DOCSLIB.ORG

The Structure and Evolution of Breast Cancer Genomes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Structure and Evolution of Breast Cancer Genomes The Structure and Evolution of Breast Cancer Genomes Scott Newman Clare College, University of Cambridge A dissertation submitted to the University of Cambridge in candidature for the degree of Doctor of Philosophy February 2011 Declaration This dissertation contains the results of experimental work carried out between October 2007 and December 2010 in the Department of Pathology, University of Cambridge. This dissertation is the result of my own work and includes nothing which is the outcome of work done in collaboration except where specifically indicated in the text. It has not been submitted whole or in part for any other qualification at any other University. i Summary The Structure and Evolution of Breast Cancer Genomes Scott Newman Chromosome changes in the haematological malignancies, lymphomas and sarcomas are known to be important events in the evolution of these tumours as they can, for example, form fusion oncogenes or disrupt tumour suppressor genes. The recently described recurrent fusion genes in prostate and lung cancer proved to be iconic examples as they indicated that important gene fusions are found in the common epithelial cancers also. Breast cancers often display extensive structural and numerical chromosome aberration and have among the most complex karyotyes of all cancers. Genome rearrangements are potentially an important source of mutation in breast cancer but little is known about how they might contribute to this disease. My first aim was to carry out a structural survey of breast cancer cell line genomes in order to find genes that were disrupted by chromosome aberrations in “typical” breast cancers. I investigated three breast cancer cell lines, HCC1187, VP229 and VP267 using data from array painting, SNP6 array CGH, molecular cytogenetics and massively parallel paired end sequencing. I then used these structural genomic maps to predict fusion transcripts and demonstrated expression of five fusion transcripts in HCC1187, three in VP229 and four in VP267. Even though chromosome aberrations disrupt and fuse many genes in individual breast cancers, a major unknown is the relative importance and timing of genome rearrangements compared to sequence-level mutation. For example, chromosome instability might arise early and be essential to tumour suppressor loss and fusion gene formation or be a late event contributing little to cancer development. To address this question, I considered the evolution of these highly rearranged breast cancer karyotypes. The VP229 and VP267 cell lines were derived from the same patient before and after therapy-resistant relapse, so any chromosome aberration found in both cell lines was probably found in the common in vivo ancestor of the two cell lines. A large majority of structural variants detected by massively parallel paired end sequencing, including three fusion transcripts, were found in both cell lines, and therefore, in the common ancestor. This probably means that the bulk of genome rearrangement pre-dated the relapse. For HCC1187, I classified most of its mutations as earlier or later according to whether they occurred before or after a landmark event in the evolution of the genome - endoreduplication (duplication of its entire genome). Genome rearrangements and sequence-level mutations were fairly evenly divided between earlier and later, implying that genetic instability was relatively constant throughout the evolution of the tumour. Surprisingly, the great majority of inactivating mutations and expressed gene fusions happened earlier. The non-random timing of these events suggests many were selected. ii Acknowledgements Thanks to members of the Edwards group past and present and especially to Paul Edwards, himself, for his sound advice and good humour over the past few years. I am also grateful to Clare College and the Medical Research Council for their financial support. Most of all, thanks also to my patient and understanding wife, Star who has supported me throughout my Master's and Ph.D studies. And last but not least, I need to thank my daughter, Ellinore. Her impending birth made me hasten the speed at which I was writing. iii Contents Declaration i Summary ii Acknowledgements