Rearrangements Occurs in T Cells After Termination of TCR Killer-Cell

Regulation of Inhibitory and Activating Killer-Cell Ig-Like Receptor Expression Occurs in T Cells After Termination of TCR Rearrangements This information is current as of September 25, 2021. Frédéric Vely, Marie-Alix Peyrat, Christelle Couedel, Jean-François Morcet, Franck Halary, François Davodeau, François Romagne, Emmanuel Scotet, Xavier Saulquin, Elisabeth Houssaint, Nicolas Schleinitz, Alessandro Moretta, Eric Vivier and Marc Bonneville Downloaded from J Immunol 2001; 166:2487-2494; ; doi: 10.4049/jimmunol.166.4.2487 http://www.jimmunol.org/content/166/4/2487 http://www.jimmunol.org/

References This article cites 54 articles, 26 of which you can access for free at: http://www.jimmunol.org/content/166/4/2487.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision by guest on September 25, 2021

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2001 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Regulation of Inhibitory and Activating Killer-Cell Ig-Like Receptor Expression Occurs in T Cells After Termination of TCR Rearrangements1

Fre´de´ric Vely,2† Marie-Alix Peyrat,2* Christelle Couedel,2* Jean-François Morcet,* Franck Halary,* François Davodeau,* François Romagne,§ Emmanuel Scotet,* Xavier Saulquin,* Elisabeth Houssaint,* Nicolas Schleinitz,† Alessandro Moretta,¶ Eric Vivier,†‡ and Marc Bonneville3*

A small fraction of T cells expresses killer-cell Ig-like receptors (KIR), a family of MHC class I-specific receptors that can modulate TCR-dependent activation of effector functions. Although KIR؉ cells are enriched within Ag-experienced T cell subsets, the Downloaded from precise relationships between KIR؉ and KIR؊ T cells and the stage of KIR induction on these lymphocytes remain unclear. In (this study, we compared KIR؊ and KIR؉ ␣␤ T cell clones, sorted by means of the CD158b (KIR2DL2/KIR2DL3/KIR2DS2 specific mAb GL183. We isolated several pairs of CD158b؉ and CD158b؊ ␣␤ T cell clones sharing identical productive and nonproductive TCR transcripts. We showed that expression of functional KIR on T cells is regulated after termination of TCR rearrangements. Transcriptional regulation of KIR genes was documented in multiple T cell clones generated from the same donor, and the presence of KIR transcripts was also detected in KIR؊ T cells. These results document a complex regulation of KIR http://www.jimmunol.org/ expression in T cells at both pre and posttranscriptional levels, under the control of yet undefined signals provided in vivo. The Journal of Immunology, 2001, 166: 2487–2494.

atural killer and T cells play central and complementary killer-cell Ig-like receptors (KIR)4) are either monomeric functions in immunity against transformed or virus-in- (KIR2DL1/KIR2DL2/KIR2DL3/KIR2DL4/KIR3DL1) or ho- N fected cells. Although T cell-mediated elimination of modimeric (KIR3DL2) (5, 6). Although KIR2DL1 and KIR2DL2/ target cells is achieved through recognition of Ags bound to MHC 2DL3 receptors recognize products of particular HLA-Cw alleles molecules, NK cell activation is in most cases negatively affected (e.g., Cw2/4/5/6/15/1602/1701 for the former, and Cw1/3/7/8/12/ by the presence of MHC class I products on target cells (1–3). The 13/14/1601/1603 for the latter), KIR3DL1 receptors interact with by guest on September 25, 2021 molecular basis of these opposite behaviors of T and NK cells was multiple HLA-B molecules (Bw*04), KIR3DL2 receptors may rec- elucidated with the identification of several NKR able to deliver ognize particular HLA-A (e.g., A*03 and A*011) alleles and inhibitory signals to effector cells upon recognition of MHC class KIR2DL4 receptor recognizes the nonclassical HLA-G molecule Ia or Ib molecules (4–7). In humans, these inhibitory MHC recep- (11–17). A novel family of broadly distributed leukocyte Ig-like tors fall into two major groups showing homology to either C-type receptors (LIRs)/Ig-like transcripts (ILTs) has been more recently lectins or Ig. Among members of the first group were identified discovered (18–20). On lymphocytes, ILT-2 (LIR-1) has been several HLA-E-reactive heterodimeric receptors comprising an in- shown to interact with a broad spectrum of HLA-A and HLA-B alleles as well as with HLA-G (18, 21). variant CD94 subunit paired to NKG2 polypeptides (8–9). Inhib- Inhibitory NKR (KIR-long (KIR-L) molecules, LIR-1/ILT-2, itory NKR belonging to the Ig superfamily (also referred to as NKG2A) harbor an intracytoplasmic immunoreceptor tyrosine- based inhibition motif, which is responsible for the inhibitory function of the receptor (5, 7). Activating NKR have also been described. Activating NKR (KIR-short (KIR-S) molecules, LIR-7/ *Institut National de la Sante´ et de la Recherche Me´dicale, Unite´ 463, Institut de Biologie, Nantes, France; †Centre d’Immunologie, Institut National de la Santeétde ILT-1) have no intracytoplasmic immunoreceptor tyrosine-based la Recherche Me´dicale/Centre National de la Recherche Scientifique de Marseille inhibition motif, but are associated with immunoreceptor tyrosine- Luminy, Marseille, France; ‡Institut Universitaire de France, Paris, France; §Immu- notech SA, Marseille, France; and ¶Istituto di Istologia, Universita di Genoa, Genoa, based activation molecule-bearing transduction polypeptides such Italy as killer cell-activating receptor-associated protein/DAP12 (KIR-S Received for publication November 23, 1999. Accepted for publication December molecules, NKG2C) or FcR␥ (LIR-7/ILT-1) (7). 1, 2000. NKRs are not specific NK cell markers. Their distribution in- ϩ The costs of publication of this article were defrayed in part by the payment of page cludes subsets of ␣␤ and ␥␦ T lymphocytes (14, 22–25). NKR charges. This article must therefore be hereby marked advertisement in accordance ␣␤ T cells are preferentially found within Ag-experienced subsets with 18 U.S.C. Section 1734 solely to indicate this fact. 1 (26), thus suggesting selective NKR induction or expansion of This work was supported in part by the Association pour la Recherche sur le Cancer ϩ by institutional grants from Institut National de la Santeét de la Recherche Me´dicale NKR T cells during in vivo T cell responses. In this regard, and by ZENECA (to F.V.). cytokines such as IL-15 and TGF-␤ have been implicated in the 2 F.V., M.-A.P., and C.C. contributed equally to this work. 3 Address correspondence and reprint requests to Dr. Marc Bonneville, Institut National de la Santeét de la Recherche Me´dicale, Unite´463, Institut de Biologie, 9 4 Abbreviations used in this paper: KIR, killer-cell Ig-like receptor; BLC, B lympho- quai Moncousu, 44035 Nantes Cedex 01, France. E-mail address: bonnevil@ blastoid cell; RT, reverse transcription; LIR, leukocyte Ig-like receptor; ILT, Ig-like nantes.inserm.fr transcript; KIR-L, KIR-long; KIR-S, KIR-short.

