Gene Expression Analysis of Flrt1, Flrt2 and Flrt3 in the Murine Midface During Early Embryogenesis

Gene expression analysis of Flrt1, Flrt2 and Flrt3 in the murine midface

during early embryogenesis

Karen Chung

A thesis submitted in conformity with the requirements

for the degree of M.Sc.

Graduate Department of Dentistry

University of Toronto

embryogenesis

Karen Chung, M.Sc., Faculty of Dentistry, University of Toronto (2009)

The Fibronectin leucine-rich transmembrane (Flrt) gene family has been implicated in

FGF signaling, which is crucial for coordinating craniofacial morphogenesis and epithelial- mesenchymal interactions (EMI). The gene expression patterns of Flrt1, Flrt2 and Flrt3 were analyzed during critical stages of murine midfacial development from 9.5-15.5 dpc. Flrt2 and

Flrt3 were observed to have unique expression patterns in the midface, whereas Flrt1 did not.

From 10.5-12.5dpc, Flrt2 was expressed in the mesenchyme of the medial nasal process(MNP).

Flrt3 was expressed in the mesenchyme of the lateral nasal process (LNP) and MNP. From 13.5-

15.5dpc, Flrt2 was expressed in the oral ectomesenchyme of the palatal shelves, whereas Flrt3 was expressed in the medial edge and oral epithelium. Both Flrt2 and Flrt3 were expressed in different sites of the developing tooth buds and hair follicles. This suggests that Flrt2 and Flrt3 have unique roles during craniofacial morphogenesis, whereas Flrt1 may have a more generalized role.

i TABLE OF CONTENTS

Introduction ...... 1 Induction and Migration of Cranial Neural Crest Cells (CNCCs) ...... 2 Neural Crest Cells ...... 2 Cranial Neural Crest Cells ...... 2 Generation and Delamination of CNCCs ...... 3 Migration of CNCCs ...... 5 CNCC Differentiation ...... 5 Predetermination of CNCC Fate ...... 6 Epithelial-Mesenchymal Interaction in determining CNCC fate ...... 9 EMI in the early development of the Structures of the Head ...... 11 Formation of the Facial Prominences ...... 13 EMI in the development of the Secondary Palate ...... 14 EMI in the development of the Meckel’s Cartilage and Teeth ...... 15 Key Signaling Factors in EMI ...... 17 Bone Morphogenetic Proteins (BMPs) ...... 17 Fibroblast Growth Factors (FGFs) ...... 19 Roles of FGF and BMP in Craniofacial Development ...... 23 Fibronectin Leucine-Rich Transmembrane (FLRT) Protein Family ...... 27 FLRT protein Discovery and Structure ...... 27 Role of FLRTs in FGF signaling ...... 32 Documented Flrt Expression in the developing embryo ...... 33 A Potential Role of FLRTs in Craniofacial Development ...... 34 Study Objectives ...... 34 Materials and Methods ...... 36 Rationale and Design ...... 36 Design of Gene Expression Studies ...... 36 Flrt gene family ...... 36 Other genes of interest ...... 36 Design of Protein Expression Studies ...... 37 Materials and Methods for ISH...... 37 Riboprobe Generation ...... 37 Preparation of Mouse embryos for whole mount and section ISH ...... 44 Preparation of embryos for cryosections ...... 44 Preparation of embryos for Whole mount ISH ...... 44 Hybridization and Detection of Probe ...... 45 Determining optimal hybridization conditions ...... 45 Probe concentration ...... 45 Post hybridization conditions for Whole Mount ISH ...... 45 Post hybridization conditions for Section ISH ...... 46 In situ hybridization Negative Controls ...... 47 Materials and Methods for Immunohistochemistry ...... 48 Antibodies used ...... 48 Primary Antibody...... 48

Secondary Antibody...... 48 Controls ...... 49 Results ...... 50 Whole Mount ISH ...... 50 Negative control at 10.5 dpc ...... 50 Flrt1 at 10.5 dpc ...... 50 Flrt2 from 9.5 – 12.5 dpc ...... 50 Flrt3 at 10.5 dpc ...... 51 Section ISH ...... 51 Negative control at 10.5 dpc ...... 51 Flrt Expression in the Primary Palate ...... 51 Flrt Expression in the Secondary Palate ...... 52 Flrt Expression in the VNO ...... 53 Flrt Expression in the developing Tooth ...... 53 Flrt Expression in the Hair Follicle ...... 54 Negative Controls for ISH ...... 54 FLRT2 Immunostaining...... 55 Figures...... 57 Discussion ...... 78 Flrt1 Expression ...... 78 Flrt2 and Flrt3 Expression...... 79 Expression in the Primary Palate ...... 81 Flrt2 in the Primary Palate ...... 81 Flrt3 in the Primary Palate ...... 81 Potential Role of FLRTs in CNCC outgrowth and differentiation ...... 82 Expression in the Secondary Palate ...... 83 Flrt2 in the Secondary Palate ...... 83 Flrt3 in the Secondary Palate ...... 84 Potential Roles of Flrt gene members in Secondary Palatogenesis ...... 84 Cell Adhesion as a possible function of FLRTs ...... 84 Spatial Patterning as a possible function of FLRTs ...... 85 FLRTs modulating FGF signaling specificity ...... 86 FLRTs possibly acting through the TGFβ signaling pathway ...... 86 Expression during Vomeronasal Organ development ...... 88 Flrt2 in the VNO ...... 88 Flrt3 in the VNO ...... 88 Expression in the Tooth ...... 88 Flrt2 in the Tooth ...... 88 Flrt3 in the Tooth ...... 89 Expression in the Hair Follicles ...... 90 Flrt2 in the Hair Follicles ...... 90 Flrt3 in the Hair Follicles ...... 91 Limitations to ISH...... 91 Protein expression pattern ...... 93 Experimental Controls ...... 98 In situ Hybridization ...... 98

Immunohistochemistry ...... 98 Future Directions ...... 99 Investigation of the different roles of FLRT2 and FLRT3 ...... 99 Proposed studies to investigate the effect of FLRTs on FGF signaling ...... 100 Investigating the genetic interaction between Flrts and members of the Fgf signaling family ...... 100 Investigating FLRT binding partners ...... 101 Investigating FLRT modulation of FGF signaling ...... 102 Proposed studies to investigate the role of FLRTs in EMI ...... 103 Experiments involving Flrt gene expression ...... 103 Experiments involving FLRT protein expression ...... 104 Conclusion ...... 105 References ...... 106

ABBREVIATIONS AER apical ectodermal ridge A-P anterior-to-posterior BCIP-NBT 5-bromo-4-chloro-3-indolyl phosphate-nitro blue tetrazolium salt BMP(R) bone morphogenetic protein (receptor) CL/P cleft lip and/or cleft palate CNCC cranial neural crest cell DN dominant-negative (mutant) dpc days post coitum EMI epithelial-mesenchymal interaction (s) EMT epithelial-mesenchymal transition FLRT fibronectin-like leucine rich transmembrane FGF(R) fibroblast growth factor (receptor) FNIII fibronectin type III (domain) FNP frontonasal process IC intracellular (domain) ISH in situ hybridization LNP lateral nasal process Mn mandibular process (1st branchial arch) MNP medial nasal process MxP maxillary process LRR leucine rich repeat (domain) ORS outer root sheath (hair) PS palatal shelf (secondary palate) PI(3)K phosphoinositide 3-kinase MABT maleic acid/ NaCl / Tween 20 (buffer) MAPK mitogen-activated protein kinase MEE medial edge epithelium MES medial edge seam MSX muscle-segment homeobox r1, r2, r3, etc rhombomere 1, rhombomere 2, rhombomere 3, etc SSC sodium chloride sodium citrate (buffer) Shh Sonic hedgehog SPRY Sprouty TGFβ transforming growth factor β IRS inner root sheath (hair) VNO vomeronasal organ VRs vomeronasal receptors

LIST OF FIGURES AND TABLES

Figure 1.1. Schematic representation of the migration of CNCCs from the rhombomeres of the neural crest into the craniofacial region...... 4 Figure 1.2. Representation of the expression domains of Shh and Fgf8 in the frontonasal prominence (FNP) of a stage 20 chick embryo ...... 10 Figure 1.3. Scanning electron micrograph of the craniofacial region of a 10.5 dpc mouse embryo...... 12 Table 1.1. Ligand specificities of FGFR isoforms...... 20 Figure 1.4. Fibroblast Growth Factor (FGF) signaling and their regulators...... 21 Figure 1.5. Schematic representation of the Fibronectin Leucine-Rich Transmembrane (FLRT) protein family interacting with FGFR...... 29 Table 1.2. Selected microarray data of gene expression in the MNP vs. LNP ...... 35 Table 2.1. Riboprobe generation ...... 39 Table 2.2. Riboprobe Sense Sequences ...... 43 Table 3.1. Comparison between Flrt2 mRNA and FLRT2 protein expression ...... 56 Figure 3.1. Whole mount ISH showing expression of Flrt2 in murine embryos at 9.5 – 12.5 dpc...... 57 Figure 3.2. Whole mount ISH showing expression of Flrt2 and Flrt3 in murine embryos at 10.5 dpc...... 59 Figure 3.3. Flrt1 gene expression at 10.5 dpc using whole mount in situ hybridization (ISH)...... 60 Figure 3.4. Negative controls...... 61 Figure 3.5. Transverse section showing the expression of Flrt2 in the developing midface at 9.5 dpc...... 62 Figure 3.6. Transverse section showing the expression of Flrt2 developing midface at 10.5 dpc...... 63 Figure 3.7. Transverse section showing the expression of (A) Flrt2 and (B) Flrt3 in the developing midface of murine embryos...... 64 Figure 3.8. Transverse section showing the expression of Flrt2 in the developing midface at 11.5 dpc...... 65 Figure 3.9. Transverse sections showing the expression of (A) Flrt2 and (B) Msx1 in the developing midface of murine embryos at 11.5 dpc...... 66 Figure 3.10. Msx2 riboprobe at 10.5 dpc...... 67 Figure 3.11. Frontal sections showing the expression of (A) Flrt2 and (B) Flrt3 in the developing midface of murine embryos at 12.5 dpc...... 68 Figure 3.12. Frontal section showing the expression of (A) Flrt2 and (B) Flrt3 in the developing oral cavity at 12.5 dpc...... 69 Figure 3.13. ISH of coronal sections showing expression of Flrt2 and Flrt3 in the palatal shelves (PS) of murine embryos at 13.5 to 14.5 dpc...... 70 Figure 3.14. Whole mount ISH of the secondary showing expression of Flrt2 in the palatal shelves (PS) of murine embryos at 14.5 dpc...... 71 Figure 3.15. Coronal sections showing expression of Flrt2 and Flrt3 in the developing hair follicle and tooth buds of murine embryos at 14.5 dpc...... 72 Figure 3.16. FLRT2 protein expression at 9.5 dpc in a transverse section of the head. ... 73

Figure 3.17. FLRT2 protein expression at 10.5 dpc in a frontal section of the developing murine midface...... 74 Figure 3.18. Frontal section demonstrating FLRT2 protein expression at 11.5 dpc...... 75 Figure 3.19. FLRT2 protein expression in the VNO, tooth bud, and hair follicle at 15.5 dpc...... 76 Figure 3.20. FLRT2 negative control at 10.5 dpc...... 77 Table 4.1. Comparing regions of Flrt2 and Flrt3 expression and the FGFR associated with that region...... 80

INTRODUCTION

Development of the craniofacial region is a complex process involving massive movements of mesenchymal cells derived from the cranial neural crest, called cranial neural crest cells (CNCCs), into the craniofacial region. Craniofacial morphogenesis depends on the continual and reciprocal interaction of CNCCs with each other and with the cells of the craniofacial epithelia to produce the various structures of the head. Genetic disorders or environmental insults that influence these events result in a variety of facial deformities, the most common of which is cleft lip and/or palate. Understanding of the development of the head and face requires knowledge of cell migration, signaling between the various tissues, and regulation of gene expression both in time and space.