iii List of Figures ix List of Tables xi Abbreviations xii Chapter 1 Introduction 1 1.1. Cancer 2 1.2. Breast Cancer 3 1.2.1. Susceptibility Alleles 3 1.2.2. Breast Cancer Histology 4 1.2.3. Gene expression patterns 5 1.2.4. Developmental Hierarchy of Breast Cells 6 1.3. Mutations that cause cancer 6 1.3.1. Sequence-level changes 7 1.3.2. Sequence-level changes in breast cancer 7 1.3.3. Changes to chromosome structure 9 1.3.4. The cytogenetics of breast cancer 10 1.3.5. Tumour Suppressor Gene Deletion 11 1.3.6. Oncogene Amplification 12 1.3.7. Gene Fusion 12 1.3.7.1. Receptor Tyrosine Kinases 13 1.3.7.2. Intracellular Kinases 14 1.3.7.3. Transcription factors and Chromatin Modifiers 14 1.3.8. Gene fusions in breast cancer 15 1.3.9. The complex structure of breast cancer genomes 15 1.4. Questions for post-genome cancer research 17 1.4.1. What types of mutations are needed to cause cancer? 18 1.4.2. How many mutations are required for cancer to develop? 19 1.4.2.1. Drivers versus Passengers 20 1.4.2.2. Driving mutations caused by chromosome aberrations 21 1.4.3. How should we deal with intra-tumour heterogeneity? 22 1.4.4. What is the role of chromosome instability? 23 1.4.4.1. The State of CIN 24 1.4.4.2. The timing of CIN 25 1.4.4.3. The Acquisition of CIN 26 1.5. Techniques used and discussed in this thesis 27 1.5.1. Florescence in situ Hybridization (FISH) 28 1.5.2. Spectral Karyotyping 28 1.5.3. Flow sorting of Chromosomes 29 1.5.4. Array CGH 30 1.5.5. Array Segmentation Algorithms 31 1.5.6. Array Painting 31 1.5.7. Massively Parallel Paired End Sequencing 32 1.7. The purpose of this thesis 35 1.7.1. Aim 1: Map chromosome rearrangements in breast cancer 35 1.7.2. Aim 2: Inveterate the relative timing of point mutations and chromosome Investiagte the realative timing of point mutations and chromosome aberrations 35 iv Chapter 2 Materials and Methods 37 2.1. Reagents, Manufacturers and Suppliers 37 2.2. Common Solutions 39 2.3. Cell Lines and Culture 40 2.3.1. Thawing Splitting and Feeding Cells 40 2.4. Chromosome Preparations 41 2.4.1. Metaphase Chromosome Preparation for Flow Sorting 41 2.4.2. Metaphase Preparation for FISH 43 2.4.3. Preparation of DNA Fibres for FISH 44 2.5. Fluorescence in situ Hybridization (FISH) 44 2.5.1. Preparation and Labelling of Chromosome Paints 44 2.5.2. BAC clones and their culture 46 2.5.3. Probe DNA Extraction and Labelling 46 2.5.4. Probe Precipitation 47 2.5.5. FISH Hybridization 47 2.5.6. Post Hybridization Washing and Detection 47 2.5.7. Fibre FISH hybridizations and Washes 48 2.5.8. Fibre FISH Detection of indirectly labelled probes 48 2.5.9. Image Acquisition and Processing 49 2.6. PCR and Sequencing 49 2.6.1. Amplification of Sorted Chromosomes for PCR 49 2.6.2. Genomic DNA preparation 50 2.6.3. cDNA Preparation 50 2.6.4. PCR of Fusion Transcripts 50 2.6.5. Sanger Sequencing of Fusion Transcripts 51 2.6.6. Sanger Sequencing of Somatically Mutated Region 52 2.6.7. Sanger Sequencing Across Genomic Breakpoints 53 2.6.8. Pyrosequencing 54 2.6.9. Illumina Sequencing 55 2.6.10. Quantitative PCR 56 2.7. Bioinformatics 56 2.7.1. SNP6 data and Segmentation 56 2.7.2. Break point regions from segmented SNP6 array CGH data 57 2.7.3. Genes at SNP6 break points 57 2.7.4. Ensembl API scripting to predict gene fusions 57 2.7.5. Ensembl API scripting to retrieve structural variant break point regions 57 2.7.6. Circular visualisation of data 57 2.8. Statistical Model 58 2.8.1. Maximum likelihood estimators and confidence intervals 58 2.8.2. Classical approach 58 2.8.3. Finding the MLEs 59 2.8.4. Confidence intervals 59 Chapter 3 The Structure of a Breast Cancer Genome 61 3.1. Introduction 62 3.2. Previous Data 62 3.2.1. Spectral Karyotyping (SKY) 62 3.2.2. Array Painting 62 3.2.3. Massively Parallel Paired End Sequencing 64 3.2.4. Exome-wide Mutation Screen and Targeted Resequencing 64 v 3.3. Analysis Part I. The Genome Structure of HCC1187 65 3.3.1. Combining Array Painting Data with SNP6 array CGH Data 65 3.3.2. Incorporating Massively Parallel Paired End Sequence data 69 3.3.3. Genes at Chromosome Break Points 70 3.3.4. Sub-Microscopic Aberrations From SNP6 and Massively Parallel paired End Sequencing Data 73 3.3.5. Broken and Predicted Fusion Genes in HCC1187 79 3.4. Expressed Fusion Genes in HCC1187 80 3.4.1. PUM1-TRERF1 80 3.4.2. CTCF-SCUBE2 85 3.4.3. RHOJ-SYNE2 88 3.4.4. CTAGE5-SIP1 92 3.4.5. SUSD1-ROD1 95 3.4.6. PLXND1-TMCC1 97 3.4.7. Other reported gene-fusions in HCC1187 100 3.5. Analysis Part II. Sequence-Level Mutations in HCC1187 101 3.5.1. Placing Sequence-Level mutations on the Genomic Map 101 3.5.2. Confirmation by pyrosequencing 102 3.6. Discussion 108 3.6.1. How complete was this analysis? 109 3.6.2. The rearrangements that fused genes 110 3.6.3. Conclusions 110 Chapter 4 The Evolution of a Breast Cancer Genome 111 4.1.
