 0202) A further embodiment of the present invention RNA polymerase (RdRp) inhibitor disclosed in Lohmann et comprises administering a compound of the present inven al. tion (e.g., represented by a structural formula selected from 0198 An embodiment of the present invention comprises I-XXIII) in association with 1-amino-1,3,5-trimethylcyclo administering a compound of the present invention (e.g., hexane, 1-amino-1 (trans).3(trans),5-trimethylcyclohexane, represented by a structural formula selected from I-XXIII) in 1-amino-1 (cis).3(cis).5-trimethylcyclohexane, 1-amino-1.3, association with ceplene ( 3,5-tetramethylcyclohexane, 1-amino-1,3,3,5,5-pentameth ylcyclohexane, 1-amino-1,3,5,5-tetramethyl-3-ethylcyclo hexane, 1-amino-1.5.5-trimethyl-3,3-diethylcyclohexane, H 1-amino-1.5.5-trimethyl-cis-3-ethylcyclohexane, 1-amino N (1S,5S)-cis-3-ethyl-1.5.5-trimethylcyclohexane, 1-amino-1, h C H 5.5-trimethyl-trans-3-ethylcyclohexane, 1-amino-(1R, N CI H; 5S)trans-3-ethyl-1.5.5-trimethylcyclohexane, 1-amino-1- HN ethyl-3,3,5,5-tetramethylcyclohexane, 1-amino-1-propyl-3, 3.5.5-tetramethylcyclohexane, N-methyl-1-amino-1,3,3,5,5- 2-(1H-Imidazol-4-yl)ethanamine dihydrochloride). pentamethylcyclohexane, N-ethyl-1-amino-1,3,3,5,5- 0199 Yet another embodiment of the present invention pentamethylcyclohexane, O N-(1,3,3,5,5- comprises administering a compound of the present inven pentamethylcyclohexyl) pyrrolidine or any other tion (e.g., represented by a structural formula selected from 1-aminoalkylcyclohexane N-methyl-D-aspartate (NMDA) I-XXIII) in association with amantadine ( inhibitors disclosed in U.S. Pat. No. 6,034,134. 0203 A further embodiment of the present invention comprises administering a compound of the present inven NH2 tion (e.g., represented by a structural formula selected from I-XXIII) in association with d-C-tocopherol or any other anti-HCV compound disclosed in U.S. Pat. No. 5,922,757. 0204 Another embodiment of the present invention com O ) prises administering a compound of the present invention (e.g., represented by a structural formula selected from I-XXIII) in association with tauroursodeoxycholic acid, 0200. A further embodiment of the present invention chenodeoxycholic acid, ursodeoxycholic acid or free bile comprises administering a compound of the present inven acid or any other bile acid HCV inhibitor disclosed in U.S. tion (e.g., represented by a structural formula selected from Pat. No. 5,846,964. I-XXIII) in association with IDN-6556 ( 0205 Another embodiment of the present invention com prises administering a compound of the present invention O O (e.g., represented by a structural formula selected from O I-XXIII) in association with 1,1'-1,4-phenylenebis (meth OH ylene)bis(4,4'-trans-(4,5,6,7,8,9-hexahydro)benzimida F Zoyl)piperidine, 1,1'-1,4-phenylenebis( methylene)bis(4, F N 4'-benzimidazoyl)piperidine or any other anti-HCV F O O compound disclosed in U.S. Pat. No. 5,830,905. F O 0206. Another embodiment of the present invention com prises administering a compound of the present invention CH O (e.g., represented by a structural formula selected from CH, NNH I-XXIII) in association with N,N'-4-(2-benzimidazole)phe HC nyl-1,4-butanedicarboxamide, N,N'-4-(2-benzimidazole )phenyl-1,6-hexanedicarboxamide, N,N'-4-(2-benzimida HC 3 ). Zole)phenyl-1,8-octanedicarboxamide, N,N'-4-(2- benzimidazole)phenyl)-1-9-nonanedicarboxamide, N,N'-4- (2-benzimidazole)phenyl-1,10-decanedicarboxamide or N,N'-4-(2-benzimidazole)phenyl-1,4-butenedicarboxam US 2006/0198824 A1 Sep. 7, 2006 24 ide or any other carboxamide HCV inhibitor disclosed in or levovirin ( U.S. Pat. No. 5,633,388. 0207 Another embodiment of the present invention com prises administering a compound of the present invention O (e.g., represented by a structural formula selected from I-XXIII) in association with any of the polyadenylic acid (5') derivatives disclosed in U.S. Pat. No. 5,496,546. HN N 0208 A further embodiment of the present invention {y comprises administering a compound of the present inven YN tion (e.g., represented by a structural formula selected from I-XXIII) in association with 2',3'-dideoxyinosine (U.S. Pat. No. 5,026,687). 0209 An embodiment of the present invention comprises H6 oH ) administering a compound of the present invention (e.g., represented by a structural formula selected from I-XXIII) in association with 0212 Combinations of the invention include a compound of the present invention (e.g., represented by a structural formula selected from I-XXIII) “in association' with one or F N more additional anti-viral agents (e.g., ribavirin, interferon Y-NH2 alfa-2a or 2b, or pegylated interferon alfa-2a or 2b). The term “in association' indicates that the components of the DOCOV combinations of the invention can be formulated into a single composition for simultaneous delivery or formulated O N separately into two or more compositions (e.g., a kit). HNS Furthermore, each component of a combination of the invention can be administered to a subject at a different time than when the other component is administered; for or any other benzimidazole disclosed in U.S. Pat. No. example, each administration may be given non-simulta 5,891,874. neously (e.g., separately or sequentially) at several intervals 0210. An additional embodiment of the invention com over a given period of time. Moreover, the separate com prises administering VX-950 ( ponents may be administered to a subject by the same or by a different route (e.g., orally, intravenously, Subcutaneously). 