ϩ induction of CD94/NKG2A dimers observed on some CD8 T tion was performed using the following degenerate V␤ primers: 5Ј-CAYN- cells following their in vitro activation (27, 28). Whether a similar RVDMYRTBTMYTGGTA and 5Ј-CMYRMHMMYMTKTWYTGGTA ϭ ϩ ϭ ϩ ϩ ϩ ϭ ϩ ϭ ϩ ϩ ϭ ϩ ϩ mechanism applies for KIR is yet unclear; in particular, direct (Y C T, N A C G T, R A G, V G A C, D G A T, M ϭ AϩC, B ϭ GϩTϩC, H ϭ AϩTϩC, K ϭ GϩT, W ϭ AϩT). A evidence for in vitro or in vivo induction of KIR on mature lym- second PCR was then performed using a nested C␤ primer (5Ј-GTGGC- phoid cells is still lacking. CAGGCACACCAGTGTG) as described (31–33). Bands of interest were Here, we have studied the Ag specificity and TCR features of purified and sequenced as described above. KIRϩ and KIRϪ ␣␤ T lymphocytes derived from cells involved in a chronic in vivo response against EBV. We characterized several Functional assays ϩ Ϫ pairs of KIR and KIR T cell clones expressing identical TCR COS cell transfection assay was performed by the DEAE-dextran chloroquine transcripts, indicating that regulation of KIR expression occurs af- method (34). In brief, 1.5 ϫ 104 COS cells were cotransfected with 100 ng of ter termination of TCR rearrangements. an expression vector coding for an EBV protein and 100 ng of an expression vector coding for an HLA allele. Transfected COS cells were tested 48 h after transfection for their ability to trigger TNF secretion by 105 responding T cells Materials and Methods after a 6-h incubation at 37°C. TNF released in culture supernatants was quan- Abs and reagents titated by a bioassay using Wehi 164 cells (35). For the peptide-induced “fratricide” assay, CTL were incubated for 2 h The following mAb have been described earlier (4) and were used for flow with 10 ␮M peptide and washed once, and cell lysis was estimated by flow cytometry analyses, immunomagnetic sorting, as well as for functional cytometry on the basis of forward/side scatter patterns and propidium io- assays: EB6 (CD158a, anti-KIR2DL1 (p58.1) and KIR2DS1 (p50.1)); dide exclusion (29). GL183 (CD158b, anti-KIR2DL2/2DL3 (p58.2) and KIR2DS2 (p50.2)); For 51Cr-release assays, cytotoxic activity of CTL clones was also es- Z276 (anti-KIR3DL1 (p70)); Q66 (anti-KIR3DL2 (p140)); and FS172 (anti- 51 51 timated by a regular Cr-release assay against Cr-labeled BLC loaded Downloaded from KIR2DS4 (p50.3)). Synthetic peptides corresponding to previously defined with antigenic peptide at a 10/1 E:T ratio, and the percent of specific target EBV epitopes (BMLF1/HLA-A2, GLCTLVAML; BZLF1/HLA-B4002, lysis calculated as previously described (31). Peptide loading of BLC was SENDRLRLL; and BZLF1/HLA-B35, PCVLWPVLPEPLPQGQLTAY performed as described in Ref. 29. In brief, 51Cr-labeled BLC were incu- HVS) (29) were obtained from Chiron Mimotopes (Victoria, Australia). bated with 10 ␮M of synthetic antigenic peptide for1hin200␮l of RPMI Cells 1640 plus 8% FCS, then washed three times in RPMI 1640/FCS previous to use in CTL assays. In some instances, the CTL assay was performed in B lymphoblastoid cells (BLC) were grown in RPMI 1640 medium with 2 the presence of GL183 mAb; in this case, effector cells were preincubated http://www.jimmunol.org/ mM L-glutamine and 8% pooled human serum (culture medium). Synovial for 15 min with GL183 mAb (1/4 final hybridoma supernatant) and then T cell lines were isolated, cultured, sorted, and cloned as described (29, added to peptide-loaded target cells expressing the relevant HLA restrict- 30). The HLA haplotypes of donors A and B were as follows: HLA-A2, ing element (e.g., HLA-B35 in the experiment shown in Fig. 2) with or -B27, -B61, -Cw1, and Cw15 for donor A, HLA-A24, -A31, -B35, -B60, without the relevant KIR ligand. -Cw3, and -Cw7 for donor B. For immunomagnetic sorting, T cells were incubated with anti-KIR mAb for 45 min, washed once, and rotated for 4 h KIR repertoire analysis at 4°C with magnetic beads coated with sheep anti-mouse IgG (Dynal, Oslo, Norway). After eight washes, bead-adherent cells were either seeded DNA and total RNA were prepared from 5 ϫ 106 T cell clones using the at 0.3 cells/well (for direct cloning) or expanded in bulk cultures in culture TRIzol reagent (Life Technologies) according to the manufacturer’s medium supplemented with rIL-2 (150 IU/ml; Chiron Mimotopes) and instructions. Total RNA (5 ␮g) was used for cDNA conversion in a total restimulated at 3-wk intervals with purified lectin (leukoagglutinin, 0.5 volume of 30 ␮l using a first-strand cDNA synthesis kit (Life Tech- by guest on September 25, 2021 ␮g/ml; Sigma, Les Ulis, France) in the presence of irradiated allogeneic nologies). Determination of the KIR repertoire was performed by PCR PBMC and BLC (25, 31). using for each amplification either 200 ng of genomic DNA for genomic typing, or 2 ␮l of cDNA synthesis reaction for transcripts detection. Flow cytometry analysis Specific oligonucleotides for genomic and cDNA sequences, and PCR conditions were described previously (36, 37). To verify the specificity Cells were phenotyped by indirect immunofluorescence as described (25, of the primers designed to detect KIR sequences, vectors containing a 31). In brief, cells were incubated first with unconjugated mAb for 30 min single KIR cDNA sequence (KIR2DS1, KIR2DL1, KIR2DL3,or at room temperature, washed, and incubated with FITC-conjugated rabbit KIR2DS2) or a bacterial artificial chromosome (BAC) containing anti-mouse Ig antiserum (BioAtlantic, Nantes, France) for 30 min on ice. KIR2DL1, KIR3DL1, KIR3DL2, and KIR2DS4 genes (kindly provided After washing, cells were analyzed by flow cytometry on a FACScan ap- by Dr. N. Wagtmann), were used as matrices in the PCR-based assay. paratus (Becton Dickinson, Mountain View, CA) using the LYSYS II soft- At a concentration of 0.1 pg of plasmid or 200 ng of BAC, only specific ware package on a FACStation. For intracellular staining, cells were per- amplifications of the KIR cDNA or genomic sequences by appropriate meabilized in saponin buffer (PBS plus 0.1% BSA plus 0.1% saponin primer pairs were detected. (Sigma) previous staining and flow cytometry was performed as described above using reagents reconstituted in saponin buffer. All washes were performed in saponin buffer. Semiquantitative PCR analysis and sequencing Analysis of TCR transcripts To compare the amount of KIR2DL3 or KIR2DS2 transcripts in T cell clones, 5 ␮l of diluted (10Ϫ1 to 10Ϫ3) or not (100) cDNA were used in a For TCR␣ transcripts, RNA from 5 ϫ 106 T cells was extracted using PCR assay to coamplify human ␤-actin and KIR2DL3 or KIR2DS2. The TRIzol reagent (Life Technologies, Rockville, MD) according to the sup- matrix concentration of the various T cell clones that led to a similar human plier’s instructions, and was dissolved in 40 ␮l water. Reverse transcription ␤-actin amplification was determined and the amplification levels of (RT) was performed on 2.5 ␮l of the RNA solution in a final volume of KIR2DL3 or KIR2DS2 at these concentrations were compared. 12.5 ␮l for 30 min at 45°C in a mix containing 50 mM Tris-HCl (pH 8.3), Full-length cDNAs of KIR2DL3 were obtained from T cell clones RNA Ј 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 10 U rRNasin (Promega, Mad- by RT-PCR using oligo(dT) RT and PCR amplification using 5 - ison, WI), 1 ␮M of each dNTP, 100 U Moloney murine leukemia virus KIR2DL3/2DS2 primer (TCGCTCATGGTCGTCAGCATGGTGTGT) reverse transcriptase (Life Technologies) and 25 pM of the C␣-specific and 3Ј-KIR2DL3/2DS2 primer (AGGGCTCAGCATTTGGAAGTTC primer 5Ј-TGAAGTCCATAGACCTCATGTC. For each clone, five PCR CGT). Amplified products were cloned in pGEM-T-easy vector and se- were performed using sets of degenerate V␣ primers described elsewhere quenced using M13 reverse and T7 primers (ABI Prism 3; Perkin-Elmer, (32). Each PCR was completed to 50 ␮lwitha1ϫ mix of Taq DNA Norwalk, CT). polymerase (Pharmacia, Piscataway, NJ), 1.25 U of Taq DNA polymerase, ␣ 25 pM of mixed V primers. Amplification was performed as described Results (31, 33). Amplified products were directly sequenced (without previous ϩ Ϫ plasmid cloning) as described (31–33) using Sequenase (Amersham, Ar- Isolation of CD158 and CD158 ␣␤ T cells sharing identical lington Heights, IL) and the C␣ sequencing primer, 5Ј-CTTTGTG in-frame and out-of-frame TCR transcripts ACACATTTGTTTGAG. For TCR␤ transcripts, RT was performed using a C␤I reverse primer Several indirect observations, such as the preferential KIR expres- (5Ј-GCAGACAGGACCCCTTGCTGG) as described above. Amplifica- sion on T cells with memory features (26), suggest that surface The Journal of Immunology 2489