Load more

Recommended publications
  • PARSANA-DISSERTATION-2020.Pdf
    DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks.
    [Show full text]
  • Analysis of Trans Esnps Infers Regulatory Network Architecture
    Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Anat Kreimer All rights reserved ABSTRACT Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer eSNPs are genetic variants associated with transcript expression levels. The characteristics of such variants highlight their importance and present a unique opportunity for studying gene regulation. eSNPs affect most genes and their cell type specificity can shed light on different processes that are activated in each cell. They can identify functional variants by connecting SNPs that are implicated in disease to a molecular mechanism. Examining eSNPs that are associated with distal genes can provide insights regarding the inference of regulatory networks but also presents challenges due to the high statistical burden of multiple testing. Such association studies allow: simultaneous investigation of many gene expression phenotypes without assuming any prior knowledge and identification of unknown regulators of gene expression while uncovering directionality. This thesis will focus on such distal eSNPs to map regulatory interactions between different loci and expose the architecture of the regulatory network defined by such interactions. We develop novel computational approaches and apply them to genetics-genomics data in human. We go beyond pairwise interactions to define network motifs, including regulatory modules and bi-fan structures, showing them to be prevalent in real data and exposing distinct attributes of such arrangements. We project eSNP associations onto a protein-protein interaction network to expose topological properties of eSNPs and their targets and highlight different modes of distal regulation.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Alternative Haplotypes of Antigen Processing Genes in Zebrafish Diverged Early in Vertebrate Evolution
    Alternative haplotypes of antigen processing genes in PNAS PLUS zebrafish diverged early in vertebrate evolution Sean C. McConnella,1, Kyle M. Hernandezb, Dustin J. Wciselc,d, Ross N. Kettleboroughe, Derek L. Stemplee, Jeffrey A. Yoderc,d,f, Jorge Andradeb, and Jill L. O. de Jonga,1 aSection of Hematology-Oncology and Stem Cell Transplant, Department of Pediatrics, The University of Chicago, Chicago, IL 60637; bCenter for Research Informatics, The University of Chicago, Chicago, IL 60637; cDepartment of Molecular Biomedical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC 27607; dGenomic Sciences Graduate Program, North Carolina State University, Raleigh, NC 27607; eVertebrate Development and Genetics, Wellcome Trust Sanger Institute, Cambridge CB10 1SA, United Kingdom; and fComparative Medicine Institute, North Carolina State University, Raleigh, NC 27607 Edited by Peter Parham, Stanford University School of Medicine, Stanford, CA, and accepted by Editorial Board Member Peter Cresswell June 23, 2016 (received for review May 16, 2016) Antigen processing and presentation genes found within the Recent genomic studies have offered considerable insights into MHC are among the most highly polymorphic genes of vertebrate the evolution of the vertebrate adaptive immune system by com- genomes, providing populations with diverse immune responses to a paring phylogenetically divergent species (11–14). Throughout wide array of pathogens. Here, we describe transcriptome, exome, vertebrates, gene linkage within the MHC region is highly con- and whole-genome sequencing of clonal zebrafish, uncovering the served. For example, MHCI and antigen processing genes remain most extensive diversity within the antigen processing and presen- tightly linked in sharks, members of the oldest vertebrate lineage tation genes of any species yet examined.