0213 The present invention further comprises composi tions comprising a compound of the present invention (e.g., represented by structural formula selected from I-XXIII) in association with one or more anti-viral agents discussed above (e.g., pegylated interferon alfa-2a or 2b or ribavirin) along with pharmaceutical compositions thereof. Dosage and Administration Lin et al., J. Biol. Chem. 279(17): 17508-17514 (2004)) in 0214) Typical protocols for the therapeutic administration association with a compound of the present invention (e.g., of such substances are well known in the art. Pharmaceutical represented by a structural formula selected from I-XXIII). composition of the invention may be administered, for 0211) Another embodiment of the present invention com prises administering a compound of the present invention example, by any parenteral (e.g., Subcutaneous injection, (e.g., represented by a structural formula selected from intramuscular injection, intravenous injection) or non I-XXIII) in association with viramidine ( parenteral route (e.g., orally, nasally). 0215 Pills and capsules of the invention can be admin NHoHCI istered orally. Injectable compositions can be administered with medical devices known in the art; for example, by injection with a hypodermic needle including the REDIPENR) or the NOVOLETR) Novo Pen discussed above. 0216) Injectable pharmaceutical compositions of the invention may also be administered with a needleless hypo dermic injection device; such as the devices disclosed in U.S. Pat. Nos. 5,399,163; 5,383,851; 5,312,335; 5,064,413; 4.941,880; 4,790,824 or 4,596,556. US 2006/0198824 A1 Sep. 7, 2006
0217 Compounds of the invention can be administered, mg per day. For example, a compound of the invention (e.g., for example, three times a day, twice a day, once a day, three represented by a formula selected from IV-XXIII) can be times weekly, twice weekly or once weekly. administered in a dosage form containing from about 20 mg to about 1200 mg of the compound (e.g., 20 mg, 80 mg, 120 0218. In an embodiment, the daily dose of a compound of mg, 400 mg. 600 mg, 1000 mg or 1100 mg). the present invention (e.g., represented by a formula selected from I-XXIII) or of any other anti-viral agent administered 0222. As discussed herein, methods of the present inven in association with a compound of the invention (e.g., tion can include administering a compound comprising a represented by a formula selected from I-XXIII) is, where structural formula selected from I-XXIII along with pegy possible, administered accordance with the Physicians ' lated or unpegylated interferon alfa-2a, pegylated or unp Desk Reference 2003 (Physicians' Desk Reference, 57th egylated interferon alfa-2b, pegylated or unpegylated inter Ed); Medical Economics Company; ISBN: 1563634457: feron alfa-2c, pegylated or unpegylated interferon alfa n-1, 57th edition (November 2002). The proper dosage can, pegylated or unpegylated interferon alfa n-3, unpegylated however, be altered by a clinician to compensate for par pegylated consensus interferon, ribavirin or any combina ticular characteristics of the Subject receiving the therapy tion thereof. depending, for example, on the potency of the compound 0223) In an embodiment, a therapeutically effective dos administered, side-effects, age, weight, medical condition, age of interferon alfa-2b (e.g., INTRON-AR), particularly overall health and response. for the treatment of chronic hepatitis C is 3 million IU 0219. The term “therapeutically effective amount’ means (international units) three times a week (TIW) administered that amount of a therapeutic agent or Substance (e.g., com Subcutaneously or intramuscularly. In patients tolerating pound represented by structural formula selected from therapy with normalization of serum alanine aminotrans I-XXIII, interferon or ribavirin) that will elicit a biological ferase (ALT) at 16 weeks of treatment, INTRONAR therapy or medical response of a tissue, system, Subject or host that should be extended to 18 to 24 months (72 to 96 weeks) at is being sought by the administrator (such as a researcher, 3 million IU TIW to improve the sustained response rate. doctor or veterinarian) which includes alleviation of the symptoms of Flaviviridae virus (e.g., HCV) infection and 0224. If severe adverse reactions develop during the prevention, slowing or halting of progression of Fla INTRONAR treatment, the dose should be modified (50% viviridae virus (e.g., HCV) infection and its symptom(s) to reduction) or therapy should be discontinued as indicated any degree including prevention of the infection of a host below. If intolerance persists after dose adjustment, with a Flaviviridae virus (e.g., HCV) following transplant of INTRON AR) therapy should be discontinued. a liver into said host. For example, in one embodiment, a 0225. In an embodiment, the recommended dose of PEG “therapeutically effective dosage' of a compound of the interferon alfa-2b (e.g., PEG-INTRONR) regimen is from invention (e.g., represented by a structural formula selected about 0.5 to about 1.5 g/kg/week, preferably 1.0 ug/kg/ from I-XXIII) or a combination including another anti-viral week for one year. agent (e.g., ribavirin and/or pegylated or unpegylated inter feron alfa-2a or 2b) results