CNCC generation, migration, and differentiation are influenced by the secretion of signaling molecules from the overlying ectoderm. CNCCs are multipotent and give rise to many cell types depending on these extracellular signaling cues. This interaction between the mesenchymal CNCCs with the overlying epithelium is called epithelial-mesenchymal interactions (EMI). Members of the fibroblast growth factor (FGF) signaling molecule family have been shown to be key signaling molecules in EMI and their perturbation results in altered craniofacial development.

Evidence suggests that the three members of the Fibronectin Leucine-Rich

Transmembrane (FLRT) family, putative FGF receptor interacting proteins, can modulate FGF signaling and very recently in our laboratory Flrt2 expression was identified in a screen for differentially expressed genes during craniofacial development. Therefore, it is possible that one or more of the FLRTs are involved in modulating FGF signaling during craniofacial development.

The objective of this thesis was to investigate the temporo-spatial expression of the three members of the Flrt gene family in the developing mouse embryo during midfacial morphogenesis.

Induction and Migration of Cranial Neural Crest Cells (CNCCs)

Neural Crest Cells The neural crest is a transient band of cells that develops between the neural tube and the epidermis of a vertebrate embryo during neural tube formation. Neural crest cell (NCC) induction (generation) requires contact-mediated interactions between the surface ectoderm of the epidermis and neuroepithelium of the neural plate. Neural crest cells arise uniformly along almost the entire length of the neural tube of the vertebrate embryo. There are several categories of NCCs based on function. These are cranial, vagal and sacral, trunk, and cardiac neural crest cells. The cranial neural crest cells (CNCCs) arise from both the midbrain (mesenchephalon) and the future hindbrain regions of the neural tube and are responsible for craniofacial development

(Noden 1983; Bronner-Fraser 1994).

Cranial Neural Crest Cells Cranial neural crest cells (CNCCs) are pluripotent mesenchymal cells which can differentiate into various cell types including neurons, glia, and melanocytes (Graham, Begbie et al. 2003). CNCCs contribute to tissue patterning by generating the facial mesenchyme (Nichols

1986). Numerous craniofacial elements, including most of the peripheral nervous system, bone, cartilage, muscle, tooth elements, chondrocytes in Meckel’s cartilage and connective tissues in the head are derived from this facial mesenchyme (Noden 1983; Couly and Le Douarin 1985; Le

Douarin, Brito et al. 2007).

As noted above, CNCCs are found both the mid and hind brain. The CNCCs found in the hindbrain are segmented along the anterior-to-posterior (A-P) axis into segments, called rhombomeres (Vaage 1969). Rhombomeres are transiently divided into regions of the neural tube. Each rhombomere expresses its own unique set of transcription factors (Brugmann,

Tapadia et al. 2006). Rhombomeres are numbered starting from A-P rhombomeres (r1, r2, r3, etc.) (Figure 1.1).

Generation and Delamination of CNCCs In order for CNCCs to delaminate and emigrate from the neural tube during early vertebrate embryogenesis, epithelial to mesenchymal transformation (EMT) must occur. Key transcription factors in the EMT process are members of the Snail and Slug zinc-finger transcription factor gene family (Nieto, Sargent et al. 1994). They are responsible for repressing

E-cadherin, a cell adhesion molecule expressed in epithelial cells (Cano, Perez-Moreno et al.

2000). Other transcription factors, such as AP-2α, Id2, Id3, FoxD3, Sox9, Sox10, and LSox, are also required for the formation of the neural crest (reviewed by Huang and Saint-Jeannet 2004;

Meulemans and Bronner-Fraser 2004; Morales, Barbas et al. 2005).

Several members of the Bone Morphogenetic Protein (BMP) family have been shown to be involved in the delamination and migration of NCCs, including CNCCs (Burstyn-Cohen,

Stanleigh et al. 2004; Bobick and Kulyk 2006). BMP2 triggers neural crest delamination in the head, whereas BMP4 acts in the trunk (Sela-Donenfeld and Kalcheim 1999; Kanzler, Foreman et al. 2000). BMP4 and BMP7 have been shown to be critical in the induction and regulation of key transcription factors Snail and Slug zinc-finger (Liem, Tremml et al. 1995).

Figure 1.1. Schematic representation of the migration of CNCCs from the rhombomeres of the neural crest into the craniofacial region.

The hindbrain is divided into 7 segments or rhombomeres. Large numbers of neural crest cells migrate laterally from r1, r2, r4, r6, and r7 to the pharyngeal arches. A smaller number of neural crest cells from r3 and r5 migrate rostrally and caudally (Trainor and Krumlauf 2001).

Adapted from Couly et al. (2002).

Migration of CNCCs Following delamination, CNCCs migrate in discrete streams sub-ectodermally to the craniofacial prominences and branchial arches in the developing embryo (Farlie, Kerr et al.

1999) (Figure 1.1). CNCCs from r3 and r5 do not migrate through the mesoderm surrounding them, but join the other streams of migrating CNCCs. Those that do not migrate will die.

The path of migration of CNCCs is controlled by the secretion of inhibitors and attractants. Ephrins are postulated to direct CNCC migration to the anterior sclerotome through inhibition from the posterior sclerotome (Wang and Anderson 1997; Brugmann, Tapadia et al.

2006). Ephrins are inhibitory signaling ligands involved in animal development found in the posterior sclerotome. They appear to be responsible for separating the streams of CNCCs, as blocking Eph receptors causes mixing of different streams (Smith, Robinson et al. 1997).

CNCC Differentiation CNCC differentiation is controlled by a group of genes called homeobox genes.

Homeobox genes encode gene-specific transcription factors that are responsible for controlling activation of signaling cascades (Lumsden and Krumlauf 1996; Trainor and Krumlauf 2001).

Homeotic genes encode a conserved 60 amino acid homeodomain that, along with other transcription factors, bind promoter DNA (McGinnis, Levine et al. 1984; Scott and Weiner 1984;

McGinnis and Krumlauf 1992; Gehring, Qian et al. 1994).

Hox genes are a subgroup of homeobox genes. These were first discovered in Drosophila, where the order that each Hox gene is expressed in the chromosome is identical to the order expressed along the anterior to posterior body axis (Regulski, Harding et al. 1985). This order has also been observed to be conserved in mice and in humans (Levine, Rubin et al. 1984;

McGinnis, Hart et al. 1984; Colberg-Poley, Voss et al. 1985). Hox genes are transiently

5 expressed in a segment (or rhombomere)-specific manner and are found in CNCCs that populate the branchial arches, but are not expressed during facial primordia development. These transcription factors provide the patterning information, which determines the final tissue identity of the CNCCs (Schneider and Helms 2003).

Hox negative cells exist in a rostral domain located in the anterior region of the cranial neural crest extending to, and including, r2. The CNCCs from this domain are responsible for forming the facial skeleton and develop from the first branchial arch (Creuzet, Couly et al. 2002;

Creuzet, Couly et al. 2005). Both the Hox-negative and Hox-positive domains (r3 to r8) are capable of generating cartilage, but only the Hox-negative domain can yield membranous bones

(Creuzet, Couly et al. 2005).

Different combinations of Hox genes in the various regions are responsible for specifying the fate of CNCCs. In Hoxa2 knock-out mutants, the second pharyngeal arch transforms to duplicate the first pharyngeal arch (Gendron-Maguire, Mallo et al. 1993; Rijli, Gavalas et al.

1998). Hoxa3 genes are responsible for specifying the development of the neck cartilage and pharyngeal arch derivatives (Chisaka and Capecchi 1991). Knock-out of both Hoxa1 and Hoxb1 genes stop the migration of CNCCs from r4, whereas knock-out of either of these genes alone does not confer the same effect, suggesting that both are required for CNCC migration to the 2nd pharyngeal arch (Gavalas, Trainor et al. 2001).

Predetermination of CNCC Fate The fate of CNCCs appears to be determined in part by intrinsic genetic programs

(predetermination) as well as by the influence of extracellular signals in the local environment.

The extent of lineage determination once neural crest cells have migrated to the structures of the craniofacial region is still unclear. Predetermination of CNCCs can, at least in some situations,

6 occur early in embryogenesis. For instance, when presumptive second or third arch neural crest cells were excised from the neural crest and replaced with presumptive first arch cells, the grafted cells migrated along the normal second arch pathways but they formed a complete, duplicate first arch skeletal system in their new location (Noden 1983).

In another series of studies using duck and quail beak chimeras, where quail CNCCs were transplanted onto duck hosts and vice versa, transplantation of duck CNCCs into quail embryos produced embryos with a duck-like beak. Similarly, transplantation of quail CNCCs into duck embryo resulted in embryos that developed with a quail-like beak. Subsequent analyses of molecular markers, that are expressed differently between the two species, showed that the transplanted CNCCs maintained their own species-specific temporal expression program and also imposed their species-specific temporal expression program on the adjacent host ectodermal tissue (Trainor 2003). Transplanted CNCCs carried out their pre-determined, species-specific genetic program and affected non-CNCC-derived host tissues (Schneider and Helms 2003;

Trainor 2003). However not all studies supported the pre-programming theory (Trainor, Ariza-

McNaughton et al. 2002; Trainor 2005).

Key observations that altered the perception of CNCC tissue pre-determination was derived from experiments where the number of cranial neural crest cells transplanted from r3, r4, or r5, to r2 varied. Single cells that broke off from the primary graft acquired the identity of the new region (i.e. r2) (Trainor and Krumlauf 2001; Trainor 2005). Also, when neuroepithelial cells in zebrafish were transposed as small grafts of 10 or fewer cells, Hox gene plasticity was observed (Schilling, Prince et al. 2001). In a larger graft of up to 30 cells, CNCCs at the centre of the mass would retain their identity, whereas the outlying cells would adopt the identity of the surrounding tissue (Schilling, Prince et al. 2001). These observations demonstrated the

7 importance of the environment on CNCCs, suggesting that CNCCs may be somewhat “plastic”

(the ability of cells to undergo a different genetic program than the one they would undergo based on their origin) depending on the surrounding cells (reviewed by Trainor and Krumlauf

2001), and means that gene expression and identity can be influenced by the surrounding environment.

