Quick viewing(Text Mode)

And the Evolution of Brood Parasitism

And the Evolution of Brood Parasitism

SYSTEMATICS OF NEW WORLD (AVES, CUCULIDAE) AND THE OF BROOD

Janice Maryan Hughes

A thesis submitted in confomiity with the requirements for the degree of Doctor of Philosophy

Graduate De partment of Zoology , University of Toronto

O Copyright by Janice Maryan Hughes 1997 National Library Biblioth6que nationale I*l of Canada du Canada Acquisitions and Acquisitions et Bibliographie Services services bibliographiques 395 Weilingtm Street 395. nie Wellingtm Ottawa ON K1A ON4 CMawaON K1AON4 Canada Canada

The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant a la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la fome de microfiche/nlm, de reproduction sur papier ou sur format électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantid extracts fkom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.

Canada -- -- ABSTRA CT

Systernatics of New World Cuckoos (Aves, Cuculidae) and the Evolution of Brood Parasitism

Degree in Doctor of Philosophy, 1997 Janice Maryan Hughes

Department of Zoology University of Toronto

Monophy ly of the cuckoos (Cuculidae) was demonstrated through the description of 14 osteological synapomorphies. Only three apparent synapomorphies united the otherwise anatomically divergent (Musophagidae), (Opisrhocomus hoazin), and

Cuculidae. Therefore, I recomrnended their placement in separate, but adjacent orders. phylogeny reconstructed using 135 osteological characters differed markedly from currently accepted classifications. Al1 brood parasitic cuckoos, including New World obligate parasites Tapera and and facultative parasites , formed a . This implies that the ancestral Coccyirts was an obligate parasite, and is

consistent with many be havioral to parasitism exhibited by this . Tribe Saurothenni (Phaenicophaeinae) was erected to house al1 nonparasitic, arboreal. solitady breeding New World cuckoos. The Old World genus was removed from the New World . Three subfamilies, comprised of nonparasitic. terrestrial cuckoos of Old World and New World distribution, occupied positions on the

phylogeny. A new classification of the Cuculidae was proposed. I demonstrated that two of facultative brood parasites, the Black-billed

(Coccyziis erythoprhalmus) and Yellow-billed (C.americanus) cuckoos, produce that fully or nearly match the eggs of over 70% of their reported species, a proportion significantly greater than if hosts were being selected at random from a potential host pool. This supports an hypothesis of , and impiies an historically intense relationship between parasite and host. Factors responsible for the loss of obligate parasitism in this genus may also have contributed to the general paucity of obligate parasitism in New World cuckoos. Cornpetitive exclusion or resistance to invasion by parasitic (Molotlirusspp.) should be considered. The phylogeny of the genus Coccyzrts was reconstmcted using skeletal characters, cytochrome b sequences, and extemal morphology. The optimal topology suppons a Neotropical origin for the genus. Several vicariant and colonization events were responsible for the current distribution of South Amencan endemic species. The

Cuckoo (C.minor) had two major northward routes out of South Amerïca. Yellow-billed and Black-bilied cuckoos are highly divergent, and each represents a separate invasion of North America from .

.. . Ill ACKNO WLEDGEMENTS

First, I would like to thank rny academic advisor, Jon Barlow, for sharing his vast knowledge of the avian world, his sense of humor, and love of music. Most of all, 1 appreciate his fortitude and good advice. Yes, Jon, I was listening. 1 also thank the members of my advisory cornmittee: Bob Murphy, for those long talks on our two shared interests of phylogenetics and photography, and Roger Hanse11 for consistently presenting a direction to my work that had not yet occurred to me. 1 thank Allan Baker and Bob Murphy for providing laboratory facilities, and Oliver Haddrath, Mark Peck, Dilara Ally, and Dawn Marshall for technical assistance. 1 am particularly grateful to Oskana Borowik for her expertise with the DNA sequences.

I thank D. J. Agro, L. R. Bevier, and 1. I. Lovette (Academy of Natural Sciences, Philadelphia), G. F. Bmowclough, C. Blake, and P. Sweet (American Museum of Natunl History. New York), R. M. Zink and J. T. KIicka (Bell Museum of Natural History, St. Paul), B. C. Livezey and R. Panza (Carnegie Museum of Naturai History, Pittsburgh), D. E.

Willard and J. M. Bates (Field Museum of Natural History, Chicago), T. Webber and D. W. Steadman (Flonda Museum of Natural History, Gainesville), J. V. Rernsen, D. L. Ditunan, and F. H. Sheidon ( State University Museum of Zoology, Baton Rouge), R. C. Banks and R. Browning ( National Museum of Natural History, Washington, D.C.). C. Cicero and N. K. Johnson (University of California Museum of Vertebrate Zoology, Berkeley), and R. B. Payne. L. L. Payne, and J. Hinshaw (University of Michigan Museum of Zoology, Ann Arbor) for their invaluable assistance in providing the many specimens required for this study. I thank Jim Dick, Oliver Haddrath, Brad Millen, Glenn Murphy, and Mark Peck for

iheir assistance in the Royal Ontario Museum collections. In addition, 1 am grateful to the many people in the Department of Zoology who have helped to straighten my road: Sheila Freeman. Dr. Harold Harvey, Sonia McKenUe, Mary Delac, Liz Tudor-Mulroney, Dr. Dan Brooks, and Dr. Jim Rising.

This work was supported by grants from the Naturai Sciences and Engineering

Research Council to me and Jon C. Barlow (grant A-3472). Portions of chapter 2 of this dissertation have been published previousiy, and copyright release for reproduction herein has been obtained from the Canadian Journal of Zoology. J. C. Barlow, M. G. Brooker, R.

1. C. Hansell, L. F. Kiff, D. R. Kozlovic. S. M. Lanyon, D. A. McLennan, M. T. Murphy, R. W. Murphy, and K. C. Parkes provided helpful comments on some aspects of this dissertation. Field work in would not have been possible without the kindness and hospitality of the Texas Parks and Wildlife Department, in particular Jack "Looks like it's gonna rain" Kilpatric, Lonesome Dave Dvorak, Bob West. Robert Culpepper, Rick MacIntyre, and EM House. My sincere thanks to my brother, Mark Hughes, for providing the illustrations accompanying this manuscript and, of course, to my daughter, Eliana, for always giving me something else to think about. Finally, 1 am most deeply indebted to my husband, Ron. for

his encouragement, patience, and support through Iong periods of neglect, for listening to unceasing 'cuckoo-talk' to the exclusion of al1 other conversation. and for starting the whole thing many ago with Lefty the Canary. 1 dedicate this manuscript to the memory of rny father,

Arthur Edward Hughes.

How grateful 1 am that his bedtime stories retold the taies of Charles Darwin. Richard Leakey, and Tuzo Wilson, and not Peter Rabbit. TABLE OF CONTENTS

.. ABSTRACï ...... 11

ACKNOWLEDGEMENTS ...... iv

DEDICATION...... vi LISTOFTABLES...... xi LISTOFFIGURES...... xii

LIST OF APPENDICES ...... xiv PREFACETO THE DISSERTATION...... xv

G ENERAL INTRODUCTION ...... 1

CHAPTER1: Monophyly and phylogeny of the cuckoos (Cuculidae) based on osteological characters ......

Introduction ...... Monophyly ...... Phy logeny and classification ...... Materials and methods ...... Monophyly ...... Phylogeny ......

Taxa and specimens ...... Outgroup selection...... Character analysis ...... Tree denvation and analysis ...... Results ...... Monophyly ...... Phylogeny ......

vii Cuckoos ...... Outgroups ...... Character consistency ...... Discussion ...... Monophyly ...... Hoatzin ...... Phylogeny ...... Single evolution of brood parasitism ......

Inclusion of Cocc_vtus in the Cuculinae ...... Re-evolution of terrestriality ...... Phaenicophaeinae...... Centropodinae ...... Terrestriality in a plesiomorphic position ...... Cuckoo origins ...... Hoatzin ...... CucuIiforrnes ...... Appendix 1.1. Suggested diagnostic characters of the Cuculidae ...... Appendix 1.2. Specimens used for monophyly analysis ...... Appendix 1.3. Specimens used for phylogenetic reconstruction ...... Appendix 1.4. Character descriptions ...... Appendix 1 .5. Character change list ...... CHAPTER2: Taxonornic significance of host egg mimicry by facultative brood parasites of the genus Coccy;rcs ...... Abstract ...... Introduction ...... Methods ...... Results ...... Discussion ......

CHAPTER3: Phylogeny and historical biogeography of the genus Coccyzw inferred from osteology and cytochrome b sequences ...... Abstract ...... Introduction ...... Materials and methods ...... and distribution ...... Outgroups ...... Skeletdphylogeny...... Taxa ...... Charac ters ...... Tree derivation and analysis ...... DNAsequencing ...... Taxa ...... DNA extraction, amplification, and sequencing ...... Tree derivation and analysis ...... Extemal morphology ...... Results ...... Skeletal characters ...... DNAanalyses ...... Extemai morphology ...... Discussion ...... Historical systematics ...... Biogeography ...... Neotropics ...... NorthAmenca ...... Appendix 3.1. Skeletal and tissue specimens ...... Appendix 3.2. Skeletal character descriptions ...... 154 Appendix 3.3. Skeletal character change list ...... 156 Appendix 3.4. Nucieotidr sequences of cytochrome b gene ...... 157 GENERALSUMMARY ...... 166 LITERATURE~ITED...... 169 ------LIST OF TABLES

Classification of the Cuculiformes sensu Peters ( 1940) ...... Data matrix of 135 osteological characters for 33 cuculid genera, Hoatzin (Opisthocomus hoazin), and turacos ...... Phylogenetic classification of the cuckoos and sister taxa based on

optimal uee (Fig. 1.14) ...... and subfamily of potential hosts of Yellow-billed (Coccyzus arnericanus) and Black-billed (C. erythroptlzaimus) cuckoos, and their egg type in terms of degree of match exhibited ...... Number of actual host species used by Yellow-billed and Black- billed cuckoos and in the potential host species pool. and their egg types in each pographic zone ...... Number of obligately and facultatively parasitic. and nonparasitic cuckoos in New and Old World regions ...... Data matrix of skeletal characters for six Coccyzus species ...... Character States of morphological characters for nine Coccyzus species ...... Numbers of synonymous and nonsynonymous transitions and transversions in first, second, and third codon positions ...... Matrix of pairwise estimates of genetic distance for seven Coccyzus species based on Kimura's (1980) Zparameter mode1 ...... Wing, tarsus, and bill lengths of adult Mangrove Cuckoos (Coccyzus minor) from Middle Amenca and the Lesser Antilles ...... LIST OF FIGURES

Skull of Greater (Geococcyx culifornianus) in right lateralaspect ...... FIGURE 1.2 Skull of in right caudo-lateral aspect ...... FIGW 1.3 Skull of Greater Roadrunner in ventral aspect ...... FIGURE 1.4 Os articulare of Greater Roadmnner in dorsal aspect ...... FIGURE 1.5 Right tibiotarsus of Greater Roadmnner in caudal aspect ......

FIGURE 1.6 Right tarsometatarsus of Greater Roadxunner in cranial aspect .....

FIGURE 1.7 Right tarsometatarsus of Greater Roadmnner in (a) dorsal and (b) caudalaspect ...... Right coracoideum of Greater Roadrunner in dorsal aspect ...... Right scapuia of Greater Roadninner in dorsal aspect ...... Right humerus of Greater Roadrunner in (a) cranial and (b) distal aspect ......

FIGURE 1.11 Pelvis of Cuban -cuckoo (Saurothera merlini) in dorsal aspect FIGURE1.12 Pelvis of Cuban Lizard-cuckoo in ventrd aspect ...... FIGURE1.13 Hypothesis of phylogeny for 33 cuculid genera and two outgroups (Opis~hocornushoazin and Musophagidae) ...... Hypothesis of phylogeny for the Cuculinae based on osteological characters indicating the origin of brood parasitism and subsequent evolution of anti-host adaptations to parasitism ...... FIGURE 1.15 Pelvis of Cuban Lizard-cuckoo indicating sections A-C of crista dorsolateralis ilii ...... Optimal phylogenetic uee for six Coccyz~tsspecies based on skeletal characters ......

xii FIGURE 3.2 Optimal phylogenetic tree for seven Coccyzus species based on cytochrome b gene sequences ...... 138 FIGURE3.3 Hypothesis of phylogeny for nine Coccyzus species based on skeletal characters, cytochrome b sequences, and external morphology ...... 140

... Xlll LIST OF APPENDICES

APPENDIX 1.1 Suggested diagnostic chancters of the Cuculidae ......

APPEND~Xf 2 Skeletal specimens used for monophyiy analysis of the Cuculidae

APPENDIX 1.3 Skeletal specimens used for phyiogenetic reconstruction of the Cuculidae ......

APPENDK 1.4 Skeletal character descriptions ......

APPENDIX 1.5 Character change lis

1.14) ......

APPENDIX 3.1 Skeletal and tissue specimens used for Coccyzus phylogeny .....

APPENDIX 3.2 Skeletai character descriptions ......

APPENDIX 3.3 Character change list for skeletal characters on optimal tree (Fig.

3.1) ......

APPENDIX 3.4 Cytochrome b sequences for seven species of Coccyz~rs......

xiv PREFACE TO THE DISSERTATION

When I began this work, 1 pledged to submit for publication ail chapters of this dissenation as they were completed. Because it was necessary for each manuscnpt to stand alone when published. 1 was compelled to include some duplicate explanatory information in the introductions and discussion sections of certain chapters.

Below is a list of chapters as they have been, or will be, published.

CmR1: Hughes, J. M. Monophyly and phylogeny of the cuckoos (Aves, Cuculidae) inferred from osteological characters.

CHMER 2: Hughes, J. M. 1997. Taxonomie significance of egg mimicry in facultative

brood parasites of the genus Coccyzus (Cuculidae). Cm. J. 2001. 75: 1380-1386.

CHAPTER3: Hughes, J. M. Phylogeny and histoncal biogeography of the genus Coccyzus inferred from osieology, cytochrome b sequences. and extemal morphology. -- - - GENERAL INTRODUCTION

Few avian families have aroused such feelings of fascination, speculation, and revulsion as the Cuculidae. Perhaps this is due to the infamous reputation of its 55 brood parasitic species that lay their eggs in the of other . It could be the comedic behavior of the Greater Roadrunner (Geococcyx californianus) of the American southwest, the noisy, gregarious habits of communally breeding anis (), or the skulking and secretive nature of many arboreal species, such as the Yellow-billed Cuckoo (Coccyzus antrricanrrs), that allows them to elude observation. Whatever the reason, this ancient and diverse farnily has achieved almost legendary status that is rare for an extant taxon. The name clrckoo is onomatopoeic, and describes the pleasant two-note cd1 of the Cornmon Cuckoo (Grculus canorns). an obligate of the Old World. The widespread imitation of the cal1 of this species has spawned sirnilar vemacular names in many other languages, such as the French coucou, Dutch koekoek, and Japanese kuk-ko (Rowan 1983). However, derivations of the word ci~koohave extended far beyond a description of its dl. When applied to people, the title implies foolishness or insanity. A cltckold describes the husband of an unfaithful wife in Middle English. Cuckoo has also been used adjectivally for many non-cuculid taxa that exhibit pansitic behavior, such as the Cuckoo-weaver (Anomnlospiza imberbis, Ploceidae. Passeriformes), Cuckoo- ( sulciJer, , ), Cuckoo ( ves~ulis,

Apidae, Hymenoptera), Cuckoo ( ossifagns, Labridae, Pisces), Cuckoo Copepod (Parachordeuminnz amphiurae, Siphonosrornatoida, Copepoda), and Cuckoo Flower (Lychnisj7os-cricrrli. Caryophyllaceae). Cuckoos have been irnmortalized in the writings of Shakespeare, Aristotie, and the Bible. Their calls have been incorporated into folk songs and madngals, and more formally

in the works of Beethoven, Delius. and Saint-Saëns (Rowan 1983). They are the harbingers of spring and the bringen of rain. Some species have been revered for their rnystical powers to heal, confer strength and endurance, and ward off evil spirits (Hughes 1996a). However, cuckoos have been more frequently associated with felony (Knowlton 1909), sioth (Bonhote 1907, Topsell 1972), carelessness, and evil (Bickerton 1927). stemming primarily from uninformed prejudice against brood parasitism (Wilson 1877, Dawson 1903). Fortunately, more recent publications have successfully avoided the anthropomorphic implications of this remarkable and successhil breeding suategy. Despite their historical notoriety, cuckoos, in general. are poorly known. Most species occur at low density, and have furtive and solitary habits. Over half reside in essentially inaccessible regions of the tropics and, consequently, are often difficult to study in the field. As a result, most widely accepted classifications have been based on insufficient information and the adherence to traditional groupings.

The Cuculidae is highly heterogeneous in habits. Therefore, it is an appropriate taxon with which to study the evolution of brood parasitism, communal breeding, polyandry, terrestrial and arboreal locomotion, and strategies, as well as, dispersal, migration. and biogeography. In the past, examinations of such disciplines have suffered from the lack of a robust hypothesis of phylogeny. My study of cuculid evolutionary relationships: (1) reviews and revises the classification of both New and Old World cuckoos, thereby, providing a foundational work for future workers; (2) serves as an exercise in phylogenetic techniques by using several data types at taxonomie levels frorn to genus: and (3) provides a preliminary exarnination of brood parasitism evolution in New World cuckoos based on the results of the preceding analyses. CHAPTER 1: Monophyly and phylogeny of the cuckoos (Cuculidae) based on osteological characters.

Absrrncr. - A reanalysis of 32 characters from the literature previously deemed diagnostic of the Cuculidae revealed only five to be synapomorphic. 1 subsequently examined skeletons fmm 51 avian families and identified 9 additional synapomorphies that supponed cuckoo monophyly. My cladistic analysis of 33 cuculid genera using 135 skeletal characters (CI = 0.78. RI = 0.93) differs markedly from currently accepted taxonomies. The most striking deviation is the placement of both New and Old World parasitic cuckoos in the Cuculinae. supponing the evolution of brood parasitism in a single event nther than three times as previously proposed. Uni ike earlier classifications. the Cuculinae also includes the facultative parasite Coccycus. This suggests that the ancestral Coccyzus was an obligate parasite. and is consistent with the many behavioral adaptations to pansitism exhibited by this genus. Other changes include the placement of three subfamilies, comprised of nonpansitic. terrestrial cuckoos of Old World (Centropodinae and Carpococcystinae) and New World (Neomorphinae) distribution, in basal positions on the tree. Only three apparent synapomorphies of the os carpi ulnare were found to uni te the turacos (Musophagidae), Hoatzin, and Cuculidae. Until further analyses demonstnte monophyly of these othenvise anatomically diverse taxa, 1 recommend their placement in separate, but adjacent orders: Musophagiformes, Opisthocomiforrnes, and Cuculiformes.

INTRODUCTION The Cuculidae is an ancient and diverse family comprised of 129 species in 38 genera (Morony et al. 1975) that are widespread in both Eastern and Western hemispheres. Cuckoos occupy biomes ranging from arid desert to humid ; however, most species are typical of light to heavy scrub and woodland, and are frequently associated with watercourses (Horsfall 1985). Cuckoos of tropical and subtropical distribution are generally sedentary. Several migratory species extend to higher latitudes (Horsfall 1985).

One genus () is restricted to . Cuckoos tend to be quiet, skulking birds, although their vocalizations, heard prhu-ily during the breeding season, may be both explosive and persistent (Wyllie 198 1, Rowan 1983). Nevertheless, many species are pooriy studied because of their low density and secretive habits. All mernbers of the Cuculidae have zygodactyl feet, with the first (hallux) and fourth toes directed backwards. In general. cuckoos have stout bills that are slightly to strongly decurved and hooked at the tip. Most species have drab , usually mottled or barred with grays, browns, and blacks. However, several memben of the Old World superjenus Chr-ysococcy.r are characterized by metallic green plumage, and are among the few cuckoo species to exhibit . Many cuckoos are strong fliers and arboreal in habits; and a few. such as the Yellow-billed (Coccyzus americanus) and Black-billed (C. erythropthalmus) cuckoos, are long-distance migrants. Arboreal species are short-legged wiih slim, elongate bodies, long, graduated taiis, and pointed wings. These cuckoos generally range from 20-120 g in weight, and 1545 cm in length. One exception is the Austrdian Channel-billed Cuckoo (Scyrlirops novaehollandine) that weighs over 350 g and exceeds 60 cm in length. In contrast. about 45 species, including the familiar Greater Roadrunner (Geococcyx

cnlifomiunlis) of the American Southwest, are primarily terrestrial, foraging and nesting on or near the ground. Many cursorial cuckoos are heavier bodied (200-700 g) than arboreal

species. and have long legs, large feet, and short. rounded wings. Although capable of

flying, most terrestrial cuckoos prefer to flee from a disturbance on foot (Wyllie 198 1). Among cuckoos, food habits range from herbivory to carnivory. Many species, principally members of the Cuculinae, are known for their reliance on toxic, aposomatic , and may congregate in uncharacteristicaliy large numbers during periodic outbreaks (Nolan and Thompson 1975, Wiley 1981). Many larger cuckoos, including the roadninners (Geococcyx and ), lizard-cuckoos (Saurothera), ground-cuckoos (Cczrpococcyx), and (Centropus). will prey on reptiles, rodents, and small birds (Delacour and Jabouille 1931, Lack 1976, Willis 1982. Rowan 1983, Hughes 1996a), particularly during the breeding season when it is beneficial to feed highly nutritious food to young. A few species (e-g., Scythrops novaehollandiae and Eudynamys scolopncea) consume substantiai quantities of fruit (Wyllie 198 1). Others may take fruit and seeds occasionally, but their diet is cornprised prirnarily of anhropods. Cuckoos are apparentiy monogamous; however, the Black (Centropus grifli;

Vernon 197 1 ), (Coccyzus pumilis; Ralph 1975), and perhaps other species, may be polyandrous. Most cuckoos tend to be solitary in habits, and are only regularly observed in pairs during the breeding season. At this time. territories may be vigorously defended by one or both members of a mated pair (Wyllie 1981). In contrast. the crotophagine cuckoos (Guira and Crotophaga) are communal breeders that build large, bulky nests in which several females lay their eggs and share the responsibilities of incubation and tending of the young. Each colony defends a communal iemtory. Within a colony, the dominant female removes the eggs of subordinate females throughout the laying period so that the incubated clutch is compnsed principally of her offspring (Verhencamp

1976, Verhencarnp et al. 1986, Calvalcanti et al. 199 1. Macedo 1992). Although many cuckoos construct a and care for their own young, the Cuculidae may be best known for the 55 species among them that are brood parasites laying

eggs in the nests of other birds. Of these, 5 1 species are obligate parasites (Wyllie 198 l),

and at least four species of the genus Coccyzus are facultative parasites, which may lay their eggs both intra- and interspecifically when certain environmental conditions prevail (Nolan and Thompson 1975, Ralph 1975, Sick 1993). Most obligately parasitic cuckoos exhibit one or more behaviors which enhance their reproductive success. Many lay rnimetic or

cryptic eggs which are less likely to be recognized as foreign eggs and subsequently destroyed by their hosts. Some species, including the Cornmon Cuckoo (Cucufus canorus) are wel1 known for producing polymorphic eggs. Individual females within a population lay eggs that mimic their most frequent host, resulting in distinct. sympatric, maternai lineages called gentes (singular: gens). Most parasitic cuckoos also exhibit behaviors that ensure that the parasitic chick is the sole occupant of the host nest. Adult fernales remove a single host egg pnor to depositing their own egg. In addition, many Old World cuckoo chicks push al1 host eggs or nestlings over the rim of the nest cup during the first few days following hatching (Jourdain 1925, Hamilton and Orians 1965, Payne 1977). The New World (Tapera naevia) nestling uses rnandibular hooks to kill host offspring in a manner similar to that of the parasitic of the genus Indicaror (: Morton and Farabaugh 1979). Other pansitic cuckoo species lacking these anti-host behaviors rely solely on larger size and aggressive behavior of their nestlings io out compete host young while in the nest (Wyllie 198 1). Most currently accepted classifications include the cuckoos and their putative sister group, Musophagidae, in Cuculiformes (Peters 1940, Wetrnore 1960. Morony et al. 1975, Howard and Moore 199 1). However, some taxonomists have suggested that these taxa are too divergent to be in the same order (e.g., Banneman 1933, Lowe 1943, Berger 1960), and othen have questioned their association (see Sibley and Ahlquist 1990). The musophagids, or turacos, are an enigmatic family (20 species in 6 genera) restricted to tropical (Howard and Moore 1991). They are frugivorous. inhabit deep . and are adept at moving quickly through dense vegetation. Before their flight have matured, "fledglings" use tiny on their wing joints. in addition to their feet, to move among the branches of the nesting tree. Adults fly poorly, but rarely corne down to the ground (Stegmann 1978). Turacos are monogamous: however, observations of group foraging have led some workers to suggest that a few species may nest cornrnunally (Horsfall 1985). Recently, some systematists have suggested that the Hoatzin (Opisthocomus hoazin)

is the sister taxon to the cuckoos (Sibley and Ahlquist 1990. Hedges et al. 1995), or is in fact a cuckoo (Sibley and Ahlquist 1972, 1973). This unique and anatomically divergent (Seibel 1988) inhabits the tropical forests of South America where it nests over watercourses and swamps. Durhg the breeding season. social units are composed of a monogamous pair of adults and several non-breeding helpers at the nest (Strahl 1987). Like the turacos, the Hoatzin chick uses wing claws to climb among the branches of the nesting tree. When in danger. the young Hoatzin drops into the water, then uses its fore- and hind-

Iimb claws to clamber back to the nest once the threat has passed (Grirnmer 1962). The Hoatzin is the only avian folivore that ferments leaves in a modified crop, and has a

skeleton highly modified to accommodate its unique digestive system (Grajal et al. 1989).

Anatornical pecularities exhibited by the Hoatzin have perplexed taxonornists for over two

centuries and, as a result, this species has been placed with gallinaceous birds (), cuckoos (Cuculiformes), turacos (Musophagidae),and in its own monotypic order Opisthocomiformes (see SibIey and Ahlquist 1973, 1990 for a review). Monopliyly. - A monophyletic group is one which is hypothesized to include dl the known descendants of a common ancestor and, thereby, its members share a more recent ancestor with each other than with any other taxa (Raikow 1982). One prernise of phylogenetic systematics is that the group under examination must be rnonophyletic in

order to accurately determine the evolutionary relationships among its included taxa (Wiley 198 1). If this is not the case, then any subsequent hypotheses of genealogy will be wrong (Raikow 1982, but see Lanyon 1994 for a practical example). Many recent phylogenetic studies in merely assume ingroup rnonophyly. However, some workers have demonstrated that well accepted avian groups

may not be monophyletic; e-g., Hawaiian honeycreepers (Drepanididae; Raikow 1978). manakins and cotingas (Pipridae? Cotingidae; Prurn 1990), and blackbirds (Agelaitts; Lanyon 1994). Thus many widely accepted taxa may be paraphyletic or polyphyletic, and taxonomists have consequently assumed monophyly due to their familiarity with established classification and lack of empirical evidence to think othenvise. Now, as systematists reevaluate avian classification using robust methodologies unavailable to

earlier taxonornists. it is imperative that contemporary workers first demonstrate rnonophyly so that subsequent analyses can be used effectively to evaluate traditional sequences. Monophyly of cuckoos has been well accepted for over 100 years. but many characters used commonly to distinguish the Cuculidae from other taxa are either plesiomorphic or homoplasious among avian families (e.g., zygodactyl feet, holorhinal nares. desmognathous paiate). As a consequence, it is important in this study that 1 review and reevaluate the traditiondly accepted diagnostic characters to determine their vaiidity

(Appendix 1.1). In addition, 1 examine the characters offered in the unpublished study by Sribel (1988) as being synapomorphic of the cuckoos. Finaliy, 1 present a list of sy napomorphies compiled following rny examination of skeletons of 54 families from 25 avian orders. This list is sufficient to establish nonophyly of the cuckoos for the following purposes: (1) phylogenetic reconstruction, (2) evduation of the taxonomie status of the

Hoatzin as suggested by Sibley and Ahlquist (1972, 1973. 1990). and (3) provision of basic guidelines for inclusion of al1 extinct and taxa currently attributed to the Cuculidae. Phylogeny and classification. - The classification of the cuckoos has a long and enigmatic history. In the past, systematists have attempted to interpret relationships within the Cuculidae through the study of cuckoo morphology (e.g., Beddard 1885. Shufeldt 1901, Pycraft 1903. Verheyen 1956a. Berger 1960, Seibel 1988), genetics (Sibley and Ahlquist 1990. Avise et al. 1994). and behavior (Hughes 1996b). However the substantiai, and often "idiosyncratic," differences observed among cuculid taxa have not yielded a consensus among several investigators. As a result. the classification of cuckoos has changed at least

34 times since first published by Linnaeus in 1758 (see Seibel 1988. Sibley and Ahlquist 1990). Although problematic, the widely accepted classification of Peters (1940) rernains the basis for most contemporary cuculid taxonomies (Table 1.1). Most of the contentious arrangements of taxa occur in two of the six subfamilies: the Neomorphinae and Phaenicophaeinae. The Neomorphinae comprise 13 species of parasitic and nonparasitic birds. Although they differ substantially in anatorny and life history, Peters based inclusion of these species in the same subfamily on their nearly complete New World distribution TABLE1.1. Classification of the Cuculiformes sensu Peters (1940). Obligately parasitic genera are indicated by (*). Facultatively parasitic genus is indicated by (O).

Order Cuculiformes Family Musophagidae Family Cuculidae Subfamily Cuculinae

Genus * Genus Pachycoccyx * Genus Cucrilus * Genus Cercococcyx * Genus Penthoceryx * Genus Cacornantis * Genus Rhumphornantis * Genus Misocalius * Grnus Chrysococcyx * Genus Chalcites * Genus Caliechthrus * Genus Surniculus * Genus Microdynamis * Genus Eudynamys * Genus Urodynarnis * Genus Scyrhrops * S ubfarnily Phaenicophaeinae Genus Coccyzus O Genus Hyetornis Genus TABLE1.1. Classification sensu Petea (1940) continued.

-- Genus Sartrothern Genus Ceuthmochares Genus Rhopodytes Genus Taccocua Genus Rhinorrha Genus ~nclostornus Genus Rhanlphococcyx Grnus Phnenicophaeus Genus Dasylophus Genus Lepidogrammus Subfamily Crotophaginae Genus Crotophaga Genus Guirn Subfamily Neomorphinae Genus Tapera * Genus Morococcyx Genus Dromococcyx * Genus Geococcyx Genus Nromorphus Genus Carpococcyx Subfamily Couinae Genus Coua Subfamily Centropodinae Genus Centropus (except Carpococcyx) and their predilection for terrestrial foraging (Berger 1960). Before Peters, most systematists had placed the neomorphine obligate parasites Tapera and Drornococcyr in a separate subfamily (Diplopterinae; eg, Sclater and Sdvin 1873, Shelley

1891) or with the Old World parasites (Cuculinae; e-g., Beddard 1885, Gadow and Selenka 189 1). Peters admitted dissatisfaction with the Phaenicophaeinae. refemng (Peters, in litt. to Berger 1952: 567) to the subfamily as "a general 'catch-dl' group for genera that cannot be satisfactonly allocated in the other subfamilies." This unnatural, albeit convenient, assemblage of approximately 3 1 species of New and Old World cuckoos includes at least seven monotypic genera, as well as the facultative parasites Coccyzus. Peters' justification for this grouping remains unknown. He may have assigned arbitrarily al1 arboreal, non- obligate parasitic cuckoos to the Phaenicophzeinae. In the decades since Peters' volume, several morphological, molecular, and behavioral systematists (Berger 1952, 1954, 1960, Verheyen 1956a. Sibley and Ahlquist 1972, Bmsh and Witt 1983, Avise et al. 1994, Hughes 1996b) have undertaken limited assessments of cuckoo relationships, and although these workers did not produce definitive classifications, they nonetheless revealed inconsistencies in traditional classifications. Seibel's unpublished (1988) phylogenetic reconstruction of the Cuculidae, based on 48 postcranial characters. has not received adequate attention from the scientific cornmunity. In addition. a new classification of the Cuculidae was proposed by Sibley and Monroe

( 1990) based on a DNA-DNA hybridization study of the Aves (Sibley and Ahlquist

1990). However, aspects of Sibley and Ahlquist's methodology have been criticized (e-g., Houde 1992. Mayr and Bock 1994)' and many authors have advised against using the resulting p hy logenies for comparative study (Lanyon 1992, Peterson 1992).

In the present study, 1 reconsmct the phylogeny of the cuckoos using both cranial and postcranial osteological characters. The dichotomy of generalized locomotory habits

(arboreal vs. terrestrial) arnong cuckoos justifies the inclusion of cranial characten. which are independent of the appendicular skeleton. In addition, postcranial characters are largeiy independent of feeding methods and, hence, may also be useful in resolving relationships in an ancient and diverse group which occupies many and uses a variety of foods. 1 also reevaluate and subsequently revise the list of postcranial characters used by Seibel (1988). The present study contrasts with previous analyses by inclusion of: (1) most cuculid genera and (la) a character set sufficiently large to resolve dl relationships among the taxa, and (2) the use of cladistic methodology. 1 then propose a new phylogenetic classification of the Cuculiformes, expound on its efficacy, and follow by discussing it in light of the evolution of brood parasitism. the informed relationship of locomotory strategies to use, the logical interpretation of biogeography. and the rationale of cuculid origins.

MATERIALS AND METHODS MONOPHYLY In many earlier classifications, taxa have been chancterized frequently by a set of phenetic characters that they share, regardless of exclusivity to the group. Now it is generally accepted that a tme tmon must be a monophyletic group clearly diagnosable by a set of shared derived characters, or synapomorphies (Wiley :98 1). Thus. prior to reconstructing a phylogeny, it is irnperative that the taxon in question be monophyletic. othenvise the resulting hypotheses of evolution may be incorrect (Raikow 1982. Lanyon

1994).

1 used the outgroup cornparison method of Raikow (1982) to establish monophyly of the Cuculidae. This procedure dictates that monophyly of a study group is demonstrated through character state cornparisons within a more inclusive group that itself cm be shown to be monophyletic (Gaffney 1979). Monophyly of this ingroup, which includes the study group plus additional taxa, must be hypothesized using a rnethod other than outgroup cornparison, such as fossil stratigraphy or the accepted results of a previous study. A ciosely related group is designated to serve as the outgroup. Character States that are present in some ingroup taxa, but no outgroup taxa, are considered to be derived within the ingroup. The monophyly of the study group is then supponed through the description of derived character states that are unique to the study group (see Fig. 1 in Raikow 1982). Traditionally, the turacos (Musophagidae) were considered the sister group to the Cucuiidae and both families were included in the Cuculiformes. However, this association

was questioned by Sibley and Ahlquist (1990) following their DNA-DNA hybndization analyses. As a result, cuculiform monophyly could not be assumed and ii was imperative that I select a higher-level taxon to serve as the ingroup. The Class Aves is monophyletic (Raikow 1982). Furthemore. the primary divisions of the Class Aves have been demonstrated to be monophyletic (Sheldon and

Bledsoe 1993). Therefore, I used the Infraclass (= "other neognaths"; Fig. 6b in

Sheldon and Bledsoe 1993) as the designated ingroup. The outgroup was the Parvclass Galloanserae, which includes the Galliformes and . Character states that were present in some Neoaves taxa, but not in the Gailoanserae. were considered to be derived. Support for cuckoo rnonophyly was given by character states that were derived within Neoaves and unique to the Cuculidae. Derived character states that were not unique to the Cuculidae could be either plesiornorphic at a higher taxonornic rank (symplesiomorphic), or homoplasiousl y derived. Because neither condition corroborates an hypothesis of

monophyly. such character states were considered non-diagnostic and discarded.

I examined a total of 306 disarticulated skeletal specimens from 54 families in 25 avian orders (Appendix 1.2). This included 209 specimens from 68 cuckoo species

representing 33 of 4 1 genera. The three-species genus Cercococcyx and the monotypic genera Rhcimphomantis, Caliechtlzrus, Microdynamis, Scytlirops, Taccocua, Zanclostomus,

and Phaenicopliaeru were excluded because no specimens were available for snidy. In the initial analysis. 1 reviewed 32 osteological chancters from the literature that have been previously considered diagnostic of the Cuculidae. including eight potential synapomorphies proposed by SeibeI(1988; Appendix 1.1). In a second analysis. I surveyed al1 specimens for previously undescribed osteologicaf synapomorphies of the cuckoos.

PHYLOGENY Tarn and specimens. - The genera- and species-level taxonomy of cuckoos has changed many times in past decades. In recent classifications, the Cuculidae has comprised at least 129 species (Morony et al. 1975) arranged in 29 (Sibley and Monroe 1990) to 40 (Howard and Moore 1991) genera. This wide discrepancy results primarily from varied treatrnent of the approximately 20 monotypic taxa within the farnily. 1 followed the classification of Howard and Moore (199 1) because their mangement of genera divides the family into the largest number of operational units. In addition, 1 include the genus

Coccycita, usually placed in Piaya (e.g., Peters 1940. Morony et al. 1975, Sibley and Monroe 1990. Howard and Moore 1991), but viewed as a monotypic genus in a few older classifications (e-g.. Ridgway 19 16, Cory 19 19). My decision to partition accepted generic groupings is not an assertion that other classifications that merge them are invalid. This approach merel y simplified the identification of intrageneric variabili ty w hen constructing characters, and also allowed for the heuristic examination of other classifications once a tree was produced.