in the eradication of detectable 0226. In an embodiment, a therapeutically effective dos Flaviviridae Viral RNA (e.g., HCV RNA) for any period of age of interferon alfa-2a (e.g., ROFERON-AR), particularly time, for example, 12 or more weeks (e.g., 24 weeks). for the treatment of chronic hepatitis C, is 3 MIU three times Detection of viral RNA in a host can be done easily using a week (TIW) administered subcutaneously or intramuscu conventional well-known methods in the art. See also the larly for 12 months (48 to 52 weeks). As an alternative, Physicians’ Desk Reference (“PDR) for the therapeutically patients may be treated with an induction dose of 6 MIU effective dose and dosage regimens approved by the U.S. TIW for the first 3 months (12 weeks) followed by 3 MIU Federal Food and Drug Administration. TIW for 9 months (36 weeks). 0220. In an embodiment, a therapeutically effective dos 0227 Patients who tolerate and partially or completely age or amount of a compound represented by a structural respond to therapy with ROFERON-AR) but relapse follow formula selected from I-III is about 20 mg/day to about 800 ing its discontinuation may be re-treated. Re-treatment with mg per day; about 20 mg/day to about 600 mg per day; about either 3 MIU TIW or with 6 MIU TIW for 6 to 12 months 20 mg/day to about 400 mg per day; about 20 mg/day to may be considered. about 100 mg per day; about 60 mg/day to about 800 mg per 0228. In an embodiment, a temporary dose reduction by day; about 60 mg/day to about 600 mg per day; about 60 50% is recommended in patients who do not tolerate the mg/day to about 400 mg per day; about 60 mg/day to about prescribed dose of ROFERON-AR). If adverse events 200 mg per day; or about 60 mg/day to about 100 mg per resolve, treatment with the original prescribed dose can be day. For example, a compound of the invention (e.g., rep re-initiated. In patients who cannot tolerate the reduced resented by a formula selected from I-III) can be adminis dose, cessation of therapy, at least temporarily, is recom tered in a dosage form containing from about 20 mg to about mended. 800 mg of the compound (e.g., 20 mg, 50 mg, 100 mg, 200 mg, 400 mg. 600 mg or 800 mg). 0229. In an embodiment, the recommended dose of PEG interferon alfa-2a (e.g., PEGASYSR) monotherapy is 180 0221) In an embodiment, a therapeutically effective ug (1.0 mL) once weekly for 48 weeks by subcutaneous amount or dosage a compound represented by a structural (SC) administration in the abdomen or thigh. formula of any of IV-XXIII is about 80 mg/day to about 1200 mg per day; about 80 mg/day to about 120 mg per day; 0230. In an embodiment, a therapeutically effective dos about 80 mg/day to about 400 mg per day; about 80 mg/day age of consensus interferon alfa (e.g., INFERGENR), par to about 600 mg per day; or about 80 mg/day to about 1000 ticularly for treatment of chronic HCV infection, is 9 mcg US 2006/0198824 A1 Sep. 7, 2006 26
TIW administered SC as a single injection for 24 weeks. At in association with a compound of the invention (e.g., least 48 hours should elapse between doses of INFER represented by a formula selected from I-XXIII). GENR). 0241. In an embodiment, the recommended duration of 0231. In an embodiment, patients who tolerated previous REBETRONR treatment for patients previously untreated interferon therapy and did not respond or relapsed following with interferon is 24 to 48 weeks. The duration of treatment its discontinuation may be subsequently treated with 15 mcg should be individualized to the patient depending on base of INFERGENRTIW administered SC as a single injection line disease characteristics, response to therapy, and toler for up to 48 weeks. ability of the regimen. After 24 weeks of treatment, Virologic response should be assessed. Treatment discontinuation 0232. In an embodiment, for patients who experience a should be considered in any patient who has not achieved an severe adverse reaction on INFERGENR), dosage should be HCV RNA below the limit of detection of the assay by 24 withheld temporarily. If the adverse reaction does not weeks. In patients who relapse following interferon therapy, become tolerable, therapy should be discontinued. Dose reduction to 7.5 mcg may be necessary following an intol the recommended duration of treatment is 24 weeks. erable adverse event. 0242. In an embodiment, the recommended dosage of a combination of ribavirin (e.g., REBETROL(R)) and inter 0233. If adverse reactions continue to occur at the feron alfa-2b (e.g., INTRON-AR) depends on patient body reduced dosage, the physician may discontinue treatment or weigh. In an embodiment, the adult dosage regimen is set reduce dosage further. However, decreased efficacy may forth below in Table 2: result from continued treatment at dosages below 7.5 mcg. 0234. During subsequent treatment for 48 weeks with 15 TABLE 2 mcg of INFERGENR), up to 36% of patients required dose reductions in 3 mcg increments. Recommended Adult Dosing 0235. In an embodiment, a therapeutically effective does Body weight REBETOL Capsules INTRON A Injection of albumin-interferon-alpha (e.g., ALBUFERONR)) is 75 kg 3 x 200-mg capsules AM, 3 million IU 3 times Subcutaneously. 3 x 200-mg capsules PM weekly s.c. daily p.o. 0236. In an embodiment, a therapeutically effective dose of ribavirin (e.g., REBETROL(R) depends on the patients body weight. In an embodiment, the recommended dose of 0243 In an embodiment, the pediatric dosage regimen, REBETOL(R) is provided, below, in Table 1. for the combination, is set forth below in Table 3:
TABLE 1. TABLE 3 Recommended Dosing Pediatric Dosing Body weight REBETOL Capsules Body weight REBETOL Capsules INTRON A Injection 75 kg 3 x 200 mg capsules AM, daily p.o. 3 x 200 mg capsules PM daily p.o. 37–49 kg 1 x 200-mg capsule AM 3 million IU/m3 times 2 x 200-mg capsules PM weekly s.c. daily p.o. 50–61 kg 2 x 200-mg capsules AM 3 million IU/m 3 times 0237. In an embodiment, the recommended duration of 2 x 200-mg capsules PM weekly s.c. treatment with ribavirin (e.g., REBETOL(R) for patients daily p.o. previously untreated with interferon is 24 to 48 weeks. The >61 kg Refer to adult dosing table Refer to adult dosing table duration of treatment should be individualized to the patient depending on baseline disease characteristics, response to therapy, and tolerability of the regimen. After 24 weeks of 0244. In an embodiment, dosage modification of REBE treatment, Virologic response should be assessed. Treatment TOLR/INTRON-AR) treatment is indicated when adverse discontinuation should be considered in any patient who has reactions are observed in the patient. For example, in not achieved an HCV RNA below the limit of detection of patients with a history of stable cardiovascular disease, a the assay by 24 weeks. permanent dose reduction is required if the patient's hemo globin decreases by >/=2 g/dL during any 4-week period. In 0238. In an embodiment, in patients who relapse follow addition, for these cardiac history patients, if the patients ing interferon therapy, the recommended duration of treat hemoglobin remains <12 g/dL after 4 weeks on a reduced ment with ribavirin (e.g., REBETOL(R) is 24 weeks. dose, the patient should discontinue combination REBE 0239) REBETOL(R) may be administered without regard TOLR/INTRON-AR therapy. to food, but should be administered in a consistent manner 0245. In an embodiment, it is recommended that a patient with respect to food intake. whose hemoglobin level falls below 10 g/dL have his/her 0240. In an embodiment, a combination of interferon REBETOL(R) dose reduced to 600 mg daily (1x200-mg alfa-2b and ribavirin (e.g., REBETRONR) is administered capsule AM, 2x200-mg capsules PM). A patient whose US 2006/0198824 A1 Sep. 7, 2006 27 hemoglobin level falls below 8.5 g/dL should be perma 10.5 by an aqueous 1 N solution of sodium hydroxide, 80 ml nently discontinued from REBETOLR/INTRON AR) of ethanol were added to the solution. By collecting the therapy. generated precipitate through filtration, Ara-C-5'- 0246. In an embodiment, when administered in combi Stearylphosphate monosodium salt (C-type) was obtained in nation with REBETOL(R), the recommended dose of PEG wet state, and by drying the wet material in the same manner Intron(R) is 1.5 micrograms/kg/week. The recommended as in Example 2, 4.20 g of Ara-C-5'-Stearylphosphate mono dose of REBETOL(R) is 800 mg/day in 2 divided doses: two Sodium salt (C-type) of m.p. 221°C. (decomposition) were capsules (400 mg) with breakfast and two capsules (400 mg) obtained. with dinner. REBETOL(R) should not be used in patients with 0254 The purity of the thus obtained product was creatinine clearance.<50 mL/min. 99.62% by liquid chromatography and E. cm" (273 nm, 0247. Ideally, though not necessarily, an infected host 0.1N NaOH) was 151.4. This procedure is taken from U.S. who is administered a composition of the invention will, Pat. No. 4,812,560. eventually, exhibit no detectable HCV RNA is his body for Example 2 a period of time (e.g., 12 or more weeks). 0248. The term “no detectable HCV-RNA’ in the context Production of Ara-C-5'-stearylphosphate of the present invention means that there is less than about monosodium salt 100 copies of HCV-RNA per ml of serum of the patient as measured by quantitative, multi-cycle reverse transcriptase 0255 Into 1.5 liters of water 500 g of Ara-C-5'- PCR (rtPCT) methodology. Such PCR based assays are Stearylphosphate were added and after adjusting the pH of conventional and very well known in the art. In general, the mixture to 10.8 by sodium hydroxide while stirring the rtPCR is performed by isolating the RNA from a specimen, mixture, 6 liters of ethanol were added to the mixture. After reverse-transcribing it to generate cDNAS, amplifying spe allowing the mixture to cool for 16 hours, the thus formed cific nucleic acid sequences by PCR, and then using a precipitate was collected by centrifugation to obtain Ara-C- variety of methods to detect the amplified sequences (Urdea 5'-Stearylphosphate monosodium salt in wet state. et al., Clin. Chem. 43:1507-1511 (1997)). 0256 By drying the thus obtained wet salt at 30°C. under 0249. In one embodiment, a method of the present inven reduced pressure, 332 g of amorphous (C-type) Ara-C-5'- tion, when administered to a host infected with a Flaviviri Stearylphosphate monosodium salt of m.p. 223°C. (decom dae virus, will exhibit a sustained virologic response. The position) were obtained. term “Sustained Virologic response' as used in the context of 0257) The purity of the thus obtained product was 99.5% the present invention means that there is no detectable according to liquid chromatography and E. cm" (273 nm, HCV-RNA in the serum of patients treated in accordance 0.1N NaOH) was 152. 