    [Show full text]
  • Epigenetics Page 1
    Epigenetics esiRNA ID Gene Name Gene Description Ensembl ID HU-13237-1 ACTL6A actin-like 6A ENSG00000136518 HU-13925-1 ACTL6B actin-like 6B ENSG00000077080 HU-14457-1 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ENSG00000138107 HU-10579-1 ACTR2 ARP2 actin-related protein 2 homolog (yeast) ENSG00000138071 HU-10837-1 ACTR3 ARP3 actin-related protein 3 homolog (yeast) ENSG00000115091 HU-09776-1 ACTR5 ARP5 actin-related protein 5 homolog (yeast) ENSG00000101442 HU-00773-1 ACTR6 ARP6 actin-related protein 6 homolog (yeast) ENSG00000075089 HU-07176-1 ACTR8 ARP8 actin-related protein 8 homolog (yeast) ENSG00000113812 HU-09411-1 AHCTF1 AT hook containing transcription factor 1 ENSG00000153207 HU-15150-1 AIRE autoimmune regulator ENSG00000160224 HU-12332-1 AKAP1 A kinase (PRKA) anchor protein 1 ENSG00000121057 HU-04065-1 ALG13 asparagine-linked glycosylation 13 homolog (S. cerevisiae) ENSG00000101901 HU-13552-1 ALKBH1 alkB, alkylation repair homolog 1 (E. coli) ENSG00000100601 HU-06662-1 ARID1A AT rich interactive domain 1A (SWI-like) ENSG00000117713 HU-12790-1 ARID1B AT rich interactive domain 1B (SWI1-like) ENSG00000049618 HU-09415-1 ARID2 AT rich interactive domain 2 (ARID, RFX-like) ENSG00000189079 HU-03890-1 ARID3A AT rich interactive domain 3A (BRIGHT-like) ENSG00000116017 HU-14677-1 ARID3B AT rich interactive domain 3B (BRIGHT-like) ENSG00000179361 HU-14203-1 ARID3C AT rich interactive domain 3C (BRIGHT-like) ENSG00000205143 HU-09104-1 ARID4A AT rich interactive domain 4A (RBP1-like) ENSG00000032219 HU-12512-1 ARID4B AT rich interactive domain 4B (RBP1-like) ENSG00000054267 HU-12520-1 ARID5A AT rich interactive domain 5A (MRF1-like) ENSG00000196843 HU-06595-1 ARID5B AT rich interactive domain 5B (MRF1-like) ENSG00000150347 HU-00556-1 ASF1A ASF1 anti-silencing function 1 homolog A (S.