KIR are induced at late stages of T cell differentiation, after ter- Functional analysis of KIRϩ and KIRϪ ␣␤ T cell clones mination of TCR rearrangements. However, this hypothesis re- The functionality of KIRs on the aforementioned T cell clones was mains to be formally proven. Indeed despite numerous attempts, it studied by analyzing the effect of KIR engagement on T cell clone has not been possible to induce or modulate surface KIRs on es- cytolytic activity. Cross-linking of CD158b using mAb GL183 tablished T cell clones in vitro, even in the presence of cytokines induced partial inhibition of anti-CD3 redirected lysis of murine (e.g., IL-15, IL-4, IL-12, IFN-␥, and TGF␤) known to affect sur- FcRϩ P815 cells by the CD158bϩ clone BGL19, when compared face expression of lectin-like NKRs, such as CD94-NKG2 het- Ϫ erodimers (27, 38). A way to demonstrate this would be to isolate with its CD158b counterpart (clone B2.5) (data not shown). Sim- ilar results were obtained when KIR were cross-linked by their pairs of clones differing by their KIR phenotype but expressing ϩ ϩ identical TCRs. To this end, we attempted to isolate KIRϩ and physiological ligands (i.e., using HLA-Cw3 or Cw7 targets) KIRϪ ␣␤ T cell clones showing the same antigenic specificity. and the T cell clone activated by its nominal peptidic Ag. Indeed, CD158bϩ (GL183ϩ) KIRϩ T cell lines were generated from two EBV peptide-loaded BLC lacking CD158b ligands (e.g., HLA- ϩ ϩ synovial T cell lines derived from rheumatoid arthritis patients, Cw4 targets) were more efficiently lysed by the CD158b clone ϩ which were previously shown to be selected in vivo by a restricted BGL19 than those expressing CD158b ligands (e.g., HLA-Cw3/7 ϩ ϩ set of well-defined EBV-derived Ags (29, 39). The specificity of targets) (Fig. 2A, right). By contrast, Cw4 and Cw3/7 BLC unsorted (predominantly CD158bϪ) and CD158bϩ T cells derived loaded with the HLA-B35-restricted BZLF1 peptidic Ag were from these patients was then determined by testing their reactivity lysed to a similar extent by the KIRϪ clone B2.5 (Fig. 2A, left). to COS cells cotransfected with cDNAs coding for various EBV/ This difference was exclusively accounted for by KIR engagement ϩ ϩ HLA combinations (29, 34). The CD158b cell lines derived from because efficient cytolysis of Cw3/7 target cells by clone BGL19 Downloaded from both patients reacted to few dominant EBV/HLA combinations was fully restored when masking KIR during the CTL assay (Fig. also recognized by unsorted autologous T cell lines (data not 2B). Taken together, these results indicated that the CD158b mol- ϩ shown). T cell clones were then generated from CD158b and ecules on clone BGL19 were functional as inhibitory receptors for unsorted T cell lines, checked for CD158b expression, and HLA-Cw3/Cw7. screened for their reactivity against the aforementioned dominant Ϫ viral Ag in a peptide-induced fratricide assay. Several CD158b http://www.jimmunol.org/ and CD158bϩ clones recognizing the same EBV epitope (BMLF1/ Transcriptional and posttranscriptional control of KIR A2) were isolated from one patient (A). Similarly, we obtained expression in ␣␤ T cells from the other patient (B), CD158bϪ and CD158bϩ T cell clones A PCR-based analysis of the KIR repertoire was performed on reacting against another EBV Ag (BZLF1/HLA-B35 epitope). ϩ Ϫ Ϫ ϩ KIR and KIR T cell clone DNA and RNA. Genotype of T cell Representative CD158b (A4.5, B2.5) and CD158b (AGL10, clones derived from donor B (B2.5, BGL19) is 2DL1ϩ, 2DL2-, BGL19) T cell clones derived from patients A (A4.5, AGL10) and ϩ ϩ ϩ - - - ϩ - B (B2.5, BGL19) are shown in Fig. 1. TCR␣ and ␤ transcripts 2DL3 , 3DL1 , 3DL2 , 2DS1 , 2DS2 , 2DS3 , 2DS4 , 2DS5 , and 3DS1Ϫ (Table II and Fig. 3). Genotype of cells from donor A derived from these clones were then amplified by RT-PCR and the ϩ ϩ ϩ ϩ corresponding V(D)J junctional regions sequenced. TCR␣- and origin (AGL10 and A4.5) is 2DL1 , 2DL2 , 2DL3 , 3DL1 , by guest on September 25, 2021 ϩ ϩ ϩ - ϩ - Ϫ ␤-chains with identical junctional sequences were identified in the 3DL2 , 2DS1 , 2DS2 , 2DS3 , 2DS4 , 2DS5 , and 3DS1 (Ta- two pairs of KIRϩ and KIRϪ T cell clones reacting against the ble II and Fig. 3). Evidence for a transcriptional regulation of KIR above Ags (Table I). Of note, KIRϩ and KIRϪ T cell clones shared genes was obtained by comparing the transcripts and the genes not only in-frame but also out-of-frame TCR transcripts (Table I), detected in a given cell (Table II and Fig. 3). In AGL10 cells, thus proving that they were the progeny of the same mature T cell neither 2DS1 nor 2DS4 transcripts were detected, while 2DS1 and clone. Taken together, these data formally demonstrated that the 2DS4 genes were present. Similarly, in A4.5 cells, no transcripts regulation of KIR cell surface expression occurs after termination for 2DL1, 2DL2, 3DL1, 3DL2, 2DS1, or 2DS4 were detected de- of TCR gene rearrangements. spite the presence of the corresponding genes.