3. with the present invention for at least 24 weeks after the end 0258. The same result as above was obtained when of the combined therapy treatment. Preferably, the period of acetone, methyl ethyl ketone, tetrahydrofurane or dioxane Sustained Virologic response is at least one year—or was added instead of ethanol to precipitate the monosodium longer—after the end of treatment. salt. This procedure is taken from U.S. Pat. No. 4,812,560. EXAMPLES Example 3 0250) The following examples are intended to exemplify and further clarify what is the present invention and should Production of Ara-C-5'-stearylphosphate not be construed to limit the present invention. monosodium salt 0259. To 2.40 g of Ara-C-5'-stearylphosphate (a dried Example 1 material), 6 ml of water were added and, after adjusting the mixture to pH 12.0 with aqueous 1N solution of sodium Production of Ara-C-5'-stearylphosphate (III) and hydroxide, 30 ml of ethanol were added to the mixture and Ara-C-5'-Stearylphosphate monosodium salt the mixture was stirred for 3 hours at 55° C. After cooling the mixture for 16 hours by standing, the precipitate was 0251) To 6.4 g (10 mmol) of N, O, O'-triacetyl-Ara collected by filtration and dried for 10 hours at 30° C. under C-5'-phosphate tri-n-butyl ammonium salt, 5 g of Stearyl a reduced pressure to obtain 1.83 g of Ara-C-5'-stearylphos alcohol, 30 ml of pyridine and 8 g of p-toluenesulfonyl phate monosodium salt (C-type) of m.p. 220° C. (decom chloride were added and the mixture was maintained at 40° position). The purity of the thus obtained product was 99.5% C. for 3 hours. Then, the reaction mixture was extracted after according to liquid chromatography and E cm" (273 nim, adding 50 ml of water and 50 ml of chloroform. 0.1N NaOH) was 150.9. This procedure is taken from U.S. 0252) Deacetylation of the triacetyl compound in the Pat. No. 4,812,560. chloroform solution was carried out by adding 20 ml of aqueous ammonia and ethanol thereto and the deacetylated Example 4 compound was extracted with water. 0253. After collecting the aqueous layer, the aqueous Production of Ara-C-5'-stearylphosphate layer was adjusted to pH 2.5 by adding conc. hydrochloric monosodium salt acid, and the precipitated Ara-C-5'-Stearylphosphate was 0260 To 2.40 g of Ara-C-5'-stearylphosphate, 10 ml of collected by filtration. After adding 20 ml of water to the water were added and, after adjusting the mixture to pH10.0 thus obtained precipitates and adjusting the solution to pH by sodium hydroxide while stirring, the mixture, the thus US 2006/0198824 A1 Sep. 7, 2006 28 formed solution was condensed to dryness under a reduced Example 8 pressure to obtain 2.30 g of Ara-C-5'-stearylphosphate monosodium salt (C-type). Synthesis of N'-(Dipropylamino)methylenelara binocytidine (VIII) 0261) The melting point of the thus obtained product was 219.8°C. (decomposition), the purity thereof was 99.1% by 0270 Ara-C (85 mg, 0.35 mmol) in DMF (2 mL) was liquid chromatography and E cm (273 nm, 0.1N NaOH) reacted with dipropylformamide dimethyl acetal (0.9 g, 5.14 was 152.6. This procedure is taken from U.S. Pat. No. mmol). Evaporation and crystallization from ethanol-ethyl 4,812,560. acetate gave N'-(Dipropylamino)methylenelarabinocyti dine (104 mg. 85%). Example 5 0271 This procedure is taken from Kerr et al., J. Pharm. Sci. 83(4): 582-586 (1994). Ara-C-5'-Stearylphosphate monosodium salt monohydrate Example 9 0262 To 10 g of Ara-C-5'-stearylphosphate, 30 ml of Synthesis of N'-(Dibutylamino)methylenelara water were added and, after adjusting the pH of the mixture binocytidine (IX) to 10.5 by 5N sodium hydroxide, 50 ml of ethanol were added to the thus formed solution with stirring at about 40° 0272 Ara-C (85 mg, 0.35 mmol) in DMF (2 mL) is C. to precipitate the monosodium salt. reacted with dibutylformamide dimethyl acetal (0.9 g, 5.14 mmol). Evaporation and crystallization from ethanol-ethyl 0263. The mixture was heated to 65° C. and after adding acetate gave N'-(Dibutylamino)methylenelarabinocytidine the seed crystal of Ara-C-5'-stearylphosphate monosodium (104 mg. 85%). salt monohydrate (B-type), the mixture was maintained with stirring while keeping the temperature for 5 hours to form Example 10 crystals. After microscopically confirming the completion of crystallization, 20 ml of ethanol were added to the mixture Synthesis of N'-(Diisopropylamino)methylene) and the mixture was gradually cooled. arabinocytidine (X) 0264. After one night, the crystals were filtrated and by 0273 Ara-C (500 mg, 2.05 mmol) in DMF (10 mL) was drying under a reduced pressure 8.9 g of Ara-C-5'- reacted with diisopropylformamide dimethyl acetal (2.3 g, Stearylphosphate monosodium salt monohydrate (crystals of 13.2 mmol). After evaporation, the residue was crystallized P-type) of m.p. 220° C. (decomposition) were obtained. from ethanol-ether to give pale lemon-colored crystals of 0265). The purity of the thus obtained product was 99.7% N'-(Diisopropylamino)methylenelarabinocytidine (723 by liquid chromatography and E. cm'' (273 nm, 0.1N mg, 93%). NaOH) was 153.0. This procedure is taken from U.S. Pat. 0274 This procedure is taken from Kerr et al., J. Pharm. No. 4,812,560. Sci. 83(4): 582-586 (1994). Example 6 Example 11 Synthesis of N'-(Dimethylamino)methylenelara Synthesis of N'-Piperidinomethylenelarabinocyti binocytidine (VI) dine (XI) 0266 Ara-C (300 mg, 1.23 mmol) in DMF (5 mL) was 0275 Ara-C (500 mg, 2.05 mmol) in DMF (10 mL) was reacted with dimethylformamide dimethyl acetal (1.7g, 14.2 reacted with N-(dimethoxy methyl)piperidine (2.7 g. 16.8 mmol). On evaporation and crystallization from a minimum mmol) for several hours at room temperature. The contents amount of ethanol, white crystals of N'-(Dimethylami were evaporated and the residue chromoatographed over no)methylenelarabinocytidine were obtained (371 mg, silica gel using 1-6% MeOH in CHCl2. The desired frac tions were collected and evaporated. The foam obtained was 100%). recrystallized from a mixture of ethanol, CHCl, and ethyl 0267. This procedure is taken from Kerr et al., J. Pharm. acetate to give N-Piperidinomethylenelarabinocytidine Sci. 83(4): 582-586 (1994). (594 mg. 85%). 