The confusion related to CNCC preprogramming and plasticity was clarified when

Trainor et al. (2002) had determined that only CNCCs from the mid/hindbrain junction (isthmus) are pre-programmed and do not duplicate the lower jaw when transplanted to r4. He discovered that triggering of gene expression in these tissues originates from the isthmic organizer. It is a signaling centre, which controls the fate of mid/hindbrain-derived CNCCs by secreting growth factors, such as WNT and FGF8 (Canning, Lee et al. 2007). If transplanted, the isthmic organizer would alter local CNCCs to resemble first arch-derived CNCCs (Trainor, Ariza-McNaughton et al. 2002).

Plasticity is not only limited by the proximity to the isthmic organizer, the signaling centre in the brain, but also by other factors such as developmental age. The degree of plasticity decreases with developmental time. Developmental time is often measured by the number of somites in the developing embryo. The increasing numbers of somites indicates increasing developmental age, and corresponds to decreasing plasticity of CNCCs. For example, when

CNCCs are transplanted at the 5 somite stage, Hox gene plasticity was observed in >80% of cells. In comparison, at the 15 somite stage, alteration in Hox gene expression was observed in only 40% of cells (Schilling, Prince et al. 2001).

In addition, patterning information may be derived from non-neural crest tissues. For example, ablation of CNCCs destined for the second and third branchial arches in chick embryos

8 does not affect early development of those arches (Veitch, Begbie et al. 1999). Hoxa1/Hoxb1 mutant mice, which specifically lack the second branchial arch neural crest, still develop normally patterned second arches (Gavalas, Trainor et al. 2001). Therefore, it appears that craniofacial development is not only patterned by autonomously pre-programmed CNCCs, but is regulated by interactions with CNCCs and non-CNCCs in the environment.

Epithelial-Mesenchymal Interaction in determining CNCC fate

As noted above, neural crest fate is controlled by both intrinsic (preprogramming) and extrinsic factors (reviewed by Richman and Lee 2003). Upon reaching their final destination, the

CNCC-derived mesenchyme is responsive to signals from the overlaying ectoderm. Signals from the ectoderm trigger signaling cascades and expression of transcription factors in the underlying mesenchyme which influence CNCC fate. This interaction also occurs in the opposite direction, and molecular communication between the epithelium and mesenchyme in both directions is referred to as epithelial-mesenchymal interactions (EMI). EMI has been shown to control embryonic development and differentiation of numerous tissues and organs, as well as gross A-P patterning.

Figure 1.2. Representation of the expression domains of Shh and Fgf8 in the frontonasal prominence (FNP) of a stage 20 chick embryo

Shh (red) is expressed in the ventral FNP, whereas Fgf8 (green) is expressed in the dorsal part of the FNP. Chondrogenic NCC-derived mesenchyme (blue) is responsive to growth factor signals from the ectoderm. epi: facial epithelium, ncm: neural-crest derived mesenchyme, neu: neuroepithelium Adapted from Hu (2003).

EMI in the early development of the Structures of the Head The development of the craniofacial region involves the key signaling molecules expressed in the ectoderm of the frontonasal process (FNP), including Sonic hedgehog (SHH) and Fibroblast Growth Factor 8 (FGF8) (figure 1.2) (Hu, Marcucio et al. 2003; Abzhanov and

Tabin 2004; Creuzet, Schuler et al. 2004; Abzhanov, Cordero et al. 2007). Shh expression in the ventral portion of the FNP is adjacent to, but not overlapping, Fgf8 expression (Hu, Marcucio et al. 2003), and antagonistically regulate each others’ expression (Abzhanov, Cordero et al. 2007) and these two signaling molecules act parallel to one another to coordinate the outgrowth and eventual chondrogenesis within the FNP (Abzhanov and Tabin 2004). Transplantation experiments of the boundary epithelium has shown that the epithelium is responsible for patterning information for the underlying NCC-derived mesenchyme (Abzhanov, Cordero et al.

2007). Thus, it is apparent that EMI in the midface is critical for craniofacial morphogenesis.

Figure 1.3. Scanning electron micrograph of the craniofacial region of a 10.5 dpc mouse embryo.

There are eight distinguishable facial prominences surrounding the oral cavity: paired medial nasal processes (MNP) and lateral nasal processes (LNP), and maxillary processes (MxP), which develop into the primary palate, or upper lip. The pink dots demarcate the separation between the primary palate and the mandible. Adapted from http://www.med.unc.edu/embryo_images.htm

Formation of the Facial Prominences

As noted previously, cranial neural crest cells (CNCCs) migrate from the neural tube, to the midfacial region. Following migration, in response to signals from the overlying ectoderm such as FGFs and BMPs, the CNCC-derived ectomesenchyme expands, causing outgrowth of the prominences to produce the midface and the 1st (mandibular) and 2nd (hyoid) pharyngeal arches

(figure 1.1). There are eight distinguishable facial prominences surrounding the primitive oral cavity (stomodeum). On each left and right side, these are the medial nasal process (MNP), lateral nasal processes (LNP), and maxillary processes (MxP); all three of which lie superior to the mandibular prominence (Mn) (figure 1.3). The paired MNP, LNP, and MxP develop into the primary palate and upper lip. The stomodeum is generated by the expansion of the midfacial prominences (Chai, Maxson et al. 2006). Nasal pits are formed from the horse-shoe shaped

MNPs and LNPs (Chai, Maxson et al. 2006).

Many experiments on EMI that characterized the importance of the facial ectoderm on the outgrowth of the mesenchyme in the facial region were studied by J.M. Richman. To identify which growth factors were involved in EMI, a technique that involved removing the epithelial layer and placing a growth factor coated bead on the underlying mesenchyme was commonly used to specify which growth factor was critical for EMI. Richman et al. (1997) used FGF2- or

FGF4-coated beads to observe that elongation of Mn cartilage rods and frontonasal mass mesenchyme occurred with FGF stimulation. However, FGF-coated beads alone were not sufficient to replace the epithelium, suggesting that other growth factors are also necessary for outgrowth.

Following outgrowth, fusion between the MNP and LNP, and MNP and MxP begins to occur to generate the primary palate, or upper lip. A failure in this fusion process or during the

13 outgrowth of the midfacial processes leads to cleft lip, which can be accompanied with/without cleft palate (CL/P), which is the most common craniofacial disorder (Stanier and Moore 2004).

EMI in the development of the Secondary Palate Development of the secondary palate, the hard palatal structure that divides the nasal cavity from the oral cavity, commences around 11 dpc in the mouse (review Gritli-Linde 2007).

The secondary the palatal shelves (PS) are derived from bilateral outgrowths from the inner section of the maxillary processes. The PS extend along the A-P axis of the lateral walls of the oropharynx. From 12.5 to 14 dpc, the PS first extend vertically downwards into the oral cavity on opposite sides of the tongue, then elevate into a horizontal position at 14.5 to 15 dpc. The PS have an epithelial layer that can be divided into three regions, the oral epithelium, nasal epithelium, and medial edge epithelium (MEE). Mesenchymal confluency occurs as the bilateral

PS fuse together to divide the oral and nasal cavities, then cartilage formation begins.

Disappearance of the MEE generated from both PS, which generates the medial edge seam

(MES), must occur for fusion and mesenchymal confluence between the PS.

The fate of the MES has been subject to much controversy without an agreement amongst researchers. There have been three proposed mechanisms for the disappearance of the MES: apoptosis, epithelial–mesenchymal transformation (EMT) and migration of MES cells towards the periphery of the midline (Gritli-Linde 2007). Morphological and physical evidence has been provided to support the theory that apoptosis occurs in the MES (Martínez-Álvarez, Bonelli et al.

200; Saunders 1966; DeAngelis and Nalbandian 1968; Smiley and Dixon 1968; Shapiro and

Sweney 1969; Smiley and Koch 1975; Mori, Nakamura et al. 1994; Tanigushi, Sato et al. 1995;

Martínez-Álvarez, Tudela et al. 2000; Cuervo and Covarrubias 2004; Vaziri Sani, Hallberg et al.

2005). Alternatively, according to EMT, cells of the MES are thought to transdifferentiate into

14 fibroblasts to generate mesenchymal confluency. Support for this belief has been based on cell tracking with lipophilic molecules, such as DiI, genetic cell marking, and morphological evidence (Fitchett and Hay 1989; Griffith and Hay 1992; Nawshad and Hay 2003; Cuervo and

Covarrubias 2004; Nawshad, LaGamba et al. 2004; Nawshad, LaGamba et al. 2004; Damian

LaGamba 2005; Jin and Ding 2006; Nawshad, Medici et al. 2007; Lee, Kim et al. 2008; Nogai,

Rosowski et al. 2008). A significant amount of evidence has been provided for both sides of the controversy.

Failure in the outgrowth and fusion of the PS leads to cleft palate alone (CPO). Clefts may occur only in the posterior portion of the secondary palate (posterior palate), and not the anterior region (anterior palate). This has led to the observation that regional differences in gene expression of signaling molecules govern the fusion of the secondary palate (Noden 1983;

Noden 1988; Zhang, Song et al. 2002; Nie, Luukko et al. 2006). Within each region, EMI has been shown to play a role in signaling between the PS epithelium and mesenchyme (Tyler and

Koch 1977; Tyler and Pratt 1980; Ferguson, Honig et al. 1984). Genes such as bone morphogenetic protein (Bmp)-2, Bmp4, Muscle segment homeobox (Msx)-1, Fibroblast growth factor (Fgf)-10, and FGF receptor (Fgfr)-2b have been found to exhibit differential expression patterns along the A-P axis of the developing palate, but their roles and interactions during palatal development have yet to be clarified and will be discussed in a later section.

EMI in the development of the Meckel’s Cartilage and Teeth Hind-brain derived pluripotent CNCCs from r1, r2 and partially from r3 stream into the

1st pharyngeal arch to generate the mesenchyme of the mandible (Mn) (Trainor 2005), which develops teeth and Meckel’s cartilage, the template for the lower jaw.

Meckel’s Cartilage Around embryonic day 5 (E5) in the chick, growth factor signals from the ectoderm trigger condensations in the CNCC-derived ectomesenchyme to commence the development of

Meckel’s cartilage (Mina, Upholt et al. 1991; Chai, Jiang et al. 2000). A day later, these condensations differentiate into chondrocytes, which occurs in a caudal to rostral (head to tail) direction (Mina, Upholt et al. 1991). These chondrocytes are detectable due to their secretion of specific extracellular matrix proteins, such as aggrecan and type II collagen. By E10, the mandibular processes possess six mandibular bones that surround a fully differentiated Meckel’s cartilage (Mina, Upholt et al. 1991).

Teeth The early stages of tooth development morphologically resemble hair and gland development, which are also regulated by EMI (Jernvall and Thesleff 2000). The tooth bud is derived from the ectoderm of the first branchial arch and CNCCs from the midbrain (Imai,

Osumi-Yamashita et al. 1996; Kontges and Lumsden 1996; Brugmann, Tapadia et al. 2006;

Chai, Maxson et al. 2006; Nie X 2006). Determination of tooth type, either incisors or molars in mice, has been suggested to be predetermined by CNCCs (Ruch 1995; Tucker and Sharpe 1999;

Sharpe 2001; Cobourne and Sharpe 2003). Tooth development begins at 11.5 dpc in mice with a thickening of the oral epithelium to form the dental lamina (Mina and Kollar 1991). Transient epithelial signaling centres, associated with initiation of tooth buds, develop when the dental lamina grows into the underlying mesenchyme (Kapadia, Mues et al. 2007). The transition from bud to cap stage involves integration of the FGF and BMP signaling pathways and results in the induction of the primary enamel knot at around 14.5 dpc (Jernvall and Thesleff 2000). The enamel knot is a signaling centre at the tip of the epithelial bud that coordinates transition from

16 the bud to cap stage through EMI and has been shown to express members of the BMP, FGF,

Hedgehog (Hh) and Wnt families (Thesleff and Aberg 1999).