FIGURE 1. Identification of pairs of KIRϩ and KIRϪ T cell clones reacting against identical MHC/ EBV peptide complexes. A, Flow cytometry analysis of T cell clones derived from patients A and B using KIR-specific mAb. Shown are the fluorescence histo- grams (in log scale) obtained by staining T cell clones with GL183 mAb (open histogram) or an irrelevant isotype-matched mAb (filled histogram). Background staining was obtained with all the other NKR-specific mAb tested (i.e., EB6, ZIN276, DEC66, and FSTR172). B, Identification of EBV Ags recognized by KIRϩ and KIRϪ T cell clones. T cell clone reactivity was evaluated against EBV peptides corresponding to the major EBV epitopes identified at the poly- clonal level (see text). Because EBV Ags were recognized in the context of autologous HLA alleles, T cell specificity could be determined by an effector fratricide assay after a 2-h incubation with peptide as described (29). Ⅺ, BMLF1/A2 peptide (upper panel), BZFL1/B35 peptide (lower panel); f, BZLF1/B40 peptide (upper and lower panels). 2490 REGULATION OF KIR EXPRESSION ON T CELLS

Table I. TCR junctional sequences derived from CD158bϩ and CD158b– ␣␤ T cell clonesa

TCR Transcripts

T Cell Clone TCRV CDR3 TCRJ RF

A4.5 BV4S1 tgc agc gtt gga acc ggt gga act aat gaa aaa ctg ttt ttt ggc BJ1S4 ϩ (CD158b–) CSVGTGGTNEKLFFG

AGL10 AV15S1 tgt gca gag agt ata gga aag ctt atc ttc gga AJ23 ϩ (CD158bϩ) CA E S I G K L I F G

AV18S1 tgt gcc tcc ccc gaa ctg aca gct ggg gga aat tgc agt ttg ga AJ24 –

B2.5 BV12S1 tgt gcc acc ggc ggg gga ggg atg gat gag cag ttc ttc ggg BJ2S1 ϩ (CD158b–) CA T G G G G M D E Q F F G

BGL19 AV7S2 tgt gct gtg aga tct tca gga gga agc tac ata cct aca ttt gga AJ6 ϩ (CD158bϩ) CA V R S S G G S Y I P T F G

AV22S1 tgt gct ctt gca ata atg cag gca aca tgc tca cct ttg ga AJ39 – a ϩ

A4.5 and AGL10 clones were derived from donor A; B2.5 and BGL19 clones were derived from donor B. RF, Reading frame ( , in frame; –, out of frame). TCR genes Downloaded from were designated according to the last World Health Organization–International Union of Immunological Societies nomenclature (54).

The comparison of KIR transcription patterns in KIRϩ vs KIRϪ Further analysis of the pathways that regulate KIR expression T cell clones isolated from the same individuals prompted us to was performed in clonal NK cell lines. NK92, NK3.3, and NKL investigate whether an additional regulation pathway of KIR ex- human NK cell lines were cell surface phenotyped using CD158b ϩ pression occurred in T cells, at posttranscriptional levels. B2.5 and mAb. As described earlier, NK3.3 is CD158b whereas both http://www.jimmunol.org/ BGL19 cells transcribed all their KIR genes, although the former NK92 and NKL are CD158bϪ (data not shown). Despite the lack did not express any surface KIR and the latter expressed exclu- of detectable KIR molecules at the cell surface, KIR2DL3 tran- sively KIR2DL3 protein at the cell surface (Table II and data not scripts were detected in NK92 cells. The specificity of KIR2DL3 shown). A4.5 T cells transcribed two KIRs, 2DL3 and 2DS2, but RT-PCR detection was assessed by the lack of KIR2DL3 tran- did not express the corresponding protein at the cell surface. Sim- scripts in NKL (Fig. 4C, upper panel). Consistent with the results ilarly, out of the seven transcripts detected in AGL10 T cell clone, obtained in T cells, the level of KIR2DL3 transcripts is much only CD158b is expressed at the surface (KIR2DL2 and/or higher in the CD158bϩ NK3.3 cells, than in the CD158Ϫ NK92 KIR2DL3 and/or KIR2DS2) (Fig. 3). The “missing” KIR proteins cells (Fig. 4C, lower panel). were also absent in intact or permeabilized cells, as indicated by by guest on September 25, 2021 flow cytometry analysis using a large panel of KIR-specific mAb (see Table III). Similar complex control of KIR gene expression was documented in 14 additional T cell clones derived from donor A and 2 additional clones from donor B (Table III). Several ex- planations, such as low levels of KIR gene transcription and/or lack of reactivity of mAb to the corresponding KIR protein (e.g., due to KIR polymorphism), could account for the presence of KIR transcripts in the absence of the corresponding protein. To exclude that polymorphism of KIR2DL3 was responsible for the absence of staining using CD158b mAb, we cloned and sequenced the full- length KIR2DL3 cDNA obtained from B2.5 and BGL18 T cell clones. Both sequences were totally identical with KIR2DL3 clone 6 sequence (GenBank accession number U24074; data not shown). We then attempted to amplify full-length KIR2DL3 cDNA from A18.1 and AGL16 T cell clones using 5Ј-KIR2DL3 primer and 3Ј-KIR2DL3 primer. In these experiments, only KIR2DS2 clone 49 (GenBank accession number U24079) was cloned and sequenced (data not shown). Therefore, B2.5 T cells and A18.1 T cells express bona fide KIR2DL3 and KIR2DS2 transcripts, although no cell surface expression of the corresponding protein could be detected. We then performed a semiquantitative PCR analysis of KIR2DS2 and KIR2DL3 transcripts in AGL16 and FIGURE 2. KIR-mediated inhibition of clone BGL19 cytotoxic activity. A, CTL activity of B2.5 and BGL19 clones was estimated at a 10/1 E:T A18.1, as well as in BGL18 and B2.5 T cell clones, respectively. ϩ A lower KIR2DL3 transcription level was observed in B2.5, as ratio against BZLF1/B35 peptide-loaded HLA-B35 BLC carrying or not p58.2 KIR ligands (E, B BLC (Cw3/7); F, BM9 BLC (Cw4/4)). B, Res- compared with BGL18 T cells (Fig. 4A). Similarly, a lower ϩ toration of CTL activity of BGL19 T cell clone against KIR-L targets KIR2DS2 transcription level was observed in A18.1 as compared following masking of KIRs on effector cells. CTL activity of clones B2.5 with AGL16 T cells (Fig. 4B). These data thus indicate that quan- and BGL19 was estimated at a 10/1 E:T ratio against B BLC (Cw3/7) or titative differences in KIR transcripts are likely responsible for the BM9 BLC (Cw4/4) loaded with 10 ␮M of BZLF1/B35 peptide, in the distinct KIR surface phenotypes observed in A18.1 and AGL16, as absence (Ⅺ) or presence (f) of GL183 mAb (1/4 final hybridoma well as in B2.5 and BGL18 T cell clones. supernatant). The Journal of Immunology 2491