0276. This procedure is taken from Kerr et al., J. Pharm. Example 7 Sci. 83(4): 582-586 (1994). Synthesis of N'-(Diethylamino)methylenelara Example 12 binocytidine (VI) Synthesis of N-Morpholinomethylenelarabinocyti 0268 Ara-C (500 mg, 2.05 mmol) in DMF (2 mL) was reacted with diethylformamide dimethyl acetal (2.16 g. 14.7 dine (XII) mmol). After evaporation, the recrystallization of the residue 0277 Ara-C (100 mg, 0.41 mmol) in DMF (5 mL) was from a variety of solvents proved difficult. The residue was reacted with N-(dimethoxymethyl)morpholine (1.35 g, 9.3 finally crystallized from a solution of 4% MeOH in CHCl, mmol). Evaporation and Subsequent crystallization from to give N'-(Diethylamino)methylenelarabinocytidine as ethyl acetate-ether gave N-Morpholinomethylenelara fine colorless, whitish crystals (601 mg, 90%). binocytidine (130 mg. 93%). 0269. This procedure is taken from Kerr et al., J. Pharm. 0278. This procedure is taken from Kerr et al., J. Pharm. Sci. 83(4): 582-586 (1994). Sci. 83(4): 582-586 (1994). US 2006/0198824 A1 Sep. 7, 2006 29
Example 13 RNA level was measured using real time PCR (Taqman assay). The amplicon was located in NS5B. The PCR Synthesis of N'-Pyrrolidinomethylenelarabinocyti primers were 5B.2F, ATGGACAGGCGCCCTGA; 5B.2R, dine (XIII) TTGATGGGCAGCTTGGTTTC; the probe sequence was 0279 Ara-C (100 mg, 0.41 mmol) in DMF (5 mL) was FAM-labeled CACGCCATGCGCTGCGG. GADPH RNA reacted with N-(dimethoxymethyl)pyrrolidine (0.9 g, 6.2 was used as an endogenous control and was amplified in the mmol). Evaporation and Subsequent crystallization from same reaction as NS5B (multiplex PCR) using primers and ethyl acetate-ether gave N-Pyrrolidinomethylenelara VIC-labeled probe recommended by the manufacturer (PE binocytidine (119 mg, 89%). Applied Biosystem). The real-time RT-PCR reactions were run on the ABI PRISM 7900HT Sequence Detection System 0280 This procedure is taken from Kerr et al., J. Pharm. using the following program: 48°C. for 30 minutes, 95°C. Sci. 83(4): 582-586 (1994). for 10 minutes, 40 cycles of 95°C. for 15 seconds, 60° C. Example 14 for 1 minute. The ACT values (CTs-CTA) were plot ted against drug concentration and fitted to the sigmoid dose Synthesis of N-Dimethylpiperidinomethylene) response model using SAS system (SAS Institute, Inc.) or arabinocytidine (XIV) PRISM software (Graphpad Software, Inc.). IC50 was the 0281 Ara-C (500 mg, 2.05 mmol) in DMF (10 mL) is drug dose response necessary to achieve an increase of 1 in reacted with N-(dimethoxy methyl)dimethyl piperidine (2.7 ACT over the projected baseline. IC90 was the drug dose g, 16.8 mmol) for several hours at room temperature. The response necessary to achieve an increase of 3.2 over the contents are evaporated and the residue chromatographed baseline. All Taqman reagents were from PE Applied Bio over silica gel using 1-6% MeOH in CHC1. The desired system. fractions are collected and evaporated. The foam obtained is 0286 Cell toxicity assay. The toxicity of compounds on recrystallized from a mixture of ethanol, CHCl, and ethyl the replicon cells were measured by MTS assay following acetate to give N-Dimethylpiperidinomethylenelara manufacturers instructions (Promega). Briefly, 20 Jul of binocytidine. CellTiter 96(RAQueous One Solution Reagent were added to Example 15 each well of the 96-well plate containing 100 ul of culture medium. The plates were incubated for 30-60 minutes Dose Response and Cell Toxicity Assay before reading OD by DYNEX MRX. 0282. This example demonstrates the ability of various compounds of the invention to inhibit the ability of cells to TABLE 4 maintain and replicate a replicon. The example also evalu ates the toxicity level of the various compounds on the cells. Dose response and cell-toxicity assay results. 0283 Cell Culture. Cells of the luciferase replicon cell Compound IC50 (M) IC90 EC50 EC90 CCSO TI line (Vrolijk et al., J. Virol. Methods 110:201-209 (2003)) X >10 >10 O.O3 2 >1O >300 was grown in Dulbecco's minimal essential medium XI >10 >10 O.O7 8 >1O >100 (DMEM) supplemented with 2 mM glutamine, non-essential XII >10 >10 O.O2 1.5 >1O >500 amino acids (NEAA), 10 mM HEPES, 0.075% sodium XIII >10 >10 O.09 5 >1O >100 bicarbonate, 100 U/mL penicillin and 100 ug/mL streptomy Cytarabine -10 >10 O.OS 4 >1O >2OO cin, and 10% fetal bovine serum. To maintain the selection Ribavirin 40-100 not reached 20 8O -500 -25 for replicon, 0.3 mg/mL of G418 were added to the culture media. 