In total. 33 cuculid genera were included in my study. As previously rnentioned, eight genera - Cercococcyx (3 spp.), Rliarnphomzntis (1 sp.), Calicchthrus (1 sp.),

Microdynamis (1 sp.), Scythrops ( 1 sp.), Taccocua (1 sp.), Zanclostomus (1 sp.), and Phnenicophaeus (1 sp.) - were not used because skeletal material was limited or unavailable. Two or more specimens were examined for dl genera with the exception of Pnc~cocc~,Urodynarnis, and Rhinorrha. Full skeletons were available for al1 taxa but Puclzycoccy~.Specimens used for this study are listed in Appendix 1.3. Outgror~pselection. - The selection of an outgroup was problematic. Sibley and

Ahlquist ( 1990: 370) suggested that the cuckoos "have no close living relatives, but are the sister group of a large assemblage that includes more than half of the groups of living birds." By convention, Seibel (1988) used the turacos (Musophagidae) as an outgroup in his phylogenetic reconstruction as this family is most comrnonly included with the cuckoos in the Cuculiformes (e.g., Peters 1940, Wetmore 1960, Morony et al. 1975, Howard and Moore 199 1). However, Seibel was only able to identify three apparent synapomorphies of the os carpi ulnare to support this relationship suggesting that, if cuckoos and turacos are sister taxa. they diverged early from one another. Other authors (De Queiroz and Good

1988, Avise et al. 1994, Hedges et ai. 1995) subrnit that the Hoatzin may be the sister taon to the Cuculidae. In addition, at least eight histonc classifications align this enigmatic bird with the Cuculiformes (see Sibley and Ahlquist 1973, 1990). Furthemore, Sibley and

Ahlquist ( 1972. 1973, 1990) suggested that the Hoatzin is a cuckoo (Cuculidae). This uncertainty in the selection of an appropriate outgroup for rny analysis led me to examine skeletons frorn 54 avian farnilies (same specimens as in monophyly analysis; Appendix 1.2). Rarher than make an a priori decision regarding the closest relatives of cuckoos, I considered al1 plausibly related groups which possessed at least superficial similarities to the cuckoos in major skeletal elernents. In addition, I included two nonpasserine families of unknown affinities, (Coiiidae) and (Trogonidae), as well as individuals from three families of Galliformes as more distant outgroups. In total. 22 taxa from 11 avian families were selected as preliminary outgroups and also coded for the same osteological characters used to reconstruct the cuckoo phylogeny: Alectrîra (Megapodidiae); Ortalis, Cru (); Phasianus. Tympanuchus, Tragopan (); , Corythaixoides, Musophnga, (Musophagidae); Opistliocomus (Opisthocornidae); Colius, Urocolius (Coliidae); , Apaloderma (Trogonidae); Merops (Meropidae); Coracias (); Tockus, Bycanistes (Bucerotidae); B~rcco,Monasa, Malacoptila (Bucconidae). Additional States were added to characters, as necessary. to accommodate morphological divergence observed arnong sorne

of the more distantly related taxa. An initial phylogenetic analysis included al1 outgroups. The results of this investigation clearly indicated the most likely sister taxa of the cuckoos to be turacos (Musophagidae) and the Hoaizin (Opisrhocomus hoazin), which were then used as outgroups in subsequent analyses. Character analysis. - A total of 135 skeletd characters, 56 cranid characters and 79 postcnnial characters, were used to reconstruct a phylogeny of the cuckoos (Appendix 1.4). Osteologicd nomenclature follows Baurnel and Witner (1993). Sixteen postcranial characters were taken directly from Seibel (1988). An additional 39 postcranial chancters were based on 3 1 of Seibel's 48 characters, but were dtered from his original analysis in one or more ways: (1) multistate characters were divided into two or more binary characters, (2) informative intermediate conditions were assigned individual character states. (3) character states not previously recognized were added, and (4) ordering hypotheses were modified. In severd cases, al1 chancter conditions were reanalysed. Only one character from Seibel was discarded, since it was not adequately described in his manuscript. Characters were polarized into a plesiomorphic state and one or more apornorphic states through outgroup comparison with the turacos and the Hoatzin. More distant outgroups were considered when necessary. Characters for which information was unavailable or irretrievable for particular taxa were coded as missing (?). Multistate characters were considered unordered unless a reasonable hypothesis of character evolution could be formulated. A 35 x 135 data matrix (cuckoos, Opisrhocomus. Musophagidae) depicting al1 assigned chancter state codes cm be found in Table 1.2. To ensure that the resulting topology was not influenced by the dichotomy of locomotory function in cuckoos (Le., terrestrial and arboreai), a supplementary analysis was performed using oniy characters independent of the appendicular skeleton. FiRy-one characters from the tibiotarsus, tarsometatarsus, femur, pelvis, sternum, humerus, radius, and ulna were deleted from the data set. TABLE1.2. Data matrix indicating character staies among 33 cuculid genera,

Hoatzin (Opisrhocornus hoazin), and turacos (Musophagidae) for 135 osteological characters. See Appendix 1.4 for character descriptions.

Charac ters

1 Taxa 123456789012345678 Clamator O-qloph ris

Cwonrarrtis CI~~SO~OC~ Misocnli~ts Chalcites

Coccyzus &etomis Piaya

Coccycrin TABLE1 .S. Data matrix continued.

1 Taxa 123456789012345678 Rlzinortlia lllll???lOOOOOllOO Lepidogrammics 1 1 1 O O O O O 1 O O O O O 1 1 O 1 Dasyiopliris 111000001000001101 Crotophoga 00100010i000001100

Grtircl 0010001.01000001100 Tapera O1llLOOOlOOOOOllOO

Morucoccyx 011000001000011100 Drotnococcyx 0111?000I000001100

Geococcyx OllOOOOOLOOOOI11OO Neornorpllris 011000001000011100

Ca rp O coccyx OOOOOOOOlGOOOO1llO

Coun OlIOOOOO1OOOOOlllO

Crntropus 0111000001000001110 Opistliocomus O O O O 1 O O O O O O O O O O O O O Musophagidae O O 1 O 1 O O O O O O O O O O O O O '< B 3 G-

O

O

C

C

O

O

C

O

O

P-

r-.

w

r-.

O

r-.

C

CI

O TABLE1 2. Data matnx continued.

- 12 3 Taxa 901234567890123456

- - Rh in ortha Lepiclog rcmmris Dusyiophru

Crorophaga

Guircr

Tapera

Morococcyx Dromococcy-x

Grococcyx Neornorphus

Cnrpococcyx

Coria Cenrropi

OpistC~ocom~is Musophagidae TABLE1.3. Data matrix continued.

Characters

- - 3 4 5 Taxa 789012345678901234 Clamator O.ryl ophus

Pachycoccyx Cucrrlus

Sum icr L lus

Pentlioceryx

Cacomantis

Ch ~ococcyx Misocnlius CItalcites Eruiyzamys Urody>zaniis

Coccy~rls Hyetornis Piayn Coccycrta Sartro thera Cerrtl~mochares Rhopodytes Rkamphococcyx TABLE1.2. Data rnatrix continued.

-- 3 4 5 Taxa 789012345678901234 Rkinortha Lepidogrammus

DnsyIophus

Crotophagn

Grrira Tapera Morococqx Dromococcy.r Grococ- Neornorphrls Ca rpococcy-r Coua Centropus Opkrliocornus Musophagidae TABLE1.2. Data matrix continued.

- - C haracte rs

5 6 7 7 Taxa 567890123456789012 TABLE1.2. Data matrix continued.

Chamters

Taxa Rhinortha kpidogrammrrs

Dasylophus Crotophaga Grtira

Tqw rcz

Morococc8yx Dro~nococcyx

Geococcy.x

Neomorplzus C[irpocoq~

Colla Ctilitroprrs

Opisrhocom~is Musop hagidae TABLE1 .S. Data matrix continued.

Characters

- - 7 8 9 Taxa 345678901234567890 Clama to r O~luphics Pachycoccyx C~lclllles

. Sirmicii frts Pentlzoceryx Cacomantis Clt ?ysococcy~ lMisocnlirrs Chalcites Eruiynarnys Llmdynarnis Cocqzru

Hy e ru rnis Picryn Coccycren Saurothera Ceicthmochares Rliopodyres Rhamphucoccyx TABLE1.2. Data matrix continued.

7 8 9 Taxa 345678901234567890 Rhinorrhtz 211101102010100220 Lepidogrnmrnlu 2 1 1 1 O 1 1 O 1 O 1 O O O O 1 2 1 Dnsylophus 211101 101010000121 Crotopltaga 211101201110110120

Gliirn 211101201110110120 Tapera 211101212020101220

Morococcyx 111201001010000010 Droniococcy.~ 21L10121302012011220

Grococcyx 111201001011000010 Neomorphus 11120~001011000010 Cnrpococcyx 110101000010000010

Coiia 110101001010000010

Crntropus llOlOlOOlOlOOOOOlO Opistlrocamus O O O 1 O O O 1 O O O O 2 O O O O O Musophagidae O O O O O O O O O O O O O O O O O O TABLE1.2. Data matrix continued.

Chamters

1 9 000000000 Taxa 123456789012345678 Clarnator Oxylophus Pachy coccyx Cucrt lus Sr micri lus Perzthoceryx Cacornantis Ch~ococcyx Misocalius Chalcites Ercdynamys Urodynamis Coccyzrrs

Hyeto mis

Piaya Coccycria Sarirothera Ceurhmochares Rhopodytes Rharnphocaccyx TABLE1.2. Data rnatrix continued.

Taxa Rh inortha 30?000012110101121 Lepidogrammus 3 1 O O 4 O O 1 2 1 1 O 1 O 1 1 2 1 Dnsylophus 310040012110101121

Crorophagn OlOiOOOlll1OlOll~l Gtrirn 0101000111101011?1 Tapera 020220012110101121

!Morococcy 211000011111001111 Drornococcy.~ 0202200~2110101121

Geococqx 211000011111001111 Neomorp/ins ~1100001111100?111 Curpococqx lllOOOOlOllOOOlll1 Corta 111001010110001111 Cenrropcts 1110001010110001111 Opis~hocomris O 1 2 O O O O O 4 1 1 O O O 1 O O O Musophagidae O O O O1 O O O O O O O O O O O O O O TABLE1.2. Data matrix continued.

Charac ters

Taxa Clanlator O.xylophus

Pacli y coccyx

Cricri fris

Srtrnicttlrrs

Pen tlioceqx

Cncomantis

Cl~~ococcyx Misocdius

Clialcites

Eudynarny Urodynarnis

Coccyzrts

Hyerom is

Pia~a

Coccycrtn

Saurottzera Ceirthochares

Rhopoùytes Rhainphococcyx

TABLE1.2. Data matrix continued.

- -. 1 1 222333333 Taxa 789012345

cIl~ococc~

Misocaliris Chalcites Eudynainys Urodynnmis Coccyzris &etomis Piuyn Coccycria

Rharnphococcyx TABLE1 .S. Data matrix continued.

222333333 Taxa 789012345

Lepidugrammus

Geococcyx

Cmtrop us

Opisthocornus Musophagidae Tree derivation and analysis. - Trees were constnicted using the cornputer program PAUP 3.1 (Phylogenetic Analysis Using Parsimony; Swofford 1993) on an Apple Macintosh Quadra 660AV. Supplernentary tree and character analyses were performed using MacClade 3.01 (Maddison and Maddison 1992). Optimal trees were found using the

Branch and Bound algonthm. The MULPARS option was in effect. MAXTREES was set at 1,000 trees with automatic increase. Zero-length branches were collapsed to yield polytomies. Separate analyses were performed using al1 character state optirnization

schemes (ACCTRAN, DELTRAN, MINF), and addition sequences (hirthest, as is, simple). Implementing these different options did not alter the final outcome of the analysis.

Suboptimai trees were calculated by "keeping" al1 trees a specified number of steps longer than the minimal Iength tree. The consistency index (Co.retention index (Ri), and rescaled consistency index (Ra were cdculated. A11 characters were given equal weight.

RESULTS MONOPHYLY

My reanalysis of 32 characters deemed to be diagnostic of cuculid affinities by other

workers found 27 of them to be uninformative. Of these, 70 (Appendix 1.1: characten 2-9.

12- 14. 16-2 1. and 23-32) could not be used to establish rnonophyly because they were not exclusive to cuckoos; being either symplesiomorphic, or convergent derived conditions observable in other avian families. An additional seven characters (9, 12, 14, 16, 17, 24, and 25) could not define the cuckoos at the familial level because they were not found in ail

cuculid taxa studied. The representation of these seven characters as diagnostic was likely attributable to previous investigators basing studies on examination of a single individual from an incomplete series of taxa. Only Cive potentially diagnostic characters were

identified as being synapomorphic (characters 1. 10. 1 1. 15. and 22), including only two of

eight proposed by Seibel (characters 10 and 15). Seibel's other suggested synapomorphies separated cuckoos from the outgroup turacos in his phylogenetic analysis, but did not uphold monophyly when exarnined in other avian families.

The above mentioned synapomorphies are described below in extended fom and supplemented with nine additional cuculid synapomorphies resuliing from my examination of the skeletal matenal. This list, by no means exhaustive, is nonetheless sufficient to establish cuckoo monophyly for purposes of my phylogenetic reconstmction that follows.

( 1) Os qriadratum. - Condylus medialis. caudalis, and lateralis prominent, well rounded. and separated by a broad notch; condylus caudalis tapered to a rounded point, deflected and extending well beyond caudal margins of quadrate in laterd aspect; processus orbitalis quadrati tmncated and somewhat anvil-shaped (Fig. 1.1). (2) Os prerygoideum. - Mesially defiecting spur-like processus dorsalis located caudally on facies dorsalis near. but not articulating with, os quadratum (Fig. 1.1). (3) Os ectethrnoidale. - Large, quadrilateral in form. marginis lateralis and ventrdis slightly to moderately excised (Fig. 1 2)-

(4)Os palnntinum. - Marginis medialis meeting in midline below, fully or nearly concealing. rostrum parasphenoidale; lamella caudolateralis being widest midway between processus pterygoideus and mago distalis of pars choanalis, tapering towards rostrum;

processus interpalatinus extending nearly to margo caudalis of processus maxillopalatinus; in lateral aspect, cristae laterdis are defiected ventrally (Fig. 1.3). (5) Os rnu.rillare. - In ventral aspect, processus palatinus bilobed. extending caudally nearly to marginis distalis of crista ventralis; margo medialis of processus palatinus not fused caudally to margo distalis of os maxillare (Fig. 1.3). (6)Os articulare, cristn intercotylaris. - Prominent, half-disk shaped with radius

aligned approximately 45' to planum medianum (Fig. 1.4). (7)Tibiotarsus. incistrra intercondylaris. - Deep, rounded pit extending caudally at least half the length of extremitas distalis (Gilbert et al. 198 1); trochlea cartilaginis tibialis poorly developed (Fig. 1S).

OPL

Figure 1.3. Skull of Greater Roadmnner (Geococcyx californianus) in ventral aspect. OPL = os palatine, OM = os maxillare. Figure 1.4. Os articulare of Greater Roadrunner (Grococcyx californianus) in dorsal aspect. Figure 1.5. Right tibiotarsus of Greater Roadrunner (Geococcyx californianus) in caudal aspect. (8) Tarsorneratarsus, hypotarsi. - Two oblong canales hypotarsi, completely enclosed in bone, positioned side by side in planum medianum both almost entirely caudal to cotylae medialis and lateralis, and corpus tarsometatarsi (Seibel 1988, TM 13; Fie. 1.6). (9) Tarsometatarsus. trochlea metatarsi qunrti. - margo distalis proximal to incisura intertrochlearis medialis (Seibel 1988, TM21); caudal trochlea accessoria prominent and strongly inflected medially (Gilbert et al. 198 1; Fig. 1.7).

( 10) Coracoiderirn. facies articrilaris sternalis. - Crista ventralis prominent, centered, rounded, and facing stemally (Gilbert et ai. 198 1: Fig. 1.8).

( 11 ) Scapula. - Facies articularis humeralis directed dorsally: facies articularis clavicularis prominent, knob-like, and directed dorsally: extrernitas cranialis scapulae, delineated by acromion and tuberculum coracoideum, is truncated and fiattened cranially (Fig. 1.9). (12) H~rmenis.condylus ventralis. - Rounded. not flattened or oblong, in axis proximodistalis and both plana transversalia and dorsalia (Fig. 1.10).

( 13) Synsacrurn. extremitas caudalis synsncri. - Crista donalis reduced and fused to form a single low ridge; marginis lateralis of processes transversus widened in axis rostrocaudalis. facies lateralis projecting cranially (Fig. 1.1 1).

(14) Vertebrae caudales. primus. - Processes transversus tapered, not widened, paddle-shaped in ventral aspect; projecting strongly caudally (Fig. 1.12)-

PHYLOGENY Cuckoos. -The phylogenetic analysis of 135 skeletal characters yielded one fully- resolved shortest-length tree of 235 steps (including synapomorphies of the farnily; CI = 0.778. 0.7 18 excluding autapomorphies; RI = 0.932. RC = 0.725; Fig. 1.13) that differs

significantly from the currently accepted classification of the cuckoos (e.g.. Morony et al. 1975. Howard and Monroe 199 1). Perhaps the most striking deviation from these accepted taxonomies is the placement of al1 obligately parasitic cuckoos in a single monophyletic Figure 1.6. Right tarsometatarsus of Greater Roadrunner (Grococcyx calfornianus) in cranial aspect. Figure 1.7. Right tarsometatarsus of Greater Roadrunner (Geococcyx califonzianus) in (a) dorsal, and (b) caudal aspect. Figure 1.8. Right concoideum of Greater Roadmnner (Geococcyx californianus) in dorsal aspect . Figure 1.9. Right scapula of Greater Roadmnner (Geococcyx californianus) in dorsal aspect. Figure 1.10. Right humerus of Greater Roadrunner (Geococcyx californianus) in (a) cranial. and (b) distal aspect. Figure 1.1 1. Pelvis of Cuba Lizard-cuckoo (Saurothera merlini) in dorsal aspect. Figure 1.12. Pelvis of Cuban Lizard-cuckoo (Saurothera merlini) in ventral aspect. subfamily (Cuculinae: Fig. 1.13, node 66). Within the Cuculinae, there is a clade of "higher parasites" (node 43) comprised of , Cacomantis, Penthoceryx, Sumiculus, Cltrysococcyx, Chalcites, Misocalins, and Pnchycoccyx. Also included in the Cuculinae are the terrestrial, New World obligate parasites Tapera and Dromococcyx, previously placed in the Neornorphinae, and the facultatively parasitic Coccyzus, usually included in the

Phaenicophaeinae, now positioned as sister taxon to the Clamator-Oxylophus complex. This is in contrast to most earlier classifications, based primarily on the sequence in Peten (1940). which suggested that brood parasitism arose independently at least three Urnes in the cuckoos. In addition, my results indicate that terrestrial habits of Tapera and Droinococcyr has evolved secondarily. The arboreal, nonparasitic cuckoos of the Phaenicophaeinae. except Coccyzrts, fonn a rnonophyletic group that is the sister group to the parasitic cuckoos (Fig. 1.13, node 53). Within the Phaenicophaeinae, the New World genera - Saurotliera. Hyetomis, Piaya, and Coccycnia - fom a clade (node 47). An additional chde (node 50) includes four genera of malkohas. Rliopodytes, Rhamphococcyx. Lepidogrammus, and Dasylophnrr, that have been merged into Phaenicophaeus by sorne authors (e.g., Delacour and Mayr 1945, Sibley ûnd

Monroe 1990). Ceuthrnocha res and Rh in ortha occupy basal positions in the Phaenicophaeinae. The communally breeding cuckoos of the Crotophaginae. Crotophaga and Guira, are monophyletic (node 54) and the sister group to the Cuculinae and Phaenicophaeninae. In basal positions on the tree are three paraphyletic taxa of terrestrial cuckoos. The nonparasitic New World neomorphine cuckoos. Morococcyx, Grococcyx, and Neomorphus, fom a clade (Fig. 1.13, node 56). The Old World terrestrial cuckoos, Centrupus and Coua

(Centropodinae; node 60), are the sister group to the Neomorphinae. The monotypic subfamily Couinae has been dissolved with the transfer of Coua to the Centropodinae. Cnrpococcyx, an Old World form classified in the Neomorphinae (Peters 1940, and most

subsequent classifications) or Cuculidae (= Cuculinae) by Sibley and Monroe (1990)- occupies a monotypic subfarnily (Carpococcystinae) at the base of the tree (node 59). The basal position of these taxa suggests that the ancestral cuckoo was at least in part adapted for a terrestrial existence. One measure of topological stability is the number of synapomorphies defining the basal stem of each clade. My reconstmction of cuculid phylogeny is well supported at most subfamily and tribe levels (see the character change list in Appendix 1.5 for synapomorphies at each node). The Cuculinae is supported by nine synapomorphies, seven of which are unarnbiguous (Le., only one distribution of States allowed on the optimal tree).

Within the Cuculinae. the "higher parasites" are united by 13 synapomorphies (five unambiguous). The Phaenicophaeinae is supported by four synapomorphies (two unambiguous). The New World members of this subfamily form a tribe based on five

unambiguous synapomorphies. The Crotophaginae are also united by five unambiguous synapomorphies. The Neomorphinae is supported by nine synapomorphies, seven of which are unambiguous. Less well defined are the Centropodinae and Carpococcystinae, being supported by one and two (each only one unambiguous) synapomorphies, respectively. While the position of Cnrpococcyx as a basal taxon is well supported - seven unambiguous synapomorphies defining the Cuculidae without Carpococcyx (node 6 1) - only one additional step is required to collapse the Centropris - Coua clade (node 60)- making these three genera paraphyletic. Overall, the family (Cuculidae) is strongly

supported by 35 unambiguous synapomorphies, 28 with a CI of 1.00. iMy analysis supports, in part, merging the following genera: Oxylophus and

Clarnator (C Clamator); Clzrysococcyx, Misocalius, and Chalcites (< Chrysococcyx);

Eudynnrny s and Urodynam is (c Eudynamys); and Hyetornis, Piayu, and (< Piaya). However, the results do not suppon the inclusion of Penthoceryx in Cacomantis, because these genera are paraphyletic. The status of the four genera of maikohas is unclear. Although these genera form a monophyletic group, within this taxon there are two separated by eight unambiguous character state changes, one uniting Rhopodytes and Rkornphococcyx, and seven joining Lepidogrammus and Dasylophus. This degree of divergence may controvert the suppression of these four genen into Phaenicophaeus. The supplementai anaiysis using only non-appendicular characters resulted in four equal-length trees (L = 125 steps; CI = 0.797.0.7 18 excluding autapornorphies; RI = 0.926; RC = 0.733). These trees differed from the full-character optimal tree only by a minimal loss of resolution arnong the "higher parasites" of the Cuculinae.

Outgroups. - The results of the preliminary analysis suggest that the Hoatzin is the sister taon to the cuckoos. This relationship is supported by seven synapomorphies, five of which are unambiguous. Furthemore, the turacos (Musophagidae) are sister group to the Hoatzin-Cuculidae clade. These three taxa are united by 11 synapomorphies (seven unambiguous). The placement of the Hoatzin outside of a turaco-cuckoo clade - as implied by many traditional classifications that include only the Musophagidae and Cuculidae in the Cuculifornes - would require an additional seven steps in the tree construction. Superficially. the Hoatzin and the turacos share many skeletal similarities. The union of these two taxa in a clade would require an additionai five steps. Cliaracter consistency. - Cranial characters had slightly lower mean consistency indices than did postcranial characters. 0.850 and 0.9 13, respectively. Although most of the

characters had consistency indices of 1.00 (cranial = 38 characters; postcranial = 61 characters), certain skeletal elements showed more homoplasy than others. These included

the os basioccipitale (mean CI = 0.6 1 1, n = 3), os exoccipitale (0.750. 4)- os articulare (0.600, S), sternum (0.767.3). and ulna (0.747,s). In addition, many potential characters of the os palantinum and os ectethmoidale were examined and subsequently discarded because they were phylogenetically uninformative (CI < 0.250). The most informative skeletal elements, in terms of the nurnber of useful characters extracted, were the tarsornetatarsus

(18 characters), pelvis (14), and os quadratum (9). When analyzed separately, cranial characters resulted in 3 1 (L = 96 steps, CI = 0.740. RI = 0.905, RC = 0.669), and postcranial characters in 2 (L = 132 steps, CI = 0.803, RI = 0.947, RC = 0.761) equally parsirnonious trees. Although there were too few cranial characters to fully resolve the topology, they successfully resolved al1 taxa at tribe level, except the New World phaenicophaeine genera. The two trees based on postcranial characters were identical to the full data tree, but lacked resolution of Chrysococcyx, Hyetornis, and Piayn.

DISCUSSION MONOPHYLY Many early systematists attempted to define a taxon using a single character and, as a result, classifications often included species of questionable affiliations. The Cuculinae of

Nitzsch (1840), based on the superficial structure of the oil-gland, included the cuckoos, Cuckoo-roller (Leptosomus discolor, , ), honeyguides (Indicaror spp.. Indicatoridae. Piciformes), and trogons (Trogon spp., Trogoniformes).

Likewise. Lilljeborg ( 1886) placed the honeyguides in the Cuculidae after observing similarities in their zygodactyl feet. In contrast, Goodchild (1 89 1) concluded that cuckoos were polyphyletic based on their arrangement of secondary wing coverts. He suggested that "normal cuckoos" (i-e., arboreal) were most closely associated with picarian birds (=

Piciformes) and pigeons (= ), and that ground cuckoos were allied with the gallinaceous birds, in particular the guans (Cncidae) and (Megapodiidae). However by the end of the nineteeth century, most systematists considered the cuckoos. as ccrrently defined, to be a natural group that is anatomically divergent from dl other avian families. Although cuckoo monophyly was not questioned seriously for more than one hundred years (but see below regarding the inclusion of the Hoatzin), previous workers failed to define and describe accurately those traits which they considered to be diagnostic.

Most traditional characters, e.g., zygodactyl foot and desmognathous palate, are either plesiomorphic or homoplasious. Hence, taxonomists generally described the cuckoos using a list of monothetic characters. al1 of which had to be satisfied for inclusion in the family. In contrast, Seibel (1988) offered eight potential synapomorphies of the Cuculidae. However, my examination indicated that only two characten were synapomorphic. being found only in cuckoos and not among other avian families. My presentation of 14 cuculid synapomorphies sufficiently defines the Cuculidae to the exclusion of other purportedly related taxa, for purposes of phylogenetic reconstruction, and as a guideline for inclusion of extinct and fossil taxa. Homin. - The Hoatzin has been placed in the Galliformes (e.g., Fürbringer 1888,

Gadow 1892. Peters 1934. Cracraft 198 L), Cuculiformes (e-g., Pycraft 1895. Verheyen 1956b, Hedges et al. 1995), or the monotypic order, Opisthocorniformes (e-g.. Bamikol 1953, Stresemann 1959). Based on protein electrophoresis and DNA-DNA hybridization data. Sibley and Ahlquist concluded that the Hoatzin is a cuckoo (Cuculidae) most closely allied with the communally breeding anis (Crotophaga spp. and Guira guira; Sibley and

Ahlquist 1972. 1973) or the (Geococcyx spp.; Sibley and Ahlquist 1990). However. the methodologies utilized in these studies have been criticized subsequently (e.g., Bmsh 1979. Houde 1987, Lanyon 1992. Peterson 1992. Mayr and Bock 1994). The association was also questioned by Bock ( 1992) who suggested that the anisodactyl foot

structure of the Hoatzin was sufficient to exclude it from the zygodactylous cuckoos. In addition, many of the morphological characters cited by Sibley and Ahlquist as support for the Hoatzin's inclusion in the Cuculidae show general similarities to the anis (e-g., communal nesting, pelvic muscle formula, and arrangement of secondary wing coverts: see Sibley and Ahlquist 1972, 1973, 1990 for a complete list), but have not been demonstrated to be homologous. Other characters, such as short processes mandibularis, large fossae temporalis. and absence of processes basipterygoideus, are symplesiomorphic. and, therefore, cannot be considered evidence for inclusion in the Cuculidae. Based on the results of my analysis and the consideration of previous studies. I conclude that the cuckoos are rnonophy letic without the Hoatzin. The taxonomie relationship between the Hoatzin and the Cuculidae is discussed below.

PHYLOGENY The taxonomy of the cuckoos has remained virtually unchanged for many decades, with the sequence of Peters (1940) still being the most widely accepted. Several subsequent studies (Verheyen 1956a, Berger 1960, Seibel 1988) have provided some compelling evidence favoring the revision of cuculid classification, but have failed to gain support from the omithological cornrnunity. Both Verheyen and Berger included too few taxa in their analyses to render any comprehensive conclusions. and Seibel's work has remained in dissertation form only. Another cuckoo phylogeny (Hughes 1996b) has been recently published. The complementary potential of this work to the present snidy will be discussed below. My analysis of cuculid relationships based on osteological data addresses most genera of cuckoos using a large character set and the robust methodology of phylogenetic systematics unavailable to earlier taxonomists. Therefore, the resuits of this analysis should be used not only to reevduate previous classifications, but also to propose a ne w hypothesis of evolutionary relationships within the group (Brooks and McLennan 199 1). A new phylogenetic classification of the cuckoos based on the optimal tree (Fig.

1.13) is shown in Table 1.3. Single rvolrrtion of brood parasirism. - From many earlier classifications one inferred that the evolution of brood parasitism in the cuckoos resulted from at least three independent events: two ongins of obligate parasitism in the Cuculinae and Neomorphinae, and at least one origin of facultative parasitism in the Phaenicophaeinae. sensu Peten

( 1940). However, it seems unlikely that so rare a behavior in birds (about 1% of al1 species; Payne 1977) would have arisen so many times in a single family. In conuast, the

present analysis supports a single evolution of brood parasitism in the cuckoos which is, in effect, an important behavioral synapomorphy uniting the Cuculinae (Hughes 1996b). TABLE 1.3. Phylogenetic classification of the cuckoos and sister taxa derived frorn optimal tree (Fig. 1.13). Taxonornic ranking after the methods in Wiiey (198 1).

Order Musophagiformes (Banneman 1933) Order Opisthocorniformes (L' Herminer 1837) Order Cuculiformes (Wagler 1830) Famiiy Cuculidae (Vigors 1825) Subfamily Carpococcystinae (Verheyen 1956a) Genus Carpococcyx

Subfamily Centropodinae (Gray 1840) Genus Centropus Genus Corta

Subfamily Neomorphinae (Shelley 189 1 )

Genus Morococcyx Genus Geococcyx Genus Neornorplzus Subfamily Crotophaginae (Swainson 1837) Grnus Crotophagn Genus Grrira Subfamily Phaenicophaeinae (Gray 1840) Tribe Rhinorthini (Seibel 1988) Genus Rhinortha

Tribe Ceuthmocharini (Hughes. new tribe) Genus Ceuthmochares TABLE1.3. Classification continued.

-- Tribe Phaenicophini (Salvin 1882) Subtribe Rhopodytina (Hughes, new subtribe) Genus Rhopodytes Genus Rhamphococcyx Subtribe Phaenicophina (Hughes, new subtribe) Genus Lepidogrammur Genus Dasylophus Phaenicophaeini incenae sedis Genus Taccocua Genus Zanclostorttus Genus Phaenicophaeus

Tribe Saurotherini (Gray 1840) Genus Saurothera

S upergenus Pinya Genus Hyetornis Genus Piaya Genus Coccycua Subfamily Cuculinae (Vigors 1825)

Tribe Taperini (Verheyen 1956a) Genus Tapera Genus Dromococcyx TABLEi .3. CIassification continued.

Tribe Eudynamini (Baker 1927) Supergenus Eudynamys Genus Eudynamys Genus Urodynamis Eudynamini Genus Microdynamis Genus Scythrops

Tribe Coccygini (Swainson 1 837) Genus Coccyzirs S upergenus Clamator Genus Clnrnator Genus ûxylophus Tribe Cuculini (Vigors 1825)

Subtribe Pachycoccystina (Hughes. new subuibe) Genus Pachycoccyx

Subtribe Chrysococcystina (Hughes, new subtribe)

Supergenus Chrysococcyx (Berger 1955) Genus Chrysococcyx Genus Misocalius Genus Chalcites TABLE1.3. CIassification continued.

Subtribe Cuculina (Vigors 1825) Genus Srtmiculus Genus Penthoceryx Genus Cucrdus Genus Cacornantis

Cuculini incertae sedis Genus Cercococcyx Genus Rhamphornantis Genus Caliechthnrs Furthemore. behavior can be used to subdivide the clade of parasitic genera into three clades of "lower parasites" - ( 1) Tapera and Dromococcyx; (2) Eudynamys, Urodynarnis, and probably Scythrops not included in this study; and (3) Clamaror, Oxyiophus, and Coccy;i

hast offspring ejection by cuckoo nestlings

brood parasitism Figure 1.14. Hypothesis of phylogeny for the Cuculinae based on t osteological characters lndicatlng the origin of brood parasitlsm and subsequent evolution of anti-host adaptations to parasitism. uses the shallow, sensitive depression in its scapular region to push host eggs or hatchlings over the rim of the nest cup. This behavior ensures that the cuckoo nestling is the sole occupant of the nest. and significantly improves its chance of fledging (Jourdain 1925, Payne 1977). In my analysis, host-offspring ejection behavior is synapomorphic among the "higher parasites." Ln contrast, "lower pansite" nestlings do not exhibit ejection behavior, and are raised with one or more host chicks in the nest. Like other taxa of brood parasites, such as the cowbirds (Icterinae; Friedmann I963), whydahs and indigobirds (Viduinae; Payne 1973a). and the Cuckoo Weaver (Anomalospiza imberbis, Ploceidae; Maclean 1985), these cuckoos use their larger size. aggressive begging behavior, and hyperstimulating mouth coloration to out-compete the host Young (Hamilton and Orians 1965, Wyllie 198 1). One notable exception is the Striped Cuckoo (Tapera naevia), a New World obligate parasite that has evolved mandibular hooks which it uses to kill host chicks in a manner similar to that of the parasitic honeyguides of the genus Indicator (Piciformes; Morton and Fanbaugh 1979). It seems logical to sepante the Cuculinae into two grades of parasites based on host-ejection behavior because its presence or absence is often accornpanied by a suite of other behaviors, such as host-chick rnimicry (Jourdain 1925. Friedmann 1964). begging-cal1 mimicry (Courtney 1967. Mundy 1973, Morton and Farabaugh 1979), and mouth-pattern mirnicry (Payne 1977) that are dependent on whether a cuckoo chick is raised alone or with nestmates. inclusion of Coccyzus in the Cuculinae. - My classification based on osteological characters differs markedly from that of Peters (1940) in the transfer of the facultatively

pansitic genus Coccyzris from the nonparasitic Phaenicophaeinae sensu Peters ( 1940) to the parasitic Cuculinae. It is likely that Peten grouped Coccyzus with the New World members of the Phaenicophaeinae, such as Piaya and Saurothera, based on similarities in behavior and vocalizations, New World distribution, and non-obligately parasitic breeding strategies (Berger 1960). However, behavioral and vocal similarities between Coccyzus and the New World Phaenicophaeinae (Saurotherini, this study) have never been shown to be homologous. In fact, many aspects of Coccyzus behavior and ecology strongly link this genus to the Cuculinae (Hughes 1996b). Also, if Peters considered parasitisrn and distribution in the ailocation of his genen, he did so inconsistently. He seemingly had littie difficulty in including the aberrant Old World genus Carpococcyx and the obligate brood parasites Tapera and Dromococcyx in the Neomorphinae, an othenvise nonpansitic, New World subfamily. Eûrlier this century, most systernatists classified Coccyirts with the obligate parasites of the Cuculinae based on internai , osteology, myology, and pterylosis (Beddard 1885, 1901, Shufeldt 1886, 190 1, 1909, Shelley 189 1, Sharpe 1900, Pycraft 1903,

Chandler 19 16). Coues ( 1897) suggested that the subfamily Coccyzinae - presented first in the ninth supplement of the American Omithologists' Union Check-list of North American Birds (Ridgway et al. 1899) to distinguish between New and Old World "tree cuckoos" - be abandoned based on the work of Beddard and Shelley. More recent examinations of Coccyzus osteology (Verheyen 1956a, 196 1. Seibel 1988), myology (Berger 1952, 1960), and behavior and ecology (Hughes 1996b) continue to support placement of this genus in the Cuculinae, but unfortunately these studies have failed to breach the adherence to convention that has plagued cuculid classification since the publication of Peters' ( 1940) Check-list. Sibley and Ahlquist (1990) addressed avian classification using DNA-DNA hybridization and produced a phenogram that clearly positions Coccyzr~sin the Coccyzinae. a "clade" of New World phaenicophaeine cuckoos (= Süurotherini, this study). However, it is unclear how the authors anived at their conclusions. In three melting curves that included only cuckoos and turacos, one showed Coccyzus clustering with Oxylophus (pg. 726, Fig. 76), another positioned Coccyzus midway between the Phaenicophaeinae and the "higher parasites" of the Cuculinae (pg. 727, Fig. 80), and the third aligned Coccyzus with

Piaycz and Coythnixoides, a turaco (pg. 729, Fig. 84). The first two curves are consistent with my cuckoo phylogeny, but not with the phenogram in Sibley and Ahlquist (1990) and accompanying classification produced by Sibley and Monroe (1990). The results of the third curve are perplexing, particularly because Sibley and Ahlquist maintain that turacos and cuckoos are not closely related. The authors rnay have based their classification of the Coccyzinae on a single melting curve that clusters Coccyzus with Piaya and Saurothera (pg. 720, Fig. 58). However, because this single analysis also included three more distantiy related taxa (Apaloderma, Trogon, Trogonidae; Treron, Columbidae), it should be considered less informative with regard to resolving relationships within the cuckoos themselves. Otner workers have cnticized Sibley and Ahlquist for producing phenognms and classifications not consistent with the experimental results upon which they purportedly were based (e.g.. Houde 1992. Lanyon 1992, Mayr and Bock 1994). This assertion rnay also hold tme for Sibley and Ahlquist's placement of Coccyzus. Despite Sibley's condemnation of systematists that perpetuate well accepted classifications albeit evidence to the contrary (Sibley and Ahlquist L973: 3; 1990: 370, 377). he has continued this tradition by assigning Coccyzus to the Coccyzidae in spite of his own findings.