Table II. KIR genotype and phenotype of CD158bϩ and CD158b– ␣␤ T cell clonesa

B2.5 BGL19 A4.5 AGL10

KIR DNA RNA Prot DNA RNA Prot DNA RNA Prot DNA RNA Prot

2DL1 ϩϩ– ϩϩ– ϩ ––ϩϩ– 2DL2 – – – – – – ϩ ––ϩϩϩ? 2DL3 ϩϩ– ϩϩϩϩϩ– ϩϩϩ? 2DL4 ND ϩ ND ND ϩ ND ND – ND ND ϩ ND 3DL1 ϩϩ– ϩϩ– ϩ ––ϩϩ– 3DL2 ϩϩ– ϩϩ– ϩ ––ϩϩ– 2DS1 – – – – – – ϩ ––ϩ –– 2DS2 – – – – – – ϩϩ– ϩϩϩ? 2DS3 – – ND – – ND – – ND – – ND 2DS4 ϩϩ– ϩϩ– ϩ ––ϩ –– 2DS5 – – ND – – ND – – ND – – ND 3DS1 – – ND – – ND – – ND – – ND

a Analysis of the KIR repertoire on T cell clone-derived genomic DNA or cDNA was performed using previously described primers (36). The KIR nomenclature is from Ref. 36. Presence of the corresponding KIR protein (Prot) either on the cell surface or intracellularly was studied by ﬂow cytometry on, respectively, intact or saponin-permeabilized cells using a panel of KIR-speciﬁc mAbs: EB6 (CD158a, KIR2DL1/KIR2DS1), GL183 (CD158b, KIR2DL2-2DL3/KIR2DS2), ZIN276 (anti-KIR3DL1), DEC66 (anti- KIR3DL2), and FSTR172 (anti-KIR2DS4). While KIR recognized by GL183 mAb on clone BGL19 was unambiguously assigned to KIR2DL3, GL183ϩ receptors on clone AGL10 could correspond to either KIR2DL2, 2DL3, or 2DS2. Downloaded from

Discussion KIR expression on T cells has been mainly described on CD8ϩ Two groups of cell surface receptors have been identiﬁed in NK memory T cells (26). KIR engagement by autologous MHC class

and T cell subsets, which define a repertoire of MHC class I rec- I molecules can regulate in vitro CD3/TCR-mediated cytotoxicity http://www.jimmunol.org/ ognition. Ig-like molecules include KIR and LIR/ILT molecules, and cytokine production suggesting a role of KIR in the control of whereas C-type lectins include CD94/NKG2 heterodimers in hu- T cell activation (22, 23, 25, 27, 43, 47–49). In a previous study, ϩ mans as well as CD94/NKG2 heterodimers and Ly-49 ho- activation of KIR CTL clones following recognition of tumor modimers in the mouse (5, 6). The shaping of this MHC class I Ags was shown to be abrogated by KIR (50). Interestingly, in our repertoire appears to differ between lectin-like and Ig-like mole- study, the inhibitory effect of KIR on TCR-mediated activation of cules. Indeed the cell surface expression of murine Ly-49 is influ- ␣␤ T cell clones was partial. The efficiency of KIR-mediated enced by the level of expression of cognate MHC class I molecules inhibition is likely affected by numerous parameters such as the (40, 41), whereas KIR cell surface expression does not seem to be directly affected by the nature or expression levels of HLA class I by guest on September 25, 2021 molecules (14, 42). Besides, activation of CD94/NKG2 gene transcription and/or cell surface export of intracytoplasmic CD94/ NKG2 heterodimers can be induced on developing and mature lymphoid cells after short-term in vitro culture in the presence of IL-15 (27). By contrast, all attempts to induce KIR in vitro on mature T or NK cells have failed so far. These results, which confirm that expression of KIRs and NKR homologous to C-type lectin is regulated through distinct pathways (43), have left open the issues as to when and how KIR are induced. The absence of both KIR transcripts (data not shown) and proteins (44) in thymo- cytes, and by contrast their selective expression on fully differen- tiated NK cells (45) and Ag-experienced T cells (26), suggests late KIR induction during lymphoid cell development. Along this line the existence of KIRϩ and KIRϪ T cell clones sharing identical productive and nonproductive TCR transcripts formally proves that induction/modulation of KIR expression occurs after termination of TCR rearrangements. In line with previous studies (25, 27, 28), the KIR phenotype of our T cell clones was highly stable (i.e., they remained KIRϩ or KIRϪ irrespective of their activation status (data not shown)), thus strongly suggesting that KIR induction occurred in vivo and not during the process of synovial T cell line generation. Cytokines are probably involved in KIR cell surface expression, as suggested by the in vitro induction of KIR on developing CD34ϩ hematopoietic progenitor cells upon treatment with Flt-3 ligand and IL-15 (46). However, whether the same factors will be required to induce KIR on precursor and mature lymphoid cells remains open. In this regard, preliminary experiments FIGURE 3. KIR gene transcription patterns of T cell clones. The detec- failed to demonstrate any effect on KIR expression by T cell clones tion of transcripts and genes for each KIR was performed by RT-PCR and of exogenously added IL-15, either alone or in combination with genomic PCR as described previously (36). The same panels of KIR am- IL-2 (M.-A.P. and M.B., unpublished observations). plification were obtained in three independent experiments. 2492 REGULATION OF KIR EXPRESSION ON T CELLS

Table III. KIR transcript patterns of KIRϩ and KIR– T cell clones derived from donors A and Ba

KIR Surface Expression Clone 2DL1 2DL2 2DL3 2DL4 3DL1 3DL2 2DS1 2DS2 2DS3 2DS4 2DS5 3DS1