Early Hair Follicle Development Similar to tooth development, the first stage of hair follicle induction is coordinated by epithelial-mesenchymal interactions (EMI). Spacing, polarity, and differentiation patterns are driven by gradients of inhibitors and activators from the skin epithelium and mesenchyme

(review Schmidt-Ullrich and Paus 2005). The first dermal signal from the mesenchyme to the epithelium causes the formation of regularly spaced thickenings in the epidermis, known as placodes (Hardy 1992), and the condensation of the underlying mesenchyme. Another signal from the epithelium to the mesenchyme causes the epithelial placode cells to proliferate and grow downwards to form the hair germ (Schmidt-Ullrich and Paus 2005).

At the next stage, peg stage, these specialized epithelial cells differentiate and encapsulate the dermal condensate, which has become the dermal papilla (Hardy 1992). The dermal papilla is the source of the second dermal signal, which controls follicular epithelium proliferation and downgrowth (Millar 2002). The inner root sheath (IRS) is a rigid tube formed from the first epithelial cells in the follicle. The outer root sheath (ORS) develops around the

IRS. Hair follicle morphogenesis is dependent on EMI, particularly two epithelial signals from the epithelium.

Key Signaling Factors in EMI

Bone Morphogenetic Proteins (BMPs) BMPs are critical for craniofacial development, as they are involved in formation of the cranial neural crest, facial primordia, tooth, lip, and palate (see review by Nie X 2006). The Bmp

17 gene family belongs to the transforming growth factor (Tgf)-β superfamily, which includes more than 20 members (Kishigami and Mishina, 2005).

BMP receptors (BMPRs) are divided in to two types: type I and type II (BMPRI and

BMPRII). Type I receptors are high-affinity BMP binding receptors, whereas Type II are low- affinity receptors. Both types of receptors are needed to form a functional complex to initiate downstream signaling events. The serine/threonine kinase domains of the type II receptor are constitutively active and, upon BMP binding, the BMPRII receptor phosphorylates Gly-Ser domains in the type I receptor (Miyazono, Maeda et al. 2005). Activation of BMPRI results in phosphorylation of downstream Smad proteins, and can also activate the Ras/mitogen-activated protein kinase (MAPK) pathway, phosphoinositide 3-kinase/AKT (PI(3)K/AKT), and PLC-

γ/PKC (phospholipase-Cγ/protein kinase C) pathways (Kishigami and Mishina, 2005).

Activation triggers an intracellular signal cascade to turn on transcription of target genes (Nohe,

Keating et al. 2004).

BMPs are able to directly regulate the expression of Muscle segment homeobox (Msx) genes, Msx1 and Msx2. Msx1 and Msx2 are unlinked homeobox containing genes that are highly expressed in the midface, with some overlap in regions of their expression. Both of these transcription factors have similar DNA binding site sequences. However, MSX2 has a greater affinity for DNA, and MSX1 is a more potent transcriptional repressor (Alappat, Zhang et al.

2003). BMPs regulate the expression of Msx2 via direct binding of Smad4 to the Msx2 promoter.

Msx2 expression can also be activated independent of BMP and FGF signaling pathway (Sirard,

Kim et al. 2000; Tan, Nonaka et al. 2002). Msx1 expression can be induced by BMP4 and FGF8 signaling (Bei and Maas 1998). Msx2 expression can also be induced by BMP4, but cannot be induced by FGFs (Vainio, Karavanova et al. 1993; Bei and Maas 1998; Päivi Kettunen 1998).

Fibroblast Growth Factors (FGFs) Fibroblast growth factors (FGFs) are a family of structurally related growth factors involved in angiogenesis, wound healing, and embryonic development. They play critical roles in patterning, proliferation, and morphogenesis during embryogenesis (see review by Thisse and

Thisse 2005). FGFs are multifunctional proteins with a wide variety of effects; they are most commonly mitogens, but also have regulatory, morphological, and endocrine effects.

In humans, there are 22 members of the FGF family, which can be divided into several subgroups depending on sequence similarity and biochemical and developmental properties

(Ornitz and Itoh 2001). The mammalian FGF family can be divided into the intracellular

FGF11/12/13/14 subfamily (iFGFs), the hormone-like FGF15/21/23 subfamily (hFGFs), and the canonical FGF subfamilies, including FGF1/2/5, FGF3/4/6, FGF7/10/22, FGF8/17/18, and

FGF9/16/20. Canonical FGFs function in a paracrine (local) manner, whereas hormone-like

FGFs function in an endocrine (systemic) manner (Itoh and Ornitz 2008).

FGF Receptors FGFRs are tyrosine kinase receptors that contain three immunoglobulin (Ig)-like domains

(Johnson, Lee et al. 1990). There are four known members of the FGF receptor family, called

FGFR1, FGFR2, FGFR3, and FGFR4. Each member of the FGFR family is able to bind a specific subset of FGFs. Most FGFs are also able to bind to several different FGFR subtypes

(Table 1.1) (Neufeld and Gospodrowicz 1986; Coutts and Gallagher 1995). Alternative mRNA splicing occurs in the carboxy-terminal half of the Ig domain III, resulting in IIIb or IIIc isoforms of FGFR1, FGFR2, and FGFR3 resulting in 7 different FGFR subtypes (FGFR 1b, 1c, 2b, 2c, 3b,

3c, and 4) that can be expressed at the cell surface (Miki, Bottaro et al. 1992; Chellaiah,

McEwen et al. 1994). This occurs in a tissue-specific manner and affects ligand-receptor specificity.

FGFR Isoform FGF Ligand Specificity FGFR1b FGF1, -2, -3 and -10 FGFR1c FGF1, -2, -4, -5, -8 and -6 FGFR2b FGF1, -3, -7, -10 and -22 FGFR2c FGF1, -2, -4, -6, -9, -17 and -18 FGFR3b FGF1 and 9 FGFR3c FGF1, -2, -4, -8, -9, -17, -18 and -23 FGFR4 FGF1, -2, -4, -6, -9, -16, -17, -18 and -19

Table 1.1. Ligand specificities of FGFR isoforms.

FGFRs are able to bind multiple FGF ligands. FGF7 and FGF10 are considered to be expressed in the mesenchyme and FGF2, 4, 6, 8 ,9 and 17 are expressed in the epithelia. (Eswarakumar,

Lax et al. 2005)

Figure 1.4. Fibroblast Growth Factor (FGF) signaling and their regulators.

FGF, FGFR, and heparan sulphate form a ternary complex resulting in FGFR dimerization and transphosphorylation, leading to an increase in FGFR kinase activity.

Intracellular substrates, such as the docking protein FRS2, are phosphorylated. Three major

21 signaling pathways include PI-3 kinase activity (PI(3)K), mitogen-activated protein kinase

(MAPK) pathway and phospholipase C gamma pathway (PLC-γ). These pathways lead to cell- type specific responses in the cytoplasm and nucleus. Positive influences on the FGF signaling pathway (FLRT) and negative influences (SPRY) are indicated. FLRT3 has also been shown to bind Rnd1 and Unc5B (Ogata, Morokuma et al. 2007; Karaulanov, Böttcher et al. 2009).

Adapted from Partanen (2007).

FGF signaling cascade

In order to activate the FGF signaling cascade, two FGF molecules, connected by a heparan sulfate proteoglycan, bind to the extracellular IgII and IgIII domains of the FGFR, which leads to receptor homodimerization (Schlessinger 2004) (figure 1.4). The intracellular domains of the dimerized receptors trans-autophosphorylates conserved tyrosine residues, resulting in receptor activation. Activation of the receptor allows binding of proteins that contain Src homology 2

(SH2) or phosphotyrosine binding (PTB) domains to the receptor, resulting in the phosphorylation and activation of these binding proteins (Pawson 1995; Forman-Kay and

Pawson 1999; Dhalluin, Yan et al. 2000). FGF signaling occurs mainly through the PI-3 kinase activity (PI(3)K), mitogen-activated protein kinase (MAPK) pathway, and phospholipase C gamma pathway (PLC-γ) (figure 1.4). Sprouty (SPRY), which patterns apical branching in drosophila tracheae (Hacohen, Kramer et al. 1998), acts as a negative feedback regulator of FGF signaling (Hanafusa, Torii et al. 2002).

Roles of FGF and BMP in Craniofacial Development

Primary Palate Signaling molecules, such as those from the BMP and FGF families, are critical for proper midfacial prominence outgrowth and fusion (see review by Francis-West, Ladher et al.

1998).

CNCC migration to the facial primordia has been shown to be partially dependent on

BMPs (Kanzler, Foreman et al. 2000; Knecht and Bronner-Fraser 2002; Tribulo, Aybar et al.

2003). During primary palate development, Bmp4 and Bmp7 are expressed in the epithelium, whereas Bmp2, Msx1 and Msx2, are expressed in the underlying mesenchyme (Bennett, Hunt et al. 1995; Barlow and Francis-West 1997; Francis-West, Ladher et al. 1998). Subsequently,

Bmp4 expression transitions to the mesenchyme, and is expressed in both the epithelium and the mesenchyme of the distal tips of the primordia (Barlow and Francis-West 1997). BMP2 and

BMP4 were shown to activate the expression of Msx1 and Msx2 in the mesenchyme by implanting BMP-coated beads beneath the epithelium (Barlow and Francis-West 1997).

BMPs and their receptors have been demonstrated to be critical for lip and palate development. Conditional inactivation of Bmp4, using the Nestin cre transgenic line in a mouse model, resulted in cleft lip alone (Liu, Sun et al. 2005). Conditional inactivation of Bmpr1a, the receptor for BMP4, resulted in cleft lip and palate due to decreased cell proliferation in the MxP mesenchyme, and alterations in anterior to posterior (A-P) patterning (Liu, Sun et al. 2005).

These studies demonstrated the individual contribution and importance of BMPR1a and its ligands during primary palatogenesis.

Another molecule that is critical for palatal development is Fgf8, which is expressed in domains of the craniofacial complex, exclusively in the epithelium, and directs the patterning and growth of underlying CNCCs (Francis-West, Ladher et al. 1998; Abzhanov and Tabin 2004;

Creuzet, Schuler et al. 2004). Shigetani et al. (2000) studied the effects of ectopic FGF8 on the movement of CNCCs using DiI to track the migration of cells during chick development. DiI is a highly fluorescent lipophillic dye that labels the plasma membrane of a cell and its daughter cells, but does not transfer between membranes to other cells, allowing the detection of cell lineages. FGF8-coated beads were implanted into the interstices between ectoderm and mesenchyme in the presumptive premandibular region. Ectopic FGF8 caused expression of target homeobox genes in the local mesenchyme. Focal injections of DiI revealed that there was a transformation of the original premandibular ectomesenchyme into the mandibular arch.