The results of a limited molecular analysis of cuculiform relationships (seven species from six cuckoo genera; Avise et al. 1994) using cytochrome b sequences are inconclusive with regard to the taxonomic position of Coccyots. This genus clusters with

the Phaenicophaeinae sensu Peters (1940; Chestnut-breasted Cuckoo Rhamphococcyx [<

Phaenicophaeus] curvirostris and Piaya cayana) in phenetic analyses, but is paraphyletic with the Cuculinae (Pallid Cuckoo Cucrtlr

of transversion data and when data are coded for amino acid substitutions. Furthemore, the latter analysis supports the highly unlikely polyphyly of Coccyzus. Methodologies used by

Avise et al. ( 1994) have been criticized (Hackett et ai. 1995), and Avise and Nelson ( 1995) have admitted to errors in one of their sequences. My cytochrome b sequences of Yellow- billed (Coccyus arnericanus) and Black-billed (C. erythroptlzalmus) cuckoos (Appendix

3.4) do not corroborate those published in Avise et al. ( 1994). Therefore, any modification or avocation of traditional cuculid taxonomy implied by Sibley and Ahlquist (1990) and Avise et al. ( 1994) should be disregarded until a more comprehensive rnolecular andysis of the group is undertaken. The present analysis of cuckoo osteology strongly supports the inclusion of

Coccy:us in the Cuculinae. For this genus to be moved to the base of the Saurotherini clade. as suggested by the classification of Peters (1940), would require an additional 29 steps. and would precipitate a reduction in the CI of the optimd tree from 0.778 to 0.696. In addition, Coccyzris differs from the Saurotherini by approximately 32% of the chmcters

(33 of 103 characters; mean CI = 0.822) that are used to resolve taxon relationships within the Cuculidae (135 total characters - 32 cuculid synapomorphies). That Coccyzus is a New World genus among an Old World subfamily is inconsequentiai, because extant migratory members of this genus (C. amerkanus and C. erythropthalrnus) are often sighted as vagrants in Britain and continental Europe (American Ornithologists' Union 1983, Peteaon et al. 1983). Therefore, it is plausible that an ancestor could colonize North Arnerica from European stock. Seibel (1988) was unable to resolve the position of Coccyzris within the Cuculinae. His preferred tree placed this genus in a tricotomy with Clamator and the "higher parasites" (rny term). Seibel's (1988) difficulties stemmed from his failure to consider seriously a number of "puzzlingly intemediate" (p. 82) conditions shed by Coccyzus, Clumaror, and

0.rylophris (< Clamator by Seibel). An apparent bias towards binary characters resulted in his lumping of these intermediate conditions into either the primitive or single derived state.

1 was able to resolve fully the position of Coccyzus in a well supported clade (Coccygini; six unambiguous synapomorphies) with Clamator and Oxylophus by assigning the intermediate condition a discrete character state and, thereby, extending the problematic binary characters into multistate characters. The Coccygini clade of this snidy is supported by the work of Verheyen (1956a) whose cuculid classification included the farnily

Coccystidae (= Coccystini) which contained Clamator (> Oxylophus), Coccyzics, and Pnchycoccy'r. However. 1 find that Pachycoccyx is paraphyletic to the Coccygini. The position of Coccyzris in the Cuculinae suggests that the ancestor of this genus was an obligate brood parasite. This implies that the facultative behavior exhibited by extant Coccyzzts species represents the loss of obligate parasitism. rather than the de novo development of parasitism from a nonparasitic ancestor. Traditional views suggest that

Coccyz~isrepresents an intemediate in a lineage that is becoming parasitic and that cuckoos possess some inherent predispositions to parasitism that are fueling its repeated evolution in the Cuculidae (Miller 1946, Berger 1960. Hamilton and Orians 1965). Although the reversal of parasitism in Coccyz~ismay seem somewhat unlikely, it is. ostensibly. the retum to an ancestral state, and requires no ad hoc hypothesis of "preadaptation" towards brood parasitism in the farnily as a whole. Many workers have noted the propensity of the Yellow-billed and Bfack-billed cuckoos for laying their eggs in other birds* nests (e.g.. Darwin 1859. Bent 1940. Nolan and

Thompson 1975. Fleischer et al. 1985). Fleischer et al. ( 1985: 125) commented that both intraspecific and interspecific parasitisrn were "regular aspects of Coccyzus breeding biology." Although these cuckoos most frequently use each other as hosts where their ranges overlap, their eggs have also been found in the nests of 15 species of North American birds (Herrick 1910, Bent 1940. Hughes L997b. see also chapter 2. this dissertation). At least seven host species have successfully hatched or fledged cuckoo young (Darwin 1859. McIlwraith 1894. Macon and Macon 1909. Nickel1 1954a. Nolan and Thompson 1975, Wolfe 1994). Unfortunately, the overall success rate of pansitized nests is unknown since few affected host nests have been monitored subsequendy to determine their outcorne. In most cases. researchers have tampered with the cuckoo eggs or collected the entire clutch because of its value as an oddity.

Unlike nonparasitic cuckoos, Coccyz~isshares a number of life-history traits with the Cuculinae that would seem adaptive to a parasitic life style. These include: (1) the disassociation of egg-laying from the "normal" sequence of courtship. nest construction, egg-laying. incubation. and care of young (Kendeigh 1952. after Herrick 1910); (2) a short incubation period that would allow a parasitic chick to hatch before the host chick (Hamilton and Orians 1965, Payne 1977): (3) a short nestling period reducing the time that a parasite is dependent upon its foster parents; (4) nestlings with an omnivorous diet that would be compatible with a large number of potential host species (Hamilton and Orians 1965); (5)a delayed breeding season that adds stability to the parasite-host relationship by allowing the host to successfully raise a first brood unaffected by parasitism (May and Robinson 1985); and (6) a constant readiness to breed, within season, in response to exogenous stimuli, such as resource availability (Hamilton and Hamilton 1965, Ralph 1975). In addition. the Yellow-billed and Black-billed cuckoos rnay lay mimetic eggs when parasitizing interspecifically (Hughes 1997b, see also Chapter 2. this dissertation). Although some of these traits may have adaptive value in a nonparasitic bird that faces pressure or fluctuations in food availability. it is unlikely that their manifestation

in both Coccyz~isand the Cuculinae is entirely the result of convergence. Hughes ( 1996b) offers a more thorough discussion of the evolutionary implications of Coccyzus behavior. Facultative brood parasitism has also been recorded in the Dark-billed (Coccyzus rnelncoryphus; Sick 1993) and Dwarf (C. prmilis; Ralph 1975) cuckoos of South America. The remaining five Coccyzlrs species are poorly known and. as a result. facultative parasitism has not been documented. This statement reflects the general state of knowledge of this avian taxon. Many aspects of Coccyzus life history are virtually unknown, and to date. there has been no large scale examination of brood parasitism frequency in any species of Coccyzus. Future work may show that brood parasitism in this genus occurs with greater frequency and success than has been considered to date. Re-evolution of terrestrialiry. - Peters (1940)placed the obligate parasites Tapera and Dromococcy.t in the Neomorphinae based on their New World distribution and terrestrial habits. He also may have been influenced by Friedmann (1933) who suggested that the Stnped Cuckoo (Tapera naevia) developed brood parasitism independently in the

New World. More recently. Berger ( 1960) proposed that ancestral cuculine stock brought parasitism to the Americas from the Old World. In most classifications. Tapera and Dromococcyx have been set apart from the nonparasitic. terrestrial cuckoos based on their osteology (S hufeidt NO1. Verheyen 1956a, Seibel 1988). myology, syringeal morphology, and pterylosis (Beddard 1885, Shelley 189 1, Berger 1960), and behavior and ecology (Hughes 1996b). Some systematists have put Tapera and Dromococcyx within the

Cuculinae. w hile othen have placed these genera in their own subfamiiy (Diplopterinae:

Sciater and Salvin 1873, Shelley 1891; or Taperinae: Verheyen 1956a, Seibel 1988) occupying some interrnediate position between the parasitic Cuculinae and the terrestrial, nonparasitic cuckoos of the Centropodinae and Neomorphinae. Friedmann, himself, commented (in Iirt. to K. C. Parkes, 7 August 1969) that he "would not object to the Neomorphinae being split into two - the Neomorphinae with Neomorphus, Geococcyx. and rMorococcyx, and the Taperinae with Tapera and Dromococcyx" (K. C. Parkes. pers. c0rn.m.). Sibley and Ahlquist (1990) did not include either Tapera or Dromococcyx in their DNA-DNA hybridization analysis, but merely maintained the taxonornic arrangement of

Peters ( 1940) in their classification (Sibley and Monroe 1990). My study clearly supports the removal of Tapera and Dromococcyx from the Neomophinae sensu Peters (1940). Reconstructing Peters' Neomorphinae requires an additional 78 steps, and reduces the overall uee CI from 0.778 to 0.580, and RI from 0.932 to 0.828. The Tapenni differ from the Neomorphinae by 45 highly consistent characters (mean CI = 0.857). many of which are rnultistate characters that differ by more than one state. These results are consistent with both the inclusion of these taxa in the Cuculinae, or the erection of a separate subfarnily positioned as sister taxon to the Cuculinae to contain them. However. due to the number of osteological synapomorphies uniting the Tapenni and the other obligate parasites (nine synapomorphies, seven unambiguous), 1 see no reason to exclude Tapera and Dromococcyx from the Cuculinae.

Berger ( 1960) concluded that the physicd and behavioral sirnilarities of Tapera and Droniococcyx to the neomorphine cuckoos was the result of convergence. 1 have found only three characters. most probably associated with locomotion and foraging behavior, that are markedly sirnilar in the Taperini and Neomorphinae. Two convergent characters are found on the caudal end of the mandibular apparatus and are associated with the attachrnent sites of the M. depressor rnandibulae: (1) the U-shaped hiatus subtympanicus (character 40). and (2) the shape of the caudal surface of os articulare (character 50). The M. depressor mandibulae serves to raise and lower the mandible (George and Berger 1966). Lowe (1938) and Berger (1957) suggested that the relative development of this muscle was strongly indicative of foraging strategies and, therefore. could not be considered a valid taxonomic character in some species. In cuckoos, the specific structure of the M. depressor mandibulae and its affiliated skeletal elements may be associated with the mechanisms of ground foraging. The Neornorphinae and Tapenni are arnong the few cuckoos that use a characteristic "chase and capture" mode of foraging. While pursuing prey, the neck is usually outstretched and the head and tail held horizontally to the body (Slud 1964, Ridgely and Gwynne 1989, Sieving 1990, Hughes 1996a). The third convergent character (character 68) is found on the tanometatarsus. In neomorphine and taperine cuckoos, the tuberositas m. tibialis anticus is enlarged and positioned immediately distal to the mesial foramina vascularia proximalia. This corresponds to the relative insertion point of the tendon of this muscle and is an to terrestrial locomotion (Berger 1952).

If Tapera and Dromococcyx were truly cursorial - like Geococcyx. Neornorphus, and içlorococcyx, the neomorphine cuckoos to which they were linked by Peters (1940) - one rnight expect a greater similarity in skeletal elements. However, the Tapenni have been poorly studied, and as such, their proclivities for terrestrial behavior may be overestimated.

Although they spend some rime on the ground and are capable of mnning well, Tapera and Drornococcyx both perch. display, and vocalize at some height in the vegetation (Slud 1964, Hilty and Brown 1986. Stiles and Skutch 1989, Sieving 1990). Sternal keel depth is often used to predict flying abilities because the relative developrnent of the keel is directly

related to the development of the two major flight muscles, Mm. pectoralis and supracoracoideus, that have their origins on the keel (George and Berger 1966). The ratio of keel depth to sternum length, where a higher number characterizes a deeper sternum, indicates that Tapera (mean = 0.39, n = Il) and Drornococcyx (mean = 0.41, n = 3) both have significantly deeper keels than do other terrestrial cuckoos (Geococcyx. mean = 0.3 1, n = 6, p < 0.003; Neomorphus, mean = 0.30, n = 3, p < 0.002: Morococcyx, mean = 0.32, n = 4, p < 0.005: Coua, rnean = 0.32, n = 5, p c 0.025; Crntropus, mean = 0.31, n = 7, p <

0.0004 for Tapera, p < 0.00 1 for Drornococcyx; adult birds, sexes pooled; ANOVA). However. the keel depthktemum length ratio of the Taperini is similar to the sedentary. arboreal cuckoos of the New World Saurotherini (Sauruthera, mem = 0.37. n = 4; Piaya, mean = 0.4 1. n = 6: Hyetornis, mean = 0.39, n = 4) that fly moderately well. Migratory cuculine cuckoos, such as Cuculus, Chalcites, and Coccyzus, have keel depthktemum length ratios in excess of 0.48. Hence, ïaaprra and Dromococcyx may not be fully terrestrial. Slud (1964) observed Tapera flying with steady wing beats for a considenble distance at a height of about 15 meters. Wetmore (1968) noted markedly underdeveloped legs muscles in Drornococcy.r. These birds have been most frequently observed while foraging on the ground, and this behavior may represent their predominant terrestrial activity. Piiaenicoplzaeinae. - Peters (1940) had some difficulty in treating this anatomically diverse, subfarnily of arboreal, nonparasitic cuckoos. However, my analysis supports its logical partitioning into four tribes that include al1 taxa assigned to this subfamily by Shufeldt (1901), Verheyen (1956a), and Seibel (1988). Rhinortha and Cerr rhmochares are anatomically distinct (Berger 1960, Seibel 1988). Thus, their placement into separate, paraphyletic taxa - Rhinothini and Ceuthmocharini - is well justified. The remaining two tribes, the Old World Phaenicophini and the New World Saurotherini, are associations that have not been disputed historically. My classification supports an Old World origin for the Phaenicophaeinae with a single. subsequent colonization of the New World by the ancestral saurotherine cuckoo. Some taxonomists have suggested that the malkohas - eight genen of Old World phaenicophaeine cuckoos sensu Peters (1940), not including Ceuthrnochares - should be merged into the genus Pliaenicophnelrs (Delacour and Mayr 1945, Delacour 1946, 1947, Sibley and Monroe 1990). The group is represented in this study by Rhinortha, Rhopodytes, Rhnmphococcyx, Lepidogromrnus, and Dasylophus. My results indicate that the mdkohas are paraphyletic, with the divergent Rlzinort/za positioned outside the clade containing the other four genera. Also, within the Phaenicophini there are two subtribes that are separated by unambiguous state changes in eight characters. It is possible that at least a few members of this group (e.g., Rlzopodytes and Rl~amphococcyr)could be merged into a single genus, but I am reluctant to make this recornmendation without examining mu!tiple specimens from al1 genera in question. However, due to the general lack of malkoha skeletal material, in particular the two genera not included in my study Phaenicophaeus (1 cornpiete specimen) and Taccocua (none available; Wood and Schnell

1986, and various pers. comrn.), the question of appropriate allocation to genus may remain unanswered for some time. Centropodinae. - It is likely that Peters (1940) placed the 10-species genus Colra in a monotypic subfarnily, Couinae, because it is restricted to Madagascar. However, he recognized association of this taxon with Centropus and placed it next to the monotypic Centropodinae in his sequence. Many other systematists have suggested that Coua and Centropus are close relatives, based on similarities in osteology, pterylosis, behavior,

protein assay, and DNA, and as a resuit, these two genera have been placed together repeatedly in higher ranking taxa, often with other genera of terrestrial cuckoos, such as Carpococcyx and Geococcyx (Beddard 1885, 1898, Verheyen 1956a, Sibley and Ahlquist 1972, Seibel 1988, Sibley and Monroe 1990, Hughes 1996b). My analysis indicates that Coua and Centropus are sister taxa that together comprise the clade Centropodinae. Berger

( 1960) thought that the degree of anatomical divergence observable in these genera did not justify individual subfamily status. My examination of several Coua and Centrupu skeletons supports this view. Centropiis comprises 25 species of terrestrial cuckoos (coucals) that are distributed widely throughout Asia and Africa. The genus is thought to have onginated in Asia, and being of forest origin, individuals subsequently dispersed over land when a forest connection existed between the two continents (Invin 1985). Coua may represent a divergent lineage from ancestral African Cenrropus stock. Berlioz (1948) suggested that

Coua, like many other endemic Madagascar birds. was originally a forest dweller that has rnoved secondarily into more open, arid habitat types after its ancestor colonized the island from mainland Africa. Madagascar has been colonized by other African terrestrial birds that are incapable of long flights. For example, - (Nurnididae) are present on both sides of the Channel (Dorst 1972). Another centropodine cuckoo, the forest-dwelling Malagasy Coucal (Cenfropusrouiou), is also found on Madagascar and in the Seychelles (Langrand 1990. Sibley and Monroe 1990). Terrestrialin in a plesiomorphic position. - Carpococcyx is a poorly known genus of two species (C. renatildi and C. radieeus) which occurs in humid forest habitat in south- east Asia and Indochina. Shelley ( 189 1) placed this taon in the Neomorphinae due to its terrestrial habits and generalized morphological similarities to the New World roadmnners

(Geococcyx) and ground-cuckoos (Neornorphtrs). Coues ( 1897) argued that Carpococcyx could not be included logically in the Neomorphinae because of its Asian distribution. However, its position in the subfarnily was retained by Peters (1940). Verheyen (1956a) transferred Carpococcyx from the Neomorphinae to the Centropodidae, a family that also

included Coua and Centropus. Seibel's ( 1988) taxonornic position for Carpococcyx is less clear. Although he included this genus in the Geococcyginae (Neornorphinae sensu Peters,

excluding Tapera and Dromococcyx) by convention, Carpococcyx also could be interpreted as the sister taxon to the Neomorphinae that is paraphyletic to Couo and Centropus. More

recently, Sibley and Monroe (1990) transferred Carpococcyx to the Cuculinae based on the DNA-DNA hybridization evidence of Sibley and Ahlquist (1990). However Sibley and Ahlquist did not include Carpococcyx tissue in their biochemical analyses, therefore, there is absolutely no data to support the transfer of this genus to the Cuculinae. Despite these different opinions, Carpococcyx continues to included in the Neomorphinae sensu Peters

( 1940) in dl other currently accepted classifications. My analysis indicates that Carpococcyx is the most plesiomorphic cuculid genus, suggesting that the ancestral cuckoo was at least partially adapted for terrestrial locomotion. Because my analysis of non-appendicular characters produced the same topology, I can conclude that the basai position of terrestrial cuckoos is not a function of using the poorly- flying turacos and Hoatzin to polarize chancters. This placement of terrestrial cuckoos was corroborated by Verheyen (1956a. 1961) and Seibel (L988). and in part by Hughes (1996b). In addition. Shufeldt (1909: 356) comrnented that many typical cuculine characters were expressed more strongly in the terrestrial types and less so in the derived, arboreal Cuculinae. He proposed that the ancestral form was terrestrial, and suggested that

Geococcyx may be a "modem, highly specialized representative of the ancestral stock." Based on the structure of the metacarpus, Stegrnann (1978: 50-51) concluded that the "round-winged. forest-dwelling" cuculid form is plesiomorphic and shows greater affiniûes to the turacos, or the ancestor that they have in common. Van Tyne and Berger (1959) argued that terrestriality could not be plesiomorphic arnong cuckoos because the zygodactyl foot is considered an adaptation to perching and climbing, not cursorial locomotion. Many other zygodactyl groups, such as (Picidae). (Psittaciformes), and toucans (Ramphastidae), are predominantly arboreal. However, this statement disregards the role of phylogenetic constraint in explaining zygodactyly in cuckoos. Although the ordinal relationships of birds are poorly known, cuckoos have been commonly associated with some nonpasserine taxa with zygodactyl feet. such as turacos (Musophagidae; semi-zygodactyl), mousebirds

(Coliiformes), and parrots (Psittaciformes). Therefore. it is reasonable to assume that cuckoos did not evolve zygodactyly independently, but may have inherited it from an early ancestor. The putative sister taxa to the cuckoos, the turacos and the Hoatzin. exhibit an intermediate condition between tme arboreal and terrestrial locomotion. Although both are primarily arboreal and noted for their agility in moving through the branches. they have a slow and laborious flight (Stegmann 1978). Their locomotory habits have been compared to those of some terrestrial type cuckoos, such as the neomorphine Morococcyx and several species of Coua, that walk in a dove-like fashion dong branches (Berger 1960). Other cuckoos, such as the malkohas, Saurotherini. and Crotophaginae, also exhibit intermediate locomotory habits (Berger 1960). The only uuly arboreal cuckoos are arnong Cuculinae, suggesting that strong flying ability is definitely a derived chvncteristic in cuckoos. Cudoo origins. - The Old World origin of the Cuculidae has been accepted by many workers. Because, in part, of the presence of their putative sister group, the Musophagidae, in Africa, and also because there are more cuckoo species in Old World tropical and subtropical regions than in the New World (Berger 1960, Cracraft 1973). The Asian distribution of Carpococcyx is consistent with the subsequent divergence of early, forest dwelling centropodine cuckoos that eventually gave rise to Centropus and Coua. My phyiogeny implies that the New World was subsequently colonized by an ancestral terrestrial cuckoo derived from Old World stock, establishing a lineage that eventually gave rise to the neomorphine cuckoos Morococcyx, Geococqx, and Neomorphus. The cuckoos are an ancient family with a scanty fossil record dating from the Upper of (Dynnmopterus velox: Milne-Edwards 1892). In the New World, two early cuckoo are known from the Lower of Saskatchewan (Neococcyx mccorquodalei; Weigel 1963) and the Lower Miocene of Colorado (CursoRcoccyx gernldinae: Martin and Mengel 1984). This latter record was assigned to the

Neomorphinae, indicating that terrestrial cuckoos have been in central North Arnerica for at least 20 miilion years. The location of the Cursoricoccyx fossil corresponds to the extreme northem range limit of the most northerly neomorphine cuckoo, the Greater Roadrunner

(Geococcyx californianus; Andrews and Righter 1992). This implies that Cursoricoccyx may have had a more northerly distribution than its extant relatives. Other memben of the

Neornorphinae range from south to central South Amenca (Meyer de Schauensee 1982. Howell and Webb 1995). The existence of terrestrial cuckoos in the New World 20 million yean ago suggests that Old World terrestrial stock could have dispersed to North America by the Bering land bridge, which connected Asia and Nonh America pnor to the Miocene (McKenna 1983). Like many other birds, neomorphine cuckoos may have been broadly distributed at northern latitudes prior to the late Teniary climatic deterioration (Cracraft 1973), with the northem boundary of their range being continually pushed southward with the onset of cooler temperatures. The distribution of extant roadmnners is lirnited by persistent snow cover as it impairs their ability to forage effectively for reptiles and dunng the winter (Norris and Elder 1982). More recent events in the biogeographic history of the cuckoos are more difficult to

diagnose. Cracraft ( 1973) sugpested that the nearly global distribution of the cuckoos couid only be explained by several Northem and Southern Hernisphere dispersa1 events. This statement is supported by my phylogeny which requires at least five major intercontinental movements to explain the current distribution of the farnily. However, given the age of the Cuculidae and the propensiry of some of its members for long-distance flight, this many dispersai events does not seem unreasonable. Hoatzin. - Perhaps no species has proved to be a greater systematic enigma than the Hoatzin. Since first described as Phasianus hoazin by Müller (1776), this species has been allied with the Galliformes in 17, the turacos in 4, and the cuckoos in 8 classifications. In addition, it has been placed in the monotypic order, Opisthocomiformes. 12 times (see Sibley and Ahlquist 1973, 1990 for a review). Peters (1934) considered the Hoatzin an aberrant galliform and placed in the monotypic farnily. Opisthocornidae. in the Galliformes. Despite much evidence to the contrary, this position has persisted in many current taxonomic sequences.

Since Peters' (1940) work, several studies have supported the alliance of the Hoatzin with the cuculiforms, based on similarities in osteology (Verheyen 1956b, De Queiroz and Good 1988), myology (Stegmann 1978). and mitochondrial (Avise et al. 1994) and nuclear gene sequences (Hedges et al. 1995). In addition, the protein electrophoresis and DNA-DNA hybndization evidence of Sibley and Ahlquist ( 1972, 1973, 1990) placed the Hoatzin in the Cuculidae, rnost closely allied with the North Arnerican roadrunners

(Geococcy.~)and anis (Crotophaginae). This association of the Hoatzin with the anis was corroborated by Hughes (1996b) based on an analysis of behavioral and ecoiogical characters. However, this author cautioned that this affiliation could be the result of homoplasious adaptations to communal breeding in these two taxa. The position of the Hoatzin as sister taon to the Cuculidae in the present study verifies that this species is not a gallinaceous bird. On the other hand, it is noi a cuckoo. To include the Hoatzin in the Cuculidae, basal to the Neomorpliinae-Crotophaginae clade as suggested by Sibley and Ahlquist (1990: 845, Fig. 360) would require an additional 56 steps ICI = 0.673, RI = 0.62 1 ), after deleting taxa not included in both analyses. My study indicates that the Cuculidae is monophyletic without the Hoatzin (see the above discussion of cuckoo monophyly). Superficially, the Hoatzin more closely resembles the turacos. This was fint descnbed in detail by Pycraft (1903). In addition. Verheyen (l956b) listed 50 osteological characters that united the Hoatzin and the Musophagidae. Stegmann (1978) noted that both young turacos and use their wings and the claws of digits I (digitus alularis) and II (digitus major) for ciimbing arnong the branches of the nesting tree long before their flight feathers have fully developed. Both taxa share a characteristic retardation of growth of the outer primaries that facilitates this form of Iocomotion. He added that, although the wing and associated structures of the Hoatzin most resemble that of the cuckoos, if the taxonomic importance of these chancters and the peculiarity of their ontogenetic development is considered, the Hoatzin shouid be dlied with the Musophagidae. Interestingly. efements of both taxa combine in the Lower Eocene fossil panariim of Wyoming. This species has a skull and mandible most like the Hoatzin, but shows some similarities to the turacos in postcranid skeletal elements (Olson 1992). The author adds that the elongated hind limb elements, particularly the tarsornetatarsus, "suggest a more terrestrial mode of Iife than the modern species of Musophagidae or , perhaps not unlike some of the terrestrial Cuculidae (pg. 127)." This is not to suggest that Foro panarium represents the ancestor of the Hoatzin-cuculiform radiation. because there is another contemporary fossil more closely associated with the modem Hoatzin (Cracraft 197 1). Rather. it indicates the existence of a lineage of primitive. generalized. terrestrial nonpasserines that may have shared an ancestor with the proto- cuculi forms. These findings are consistent with my analysis that supports the paraphyly of the Hoatzin and the turacos. and with the suggestion that the cuckoos diverged from a terrestrial ancestor. Unfortunately, the taxonornic relationship between the NraCOS and the

Hoatzin has been obscured by a distant point of divergence and the subsequent adaptation to highly specialized life styles. Since the Hoatzin lacks most of the derived characters of the Cuculidae (this study) and the Musophagidae (Seibel 1988), and cannot be placed in any "higher level taon that is clearly defined by synapornorphies" (Olson 1985: 109). 1 suggest that it be assigned to the monotypic order, Opisthocorniformes. This treatment of the Hoatzin has been proposed previously by several systematists, including Sclater (IWO),

Sharpe ( 189 l), Beddard (1898), and Stresemann (1934, 1959), and has been used recently in a few omithological texts (e.g.. Gill 1995, Feduccia 1996). Cucuiiformes. - The relationship between cuckoos and turacos was first recognized by Linneaus (1758). but it was not until Fürbringer (1888) combined them in a suborder Coccygiformes that the association became widely accepted. These taxa were given subordinal status (Cuculi and Musophagi) and Coccygiformes was raised to ordinal rank by Shufeldt (1904). Peters (1940) continued this tradition by combining the two taxa, as the families Cuculidae and Musophagidae, in the order Cuculiformes. This arrangement is currently the most widely accepted classification of the Cuculiformes. Many systematists have noted subsequently the significant anatomical and bioc hemical differences bet ween these two avian families. Lowe ( 1943, after Bannerman 1933) and Berger (1960), concluded that based on their osteology and myology, the Cuculidae and Musophagidae could in no way be regarded as belonging to the sarne order. Lowe also noted that the tracts, which are generally consistent and characteristic within orders, including the Passeriformes, are not the same in cuckoos and turacos. Van Tuinen and Valentine (1986) suggested that differences in chromosome banding patterns set turacos apart from al1 other avian orders. Based on DNA-DNA hybridization evidence,

Sibley and Ahlquist ( 1990) placed the cuckoos (Cuculiformes) and turacos (Musophagiformes) in separate, non-sister orders in the large Parvclass Passerae with several other nonpasserine orders and the Passeriformes. In contrast, Stegmann (1978) noted that although the cuckoos and turacos are very different in the structure of the carpometacarpus, strong similarities in wing myology sugpst that they have descended from the same ancestor. but have evolved independently over a long time period. He concluded that they should be placed in the same order to recognize their "mutual relationships (p. 5 l)." Seibel (1988) tentatively upheld the inclusion of the Musophagidae in the Cuculiformes based on three synapomorphies of the os carpi ulnare. There is little osteological evidence to convince me that the cuckoos, Hoatzin. and turacos fom a monophyletic group. My study corroborates Seibel (1988) in uncovenng only three apparent synapomorphies of the os carpi ulnare (characten 121, 122, and 123, this study) uniting these three otherwise anatornically diverse taxa. While monophyly may be possible, it is likely that two or more of these taxa are paraphyletic, with the extant members being highly divergent representatives of the ancient and generalized ancestors from which they arose. By convention, they cannot be classified together in the Cuculifomes. Until further evidence of their monophyly is revealed in a higher-level systematic study, 1 recommend the placement of the turacos, the Hoatzin, and the cuckoos in separate, but adjacent orden: Musophagiformes, Opisthocomiformes, and Cuculiformes. APPENDIX 1.1. Suggested diagnostic osteological characters of the Cuculidae from Beddard ( 1885, 1898), Shelley ( 189 1), Gadow ( 1WZ), Pycraft (1903). Witherby

(1938), Sibley (1955), Van Tyne and Berger (1959), Berger (l960), Sibley and Ahlquist

(1972. 1990), Stegmann (1978), Gilbert et al. (198 l), and Seibel (1988). This list is not exhaustive, but includes most of the charactes that have been used previously to define the Cuculidae. However, many of the characters listed below may represent questionably homologous conditions that are not synapomorphic at the family level and, thus, cmot be used to support monophyly.

( 1) Os Iacrirnale cuculine; (2) Os uncinatum absent; (3) Holorhinal; (4) Nues more or less impervious; (5) Tomia smooth; (6) Processes basipterygoideus absent or rudimentary; (7) Desrnognathous pdate; (8) Vomer small; (9) Margo medialis of os palantinum meeting in plana medianus below, and concealing, rostrum sphenoidale; ( 10) Incisura intercondylaris of tibiotarsus a rounded pit extending caudally at least half of the length of the extrerniras distalis; (1 1) Two bony canales hypotarsi, subequal in size, with proximal openings side by side in planum medianurn; ( 12) Tuberositas m. tibialis anticus positioned imrnediately distal to foramina vascularia proximalia: (13) Mesiai "wing" on trochlea metatarsi secondii not larger than lateral "wing"; (14) Presence of protuberance on

facies lateralis of trochlea metatarsi tertii; ( 15) Trochlea metatarsi quartii of tarsometatarsus with rnesially inflected caudal trochlea accessoria, and with margo distalis proximal to incisura intertrochlearis medialis; (16) Margo medialis of ala preacetabularis ilii not meeting above crista iliaca dorsalis in planum medianus; (17) Margo cranialis of apex carinae not continued cranially as far as free end of spina extema; (18) Sternum usuaily with two notches on each side, one sometimes lost or closed to fonn fenestra; (19) Four ribs reaching sternum; (20) Coracoideum not fused or ankylosed; (2 1) Processus procoracoideus not fused with processus acrocoracoideus; (22) Facies articularis stemalis ventralis of coracoideum centered. rounded, and facing sternally; APPENDM 1.1. Suggested diagnostic characten continued.

- - - - (23) Facies articularis sternalis ventralis of coracoideurn large, facies articularis sternalis dorsalis small to large; (24) Clavicula without distinct facies articularis acrocoracoideus; (25) Clavicula with distinct "procoracoidal facet" sensu Seibel; (26) Apophysis furculae present; (27) Os metacarpale minus almost as broad in planum transversus as os metacarpale rnajus; (28) Atlas perforated; (29) 13 to 14 vertebrae cervicales; (30) Four vertebrae thoracica; (31) 17 to 18 vertebrae; (32) Margo lateralis of vertebrae thoracica not produced into spikes. APPENDIX 1.2. Skeletal specimens exdned for the determination of cuckoo rnonophyly. -411 specimens from the Royai Ontario Museum.

PARVCLASS GALLOANSERAE GALLIFORMES.Megapodiidae: Alectura lathami 9 1372. Cracidae: Ortalis vetula 109233. Phasianidae: Tragopan temminckii 1563 1 1. Tetraonidae: Lagopus lagopus 146236.

ANSENFORMES. : Anas plaryrhynchos 9 1898; Branta canadensis 140 143.

NFRACLASS NEOAVES ,Diomedeidae: Diomedea chryostorna 102 179. : Fdmarus giacialis 142339. Pelecruioididae: Pelecnnoides urinatrix 145036. SPHEMSCIFORMES,Spheniscidae: Sphenicus humboldti 95 163; S. demersus 123572,

1573 19.

GAVIFORMES,Gaviidae: Gavia stellata 93475; G. immer 128636. PODICIPEDFORMES,Podicipedidae: Tachybnptus dominicus 104352; major

129606, 148780.

PELECANIFORMES,Phalacrocoracidae: Phalacrocorczx artritus 67 107. Sulidae: Su la

lericogaster 1 1 8342. Pelecanidae: Pelecanus erythrorliynchos 157450. CICONIIFORMES,Ardeidae: Ardea herodias 9 1778. Threskiornithidae: Eudocimus albus 93065. Ciconiidae: Ciconia ciconia 157594. PHOENICOPTEEUFORMES,Phoenicopteridae: Phoenicoptents ruber 92473, 157862. ,Cathartidae: Cathartes aura 76068. Pandionidae: Pandion haliaetus

156 148. Accipitridae: Accipiter gentilis 155866. Falconidae: Fa lco spanerius 109139.

GRUIFORMES,Gruidae: Gnrs canadensis 128 168. Psophiidae: Psophia crepitans 7 1368. Rallidae: Ralh elegans 9 1373. APPENDK 1.2. Skeletal specimens continued.

CHARADRIIFORMES.Charadriidae: Charadrius semipnlmatus 108624. Lariidae: Larus glaucescens 1380 18. Alcidae: Alle aile 145 149. Haematopodidae: Haernatopus ostrnlegus 1 18068.

COLUMBIFORMES,Columbidae: Zenaida rnacroura 125737; Columba livia 96930. i 10066. PTEROCLIDKFORMES,Pteroclididae: Pterocles bicinctus 1 14389.

PS CH TA CE OR MES, Psittacidae: Psiitaccis erithacus 1 1 194 1 ;Amazona ochrocephala 1064 18: A. amazonica 145329. MUSOPHAGIFORMES:see Appendix 1.3. OPISTHOCOMIFORMES: see Appendix 1 -3. CUCULIFORMES: see Appendix 1.3. STRIGIFORMES.Strigidae: Strix varia 9 lW3;Bubo virginian~ls138 1 14. Tytonidae: Tyto alba 1283 19. .Caprimulgidae: Cltordeiles minor 1 24276; Caprimrilgus vociferus 156 134. Podargidae: Podarg~tsstrigoides 157323.

APODIFORMES.Apodidae: Chaetura pelagica 1 1 1 147; Streptoprocne semicollaris 1 13378. Trochilidae: E~igenesfulgens 1 133 15. COLIIFORMES,Coliidae: Colius striatus 1 14607, 155750; Urocolius indicus 155754. TROGONIFORMES.Trogonidae: Trogon citreolus 1 13348; T. vidacents 1 157 16; Apalodenna narina 156980. CORACIIFORMES.Alcedinidae: Dacelo gigas 156745. Meropidae: Merops ornatus 156265; M. orientalis 125259. Coraciidae: Coracios benghalensis 125250; C. garrulus 120743. Bucerotidae: Tockus erythrorhynchus 1 145 10.

PICIFORMES,Bucconidae: Monasn ntra 12578 1. Capitonidae: Capito 1 14849.

Rharnphastidae: Pteroglossc~storqrmtus 1 15772. Picidae: Dryocopus pileatus L 548 1 1. APPENDIX 1.2. Skeletal specimens continued.

PASSERIFORMES,Eurylaimidae: Smitliornis capensis 1 142 1 1. Dendrocolaptidae: Dendrocincfa nnabatina L 12849. Tyrannidae: Contopus virens 1 14 199. Mimidae: Mimus pofyglottos 129892. Emberizidae: Pipi10 erythrophthalmus 106787;

Zonotrichia albicollis 1 10050. APPENDIX 1.3. Skeletal specimens used for phylogenetic reconstruction of the

Cuculidae are from the collections of the following museums: Amencan Museum of Natural History (AMNH), Bell Museum of Naturai History (BMNH), Carnegie Museum of Natural History (CM), Field Museum of Natural History (FMNH), Florida Museum of Natural History (Un, Louisiana State University Museum of Museum of Zoology (LSU),

Royal Ontario Museum (ROM),United States National Museum of NaturaI History (USNM), University of California Museum of Vertebrate Zoology, Berkeley (CMVZ), and University of Michigan Museum of Zoology (UMMZ).