Patient A Genotype ϩϩϩND ϩϩϩϩ– ϩ –– CD158bϩ AGL10 Transcripts ϩϩϩϩϩϩ – ϩ –––– AGL16 – ϩϩϩϩϩϩϩ–––– AGL6 – ϩϩϩϩϩϩϩ–––– AGL12 – – ϩϩϩϩϩϩ–––– AGL18 – ϩ – ϩϩ – ϩϩ –––– AGL19 – ϩϩϩϩϩ – ϩ –––– KIR–b A4.5 Transcripts – – ϩ ––––ϩ –––– A18.1 – ϩϩϩϩ ––ϩ –––– AZ4 – ϩϩϩϩ ––ϩ –––– A14.11 – ϩϩϩϩ ––––––– A5.23 – ϩϩϩϩ ––––––– A1.15 – – ϩ ––ϩ –––––– A2.10 – – – ϩ –––––––– AMS8.25 – ϩ – ϩ –––––––– AZ1 – – – ϩϩ ––––––– AZ8 – ϩϩϩϩ – ϩϩ – ϩ –– Patient B ϩ – ϩ ND ϩϩ –––ϩ –– Downloaded from CD158bϩ BGL19 Transcripts ϩ – ϩϩϩϩ –––ϩ –– KIR–b B2.5 Transcripts ϩ – ϩϩϩϩ –––ϩ –– B12.21 – – ϩϩϩ ––––ϩ –– B12.4 – – – ϩϩ –––––––

a The presence of KIR genes and transcripts was detected using genomic PCR and RT-PCR. b No staining of KIR– T cell clones was detected using EB6 (anti-KIR2DL1/2DS1 mAb), GL183 (anti-KIR2DL2/2DL3/2DS2/2DS3 mAb), ZIN276 (anti-KIR3DL1 mAb),