0284 Dose-Response and Luciferase Assays. Replicon 0287 IC50: drug dose necessary to reach a 2-fold cells were seeded at 5000 cells/well in 96-well collagen decrease in replicon RNA level. I-coated Biocoat plates (Becton Dickinson; Palo Alto, 0288 IC90: drug dose necessary to reach a 10-fold Calif.). Twenty-four hrs post-seeding, compounds (see Table decrease in replicon RNA level 1 below) were added to replicon cells. The final concentra tion of DMSO was 0.5%, fetal bovine serum was 10%, and 0289 EC50: drug dose necessary to reach a 2-fold G418 was not added. The cells were incubated with the decrease in luciferase signal. compounds for 2 days, at which point the cells were washed 0290 EC90:drug dose necessary to reach a 10-fold with PBS and lysed in 40 ul Glo Lysis Buffer (Promega; reduction in luciferase signal. Madison, Wis.). 20 ul of lysates were mixed with 100 ul Luciferase Assay Reagent (Promega) and read on a Micro 0291 CC50: drug dose necessary to reduce the MTS titer Plate Luminometer MLX (DYNEX Technologies: signal to 50% of that of no drug control Chantilly, Va.). The fold of reduction in luciferase signal 0292 TI:CC50/EC50 in 5-2 cells. compared to no compound control was plotted against drug concentration and fitted to the sigmoid dose response model 0293 All units are uM. using PRISM software (Graphpad Software Inc.; San Diego, 0294 The present invention is not to be limited in scope Calif.). by the specific embodiments described herein. Indeed, vari 0285 Taqman Assay Method. Replicon cells were seeded ous modifications of the invention in addition to those at 4000 cells/well in 96-well collagen 1-coated Biocoat described herein will become apparent to those skilled in the Plates (Becton Dickinson). Twenty-four hours post-seeding, art from the foregoing description. Such modifications are compounds were added to replicon cells. The final concen intended to fall within the scope of the appended claims. tration of DMSO was 0.5%, fetal bovine serum was 10%, 0295 Patents, patent applications, publications, product and no G418 was added. Cells were incubated with com descriptions, and protocols are cited throughout this appli pounds for 2 days, at which point the cells were washed with cation, the disclosures of which are incorporated herein by PBS and lysed in 1x cell lysis buffer (Ambion). The replicon reference in their entireties for all purposes. US 2006/0198824 A1 Sep. 7, 2006 30
SEQUENCE LISTING
<160> NUMBER OF SEQ ID NOS: 3
<21 Oc SEQ ID NO 1 <211 LENGTH 17 <212> TYPE DNA <213> ORGANISM: Artificial Sequence <220&. FEATURE: <223> OTHER INFORMATION: Primer 5B.2F
<400 SEQUENCE: 1 atggacaggc gcc ctda 17
SEQ ID NO 2 LENGTH 2.0 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer 5B.2R
<400 SEQUENCE: 2 ttgatgggca gcttggtttc 20
SEQ ID NO 3 LENGTH 17 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: RT-PCR probe <400 SEQUENCE: 3 cacgc.catgc gctg.cgg 17
We claim: pharmaceutically acceptable leaving group which is capable 1. A method for treating a host infected with a virus which of being converted into —OH or phosphate when the is a member of the Flaviviridae family of viruses, compris compound represented by formula I is administered in vivo. ing administering to said host a therapeutically effective 2. The method claim 1 wherein the virus is hepatitis C amount of a compound represented by structural formula I virus. 3. The method of claim 1, wherein the compound repre sented by formula I is administered in association with interferon-alfa, pegylated interferon-alfa or albumin-inter feron-alpha. 4. The method of claim 3 wherein the compound repre sented by formula I is administered in association with an interferon-alfa selected from the group consisting of inter feron alfa-2a, interferon alfa-2b, interferon alfa-2c, inter feron alfa n-1, interferon alfa n-3 and consensus interferon. 5. The method of claim 3 wherein the compound repre sented by formula I is administered in association with a pegylated interferon-alfa selected from the group consisting of pegylated interferon alfa-2a, pegylated interferon alfa-2b. or a pharmaceutically acceptable salt thereof or a pharma pegylated interferon alfa-2c, pegylated interferon alfa n-1, ceutical composition thereof which composition comprises a pegylated interferon alfa n-3, and pegylated consensus inter pharmaceutically acceptable carrier; wherein R and Rare feron. independently —OH or a pharmaceutically acceptable leav 6. The method of claim 1, wherein the compound repre ing group which is capable of being converted into —OH, sented by formula I is further administered in association For —CH when the compound represented by formula I is with ribavirin. administered in vivo, and wherein R is a straight or 7. The method of claim 1 wherein R=R'= OH. branched chain Co. to C alkylphosphate or a straight or 8. The method of claim 1, wherein R is a C to Co branched chain Co. to C alkenylphosphate group or a alkylphosphate group US 2006/0198824 A1 Sep. 7, 2006
9. The method of claim 8, wherein R is a Cls to Co alkylphosphate group. 10. The method of claim 9, wherein R is –OPOH CH7 or a corresponding ion thereof. 11. The method of claim 1, wherein R is a Cs to Co alkenylphosphate group. 12. The method of claim 1 wherein said compound is represented by structural formula II whereinn and mare independently 0, 1, 2 or 3 and Q is CH, NR, O, S, SO or SO; and R is independently H, C to C. alkyl or C to Ce acyl or wherein R' and R, taken together III with the N, are represented by the structural formula:
CH3
CH3