------GALLIFORMES,Phasianidae: Phasianus colchicris ROM 99375, 100505; Tyrnpnnuchus pallidicinctus ROM 145720, 145875; Tragopan temminckii ROM 1563 1; T. caboti ROM 156308. Cmcidae: Ortalis vetula ROM 109233; 0.poliocephala ROM 115670; Crn.rubra ROM 1 1320 1, C. alector ROM 94657. Megapodiidae: Alectura lathami ROM 9 1372, 150923, 158266. OPISTHOCOMIFORMES,Opisthocornidae: Opisthocomus hoazin FMNH 105556, 105557, LSU 62740,6274 1, ROM 12 119 1, CMVZ 165 108, UMM2 46 193. MUSOPHAGIFORMES,Musophagidae: Crinifer piscator UF 387 L 8; Corythaixoides concoior ROM 12080 1, 156909, 156923, 156924; Corythaeola cristata UF 38728; Musuphaga violacea ROM 157857; M. rossae CM 1 10 14; Tauraco porphyreolopha ROM 12 1 127; T. leucotis UF 38724; T. erythrolophus ROM 126587, 144367; T. hartlaubi CM 9932; T. schalotvi ROM 156833. CUC~~IFORMES,Cuculidae: Clamator glandarius USMN 489460,552920, CMVZ 1587 10, UMM2 2 129 14; C. coromandus USMN 343240; Oxylophus jacobinus ROM 125557, CMVZ 1587 18; 0.levaillantii FMNH 3 19965, ROM 1 145 15: Pachycoccyx audeberti UMM2 209200; Cuculus clamosus CMVZ 158720, UMM2 2 12918, 217502; C. solitariris ROM 97556; C. canorus ROM 105283, 121069, 128324; APPENDIX 1.3. Skeletal specimens continued.

Cuculidae. continued: Cunilus gufaris UMMZ 2 1750 1: C. pullidus ROM 124533. 15% 18;

C. saturatus UMMZ 207450; Cacornantis merulinus UMM2 207451, 210982; C.

vnriolosus UMMZ 22802 1; C. pyrrhophanus AMNH 9426, ROM 659 1 1, 156756,

UMM2 2 14228; Penthoceryx sonneratii UMM2 223664: Sumiculus lugubris USNM

488329, UMM2 23306 1 ; Misoculius oscrtfans CMVZ 156701, UMMZ 2 14229,

2 14230; Chalcires lucidus ROM 11 aO9, 157420. UMM2 23 160 1; C. basalis CMVZ 143438, UMMZ 2 14232; Cltr~sococcyxcaprius ROM 12 1222, UMM2 2 12919,

219889; C. cupreus UMMZ 218545; C. klaas ROM 121125, UMM2 158083; Eridparnys scolopacea FMNH 104588, ROM 96834, USNM 292054, 292055,

UMM2 2 10347; Urodynamis faitensis CM 8446; Coccyars erytlzropthalmus ROM

91632, 127355. 137975, 154485, 154487, 154587, 158290; C. americanus LSU

159628; ROM 149492? 158249, CMVZ 115629, UMM2 73876, 73877, 221478; C.

minor BMNH 36623, ROM 109441, 111106, 121431, 121475, 121524, 121525, UMM2 152623.208492,228344; C. melncoryphus CM 2332, ROM 158342, USMN

227775, CMVZ 94086, 130117; C. piirnilis FMNH 297439: C. lansbergi LSU

1 143 14: Piaya cayana ROM 97362. 104346, 1 15608, 118303, 125762. 126623,

UMM2 153092: P. melanogasrer UF 76229. USMN 559339: Hyetomis pluvialus

USMN 559 182, 559 183. CMVZ 149905; H. rufigrdaris USMN 554608: Coccycrm

minuta LSU 101256, USMN 345882, USMN 433599, UMM2 139991, 139992;

Saurorhera merfini UF 26236, ROM 11 1123, UMM2 158527; S. vetula USMN

3 18889, 555762; Ceuthmochares nereus ROM 105290, USMN 29240 1, 34741 1,

UMM2 158 185; Rhopodytes tristis ROM 1 10498, USMN 19484, 344368; Rhamphococcyx cnlyorhynchrts USMN 226 190; R. curvirostris FMNH 1064 15.

USMN 559826; Dnsylophus superciliosus AMNH 17737, UMMZ 228022,228068; APPENDIX 1.3. Skeletal specimens continued.

- . ------Cuculidae, continued: Lepidogrammus cwningi AMNH 17738, 17739, UMMZ 233062, 233063; Rhinortha chforophaeus FMNH 106422; Crotophaga major FMNH 105527, 298009, CMVZ 94089; C. uni ROM 1094 19, 12 1520, UMM2 2222 18; C. sulcirostris ROM 97357, 115726, L 18382; Guira guira AMNH 5300. USMN 345885, 614643, UMM2 200661; Tapera naevia BMNH 36609, LSU 34867, USNM 346329, CMVZ 85635. 94088, UMM2 135 167, 209208, 2 14005, 2 18370, 218946, 2222 17; Morococcyx erytlzropygus ROM 1 15724, 115725, 1 18352, 1 18392, CMVZ 153902,

UMM2 159 1 1 1 ; Dromococcyx phasianellus ROM 1 15864, CMVZ 85638; D. pnvoninus LSU 101257, UMM2 209206. 209207; Grococcyx californianris CM 9378. 9430, 14051, LSU 126393, 157233, ROM 94674, 99424, 128876, USMN

61096 1, 61437 1, CMVZ 53617, 15 1854, 153904; G. velox BMNH 14324, CMVZ

856646, UMM2 15646 1, 159 1 12; Neomorphus geoffroyi LSU 106946, UMM2

200592; N. pucheranii LSU 1 1463 1; Carpococcyx renauldi ROM 102 151, 1 12529,

UMM2 2 19043, 2 1985 1, 22388 1; C. radicetis USNM 223970; Coua reynaudii UMMZ 208403; C. crisrata FMNH 356642, USNM 432197, UMM2 157526; C. caerltlea FMNH 345642, ROM 208404, UMM2 208404, 209201; C. serriana

UMMZ 209202: Centrupus goliath USMN 557 15 1, 557 16 1 ; C. phasianinris ROM 1548 15, CMVZ 142202; C. viridis UMMZ 228027; C. senegaiensis UMM2 207709; C. menbecki AMNH 7408; C. toiifou FMNH 345648; C. monachus UF 263 10; C. sicpercilionu LJF 35290, LSU 28019; C. rufceps UMM2 209203. COLIIFORMES,Coliidae: Cofius striatus ROM 99205, 1 14607, 155750; Urocolius indicus ROM 155754.

TROGONFORMES,Trogonidae: Trogon viridis ROM 11484 1; T. cirreofus ROM 1 13348; T. violaceus ROM 1 157 16; Apalodemn narina ROM 156980. APPENDR 1.3. Skeletal specimens continued

------CORACIIFORMES.Meropidae: Merops orientalis ROM 125258; M. ornatus ROM 125259;

M. apiaster ROM 99933. Coraciidae: Coracias brnghalensis ROM 125250; C.

gnrridus ROM L20743; C. spatulata ROM 114546. Bucerotidae: Tockus

erythrorhynchus ROM 1 145 10; T. flavirostris ROM 120857; Ceratogyrnna brevis ROM 114295.

PICIFORMES,Bucconidae: Monnsa atra ROM 12578 1 ; M. flavirostris ROM 105939; Bucco

capensis ROM 1 12539; Mnlczcoptiln fusca ROM 1 15 1 3 1. APPENDIX 1.4. Skeletal character descriptions. Zero (O) = ancestral condition unless otherwise noted. Multistate chxacters are unordered unless rnarked as ordered. CI = consistency index. Abbreviations: m., musculus; n.. nervus, nervi; proc., processus, processes; sync., synchondrosis, synchondroses.

CMAL CHARACERS

1. Cranium, size of fossa temporalis: (0) small to moderate: ( 1) large. meeting, or nearly meeting sagitally. CI = 0.50.

2. Cranium. fissura cranio-facidis: (0) well defined; ( 1) rnoderately to poorly defined. CI = 0.50. 3. Os frontale, size of proc. orbitalis (ordered): (0) large: (1) small to moderate; (2) vestigial. CI = 1.00. 4. Os frontale. shape of margo supnorbitalis (ordered): (0) not flared; (1) slightly flared; (2) suongly flared. CI = 0.50. 5. Os squamosum, size of proc. postorbitalis: (0) large: (1) moderate; (2) small. CI = 0.50.

6. Os squarnosum, size of proc. suprameaticus relative to proc. postorbitalis: (0) small; (1) large. CI = 1.00. 7. 0s squamosum, shape of proc. suprameaticus: (0) triangulûr, flattened in planum

rnedianum: ( 1) bulbous in dorsal aspect. CI = 1.00.

8. Os squamosum. length of proc. suprameaticus: (0) short; does not obscure head of proc.

oticus quadrati; ( 1) long: obscures head of proc. oticus quadrati. CI = 1.00. 9. Os lacrimale. extent of articulation with os frontale: (0) large; (1) srnall to moderate. CI

= 1 .oo. 10. Os lacrimale. width of distd end of proc. orbitalis: (0) wide to moderate: (1) narrow. CI

= 0.50. APPENDLY 1.4. Character descriptions continued.

-- --- Il. Os lacrimale, shape of proc. supraorbitalis: (O) ovoid, triangular, or rod-shaped; (1) semi-lunar, rnargo doaalis well caudal of fissura crmio-dorsdis and sutured to lateral

extensions of os frontale. CI = 1.00.

12. Os lacrimale, shape of proc. supraorbitdis: (0) not as in state 1; (1) triangular. directed laterally, margo donalis horizontal, not curved. CI = 1.00.

13. Os lacrimale, shape of proc. supraorbitalis: (0) not as in state 1; (1) triangular, directed caudo-laterally, dorsal margin curved, not horizontal. CI = 1.00.

14. Os lacrimale. shape of proc. supraorbitalis: (0) ovoid. triangular, or semi-lunar; (1) rod- shaped, wide in axis rostrocaudalis, positioned in V-shaped notch formed by os frontale and os nasale. CI = 1.00.

15. Os ectethmoidale. as in monophyly character 3 (see Results of above monophyly

analysis): (0)no: (1) yes. CI = 1.00.

16. Os ectethmoidale, generalized fom: (0) triangular, margo ventdis horizontal; ( 1) not

as in state O. CI = 1.00.

17. Os ectethrnoidale. rnargo lateralis: (0)straight or concave; (1) convex. CI = 0.50.

18. Os ectethmoidale, margo lateralis: (0) not as in state 1; (1) prominant, bulbous

protmsion directed ventrally. CI = 1.00.

19. Os ectethmoidale, margo latenlis: (0) not as in state 1: (1) straight distally. strongly excised proximally. CI = 1.00. 20. Os jugale, point of articulation of distal end: (0) juncture of os premaxilla and os nasale;

( 1) donal to juncture. CI = 1 .O.

2 1. Os quadratum, as in monophyly character 1: (O) no; ( 1) yes. CI = 1.O.

22. 0s quadratum. shape of proc. orbitalis: (0) blunt; (1) strongly pointed. CI = 1.00. APPENDIX 1-4. Character descriptions continued.

------. - 23. Os quadratum. shape of proc. orbitalis: (0)not as in state 1; (1) narrow dom-ventrally,

elongate. CI = 1.W. 24. Os quadratum, angle of proc. oticus and proc. orbitalis in lateral aspect (ordered): (0)

large; ( 1) moderate; (2) srnail. CI = 0.67. 25. Os quadratum. mesial inflection of proc. orbitaiis (ordered): (O) none or little; (1) moderate; (2) strong. CI = 0.67. 26. Os quadratum, proc. mandibularis, relative sizes of condylus caudaiis and condylus pterygoidus: (0) condylus medialis slightly larger than condylus pterygoidus; (1)

condylus medialis much larger than condylus pterygoidus. CI = 1.00. 27. Os quadratum. inflection of distal end of condylus caudaiis in lateral aspect: (0) not as

in state 1; ( 1 ) pointed donally. CI = 1.00. 28. Os quadraturn, inflection of distal end of condylus medialis in lateral aspect: (0) not as

in state 1; ( 1) pointed strongly ventrally. CI = 1.00. 29. Os quadratum, expansion of distal end of cotyla quadrojugalis (ordered): (O) more than

two times wider than neck of proc. quadratojugalis; (1) approximately two times wider; (2) less than two times wider. CI= 1.00. 30. Cavitas tympanica, position of candis nervus facidis: (0) at same level caudo-rostrally

as meatus acousticus externas; (1) caudal to meatus acousticus extemas. CI = 1.0. 3 1. Cavitas tympanica. shape of otic region defined by ala tympanica and proc. oticus quadrati in lateral aspect: (0) short ovai: (1) long oval. CI = 1.00.

32. Cavitas tympanica, otic region as above, angle of longest chord: (0) 15 to 45'; (1)

approximately 90'; (2) 45"to 90°. CI= 0.50. 33. Os basioccipitale. form of crista basilaris transversa: (0) poorly defined; (1) well defined. CI = 0.50. APPENDIX 1.1. Chancter descriptions continued.

34. Os basioccipitale, form of crista basilais transvena: (0) sepanted at midpoint rostral to condylus occipitalis; (1) entire. CI = 0.67. 35. Os basioccipitale, position of crista basilaris transversa: (0) caudal or at same level caudo-rostrally as ostium canalis carotici; (1) rostral to ostium candis carotici. CI = 0.67.

36. Os basisphenoidale, bar-like process between ostium canalis carotici and lamina

basiparasphenoidalis: (0) absent; ( 1) present. CI = 1.O. 37. Os exoccipitale, shape (ordered); (O) Bat or only slightly raised; (1) produced into bulbous expansion raised above contour of os occipitale; (2) as in state 1, but greatly

expanded. CI = 1.W. 38. Os exoccipitale, position of foramen n. vagi relative to ostiurn canalis opthalmic externi: (0) caudal or at same level in axis rostrocaudalis as ostium canalis opthalmic

extemi; ( 1) rostral to ostium canalis opthdmic extemi. CI = 1.00.

39. Os exoccipitale, size of hiatus subtympanicus: (0) large; (1) small. CI = 0.50.

40. Os exoccipitale, shape of hiatus subtympanicus: (0) V-shaped; ( 1) widened U-shape. CI = 0.50.

4 1. Os parasphenoidale, rostrum parasphenoidale: (0) exposed; ( 1) obscured. CI = 1.00. 42. Os parasphenoidale, proc. basipterygoideus: (0) present: (1) absent. CI = 1.00.

43. Os pterygoideum. as in monophyly character 2: (0) no: ( 1) yes. CI= 1.00.

44. Os pterygoideum, facies ventralis of rostral end: (0) flanged; (1) not flanged. CI= 1.00. 45. Os pterygoideum, shape of facies articularis sphenoidalis in ventral aspect: (0) not as in

state 1; ( 1) flared with rostrally projecting spurs. CI = 1.00. 46. Os palatinum, as in monophyly chancter 4: (0) no; (1) yes. CI =1.00.

47. Os maxillare. as in monophyly character 5: (0) no; ( 1) yes. CI = 1.00. APPENDIX 1.4. Character descriptions continued.

- - -- - 48. Os maxillare, caudal extremes of proc. palatinus in ventral aspect: (0) enclosed within medial margins of os palatine, visible; (1) displaced laterally, obscured by os palatine.

CI = 1.00. 49. Os articulare. shape of cotylae lateralis in dorsal aspect: (0) not as in state 1; (1) pointed with appearance of two cotylae. upper rounded, lower pointed and deflected latero- caudally. CI = 0.50. 50. Os articulare, shape of caudal surface: (0) semi-circular: (1) U-shaped. CI = 0.50.

5 1. Os articulare, size of caudal surface in plana dorsalis (ordered): (0) deep; (1) moderate; (2) shallow. CI = 0.50. 52. Os articulare, tuberculum pseudotemporale: (0) small or vestigial; (1) prominant. CI = 0.50. 53. 0s articulare, crista intercotylaris, as in monophyly character 6: (0) no; (1) yes. CI =

1.m. 54. Apparatus hyobranchialis. shape of basihyal bone in dorsal aspect: (0) compressed in

plana dorsalia; ( 1) compressed in planum medianum. CI = 1.00. 55. Apparatus hyobranchialis. shape of os basibranchiale rostrale in lateral aspect: (0) margo ventralis straight; (1) prorninant protmsion near midpoint of margo ventralis. CI = 1 .m. 56. Apparatus hyobranchialis, relative width of distal and proximal end of os basibranchiale

in lateral aspect: (0) similar; (1) distal end wider than proximal. CI = 1.00. APPENDIX 1.4. Character descriptions continued.

POSTCMAL CHARACTERS

Numbers of characters based on Seibel (1988) are given in parentheses. Revised characters are based partially on those of Seibel (1988) but have been recoded, split into several characters, extended to include more character States, or otherw ise modified from the original character description.

57. Tibiotarsus, form of incisura intercondylaris, as in monophyly character 8: (0) no; (1) yes. CI = 1.00.

58. Tarsometatarsus, position of cades hypotarsi, ss in monophyly character 8: (0) no; (1) yes. CI = 1.00. 59. Tarsometatarsus, number of canales hypotarsi: (0) one; (1) two (Seibel L988: character TM 13, revised). CI = 1.00. 60. Tarsometatarsus, relative size of canales hypotarsi: (0) equal, or almost equal in size;

( 1) canales medialis much larger than canales lateraiis (Seibel 1988: TM 13, revised). CI = 1.oo.

6 1. Tarsometatarsus, size of cristae hypotarsi: (0) moderate to large: ( 1) small (Seibel 1988:

TM 1 3, revised). CI = 1.00. 62. Tarsometatarsus. direction of deflection of crista medialis hypotarsi: (0) caudally; (1) laterally (Seibel 1988: TM 13, revised). CI = 1.00. 63. Tarsometatarsus, shape of lateral surface: (0) broad in planum medianuril, facies lateralis flattened; (1) flat, nmow throughout length (Seibel 1988: TM 16). CI = L .oo. 64. Tarsometatarsus, degree of torsion of shaft relative to cotylae (ordered): (0) none; (1)

moderate; (2) high torsion (Seibel 1988: TM 17, revised). CI = 1.00. APPENDIX 1.4. Character descriptions continued.

65. Tarsometatarsus, relative position of foramina vascularia proximalia in axis proximodistalis: (0) foramina lateralis proximal to foramina medialis; (1) not as in state O (Seibel 1988: TM 26, revised). CI = 0.50. 66. Tarsometatarsus, relative position of foramina vascularia proximalia in axis proximodistalis (ordered): (O) foramina medialis not proximal to foramina lateralis;

( 1) slightly proximal; (2) highly proximal (Seibel 1988: TM 26. revised). CI = 0.67. 67. Tarsometatarsus, position of tuberositas m. tibialis anticus: (0) distal to foramina vascularia proximalia medialis only; (1) borders margo distalis of both foramina (Seibel 1988: TM 27, revised). CI = 0.50.

68. Tarsometatarsus, position of tuberositas m. tibialis anticus: ;Cl) distinct gap between

tuberositas and foramina; (1) tuberositas immediately distal to foramina (Seibel 1988: TM 28, revised). CI = 0.50. 69. Tarsometatarsus, form of sulcus between tuberositas m. tibialis anticus and foramina

vascularia proximalia medialis (ordered): (O) no sulcus; (1) shallow: (2) distinct; (3)

deep (Seibel 1988: TM 29, revised). CI = 1.OO. 70. Tarsometatarsus, protuberance on facies lateralis of trochlea metatarsi tertii: (0) absent;

( 1) present (Seibel 1988: TM 20, revised). CI = 1.00. 7 1. Tarsometatarsus, depression on facies lateralis of trochlea metatarsi tertii: (0) absent; (1) present (Seibel 1988: TM 20, revised). CI = 1.00. 72. Tarsometatarsus, size of "wings" of trochlea metatarsi secundii: (0) mesial wing much larger than lateral wing; (1) wings equd in size or indiscemible (Seibel 1988: TM 24). CI = 1 .oo* 73. Tarsometatarsus, position of facies distalis of trochlea metatarsi quarti (ordered): (O) distal to incisura intertrochlearis medialis; (1) proximal to incisura; (2) highly proximal to incisura (Seibel 1988: TM 2 1, revised). CI = 1.00. APPENDIX 1.4. Character descriptions continued.

-- -- - 74. Tarsornetatarsus, inflection of trochlea metatani quarti, as in monophyly character 9:

(O) no; ( 1) yes. CI = 1.W. 75. Tarsometatrusus. contour of facies distalis of trochlea metatarsi quarti (ordered): (O)

straight transverse; ( 1) curved proximaily; (2) notc hed (Seibel 1988: TM 25, revised).

CI = 1.00. 76. Femur. extremitas proximalis femoris, pneumatic foramina caudalis: (0) absent; (1) srnall; (2) large (Seibel 1988: FE 2, revised). CI = 1.00. 77. Femur orientation of fovea ligamentum capitis: (0) faces mesially or proximo-rnesially;

( 1) faces proximally (Seibel 1988: FE 3, revised). CI = 1.00. 78. Femur. contour of margo lateralis of trochanter femoris: (0) distinct proximal expansion: (1) no distinct proximal expansion (Seibel 1988: FE 4. revised). CI =

1.oo.

79. Femur. size of crista trochanteris (ordered): (0) large. square: (1 ) moderate. flap-like;

(2) small (Seibel 1988: FE 4, revised). CI = 1-00. 80. Pelvis. relative widths of facies donalis (ordered): (O) narrowest point less than half the

width between processes antitrochantericus; (1) approximately half; (2) more than half (Seibel 1988: PE 15, revised). CI = 0.67.

81. Ilium, form and degree of fusion of crista iliaca dorsalis and margo medialis of ala preacetabularis ilii (ordered): (O) crista and margo medialis fused; (1) crista contact margo medialis without fusing, or have bridges of bone that approach or anklylose;

(2) no contact, ridges straight, tall, and close to margo medialis; (3) as in 2. but ndges lower and widely spaced (Seibel 1988: PE 18, revised). CI = 0.50.

82. Ilium, form of antenor bridge connecting crista iliaca dorsalis and margo mediaiis of da

preacetabularis ilii: (0) not as in state 1; (1) broad, ankylosed to median ndge; fossa iliaca dorsalis diamond shaped in cranial aspect (Seibel 1988: PE 22). CI = 1.00. APPENDIX 1.4. Character descriptions continued.

------83. Ilium. contour of crista iliaca dorsalis in dorsal aspect (ordered): (0) not as in state 1 or 2: (1) straight or curving slightly mesidly at margo caudalis: (2) cnsta remains free farther caudaily, curving latenlly at margo cauddis (Seibel 1988: PE 23). CI = 1.00. 84. Ilium, contour and orientation of margo cranialis of crista donolaterdis ilii immediately lateral to tip of proc. antitrochantericus: (0) broadly curved, directed obliquely cranio-

caudally; ( 1) straight, directed obliquely meso-laterally (Seibel 1988: PE 2 1). CI = 1.m. 85. Ilium, size of tuberculum preacetabulare (ordered): (O) moderate to large; (1) small: (2) vestigial (Seibel 1988: PE 5, revised). CI = 0.60. 86. Ilium, form of tuberculum preacetabulare: (0) not as in state 1; (1) short, blunt, broad in

axis dorsoventralis (Seibel 1988: PE 19). CI = 1.00. 87. Ilium. cross-section shape of margo medialis (Fig. 1.15, section A) of crista iliaca dorsolateralis in axis dorsoventralis: (0) broad, forming smooth arc; (1) compressed

into thin, blade-like shelf (Seibel 1988: PE 10). CI = 1.00-

88. ilium. posterior extent of spina dorsolateralis ilii (ordered): (0) very long; ( 1) moderate; (2) short (Seibel 1988: PE 12, revised). CI = 0.75. 89. Ilium. relative Iengths of sections B and C (Fig. 1-16) of crista dorsolateralis ilii (ordered): (O) B longer than section C; (1) broadly rounded, no clear distinction: (2) B

and C same length; (3) B shorter than C (Seibel 1988: PE 13. revised). CI = 1.00. 90. Ilium, contour of margo lateralis of crista dorsolateralis ilii, relative to tip of proc.

antitrochantericus: (0) not as in state 1; ( 1) margo lateralis and antitrochantericus meeting, margo lateralis straight to slightly convex (Seibel 1988: PE 17, revised). CI = 1.00. APPENDIX 1.4. Character descriptions continued.

9 1. Ilium, contour and cranio-caudal position of cnsta donolateralis ilii: (0)margo lateralis of crista displaced caudally relative to proc. antitrochantericus foming a gap, margo lateralis straight to concave: (1) intermediate between state O and 2: (2) as in state O, but rnargo lateralis of crista immediately caudal to the proc. antitrochantericus convex; (3) not as in state O, 1, or 2 (Seibel 1988: PE 24, revised). CI = 0.75. 92. Ilium. relative length of sync. ilioischiadica from cnsta caudalis fossa rendis to proc. marginis caudalis in axis rostrocaudalis. with reference to depth of recessus caudalis

fossae: (0) intemediate between state 1 and 2; (1) sync. ilioischiadica long, recessus caudalis fossae present and deep; (2) sync. ilioischiadica short, recessus caudalis fossae shallow (Seibel 1988: PE 20, revised). CI = 0.67. 93. Os coxae, forarnen obturatum: (0) margo ventralis closed by bone, ischium and pubis ankylosed; (1) closed, but ischium and pubis not ankylosed; (2) margo ventralis not closed by bone (Seibel 1988: PE 8, revised). CI= 1.00. 94. Sternum, cranial extent of apex carinae (ordered): (O) cranial tip of apex caudal to

labrum extemum of sulcus articularis coracoideus; ( 1) apex at same cranio-caudal level as sulcus; (2) apex craiiial to sulcus (Seibel 1988: ST 5, revised). CI = 0.50. 95. Stemum, fom and fusion of rostmm sterni: (0) spina extema only; (1) spina interna and externa present, sepante; (2) both present, fused, spina interna protrudes; (3) both present, fused, spina extema protmdes; (4) both present, fused, and widened in axis dorso-ventralis (Seibel 1988: ST 2, revised)- CI = 0.80.

96. Stemum, size of spina externa: (0) prominant; ( 1) greatly reduced. CI = 1.00. 97. Stemum, shape of spina interna: (0) not as in state 1; (1) wide, flattened in axis doso- ventralis. CI = 1.00. 98. Coracoideum. form and inflection of facies articularis sternalis, as in rnonophyly

character 10: (0) no; ( 1) yes. CI = 1.00. APPENDK 1-4. Character descriptions continued.

99. Coracoideum, relative size of facies articularis sternaiis: (0) dorsal large. ventrai small;

( 1) dorsal small, ventral large; (2) both small, equal in size; (3) both small, but dorsal

larger; (4) both large (Seibel 1988: CO 19, revised). CI = 1.00.

100. Coracoideum, direction faced by facies articularis clavicularis: (0) mesially; ( 1) rneso-

ventrally to ventrally (Seibel 1988: CO 1). CI = 1.00. 101. Coracoideum, fusion of proc. procoracoideus and proc. acrocoracoideus: (0) not as in

statr 1; ( 1) forming a solid boundary of candis triosseus (Seibel 1988: CO 2 1). CI = 1-00.

102. Coracoideum, direction of inflection of proximal tip of proc. acrocoracoideus: (0)

dorso-Iaterally; ( I ) dorso-rnesially (Seibel 1988: CO 20, revised). CI = 1.00. 103. Coracoideum. size and fom of "brachial tuberosity" sensu Howard (1929) of proc. acrocoracoideus (ordered): (O) small or absent; (1) moderate. inflected meso- ventrally; (2) large, strongly inflected (Seibel 1988: CO 20, revised). CI = 1.00. 104. Coracoideum, shape of distal extreme of cotyla scapularis: (0) blunt or rounded; (1)

sharply pointed, elongate. CI = 1.W. 105. Clavicuia, form of synostosium interclavicularis: (0) united by ligament: (1) fùsed. CI = 1-00. 106. Clavicula, facies articularis procoracoideus: (0) absent; (1) present, distinct; (2) present, indistinct (Seibel 1988: FU 1, revised). CI = 1.00. 107. Clavicula, orientation of facies articularis acrocoracoideus (ordered): (0) dorso- laterally to dorsally; (1) latero-donally to laterally; (2) ventro-laterally (Seibel 1988: FU 2, revised). CI = 1.00.

108. Scapula, as in monophyly character 1 1: (O) no; ( 1) yes. CI = 1.00. APPENDM 1.4. Character descriptions continued.

------109. Scapula, extremitas cranialis scapulae, contour of margo dorsdis and ventralis: (0)

obscured by fusion. or not as in other States; (1) mugo donalis straight from mesial of facies articularis humeralis to acromion, margo ventralis with abrupt mgle between

facies articuiaris humerdis and acromion; (2) intermediate between state 1 and 3; (3) both rnargo dorsalis and ventralis aimost straight from facies articularis humerdis to acromion where both bend abruptly dorsally (Seibel 1988: SC 15, revised). CI = 1.00. 110. Humerus, protuberance near attachment of m. supraspinatus: (0) absent; (1) present

(Seibel 1988: HU 9). CI = 1 .W. 11 1. Humerus, extremitas proximalis humeri, "bulbous convexity" on facies cranialis just

lateral to midpoint: (0) absent; ( 1) present (Seibel 1988: HU 16). CI = 1.00. 1 12. Humems, position of fossa m. brachialis in cranid aspect: (0) mesial to center of corpus humeri; (1) far mesial; (2) at or lateral to meso-lateral center of corpus humeri (Seibel 1988: HU 47, revised). CI = 0.67. 113. Humerus, form and position of proc. Rexorius in axis proximodistalis (ordered): (O) square shape in distal aspect, finger-like in caudal aspect, tip distinctly distal to condylus ventralis: (1) shape as in state 0, but tip not distal to condylus venualis; (2) tip of proc. flexonus "cut off', condylus ventralis protrudes distally to tip of processus (Seibel 1988: HU 14, revised). CI = 0.67.

114. Humems, form of condylus ventralis, as in rnonophyly character 12: (0) no; (1) yes. CI = 1-00. 115. Ulnü, margo distalis of proc. cotyla dorsalis relative to proc-cotyla ventralis: (0) same level in axis proxirnodistalis; (1) markedly proximal; (2) markedly distal (Seibel

1988: UL 1, revised). CI = 0.40. 116. Ulna, wide fossa between proc. cotylae dorsalis and ventralis: (0) absent; (1) present (Seibel 1988: UL 1, revised). CI = 1.00. APPENDIX 1.4. Character descriptions continued.

117. Ulna, shape of proc. cotyla dorsalis: (0) not elongate; ( 1) elongate. CI = 0.33. L 18. Ulna, prominant spur on margo distalis of proc. cotyia dorsalis: (0) absent; (1) present. CI = 1.00. 119. Ulna, incline of longest chord passing through face of proc. cotyla ventralis: (0)not as

in state 1 ; ( 1) meso-distally to latero-proximally (Seibel 1988: UL 4). CI = 1.o. 120. Radius, extremitas distalis radii, facies articulais radiocarpalis: (0) concave or convex;

( 1) straight. CI = 1.00.

121. Os carpi ulnare, angle of juncture of crus breve and crus longum: (0) not

approximately 90"; ( 1) approximately 90' (Seibel 1988: CU 1). CI = 1.00. 122. Os carpi ulnare, shape of crus longum: (0) curved or bent: (1) nearly straight (Seibel 1988: CU 2). CI = 1.00. 123. Os carpi ulnare. relative thickness of crus breve and crus longum: (0) facies articularis ulnaris thicker than crus longum: (1) approximately equal (Seibel 1988: CU 3). CI = 1.oo. 124. Os carpi ulnare, shape of distal end: (0) blunt. expanded, or bulbous; (1) pointed, margo distalis 45" to crus longum; (2) strongly pointed, approximately 30". CI = 0.67. 125. Phalanx proximalis digiti rnajoris, shape in planum transversalia: (0) triangular, concave sides; (1) rectangular, flat sides (Seibel 1988: PH 1). CI = 1.00.

126. Atlas, foxm: (0) notched; ( 1) perforated. CI = 1.00. 127. Axis. form of proc. articularis caudaiis in lateral aspect: (0) elongate with rounded tip;

( 1) anvil-shaped. CI = 1.00.

128. Vertebrae cervicaies, number: (0) 14 or more; ( 1) 13. CI = 1.00.

129. Vertebrae thoracica, number: (0) 5; ( 1 ) 4. CI = 1.00. APPENDK 1.4. Character descriptions continued.

130. Synsacrum, extremitas caudalis synsacri, as in monophyly character 13: (O) no; (1)

yes. CI = 1.00.

13 1. Venebrae caudales, pnmus, as in monophyly character 14: (0)no; (1) yes. CI = 1.00.

132. Pygostylus, cranial extent of margo dorsalis in lateral aspect: (0) not as in state 1 or 2;

( 1) caudal of facies articularis; (2) cranial of facies articularis. CI = LOO. 133. Pygostylus. approximate angle of juncture of margo dorsalis and caudalis in lateral

aspect: (0) 45"; ( 1) 90". CI = 1.00.

134. Pygostylus, angle of juncture of basis pygostyli and margo caudalis in lateral aspect:

(0) straight. 180'; ( 1) obviously angled, about 135". CI = 1.00.

135. Pygostylus. shape of caudal region between basis pygostyli and canalis vascularis in lateral aspect: (0) tapered to point, projecting craniaily; (1) blunt. squared-off. CI = 1.oo. Figure 1.15. Pelvis of Cuban Lizard-cuckoo (Saurothera merlini) indicating sections

A-C of cnsta dorsolateralis ilii. APPENDR 1S. Character change list for skeletal characters on shortest-length tree (Fig. 1.13). Double-Iined arrows indicate that changes occurred on al1 possible reconstructions. Single-lined arrows indicate that changes occur only under some reconstructions.

--- CHARA~R1: O [node 671 => 1 [node 441; O [node 641 => 1 [node 531; 1 [node

451 => O [Coccycua];O [Centropus] --> 01 [within terminal]. CHARACTER2: O [node 591 => 1 [node 6 11; 1 [node 631 => 0 [node 541. CHARACTER3: O [node 591 => 1 [node

6 11; 1 [node 681 --> 2 [node 431. CHARACTER4: O [node 631 => 1 [node 641; 1 [node 681 => 2 [node 691; 1 [node 391 --> 2 [node 381; 1 [node 501 =s O [node 491. CHARA~R5: 1 [node 581 --> O [node 591; O [node 631 => 1 [node 641; 1 [node 421 => 2 [node 411; 1

[node 501 ==> O [node 491. CHARACTER6: O [node 381 => 1 [node 371. CHARACTER7: O

[node 631 => 1 [node 541. CHARACTER8: O [node 681 --> 1 [node 431. CHARACTER9: O

[node 581 ==> 1 [node 591. CHARA~R10: O [node 671 => 1 [node 681; O [node 5 11 =>

1 [node 471. CHARACTERL 1: O [node 391 => 1 [node 381. CHARACTER12: O [node 421

==> 1 [node 411. CHARACTER13: O [node 671 => I [node 441. CHARACTER14: O [node 621 ==> 1 [node 561. CHARAC'IZR15: O [node 581 => 1 [node 591. CHARACTER16: O

[node 581 ==> 1 [node 591. CHARACTER17: O [node 581 --> 1 [node 591; 1 [node 611 --> O

[node 621. CHARACTER18: O [node 501 => 1 [node 491. CHARACTER 19: O [node 501

==> 1 [node 481. CHARACTER20: 1 [node 581 --> O [node 591. CHARACTER2 1 : O [node

581 ==> 1 [node 591. CHARACTER22: O [node 611 => 1 [node 621. CHARACTER23: O

[node 5 11 => 1 [node 501. CHARACTER24: O [node 611 => 1 [node 621; 1 [node 641 =>

2 [node 661; 1 [node 521 => O [node 5 11. CHARACTER25: O [node 621 => 1 [node 631; L

[node 681 --> 2 [node 431; 1 [node 471 => O [Snurothera]. CHARACTER26: O [node 681 --> 1 [node 691. CHARACTER27: O [node 561 => 1 [node 551. CHARACTER28: O [node

521 ==> I [node 511. CHARACTER29: O [node 621 ==> 1 [node 631; 1 [node 681 --> 2

[node 431. CHARACTER30: O [node 581 ==> 1 [node 591. APPENDIX 1S. Chancter change List continued.

------. CHARACTER3 1: O [node 631 => I [node 641. CHARACTER32: O [node 611 --> 1 [node 621; 1 [node 631 --> O [node 641; O [node 421 => 2 [node 411; O [node 501 => 1

[node 491. CHARACTER33: O [node 631 --> 1 [node 641; 1 [node 681 --> O [node 431; 1

[Eudynamysl--> 0 1 [within terminai]; 1 [node 521--> O [Ceuthmochares]. CHARACTER34:

O [node 631 --> L [node 641; 1 [node 661 --> O [node 671; O [Coccyzus] --> 01 [within terminal]. CHARACTER35: O [Coccyzus] --> 0 1 [within terminal]; O [node 521 => 1 [node 511; O [node 561 ==s 1 [node 551. CHARACTER36: O [node 561 => I [node 551.