Secondary Palate During early outgrowth of the secondary palate (12.5–13.5 dpc) expression of Msx1,

Bmp4 and Bmp2 is restricted to the anterior portion of the secondary palate (Zhang, Song et al.

2002). Bmp4 is expressed in the epithelium, whereas Bmp2 and Msx1 are expressed in the underlying mesenchyme (Barlow and Francis-West 1997, Bennett et al 1995, Francis-West

1998).

FGF signaling is significant for palatal shelf (PS) development, as knock-out mice containing any of the following mutations Fgf10–/–, Fgfr2b–/–, and Spry2–/–, an FGF signaling antagonist, all exhibit cleft palate (Rice, Spencer-Dene et al. 2004; Welsh, Hagge-Greenberg et al. 2007). In humans, mutations in Fgfr2 and in TWIST, a transcription factor involved in FGF signaling, cause the craniosynostosis syndromes Apert and Saethre-Chotzen respectively and both of which manifest with cleft palates (Wilkie 1996; Rice, Aberg et al. 2000; Rice 2008).

Elevation and fusion of the PS in an A-P direction is regulated by different families of signaling molecules. As previously mentioned, BMPRs are found in the anterior region of the secondary palate. In the posterior region of the secondary palate, epithelium-derived FGF8 induces the expression in the palatal mesenchyme of Pax9 (Hilliard, Yu et al. 2005), the absence of which causes cleft palate in Pax9 null mice (Peters, Neubuser et al. 1998). Furthermore, Fgf10 is expressed in the mesenchyme immediately adjacent to the MEE during palatal outgrowth

(Rice, Spencer-Dene et al. 2004). The gene for the cognate receptor of FGF10, Fgfr2-IIIb, is strongly expressed in the epithelium of the posterior palate and floor of the mouth and regulates the epithelial expression of Shh upon activation by Fgf10 (Rice, Spencer-Dene et al. 2004).

Mandible Outgrowth and patterning of the first branchial arch appears to be dependent on regionally specific expression of FGF and BMP (Chai, Maxson et al. 2006). FGF8 expression from the mandibular ectoderm has been shown to be essential for mesenchymal cell survival and morphogenesis of the mandible. Inactivation of Fgf8 in the mandibular epithelium causes a loss of proximal-mandibular structures in newborn mice (Trumpp, Depew et al. 1999). However, development of distal structures, such as the incisors, was not affected (Trumpp, Depew et al.

1999), which suggests that distal structures of the mandible have another mechanism of control.

Morphogenesis of the distal portion of the mandible is dependent on BMP signaling.

BMP4 is expressed in the ectoderm of the mandible as early as 9.5dpc. BMPs are essential for mandibular arch patterning, as knock-out of Bmpr1a caused several defects, including defective tooth morphogenesis and bilateral CL/P (Liu, Sun et al. 2005). Consequently, anterior to posterior (A-P) differences in signaling proteins are essential for proper morphogenesis of the mandible, which is similar to that of the secondary palate.

Meckel’s Cartilage BMPs have a negative effect on the development of Meckel’s cartilage. Application of exogenous BMP7 has been shown to cause apoptosis, ectopic expression of Msx genes, and inhibited the formation of Meckel's cartilage (Mina, Wang et al. 2002). Msx genes have roles in chondrogenesis (McGonnell 1998; Alappat, Zhang et al. 2003). Msx2 is expressed in a portion of

CNCCs which migrate to the first branchial arch (Takahashi, Nuckolls et al. 2001). Cultures of primary CNCCs which have a loss of function Msx2 mutation, show accelerated chondrogenesis

(cartilage formation), as indicated by alcian blue staining, and an increase in expression of the chondrogenic markers type II collagen and aggrecan (Takahashi, Nuckolls et al. 2001). Thus,

Msx2, which can be induced by BMPs, appears to inhibit chondrogenesis in migrating CNCCs.

In contrast to BMPs, FGFs have a positive effect on the development of Meckel’s cartilage. Decreased expression of Fgfr3 lead to decreased differentiation of chondrocytes and truncation of Meckel’s cartilage (Havens, Velonis et al. 2008). Bobick and Kulyk (2004), who used chick mesenchymal cultures, demonstrated increased chondrogenesis in the mandibular mesenchyme when treated with FGF2, 4,or 8.

Surprisingly, FGF2, 4, and 8 had a negative effect on chondrogenesis in the frontonasal and limb mesenchyme. Both stimulatory and inhibitory effects on chondrogenesis were mediated by the MEK-ERK pathway.

Constitutive activation of Fgfr2 and Fgfr3 results in Crouzon’s syndrome and achondroplasia respectively, where both are characterized by a smaller midface (Jabs, Li et al.

1994; Reardon, Winter et al. 1994; Meyers, Orlow et al. 1995; Cobourne and Sharpe 2003).

FGFR2c is expressed in the mesenchyme and is responsible for normal skeletogenesis. Patients with Crouzon’s syndrome express a mutant form of FGFR2c that is constitutively active

(Eswarakumar, Horowitz et al. 2004) and causes the bones in the skull to fuse improperly.

FGFR3 is a negative regulator of chondrogenesis and bone formation. Similar to those who suffer from Crouzon’s syndrome, patients with achondroplasia express a mutant form of FGFR3 that is constitutively active (Shiang, Thompson et al. 1994), and thus have shortened bones.

Fibronectin Leucine-Rich Transmembrane (FLRT) Protein Family

FLRT protein Discovery and Structure The Flrt gene family was first discovered while attempting to detect muscle-specific protein encoding gene sequences by screening a human skeletal muscle cDNA library (Lacy,

Bonnemann et al. 1999). This search yielded the discovery of a novel protein which contained fibronectin-like, leucine-rich repeat-containing domains with a predicted transmembrane region.

This protein was called fibronectin-like, leucine-rich, transmembrane protein-1 (FLRT1). FLRT2 and FLRT3 were identified following electronic searches of human EST databases for similar proteins (Lacy, Bonnemann et al. 1999).

The FLRTs are putative single-pass transmembrane proteins with conserved secondary structure, which consist of 10 leucine-rich repeats (LLRs) flanked by cysteine-rich regions, a fibronectin type III-like (FNIII) domain, a transmembrane (TM) domain, and a short intracellular

(IC) tail (Lacy, Bonnemann et al. 1999; Bottcher, Pollet et al. 2004; Haines, Wheldon et al.

2006; Karaulanov EE 2006) (figure 1.5). By analyzing the protein sequence, there is 45% identity between each FLRT protein, mostly within the LLR, TM, and intracellular region. High amino acid identity (+90%) is observed between human and murine FLRT proteins (Haines,

Wheldon et al. 2006).

FLRT1 and FLRT2 precipitate as a 90 kDa and 85 kDa proteins respectively. However

N-glycosidase F treatment decreases molecular weight, indicating that FLRTs are glycosylated proteins (Lacy, Bonnemann et al. 1999). Based on protein analysis, Lacy et al. (1999) predicted

N-linked glycosylation sites in the extracellular region of FLRTs, twice in FLRT1, five times in the FLRT2, and four times in FLRT3 (Lacy, Bonnemann et al. 1999).

Leucine-Rich Repeat (LRR) Domain One of the major structural features of FLRTs is the LLR domain, which is comprised of

10 leucine-rich repeats (LRRs). This LRR region is bound by a cysteine rich region at either end of the domain (figure 1.5). Each LRR consists of conserved hydrophobic repeats of approximately 24 amino acids, that in many proteins generate a concave structure to interact with other proteins (Kobe and Kajava 2001).

Figure 1.5. Schematic representation of the Fibronectin Leucine-Rich Transmembrane (FLRT) protein family interacting with FGFR.

The FLRT protein family has 3 members, including FLTR1, FLRT2 and FLRT3. FLRTs are single-pass transmembrane proteins. Conserved secondary structure is observed with this protein family. FLRTs contain 10 leucine-rich repeats (LLRs) flanked by cysteine-rich regions, a fibronectin type III-like (FNIII) domain, a transmembrane (TM) domain, and a short intracellular

(IC) tail. The FNIII-domain of FLRT1-3 binds to the Ig-domain of FGFR (adapted from Haines,

Wheldon et al. 2006; Karaulanov, Böttcher et al. 2006).

FLRTs and Cell-Cell Interactions and Adhesion As noted, one of the major structural features of FLRTs is their leucine-rich repeats

(LRRs). LRRs have been shown to bind each other in a homotypic fashion (Fournier, GrandPre et al. 2001; Lin, Ho et al. 2003). It has been postulated that LRR-containing membrane proteins can cause homotypic adhesion of cells (the attachment of a cell to a second cell of the identical type via adhesion molecules) or result in cell recognition (Buchanan and Gay 1996; Lacy,

Bonnemann et al. 1999; Kuja-Panula, Kiiltomaki et al. 2003). Indeed, it has been shown that

FLRT proteins physically interacted in a homotypic manner. Flrt transfected cells will sort (or bind to) other transfected cells, not non-transfected cells, in a confluent mono-layer (Karaulanov,

Böttcher et al. 2006). The TM domain and LRR domains of FLRT proteins were found to be essential for cell-sorting; the TM domain acts as anchorage to the cell membrane whereas the

LRR domain was responsible for homotypic cell adhesion (Karaulanov, Böttcher et al. 2006).

FLRTs may function to mediate adhesion during embryogenesis, which could be attributed to the LRR domain. Recently, FLRT3 has been shown to mediate adhesion in murine embryos. Targeted gene disruption of Flrt3 resulted in homozygous mutant murine embryos that underwent normal gastrulation, but death at 10.5 dpc with adhesion defects including failure of ventral closure, headfold fusion, and definitive endoderm migration (Maretto, Müller et al.

2008). Further evidence to support the hypothesis that Flrt genes are involved in cellular adhesion comes from gene expression patterns in the chick and murine systems. Flrt3 expression in chick embryos was similar to that in murine embryos exhibiting expression in the interface between the apical ectodermal ridge (AER) and the mesenchyme it adheres to, and at other sites of Fgf8 expression. These evidences suggest that Flrt3 may have a crucial role in regulating

30 cellular adhesion between the epithelium of the AER and the underlying mesenchyme (Smith TG

2006).

Since Fgf8 and cFlrt3 are similarly expressed in the AER (Smith and Tickle 2006) and

XFLRT3 was shown to positively modulate FGF activity (Bottcher, Pollet et al. 2004), it has been suggested that cFLRT3 functions to reinforce FGF10-mediated AER formation (Yonei-

Tamura, Endo et al. 1999) to drive Fgf8 expression during limb bud outgrowth (Xu, Weinstein et al. 1998; Smith and Tickle 2006).

In contrast, however, previous studies that over-expressed Flrt3 in non-adhesive cells did not result in differences in cell aggregation between Flrt3 expressing and control cells

(Robinson, Parsons Perez et al. 2004). This hinted that FLRT3 may not mediate homotypic cell binding or adhesion (Robinson, Parsons Perez et al. 2004; Tsuji, Yamashita et al. 2004) and may perhaps instead confer homophilic cellular recognition between cells (Robinson, Parsons Perez et al. 2004; Tsuji, Yamashita et al. 2004; Haines, Wheldon et al. 2006). However, more evidence to suggest that FLRTs are involved in adhesion has since been published and will be mentioned in subsequent sections.