15. The method claim 14 wherein the virus is hepatitis C 13. The method of claim 1 wherein the host is adminis virus. tered the compound following transplantation of a liver into 16. The method of claim 14, wherein the compound said host or transfusion of blood into said host. represented by formula IV is administered in association 14. A method for treating a host infected with a virus with interferon-alfa, pegylated interferon-alfa or albumin which is a member of the Flaviviridae family of viruses, interferon-alpha. comprising administering to said host a therapeutically 17. The method of claim 14 wherein the compound effective amount of a compound represented by structural represented by formula IV is administered in association formula IV with an interferon-alfa selected from the group consisting of interferon alfa-2a, interferon alfa-2b, interferon alfa-2c, interferon alfa n-1, interferon alfa n-3 and consensus inter
IV feron. 18. The method of claim 14 wherein the compound represented by formula IV is administered in association with a pegylated interferon-alfa selected from the group consisting of pegylated interferon alfa-2a, pegylated inter feron alfa-2b, pegylated interferon alfa-2c, pegylated inter feron alfa n-1, pegylated interferon alfa n-3, and pegylated consensus interferon. 19. The method of claim 14, wherein the compound represented by formula IV is administered in association with ribavirin. or a pharmaceutically acceptable salt thereof or a pharma 20. The method of claim 14 wherein R= ceutical composition thereof which composition comprises a pharmaceutically acceptable carrier; wherein R and R are independently —OH or a pharmaceutically acceptable leav ing group which is capable of being converted to phosphate, —OH, - F or —CH when the compound represented by formula IV is administered in vivo, wherein R is -OH, a straight or branched chain C to C alkylphosphate or a straight or branched chain Co. to Calkenylphosphate group or a corresponding ion thereof. or a pharmaceutically acceptable leaving group which is 21. The method of claim 14 wherein R=R=R= - capable of being converted into —OH, phosphate, F or CH, when the compound represented by formula IV is OH. administered in vivo and wherein R' and R are indepen 22. The method of claim 14, wherein R' and Rare C-Cs dently C to Co alkyl or wherein R' and R taken together alkyl. with N form a C to C, ring represented by the following 23. The method of claim 22, wherein R' and R are structural formula: isopropyl. US 2006/0198824 A1 Sep. 7, 2006 32
24. The method of claim 14, wherein R' and R taken together with N are represented by the structural formula: -continued
VIII ry(CH2)m N (CH2) l/ whereinn and mare independently 0, 1, 2 or 3 and Q is CH, NR, O, S, SO or SO; and R is independently H, C to C. alkyl or C to C acyl. 25. The method of claim 14, wherein R' and R taken HO O together with N are represented by the following structural formula:
CH3
CH3
26. The method of claim 14 wherein the host is admin HO O istered the compound following transplantation of a liver into said host or transfusion of blood into said host 27. The method of claim 14 wherein the compound is represented by a structural formula selected from the group HO consisting of:
VI
HO O
HO O HO XI
HO VII
HO O HO O
HO HO US 2006/0198824 A1 Sep. 7, 2006 33
-continued -continued XII XVI 11\, e O N e dir N21
O N HO-P-O O HO O HO O HO HO
XVII HO XIII N-1N1-1
N2 2 N dir N21
N21 O O1. N HO-P-O O | HO es O HO O HO HO
XIV XVIII HO 1-1N1-S-1a e 2N N N dir N21
N21 O O1. N HO-P-O O | HO es O HO O HO HO
HO XIX XV N >1 2 N2 N C18H37 N21 dir N21 O O N O N HO-P-O O HO-P-O O | HO | HO O O
HO HO US 2006/0198824 A1 Sep. 7, 2006 34
-continued -continued
XXIII
XX 2N s N N e C18H37 N21 N 1. O N t N21 HO-P-O O
8 O le. N I, Yao HO-P-O O | HO HO O 28. A composition comprising a compound represented by HO structural formula IV
IV XXI
ON
N2 dir N21
O O1. N HO-P-O O HO or a pharmaceutically acceptable salt thereof or a pharma O ceutical composition thereof which composition comprises a pharmaceutically acceptable carrier; wherein R and Rare HO independently —OH or a pharmaceutically acceptable leav ing group which is capable of being converted to phosphate, —OH, - F or —CH when the compound represented by formula IV is administered in vivo, wherein R is a straight or branched chain C to C alkylphosphate or a straight or XXII branched chain Co. to C alkenylphosphate group and wherein R' and R are independently C, to Co alkyl or and wherein R' and R taken together with N form a C to C, N ring represented by the following structural formula:
Ne C18H37 N21 / (CH2)CH2)m N a lu -N Q O N NCH,- HO-P-O O | HO O whereinn and mare independently 0, 1, 2 or 3 and Q is CH, NR, O, S, SO or SO; and R is independently H, C to C. HO alkyl or C to Ce acyl or wherein R' and R, taken together with the N, are represented by the structural formula: US 2006/0198824 A1 Sep. 7, 2006 35
-continued XVIII CH3 1N1\1\-1S,
N2 dir N21 CH3 O O1. N HO-P-O O 29. The composition of claim 28 which is represented by | HO a structural formula selected from the group consisting of O
HO XIX
XV N1 >1
N2 N2 dir N21 dir N21 O 1. O 1. O N O N HO-P-O O HO-P-O O | HO | HO O O
HO HO XX
XVI 1N1-S O 2 N N2 dir N21 ir N21 O 1. O N O O1. N HO-P-O O HO-P-O O | HO | HO O O
HO HO XXI
XVII N-1-1-1 ON
N2 N2 dir N21 ir N21 O 1. O N O 1. HO-P-O O O N | HO HO-P-O O O | HO O
HO HO US 2006/0198824 A1 Sep. 7, 2006 36
-continued -continued XXIII
XXII -ON
h 1. HO-P-O O O N | HO
O HO
HO