CHARACTER37: O [node 641 => 1 [node 661; 1 [node 381 => 2 [node 371. CHARACIER

38: O [node 501 => 1 [node 491. CHARACTER39: O [node 581 => 1 [node 591; 1 [node

561 => O [node 551. CHARACTER40: O [node 661 => 1 [node 651; O [node 561 ==> 1

[node 551. CHARACTER4 1: O [node 591 ==> 1 [node 6 11. CHARACTER42: 1 [node 671

==> O [node 4-41. CHARACTER43: O [node 581 => 1 [node 591. CHARACTER44: O [node 631 ==> 1 [node 641; O [Guira] --> 0 1 [within terminai]; O [Centroprrs] --> 0 1 [within terminal]. CHARACTER45: 1 [node 6 11 => O [node 621; 1 [Centropus] --> 01 [within terminal]. CHARACTER46: O [node 581 ==> 1 [node 591. CHARACTER47: O [node 581

=> 1 [node 591. CHARACTER48: O [node 591 => 1 [node 611. CHARACTER49: O [node

591 --> 1 [node 611; 1 [node 621 --> O [node 631. CHARACTER50: O [node 621 => 1 [node

631; 1 [node 661 ==> O [node 651. CHARACTER5 1: O [node 581 => 1 [node 591; 1 [node 661 ==> 2 [node 671; 1 [node 461 ==> 2 [node 451; 1 [node 621 ==> O [node 561. CHARACTER52: O [node 531 => 1 [node 521; O [node 611 => 1 [node 601. CHARA~R 53: O [node 581 ==> 1 [node 591. CHARACTER54: O [node 571 ==> 1 [node 581.

CHARACTER55: O [node 661 => L [node 651. CHARACTER56: O (node 681 => 1 [node

691. CHARACTER 57: O [node 581 ==> 1 [node 591. CHARACTER58: O [node 581 => 1

[node 591. CHARACTER59: O [node 581 ==> 1 [node 591. CHARACTER60: O [node 621

==> 1 [node 631. CHARACER6 I : O [node 661 => I [node 671. APPENDIX 1S. Chmcter change list continued.

CHARACTER62: O [node 621 => 1 [node 631. CHARACTER63: O [node 681 --> 1 [node 431. CHARACTER64: O [node 661 => 1 [node 671; 1 [node 681 --> 2 [node 431.

CHAIWCTER65: O [node 581 => 1 [node 591; 1 [node 621 => 0 [node 631. CHARACTER

66: O [node 631 => 1 [node 641; 1 [node 381 => 2 [node 371; 1 [node 471 => O [node

461. CHARACTER67: O [node 621 => 1 [node 561; O [node 591 => 1 [Carpococcyx]. CHARACTER68: 1 [node 661 =z O [node 671; 1 [node 531 => O [node 521. CHARACTER

69: O [node 671 => 1 [node 681; 1 [node 681 --> 2 [node 431; 2 [node 381 => 3 [node 371.

CHARACTER70: O [node 581 => 1 [node 591. CHARACTER 71: O [node 631 => 1 [node

541. CHARACTER72: O [node 581 => 1 [node 591. CHAFL~CTER73: O [node 581 => 1

[node 591; 1 [node 621 => 2 [node 631. CHARACTER74: O [node 581 => 1 [node 591.

CHARACTER75: O [node 611 ==> 1 [node 621; 1 [node 411 => 2 [node 401. CHARACTER

76: O [node 571 ==> 1 [node 581; 1 [node 621 => 2 [node 561. CHARACTER 77: O [node

681 ==> L [node 431. CHARACTER78: O [node 581 => I [node 591. CHARACTER79: 9

[node 621 => 2 [node 631; 2 [node 641 => i [node 531. CHARACTER80: O [node 641 --> 1

[node 661; 1 [node 681 =z 7 [node 431; 1 [node 671 --> O [node 441. CHARACTER8 1: O

[node 591 ==> 1 [node 611; 1 [node 631 -> 2 [node 641; 2 [node 681 => 3 [node 431; 2

[node 531 --> 1 [node 521; 1 [node 471 --> 2 [node 461; 1 [node 501 --> 2 [node 481.

CHARACTER82: O [node 631 => 1 [node 54). CHAUCER 83: O [node 581 => 1 [node

591; 1[ node 661 ==> 2 [node 651. CHARACTER84: O [node 561 ==> 1 [node 551.

CHARACTER85: O [node 621 ==> 1 [node 631; 1 [node 431 ==> 2 [node 421; 1 [Drornocaccyx] --> 12 [within terminal]; I [node 521 => O [node 511; O [node 451 => 1

[Coccycun]. CHARACTER86: O [node 631 =z 1 [node 541. CHARACTER87: O [node 641

=> 1 [node 661. CHARACTER88: O [node 621 => I [node 631; 1 [node 631 => 2 [node

641; 2 [Drornococcyx] --> 12 [within terminal]; 2 [node 5 11 => 1 [node 501. APPENDIX 1 S. Chancter change list continued.

CHARACTER89: O [node 581 => 1 [node 591; 1 [node 621 => 2 [node 631; 2 [node 681 => 3 [node 431. CHARACTER90: 0 [node 521 => 1 [node 5 11. CHARACTER9 1: O [node 581 --> 1 [node 591; 1 [node 611 --> O [node 621; O [node 641 => 3 [node 531; O

[node 621 --> 2 [node 561. CHARACTER92: 1 [node 631 --s O [node 641; O [node 641 -> 2

[node 661; O [node 501 => 1 [node 491. CHARACTER93: 1 [node 621 => O [node 631; 1

[node 581 => 2 [Opisthocomus]. CHARACTER94: O [node 621 --> 1 [node 631; 1 [node

641 ==> 2 [node 661; 1 [node 641 --> O [node 531; O [node 511 ==> 1 [node 471. CHARACTER95: O [node 681 => 2 [node 691; O [node 431 => 1 [node 421; O [node 661

==> 2 [node 651; O [node 531 => 4 [node 521; 4 [node 511 => 3 [node 471. CHARA-

96: O [node 6 11 --> 1 [node 601; 1 [Cenrropiis] --> 01 [within terminal]. CHARACTER97: O

[node 411 ==> 1 [node 401. CHARACTER98: O [node 581 => 1 [node 591. CHARA~R

99: O [node 611 ==> 1 [node 621; 1 [node 631 => 2 [node 641; 2 [node 671 => 3 [node

681; O [node 581 => 4 [Opistl~ocomus].CHARACTER 100: O [node 571 => 1 [node 581.

CHARACTER10 1 : 0 [node 571 =r 1 [node 581. CHARACTER102: O [node 621 => 1 [node

561. CHARACTER 103: O [node 621 ==> 1 [node 631; 1 [node 661 ==> 2 [node 671.

CHARACTER104: O [node 681 ==> 1 [node 691. CHARACTER105: O [node 571 => 1 [node

581. CHARACT'ER 106: O [node 581 ==> 1 [node 591; 1 [node 681 ==> 2 [node 431.

CHARACTER107: O [node 581 => 1 [node 591; 1 [node 631 => 2 [node 641. CHARACTER 108: O [node 581 ==> 1 [node 591. CHARACTER109: 2 [node 581 --> O [Opisthocomus];2

[node 631 ==> 3 [node 641; 2 [node 621 ==> 1 [node 563. CHARACTER110: O [node 621

==> 1 [node 561. CHARACTER11 1: O [node 641 => 1 [node 661. CHARACTER112: O

[node 581 ==> 1 [node 591; 1 [node 621 => O [node 631; O [node 641 ==> 3 [node 661.

CHMCTER I 13: O [node 631 => L [node 641; L [node 391 => 2 [node 381; 1 [node 501

==> O [node 493. CHARACTER1 14: O [node 581 ==> 1 [node 591. APPENDIX 1S. Chancter change list continued.

CHARA~R115: O [node 591 => 1 [node 611; 1 [node 631 -> 2 [node 641; 2

[node 691 => 1 [Coccyzus]; 2 [node 661 --> 1 [node 651; 2 [node 511 => 1 [node 471.

CWCTER 1 16: O [node 661 => 1 [node 671. CHARACTER1 17: O [node 631 --> 1 [node

641; 1 [node 661 --> O [node 651; I [node 5 11 => O [node 471. CHARACTER118: O [node 691 => 1 [node 701. CHARA~R1 19: O [node 571 => 1 musophagidae]. CHARA- 120: O [node 691 ==> 1 [node 701. CHARACTER12 1: O [Ancestor] c=> 1 [node 571.

CHARACTER 122: O [Ancestor] <=> 1 [node 571. CHARACTER123: O [Ancestor] o 1

[node 571. CHARACTER124: 1 [node 641 => 2 [node 661; 1 [node 621 --> O [node 561; 1

[node 591 --> O [Carpococcyx]. CHARACTER125: O [node 581 => 1 [node 591.

CHARACTER126: O [node 581 => 1 [node 591. CHARACTER127: O [node 581 => 1 [node

591. CHARACTER128: O [node 681 => 1 [node 691. CHARACT'ER129: O [node 591 => 1

[node 6 11. CHARACTER130: O [node 581 => 1 [node 591. CHARACTER13 1: O [node 581 ---> 1 [node 591. CHARACTER132: O [node 611 ==> 1 [node 621; 1 [node 621 => 2 [node

631. CHARACTER133: 0 [node 621 => 1 [node 631. CHARACTER134: O [node 471 => 1 [node 461. CHARACTER135: O [node 421 ==> 1 [node 391. CHAPTER 2: Taxonornic significance of host egg rnirnicry by facdtative brood parasites of the genus Coccyzus.

Absrracr. - Black-billed (Coccyzris eryrhroprhalm~is)and Yellow-billed (C. omericanus)cuckoos are facultative brood parasites that occasionally lay their eggs in the nests of 10 and 1 1 other bird species. respectively. This study demonstrates that both cuckoo species produce blue-green eggs that fully or nearly match the eggs of over 70% of their reponed host species. a proportion significanrly greater than if hosts were being selected at nndom from the potential host pool. These results suggest that the cuckoos rnay be selecting hosts based on their egg color, and supports an hypothesis of egg rnirnicry. Since egg rnimicry is unlikely to evolve in a Facultative parasite, its existence in Coccyzus would imply a histori~ally intense relationship between these birds and their hosts. This hypothesis is corroborated by recent phy logenetic analyses w hich suggest that the ancestral Coccy:us was an obligate parasite. Factors responsible for the loss of obligate parasitism in this genus may also have contributed to the general paucity of obligate parasitisrn in New World cuckoos. Competitive exclusion or resistance to invasion by pansitic cowbirds (Molotlirus spp.) should be considered.

INTRODUCTION

At least 51 species of cuckoos are obligate brood parasites, laying their eggs in the nests of other birds. Most parasitic cuckoo species exhibit a suite of adaptations for parasitism that serve to increase their reproductive success, such as egg rnimicry and . host offspring ejection behavior by cuckoo young, and hast egg removal by fernale cuckoos pnor to depositing their own egg. Several cuckoo species exhibit facultative brood parasitism, whereby they usually rear their own young, but will deposit additional eggs both intra- and interspecifically when certain environmental conditions prevail (Nolan and Thompson 1975. Fleischer et al. 1985, Hughes 1996a). This breeding strategy has been dernonstrated in four species of the New

World genus Coccyziîs: Yellow-billed Cuckoo (C.nmericanus; Fleischer et al. 1985), Black-billed Cuckoo (C. erythroprhalmus: Nolan and Thompson 1975), Dark-billed Cuckoo (C. melacoryphus; Sick 1993). and Dwarf Cuckoo (C. pumilis; Ralph 1975). The remaining five Coccyzus species are poorly known and, hence, parasitism has not been documented. Conventional views imply that facultative parasitism may represent some intermediate form in the evoiution of obligate parasitisrn (Miller 1946, Weller 1959). Some workers have suggested that Yellow-billed and Black-billed cuckoos are randornly depositing their eggs in the nests of other birds (Hamilton and Orians 1965). perhaps following the destruction of their own nest (Bendire 1895). This view was contested by

Nolan and Thompson (1975), who cited the many well documented accounts of interspecific parasitism by these species. In addition, they noted an absence of foreign eggs, other than those of the Yellow-billed Cuckoo and the obligately parasitic Brown- headed (Molothn

Black-billed and Yellow-billed cuckoos occasionally parasitize the nests of 10 and 1 1 species of birds, respectively. Host species cornrnon to both cuckoos are the American

Robin (Twdus migraton'iis: e.g., Edwards 1903, Hemck 1910, Forbush 1927). Gray

Catbird (Dumetella carolinensis; Bent 1948), Wood Thmsh (Hyfocichla mustefina; e-g., Allen 1877, Dawson 1903), Cedar Waxwing (Bombyifla cedrorrm; Herrick 19 10). and (Cardinalis cardinalis; Bendire 1895, Bent 1940). The Yellow-billed Cuckoo hûs also laid eggs in the nests of the Rufous-sided Towhee (Pipilo erythroplztlzalmus; Sprunt and Chamberlain 1949, Nolm and Thompson 1975), Dickcissel (Spiza mnericana), Black-throated Sparrow (Amphispiza bilineara: Attwater 1892), Red-

winged Blackbird (Agelniw phoeniceus, e.g., Nickel1 1954a, Black 1992), and Mouming Dove (Zenaida mncroura; Wolfe 1994). Black-billed Cuckoo eggs have been found in the nests of the (Conropus virens; Bent 1940), Veery (Catharus fuscescens; Roberts 1932), Yellow Warbler (Dendroica petechia), and Chipping Sparrow (Spizella passerina; Mcllwraith 18%). In addition, Darwin ( 1859) noted an unspecified

CUC~OOegg (Caccyzus sp.) in the nest of a Blue Jay (Cyanmina cristatu). Most frequently, the Yellow-billed and Black-billed cuckoos parasitize each other (e.g.. Bent 1940, Nolan and Thompson 1975). Furthemore, at least seven host species have successfdly hatched or fledged cuckoo young (Danvin 1859, McIlwraith 1894, Macon and Macon 1909, Bent 1940, Nickel1 1954a, Nolan and Thompson 1975, Wolfe 1994). Unfortunately, the frequency of facultative parasitism within cuckoo populations remains unknown, and few affected host nests have been subsequently monitored to determine their outcorne. In most cases. researchers have tampered with the cuckoo eggs or collected the entire clutch because of its value as an oddity. Oberholser (1975: 434) noted that host species used by the Yellow-billed Cuckoo in Texas "generally produce eggs similar in size and color to those of the cuckoo," thus suggesting that this species is laying mimetic eggs like many obligately parasitic cuckoos. The purposes of the present study are to quanti@ the occurrence of Yellow-billed and Black-billed cuckoo eggs in the nests of host species that produce similarly colored eggs, and to compare the ratio of matching to non-matching eggs in actual hosts with the relative proportions of these egg types produced by a potential host pool. Higher proportions of

matching cuckoo eggs in actual hosts than in potential hosts would support the hypothesis that Yellow-billed and Black-billed cuckoos are not depositing their eggs in nests randomly

but are selecting hosts to which they have evolved similarly colored eggs. I subsequently

propose an hypothesis for the evolution of egg mirnicry in Coccyzus CUC~OOS.

METI-IODS 1 compared the ground color and presence of maculations, if any, of reported host eggs with. the imrnaculate blue-green eggs of Yellow-billed and Black-billed cuckoos using

photographs in Hamson (1975. 1979). descriptions in Ehrlich et al. (1988), and personal observations of eggs in the Royal Ontario Museum collection. Irnmaculate or sparsely marked host eggs with a blue or blue-green ground color were scored as a "match." Irnrnaculate or maculated host eggs with a ground color other than blue or blue-green were scored as "no match." Heaviiy marked eggs were scored as "no matchT'regardless of ground color. The Blue Jay was excluded as a host in this analysis because the parasitic cuckoo species could not be determined from Darwin's (1859) description of the observation. This study does not consider cases of intraspecific parasitism. In addition, I did not include the Dark-billed or Dwarf cuckoo since individual cases of parasitism in these poorly studied species have not been adequately documented. To confirm that reported hosts were not merely a representative sample of al1 North American birds, I scored the egg colors and presence of maculations of dl potential hosts based on the aforementioned criteria. Obviously inappropriate potential hosts, such as species of waterfowl, gulls. wading birds, shorebirds, gamebirds. and raptors, were excluded, as were those species that are not sympatric with the cuckoos, nest in different habitats, or feed offspring an unsuitable diet. In addition. 1 excluded potential host species

(e.g., gnatcatchers) that are smaller than the smallest actual host species (i.e., Yeliow Warbler, 12-14 cm) because their nests may not be large enough to accommodate cuckoo eggs. Most actual host species build a cup-shaped nest that is placed above the ground. However, the Yellow-billed Cuckoo has parasitized the Rufous-sided Towhee (Sprunt and Chamberlain 1949, Nolan and Thornpson 1975), suggesting that some ground-nesting birds may be suitable hosts. Accordingly, ground-nesting birds that constmct a nest, as opposed to laying in a scrape or depression, were also included in the analysis. In contrast, there

was no evidence to support the inclusion of birds that nest in cavities. or those that build penduline or oven-shaped nests. The peak breeding period for Yellow-billed and Black-billed cuckoos (Juneduly; Bent 1940) is later than that of rnany North American birds. Therefore, 1 included as

potential hosts single-brooded species whose peak breeding period is no earlier than 1 June, and multiple-brooded species in which the peak periods of second or third clutches occur between June and August. Breeding periods were detemiined using Bent (1942, 1946, 1948, 1949, 1950, 1953, 1958, 1968).

Many actuai host species are geographically wide ranging (e-g., ,

Red-winged Blackbird), but others are not (e.g., Black-throated Sparrow ). Therefore to approximate better the number of potential hosts available to any individual cuckoo, 1 divided the combined ranges of both cuckoo species into six zones: nonhwest (NW); northeast (NE); central-west (CW): central-east (CE); southwest (SW); and southeast (SE).

Ranges were divided east to West at the 100th meridian. as suggested by Peterson (1980). and north to south at 45ON and 35"N. latitudes roughly corresponding to the northem limit of the Yellow-billed Cuckoo and the southern limit of the Black-billed Cuckoo. Accordingiy. the Black-billed Cuckoo occun alone in zones NW. NE, and CW, and the Yellow-billed Cuckoo occurs done in zones SW and SE. The species are sympatric in zone CE. Only birds that nest in each respective zone were considered potential host species for each resident breeding cuckoo species.

RESULTS Overall. Yellow-billed and Black-billed cuckoos laid eggs that fully or nearly matched host eggs in 8 of 11 and 7 of 10 of their actual host species, respectively. Furthemore, the most frequently reponed hosts, American Robin, Gray Catbird, and Wood Thrush, lay immaculate blue-green eggs, as do the cuckoos. Of reported occurrences of parasitized clutches that did not involve intragenenc parasitism. 67.9% of Yellow-billed and 75.0% of Black-billed cuckoo eggs were observed in nests of birds that produced eggs resembling cuckoo eggs. These values may underestimate actual proportions of cuckoo eggs that matched host eggs because matching eggs are more likely to be overlooked in conventional nest surveys. A potential host pool of 81 species occurred within the ranges of both cuckoo species, with 64 and 63 host species available to Yellow-billed and Black-bill cuckoo populations, respectively. Overail, only 17 potential host species produced eggs that were similar in coloration to cuckoo eggs, with 8 of these found arnong thmshes (Muscicapidae, Turdinae) and cardinals (Emberizidae, Cardinalinae). Furthemore, these two subfamilies represent 8 of L9 actual host species and approximately 48.0% and 43.8% of reported occurrences of parasitism by Yellow-billed and Black-billed cuckoos. respectively, when cases of intrageneric parasitism are not considered. Potential host species are quantified by family, subfamily, and egg type in Table 2.1. Considerably fewer hosts were available to individual cuckoo species within each geographic zone (Table 2.2). If Yellow-billed and Black-billed cuckoos were placing their eggs in nests randomly, the expected ratio of non-matching to matching eggs of actual hosts should approximate that of the potential host pool. However. in al1 geographic zones, both cuckoo species parasitized a significantly greater proportion of hosts that produced blue- green eggs than was available to them from the host pool (NE, p = 0.0 1 16; NW, p = 0.0249;

CW, p = 0.0445: CE, p = 0.0054 for the Yellow-billed Cuckoo and p = 0.0048 for the

Black-billed Cuckoo: SW, p = 0.0479: SE, p = 0.0128; Fisher's exact test). This indicates that in terms of egg coloration, actual host species used by Yellow-billed and Black-billed cuckoos are not representational of the potential host pool. These results suggest that both cuckoo species rnay be selecting hosts based on their egg color. and support an hypothesis of egg mimicry. Reports of Yellow-billed Cuckoo eggs laid and hatched in Mouming Dove nests (Nickel1 1954b, Wolfe 1994) are problematic. Hypothetically. the Mouming Dove should not be considered a potential host because it feeds its nestlings crop milk, an unsuitable diet for primarily insectivorous nestling cuckoos. However, the deposition of cuckoo eggs in dove nests may represent failed attempts at intraspecific parasitism in which the female cuckoo intended to parasitize the nest of another Yellow-billed Cuckoo. Both species build TABLE2.1. Families and subfarnilies of potential hosts of Yellow-billed and Black- billed cuckoos and their egg type in terms of degree of match exhibited. The Mouming

Dove (Columbidae) has been included for illustrative purposes, but see the text for a discussion of its suitability as a host species.

Cuckoo species Egg tY Pe

------Fami 1y Subfamily Yellow-bilfed Black-billed No match Match

Columbidae

Cuculidae

Tyrannidae Fluvicolinae

Tyranninae

Corvidae

Muscicapidae Turdinae

Mimidae

Bombycillidae

Laniidae Laniinae

Vireonidae Vireoninae

Emberizidae Pamlinae

Thraupinae

Cardinalinae TABLE2.1. Potential host family and subfarnily continued.

Cuckoo species Egg type

Famil y Subfarnily Yellow-billed Black-billed No match Match

- - Emberizidae Emberizinae 10

Ic terinae 2

-. a The host species is the Black-billed Cuckoo. No other cuckoo species fulfills the criteria for potential host species. Intraspecific pansitism was not considered. b The host species is the Yellow-billed Cuckoo. See footnote a. T.GLE 2.2. Numbers of actual host species used by Yellow-biiled and Black-billed cuckoos and in the potentiai host species pool and their egg types in each geographic zone. See the text for a description of geographic zones.

Egg type of actual hosts Egg type of potential

hosts

------Geographic zone Cuckoo species No match Match No match Match

Northwest Black-billed 1 5 24 8

Northeast B lack-billed 3 6 33 12

Central-west Black-billed 1 3 18 4

Central-east Black-billed 3 7 39 Il

Yellow-billed 3 7 38 11

Southwest Yellow-billed 2 3 34 4

Southeast Yellow-biIIed 3 5 3 1 6 a similarly sized, loosely constructed platform of sticks, placed in shrubs or smail trees (Harrison 1975). However, the inclusion or exclusion of the as an actual or potential host species does not affect the significant outcome of these analyses.

DISCUSSION It is generally accepted that the ancestral cuckoo was nonparasitic (Berger 1960. Seibel 1988, Hughes 1996b, see dso Chapter 1, this dissertation) and laid imrnaculate white

eggs (Friedmann 1964) and. hence, the blue-green egg coior exhibited by Coccyzus cuckoos is not plesiomorphic. In fact. al1 7 1 species of nonparasitic cuckoos lay unmarked white eggs (Oates 1903, Bond 1960, Smythies 1968, Wyllie 1981, Rowan 1983, Ali and Ripley 1987. Ehrlich et al. 1988. Stiles and Skutch 1989). and the bluish eggs of commundly breeding anis (Cuculidae. Crotophaginae) are white when fint laid (L. F. Kiff, in litt.). In contrat, immaculate, white eggs are rare among obligately parasitic cuckoos. Blue or blue- green eggs are more common, and have been found in many cuckoo species to mimic the eggs of frequently used hosts (e.g., Banneman 1933. Friedmann 1964. Wyllie 198 1. Rowan 1983, Moksnes et al. 1995). Host egg rnimicry can be found in al1 genera of parasitic cuckoos (Wyllie 1981)- with possible exception of the New World parasites T~pernand Dromococcyx. Most workers agree that egg mirnicry has evolved in response to the selective pressure of hosts that are able to discriminate between the cuckoo's and their own eggs. Mimetic eggs are less likely to be discovered, and subsequently destroyed. by a rejecting host (Rothstein L990). Davies and Brooke (1988) have shown that egg rejection behavior will only &se in a host species that is frequently parasitized, since it may be reproductively "less expensive" to accept a rare case of parasitism than to risk the greater losses resulting from rejecting an

egg in an unparasitized clutch by mistake. Under low levels of parasitism (< 2%) it may

take considerable time for rejection behavior to become fixed in a host population (Davies and Brooke 1989). and prior to this. there will be no selective pressure for the evolution of egg rnimicry in a parasitic species (Rothstein 1990). Presently, interspecific brood parasitism by Yellow-billed and Black-billed cuckoos is uncornmon. In a 13- study during which a total of 39 nests were observed, Nolan and Thompson (1975) reported only one case of interfamilial parasitism (Yellow-billed Cuckoo X Rufous-sided Towhee) and three cases of intrageneric parasitism (Yellow-billed X Black-billed cuckoos). So how can egg mimicry in Coccyzus, suggested by the results of the present analysis, be explained? A review of the taxonornic status of this genus may provide clarification. The most widely accepted classification of cuckoos, based on Peters (1940), places Coccyzus in a large, diverse subfarnily of nonparasitic cuckoos (Phaenicophaeinae) of both New and Old World distribution. Peters rnay have allied Coccyzus with New World genera such as Piayn and Snurorhera, based on purported similarities in behavior and vocalizations, distribution, and non-obligatefy parasitic breeding strategies (Berger 1960). However, Peters himself admitted dissatisfaction with the Phaenicophaeinae, cailing it a

"catch-dl" group (Berger 1952). Behavioral and vocal similarities between Coccyzus and New World phaenicophaeine cuckoos have never been shown to be homologous. In fact, many aspects of Coccyzus behavior and ecology strongly link this genus to the Old World obligate parasites (Hughes 1996b). Peters' classification has not been corroborated by

recent phylogenetic analyses. Both Seibel's ( 1988) and Hughes' (subrnitted, see also

Chapter 1, this dissertation) assay of osteological chancters and Hughes' (1996b) analysis based on behavior and ecology place Coccyzirs in the monophyletic Cuculinae, a clade comprising al1 obligately parasitic cuckoos. Furthemore, many earlier workers allied Coccyzus with the Cuculinae, based on interna1 anatomy, osteology, myology, and

pterylosis (e-g., Shufeldt 190 1, Shelley 189 1, Pycraft 1903, Chandler 19 16, Verheyen 1956a, Berger 1960, see Hughes 1996b for a review). This taxonomic position suggests that the ancestor of Coccyzns was an obligate parasite, therefore, the parasitic behavior of Coccyzrrs represents a loss of obligate parasitic behavior rather than the development of facultative parasitism from a nonparasitic ancestor. If the ancestor of Coccyzus was an obligate parasite. it is not surprising that this genus shares many life-history traits with the Cuculinae that are adaptive to a pansitic life style. including: (1) the disassociation of egg laying from the "normal" sequence of courtship. nest construction, egg laying, incubation and care of young (Kendeigh 1952, after Hemck 19 IO); (2) a short incubation period that would allow a parasite chick to hatch before the host chick (Hamilton and Onans 1965, Payne 1977); (3) a short nestling period to abbreviate the time that a parasite is dependent on its foster parents; (4) nestlings with an omnivorous diet that wouid be compatible with those of a large number of potential host species (Hamilton and Onans 1965); (5) a delayed breeding season that adds stability to the paras ite-host relationship by allowing the host to raise their first brood successfully , unaffected by parasitism (May and Robinson 1985); and (6)a constant readiness to breed, within season, in response to exogenous stimuli such as resource availability (Hamilton and Hamilton 1965. Ralph 1975). In addition, a Black-billed Cuckoo nestling has been observed ejecting Chipping Sparrow nestlings from a host nest (Macon and Macon 1909). Hamilton and Hamilton (1965) and Lack (1968) have suggested that some of the aforementioned traits are not associated with the evolution of brood parasitism but are adaptations to an unpredictable food supply, primarily caterpillars. However, several

studies have shown that Yellow-billed Cuckoos may not have ngorous dietary constraints.

Laymon ( 1980) and Potter (1980) observed adult cuckoos feeding young a wide variety of prey items and noted that they made little to occasional use of caterpillars which were abundant near nest sites. Likewise, Hamilton and Hamilton (1965) concluded that populations in were breeding at a much lower density than would be indicated by the food supply. They noted that although the cuckoos showed a preference for

lepidopterous larvae, they were not restricted to them. In addition, at least two Coccyzus species, Yellow-billed (Potter 1980) and Dwarf (Ralph 1975) cuckoos, molt during the nesting cycle rather than after it, implying that the adult birds are not facing limited resource availability during the breeding season. In Coccyzris cuckoos, the "disassociation" of egg laying from the normal breeding cycle is often manifested in the "wasting" of eggs by laying them on the ground prior to nest building (Ralph 1975). dropping them into unfinished nests (Spencer 1943, Ralph 1975, Potter 1980), or laying hem well after earlier laid eggs have hatched (Bent 1940). It seems counterintuitive that such behavior would be adaptive in a nonpansitic bird.

Evidence of egg mimicry in Yellow-billed and Black-billed cuckoos also suggests that their present definition as occasional facultative parasites is inaccurate and supports the

hypothesis that the ancestral Coccyzus was an obligate brood parasite. Accordingly, defenses arnong some commonly used host species in al1 probability evolved. Rothstein

( 1975) demonstrated that many cm be categorized as "accepters" or "rejectea" of Brown-headed Cowbird eggs. This North American obligate brood parasite lays heavily maculated grayish-white eggs (Ehrlich et al. 1988). Egg-replacement experiments have shown that although rejecter species discriminate against aiien eggs based on differences in size, ground color, and rnaculation, size is the least important parameter eliciting eventual egg ejection by the host (Rothstein 1982). Surprisingly. of the dozen or so rejecter species identified by Rohwer and Spaw (1988). al1 species that lay blue-green eggs and nest concunently and syrnpatrically with the cuckoos are arnong their most frequently reponed hosts. These host species have eggs that differ from cuckoo eggs primarily in size. Since parasitic eggs are generally ejected within 24 hours of parasitism. the discovery of a cuckoo

egg in a host nest suggests that the egg has been accepted and that egg mirnicry has been an effective response to the host-rejection defense. Whether cuckoos parasitize rejecter

species whose eggs do not match theirs, such as the Eastern Kingbird (Tyrannus venicalk), Logperhead Shrike (Lanius frrdovicianus),and Brown Thrasher (Toxostomo nifum; Rohwer and Spaw 1988), is unknown. It may be that parasitism is occumng and ill-matching cuckoo eggs are being ejected, or that these species are not being used as hosts. Among cuckoos, obligate parasitism is a derived character (Berger 1960, Seibel 1988, Hughes 1996b. Hughes submitted, see also Chapter 1. this dissertation) that may not have evolved until the emergence of birds during the Miocene (Olson 1985) provided suitable hosts. If the Cuculinae originated in the Old World (Seibel 1988). the ancestral Coccyzus io fint colonize the New World myhave been an obligate parasite that specidized on hosts laying blue-green eggs. The selective factors involved in the revend of obligate parasitism in this genus remain an enigma. However, some ches may be revealed by considering the general scarcity of obligate parasitism among New World cuckoos. Despite the ubiquity of potential passenne hosts, particulariy in the Neotropics, there are only three obligately parasitic species of New World cuckoos. This is in contrast to 47 species in the Old World. Correcting for geographic land area upholds this difference among the obligate parasites (p = 0.0021; Fisher's exact test) but, surprisingly, reveals similar species richness of nonparasitic cuckoos in New World and Old World regions

(Table 2.3). It is possible that selective pressures involved in suppressing rates, or exacerbating extinction rates, among ancestral obligate parasites of the New World may have also been a factor in the loss of obligate parasitism in Coccynls. Obligate brood parasitism occurs in three and four avian families in the New World and Old World, respectively; only the Cuculinae are found in both regions. Despite some among obligate parasites of different families, only the New World cuckoos and (Molothr~isspp.) face significant overlap in host usage. In the Neotropics, over 60% of Striped Cuckoo (Tapera naevia) hosts are also frequented by Bronzed and Shiny cowbirds (Molothrus aeneus and M. bonariensis). In addition, these cowbirds also share many hosts with both species of the cuculid genus Dromococcyx (e.g., Friedmann 1933. 1966, Neunteufel 195 1, Schonwetter 1964, Friedmann et al. 1977, Sick 1993). In North

Arnerica, al1 species parasitized by Yellow-billed and Black-billed cuckoos are also used by the Brown-headed Cowbird (Friedmann 1963, 1966, Friedmann et al. 1977). If these general patterns of host usage existed in the early radiation of parasitic cuckoos in the New World, competition for host nests may have played a role in limiting their overall success. Cowbirds could be formidable cornpetitors in regions of sympatry. The Brown-headed TABLE2.3. Number of obligateiy and facultatively parasitic and nonparasitic cuckoos in New and Old World regions per 4 1 million km2 land area.

Nurnber of species

New World Old World

- - Obligately parasitic cuckoos

Facultatively parasitic cuckoos

Nonparasitic cuckoos

Note: With additional study, other purportedly nonparasitic cuckoos may prove to be facultative parasites. Cowbird can lay over 40 eggs per season and is abundant throughout most of its range (Scott and Ankney 1983). Parasitism levels rnay approach 100% in local areas (Friedmann 1963). Though somewhat Iess generdized in host selection, Bronzed and Shiny cowbirds exhibit similar fecundity (Wiley 1985, Carter 1986). In contrast, parasitic cuckoos are uncornmon birds that lay only 10-25 eggs per season (Payne 1977). Locd parasitism levels by cuckoos may exceed 20% (M. G. Brooker, in litt.), but are generdly below 5% (Payne and Payne 1967, Payne 1977, Brooke and Davies 1987).

The relative ages of the genera Coccyzus and Molothrns are unknown. As a result, I am unabie to ascenain if the paucity of New World obligately pansitic cuckoos is the result of cornpetitive exclusion by a more recently evolved cowbird or resistance to invasion from

Old World cuckoos by an ancestral cowbird that would aiready be fidyestablished as an obligate brood parasite in the New World. Regardless, the role of cowbirds in the limitation of New World obligately parasitic cuckoos warrants additional consideration. In

addition, future phylogenetic assays may confirm the taxonornic position of Coccyzus among the obligate parasites of the Cuculinae, thereby providing the most parsimonious

explanation for the many life-history traits that this genus shares with the Old World

parasitic cuckoos. This would support the hypothesis that egg mimicry in Coccyzus is not a preadaptation to an evolving parasitic life style but the efficacious artifact of an ancestral breeding straiegy, the rernains of a long-standing relationship between parasite and host. -- CHAPTER 3: Phylogeny and histoncal biogeography of the genus Coccyzus inferred from osteology and cytochrome b sequences.

Absrract. - Cocqzus comprises nine cuckoo species that breed from southem Canada to central South America. 1 reconstmcted the phylogeny of this genus using 14 skeletal characters and 1,032 base-pairs of the cytochrome b gene. Exhaustive parsimony analyses of both data sets resulted in the same optimal topology (skeletai data: CI = 1.00; gene sequences: CI = 0.85). as did rnolecular data when analyzed alone by Neighbor-joining and Maximum Likelihood. 1 subsequently optimized five morphological characters (e.g., tail plumage, color of bill and soft parts; CI = 1.00) on the shortest-length tree to: ( 1) resolve a polytomy created by one species missing from each respective analysis, and (2) to hypothesize the position of another species For which specimens were unavailable. The optimal topology supports a Neotropical ongin for the genus. Several vicariant and colonization events were likely responsible for the distribution of five South American endemic species. The had two major northward routes out of South America: (1) dong both sfopes of to Mexico, and (2) through the West Indies to Florida. The Cuckoo diverged from ancestral stock inhabiting the Pacific Slope of Central America. Yellow-billed and Black-billed cuckoos are highly divergent, and each repnsents a sepante invasion of North America from South America.

INTRODUCTION

The genus Coccyzus is comprised of nine species of New World cuckoos that are distributed from central North America south to . Five species are endemic to

South America, two occur predominantly at Central Amencan latitudes, and two species are long-distance migrants that maintain winter distributions in the Neotropics (Sibley and Monroe 1990). These slim-bodied. long-taiied birds range from 20-30 cm in length. Most

species have grayish-brown or rufous upperpaits with paler underparts that are pearly-white to deep buff in coloration (Hilty and Brown 1986). Superficially these cuckoos appear rnorphologically similar; however, closer examination reveals obvious differences in bill color, orbital ring and iris color, and undenail markings.

Coccyius cuckoos are generally birds of open woodland and scrub habitats (Hilty and Brown 1986. Ridgely and Gwynne 1989). and are seldom seen in dense forest, except in edge habitats where hurnan activities have opened previously inaccessible areas (Ralph L975). These cuckoos feed chiefly on . and most show a preference for hairy caterpillars. Some workers have suggested that the delayed breeding season and variable clutch size of some species may be correlated with outbreaks (Hamilton and

Hamilton 1965. Ralph 1975. Sealy 1978). Others (Fleischer et al. 1985, Hughes 1996b,

Hughes 1997b, see also Chapter 1 and 2, this dissertation) have speculated that these and other breeding peculiarities may be associated with the facultative brood parasitic behavior

that is exhibited by at least four Coccyz~tsspecies (Nolan and Thompson 1975, Fleischer et al. 1985, Ralph 1975, Sick 1993).

Coccyz~iscuckoos have furtive, unobtmsive habits, and generally occur solitarily. Most remain quiet during the non-breeding season. Even when breeding, they usually perch motionlessly, wel1 conceaied in low vegetation (Hamilton and Hamilton 1965. Hilty

and Brown 1986) and, hence, are often overlooked in density counts and nest surveys (Ervin 1989). As a result, the breeding biology, seasonal movements, and population

structure of most Coccyzus species are poorly known. Al1 aspects of life history of some South American species, such as Pearly-breasted and Ash-colored cuckoos, have yet to be addressed scientifically. Also where congeners are sympatric, the nature of ecological separation between species has not been investigated (Hughes 1997a).