    [Show full text]
  • HSD17B8 (NM 014234) Human Tagged ORF Clone – RG203806
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG203806 HSD17B8 (NM_014234) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: HSD17B8 (NM_014234) Human Tagged ORF Clone Tag: TurboGFP Symbol: HSD17B8 Synonyms: D6S2245E; dJ1033B10.9; FABG; FABGL; H2-KE6; HKE6; KE6; RING2; SDR30C1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG203806 representing NM_014234 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGTCTCAGCTCCAGAACCGACTCCGCTCCGCACTGGCCTTGGTCACAGGTGCGGGGAGCGGCATCG GCCGAGCGGTCAGTGTACGCCTGGCCGGAGAGGGGGCCACCGTAGCTGCCTGCGACCTGGACCGGGCAGC GGCACAGGAGACGGTGCGGCTGCTGGGCGGGCCAGGGAGCAAGGAGGGGCCGCCCCGAGGGAACCATGCT GCCTTCCAGGCTGACGTGTCTGAGGCCAGGGCCGCCAGGTGCCTGCTGGAACAAGTGCAGGCCTGCTTTT CTCGCCCACCATCTGTCGTTGTGTCCTGTGCGGGCATCACCCAGGATGAGTTTCTGCTGCACATGTCTGA GGATGACTGGGACAAAGTCATAGCTGTCAACCTCAAGGGCACCTTCCTAGTCACTCAGGCTGCAGCACAA GCCCTGGTGTCCAATGGTTGTCGTGGTTCCATCATCAACATCAGTAGCATCGTAGGAAAGGTGGGGAACG TGGGGCAGACAAACTATGCAGCATCCAAGGCTGGAGTGATTGGGCTGACCCAGACCGCAGCCCGGGAGCT TGGACGACATGGGATCCGCTGTAACTCTGTCCTCCCAGGGTTCATTGCAACACCCATGACACAGAAAGTG CCACAGAAAGTGGTGGACAAGATTACTGAAATGATCCCGATGGGACACTTGGGGGACCCTGAGGATGTGG CAGATGTGGTCGCATTCTTGGCATCTGAAGATAGTGGATACATCACAGGGACCTCAGTGGAAGTCACTGG AGGTCTTTTCATG ACGCGTACGCGGCCGCTCGAG
    [Show full text]
  • Epigenetic Reprogramming Underlies Efficacy of DNA Demethylation
    www.nature.com/scientificreports OPEN Epigenetic reprogramming underlies efcacy of DNA demethylation therapy in osteosarcomas Naofumi Asano 1,2, Hideyuki Takeshima3, Satoshi Yamashita3, Hironori Takamatsu2,3, Naoko Hattori3, Takashi Kubo4, Akihiko Yoshida5, Eisuke Kobayashi6, Robert Nakayama2, Morio Matsumoto2, Masaya Nakamura2, Hitoshi Ichikawa 4, Akira Kawai6, Tadashi Kondo1 & Toshikazu Ushijima 3* Osteosarcoma (OS) patients with metastasis or recurrent tumors still sufer from poor prognosis. Studies have indicated the efcacy of DNA demethylation therapy for OS, but the underlying mechanism is still unclear. Here, we aimed to clarify the mechanism of how epigenetic therapy has therapeutic efcacy in OS. Treatment of four OS cell lines with a DNA demethylating agent, 5-aza-2′- deoxycytidine (5-aza-dC) treatment, markedly suppressed their growth, and in vivo efcacy was further confrmed using two OS xenografts. Genome-wide DNA methylation analysis showed that 10 of 28 primary OS had large numbers of methylated CpG islands while the remaining 18 OS did not, clustering together with normal tissue samples and Ewing sarcoma samples. Among the genes aberrantly methylated in primary OS, genes involved in skeletal system morphogenesis were present. Searching for methylation-silenced genes by expression microarray screening of two OS cell lines after 5-aza-dC treatment revealed that multiple tumor-suppressor and osteo/chondrogenesis-related genes were re-activated by 5-aza-dC treatment of OS cells. Simultaneous activation of multiple genes related to osteogenesis and cell proliferation, namely epigenetic reprogramming, was considered to underlie the efcacy of DNA demethylation therapy in OS. Osteosarcoma (OS) is the most common malignant tumor of the bone in children and adolescents1.