Cell Adhesion and the TGFβ pathway The previously mentioned studies have investigated FLRT function in the FGF signaling pathway. However, FLRT proteins may also mediate a deadhesion effect via the TGFβ signaling pathway. Activin/nodal members, or ligands, of the TGFβ superfamily were able to induce the expression of Flrt3 and Rnd1, a small GTPase, in Xenopus laevis animal caps using microarray

(Ogata, Morokuma et al. 2007). Nodal signaling is responsible for A-P and left–right body axes, mesodermal patterning and definitive endoderm specification (Collignon, Varlet et al. 1996;

Brennan, Lu et al. 2001; Vincent, Dunn et al. 2003; Dunn, Vincent et al. 2004). FLRT3 was

31 shown to bind Rnd1. Over-expression of Flrt3 using mRNA microinjected into Xenopus embryos caused de-adhesion of blastocoel roof cells from neighbouring cells. Inhibition of Flrt3 or Rnd1 using morpholino oligonucleotides (MOs) blocked deadhesion, shown by a blockage of the internalization of C-cadherin. Deadhesion was still blocked even after treatment of ectodermal explants (animal caps) with activin to activate the TGFβ pathway. Thus, modulation of cell adhesion during Xenopus gastrulation was controlled by cadherin levels at the surface through a dynamin-dependent endocytosis pathway. The use of a dominant-negative FGFR and

FGFR-specific inhibitor failed to change the cell dissociation phenotype induced by FLRT overexpression, which suggests that this effect was independent of the FGF signaling pathway.

Role of FLRTs in FGF signaling Beyond a role in cell-cell adhesion and cell recognition, evidence also suggests that

FLRTs interact with the FGF signaling pathway. The FNIII domain of FLRTs has been shown to bind to FGFR1 in co-immunoprecipitation experiments using domain deletion constructs

(Bottcher, Pollet et al. 2004; Haines, Wheldon et al. 2006; Karaulanov, Böttcher et al. 2006)

(figure 1.5). Haines et al. (2004) also observed that FLRT1 and FLRT2 had a higher binding affinity to FGFR1 compared to FLRT3.

Bottcher et al. (2004) observed that XFlrt3 was co-expressed with XFgf8 in Xenopus laevis embryos during gastrulation (Bottcher, Pollet et al. 2004) and that injection of Fgf8 mRNA induced expression of XFlrt3 in animal caps, while injection of XFlrt3 mRNA induced the activation of the MAPK pathway, which is downstream of FGFR activation (Bottcher, Pollet et al. 2004). This suggests that XFlrt3 may participate in XFgf8 signaling.

Conflicting evidence was provided when Flrt3 overexpressing HeLa cells failed to increase ERK/MAPK activation upon stimulation with FGF2 (Egea, Erlacher et al. 2008).

Furthermore, when FGFRs were inhibited during early murine development, elimination of a downstream target of the FGF pathway occurred, but did not have an effect on Flrt3 expression, which suggests that although FLRT3 interacts with FGFR2 in transfected cells, there may not be a biological relevance between FLRT3 and FGF signaling during gastrulation (Egea, Erlacher et al. 2008). Therefore, Flrt gene expression may also be activated independently of FGF signaling in the early mouse embryo and should be investigated further.

Documented Flrt Expression in the developing embryo Flrt genes are expressed in a developmentally restricted pattern unique to each family member (Haines, Wheldon et al. 2006). More specifically, Flrt1 is only expressed in the brain and kidney. Flrt2 is highly expressed in the pancreas, and lesser in the heart and skeletal muscle.

Flrt3 is more broadly expressed than Flrt1 or Flrt2, and is found at higher levels in skeletal muscle, heart, kidney, and pancreas in adult tissues (Lacy, Bonnemann et al. 1999).

During early embryogenesis, Flrt1 is expressed in the dorsal root ganglia, trigeminal ganglia and facioacoustic ganglia, the midbrain/hindbrain and fore/midbrain boundaries, and eye

(Haines, Wheldon et al. 2006). Flrt2 is expressed in segmental stripes in a subset of the sclerotome (part of the somite that develops into vertebrae), cephalic mesoderm, head mesoderm, and the epithelia of the body wall (Haines, Wheldon et al. 2006). Flrt3 is expressed in somites where muscle precursor cells migrate from the dermomyotome to the myotome (part of the somite that develops into muscle), the apical ectodermal ridge (AER) of the limb buds

(ectodermal structure overlying and inducing the expansion of the limb bud), the interlimb somites, and the midbrain boundaries with the forebrain and hindbrain (Haines, Wheldon et al.

2006), which is consistent with Flrt3 in rats (Robinson et al 2004).

A Potential Role of FLRTs in Craniofacial Development Flrts appear to mediate cellular adhesion/recognition, interact with the FGF signaling pathway, and modulate downstream FGF signaling events. They also appear to be involved in embryonic development of various organs and nerves. These observations suggest that FLRTs may play a role in midfacial development.

A microarray study of differing gene expression levels in the midfacial processes first brought our attention to Flrt2. Individual midfacial processes were excised from 10.5 dpc murine embryos, then total RNA was extracted and gene expression levels were compared between the processes. Flrt2 had been shown to be differentially expressed between the MNP and LNP

(Gong 2006) (Table 1.2). However, the precise relationship between FLRTs and FGFs during embryogenesis remains unknown. Thus, it is important to determine the sites of Flrt gene expression during craniofacial development to further elucidate their potential roles.

Study Objectives

An increased understanding of gene expression during primary and secondary palatogenesis, as well as tooth and hair follicle formation, will contribute to the body of scientific knowledge concerning craniofacial development. As discussed previously, FGFs play an essential role in embryonic tissue differentiation and morphogenesis. Flrts have been shown to interact with the FGF pathway.

Thus, the objectives of this study were to identify the temporal and spatial patterns of Flrt gene expression during embryogenesis in the facial region in order to relate the known functions of Flrt genes in those regions.

Gene Average Fold Previously Published Observations Change Fgf8 1.10 Equal expression in the MNP and LNP (Ohuchi, Yoshioka et al. 1994) Fgf17 1.59 Greater expression in the MNP/LNP (Bachler and Neubuser 2001)

Flrt2 2.07 (Gong, Mai et al. 2009)

Table 1.2. Selected microarray data of gene expression in the MNP vs. LNP.

FGF8 is known to be expressed in both the MNP and LNP. FGF17 has been shown to be more greatly expressed in the MNP than the LNP (Bachler and Neubuser 2001). Data shows that

Flrt2 had higher expression in the MNP than LNP (Gong unpublished; Gong, Mai et al. 2009).

Bachler, M. and A. Neubuser (2001). "Expression of members of the Fgf family and their receptors during midfacial development." Mechanisms of Development 100(2): 313-316. Gong, S. Unpublished data (2006). Ohuchi, H., et al. (1994). "Involvement of Androgen-Induced Growth Factor (FGF-8) Gene in Mouse Embryogenesis and Morphogenesis." Biochemical and Biophysical Research Communications 204(2): 882-888.

MATERIALS AND METHODS

Rationale and Design

To examine the expression of Flrt1, 2, and 3 during craniofacial development, embryos were examined at various times known to cover the key periods of craniofacial development (9.5 to 15.5 dpc). Whole mount ISH was used to visualize the overall gene expression pattern in the whole embryo. Section ISH was used to observe gene expression in specific tissues.

Immunohistochemistry was used to detect protein expression in tissue sections.

Design of Gene Expression Studies

Flrt gene family Expression was first examined at 10.5 dpc for all riboprobes in whole mount ISH. From there, if the gene demonstrated a unique pattern of expression in the midface, section ISH was conducted at time points from 9.5 to 15.5 dpc.

Other genes of interest

Msx1 and Msx2 The expression of Msx1 was used to compare to that of Flrt2 because Flrt2 expression was noted in the nasal septum cartilage. The Msx2 riboprobe available in our lab did not give a unique expression pattern for unexplored reasons, so Msx1 was used because it is related to Msx2 and has a similar pattern of expression.

Fgf8 The Fgf8 riboprobe was used as a positive control for ISH methods because this riboprobe has been previously been shown to work and Fgf8 expression has been detailed in publications (Firnberg and Neubuser 2002).

Design of Protein Expression Studies

At the time that FLRT protein expression patterns were being studied in our lab, commercially available antibodies for anti-murine FLRT1, FLRT2 and FLRT3 were not available. We did investigate the use of anti-human FLRT antibodies that were commercially available. These antibodies were reacted against the full-length protein. Human FLRT1, FLRT2, and FLRT3 have about 97% amino acid similarity with the mouse homologs (Haines, Wheldon et al. 2006). However, anti-hFLRT2 did not react in murine tissue sections. Therefore, we focused subsequent studies using anti-murine FLRT2 that was provided by the Kunkel laboratory

(Harvard) (see pg 51), which conducted the first studies on FLRTs.

Materials and Methods for ISH

Riboprobe Generation Digoxigenin riboprobes for Flrt1, Flrt2 and Flrt3 were prepared by linearizing full- length, gene-specific cDNA plasmids (Open Biosystems, Huntsville, AL) followed by in vitro transcription. Riboprobes were made using the full-length gene sequence. All antisense probes were synthesized by transcribing the linearized plasmid with T7 RNA polymerase. All polymerization reactions took place in the presence of nucleotide mix that contains 10 mM of each GTP, CTP, ATP, and UTP-digoxigenin.

Flrt1 and Flrt3 riboprobes Fragments generated were ligated into the pYX-Asc vector for Flrt1 and Flrt3. Antisense probes for Flrt1/Flrt3 were generated by digesting the plasmid with EcoRV. Sense probes used as a negative control were generated for Flrt1/Flrt3 by digesting the plasmid with NotI respectively and reverse transcribing with SP6.

Flrt2 riboprobe Fragments generated were ligated into pCMV-SPORT6 vector for Flrt2. Antisense probes for Flrt2 were generated by digesting the plasmid with EcoRI. Sense probes used as a negative control were generated for Flrt2 by digesting the plasmid with HindIII and reverse transcribing with SP6.

Msx1 riboprobe Digoxigenin riboprobes for Msx1 were prepared by linearizing Msx1 gene-specific cDNA plasmid (gift of R. Maas, Harvard University, Boston, MA). The Msx1 plasmid contained a fragment located 3′ end of the homeobox region and was approximately 332 base pairs long.

Msx2 riboprobe Digoxigenin riboprobes for Msx2 were prepared by linearizing Msx2 gene-specific cDNA plasmid (gift of GR Martin, UCSF, SF, CA). The Msx2 plasmid contained 800bp cDNA fragment.

Fgf8 riboprobe Digoxigenin riboprobes for Fgf8 were prepared by linearizing Fgf8 gene-specific cDNA plasmid (gift of J.M. Richman, University of British Columbia, Canada). The Fgf8 plasmid contained the 5′ end of the gene and was approximately 200 base pairs long.