Seven of nine Coccyzus species are considered monotypic. In some classifications, the Yellow-billed Cuckoo and Mangrove Cuckoo have been divided into 2 and 14

subspecies, respectively (Peters 1940. Howard and Moore 199 1). However. polytypy of both species has recently been questioned (Banks 1988, Banks and Hole 1991). In al1 cases, the geographic and genetic variation within every Coccyzus species is poorly known. More study is required before a definitive statement can be made regarding subspecies. The evolutionary relationships within Coccyzus have not been previously examined. One aim of this study is the phylogenetic reconstruction of Coccyzus using morphological and molecular data. Previously, cladistic analyses have used osteological characters to assay evolutionary relationships among cuckoos above the generic level (Seibel 1988, Hughes submitted, see also Chapter 1, this dissertation). The present study demonstrates that skeletal chancters may be equall y useful for producing hypotheses of phylogeny within a genus. 1 selected the mitochondrial cytochrome b gene for my molecular analysis because it evolves rapidly in birds and. therefore, is an appropriate choice for examining phylogenetic relationships among closely related species (Helm-Bychowski and Cracraft 1993. Hillis et al. 1996). I subsequently propose an hypothesis of origin and divergence for al1 nine species of Coccyus cuckoos w ithin a biogeographical frarnework.

MATERIALS AND METHODS

TAXONOMYAND DISTRIBUTION Nine species of the genus Coccyz~lswem recognized in this study: Dwarf Cuckoo (Cocqzus pumilris), As h-colored Cuckoo (C. cinereus), B lac k-billed Cuckoo (C. erythropthalmus). Gray-capped Cuckoo (C. lansbergi), Dark-billed Cuckoo (C.

melacorypltus), Mangrove Cuc koo ( C. minor), ( C. ferrugineus), Pearly- breasted Cuckoo (C. julieni = C. euleri; Banks 1988, but see Sibley and Monroe 1993), and Yellow-billed Cuckoo (C.arnericanus). This follows conventional taxonomy with possibly two exceptions. Several authors have considered the Pearly-breasted Cuckoo to be a South American subspecies of the Yellow-billed Cuckoo (e.g., Ridgway 1916, Cory 1919, Gyldenstolpe 1945). However. more recent classifications uphold its species status (Peters 1940, Morony et al. 1975; see Banks 1988), as does the present study. Likewise, some classifications recognize the species status of the Cocos Cuckoo, an endemic of Cocos Island off the Pacific Coast of (e-g., Sclater 1870, Ridgway 19 16, Amencan

Omithologists' Union 1983, Sibley and Monroe 1990); others consider it a subspecies of Mangrove Cuckoo (e.g., Peters 1940, Morony et al. 1975). Because neither Cocos Cuckoo skeletons nor tissue were available for this study, 1 was unable to resolve this same dilemma. However, a consideration of its external morphology from study skins and the literature has allowed me to propose an hypothesis regarding its relationship to other

Coccyzris species. Five Coccyzris species are South Amencan endemics. The Dwarf Cuckoo and

Gray-capped Cuckoo are restricted to northern and northem : although. the Gray-capped Cuckoo migrates south in winter. at least in part, to southwestern and western (Hilty and Brown 1986). Also, there are a few sight records for these two species in eastern (Ridgely and Gwynne 1989). In contrast. the Ash-colored Cuckoo has a more southerly distribution, occupying South America east of the Andes frorn Uruguay to central Argentina (Meyer de Schauensee 1982). This species is thought to winter in southeastem Peru and northeastem (Sibley and Monroe 1990). The Dark-billed Cuckoo and Pearly-breasted Cuckoo have larger ranges in South America than do the above species. Both species range from the Caribbem Coast south to northern Argentina. The Pearly-breasted Cuckoo is restricted to lowlands east of the Andes, whereas, the Dark-billed Cuckoo also occurs West of the Andes and on the Galapagos Islands (Meyer de Schauensee 1982). The Mangrove Cuckoo has a limited distribution in lowland regions of northern South America. This species also occurs on both the Pacific and slopes of Mexico and Central America, and most West Indian islands north to southem Florida. Florida populations of the Mangrove Cuckoo were once thought to be migratory; however, numerous winter sightings support resident status in both Florida and the rernainder of its range (Hughes 1997a). The Cocos Cuckoo is endemic to Cocos Island located about 500 km southwest of the Pacific Coast of Costa Rica (Sibley and Monroe 1990). Black-billed and Yellow-billed cuckoos are long distance migrants that breed in North America and winter in the Neotropics. The Black-billed Cuckoo has the more northerly breeding range. extending from southern Canada east of the Rocky Mountains to the south central United States; whereas, the Yellow-billed Cuckoo breeds as far south as northern Mexico and the Greater Antilles. The Yellow-billed Cuckoo winters from northern South America south to northern Argentina. The Black-billed Cuckoo occurs from northern Colombia and Venezuela south to northern Pem and southem Boliva in winter (Meyer de Schauensee 1982).

OUTGROUPS Selection of an appropriate outgroup for rooting trees in this analysis presented some difficulties. Traditionally, Coccyzrls has been classified with nonparasitic cuckoos in the Phaenicophaeinae (e.g, Peters 1940) or Coccyzidae (= Coccyzinae; Sibley and Monroe 1990). These classifications imply that a nonparasitic New World genus, such as Piaya, is the sister taon to Coccyzus. However, three phylogenetic analyses based on behavior and osteology indicate that Coccyzrts should be placed with the obligate parasites in the Cuculinae (Seibel 1988, Hughes 1996b, Hughes submitted. see also Chapter 1, this dissertation). Hence, a plesiornorphic obligate brood parasite, such as Clamator,

Oxyloplzcis. or Tapera, may represent the sister group. 1 chose to include in my preliminary analyses individuals from al1 purported sister taxa for which skeletal and tissue specimens, or published cytochrome b sequences were available. See Appendix 3.1 for specimens used.

S KELETAL PHYLOGENY

Taxa. - Cornplete skeletons were available for five Coccyzus species: Black-billed Cuckoo. Gray-capped Cuckoo. Dark-billed Cuckoo, Mangrove Cuckoo, and Yellow-billed

Cuckoo. A partial skeleton of the Dwarf Cuckoo was missing the skull, wing, and lower hind limb elemenis. Four or more specimens were examined for al1 aforementioned taxa, except the Dwarf Cuckoo and Gray-capped Cuckoo for which only single specimens were available. Skeletons of the Ash-colored Cuckoo. Pearly-breasted Cuckoo, and Cocos Cuckoo were unavailable for this study. See Appendix 3.1 for a list of specimens used. Churacters. - Fourteen osteological characters were used to reconstruct a phylogeny of the genus Coccyzus (Appendix 3.2). Osteological nomenclature follows

Baume1 and Wiuner ( 1993). Characters were polarized into plesiornorphic and apomorphic states through outgroup compaiison. Charactee for which information was unavailable or irretreivable for particular taxa were coded as rnissing (?). A 6 x 14 data matrix depicting al1 assigned character state codes for ingroup taxa cm be found in Table 3.1. Tree derivation and anaiysis. - Trees were constructed using the cornputer prograrn PAUP 3.1 (Phylogenetic Analysis Using Parsimony: Swofford 1993) on an Apple Macintosh 660AV. Supplementary tree and character analyses were performed using MacClade 3.01 (Maddison and Maddison 1992). Optimal trees were found by an exhaustive search. MAXTREES was set at 1,000 trees with automatic increase. Zero- length branches were collapsed to yield polytornies. Al1 characters were given equai weight. Separate analyses were performed using dl character state optimization schernes (ACCTRAN, DELTRAN, MINF). Implementing these different options did not affect the final outcome of the analysis. Suboptimal trees were calculated by "keeping" al1 trees a

specified number of steps longer than the minimal tree. Character consistency indices (CI), retention indices (RI), and rescaled consistency indices (RC)were calculated.

DNA SEQUENCMG Tm.- Liver tissue was available for seven Coccyzris species. Ti ssue from th Dwarf Cuckoo and Cocos Cuckoo was unavailable for this study. Two or more specimens were sequenced for the Yellow-billed Cuckoo. B lack-billed Cuckoo, Dark-billed Cuckoo, and Gray-capped Cuc koo. No intraspecific variation was found and, therefore, only one TABLE3.1. Data matrix indicating character States among six Coccyzus species for 14 skeletal chamcters. A "?" indicates missing data because of incomplete or damaged skeletal material. See Appendix 3.2 for character descriptions.

Characters

S pecies 1 2 3 4 5 6 7 8 9 IO 11 12 13 14

Yellow-billed Cuckoo 1 1 1 1 1 1 1 1 1 1 1 1 1 1

Mangrove Cuckoo 111Lllt11101111

Dark-billed Cuckoo 11000110111110

Gray-capped Cuckoo O O O O O O 1 O 1 1 O 1 O O

B lack-billed Cuckoo 00000000100100

Dwarf Cuckoo 00?200000000?? representative from each species was used for subsequent phy logenetic analyses. See Appendix 3.1.

DNA extraction, amplification. and sequencing. - Genomic DNA was extracted in a solution of 0.1% SDS, lOOmM Tris-HCl (pH 8.0), 1OOrnM NaCl, lOmh4 EDTA and lOrng/rnl proteinase K. After 12 hours at 5S°C. the extract was purified using tris-HC1 saturated buffered phenol and a chloroform/isoamyl solution. The cytochrome b gene was arnplified in three overlapping segments with the polymerase chah reaction (PCR)using a combination of six oligonucleotide primers: L 14990 and H 15298. L 152 12 and H 15649, and Li5578 and Hl6065 (Friesen et al. 1996). The segments were sequenced using the Amplicycle sequencing kit (Perkin-Elmer) and primers H 15298. L 152 12, H 15649, L 15578, and H 16065- Tree derivotion and analysis. - Sequences were aligned manually using the cornputer program ESEE 3 (Cabot and Beckenbach 1989). Alignment presented no difficulties as the sequences were highly sirnilar and did not have gaps. Maximum parsimony estimate of phylogeny was performed using PAUP (Swofford 1993). and subsequent tree and character analyses were executed using MacClade (Maddison and Maddison 1992). Trees were constmcted by an exhaustive search. Software parameters were selected as outlined above for skeletal character tree derivation and analysis. Separate analyses constructed trees using unweighted, 2: 1, 5: 1, and 10: 1 transversion to transition weighting schemes. An additional analysis adopted a weighting ratio of 22: 1 for first, second, and third codon positions, respectively. Bootstrap (Felsenstein 1985) and gl (Hillis and Huelsenbeck 1992) analyses were not performed, because they have been shown to be ineffective at estimating nodal stability and phylogenetic signal (Murphy and Doyle, in press). Maximum likelihood estimates were performed using the DNAml8 1 computer program from PHYLIP version 3.5~(Felsenstein 1993). A 240- 1 transition to uansversion substitution ratio and the global rearrangment option were implemented. DNA distance values based on Kimura's "two-parameter" mode1 (1980) were calculated using the DNAdist program from the PHYLIP package. The resulting distance matrix was input into the NEIGHBOR program of PHYLIP to constnict a tree using the Neighbor-joining method

(Saitou and Nei 1987).

EXTERNAL MORPHOLOGY

Descriptions of plumage and soft parts were obtained for ail nine Coccyzus species from the literature and personal examination of study skins. Five morphologicd characters (Table 3.2) were optimized on trees resulting from the osteological and molecular analyses to: ( 1) resolve potential polytomies created by taxa missing from each respective analysis, and (2) hypothesize a placement for the Cocos Cuckoo for which tissue or skeletal matenal was unavaiiable.

RESULTS Skrlerczl clzaracters. - Parsimony analysis of 14 osteological characters yielded one fully-resolved shortest-length tree of 16 steps (CI = 1.00, RI = 1.00, RC = 1.00; Fig. 3.1). The same optimal tree was generated using a11 outgroups. A character change list cm be found in Appendix 3.3. On the optimal tree, the Yellow-billed Cuckoo and Mangrove Cuckoo are sister species forming the top of the tree. The Dark-billed Cuckoo is sister to this clade. followed by the Gray-capped Cuckoo. The Dwarf Cuckoo, a South Amencan endemic. occupies the basal position. The Black-billed Cuckoo is positioned adjacent to this basal species. Interestingiy, the Yellow-billed Cuckoo and Black-billed Cuckoo, two migratory species that breed predominately in Nonh Arnenca, are highly divergent. DNA andyses. - One thousand fifty-one nucleotides of mtDNA cytochrome b gene were sequenced. The first 19 sites were deleted from the data set because they could not be sequenced successfully in al1 taxa with the primers used. The percentages of each TABLE3.2. Character States of nine Coccyzus species for five morphological characters optirnized on shortest-length uee (Fig. 3.3). Data from Ridgway (19 16), Raiph (1975), Meyer de Schauensee and Phelps (1978), Thomas (1978). Meyer de Schauensee

(1982), Hilty and Brown (1986), Ridgely and Gwynne (1989), Stiles and Skutch (19891

Sick (1993). Haverschmidt and Mees (1994). study skins in the Royal Ontario Museum, and L. R. Bevier and R. S. Ridgley (pers. cornrn.).

Mandible Orbital ring fis color Gnduated White tips S pec ies color color tail on rectrices

Yellow-bilied Cuckoo Yellow Gray Dark brown Yes Broad

Pearly-breasted Cuckoo Yeilow Gray Dark brown Yes Broad

Mangrove Cucko~ Yellow Yellow Dark brown Yes Broad

Cocos Cuckoo Yellow Yellow Dark brown Yes Broad

Dmk-billed Cuckoo Black Gray Dark brown Yes Broad

Gray-capped Cuckoo Black Gray Dark brown Yes Broad

B Iack-billed Cuckoo Black Red Dark brown Yes Narrow

Ash-colored Cuc koo Black Red Red No Narrow

Dwarf Cuckoo Black Red Red No Narrow Figure 3.1. Optimal tree for six Coccyzus species based on 14 skeletal characters (CI = 1.00, RI = 1.00). nucleotide for seven ingroup species were: adenine (28.8%),cytosine (35.0%), guanine

( 12.5%), and thymine (23.7%). One hundred and ninety-one nucleotide positions exhibited variation within the ingroup. The transition to transversion ratio was approximately 3.24: 1 for al1 sites. These taxa exhibited a strong bias for synonymous transition substitutions, panicularly in the third codon position (Table 3.3). Sites with variation in only one ingroup species, where that state was not in any outgroup taxon. were considered autapomorphic -and excluded from subsequent analyses. Taxa with high levels of autapomorphy may cluster in parsimony analysis, thereby, produc ing inaccurate es timates of phy logeny (Felsenstein 1978). One hundred and fifteen positions were potentially phylogenetically informative. Painvise distance sumrnaries are shown in Table 3.4. Cytochrome b sequences for ingroup taxa are listed in Appendix 3.4. Parsirnony analysis of cytochrome b sequences resulted in one fully-resolved shortest-Iength tree (Fig. 3.2; length = 253 steps, CI = 0.846. RI = 0.642, RC = 0.543). This optimal tree also resulted from al1 analyses using different transversion to transition weighting schemes, and al1 outgroups. Searches in which first, second, and third codon positions were weighted with 2:2:1 ratios yielded the preferred tree with al1 but one outgroup, the Striped Cuckoo (Tapera naevia). A strict consensus of three multiple equally parsimonious shortest-length trees produced using this outgroup lacked resolution in the position of the Dark-billed Cuckoo and Black-billed Cuckoo. The Maximum Likelihood and Neighbor-joining analyses also produced the preferred topology (Fig. 3.2). The optimal tree constructed from molecular evidence (Fig. 3.2) has the same general topology as that derived from skeletal data (Fig. 3.1). with the exception of the Dwarf Cuckoo for which no tissue was available. With the addition of two taxa for which skeletons were unavailable, the Ash-colored Cuckoo takes the basal position on the tree and the Pearly-breasted Cuckoo becomes the sister species to the Yellow-billed Cuckoo. The Mangrove Cuckoo is the sister species to this clade, followed by the Dark-billed Cuckoo and Gray-capped Cuckoo as one progresses towards the base of the tree. As in Fig. 3.1, the TABLE3.3. Numbers of synonymous and nonsynonymous transitions and transverçions in first, second, and third codon positions.

Transitions Transversions

Poskion Synonymous Nonsynonymous Synonymous Nonsynonymous

First

Second

Third

Overall TABLE3.4. Matrix of pairwise estimates of genetic distance based on Kirnura's

( 1980) 2-parameter model.

-. - . ------Species 1 2 3 4 5 6 7

Yellow-billed Cuckoo

Pearly-breasted Cuckoo

Mangrove Cuckoo

Dark-billed Cuckoo

Gray-capped Cuckoo

Black-billed Cuckoo

Ash-colored Cuckoo Cuckoo

Cuckoo

Gray-capped Cuckoo

Cuckoo Po, -E :b

Mangrove Cuckoo

Pearly-breasted Cuckoo

-Yellow-billed Cuckoo molecular data tree has a South Arnerican endemic, in this case the Ash-colored Cuckoo, in the basal position with the Black-billed Cuckoo positioned adjacent to it. Externul rnorphology. - The merging of the topologies in Figs. 3.1 and 3.2 results in a polytomy at the base of the tree because tissue and skeletal specimens were not available for both basal taxa (i.e., Dwarf Cuckoo and Ash-colored Cuckoo). However, by optimizing five morphological characters (Table 3.2) on the shortest-length tree, 1 conciuded that these two species form a basal clade that is defined by two synapomorphies: red iris in adult and tail not strongly graduated. I had no skeletai or rnolecular evidence to determine if the Cocos Cuckoo and Mangrove Cuckoo are conspecific; however, the presence of one morphological synapomorphy, orbital ring yellow in adult. supports the hypothesis that the Cocos Cuckoo is best placed in a clade with the Mangrove Cuckoo. Al1 morphological characters can be optimized on the combined data tree as indicated in Fig. 3.3 with CIs of 1.00. On this topology. three species ((Dwarf Cuckoo,

Ash-colored Cuckoo), Black-billed Cuckoo) characterized by red orbital rings and narrow tail spots are basal to the clade with broad tail spots and gray orbital rings (with the exception of the interna1 clade with yellow orbital rings): (Gray-capped Cuckoo. (Dark- billed Cuckoo. ((Cocos Cuckoo, Mangrove Cuckoo), (Pearly-breasted Cuckoo, Yellow- billed Cuckoo)))). Within the broad tail spot group, is a clade of four taxa defined by their yellow lower mandibles: ((Cocos Cuckoo, Mangrove Cuckoo). (Pearly-breasted Cuckoo, Yellow-billed Cuckoo)).

DISCUSSION

HISTORICALSYSTEMATICS

The genus Coccyzus was first established in 1816 by Vieillot to include two South American species: the Ash-colored Cuckoo and Dark-billed Cuckoo (Vieillot 1817).

Although three Coccyz~sspecies had been described rnany years earlier, the Yellow-billed

Cuckoo (Linnaeus 1758). Mangrove Cuckoo (Gmelin 1788). and Black-billed Cuckoo 1 L L yellow - -

orbital ring A I tail not yellow lower - - strongly tmandible I graduated - - red iris

- - gray orbital ring broad lail spols

dark brown iris ..' tI red orbital ring - - narrow tail spots - .- Figure 3.3. Hypothesis of phylogeny for nine Coccyzus species black lower rnandible - - based on skeletal characters, cytochrome b sequences, and strongly graduated tail - - external morphology. (Wilson 18 11) had been placed in the genus Cuculus, a taon now restricted to 14 species (Howard and Moore 199 1) of Old World obligate brood parasites. In the following decades four more Coccyzus species were described (Cocos Cuckoo, Gould 1843; Gray-capped Cuckoo, Bonaparte 1850; Dwarf Cuckoo, Strickland 1852; Pearly-breasted Cuckoo, Lawrence 1864), and those previously included in Cuculus were moved to Coccyzus (Black-billed Cuckoo and Yellow-billed Cuckoo, Boneparte 1824; Mangrove Cuckoo, Gray 1846). The species composition of the genus remained intact for many decades, albeit, with some differences of opinion regarding the taxonomie rank of a few species, such as the

Pearly-breasted and Cocos cuckoos (e.g., Bouchard 1876, Dubois 1902). Ridgway (19 12) erected the new genus Micrococcyx for the Dwarf (M. pumilus) and Ash-colored (M. cinereus) cuckoos based on purponed differences in tail and wing shape. Although this generic name was used in some older publications (e-g., Ridgway 1916,

Wetmore 1926, Pinto 1938). it has not been upheld in more recent classifications (e.g., Peters 1940, American Omithologists' Union 1983, Sibley and Monroe 1990). My analysis does not provide sufficient evidence to justify the resurrection of Micrococcyx; although, the Ash-colored Cuckoo is clearly the most divergent species in terrns of genetic distance (Table 3.4). Further molecular analyses including both Ash-colored and Dwarf cuckoo tissue are required to determine if these species are sufficiently divergent from the morphologically typical Coccyztis species to warrant placement in a separate genus. In a different vein, Sibley and Monroe (1990) indicated that the Dwarf and Ash-colored cuckoos may be conspecific. This level of affinity seems unlikely given the substantial differences

in plumage of the two taxa; however, my results do support their sister relationship as recognized by Sibley and Monroe. Some authors have suggested that the Dark-billed and Mangrove cuckoos may

comprise a superspecies (e-g., Stiles and Skutch 1989, Sibley and Monroe 1990; see dso American Ornithologists' Union 1983) most probably based on similarities in appearance, behavior, vocalizations (Hilty and Brown 1986, Ridgely and Gwynne 1989, ffrench 199 l), and sympatry in a limited part of their ranges (Haverschmidt and Mees 1994). This proposal is not supponed by my results, because these two species are paraphyletic in al1 of my analyses.

The Pearly-breasted Cuckoo was considered a subspecies (Southern Yellow-biiled Cuc koo; e.g.. Ridgway 19 16, Cory L 9 19) or junior (e.g., Shelley 189 1, Dubois

1902) of the Yellow-billed Cuckoo by some earlier authors. My hypothesis of phylogeny supports a sister relationship between these taxa; however, 1 suggest that they are probably sufficiently divergent genetically (Table 3.4) to support sepante species status.

BIOGEOGRAPHY Reconstructing the historical biogeography of many avian taxa is both a complex and perplexing endeavor. The speciation process is often rapid in birds, and may be completed in as few as 10.000 years (Selander 1971). Differences in plumage color and size, relative to Old World populations, were evident in House Sparrows (Passer domesticus) within 100 years of their introduction to North America (Selander and Johnston 1967). Confounding the task of interpreting current distribution patterns of avian species are range changes through dispersal. colonization of new habitat by founder individuals, secondary contact of previously isolated avifaunas. and extinction events that Iack fossil evidence (Haffer 1985).

Haffer (1974) suggested that faunal differentiation in South America occurred

rapidly in the Quatemary, particularly during the Iast million years. This was corroborated by Vuilleumier (1984, 1985b) who tracked Cenozoic faunal turnover using the known fossils and concluded that most extant South American genera likely had a Pliocene or Pleistocene origin. He noted increases in turnover rates at the generic level in the late Pleistocene, and suggested that this could reflect increases in allopatric speciation during that period. This rapid acceleration of speciation was probably most influenced by

changing palaeogeographical and climatic-vegetational conditions (Stute et al. 1995, Smith et al. 1997) as forest and non-forest biomes altemately expanded and contracted during glacial and interglacial episodes (e.g., Haffer 1967, 1969, 1974, 1982, 1985, 1987, Webb

1978, Schubert 1988, Behling 1995, Ferrazvicentini and Saigadolabouriau 1996). As many as 20 cycles of -forest replacement have been postulated for some lowland regions of South hencadunng the Quatemary (Van der Harnrnen 1982, 1991). These cycles, in terms of isolate formation and subsequent divergence of populations, have substantially influenced evolution at the species and subspecies level (e.g., Simpson and Haffer 1978, Vuilleurnier 1984, Haffer 1985, 1987). Consequently, many workers agree that the current distribution patterns of the Neotropical avifauna are predominantly the result of changing environmental conditions during the Pleistocene (e-g., Haffer 1974, 1985, Cracraft 1985,

Fjeldsa 1985, Nores 1992). Neorropics. - My hypothesis of phylogeny suggests that Dwarf and Ash-colored cuckoos are sister species that diverged first from ancestrai stock; thus, supponing a South American ongin for the genus. Presently, these two species occupy highly disjunct distributions on that continent: the Dwarf Cuckoo in northern Colombia and Venezuela, and the Ash-colored Cuckoo in central South America, south of Amazonia. Like other

Coccyzrls cuckoos. these species prefer moderately dry to arid habitats, such as gallery

forest, woodlots, shmbby pastures, with scattered trees. and xerophytic scmb (Short 1975, Meyer de Schauensee and Phelps 1978, Thomas 1978, Hilty and Brown 1986), and have only recently expanded into humid forest clearings and edge regions (Hayes 1995) made accessible by timber cutting and clearing for agriculture (Ralph 1975). The pattern of

disjunct distribution north and south of Amazonian rainforests exhibited by Dwarf and Ash- colored cuckoos is characteristic of many species of South American non-forest birds,

including some flycatchers (e.g., Fluvicola pica), pigeons (e.g., Columba spp.), parakeets (eg, Arutinga acuticauda), and finches (e.g., Sicalis flaveola; Haffer 1974, 1985, 1987), and suggests an earlier connection of non-forest habitats across the Amazon Valley (Haffer 1974). The Amazon Basin has experienced both expansions and contractions of forest habitats throughout the Pleistocene (e.g., Webb 1978, Cracraft L 985, Haffer 1985), and during drier periods much of the region probably developed into more open or lower types of forest (Prance 1987), and savanna habitats (Eden 1974, Marshall 1985, Martinelli et ai. 1996) that are favored by these cuckoos, and presumably their ancestor. Furthemore,

Webb (1978) and Marshail (1985) have suggested that during the early Pleistocene, a wide dispersai comdor located just estof the Andes existed around persistent Amazonian forest which served to connect large savanna and open forest habitats lying to the north and south of it. Hence. the Dwarf and Ash-colored cuckoos may be vicariant remnants of a widespread ancestral species that ranged from temperate to tropical South America. As dense forest returned to Arnazonia during a subsequent interglacial period, the ancestral species may have been subdivided into northem and southem allospecies. The persistence of dense Amazonia forest in more recent times has prevented these species from substantially extending their ranges.

The ancestral Coccyzlrs species rnay also have occupied non-forest regions West of the Andes in Colombia. Ecuador, and Peru. During glacial maxima. the equatorial lowlands may have been considerably drier than at present (Webb 1978), and hence, more favorable to these populations. Haffer ( 1967, 1974) has suggested that a dispersal corridor existed north of the Andes that allowed for continued between avian populations located West (trans-Andean) and east (cis-Andean) of the mountains. The corridor was particularly effective during glacial periods when sea levels were lower and, consequently, the Caribbean lowlands were more extensive (Bradbury et al. 1981, Gallup et al. 1994). The Black-billed Cuckoo may have diverged directly from trans-Andean ancestral stock; hence. the morphological sirnilarities between this species and the Dwarf and Ash-colored cuckoos (Table 3.2). The Black-billed Cuckoo is a long-distance migrant that maintains an over-wintering distribution in trans-Andean South America. The divergence of this species will be discussed further in a subsequent section of this paper. The Gray-capped Cuckoo is a trans-Andean species that breeds in arid coastal vegetation in Colombia and Venezuela, and winters in coastal Ecuador and Peru (Hilty and . Brown 1986, Sibley and Monroe 1990). Divergence from ancestral stock may have occurred following a vicariant event that divided cuckoo populations located West and east of the Andes. A sirnilar trans- and cis-Andean vicariant event is believed to have occurred early in the divergence of some lineages of toucans (Rarnphastinae) and woodpeckers (Picidae: Prum 1986). Northwestern Colombia has been identified as a zone of rapid environmental transition (Endler 1977, Brown 1987), but workers have had some difficulty identifying the vicaxiant event that isolated trans- and cis-Andean populations (Cracraft and Prum 1988). Chapman (1917, 1926) suggested that the uplift of the Andes was a significant factor in the fragmentation of once continuous Amazonian-Pacific lowland avian populations. However, the main uplift of the northem Andean Cordilleras occurred 5-3 M.Y. before Quatemary climatic fluctuations (Mégard 1992). The final uplift of the Eastern Andean Cordillera, believed to be the greatest barrrier between cis- and trans- Andean populations, had likely occurred by 2.74 f 0.63 M.Y.B.P. (Helmens and Van der Harnrnen 1994). Hence, Andean Uplift may have been too early an event to have played a significant role in allopatric speciation during the Pleistocene. Brumfield and Capparella

( 1996) demonstrated that some avian taxa exhibit little genetic divergence between cis- and trans-Andean populations and weakly rejected the role of Andean Uplift in Pleistocene species evolution. Haffer (1967, 1969, 1974, 1985, 1987), Cracraft (1985), and othen have suggested that during Quatemary climatic oscillations, expanding and contracting forest and savanna habitats fragmented the ranges of many species, thereby, isolating portions of ancestral stock in ecological refugia (areas of ) where they became extinct, survived unchanged, or diverged. As favorable conditions retumed during a subsequent climatic cycle, previously isolated populations expanded from refugia. This mode1 is most

frequently applied to South American forest birds, but is not restricted to it (Haffer 1974). The Gray-capped Cuckoo may be associated with the xerophytic Guajiran center of endernism in northem Colornbia and Venezuela (Cracraft 1985). This and other non-forest species could have been restricted to the area of endemism during a humid interglacial cycle by the expansion of unsuitable tropicd forest habitats. Alternatively, sea-levels 30-50 m above present levels (Haffer 1974) during interglacials rnay have flooded the lowland plains of northern Colombia, producing large Caribbean embayments in the Gulf of Venezuela-Maracaibo, and the Magdalena, Sinu, and Atrato rivers (Haffer 1967. 1974). This would effectively eliminate dispersal corridors between cis- and trans-Andean ancestral cuckoo populations and, consequently, the divergence of the Gray-capped Cuckoo could occur in isolation. The dispersal corridor may have been reestablished during a subsequent climatic cycle, resulting in secondary contact between Gray-capped and Dwarf cuckoos in trans-Andean Colombia. The Dark-billed Cuckoo likely diverged from tram-Andean ancestral stock and then dispened on both sides of the mountains. Dispersal northward around the Andes would have been facilitated by lower sea-levels dunng cold, hurnid glacial periods. Altematively, during dry periods, a non-forest dispersal corridor through the Andes may have existed southeastward from the upper Maraiion valley in Peru through the Ucayali-Huallaga vaileys into eastem Bolivia and central (Haffer 1974). The tendency of the Dark-billed Cuckoo for habitat generalism has favored the continuai. graduai extension of its range south to Argentina. Fitzpatrick ( 1980) found that generalists with a preference for forest- edge and scmb habitats had large distributions in South America that were not substantially affected by the boundaries of forest distribution. The subsequent dispersal of the Dark-billed Cuckoo frorn Pacific mainland South

America to the Galapagos may have occurred more recently, perhaps within the last 150

yean. Specimens were not collected in the Galapagos until 1888 (Ridgway 1890), at which time the species was considered a rare, and apparently, recent immigrant (Rothchild and Hartert 1902). Steadman ( 1986) failed to locate Dark-billed Cuckoo fossils in caves (< 2,400 years B.P.) on Isla Floreana, where this species is currently fairly common. . An examination of the morphology of the sternum of the Dark-billed Cuckoo indicates that this species is probably capable of long distance flights, such as those necessary for the colonization of the Galapagos Islands from mainland South America. Stemal keel depth is often used to predict flying abilities because the relative developrnent of the keel is directly related to the development of the two major flight muscles, Mm. pectoralis and supracoracoideus, that have their origins on the keel (George and Berger 1966). The ratio of keel depth to sternum length in the Dark-billed Cuckoo (0.520 f 0.0329; n = 5) is sirnilar to those of the Yellow-billed Cuckoo (0.532 + 0.0345; n = 9) and Black-billed Cuckoo (0.510 + 0.018; n = 7) which are both long distance migrants. Other migratory cuckoos, such as Cuculus, Clamator, and Chalcites have keel depth/stemum length ratios in excess of 0.48. In contrat, arboreal nonmigratory cuckoos of the West

Indies (e.g., Piaya and Saurothera) have keel deptNsternum ratios of 0.37 to 0.4 1 (see Chapter 1, this dissertation for further discussion of sternum dimensions in cuckoos). The Mangrove Cuckoo is primarily a species of lowland Middle America and the

West Indies (Hughes 1997a); however, it is also known to occur sporadically in northern South America from Colornbia (Hilty and Brown 1986) to northeastem Brazil (Meyer de Schauensee and Phelps 1978, Tostain et al. 1992, Haverschmidt and Mees 1994). Banks and Hole (1991) suggested that the Mangrove Cuckoo may be of West Indian origin; however, my hypothesis of phylogeny clearly indicates a South American origin for this species. Presently, the Mangrove Cuckoo is sympatric with the Dark-billed Cuckoo in coastal, Venezuela, the Guianas, northern Brazil, and Trinidad, but these species are likely well-separated ecologically. The Dark-billed Cuckoo is somewhat general in habitat

preference; whereas, the Mangrove Cuckoo tends to be restricted to coastal and lowland

areas where it is most commonly found in , thickets, and xerophytic scmb (Meyer de Schauensee and Phelps 1978, Hilty and Brown 1986, Sick 1993. Haverschrnidt and Mees 1994). The Mangrove Cuckoo may have diverged parapatrically (Endler 1977, Smith et al. 1997) from ancestral stock dong northern coastal boundaries of its range where a clinal variation in habitat use likely occurred. This would be favored during glacial maxima when sea-levels as much as 100 m lower than current sea-level would expose greater expanses of lowlands dong the Caribbean Coast (Haffer 1967, 1974. Gallup et al. 1994). allowing for the successive colonization of new coastal habitat by mangrove and coastal scrub favoring populations. The Mangrove Cuckoo likely had two or three dispersal routes northward from South America: (1) from western populations dong both slopes of Central America to Mexico, and (2) from eastem populations northward into the West Indies. Many species of South American birds have colonized Central America from northwestem South America (e.g., Webb 1978, VuilIeumier 1985a, Cracraft 1985, Cracraft and Pmm 1988, Hackett 1993). Érard (1991) ruggested that the avifauna of the southem Lesser Antilles were mostfy South American in origin. Adult Mangrove Cuckoos, not undergoing rnolt, collected from extant populations in Central America and Mexico are smaller in wing (female: p < 0.005; male: p c 0.005), tarsus (female: p c 0.01; male: p < 0.05), and bill (female: p < 0.05; male: not significant) lengths than those from the Lesser Antilles (Student's t-test: Table 3.5: also see Hughes 1997a for measurements of 16 Mangrove Cuckoo populations). In addition, the Central American Mangrove Cuckoos have much paler throat, breast, and belly plumage. Morphological differences between these forms may reflect east-to-west clinal variation in the ancestral population. The Cocos Cuckoo probably originated by a colonization event from ancestral stock inhabiting the Pacific slope of Cenrral America within the last two million years. Paleomagnetic data indicate that Cocos Island was not in existence prior to that time (Castillo 1988). However, the radiation of the Cocos Cuckoo is not necessarily recent. Unlike the Galapagos Dark-billed Cuckoo, which is morphologically identical to the TABLE3.5. Wing, tarsus, and bill lengths (mm) of adult Mangrove Cuckoos

(Coc~yzusminor), not undergoing molt, collected from Middle America (Central America and Mexico) and the Lesser Antilles (Barbuda, Antigua, Dorninca, St. Lucia. St. Vincent, and Grenada). Data are expressed as mean f standard deviation, and sample size (n) in parentheses. See text for level of significance between populations. Data collected from specimens in Field Museum of Naturai History, Royal Ontario Museum. University of

Michigan Museum of Zoology, and Bell Museum of Naturd History, and from Ridgway

( 19 16).

Middle America Lesser Antilles

Wing length 137.6 14.92 (21) 136.8 I5.59 (1 1) 141.4 f 5.19 (45) 143.5 t 3.16 (29)

Tarsus length 28.78 f 1.09 (18) 28.35 c 0.83 (6) 29.47 +_ 0.68 (26) 29.82 f 0.77 (34)

Bill length 19.82 + 1.39 (7) 19.45 f 0.99 (6) 20.69 f 0.7 1 (20) 20.35 -t 0.76 (15) mainland form (Swarth 193 1; Hughes, pers. obs.), the Cocos Cuckoo is more richly colored than the Mangrove Cuckoo, with deep rufus upperparts and a grayish crown (Stiles and

Skutch 1989; Hughes. pers. obs.) which rnay suggest a longer penod of isolation. The distribution of the Pearly-breasted Cuckoo is poorly known. There are scanty records from eastem Colombia, Venezuela, and the Guianas south through eastern Brazil to northeastem Argentina (Meyer de Schauensee 1982); however, if this species is an austral

migrant (Hilty and Brown 1986), records nonh of Amazonia rnay represent wintering birds

(Haversc hmidt and Mees 1994). The Pearly-breasted Cuckoo likely diverged from ancestral stock occupying coastal northern South America. This cuckoo may have subsequently extended its range southward dong the Eastern Savanna Dispersai Route that

began on the Caribbean slopes, and extended eastward through the llanos of Venezuela and non-forest regions of the Guianas, crossing the Amazon Basin through expanded savannas

during glacid maxima. and into open woodland and thorn scrub of southem Brazil (Webb 1978). Range expansion in this species rnay have occurred through dispersal events by permanent residents. or dispersal south of Amazonia rnay have resulted in the establishment of new breeding grounds resulting, in the latter case, in an annual retum to ancestral sites north of the Amazon during the non-breeding season. North America. - Based on my hypothesis of phylogeny, the breeding of Yellow- billed and Black-billed cuckoos in North America resulted from independent invasions of these taxa. Cox (1968, 1985) outlined two major factors that contribute to the creation of disjunct migration patterns. such as those which I hypothesize for the separate origin and

migration of Yellow-billed and Black-billed cuckoos: ( 1) increasing temporal or spatial seasonality of the clirnate; and (2) interspecific competition, either between recently diverged, ecologically similar sibling species, or by diffuse competition between many

species. Both factors could be applicable to Coccyzïis cuckoos during the Pleistocene. Climatic fluctuations have been well documented, and cooler cycles may have increased seasonality in the tropics. In addition, several cuckoo species may have occurred sympatricaily in some regions. Finally, competition for resources between extant Coccyurs species has been observed (Bender 1961). Thus, these factors could well be relevant in establishing the migration patterns of the two North American breeders. Furthemore, my phylogeny sugpests that Yellow-billed and Black-billed cuckoos are tropical species that migrated independently into temperate North America to establish new breeding grounds. This is akin to the southem-ancestral-home theory which states that some migratory species were ongindly permanent residents in southem latitudes with distributions approximating their present winter ranges (Lincoln 1939, Cox 1968). COX (1985) used a regression analysis to determine the location of origin of paniline warblers

(Embenzidae) based on their observed migration patterns. 1 followed his methodology by plotting the midpoint latitudes of breeding and non-breeding ranges for five species of migratory Coccyzris cuckoos (Yellow-billed, Black-billed, Gray-capped, Ash-colored, and Pearly-breasted cuckoos) against the latitudinal interval between their ranges. The intercept of regression of rnidpoint latitude on latitude span between ranges was 0.4ON and 6.0's. for breeding and non-breeding ranges, respectively. These intercepts were not significantly different from a latitude midway between the equator and the Tropic of Capricorn

(breeding: t = 0.475: non-breeding: t = 1.2 16; df = 4), thereby, supporting an hypothesis of

a tropical center of ongin in the Southern Hernisphere for migratory Coccyzus cuckoos.