    [Show full text]
  • A Dissertation Entitled the Androgen Receptor
    A Dissertation entitled The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit Submitted to the Graduate Faculty as partial fulfillment of the requirements for the PhD Degree in Biomedical science Dr. Manohar Ratnam, Committee Chair Dr. Lirim Shemshedini, Committee Member Dr. Robert Trumbly, Committee Member Dr. Edwin Sanchez, Committee Member Dr. Beata Lecka -Czernik, Committee Member Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo August 2011 Copyright 2011, Mesfin Gonit This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit As partial fulfillment of the requirements for the PhD Degree in Biomedical science The University of Toledo August 2011 Prostate cancer depends on the androgen receptor (AR) for growth and survival even in the absence of androgen. In the classical models of gene activation by AR, ligand activated AR signals through binding to the androgen response elements (AREs) in the target gene promoter/enhancer. In the present study the role of AREs in the androgen- independent transcriptional signaling was investigated using LP50 cells, derived from parental LNCaP cells through extended passage in vitro. LP50 cells reflected the signature gene overexpression profile of advanced clinical prostate tumors. The growth of LP50 cells was profoundly dependent on nuclear localized AR but was independent of androgen. Nevertheless, in these cells AR was unable to bind to AREs in the absence of androgen.
    [Show full text]
  • Accumulated Degeneration of Transcriptional Regulation Contributes to Disease Development and Detrimental Clinical Outcomes of Alzheimer’S Disease
    bioRxiv preprint doi: https://doi.org/10.1101/779249; this version posted September 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Accumulated degeneration of transcriptional regulation contributes to disease development and detrimental clinical outcomes of Alzheimer's disease Guofeng Meng1,*, Dong Lu1, Feng Yu1, Jijia Sun1, Chong Ding1, Yan Sun2, Xuan Liu1, Jiapei Dai2, Wenfei jin3, and Weidong Zhang1,* 1Institute of interdisciplinary integrative Medicine Research, shanghai University of Traditional Chinese Medicine, shanghai, China 2Wuhan Institute for Neuroscience and Neuroengineering (WINN), South-Central University for Nationalities, Wuhan 430074, China 3Department of Biology, Southwest University of Science and Technology, Shenzhen, China *Correspondence: [email protected] and [email protected] Abstract Alzheimer's disease (AD) is extremely complex for both causal mechanism and clinical manifestation, requiring efforts to uncover its diversity and the corresponding mechanisms. Here, we applied a modelling analysis to investigate the regulation divergence among a large-scale cohort of AD patients. We found that transcription regulation tended to get degenerated in AD patients, which contributed to disease development and the detrimental clinical outcomes, mainly by disrupting protein degradation, neuroinflammation, mitochondrial and synaptic functions. To measure the accumulated effects,we came up with a new concept, regulation loss burden, which better correlated with AD related clinical manifestations and the ageing process. The epigenetic studies to multiple active regulation marks also supported a tendency of regulation loss in AD patients.