DEC66 (anti-KIR3DL2 mAb), or FSTR172 (anti-KIR2DS4 mAb). The same results were obtained in three independent experiments for AGL10, A4.5, BGL19, and B2.5 clones http://www.jimmunol.org/ and two independent experiments for the others clones. avidity of TCR/ligand interactions and more generally the global avidity of the interactions between effector and target cells. Such factors may easily explain the differences observed between the two situations and are in line with recent data revealing unexpected complexity in the biological function of KIR on T cells (51, 52). KIR belong to a multigenic and multiallelic family, and the by guest on September 25, 2021 polymorphism of KIR genes is still incompletely documented (37, 53). KIR genes are currently subdivided into inhibitory KIR (KIR2DL1, KIR2DL2, KIR2DL3, KIR2DL4, KIR3DL1, and KIR3DL2) and activating isoforms (KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, and KIR3DS). Eighteen distinct KIR genotypes have been previously documented (36). T cell clones derived from donor B shared the most common genotype corresponding to group 1 individuals described earlier (36), while cells from donor A harbored a newly described genotype (Table II). Given the limited number of individuals analyzed thus far (36), these numbers are certainly underestimated and, therefore, it is not surprising to detect here new KIR genotypes such as the one dis- played by cells from donor A. A variable KIR transcription pattern from one NK clone to another, but a good matching between the presence of a given KIR transcript and its corresponding protein within a given clone, has been previously reported (36). These data suggested that the regulation of KIR expression only operated at a transcriptional, but not at a posttranscriptional, level. We confirm here the transcriptional regulation of the genes encoding for KIR-L and KIR-S proteins in both T and NK cells. But, in addition, we found that KIR-L FIGURE 4. Semiquantitative PCR analysis of KIR transcripts in ϩ Ϫ and KIR-S transcripts were frequently detected in T cell clones and CD158b and CD158b T cell clones and NK cell lines. Coamplification in one NK cell line in the absence of the corresponding protein, of either KIR2DL3 (A and C) or KIR2DS2 (B) and actin transcripts were ␮ Ϫ0 revealing that RT-PCR data that document KIR transcription pat- performed using 5 l of undiluted (10 and C, upper panel) or diluted cDNAs (10Ϫ1,10Ϫ2, and 10Ϫ3). A, Comparison of KIR2DL3 transcripts tern should be interpreted with caution. This discrepancy between ϩ Ϫ from CD158b (BGL18) or CD158b (B2.5) T cell clones. B, Comparison KIR-L/KIR-S gene transcription and protein expression could be of KIR2DS2 transcripts from CD158bϩ (AGL16) or CD158bϪ (A18.1) T explained by transient KIR modulation (e.g., following receptor cell clones. C (upper panel), Detection of KIR2DL3 transcripts from cross-linking). However, we failed to detect any intracellular KIR CD158bϩ (NK3.3) or CD158bϪ (NK92 and NKL) NK cell lines. C (lower within permeabilized cells, in addition to those already detected on panel), Comparison of KIR2DL3 transcripts from CD158bϩ (NK3.3) or the surface (Table III). Furthermore, kinetic analysis of KIR sur- CD158bϪ (NK92) NK cell lines. The Journal of Immunology 2493 face phenotype and transcripts in T cell clones at various time 21. Navarro, F., M. Llano, T. Bellon, M. Colonna, D. E. Geraghty, and points after antigenic activation demonstrated stable transcription M. Lopez-Botet. 1999. The ILT2(LIR1) and CD94/NKG2A NK cell receptors respectively recognize HLA-G1 and HLA-E molecules co-expressed on target and surface expression of KIR, irrespective of the T cell clone cells. Eur. J. Immunol. 29:277. activation status (data not shown). In addition, we have shown that 22. Mingari, M. C., C. Vitale, A. Cambiaggi, F. Schiavetti, G. Melioli, S. Ferrini, and A. Poggi. 1995. Cytolytic T lymphocytes displaying natural killer (NK)-like ac- the level of KIR-L and KIR-S transcripts are positively correlated tivity: expression of NK-related functional receptors for HLA class I molecules to the cell surface expression of the corresponding KIR protein. (p58 and CD94) and inhibitory effect on the TCR-mediated target cell lysis or Thus, although the factors that induce KIR gene transcription are lymphokine production. Int. Immunol. 7:697. 23. Phillips, J. H., J. E. Gumperz, P. Parham, and L. L. Lanier. 1995. Superantigen- still unknown, our data show that the regulation of KIR expression dependant, cell-mediated cytotoxicity inhibited by MHC class I receptors on T occurs in T cells after termination of TCR rearrangements, that a lymphocytes. Science 268:403. threshold of KIR-L and KIR-S transcripts must be reached to 24. Aramburu, J., M. A. Balboa, A. Ramı`rez, A. Silva, F. Acevedo, F. Sanchez-Madrid, M. O. De Landa`zuri, and M. Lo`pez-Botet. 1990. A novel achieve efficient T and NK cell surface expression of the KIR functional cell surface dimer (Kp43) expressed by natural killer cells and T cell proteins at the cell surface, and that the transcriptional and post- receptor-␥/␦ϩ lymphocytes. I. Inhibition of the IL-2 dependent proliferation by transcriptional pathways that regulates KIR genes expression in T anti-Kp43 monoclonal antibody. J. Immunol. 144:3228. 25. Halary, F., M.-A. Peyrat, E. Champagne, M. Lopez-Botet, A. Moretta, and NK cells are at least in part shared between KIR-L and KIR-S. L. Moretta, H. Vie´, J.-J. Fournie´, and M. Bonneville. 1997. Control of self- reactive cytotoxic T lymphocytes expressing ␥␦ T cell receptors by natural killer inhibitory receptors. Eur. J. Immunol. 27:2812. Acknowledgments 26. Mingari, M. C., F. Schiavetti, M. Ponte, C. Vitale, E. Maggi, S. Romagnani, We thank Dr. Miguel Lopez-Botet (Hospital de la Princesa, Madrid, Spain) J. Demarest, G. Pantaleo, A. S. Fauci, and L. Moretta. 1996. Human CD8ϩ T and Dr. Nicolaı¨Wagtmann (Novo, Nordisk, Denmark) for providing Abs lymphocyte subsets that express HLA class I-specific inhibitory receptors repre- sent oligoclonally or monoclonally expanded cell populations. Proc. Natl. Acad. and BAC, respectively. Sci. USA 93:12433. Downloaded from 27. Mingari, M. C., M. Ponte, S. Bertone, F. Schiavetti, C. Vitale, R. Bellomo, References A. Moretta, and L. Moretta. 1998. HLA class I-specific inhibitory receptors in human T lymphocytes: interleukin 15-induced expression of CD94/NKG2A in 1. Raulet, D. H., and W. Held. 1995. Natural killer cell receptors: the offs and ons ϩ superantigen- or alloantigen-activated CD8 T cells. Proc. Natl. Acad. Sci. USA of NK cell recognition. Cell 82:697. 95:1172. 2. Yokoyama, W. M. 1998. Natural killer cell receptors. Curr. Opin. Immunol. 28. Bertone, S., F. Schiavetti, R. Bellomo, C. Vitale, M. Ponte, L. Moretta, and 10:298. M. C. Mingari. 1999. Transforming growth factor-␤-induced expression of 3. Ka¨rre, K., H. G. Ljunggren, G. Piontek, and R. Kiessling. 1986. Selective rejec- CD94/NKG2A inhibitory receptors in human T lymphocytes. Eur. J. Immunol. http://www.jimmunol.org/ tion of H-2-deficient lymphoma variants suggests alternative immune defense 29:23. strategy. Nature 319:675. 29. Scotet, E., M. A. Peyrat, A. X. Saulquin, C. Retiere, C. Couedel, F. Davodeau, 4. Moretta, A., C. Bottino, M. Vitale, D. Pende, R. Biassoni, M. C. Mingari, and N. Dulphy, A. Toubert, J. D. Bignon, A. Lim, et al. 1999. Frequent enrichment L. Moretta. 1996. Receptors for HLA-class-I molecules in human natural killer for CD8 T cells reactive against common herpes viruses in chronic inflammatory cells. Annu. Rev. Immunol. 14:619. lesions: towards a reassessment of the physiopathological significance of T cell 5. Lanier, L. L. 1998. NK cell receptors. Annu. Rev. Immunol. 16:359. clonal expansions found in autoimmune inflammatory processes. Eur. J. Immu- 6. Long, E. O. 1999. Regulation of immune responses through inhibitory receptors. nol. 29:973. Annu. Rev. Immunol. 17:875. 7. Tomasello, E., M. Ble´ry, E. Ve´ly, and E. Vivier. 2000. Signaling pathways en- 30. David-Ameline, J., A. Lim, F. Davodeau, M. A. Peyrat, J. M. Berthelot, gaged by NK cell receptors: double concerto for activating receptors, inhibitory G. Semana, C. Pannetier, J. Gaschet, H. Vie, J. Even, and M. Bonneville. 1996. receptors and NK cells. Semin. Immunol. 12:139. Selection of T cells reactive against autologous B lymphoblastoid cells during 8. Braud, V. M., D. S. Allan, C. A. O’Callaghan, K. Soderstrom, A. D’Andrea, chronic rheumatoid arthritis. J. Immunol. 157:4697. by guest on September 25, 2021 G. Ogg, S. Lazetic, N. T. Young, J. I. Bell, J. H. Phillips, et al. 1998. HLA-E 31. Davodeau, F., M. A. Peyrat, M. M. Hallet, J. Gaschet, I. Houde, R. Vivien, binds to natural killer cell receptors CD94/NKG2A, B and C. Nature 391:795. H. Vie, and M. Bonneville. 1993. Close correlation between Daudi and myco- bacterial antigen recognition by human ␥␦ T cells and expression of V9JPC1 9. Lee, N., M. Llano, M. Carretero, A. Ishitani, F. Navarro, M. Lopez-Botet, and ␥ ␦ D. E. Geraghty. 1998. HLA-E is a major ligand for the natural killer inhibitory /V2DJC -encoded T cell receptors. J. Immunol. 151:1214. receptor CD94/NKG2A. Proc. Natl. Acad. Sci. USA 95:5199. 32. Couedel, C., M. Bodinier, M. A. Peyrat, M. Bonneville, F. Davodeau, and 10. Bauer, S., V. Groh, J. Wu, A. Steinle, J. H. Phillips, L. L. Lanier, and T. Spies. F. Lang. 1999. Selection and long-term persistence of reactive CTL clones during 1999. Activation of NK cells and T cells by NKG2D, a receptor for stress- an EBV chronic response are determined by avidity, CD8 variable contribution inducible MICA. Science 285:727. compensating for differences in TCR affinities. J. Immunol. 162:6351. 11. Wagtmann, N., S. Rajogopalan, C. C. Winter, M. Peruzzi, and E. O. Long. 1995. 33. Davodeau, F., M. A. Peyrat, F. Romagne, A. Necker, M. M. Hallet, H. Vie, and ␤ Killer cell inhibitory receptors specific for HLA-C and HLA-B identified by M. Bonneville. 1995. Dual T cell receptor chain expression on human T lym- direct binding and by functional transfer. Immunity 3:801. phocytes. J. Exp. Med. 181:1391. 12. Litwin, V., J. Gumperz, P. Parham, J. H. Philips, and L. L. Lanier. 1994. NKB1: 34. Brichard, V., A. Van Pel, T. Wolfel, C. Wolfel, E. De Plaen, B. Lethe, P. Coulie, an NK cell receptor involved in the recognition of HLA-B. J. Exp. Med. 180:537. and T. Boon. 1993. The tyrosinase gene codes for an antigen recognized by 13. Gumperz, J. E., V. Litwin, J. H. Phillips, L. L. Lanier, and P. Parham. 1995. The autologous cytolytic T lymphocytes on HLA-A2 melanomas. J. Exp. Med. 178: Bw4 public epitope of HLA-B molecules confers reactivity with natural killer cell 489. clones that express NKB-1, a putative HLA receptor. J. Exp. Med. 181:1133. 35. Espevik, T., and J. Nissen-Meyer. 1986. A highly sensitive cell line, WEHI 164 14. Gumperz, J. E., N. M. Valiante, P. Parham, L. L. Lanier, and D. Tyan. 1996. clone 13, for measuring cytotoxic factor/tumor necrosis factor from human Heterogeneous phenotypes of expression of the NKB1 natural killer cell class I monocytes. J. Immunol. Methods 95:99. receptor among individuals of different human histocompatibility leukocyte an- 36. Uhrberg, M., N. M. Valiante, B. P. Shum, H. G. Shilling, K. Lienert-Weidenbach, tigens types appear genetically regulated, but not linked to major histocompati- B. Corliss, D. Tyan, L. L. Lanier, and P. Parham. 1997. Human diversity in killer bility complex haplotype. J. Exp. Med. 183:1817. cell inhibitory receptor genes. Immunity 7:753. 15. Lanier, L. L., J. E. Gumperz, P. Parham, I. Melero, M. Lopez-Botet, and 37. Valiante, N. M., M. Uhrberg, H. G. Shilling, K. Lienert-Weidenbach, J. H. Phillips. 1995. The NKB1 and HP-3E4 NK cell receptors are structurally K. L. Arnett, A. D’Andrea, J. H. Phillips, L. L. Lanier, and P. Parham. 1997. distinct glycoproteins and independently recognize polymorphic HLA-B and Functionally and structurally distinct NK cell receptor repertories in the periph- HLA-C molecules. J. Immunol. 154:3320. eral blood of two human donors. Immunity 7:739. 16. Do¨hring, C., D. Scheidegger, J. Samaridis, M. Cella, and M. Colonna. 1996. A 38. Mingari, M. C., A. Moretta, and L. Moretta. 1998. Regulation of KIR expression human killer inhibitory receptor specific for HLA-A. J. Immunol. 156:3098. in human T cells: a safety mechanism that may impair protective T-cell re- 17. Pende, D., R. Biassoni, C. Cantoni, S. Verdiani, M. Falco, C. Di Donato, sponses. Immunol. Today 19:153. L. Accame, C. Bottino, A. Morreta, and L. Moretta. 1996. The natural killer cell 39. Scotet, E., J. David-Ameline, M. A. Peyrat, A. Moreau-Aubry, D. Pinczon, receptor specific for HLA-A allotypes: a novel member of the p58/p70 family of A. Lim, J. Even, G. Semana, J. M. Berthelot, R. Breathnach, et al. 1996. T cell inhibitory receptors which is characterized by three Ig-like domains and is ex- response to Epstein-Barr virus transactivators in chronic rheumatoid arthritis. pressed as a 140kD disulphide-linked dimer. J. Exp. Med. 184:505. J. Exp. Med. 184:1791. 18. Colonna, M., F. Navarro, T. Bellon, M. Liano, P. Garcia, J. Samaridis, 40. Raulet, D. H., W. Held, I. Correa, J. R. Dorfman, M. F. Wu, and L. Corral. 1997. L. Angman, M. Cella, and M. Lopez-Botet. 1997. A common inhibitory receptor Specificity, tolerance and developmental regulation of natural killer cells defined for major histocompatibility complex class I molecules on human lymphoid and by expression of class I-specific Ly49 receptors. Immunol. Rev. 155:41. myelomonocytic cells. J. Exp. Med. 186:1809. 41. Ho¨glund, P., J. Sundback, M. Y. Olsson-Alheim, M. Johansson, M. Salcedo, C. 19. Cosman, D., N. Fanger, L. Borges, M. Kubin, W. Chin, L. Peterson, and M.-L. O¨ hlen, H.-G. Ljunggren, C. L. Sentman, and K. Ka¨rre. 1997. Host MHC class I Hsu. 1997. A novel immunoglobulin superfamily receptor for cellular and viral gene control of NK-cell specificity on the mouse. Immunol. Rev. 155:11. MHC class I molecule. Immunity 7:273. 42. Cambiaggi, A., C. Verthuy, P. Naquet, F. Romagne, P. Ferrier, R. Biassoni, 20. Wagtmann, N., S. Rojo, E. Eichler, H. Mohrenweiser, and E. O. Long. 1997. A A. Moretta, L. Moretta, and E. Vivier. 1997. Natural killer cell acceptance of H-2 new human gene complex encoding the killer cell inhibitory receptors and related mismatch bone marrow grafts in transgenic mice expressing HLA-Cw3 specific monocyte/macrophage receptors. Curr. Biol. 7:615. killer cell inhibitory receptor. Proc. Natl. Acad. Sci. USA 94:8088. 2494 REGULATION OF KIR EXPRESSION ON T CELLS