Both the Yellow-billed and Black-billed cuckoos are sympatric with basal taxa (this study) on their wintering grounds. The Black-billed Cuckoo winters in trans-Andean South America from Colombia and Venezuela south to Bolivia, overlapping the range of resident Dwarf Cuckoos and wintering Ash-colored cuckoos. The Yellow-billed Cuckoo winten in cis-Andean South America from the Caribbean Coast south to Argentina. and is generally sympatric with the Pearly-breasted Cuckoo throughout most of its range.

Unfortunately, the fossil record of Coccyzus is poor and, hence, provides little

information that would allow me to estimate dates of species divergence. The genus is represented by only Holocene (Black-billed Cuckoo, Bernstein 1965) and late Pleistocene (Coccyzus sp.. Morgan 1977) fossils from the West Indies, and one late Pleistocene (Yellow-billed Cuckoo) fossil from northern Florida (Ligon 1965). Fossils of South . American Coccyzus species have not been discovered. This study has shown that it is possible to differentiate among at least six, and probably al1 nine, species of Coccyzus cuckoos on the basis of divergent osteology. Future fossil finds in South Amenca may corroborate this hypothesis of phylogeny, provide sufficient information to predict times of divergence among Coccyz~istaxa, and. hence, assist in the reconstruction of their historical biogeognphy . APPENDIX 3.1. Skeletal and tissue specimens used. Abbreviations: ANSP, Academy of Natural Sciences in Philadelphia. FMNH, Field Museum of Natural History; LSU, Louisiana State University Museum of Natural History; MVZ, Museum of Vertebrate Zoology at University of California, Berkeley; ROM, Royal Ontario Museum; UF, University of Florida Museum of Natural History; UMMZ, University of Michigan Museum of Zoology: USNM, United States National Museum.

------Coccyzus pumilis: skeleton, FMNH 297439. C. cinereus: tissue, LSU B6833. C. erythropthalmus: skeletons, ROM 15829, 9 1632, 127355, 137975, 154487; tissue, ROM

1B-2004, 1B-2305, DB-934. C. lansbergi: skeleton, LSU 1 143 14; tissue, ANSP 5233, LSU B5126. C. rnelacoryphus: skeletons, ROM 158342, MVZ 94086. 1301 17, USNM 227775; tissue. ANSP 5958, MVZ 20036. C. minor: skeletons, FMNH 342748, ROM 109441,

1 11 106, 1 1 1666, 12 143 1, 12 1525; tissue, LSU B 115 17. C. julieni: tissue, ANSP 466 1. C. americanus: skeletons, LSU 159628, ROM 132572, 15 129 1, 158249, UMMZ 73877; tissue. ROM 1B-2006, MKP88 1. Oxylophus [< Clamator] levaillantii: skeleton, ROM L 145 15. O. jacobinus: skeletons, ROM 120761, 125557. Clamator coromandus: skeleton, USMN 343240. C. glandarius: skeleton, MVZ 1587 10. Eudynamys scolopacea: tissue,

ROM AJB56 19. Tapera naevia: skeletons, UMMZ 135 167, 2222 17; tissue, ANSP 2761, LSU B 15026. Cuculus pallidus: skeleton ROM 124533; tissue, ROM 1B-943; published cytochrome b sequence (Avise et al. 1994). Piaya cayana: skeletons, ROM 97362, 115608, 126623; published cytochrome b sequence (Avise et al. 1994). P. melanoguster: skeleton:

UF 26229. Coccycua [< Piaya] minuta: skeleton, LSU 101256. Hyetornis [< Piaya] phvialus: skeleton, CMVZ 149905. Saurothera merlini: skeleton, ROM 11 1123, UF

26236. S. vetula: skeleton. USMN 3 18889. Phuenicophaeus [> Rhamphococcyx] cuniirostris: published cytochrome b sequence (Avise et al. 1994). APPENDIX 3.2. Skeletal character descriptions. Zero (O) = ancestral condition. CI = consistency index. Character state changes within the outgroup have not been included in the cdculation of this statistic. Abbreviation: proc., processus. processes.

1. Os squamosale, shape of proc. postorbitaiis in latenl aspect: (0) narrow; (1) wide. CI = 1.oo. 2. Vertebrae caudales, degree of articulation of proc. transversus of first free with extrernitas caudalis synsacn and margo mediaiis of proc. dorsolateralis: (0) less than

50% of length: ( 1) more than 50% of length. CI = 1.00. 3. Pygostyle: shape of margo caudalis of lamina pygostyli in caudal aspect: (0) narrow; (1) dumbell shaped. CI = 1.00. 4. Sternum, shape of fused manubrium in lateral aspect (unordered): (0) pointed; (1) rounded; (2) blunt. squared off. CI = 1.00. 5. Sternum, direction of inflection of proc. craniolateralis: (0)cranially; (1) dorso-cauddly. CI = 1.00.

6. Sternum. shape of tip of proc. craniolateralis: (0) pointed: ( 1) blunt. CI = 1.00. 7. Furcula, shape of apophysis furculae (hypocleideum) in laterai aspect: (0)strongly U- shaped; dorsal and ventral caudal projections both large; (1) ventral projection much Iarger than dorsal. CI = 1.00. 8. Coracoid, shape of facies articularus of proc. procoracoideus: (0) single facies curved

caudally; ( 1) appearing as two facies with sulcus between them. CI = 1.00. 9. Pelvis, length of extrernitas cranialis synsacri cranially of da preacetabularis ilii in dorsal

aspect: (0) short, or of different configuration than in state 1; ( 1) long. CI = 1.00. 10. Pelvis, shape of tuberculum preacetabulare in dorsal aspect: (0) tip projecting cranio-

laterally; ( 1) tip projecting cranially. CI = 1.00. APPENDIX 3.2. Skeletai character descriptions continued.

Il. Pelvis, shape of proc. terminalis ischii in lateral aspect: (0) straight from sync. ilioischiadica to extremitas distalis; (1) squared off and extending posterioriy beyond synsacmm. CI = 1.O.

12. Os fernoris, extremitas distalis, angle formed by margins of trochlea fibularis in proximal aspect: (0) more than 90°; (1) approximately 9O0or less. CI= 1.00.

13. Tibiotarsus, size of epicondylus medidis: (0) small; (1) large. CI = 1.00. 14. Tarsornetatarsus, hypotanus, shape of margo cauddis of cotyia lateralis in distal aspect:

(0) bulbous, directed iaterafly ; ( 1) bulbous, directed caudally . CI = 1.00. APPENDIX 3.3. Character change list for skeletd characters on shortest-length me (Fig. 3.1). Double-lined arrows indicate that changes occurred on al1 possible reconstructions. Single-lined arrows indicate that changes occurred only under some reconstnictions.

CHARACTER1: O [node 91 => 1 [node 81. CHARACTER 2: O [node 91 => 1 [node

81. CHARACTER 3: O [node 81 => I [node 71. CHARACTER4: O [node 81 => 1 [node 71; O [node Il] => 2 [Dwarf Cuckoo]. CHARACTER5: O [node 81 => 1 [node 71.

CHARA~R6: O [node 91 => 1 [node 81. CHARACTER 7: O [node 101 => 1 [node 91.

CHARACTER8: O [node 81 => 1 [node 71. CHARACTER 9: O [node 1 11 => 1 [node IO].

CHARACTER10: O [node 101 ==> 1 [node 91. CHARACTER 1 1: O [node 91 => 1 [node 81;

1 [Mangrove Cuckoo] --> 01 [within terminai]. CHARACTER 12: O [node 1 I] => 1 [node

101. CHARACTER13: O [node 91 => 1 [node 81. CH~CTER14: O [node 81 => 1 [node

71. APPENDIX 3.4. Nucleotide sequences ( 1,032 base-pairs) of the cytochrome b gene for seven Coccyzus species.

Yeilow-bilIed CTA GGA CTATGCTTAA TTA CA CAAATTGTA Pearly-brested ...... Mangrove ...... c... Dark-billed ...... c...... c.c. Gray-capped ...... C...... CA.. Black-billed ...... c...... c?.. As h-colored ...... T.....C...... CC..

Yeliow-billed A CA GGCCTACTATTA GCCATACACTACA CC Pearly-breasted ...... Mangrove ...... c...... ~...... Dark-billed ...... c...... Gray-capped ...... C...C....A...... T B lack-biiied ....?...C...A...... Ash-colored ...... C...C..A......

1 I I Yeiiow-billed G~AGA~ACAACC~TTGCCTTTTCATCCGTT Pearly-breasted ...... Mangrove ...... C Dark-billed ...... C Gray -capped ...... c...... c Black-bilied ...... T..c...... C Ash-colored ...... A...... C

I I I Wlow-biUed G~~~A~ACATGT~G~AACGT~~AATATGGC Pearly-breasted ...... C ...... Mangrove ...... c...... C... Dark-biUed ...... c...... -...C... Gray capped ...... c...... C... Black-bilied ...... T...c..A...... ~... As h-colored ...... c..A...... C..- APPENDIX 3.4. Cytochrome b sequences continued.

130 140 150 1 I I - .- -- - - Yeuow-billed TGAcTAATCCGCAACCTTCACGCAAACGGA Pearly-breasted ...... Mangrove ...... Dark-biiled ...... Gray-capped .....T...... c...... Black-billed ...... c...... Ash-colored ...... c......

Yellow-billed GCCT CAA TATTCTTCA TCTGCA TCTA CTTA Pearly-breasted ...... Mangrove ...-...... C.. Dark-bded ...... -...CC. Gray-capped ...... B lack-biiled ...... f ...... C.. Ash-colored ...... TC..

Yellow-billed CA CA T CGGA c GA GGCTT CTA CTA c GGCT CA Peuly-breasted ...... Mangrove ...... Dark-bilied ...... Gray -capped ...... Black-biiled ...... As h-colored _..T ...... A...... A...

Yebw-billed TACCTCAACAAAGAAACCTGAAACACAGGA Pealy-breasted ...... Mangrove .....T...... Dark-billed .....T...... -...... Gray -capped ....T...... G..T...... Black-billed ......

Ash-colored- ...... T...... T...... T...... - .TT*.... APPENDE 3.4. Cytochrome b sequences continued.

.- . - - Yeiiow-biiied GTAATCCTCCTCCTAACACTCATA GCAACC Pearly-breasted ...... Mangrove ..G..?...... T Dark-billed ...... Gray-capped . G..G...... B lack-bUed ...... T...... As h-colored ...... A...... C...... T

YeUow-biiied GCCTTCGTAGGTTATGTCCTCCCATGAGGC Pearly-breasted ...... Mangrove ...... Dark-biiied ...... C...... G...... Gray-capped ...... c ..c...... Black-biiled ...... c..C..G ...... As h-colored ...... c ......

310 320 3 3 O I I 1 Yeiiow-baed CAAATATCATTCTGAGGAGCGACCÛTAAT~ Pearly-breasted ...... Mangrove ...... G..A...... Dark-billed ...... G..A...... Gray-capped ...... û..~...... Black-billed ...... G ..A...... Ash-colored ...... c..T...... ~

Yeliow-biîied A~~AATCTATT~T~~GC~AT~~CATACATC Pearfy-breasted ...... T ...... Mangrove ...... Dark-biiied ...... Gray-capped .....c...... A...... -. Black-billed .....c...... Ash-colored ..T..C...... T...... T..T APPENDIX 3.4. Cytochrome b sequences continued.

Yellow-billed GGCCAAA CCCTA GTA GAA TGGGCCTGGGGG Pearly-breasted ...... A Mangrove ...... A...... ,.A.....,,.A...... ,.A.....,,.AA Dark- biiied ...... Gray-capped ...... A B lac k-Wed ..T...... T...... A...... A Ash-colored- . A..G...... G...... A

Yellow-billed GGATTCTCAGTA GACAACCCCACACTAACC Pearly-breasted ...... Mangrove ...... Dark-biiled ..G...... Gray-capped ...... T ...... Black-billed ..G...... ?...... T...... Ash-colored ....G...... T.....G.....T

Yeiiow-billed CGCTTCTTCGC~~TA~A~TTT~T~~TCCCA Pearly-breasted ...... c ..-..-- Mangrove ...... T...... Dark-billed ...... C...... Gray-capped ...... T..?...... Black-billed ...... T.....A...... Ash-colored ..A...... T..G..T..C.....A...

Yeilow-billed TTCA TAA TTGCA GGCCTAA CCA TCGTTCA c Pearly-breasted ...... Mangrove ...... T...... Dark-billed ...... TA ..... Gny-capped ...... c...... C... Black-billed ....C...... T...... A.C... Ash-colored ..T.....C...... T.AA.C... APPENDIX 3.4. Cytochrorne b sequences continued.

~ellow-billed CTCACCTTCTTACACGAAACCGGCTCAAAC Pearly-breasted ...... Mangrove ...... c...... Dark-billed ...... Gray-capped ...... c.T ...... 8lack-billed ...... c...... Ash-colored T.A .....TC.C ...... T..A......

Yeliow-bikd AACCCCCTA GGCCTTCAATCCAACTGTGAC Pearly-breasted ...... Mangrove ...... Dark-baed ...... T...... Graytapped ...... ~...... c.... Black-billed ...... ~..~...... c..f Ash-colored ...... ?....-.....C....

YeUow-biiied AAGAT~~~ATT~~A~C~~TA~TT~T~A~TC Pearly-breasted ...... Mangrove . G...... Dark-billed ...... Gray-capped ...... T..A...... G... Black-billed ...... T..T Ash-colored ...... A.T

I I 1 Yellow-biiied AA GGACCTAGTAGGATTCACTATCATACTC Pearly-breasted ...... G ...... Mangrove ..A...... ?...... Dark-biiied . A.....G...... Gray-capped ..A...... A...... T...... Black-billed ..A...... T..C....C.... Ash-colored.- ..A..T...... T.TC..A...T.. APPENDIX 3.4. Cytochrome b sequences continued.

Pearly-breasted . A ...... Mangrove ...... A...... T Dark-biIIed ...... G...A...... T

~ellow-bdled CCTACCCTTCTAGGA GACCCAGAAAA cf TC Pearly-breasted ...... Mangrove ...... Dark-billed ..C ..T..c...... Gray -capped ..C.....C...... T... Black-biiied ...... c...... Ash-colored . A.....c......

1 I 1 %flow-billed TACCCAGCCAACCCCCTAGTAACACCACCC Peuly-breasted . ? ...... Mangrove .c...... A Dark-bilied .c...... T...... A Gray-capped CT...... T...... B lack-billed .C...... A Ash-coiored .C...... T...... C..T...

700 710 720 I 1 I YeUow-biiied CACATCAAGCCCGAATGATATTTCCTATTT Pearly-breasted ...... Mangrove ...... A..G...C...... Dark-billed ...... ~...... c Gray -capped ..T..T..A..A...... Black-biiied ..T.....A..A...... ~...... Ash-colored ...... A..A ...... c ...... APPENDIX 3 -4. Cytochrome b sequences continued.

YeLiow-bilied GCATACGCCATCCTACGATCCATCCCTAAC Pearly-breasted ...... Mangrove ...... T...C... Dark-biiied ...... ~.....c... Gray -capped ...... T.....C... Black-billed .....T...... T.....C..T As h-colored ...... T.....A...

Pearly-breasted . A ...... G ...... Mangrove ....A...... G...... Dark- billed ..GT ...T..G...... Gray-capped ...... A...... Black-billed ...... Ash-colored ...... ~...... c

I I I ~ellow-billed TCCGTACTAGTCCTCTTCCTAGCCCCATCC Pearly-breasted ...... Mangrove ...... T...... G...... Dark-biiied ...... Gray napped ...... T...... cT. Black-billed ...... T..T...... CT. Ash-colored ...... G....CT.

Yellow-biiied CTA CA CAAATCAAAA CAA CGA GCTA TAACC Pearly-breasted ...... Mangrove ...... A...... Dark-billed ...... T...... Gray-capped ...... Black-billed ~...... c......

--- Ash-colored--- ?...... ,,...... A.C...... APPENDIX 3.4. Cytochrome b sequences continued.

Yeliow-billed :TTCCGCCCCCTATCCCAAGCCCTATTCTGA Pearly-breasted ...... Mangrove ...... ?.,...... Dark-billed ...... T... Gray-capped .....T...T...... T...... T... Black-biUed .....f...... A...... Ash-colored ...... T...... T...G......

Yeiiow-biiled ATCCTA GTAA CTAACCTATTCATCCTAACA Pearly-breasted ...... Mangrove ...... c.?..... G...... Dark-billed ...... Gray -capped ...... GG ...... T...... Black-biiied ...... GG.A ...... T...... Ash-colored ...... GC.A...... T......

Mangrove ...... G...... Dark-billed ...... A...... Gray-capped ...... Black-biiIed .....T...... A...... Ash-colored .....T...... G..A......

I I I YeUow-billeci TTCATCATCATCGGCCAACTAGCATCCCTC Pearly-breasted ...... T ...... Mangrove ...... Dark-billed ...... Gray-capped .....T...... -..t... Black-billed .....T...... As h-colored .....T.....T..T...... C...A.. APPENDIX 3.4. Cytochrome b sequences continued.

I I I Yeiiow-bilied ACCTACTTCTCAATCCTC~TAATCCTGTTC Pearly-breasted ...... Mangrove ...... Dark- biiled ...... G....A... Gray-capped ...... T.A ... Black-billed ...... T.A ... Ash-colored ...... G...A...

-- - Yellow-biiied CCCAGC~ATCACACACTAGAAAACAAACTA Pearly-breasted ...... Mangrove Dark-biiied ..AGC. ATCAC...... T. .... Gray -capped ..A. CTAT. AC...... G.. . Bhck-biiied . .A. C.AT.AC...... Ash-colored . A?T.ATCAC ......

Mangrove ...... GENERAL SUMMARY

(1) This study has provided some useful insight on the systematics of New World cuckoos. Based on my reconstruction of cuckoo phylogeny using osteological charactee, 1 recomrnend several changes to the currently accepted classification of New World cuckoos. Carpococcyx, an Old World genus of terrestrial cuckoos, should be removed from the

Neomorphinae, a subfamily otherwise comprised of only New World species. Evidence suggests that Carpococcy-x may be sufficiently divergent to be placed in its own subfamily: Carpococcystinae. The New World obligate brood parasites, Tapera and Dromococcyx, should also be removed from the Neomorphinae, and placed in the Cuculinae with al1 other obligately parasitic cuckoos. This position implies that the terrestrial locomotory habits of

Tapera and Dromococcyx have evolved secondarily. Hence, the Neomorphinae includes only three genera of New World terrestrial, nonparasitic cuckoos: Neornorphus, Geococcyx, and Morococcyx. Coccyzus, the New World genus of facultative brood pansites, should be transferred from the Phaenicophaeinae to the Cuculinae. This suggests that the facultative parasitic behavior of Coccyzus represents a loss of obligate parasitism rather that the development of parasitism from a nonparasitic ancestor. (2) Some results of my analyses are compatible with currently accepted classifications. The New World communal breeders. Crotophaga and Guira, coiisistently form a clade and should continue to be classified in their own subfamily: Crotophaginae. In addition, al1 other New World nonparasitic, arboreal cuckoos (Saurothera, Piaya,

Hyetornis, and Coccycua [< Piaya]) are closely allied and should be placed in the Tribe Saurotherini on the basis of osteological synapomorphies. (3) My efforts to reveal the evolutionary relationships of New World cuckoos have also provided some understanding of familial and ordinal associations. The cuckoos

(Cuculidae) are monophyletic, as evidenced by the 14 osteological synapomorphies that 1 have described. Consequently the Hoatzin (Opisthocomus hoazin). an enigmatic South American folivore, is not a cuckoo. Furthemore, the paucity of synapomorphies linking turacos (Musophagidae) and cuckoos indicate that these taxa may not form a monophyletic group and, therefore, should not be placed together in the Cuculiformes as they are traditionaily classified. 1 recommend the placement of the Hoatzin, turacos, and cuckoos in separate, but adjacent, orden: Musophagiformes, Opisthocorniformes, and Cuculiformes.

(4) At least four species of the genus Coccyzus are facultative parasites that occasionally lay their eggs in the nests of other birds. Previous workers have noted that Coccyzrcs shares with the obigately parasitic cuckoos a number of life history traits which seem adaptive to a pansitic lifestyle. My study demonsuated that two Coccyzus species, the Yellow-billed ( C. arnericnnus) and B lack-billed (C.erythropthalmns) cuckoos, produce eggs that fully or nearly match in coloration the eggs of over 70% of their reported host species. This proportion is significantly greater than if hosts were being selected randomly from a potential host pool, and suggests that these cuckoos may be selecting hosts based on egg color. Since egg rnimicry is unlikely to evolve in a facultative parasite, its existence in Coccyzrrs implies an histoncally intense, and perhaps obligate, relationship between these birds and their hosts. This hypothesis is corroborated by my phylogenetic analyses that indicate that the ancestor of Coccyzus was an obligate brood parasite. Factors responsible for the loss of obligate parasitism in this genus may also have contributed to the general paucity of obligate parasitism in New World cuckoos. Cornpetitive exclusion or resistance to invasion by parasitic cowbirds (Molothrus spp.) should be considered.

(5) 1 reconstructed the phylogeny of nine Coccyzus species using osteology, extemal morphology. and cytochrome b gene sequences in order to reexamine species relationships within the genus, and to propose an hypothesis of their histoncal biogeography. My results indicate that three species ((Dwarf Cuckoo, Ash-colored Cuckoo). Black-billed Cuckoo), characterized by red orbital rings and narrow tail spots, are basal to a clade with broad tail spots and gray orbital rings (with the exception of an intemal clade with yellow orbital rings): (Gray-capped Cuckoo, (Dark-billed Cuckoo, ((Cocos Cuckoo, Mangrove Cuckoo), (Pearly-breasted Cuckoo, Yellow-billed Cuckoo)))). Within the broad tail spot group, is a clade of four taxa defined by their yellow lower mandibles: ((Cocos Cuckoo, Mangrove Cuckoo), (Pearly-breasted Cuckoo, Yeflow-billed Cuckoo)). Some traditional sister associations were upheld, such as the Dwarf (C. ptmilus) and Ash-colored (C. cinereus) cuckoos, Cocos (C. firrugineus) and Mangrove (C. minor) cuckoos, and Yellow-billed and Pearly-breasted (C. julieni) cuckoos. However, the commonly held notion that Yellow- billed and Black-billed cuckoos - both Neotropical migrants that breed predorninately in

North Amenca - are closely related was refuted. (6) My hypothesis of phylogeny supports a Neotropical origin for the genus

Coccyzus. Several vicariant and colonization events were likely responsible for the distribution of five South American endernic species. The Mangrove Cuckoo had two major northward routes out of South America: (1) dong both slopes of Central America to Mexico, and (2) through the West Indies to Florida. The Cocos Cuckoo diverged from ancesuai stock inhabiting the Pacific Slope of Central Amenca. Yellow-billed and Black- billed cuckoos are highly divergent, and each represents a separate invasion of North America from South America. LITERATURE CITED

ALI. S., AND S. D. RIPLEY. 1987. Compact handbook of the birds of India and Pakistan. Oxford Univ. Press, London.

ALLEN,T. A. 1877. General notes. Bull. Nuttall Ornithol. Club 3: 110. AMENCM ORNITHOLOGISTS'UNION. 1983. Check-list of North American birds. 6 ed, American Omithologists' Union, Washington, D.C.

ANDREWS, R., AND R-RIGHTER. 1992. Colorado birds: a reference to their distribution and habitat. Denver Mus. Nat. Hist., Denver.

ATTWATER, H. P. 1892. obsemed in the vicinity of San Antonio, Bexar County, Texas. Auk 9: 229-238.

AVISE. J. C., AND W. S. NELSON.1995. Reply to the editor. Mol. Phylogen. Evol. 4: 350-

356.

AVISE. J. C.. W. S. NELSON, AND C. G. SIBLEY. 1994. Why one-kilobase sequences from mitochondrial DNA fail to solve the Hoatzin phylogenetic enigma. Mol. Phylogen.

Evol. 3: 175- 184. BAKER,E. C. S. 1927. The fauna of British India, including Ceylon and Burma. Birds. vol. 4. Taylor and Francis, London.

BANKS.R. C. 1988. An old record of the Pearly-breasted Cuckoo in North America and a nomenclatural critique. Bull. Bit. Omithol. Club 108: 87-9 1.

BANKS,R. C., AND R. HOLE,JR. 1991. Taxonornic review of the Mangrove Cuckoo,

Coccyzus minor (Gmelin). Carib. J. Sci. 27: 54-62.

BANNERMAN,D. A. 1933. The birds of tropicai West Africa, with special reference to those of Gambia, . the Gold Coast and , vol. 3. Oliver and Boyd. Edinburgh. BARNIKOL,A. 1953. Verleichend anatomische und taxonomisch phylogenetische Studien an Kopf der Opisthocomiformes, Musophagidae. Galli, Columbae und Cuculi. Ein

Beitrag mn Opisthocomus-Problem. Zool. Jahrb. Syst. 8 1: 487-526.

BAUMEL, J. J., AND L. M. WITMER. 1993. Osteoiogia. Pp. 45-132 in Handbook of avian anatorny: nomina anatomica avium. (J. J. Baurnel, ed.). Publ. Nuttall Omithol. Club No. 23. BEDDARD,F. E. 1885. On the structural characters and classification of the cuckoos. Proc. 2001. Soc. Lond. l 885: 168- 187.

BEDDARD,F. E. 1898. The structure and cl~sificationof birds. Longman, Green. and Co., London.

BEDDARD.F. E. 1901. On the anatomy of the Radiated Fruit-cuckoo (Carpococcyx

radiatus). Ibis 190 1: 200-2 14.

BEHLING, H. 1995. A high-resolution holocene pollen record from Lago do Pires, southeastem Brazil: vegetation, climate, and fire history. J. Paleolimn. 14: 253-268. BENDER, R. O. 1961. Food cornpetition among closely related sympatric species. Wilson

Bull. 73: 2 14.

BENDIRE. C. 1895. Life histories of Nonh American birds. US. Natl. Mus. Spec. Bull. No. 3. BENT, A. C. 1940. Life histories of North Amencan cuckoos. goatsuckers. ,

and their allies. U. S. Natl. Mus. Bull. No. 176. BENT, A. C. 1942. Life histories of North American flycatchers, larks, sparrows, and their allies. US. Natl. Mus. Bull, No. 179. BENT, A. C. 1946. Life histories of North American jays, crows, and titmice. U.S. Natl. Mus. Bull. No. 19 1. BENT, A. C. 1948. Life histories of North Amerkm nuthatches, , thrashers, and their allies. US.Natl. Mus. Bull. No. 195. BENT, A. C. 1949. Life histories of North American thrushes, kinglets, and their allies. U.S. Natl. Mus. Bull. No. 196. BENT, A. C. 1950. Life histories of North American wagtails, shrikes, vireos, and their allies. U.S. Nad. Mus. Bull. No. 197. BENT,A. C. 1953. Life histones of North American wood warblers. U.S. Natl. Mus. Bull. No. 203.

BEM, A. C. 1958. Life histories of North American blackbirds, orioles. tanagers, and their allies. U.S. Nati. Mus. Bull. No. 21 1.

BENT, A. C. 1968. Life histories of North American cardinals. grosbeaks, buntings, towhees, finches, sparrows, and their allies. (0.L. Austin, Jr., ed.). U.S.Natl. Mus. Bull. No. 237. BERGER,A. J. 1952. The comparative hinctional morphology of the pelvic appendage in three genera of Cuculidae. Am. Midl. Nat. 47: 5 13-605.

BERGER,A. J. 1954. The myology of the pectoral appendage of three genera of American cuckoos. Univ. Mich. 2001. Misc. PubI. 85: 1-35.

BERGER,A. J. 1955. On the anatomy and relationships of glossy cuckoos of the genera

Chrysococcyx, Lompromorpha, and Chalcites. Proc. U.S. Natl. Mus. 103 : 585-597.

BERGER,A. J. 1957. On the anatomy and relationships of Fregilupus vurius. Bull. Am. Mus. Nat. Hist. 113: 225-272. BERGER,A. J. 1960. Some anatomical characten of the Cuculidae and the Musophagidae.

Wilson Bull. 72: 60- 104.

BERi-Iûz, J. 1948. Le peuplement de Madagascar en oiseaux. Mem. Inst. Scient.

Madagascar 1: 18 1- 192. BERNSTEIN,L. 1965. Fossil birds from the Dominican Republic. Quart. J. Fla. Acad. Sci.

28: 27 1-284.

BICKERTON,W. 1927. The baby bird and its problems. Methuen and Co., Ltd., London. BLACK, G. 1992. Iowa birdlife. Univ. Iowa fress, Iowa City. BOCK. W. J. 1992. Methodology in avian systematics. Bull. B.O.C. Centenary Suppi.

1 12A: 53-72. BOND,J. 1960. Birds of the West tndies. Collins Publ., London. BONAPARTE,C. L. 1824. J. Acad. Nat. Sci. Philadelphia, vol. 3, pt. 2: 367. BONAPARTE,C. L. 1850. Conspectus generum avium, vol. 1. E. J. Brill, London. BONHOTE, J. L. 1907. Birds of Britain. Adam and Charles Black, London. BOUCARD,A. 1876. Catalogus avium hucusque descriptorurn. A. Bouchard, London.

BRADBURY,J. P. , B. LE Y D EN, M. SALGADO-LABOURIAU,W. M. LEWIS.JR., C.

SCHUBERT,M. W. BINFORD, D. G. FREY, D. R. WHITEHEAD,AND F. H. WEIBUAHN. 198 1. Late Quaternary environmental history of Lake Valencia, Venezuela. Science 2 14: 129% 1305.

BROOKE.M. DE L., AND N. B. DAWES.1987. Recent changes in host usage by cuckoos, Cuculus cnnortrs in Britain. J. Anim. Ecol. 56: 873-883.

BROOKER, L. C., AND M. G. BRODER. 1990. Why are cuckoos host specific? Oikos 57: 30 1-309.

BROOKER,M. G.. AND L. C. BROOKER.1989. The comparative breeding behavior of two sympatric cuckoos, Hors field's Bronze-cuckoo Chrys~coccy~xbasalis and the Shining

Bronze-cuckoo C. lucid~ls.in Western Ausualia: a new mode1 for the evolution of egg

morphology and host specificity in avian brood parasities. Ibis 13 1: 528-547.

BROOKER, M. G., AND L. C. BROOKER. 1992. Evidence for individual female host specificity in two Austrdian bronze-cuckoos (Clirysococcyx spp.). Aust. J. Zool. 40: 485-493.

BROOKS, D. R.. AND D. A. MCLENNAN. 1991. Phylogeny. ecology, and behavior: a research program in behavioral biology. Univ. Chicago Press, Chicago.

BROWN, K. S., JR 1987. Conclusions, synthesis. and alternative hypotheses. Pp. 175- 196 in Biogeography and Quaternary history in tropical America. (T. C. Whitmore and G. T. Prance, eds.). Oxford Univ. Press, New York. BRUMFIELD,R. T., AND A. P. CAPPARELLA.1996. Historical diversification of birds in northwestern South America: a molecular perspective on the role of viciant events. EvoIution 50: 1607- 1624.

BRUSH.A. H. 1979. Cornparison of egg-white proteins: effect of electrophoretic conditions. Biochem. Syst. Ecol. 7: 155- 165.

BRUSH,A. H.. AND H. H. WITT.1983. Intraordinal relationships of the and Cuculiformes: electrophoresis of feather keratins. Ibis 125: 18 1- 199.

CABOT, E. L., AND A. T. BRECKENBACH. 1989. Simultaneous editing of multiple nucleic acid sequences with ESEE. Comp. Appl. Biosci. 5: 233-234.

CARTER,M. D. 1986. The parasitic behavior of the in south Texas. Condor 88: 1 1-22.

CASTELO, P. 1988. Anomalously young volcanoes on old hot spot traces: 1. geology and petrology of Cocos Island. Bull. Geo. Soc. Am. 100: 1400- 1414.

CAVALCANTI,R. B., M. R. LEMES,AND R. CINTRA. 199 1. Egg losses in communai nest of Guira Cuckoo. J. Field Omithol. 62: 177- 180.

CHANDLER.A. C. 1916. A study of the structure of feathers, with reference to their taxonornic significance. Univ. Calif. Publ. 2001. 13: 243-446.

CHAPMAN,F. M. 19 17. The distribution of bird-life in Colombia. Bull. Am. Mus. Nat. Hist. 36: 1-729. CHAPMAN,F. M. 1926. The distribution of bird-life in Ecuador. Bull. Am. Mus. Nat. IHist. 55: 1-784.

CORY,C. B. 19 19. Catalogue of the birds of the Americas, pt. 2. Field Mus. Nat. Hist. Publ. No. 303.

CûüES, E. 1897. The Cuculidae of the A.O.U. list. Auk 14: 90-9 1.

COURTNEY, J. 1967. The juvenile food-begging cal! of some Bedgling cuckoos - vocal mirnicry or vocal duplication by . 67: 154-157. COX, G. W. 1968. The role of cornpetition in the evolution of migration. Evolution 22: 180- 192.

COX, G. W. 1985. The evolution of avian migration systems between temperate and

tropical regions of the New World. Am. Nat 126: 45 1-474.

CJXACR~FT,J. 197 1. A new farnily of Hoatzin-like birds (Order Opisthocorniformes) from the Eocene of South Amenca. bis 113: 229-233.

CRACRAFT,J. 198 1. Toward a phylogenetic classification of the Recent birds of the world (Class Aves). Auk 98: 68 1-7 14. CRACRAFT,J. 1985. Historical biogeography and patterns of differentiation within the South American avifauna: areas of endemism. Pp. 49-84 in Neotropical Ornithology. (P. A. Buckley, M. S. Foster, E. S. Morton, R. S. Ridgely, and F. G. Buckley. eds.). Omithol. Monogr. No. 36. CRACRAF~.J., AND R. O. PRUM. 1988. Patterns and processes of diversification: speciation and historical congruence in some Neotropicd birds. Evolution 42: 603-620. DARWIN,C. 1859. On the origin of the species by means of natural selection. John Murray, London.

DAWES, N. B., AND M. DE L. BROOKE. 1988. Cuckoo versus reed warblers: adaptations and counteradaptations. Anim. Behav. 36: 262-284.

DAWES. N. B., AND M. DE L. BROOKE. 1989. An experimental stuciy of coevo~ution between the cuckoo, Cuculus canorus, and its hosts. 1. Host egp discrimination. J. Anirn. Ecol. 58: 207-224.

DAWSON,L. W. 1903. The birds of Ohio, vol. 1. Wheaton Publ. Co., Columbus. DE QUEIROZ.K., AND D. A. GOOD. 1988. The scleral ossicles of Opisthocomus and their phylogenetic significance. Auk 105: 29-35. DELACOUR,J. T. 1946. Notes on the taxonomy of the birds of Malaysia. Zoologica 3 1: 1-8. DELACOUR,J. T. 1947. The birds of Malaysia. Macmillan Co., New York. DELACOUR,J. T., AND E. MAYR. 1945. Notes on the taxonomy of the birds of the

Philippines. Zoologica 30: 105- 1 17.

DELACOUR,J. T.,AND E. MAYR. 1946. Birds of the Philippines. Macmillan Co., New York.

DELACOUR.J. T., AND P. JABOUILLE. 193 1. Les oiseaux de l'Indochine Francaise, vol, 2. Exposition Coloniale Internationale, Paris. DORST,J. 1972. The evolution and affinities of the birds of Madagascar. Pp. 615-627 in Biogeography and ecology in Madagascar. (R. Battistini and G. Richard-Vindard, eds.). Dr. W. Junk, B. V. Publ., The Hague.

Dmo~s.A. J. C. 1902. Synopsis avium, pt. 1. H. Lamenin, Brusselles. EDEN. M. J. 1974. Paleoclimatic influences and the development of savanna in southem Venezuela. J. Biogeog. 1: 95- 109.

EDWARDS,S. W. 1903. Yellow-billed Cuckoo's egg in a robin's nest. Auk 20: 68.

EHRLICH,P. R., D. S. DOBKIN,AND D. WHEYE. 1988. The birder's handbook. Simon and Schuster Inc., New York ENDLER,I. A. 1977. Geognphic variation, speciation, and clines. Princeton Univ. Press, Prince ton.