    [Show full text]
  • In This Table Protein Name, Uniprot Code, Gene Name P-Value
    Supplementary Table S1: In this table protein name, uniprot code, gene name p-value and Fold change (FC) for each comparison are shown, for 299 of the 301 significantly regulated proteins found in both comparisons (p-value<0.01, fold change (FC) >+/-0.37) ALS versus control and FTLD-U versus control. Two uncharacterized proteins have been excluded from this list Protein name Uniprot Gene name p value FC FTLD-U p value FC ALS FTLD-U ALS Cytochrome b-c1 complex P14927 UQCRB 1.534E-03 -1.591E+00 6.005E-04 -1.639E+00 subunit 7 NADH dehydrogenase O95182 NDUFA7 4.127E-04 -9.471E-01 3.467E-05 -1.643E+00 [ubiquinone] 1 alpha subcomplex subunit 7 NADH dehydrogenase O43678 NDUFA2 3.230E-04 -9.145E-01 2.113E-04 -1.450E+00 [ubiquinone] 1 alpha subcomplex subunit 2 NADH dehydrogenase O43920 NDUFS5 1.769E-04 -8.829E-01 3.235E-05 -1.007E+00 [ubiquinone] iron-sulfur protein 5 ARF GTPase-activating A0A0C4DGN6 GIT1 1.306E-03 -8.810E-01 1.115E-03 -7.228E-01 protein GIT1 Methylglutaconyl-CoA Q13825 AUH 6.097E-04 -7.666E-01 5.619E-06 -1.178E+00 hydratase, mitochondrial ADP/ATP translocase 1 P12235 SLC25A4 6.068E-03 -6.095E-01 3.595E-04 -1.011E+00 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 Protein kinase C and casein Q9BY11 PACSIN1 3.837E-03 -5.863E-01 3.680E-06 -1.824E+00 kinase substrate in neurons protein 1 Tubulin polymerization- O94811 TPPP 6.466E-03 -5.755E-01 6.943E-06 -1.169E+00 promoting protein MIC C9JRZ6 CHCHD3 2.912E-02 -6.187E-01 2.195E-03 -9.781E-01 Mitochondrial 2-
    [Show full text]
  • Differential Expression and Co-Expression Gene Networks Reveal Candidate Biomarkers of Boar Taint in Non-Castrated Pigs
    Downloaded from orbit.dtu.dk on: Oct 06, 2021 Differential expression and co-expression gene networks reveal candidate biomarkers of boar taint in non-castrated pigs Drag, Markus; Skinkyté-Juskiené, Ruta; Do, Duy N.; Kogelman, Lisette J. A.; Kadarmideen, Haja N. Published in: Scientific Reports Link to article, DOI: 10.1038/s41598-017-11928-0 Publication date: 2017 Document Version Publisher's PDF, also known as Version of record Link back to DTU Orbit Citation (APA): Drag, M., Skinkyté-Juskiené, R., Do, D. N., Kogelman, L. J. A., & Kadarmideen, H. N. (2017). Differential expression and co-expression gene networks reveal candidate biomarkers of boar taint in non-castrated pigs. Scientific Reports, 7(1), [12205]. https://doi.org/10.1038/s41598-017-11928-0 General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. Users may download and print one copy of any publication from the public portal for the purpose of private study or research. You may not further distribute the material or use it for any profit-making activity or commercial gain You may freely distribute the URL identifying the publication in the public portal If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. www.nature.com/scientificreports OPEN Differential expression and co- expression gene networks reveal candidate biomarkers of boar taint Received: 8 November 2016 Accepted: 1 September 2017 in non-castrated pigs Published: xx xx xxxx Markus Drag 1,4, Ruta Skinkyté-Juskiené 1, Duy N.
    [Show full text]
  • High Resolution Physical Map of Porcine Chromosome 7 QTL Region and Comparative Mapping of This Region Among Vertebrate Genomes
    High resolution physical map of porcine chromosome 7 QTL region and comparative mapping of this region among vertebrate genomes Julie Demars, Juliette Riquet, Katia Feve, Mathieu Gautier, Mireille Morisson, Olivier Demeure, Christine Renard, Patrick Chardon, Denis Milan To cite this version: Julie Demars, Juliette Riquet, Katia Feve, Mathieu Gautier, Mireille Morisson, et al.. High resolution physical map of porcine chromosome 7 QTL region and comparative mapping of this region among vertebrate genomes. BMC Genomics, BioMed Central, 2006, 7, pp.13. 10.1186/1471-2164-7-13. hal-02661326 HAL Id: hal-02661326 https://hal.inrae.fr/hal-02661326 Submitted on 30 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. BMC Genomics BioMed Central Research article Open Access High resolution physical map of porcine chromosome 7 QTL region and comparative mapping of this region among vertebrate genomes Julie Demars1, Juliette Riquet1, Katia Feve1, Mathieu Gautier2, Mireille Morisson1, Olivier Demeure3, Christine Renard4, Patrick Chardon4 and Denis Milan*1 Address:
    [Show full text]