Controls

Omission of the probe and use of sense probes were used as a negative controls for the whole mount and in situ hybridization studies. Sense probes were used at the same concentrations as the antisense probes. The sense probe for Msx2 was not used.

Probe Sequence Concentration Hyb. Used Temp. Flrt1 antisense Full length cDNA, Open Biosystems, 1 μg/mL 60°C accession #BC112383 (2.8kb) Flrt1 sense Full length cDNA, Open Biosystems, (2.8kb) 1 μg/mL 60°C Flrt2 antisense Full length cDNA, Open Biosystems, 0.5 μg/mL 65°C accession #BC096471, (2.9kb) Flrt2 sense Full length cDNA, Open Biosystems, (2.9kb) 0.5 μg/mL 65°C Flrt3 antisense Full length cDNA, Open Biosystems, 0.5 μg/mL 65°C accession #BC052943 (2.8kb) Flrt3 sense Full length cDNA, Open Biosystems, (2.8kb) 0.5 μg/mL 65°C Msx1 antisense 3′ end of the homeobox region, 332 bp 1 μg/mL 65°C Msx2 antisense 3′ end of the homeobox region, 800bp 1 μg/mL 65°C Fgf8 antisense 5′ end of the gene, 200 bp 1 μg/mL 65°C Fgf8 sense 5′ end of the gene, 200 bp 1 μg/mL 65°C

Table 2.1. Riboprobe generation.

Flrt1, Flrt2, Flrt3, Msx1 and Fgf8 riboprobe generation occurred using the listed restriction enzyme for plasmid linearization and corresponding RNA polymerase for in vitro transcription. Riboprobe hybridization took place at the temperature and concentration listed above.

Flrt1 Sense probe gggactggctctgggctgtagggcatgcccggctcaggagtccccgggggtgccccgtgc accccgagcacacaaccttcacttcggagagccaagccatcggtgcctgtggcctagggt gccgaagatgcagcgggggacctgcaggcatatctgaggcctggccacaaggaagactat aagacttctgtagtctctgtgtgcctctgtgctccctctgccccagggttgtagtctgtg gttttgagcctgctggtgacatggggccaaggatgtgagtgtggcctggaacattgaagc agtgaccagtgggacccagtggctccagggagcagcagcagaggaggtattgagactcca ggttgggtgggtcaggcctccagcagccatccaccatggtggtggcacactctgctgcca ccgctaccaccacacctgctgccacggtcacagccactgtcgtgatgaccacagccacca tggacctgcgggactggctgtttctctgttatgggctcattgccttcctcacggaggtca tcgatagcaccacctgcccatcagtgtgccgctgtgacaatggcttcatctactgcaatg accggggactcacatccatcccctcagacatccccgacgatgccaccaccctctacctac agaacaaccagatcaacaatgcgggcatccctcaggacctcaagaccaaggtcaaggtgc aggtcatctacctgtatgagaatgacctggacgagttccctatcaatctcccccgctccc tgagagagctgcatctgcaggacaacaatgtgcgcaccatcgccagggactctttggctc gcatcccgctgctggagaagctgcacctggacgacaactccgtttccaccgtgagcatcg aggaggatgcttttgctgacagcaagcagctcaagctgcttttcctgagccggaaccacc tgagcagcatcccgtcagggctgccccacacgctggaggaactgaggctagatgacaacc gcatctctaccatccccctgcacgcattcaagggtctcaacagcctgcggcgcctggttc tggatggcaacctgctggccaaccagcgcattgccgacgacaccttcagccggctgcaga acctcacggagctgtcgctagtacggaactcgctggctgccccgccccttaatctgccca gcgcccacctgcagaagctctacctgcaggacaatgccatcagtcacattccctacaaca ccctggccaagatgcgggagctggagaggttggacctgtccaacaacaacctcaccacgc tgcctcggggcctgtttgatgacctggggaacctggcacagctgcttctcaggaacaacc cctggttctgtggctgtaacctcatgtggctgagggactgggtgagggcacgggctgcag tggtcaatgtgcggggcctcatgtgccagggccctgagaaggtccggggcatggccatca aagacatcaccagcgagatggatgagtgctttgaggcggggtcacagggcggtgctgcta atgcagccgccaagaccacagtcagcaaccatgcctctgccaccacaccccagggctctc tgtttaccctcaaggccaagaggccaggactgcgcctcccagactccaacattgactacc ccatggccactggcgatggcgccaagacattggtcatccaggtgaagccactgacggcag actctatccgaatcacatggaaggccatgctacccgcctcttctttccggctcagttggc tacgtctgggccatagcccggctgtgggctctataacagagaccctggtgcagggggaca agacagagtacttgctgacagcactggagcccaagtccacctacatcatctgtatggtca ccatggagactggcaacacctacgtggccgatgagacacctgtgtgtgccaaggcagaga cagcagatagctatggccctaccaccacgctcaaccaggaacagaatgctggccctatgg cggggctgcccctggctgggattattggtggtgccgtggctcttgtatttctcttcctgg tcctgggagccatttgctggtacgtgcaccgggctggcgagctgctgacccgagagaggg tctacaacaggggcagcaggaggaaggacgactacatggagtcagggaccaagaaggata actccattctagaaatccgtggcccaggactgcagatgctacccatcaacccgtaccgct ccaaagaggagtacgtggtgcacaccatatttccctccaatggcagcagcctctgcaagg gtgcccacactattggctatggcaccacacgaggctaccgggaagcgggcatccctgatg tggactactcctacacatgaagctggccgcccgcgccgcaccgcaccggtgtgtcacgtg gctctgtctagcccactgcaacaccagg

Flrt2 Sense probe gtgagtttggcgtcatccattgtcaccaccaaggaatgtgcgctgggagataacaccaag ggcagtgcttctcaaacaagcagagagctctttctctctctgcttccaggtgcgctctta tctggtcctctgtcccaagtttccagaacgtggaggcagcagcgcagaaccggtcaccgc gtccactgaacctcaggaccagactggcagttctcaacgatgggcaggagggacctcggc ggcgacccctaaaacaataccatgcccggggagtccctctactgccgctctagcttcttc cctttccacctcccggacccggttggattcggatgagctaaggagacaaggctgccagat tacagactctgcataagcaagaaattcctaggctgctctccactggcctgactttctata gaagaaagaagatttgcctgcctggctggacttctcttaacagtacttcgcatcacgctt tgcttgtgtcgaaaatcctgagttgtttttgcacatggaggaccactgcatgagggcaac ctaggcagatcagactgaagacatcagaaagattgtgttaccatcttccctcagaccatt tcctctaatagaagttctagactttgacagaacctggtccggtcattttgattttgcttt ctggtgttattgtttgttgtgcttttgtttttgatttatttttttccccatcacgttgca ttttatttctgtcctccagaaatgggcctacagactacaaagtggcccggccgtggggct ttcatcctcaaattttggctcatcatttccctgggactctacttacaagtgtcaaaactc ctggcctgccctagtgtatgccgctgtgacaggaactttgtctactgtaacgagagaagc ttgacctcagtgcctcttgggatcccggagggcgtaaccgtactctacctccacaacaac caaattaataatgctggctttcctgcagagctgcacaatgtccagtcagtgcacactgtc tacctttatggcaaccagttggatgagttccccatgaaccttcccaagaatgtcagagtt ctccatctgcaggaaaacaacattcagaccatctcgcgggctgctctcgctcagctcctc aagctggaagaactccacctggacgacaactccatatctacagtgggagtagaagacgga gcgttccgggaggcgattagcctcaaactgttgtttttatcgaagaatcacctgagtagc gtgcctgttgggcttcctgtagacttgcaagagctgagagtggatgaaaaccgaattgcc gtcatatcagacatggcctttcagaacctcacaagcttggagcgcctgatcgtggatggg aatcttctgaccaacaagggcattgctgagggtaccttcagtcatctcaccaagctcaag gaattttctatagtccggaactcgctctcccacccacctcctgatctcccaggtacgcat ctgatcaggctctacttgcaggataaccagataaaccatatcccattgacagccttcgca aacctccgtaagctggaaaggctagatatatccaacaaccagctacgaatgttaactcaa ggagtcttcgatcatctctccaacctgaaacaactcactgcgcggaataacccttggttt tgtgactgcagcattaaatgggtcacagaatggctcaagtatatcccttcttctctcaac gtgcgtggtttcatgtgccaaggtcctgagcaagtccgcgggatggctgtcagggagttg aatatgaatcttttgtcttgtcccaccacgactcctggcctacctgtctttaccccagct ccaagtaccgtttctccaacaactcagtctcctactctctctgttccaagccccagcaga ggctctgtgcctccagctcctaccccatcgaaacttcccaccatccctgattgggatggc agagaaagagtgaccccacctatttctgaaaggatccaactttccatccactttgttaat gatacttcgattcaagtcagctggctgtctctctttactgtgatggcctacaaactgaca tgggtgaaaatgggccacagtctcgtagggggcatcgttcaggaacgaattgtcagtggt gagaagcaacacctgagcttggttaatttagagcccagatccacgtataggatttgttta gtgccgctggatgcgttcaactaccgcactgtggaagataccatctgttcggaggctacc acccatgcctcttatttgaacaacggcagcaacactgcttctagccatgagcagacgact tcccacagtatgggctccccttttctgctcgcaggcttgattgggggcgcagtgattttt gtgctcgttgtcttgctcagcgtcttttgctggcacatgcacaaaaagggacgctacacc tctcagaagtggaaatacaaccggggccgacggaaagacgactattgtgaagcgggtacc aaaaaagacaactccatcttggagatgacagaaacaagttttcagattgtctccttaaat aacgatcagctccttaaaggagatttcagactgcagcccatttataccccaaatgggggc attaattacacagactgccacatccccaacaacatgagatactgcaacagcagtgtgcca gatctagagcattgccatacgtaacagcctagaggtccagcgttagaaaggtggacaaac aaactctcaagaacacacatacgtgtgcacataaagacacgcaaattacatttgataaat gttacccagatgcatttgtgcatttgaatactctgtaatttatacggtgtactatataac gggatttaaaaaaaaagtgctatcttttctatttcaagttaattacaaacagttttgtaa ctctttgctttttaaaaaaaaaaaaaaa