ÉRARD. C. 199 1. Landbirds of the Lesser Antilles. CR Séances Soc. Biogeogr. 67: 3-23.

ERVIN. S. 1989. The nesting of the Dark-billed Cuckoo in the Galapagos. Noticias de Gahpagos 48: 8- 10.

FEDUCCIA,A. 1996. The origin and . Yale Univ. Press. New Haven. FELSENSTEIN,J. 1978. Cases in which parsimony or compatibility methods will be

positively rnisleading. Syst. Zool. 27: 40 1-40.

FELSENSTEIN.1. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-79 1. FELSENSTEIN,J. 1993. PHYLIP (Phylogeny Inference Package), version 3.52. Univ. Washington. Seattle. FERRAZVICEMINI,K. R., AND M. L. SALGADOLABO~AU.1996. Palynological analysis of a palm swamp in central Brazil. I. South Am. Earth Sci. 9: 34. FJELDSA. 1. 1985. Origin, evolution. and statu of the avifauna of Andean Wetlands. Pp. 85-1 12 in Neotropical Omithology. (P. A. Buckley, M. S. Foster. E. S. Morton. R. S. Ridgely, and F. G. Buckley, eds.). Omithol. Monogr. No. 36.

FFRENCH. R. 199 1. A guide to the birds of Trinidad and Tobago. 2nd ed. Comell Univ. Press, Ithaca.

FITZPATRICK,J. W. 1980. Some aspects of speciation in South American flycatchers. Pp.

1273- 1279 NI Proceedings of the 17th International Omithology Conference, Berlin, 1980. FLEISCHER.R. C., M. T. MURPHY, AND L. E. HUNT.1985. Clutch size increase and intraspecific brood parasitism in the Yellow-biiied Cuckoo. Wilson Bull. 97: 125- 127. FORBUSH, E. H. 1927. Birds of Massachusetts and other New England States, vol. 2. Massachusetts Dept. Agric., Boston.

FRIEDMANN,H. 1933. A contribution to the life-history of the Crespin or Four-winged Cuckoo, Tapera naevia. Ibis 1933: 532-539. FRIEDMANN,H. 1963. Host relations of the parasitic cowbirds. Bull. U.S. Natl. Mus. No. 233. FRIEDMANN,H. 1964. Evolutionary trends in the avian genus Clamafor. Smithson. Misc. Collect. No. 146.

FRIEDMANN, H. 1966. Additional data on the host relations of the parasitic cowbirds. Srnithson. Misc. Collect. 149: 1-12.

FEUEDMANN,H., L. F. KIFF, AND S. 1. ROTHSTEIN.1977. A further contribution to knowledge of the host relations of the parasitic cowbirds. Smithson. Contrib. 2001. No. 235. FRIESEN.V. L., A. J. BAKER, AND J. F. PLATT. 1996. Phylogenetic relationships wiihin the Alcidae (: Aves) inferred from total molecular evidence. Mol. Biol. Evol. 13: 359-367. F~RBRINGER.M. 1888. Untersuchungen zur Morphologie und Systematik der Vogel, vol. 2. Allgemeiner Theil. Tj. van Holkema, Amsterdam. GADOW,H. 1892. On the classification of birds. Proc. 2001. Soc. Lond. 1892: 229-256. GADOW,H. 1893. Vogel II, Systematischer Theil. In Bronn's Klassen und Ordnungen des

Their-Reichs , vol. 6. (H.G. Bronn, ed.). C. F. Winter. Leipzig.

GADOW.H., AND E. SELENKA.189 1. Vogel 1, Anatornischer Theil. In Bronn's Klassen und Ordnungen des Theis-Reichs, vol. 6. (H. G. Bronn, ed.). C. F. Winter. Leipzig. GAFFNEY.E. S. 1979. An introduction to the logic of phylogenetic reconstruction. Pp. 79-

11 1 in Phylogenetic analysis and paleontology. (J. Cracraft and N. Eldredge, eds.) Columbia Univ. Press, New York.

GALLUP.D. C., R. L. EDWARDS, AND R. G. JOHNSON. 1994. The timing of high sea leveis over the past 200,000 years. Science 263: 796-800.

GEORGE.J. C.. AND A. J. BERGER. 1966. Avian myology. Academic Press. New York.

GILBERT.B. M., L. D. MARTIN.AND H. G. SAVAGE 1981. Avian osteology. (B. M. Gilbert, ed.). B. M. Gilbert, Laramie.

GILL.F. B. 1995. Ornithology. 2nd ed. W. H. Freeman and Co., New York. GMELN,J. F. 1788- 1793. per regna tria naturae. vol. I, pt. 1. G. E. Beer, Lipsiae. GOODCHILD,J. G. 1891. The cubital coverts of the Euornithae in relation to taxonomy. Proc. Roy. Phys. Soc. Edin. 11: 3 17-333. GOULD.J. 1843. On nine new birds collected during the voyage of the H.M.S. Sulphur. Proc. 2001.Soc. Lond. 1843: 103-107.

GRAJAL,A., S. D. STRAHL,R. PARRA,M. G. DoMINGUEZ, AND A. NEHER. 1989. Foregut fermentation in the Hoatzin, a Neotmpical avian folivore. Science 245: 113 1-1 143. GRAY,G. R. 1840. A list of the genera of birds with an indication of the typicd species of each genus. Richard and John E. Taylor, London.

GRAY,G. R. 1844- 1849. The genera of birds. Longrnan. Green, and Longmans, London. GRIMMER,I. L. 1962. Strange little world of the Hoamin. Nad. Geogr. 122: 39 1-401.

GYLDENSTOLPE.N. 1945. A contribution to the ornithoiogy of nonhern Bolivia. Kun&

Svenska Vetens. Hand. 23: 1-3OO. HACKETT.S. J. 1993. Phylogenetic and biogeographic relationships in the Neotropical genus Gymnopithys (Fomiicariidae). Wilson Bull. 105: 30 1-3 15.

HACKETT. S. J., C. S. GRIFFITHS, J. M. BATES, AND N. K. KLEIN.1995. Re: a commentary on the use of sequence data for phylogeny reconstruction. Mol. Phylogen. Evol. 4: 350-356.

HAFFER,J. 1967. Speciation in Colombian forest birds West of the Andes. Am. Mus. Novit. 294: 1-57. HAFFER,J. 1969. Speciation in Amazonian forest birds. Science 165: 13 1- 137.

HA~R,J. 1974. Avian speciation in tropical South Amenca. (R. A. Paynter, ed.). hbl. Nuttall Ornithol. Club No. 14.

HAFFER,J. 1982. General aspects of the refugia theory. Pp. 6-24 in Biological diversification in the tropics. (G. T. Prance, ed.). Columbia Univ. Press, New York. HAFFER.J. 1985. Avian zoogeography of the Neotropical lowlands. Pp. 113-146 in

Neotropical Omithology. (P. A. Buckley, M. S. Foster. E. S. Morton, R. S. Ridgely, and F. G. Buckley, eds.). Omithol. Monogr. No. 36. HAFFER,J. 1987. Biogeography of Neotropical birds. Pp. 105-150 in Biogeography and Quaternary history in tropical America. (T. C. Whitmore and G. T. Prance, eds.). Oxford Univ. Press, New York.

HAMILTON.W. J., 111, AND M. E. HAMILTON.1965. Breeding characteristics of Yellow- billed Cuckoos in Arizona. Proc. Calif. Acad. Sci. 32: 405-432. HAMILTON,W. J., UI, AND G. H. ORIANS. 1965. Evolution of brood parasitism in altricial birds. Condor 67: 36 1-382.

HARRISON.H. H. 1975. A field guide to birds* nests of the eastern United States. Houghton Mifflin Co., Boston.

HARRISON,H. H. 1979. A field guide to western birds' nests. Houghton Mifflin Co., Boston.

HAVERSCHMIDT,F., AND G. F. MEES. 1994. Birds of . Vaco Press, Paramaribo. HAYES,F. E. 1995. Status, distribution, and biogeography of the birds of . Monogr. Field Omithol. No. 1.

HEDGES,S. B., M. D. SIMMONS,M. A. M. VAN DUK, G. CASPERS,W. W. DE JONG,AND

C. G. SIBLEY. 1995. Phylogenetic relationships of the Hoaizin, an enigmatic South American bird. Proc. Nad. Acad. Sci. 92: 11662- 11665.

HELM-BYCHOWSKI,K., AND J. CRACRAFT.1993. Recovenng phylogenetic signal from DNA sequences: relationships within the corvine assemblage (Class Aves) as inferred from complete sequences of the mitochondrial DNA cytochrome-b gene. Mol. Biol. Evo~.10: 1196-1214.

HELMANS.K. F.. AND T. VANDER HAMMEN. 1994. The Pliocene and Quaternary of the high plain of Bogotii (Colombia): a history of tectonic uplift, basin development, and

climatic change. Quaternary Int. 2 1: 4 1-6 1. HERRICK.F. H. 19 10. Life and behavior of the cuckoo. J. Exp. 2001. 9: 169-233.

HILLIS,D. M., MDJ. P. HLIELSENBECK.1992. Signal, noise, and reliability in molecular phylogenetic analyses. J. Hered. 83: 189- 195.

HILLIS, D. M., B. K. MABLE,A. LARSON,S. K. DAVIS, AND E. A. -ER. 1996. Nucleic acids IV: sequencing and cloning. Pp. 321-38 1 in Molecular systematics. (D. M. Hillis, C. Moritz, and B. K. Mable, eds.). Sinauer Assoc. Inc., Sunderland.

Hrrrt, S. L.. AND W. L. BROWN. 1986. A guide to the birds of Coiombia. Princeton Univ. Press, Princeton. HORSFALL,J. A. 1985. Cuckoos, turacos, and Hoatzin. Pp. 230-237 in The encyclopedia of

birds. (C. M. Penins and A. L. A. Middleton, eds.). Facts on File Inc., New York. HOUDE,P. 1987. Critical evaluation of DNA hybridization studies in avian systematics. Auk 104: 17-32.

HOUDE,P. 1992. Book review: Phylogeny and classification of birds: a study in molecular evolution. Quart. Rev. Biol. 67:62-63. HOWARD,H. 1929. The avifauna of Emeryville Shellmound. Univ. Cdif. Publ. 2001. 32: 30 1-394.

HOWARD.R., AND A. MOORE.1991. A complete checklist of birds of the world. 2nd ed. Academic Press, London.

HOWELL, S. N. G.,AND S. WEBB.1995. A guide to the birds of Mexico and northem Central Arnerica. Oxford Univ. Press, Oxford.

HUGHES,J. M. 1996a. Greater Roadrunner (Geococcyx californianus). In The birds of Nonh America, No. 244 (A. Poole and F. Gill. eds.). Academy of Natural Sciences, Philadelphia, and American Ornithologists' Union, Washington, D.C. HUGHES,J. M. 1996b. Phylogenetic analysis of the Cuculidae (Aves. Cuculiformes) using behavioral and ecological chancters. Auk 113: 10-22.

HUGHES,I. M. 1997a. Mangrove Cuckoo (Coccyzris minor). In The Birds of Nonh America, No. 299. (A. Poole and P. Gill, eds.). Academy of Natural Sciences, Philadelphia. and American Omithologists' Union. Washington. D.C.

HUGHES,I. M. 1997b. Taxonornic significance of egg rnirnicry in facultative brood

parasites of the genus Coccyzus (Cuculidae). Cm. J. 2001.75: 1380- 1386. HUGHES,J. M. 1997c. Vocal duetting by a mated pair of Coral-billed Ground-cuckoos

(Carpococcyx renauldi) at the Metro Toronto Zoo. Zoo Biol. 16: 179- 186. HUXLEY,T. H. 1867. On the classification of birds; and on the taxonomie value of the modifications of certain of the cranial bones observable in that class. Proc. Zool. Soc. Land. 1867: 4 15-472. &WIN, M. P. S. 1985. Interrelationships among African species of Centroptu (Cuculidae). Ostrich 56: 132- 134. JOURDAIN, F. C. R. 1925. A study of parasitism in the cuckoos. Proc. Zool. Soc. Lond. 1925: 639-667.

KENDEIGH, S. C. 1952. Parental care and its evolution in birds. U1. Biol. Monogr. No. 22.

KIMURA. M. 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Biol. 16: 11 1- 120. KNOWLTON, F. H. 1909. Birds of the world. (R. Ridgway, ed.). A. Constable and Co.. Ltd., London.

LACK, D. 1968. Ecological adaptations for breeding in birds. Methuen and Co., Ltd., London. LACK, D. 1976. Island biology illustrated by the land birds of Jamaica, vol. 3. Studies in Ecology. Univ. California Press, Berkeley.

LANGRAND, 0. 1990. Guide to the birds of Madagascar. Yale Univ. Press, New Haven. LANYON, S. M. 1992. Review of: Phylogeny and classification of birds: a study in molecular evolution. Condor 94: 304-3 10.

LANYON. S. M. 1994. Polyphyly of the blackbird genus Agelaius and the importance of assumptions of monophyly in comparative studies. Evolution 18: 679-693.

LAWRENCE,G. N. 1861. Catalog of birds collected at the Island of Sombrero, W. L, wiih

observations by A. A. Julien. Ann. Lyc. Nat. Hist. New York 8: 93-107. LAYMON. S. A. 1980. Feeding and nesting behavior of the Yellow-billed Cuckoo in the Sacramento Valley. Wildlife Management Administrative Rept. 80-2. California Dept. and Game, Sacramento. L'HERMINER,M. 1837. Recherches anatomiques sur quelque genres d'oiseaux rares ou encore peu connus sous le rapport de l'organisation profounde. Comptes Rendus.

Acad. Sci. Paris 12: 433-44 1. LIGON, J. D. 1965. A Pleistocene avifauna from Haile, Florida. Bull. Fla. State Mus. 10: 127- 158.

LILUEBORG. W. 1886. Outiine of a systematic review of the class of birds. Proc. 2001. Soc. Lond. 1886: 5-20. LINCOLN,F. C. 1939. The migration of Amencan birds. Doubleday, Doran. and Co., New York. LINNAEUS. C. 1758. Systema naturae per regna tria naturae, vol. 1. 10th ed. Lmpensis L. Salvii, Holrniae.

LOWE, P. R. 1938. Some matornicd and other notes on the systematic position of the genus Picathnrtes, together with sorne remarks on the families Sturnidae and Eulabetidae. lbis 1938: 254-269.

LOWE. P. R. 1943. Some notes on the anatomical differences obtaining between the Cuculidae and the Musophagidae. with special reference to the specialization of the

oesophagus in Cucrilus cunorrrs Linnaeus. lbis 85: 490-5 15.

MACEDO. R. H. 1992. Reproductive patterns and social organization of the communal Guira Cuckoo (Guira guira) in centrai Brazii. Auk 109: 786-799.

MACLEAN, G. L. 1985. Roberts' birds of Southern Africa. 5th ed. Trustees of the John Voe!cker Bird Book Fund, Cape Town.

MACON, J.. AND J. M. MACON. 1909. Catalogue of Canadian birds. Canada Dept. Mines. Ottawa.

MNDISON, W. P., AND D. R. MADDISON. 1992. MacClade, version 3. Sinauer Assoc., Sunderland.

MARSHALL, L. G. 1985. Geochronology and land-mammal biochronology of the Transamerican faunal interchange. Pp. 49-85 in The great American biotic interchange. (F. G. Stehli and S. D. Webb, eds.). Plenum Press, New York.

MARTM, L. D.,AND R. M. MENGEL. 1984. A new cuckoo and a chachaiaca from the early Miocene of Colorado. Carnegie Mus. Nat. Hist. Spec. Publ. 9: 171-177. MARTMELLI,L. A., L. C. R. PESSENDA,E. ESPINOZA,P. B. CAMARGO,E. C. TELLES,C. C. CERRI,R. L. VICTORIA,R. ARAVWA, J. RICHEY, AND S. TRUMBORE.1996. C-13 variation with depth in soils of Brazil and climate-change during the Quaternary. Oecologia 106: 376-38 1.

MAY, R. M., AND S. K. ROBINSON.1985. Population dynhcs of avian brood pansitism.

Am. Nat. 126: 475-494.

MAYR,E., AND W. J. BOCK. 1994. Provisional classification v standard avian sequences: heuristics and communication in omithology. ibis 136: 12- 18. MC~LWRAITH.T. 1894. The Birds of Ontario. 2nd ed. William Briggs, Toronto.

MCKENNA,M. C. 1983. Holarctic landmass remangement, cosmic events, and Cenozoic

terrestrial . Am. Miss. Bot. Gard. 70: 4591189.

MÉGARD,F. 1992. The evolution of the Pacific Ocean margin in South America north of Arica Elbow. Pp. 208-230 in Evolution of the Pacific Ocean margins. (Zvi Ben- Avraham, ed.). Oxford Univ. Press. New York.

MEYERDE SCHAUENSEE, R. 1982. A guide to the birds of South America. Livingston Publ. Co., Wynnewood.

MEYERDE SCHAUENSEE,R., AND W. H. PHELPS, JR. 1978. A guide to the birds of Venezuela. Princeton Univ. Press, Princeton.

MILLER, A. H. 1946. Social parasites among birds. Sci. Mon. 62: 238-246.

MILNE-EDWARDS,A. 1892. Sur les oiseaux fossiles des dépots Eocènes de phosphate de

Chaux du sud de la France. Comptes Rendus, Congrés d'ornithologie International (Budapest, 189 1) 2: 60-80.

MOKSNES,A., E. R~SKAFT,AND T. RSSE.1995. On the evolution of blue cuckoo eggs in Europe. J. Avian Biol. 26: 13-19. MORGAN.G. S. 1977. Late Pleistocene fossil vertebrates from the Cayman Islands, B. W. 1. Master's thesis, Univ. of Florida, Gainesville. MORONY.J. J.. JR., W. J. BOCK.AND J. FARRAND, JR. 1975. Reference list of the birds of the worid. Am. Mus. Nat. Hist., New York.

MORTON, E. S.. AND S. M. FARABAUGH.1979. Infanticide and other adaptations of the nestling Striped Cuckoo, Tapera naevia. Ibis 12 1: 2 12-213. MULLER,P. L. S. 1776. Des Ritters Car1 von Linne. Vollstanigen Natursystems Supplements und Register-band uber alle sechs Theile oder Classen des Theirreichs. G. N. Raspe, Numberg. MUNDY, P. J. 1973. Vocal mirnicry of their hosts by nestlings of the and Stnped Crested Cuckoo. Ibis 1 15: 602-604.

MURPHY. R. W., AND K. D. DOYLE.Phylophenetics: frequencies and polymorphic characters in genealogicd estimation. Syst. Biol. In press. NEUTENEmL. A. 195 1. Observaciones sobre el Dromococcyx pavoninus Pelzeln y el parasitisme de los cuculidos. Homero 9: 288-290.

NICKELL,W. P. 1954a. Red-wings hatch and raise a Yellow-billed Cuckoo. Wilson Buil. 66: 137-138. NICKELL. W. P. 1954b. Yellow-biiled Cuckoo's egg in Mourning Dove's nest. Wilson Bull. 66: 137. NITZSCH.C. L. 1840. Systern der Pterylographie. E. Anton, Halle.

NOLAN,V.. JR., AND C. F. THOMPSON.1975. The occurrence and significance of

anomalous reproductive activities in two North American cuckoos Coccyzus spp. Ibis 117: 496-503. NORES,M. 1992. Bird speciation in subtropical South America in relation to forest expansion and retraction. Auk 109: 346-357.

NORRIS,D. J., AND W. H. ELDER.1982. Decline of the roadrunner in Missouri. Wilson Bull. 94: 354-355.

OATES. E. W. 1903. Catalogue of the collection of bird's eggs in the British Museum. vol. 3. Order of the Trustees, London. OBERHOLSER, H. C. 1975. The bird life of Texas. Univ. Texas Press, Austin.

OLSON.S. L. 1985. The fossil record of birds. Pp. 79-238 in Avian biology. (D.S. Farner, J. R. King, and K. C. Parkes, eds.). Harcourt Brace Jovanovich Publ., New York. OLSON,S. L. 1992. A new family of primitive landbirds from the lower Eocene of Wyoming. Pp. 127436 in Proceedings of 2nd International Symposium of the Society of Avian Paleontology and Evolution. Nat. Hist. Mus., Los Angeles. PAYNE.R. B. 1973a. Behavior, mimetic songs and Song diaiects, and relationships of the pansitic indigobirds (Vidua)of Africa. Omithol. Monogr. No. 11. PAYNE, R. B. 1973b. Individual laying histories and the clutch size and numbers of eggs of parasitic cuckoos. Condor 75: 414-438. PAYNE,R. B. 1977. The ecology of brood parasitism in birds. Annu. Rev. Ecol. Syst. 8:l-

28.

PAYNE,R. B., AND K. PAYNE.1967. Cuckoo hosts in southem Africa. Ostrich 38: 135-143. PETERS, J. L. 1934. Check-list of birds of the world, vol. 2. Harvard Univ. Press, Cambridge.

PETERS, J. L. 1940. Check-list of birds of the world, vol. 4. Harvard Univ. Press, Cambridge.

PETERSON,A. T. 1992. Book review: Phylogeny and classification of birds: a study in molecular evolution. bis 134: 204-206. PETERSON, R. T. 1980. A field guide to the birds of eastern and central Nonh America. Houghton Mifflin Co., Boston.

PETERSON,R., G. MOUNTFORT,AND P. A. D. HOLLOM.1983. A field guide to the birds of Britain and Europe. 4th ed. Collins, London.

PINTO, 0. 1938. Catalogo das aves do Brasil, pt. 1. Museu Paulista Revista, vol. 22. SiIo Paulo. PO~R,E. F. 1980. Notes on nesting Yellow-billed Cuckoos. J. Field Ornith. 51: 17-28. PRANCE, G. T. 1987. Soils and vegetation. Pp. 19-45 in Biogeography and Quarternary history in tropical Arnenca. (T. C. Whitmore and G. T. Prance, eds.). Oxford Univ. Press, New York. PRUM, R. 0. 1986. Historical relationships among avian forest areas of endernism in the Neotropics. Pp. 2562-2572 in Proceedings of the 19th International Omithological Congress, Ottawa, 1986. PRUM.R. 0. 1990. Phylogenetic analysis of the evolution of display behavior in the Neotropical manakins (Aves: Pipridae). Ethology 84: 202-23 1. PYCRAFT,W. P. 1895. On the pterylography of the Hoatzin, Opisthocomus cristc~tus.Ibis 37: 345-373.

PYCRAFT, W. P. 1903. Contributions to the osteology of birds, pt. 4. Proc. 2001. Soc. Lond. 1: 258-29 1.

RAIKOW. R. J. 1978. Appendicuiar myology and relationships of the New World nine- primaried oscines (Aves: Passeriformes). Bull. Carnegie Mus. Nat. Hist. 7: 1-43. RAIKOW, R. 1. 1982. Monophyly of the Passeriformes: test of a phylogenetic hypothesis. Auk 99: 43 1-445. RALPH,C. P. 1975. Life style of Coccyus pumilus, a tropical cuckoo. Condor 77: 60-72.

RIDGELY,R. S., AND J. A. GwYNNE, JR. 1989. A guide to the birds of Panama, with Costa Rica, , and . 2nd ed. Princeton Univ. Press, Princeton. RIDGWAY, R. 1890. Scientific results of explorations by the U.S. Fish Commission steamer . 1: Birds collected on the Galapagos Islands in 1888. Proc. U.S. Natl. Mus. 12: 101-128.

RIDGWAY,R. 1912. Diagnosis of some new genera of American birds. Proc. Biol. SOC. Wash. 25: 97-102.

RIDGWAY, R. 1916. The birds of North and Middle Arnerica, pt. 7. Bull. U.S. Natl. MUS. No. 50. RIDGWAY, R., J. A. ALLEN, W. BREWSTER,E. COUES,AND C. H. MERRiAN. 1899. Ninth supplement to the American Omithologists* Union check-list of North American birds. Auk 16: 97- 133.

ROBERTS, T. S. 1932. The birds of Minnesota. Univ. Minnesota Press, Minneapolis.

ROHWER, S., AND C. D. SPAW.1988. Evolutionary iag versus bill-size constraints: a comparative study of the acceptance of cowbird eggs by old hosts. Evol. Ecol. 2: 27- 36.

RO~SCHILD,W., AND E. HARTERT. 1902. Further notes on the fauna of the Galiipagos Islands: notes on the birds. Novit. Zool. 9: 38 1-4 18. ROTHSTUN, S. 1. 1975. An experimental and teleonomic investigation of avian brood parasitism. Condor 77: 250-27 1.

ROTHSTEIN, S. 1. 1982. Mechanisms of avian egg recognition: which egg parameters elicit responses by rejector species? Behav. Ecol. Sociobiol. 1 1: 229-239.

ROTHSTEIN. S. 1. 1990. A mode1 system for : avian brood parasitism. Annu. Rev. Ecol. Syst. 2 1: 48 1-508.

ROWAN, M. K. 1983. The doves, parrots, louries, and cuckoos of southem Africa. Croom Helm Ltd., London.

SAITOU, N., AND M. NEI. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 106-425.

SALVIN,0. 1882. A catalogue of the collection of birds. Cambridge Univ. Press, Cambridge.

SCHONWE~R,M. 1964. Handbuc h der Ooiogie. Vol. 1: Nonpasseres. Akademie-Verlag, Berlin. SCHUBERT,C. 1988. Climatic changes during the glacial maximum in northem South America and the Caribbean: a review. Interciencia 13: 128- f 37.

SCLATER,P. L. 1870. Further notes on the cuckoos of the genus Coccyzus. Proc. Zool. Soc. Lond. 1870: 165- 169. SCLATER,P. L. 1880. Remarks on the present state of the system avium. Ibis 22: 340-350, 399-4 1 1.

SCLATER.P. L., AND O. SALVIN.1873. Nomenclator avium Neotropicalium. Sumptibus Auctorum, London.

SCOTT, D. M., AND C. D. ANKNEY. 1983. The laying cycle of Brown-headed Cowbirds: passerine chickens? Auk 100: 583-592. SEALY,S. G. 1978. Possible influence of food on egg-laying and clutch size in the Black- billed Cuckoo. Condor 80: 103-104.

SEIBEL.D. E. 1988. A phylogenetic analysis of the Cuculiformes and Opisthocornus, based

on postcranial skeletal characters. Ph.D. dissertation. Univ. Kansas, Lawrence. SELANDER.R. K. 1971. Systematics and speciation in birds. Pp. 57-147 in Avian biology.

(D. S. Farner and J. R. King, eds.). Academic Press, New York. SELANDER,R. K., AND R. F. JOHNSTON. 1967. Evolution of the . 1: Intrapopulation variation in North America. Condor 69: 2 17-258- SHARPE,R. B. 1891. A review of recent attempts to classify birds. Address given at Congrés d'Ornithologie international, Budapest. 189 1. SHARPE,R. B. 1900. Hand-list of the genera and species of birds, vol. 7. British Mus. Nat. Hist., London.

SHELDON, F. H.,AND A. H. BLEDSOE.1993. Avian molecular systematics, 1970s to 1990s. Annu. Rev. Ecol. Syst. 24: 243-278.

SHELEY, G. E. 1891. Suborder Coccyges. Pp. 209-456 in Catalogue of the birds in the British Museum. (P. L. Sclater and G. E. Shelley, eds.). British Mus. Nat. Hist., London.

SHORT,L. L. 1975. A zoogeographic analysis of the South Amencan chaco avifauna. Bull. Am. Mus. Nat. Wist. 154: 163-352.

SHUFELDT.R. W. 1886. Contributions to the anatomy of Geococcyx californianus. Proc. 2001.Soc. Lond. 1886: 466-49 1. SHUFELDT,R. W. 190 1. The osteology of the cuckoos (Coccyges). Proc. Am. Philos. Soc. 40: 4-5 1.

SHUFELM.R. W. 1904. An arrangement of the farnilies and the higher groups of birds. Am. Nat. 38: 833-857.

SHUFELDT,R. W. 1909. Osteology of birds. New York State Mus. Bull. No. 130.

SIBLEY, C. G. 1955. A synopsis of the birds of the world: a manual of systematic onithology. Comell Univ. Dept. Conservation, Ithaca, New York.

SIBLEY, C. G., AND J. E. AHLQUIST.1972. A comparative study of the egg white proteins of non-passerine birds. Peabody Mus. Nat. Hist. Bull. No. 39.

SIBLEY.C. G., AND J. E. AHLQCIIST. 1973. The relationships of the Hoatzin. Auk 90: 1-13.

SIBLEY. C. G.,AND J. E. AHLQüiST. 1990. Phylogeny and ciassification of birds: a study in rnolecular evolution. Yale Univ. Press, New Haven.

SIBLEY, C. G., AND B. L. MONROE,JR. 1990. Distribution and taxonomy of birds of the world. Yale Univ. Press, New Haven.

SIBLEY, C. G., AND B. L. MONROE,JR 1993. Supplement to the distribution and taxonomy of birds of the world. Yale Univ. Press, New Haven-

SICK, H. 1993. Birds in Brazil. Princeton Univ. Press, Princeton.

SEVWG, K. E. 1990. Cuckoo foraging behavior, with notes on habits and possible social organization in Panama. I. Field Ornithol. 61: 41-46.

SIMPSON.B. B., AND J. HAFFER. 1978. Speciation patterns in the Amazonian forest biota. Ann. Rev. Ecol. Syst. 9: 497-518. SLUD, P. 1964. The birds of Costa Rica. Bull. Am. Mus. Nat. Hist. No. 128.

SMITH, T. B., R. K. WAYNE,D. I. GIRMAN,AND M. W. BRUFORD.1997. A r0k for ecotones in generating rainforest biodiversity. Science 276: 1855- 1857. SMYTHIES.B. E. 1968. The birds of Bomeo. Oliver and Boyd Publ., London. SPENCER,O. R. 1943. Nesting habits of the Black-billed Cuckoo. Wilson Bull. 55: 11-22. SPRUNT,A., JR., AND E. B. CHAMBERLAIN.1949. South Carolina birdlife. Contrib. Charleston Mus. No. 1 1. STEADMAN,D. W. 1986. Holocene vertebrate fossils from IsIa Floreana, Galapagos

(Ecuador). Srnithson. Contrib. Zool. 4 13: 1- 104. STEGMANN,B. C. 1978. Relationships of the superorders Alectoromorphae and

Chandriomorphae (Aves): a comparative study of the avian hand. (R. A. Paynter, Ir., ed.). Publ. Nuttdl Ornithol. Club No. 17,

STILES,F. G., AND A. F. SKUTCH.1989. A guide to the birds of Costa Rica. Corne11 Univ. Press, Ithaca. S~L,S. D. 1985. The behavior and socio-ecology of the hoatzin, Opisthocomus hoazin, in the llanos of Venezuela. Ph.D. dissertation. State Univ. New York, Albany. STRAHL,S. D. 1987. The social organization and behavior of the Hoatzin Opisthocomus hoazin in central Venezuela. Ibis 130: 483-502.

STRESEMANN,E. 1934. Aves. In Handbuch der Zoologie. vol. 7, pt. 2. sec. 8. (W.

Kükenthal and T. Krumbach, eds.). Walter de Gruyter, Berlin. STRESEMANN,E. 1959. The status of avian systematics and its unsolved problems. Auk 76: 269-280.

STRICKLAND,H. E. 1852. P. 28 in Contributions to ornithology. (W. Jardine. ed.). S. Highley, London. STUTE, M.. M. FORSTER,H. FRISCHKORN,A. SEREJO,J. F. CLARK,P. SCHLOSSER,W. S.

BROECKER,AND G. BONANI. 1995. Cooling of tropical Brazil (5°C)during the last glacial maximum. Science 269: 379-383. SWAINSON,W. 1837. On the natural history and classification of birds. vol. 2. Longman, Rees. Orme, Brown, Green. and Longman, London. SWARTH.H. S. 193 1. The avifauna of the Galiipagos Islands. Occa. Pap. Calif. Acad. Sci. No. 18. SwoWoRD, D. L. 1993. PAUP: Phylogenetic analysis using parsimony, version 3.1. Illinois Nat. Hist. Surv., Champaign. THOMAS,B. T. 1978. The Dwarf Cuckoo in Venezuela. Condor 80: 105- 106. TOPSELL,E. 1972. The fowles of heaven or history of birdes. (T. P. Harrison and F. D. Hoeniger, eds-). Univ. Texas Press, Austin.

TOSTAIN. O.. J. DUJARDIN,C. ÉRARD,AND J. THIOLLAY.1992. Oiseaux de Guyane. Société d'Études Omithologiques, Brunoy.

VAN DER HAMMEN, T. 1982. Paleoecology of tropical South America. Pp. 60-66 in Biologicai diversification in the tropics. (G. T. Prance, ed.). Columbia Univ. Press. New York.

VAN DER HAMMEN. T. 1991. Palaeoecological background: Neotropics. Climate Change

19: 37-47.

VAN TUINEN.P., AND M. VALENTINE.1986. Phylogenetic relationships of turacos (Musophagidae: Cuculiformes) based on comparative chromosome banding analysis. Ibis 128: 364-38 1.

VANTYNE, J., AND A. J. BERGER.1959. Fundamentals of omithology. I. Wiley and Sons, Inc., New York. VEHRENCAMP.S. L. 1976. The evolution of communal nesting in Groove-billed Anis. Ph.D. dissertation. Comell Univ., Ithaca.

VERHENCAMP,S. L., B. C. BOWEN,AND R. R. KOFORD. 1986. Breeding roles and pairing patterns within communal groups of Groove-billed Anis. Anim. Behav. 34: 347-366.

VERHEYEN.R. 1956a. Contribution à l'anatomie et à la systématique des touracos

(Musophagi) et des coucous (Cuculiformes). Bull. Inst. R. Sci. Nat. Belg. 32(23): 17- 28. VERHEYEN,R. 1956b. Note systématique sur Opisthoco~nushoazin (St-Müller). Bull. Inst.

R. Sci. Nat. Belg. 32(32): 1-8. VERHEYEN,R. 196 1. A new classification for the non-passerine birds of the world. Bull. Inst. R. Sci. Nat. Belg. 37(32): 1-36.

VERNON,C. 1. 197 1. Notes on the biology of the . Ostrich 42: 242-258. VEILLOT, L. J. P. 18 16. Analyse d'une nouvelle ornithologie elementaire. Deterville, Paris.

VIEILLOT,L. J. P. 18 17. Nouveau dictionnaire d'histoire naturelle, vol. 8. Deterville, Paris.

VIGORS,N. A. 1825. Observations on the natural affinities that connect the orders and families of birds. Trans. Lim. Soc. Lond. 14: 395-562. VUILLEUMIER,F. 1984. Faunal turnover and developrnent of fossil avifaunas in South Arnerica. Evolution 38: 1384- 1396. VUILLEUMIER,F. l985a. Fossil and Recent avi faunas and the Interamericm interchange. Pp. 387-424 Ni The great Amencan biotic interchange. (F. G. Stehli and S. D. Webb, eds.). Plenum Press, New York. VUILLEUMIER,F. 1985b. Fossil evidence on the development of South Arnerica avifaunas. Pp. 348-357 in Proceedings of the 18th International Omithological Conference, Moscow, 1982.

WAGLER,I. G. 1830. Natürliches System der Amphibien mit vorangehender Classification

der Siiugethiere und Vogei. J. G. Cotta Munich.

WEBB,S. D. 1978. A history of savanna venebrates in the New World. Part II: South Amenca and the Great Interchange. Annu. Rev. Ecol. Syst. 9: 393-426.

WEIGEL, R. D. 1963. Oligocene birds from Saskatchewan. Quart. J. Ra. Acad. Sci. 26: 257-262. WELLER,M. W. 1959. Parasitic egg laying in the Redhead (Aythya urnericana) and other North American Anatidae. Ecol. Monogr. 29: 333-365. WETMORE,A. 1926. Observations on the birds of Argentina, Paraguay, Uruguay, and Chile. Bull. U.S. Natl. Mus. No. 133. WETMORE,A. 1960. A classification for the birds of the world. Srnithson. Misc. Collect. 139 (1 1): 1-37. WETMORE,A. 1968. The birds of the Republic of Panama Pt. 2. Columbidae (pigeons) to Picidae (woodpeckers). Srnithson. Misc. Collect. No. 150. WILEY,E. O. 198 1. Phylogenetics: the theory and practice of phylogenetic systematics. J. Wiley and Sons, New York. WILEY, I. W. 1985. parasitism in two avian cornmunities in Puerto Rico. Condor 87: 165- 176.

Waus, E. 0. 1982. Ground-cuckoos (Aves, Cuculidae) as army followen. Rev. Bras. Biol. 42: 753-756. WILSON, A. 18 1 1. Arnerican omithology. Porter, Philadelphia.

WILSON, A., AND C. L. BONAPARTE.1877. American ornithology, vol. 2. Casseil, Petter, and Gaipin, London. WITHERBY, W. F. 1938. The handbook of British birds. Vol. 2, warblers to . H. F. and G. Witherby, Ltd., London. WOLE, D. H. 1994. Yellow-billed Cuckoo hatched in Mourning Dove nest. Bull. Okla. Ornithol. Soc. 27: 29-30.

WOOD. D. S., AND G. D. SCHNELL. 1986. Revised world inventory of avian skeletal specimens. American Ornithologists' Union, Washington, D.C. and Oklahoma Biological Survey, Norman.

WYLLE, 1. 198 1. The cuckoo. Universe Books, New York. IMAGE NALUATION TEST TARGET (QA-3)

APPLIED IMAGE. lnc -.-S 1653 East Main Street --, Rochester, NY 14609 USA ------Phone: 716/4ô2-0300 ---- Fm: 71612884989

O 1993. Applied Image. Inc.. All Righls Rese~ed

Top View


© 2022 Docslib.org