43. Andre, P., C. Brunet, S. Guia, H. Gallais, J. Sampol, E. Vivier, and 48. Battistini, L., G. Borsellino, G. Sawicki, F. Poccia, M. Salvetti, G. Ristori, and F. Dignat-George. 1999. Differential regulation of killer cell Ig-like receptors and C. F. Brosnan. 1997. Phenotypic and cytokine analysis of human peripheral blood CD94 lectin-like dimers on NK and T lymphocytes from HIV-1-infected indi- ␥␦ T cells expressing NK cell receptors. J. Immunol. 159:3723. viduals. Eur. J. Immunol. 29:1076. 49. Bakker, A. B., J. H. Phillips, C. G. Figdor, and L. L. Lanier. 1998. Killer cell 44. Mingari, M. C., M. Ponte, C. Cantoni, C. Vitale, F. Schiavetti, S. Bertone, inhibitory receptors for MHC class I molecules regulate lysis of melanoma cells ␥␦ R. Bellomo, A. Tradori Cappai, and R. Biassoni. 1997. HLA-class I-specific mediated by NK cells, T cells, and antigen-specific CTL. J. Immunol. 160: inhibitory receptors in human cytolytic T lymphocytes: molecular characteriza- 5239. tion, distribution in lymphoid tissues and co-expression by individual T cells. Int. 50. Ikeda, H., B. Lethe´, F. Lehmann, N. Van Baren, J.-F. Baurain, C. De Smet, Immunol. 9:485. H. Chambost, M. Vitale, A. Moretta, T. Boon, and P. G. Coulie. 1997. Charac- terization of an antigen that is recognized on a melanoma showing partial HLA 45. Andre, P., O. Spertini, S. Guia, P. Rihet, F. Dignat-George, H. Brailly, J. Sampol, loss by CTL expressing an NK inhibitory receptor. Immunity 6:199. P. J. Anderson, and E. Vivier. 2000. Modification of P-selectin glycoprotein 51. Cambiaggi, A., S. Darche, S. Guia, P. Kourilsky, J.-P. Abastado, and E. Vivier. ligand-1 with a natural killer cell-restricted sulfated lactosamine creates an alter- 1999. Modulation of T-cell functions in KIR2DL3 (CD158b) transgenic mice. nate ligand for L-selectin. Proc. Natl. Acad. Sci. USA 97:3400. Blood 94:2396. 46. Yu, H., T. A. Fehniger, P. Fuchshuber, K. S. Thiel, E. Vivier, W. E. Carson, and ϩ 52. Ugolini, S., and E. Vivier. 2000. Regulation of T cell function by NK cell re- M. A. Caligiuri. 1998. Flt3 ligand promotes the generation of a distinct CD3 ceptors for classical MHC class I molecules. Curr. Opin. Immunol. 12:295. human natural killer cell progenitor that responds to interleukin-15. Blood. 92: 53. Wilson, M. J., M. Torkar, A. Haude, S. Milne, T. Jones, D. Sheer, S. Beck, and 3647. J. Trowsdale. 2000. Plasticity in the organization and sequences of human KIR/ 47. Ferrini, S., A. Cambiaggi, R. Meazza, S. Sforzini, S. Marciano, M. C. Mingari, ILT gene families. Proc. Natl. Acad. Sci. USA 97:4778. and L. Moretta. 1994. T cell clones expressing the natural killer cell-related p58 54. WHO-IUIS nomenclature sub-committee on TCR designation. 1995. Nomencla- receptor molecule display heterogeneity in phenotypic properties and p58 func- ture for T-cell receptor (TCR) gene segments of the immune system. Immuno- tion. Eur. J. Immunol. 24:2294. genetics. 42:451. Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021