Flrt3 Sense probe cgcgcagtcaactggatgctctcgcgcgcagtcctcagcgcaggagtgatctgaagcagg accgctcaggctgcagctgccgtggctttgtgtgcactggatgccgcgctccggagacgg gggagggtttttacttcaactcacaggcaatggaattacagctgtagcagcagggtataa aggattgctttttcctcgtcttcctggaggtgctcagtcctggcccattttaaggacgag aaatataaagggaatttagtgtgcttccttctctttccatgaagactgcatgcactgtgc cctttgcttcttaaaagagactccacccactccagtagaccggggactaaaacagaaatt ctgagaaagcagcaagaagcagaagaaatagctatttcacagcagtaacagaagctacct gctataataaagacctcaacactgctgaccatgatcagcccagcctggagcctcttcctc atcgggactaaaattgggctgttcttccaagtggcacctctgtcagttgtggctaaatcc tgtccatctgtatgtcgctgtgacgcaggcttcatttactgtaacgatcgctctctgaca tccattccagtgggaattccggaggatgctacaacactctaccttcagaacaaccaaata aacaatgttgggattccttccgatttgaagaacttgctgaaagtacaaagaatataccta taccacaacagtttagatgaattccctaccaaccttccaaagtatgtcaaagagttacat ttgcaagagaataacataaggactatcacctatgattcactttcgaaaattccgtatctg gaagagttacacttggatgataactcagtctcggctgttagcatcgaagagggagcattt cgagacagtaactatctgcggctgctttttctgtcccgtaaccaccttagcacaatcccg gggggcttgcccaggactattgaggaattacgcctggatgacaatcgcatatcaacgatc tcttccccatcacttcatggtctcacaagcctgaaacgcctggttttagatggaaacttg ttgaacaaccatggtttgggtgacaaagttttcttcaacttagtaaacttaacagagctg tccctggtgaggaattccttgacagcagcgccagtgaaccttcccggcacaagcctgagg aagctttaccttcaagacaaccatatcaaccgggtacccccaaatgctttttcttattta aggcagctgtatcgactcgatatgtctaataataacctaagcaatttacctcagggtatc tttgatgatttggacaatataacccaactgattcttcgcaacaatccttggtattgtgga tgcaagatgaaatgggtacgagactggttacagtcgctaccggtgaaggtcaatgtgcgt gggctcatgtgccaagccccagaaaaggtccgtggaatggctatcaaggacctcagtgca gaactgtttgattgtaaagacagtgggattgtgagcaccattcagataaccactgcaata cccaacacagcatatcctgctcaaggacagtggccagctcctgtgaccaaacaaccagat attaaaaaccccaagctcattaaggatcagcgaactacaggcagcccctcacggaaaaca attttaattactgtgaaatctgtcacccctgacacaatccacatatcctggagacttgct ctgcctatgactgctctgcgactcagctggcttaaactgggccatagcccagcctttgga tctataacagaaacaatcgtaacaggagaacgcagtgaatacttggtcaccgccctagaa cctgaatcaccctatagagtatgcatggttcccatggaaaccagtaacctttacctgttt gatgaaacacctgtttgtattgagacccaaactgcccctcttcgaatgtacaaccccaca accaccctcaatcgagagcaagagaaagaaccttacaaaaatccaaatttacctttggct gccatcattggtggggctgtggccctggtaagcatcgccctccttgctttggtgtgttgg tatgtgcataggaacgggtcactgttttcacggaactgtgcgtacagcaaagggcggagg agaaaggatgactatgcagaagccggtactaagaaagacaactccatcctggaaatcagg gaaacttctttccagatgctaccgataagcaatgaacccatctccaaggaggagtttgta atacacaccatatttcctccgaatgggatgaatctgtacaagaacaacctcagtgagagc agtagtaaccggagctacagagacagtggcatcccagactcggaccactcacactcatga tgcaaggaggtcccacaccagactgttccgggtttttttttaaaaaacctaagaaaggtg atggtaggaactctgttctactgcaaaacactggaaaagagactgagagaagcaatgtac tgtacatttgccatataatttatatttaagaactttttattaaaagtttcagatttcagg ttgctgctgcggttgatgtagtggggatgcctgaacacaattctatattttagtattttt tagtaatttgtactgtattttccttgcagatattgaagttataaaccatttactttgtgt tctactgagtaagatgacttgttgactgtgaaagtgaattttcccgctgtgttgaacaat caggactgcgttcacatgagacccttgtagtataagcacaggccgtttttcactttggta ttaatacaatgtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

Fgf8 Sense probe gcagaacgccaagtacgagggctggtacatggcctttacccgcaagggccggccccgcaa gggctccaagacgcgccagcatcagcgcgaggtgcacttcatgaagcgcctgccgcgggg ccaccacaccaccgagcagagcctgcgcttcgagttcctcaactacccgcccttcacgcg cagcctgcgcggcagccaga

Msx1 Sense Probe cgagtgcgcctgggaactcggcctgagcggcgcagggatccaggccccgctcgctcgagt ggccttctggggaagccgcaggaggctcgcgcgcgagagccggccgggccaggaacccag gagctcgcagaagccggtcaggagctcgcagaagccggtcgcgctcccagcctgcccgaa agccatgatccagtgctgtctcgagctgcggctggagggggggtccggctctgcatggcc ccggctgctgctatgacttctttgccactcggtgtcaaagtggaggactccgccttcgcc aagcctgctgggggaggcgttggcc

Msx2 Sense Probe tcatggcttctccgtgcaaaggcaatgacttgttttcgcccgacgaggagggcccagcag tggtggccggaccaggcccggggcctgggggcgccgagggggccgcggaggagcgccgcg tcaaggtctccagcctgcccttcagcgtggaggcgctcatgtccgacaagaagccgccca aggaggcgtcccgctgccggccgaaagcgcctcggccggggccaccctgcggccactgct gctgtcggggcacggcgctcgggaagcgcacagccccgggccgctggtgaagcccttcga gaccgcctcggtcaagtcggaaaattcagaagatggagcggcgtggatgcaggaacccgg ccgatattcgccgccgccaagacatacgagccctaccactgcaccctgaggaaacacaag accaatccggaagccgcgcacgcccctttaccacatcccagctcctcgccctggagcgca agttcccgtcacgaaacagtaccctctccattgccagagccgtgcagagttctcccagcc tctctgaacctcacagagacccagcgtcacaatctggttcccggaacccgaaaggccaaa ggcgaccaagattgcagcgaggcagaaactggacaagctgaaaatggtgcaaaccctatc tgcctccaagcttcgggtctccctttccccatg

Table 2.2. Riboprobe Sense Sequences.

Sense probes for Flrt1, Flrt2, Flrt3, Msx1, Msx2 and Fgf8 riboprobe are listed.

Preparation of Mouse embryos for whole mount and section ISH

Timed pregnant CD6 mice were obtained from Charles River (MA). Embryos were removed at 9.5, 10.5, 11.5, 12.5, 13.5, 14.5, and 15.5 days post-coitum (dpc). Embryos were fixed in 4 % paraformaldehyde in PBS buffer overnight at 40C. These embryos would be used for either section or whole mount ISH.

Preparation of embryos for cryosections Embryos were washed three times in PBS, and cryoprotected in 30 % sucrose/0.1 M phosphate buffer pH 7.0 overnight at 40C. The embryos were then equilibrated in a 50:50 mixture of 30 % sucrose:OCT (Tissue Tek 4583) for at least 1 hour on a rocking platform at 40C.

Heads of embryos were then removed and embedded in 2 different planes, frontal and transverse across the midfacial region. Sections (transverse and frontal) were made, 14 μm thick, and mounted onto Superfrost Plus slides (Fisher-Scientific) and air-dried overnight. The slides were stored at -200C until needed.

Preparation of embryos for Whole mount ISH Timed embryos were eviscerated, with their heads punctured in the brain with a syringe needle to avoid trapping of reagents in the lumen. They were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) at 4°C overnight. The next day they were washed in PBTX

(PBS, pH 7.4, and 0.1% Triton X-100) for 20 minutes and stored in methanol at -20°C until ready for hybridization. Prior to hybridization, the embryos were rehydrated through a methanol/PBTX series (from 75%/MeOH to PBTX) and treated with proteinase K (10 μg/mL) in

PBTX for 5 to 20 minutes, the length depending on the size of the embryos. Approximately 5 minutes for 9.5 dpc, 10 min for 10.5 dpc, 12 min for 11.5 dpc. They were then refixed in 0.2% glutaraldehyde/4% paraformaldehyde for 20 minutes after which they were placed in

44 prehybridization buffer (50% formamide, 5X SSC, 2% blocking powder, 0.1% Triton X-100,

0.5% 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS), 1 mg/mL yeast total RNA (Invitrogen), 5 mM ethylene diaminetetraacetic acid (EDTA), 50 μg/mL heparin) at

60°C for 2 hours.

Hybridization and Detection of Probe

Determining optimal hybridization conditions Temperature for riboprobe hybridization was tested at 60°C initially, and then the experiment would be repeated again at 65°C for increased stringency if the initial expression pattern was strong. Concentration of the riboprobe was tested at 1 μg/mL and 0.5 μg/mL. If the expression pattern was strong at 0.5 μg/mL, this concentration would be used. Otherwise, 1

μg/mL would be used.

Probe concentration Embryos were hybridized overnight at 65°C for all probes except Msx2 and Flrt1, which were hybridized overnight at 60°C. The Msx1-labeled and Flrt1-labeled riboprobe was added to hybridization buffer at a concentration of 1 μg/mL. Flrt2- and Flrt3- labeled riboprobe was added to hybridization buffer at 0.5 μg/mL. Sense probes were used at the same concentration as a negative control. The sense probe for Msx2 was not used.

Post hybridization conditions for Whole Mount ISH Post-hybridization washes comprised of a series of 30 minute washes in 100%, 75%,

50%, and 25% of solution 1 (50% formamide, 5X SSC, 0.1% Triton X-100) to 2X SSC at 65°C.

They were next washed with 2X SSC, 0.1% CHAPS twice for 30 minutes at 65°C followed by

0.2X SSC, 0.1% CHAPS twice for 30 minutes at 65°C. After rinsing with TBTX (50 mM Tris.Cl pH 7.5, 150 mM NaCl, 0.1% Triton X-100) the embryos were incubated with preabsorbed

(antibody incubated with whole mouse embryo powder prior to use) anti–digoxigenin-alkaline phosphatase antibody (Boehringer Mannheim, Indianapolis, IN) at a concentration of 1:2000 in

10% sheep serum (Gibco), 2% bovine serum albumin (BSA) in TBTX overnight at 4°C. The next morning, the embryos were washed with TBTX/0.1% BSA for 1 hour each at room temperature five times. They were then washed with TBTX for 15 minutes two times followed by NTMT (100 mM NaCl, 100 mM Tris Cl, pH 9.5, 50 mM MgCl2, 0.1% Tween-20) for 10 minutes three times. The color-detection step was achieved by incubating the embryos in NTMT containing 4.5 μL NBT and 3.5 μL 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) per milliliter.

The embryos were rocked for the first 20 minutes and then transferred to a glass scintillation vial and placed in the dark and checked periodically at 10- to 20-minute intervals for staining.

Usually after 1½ hours, the reaction was stopped by washing the embryos with NTMT followed by PBTX. The stain was fixed by incubating the embryos in 4% paraformaldehyde in PBTX overnight at 4°C.

Post hybridization conditions for Section ISH Sections were removed from storage and warmed to room temperature. The riboprobe was diluted 1 ul to 500ul in hybridization buffer (0.2 M NaCl, Tris HCl, pH 7.5, 1 mM Tris base,

5 mM NaH2PO4, 5 mM Na2HPO4, 0.05 M EDTA, 50 % formamide, 10 % dextran sulfate, 1 mg/ml rRNA, 1 × Denhardt's (Bioshop)). The probe was denatured at 700C for 10 minutes, vortexed, and pipetted onto each slide. After coverslipping, the slides were placed in a box containing 2 sheets of 3 mm Whatman paper wet with 50 % Formamide/1 × SSC. The box was sealed with tape and incubated overnight at 600C. The next day, the slides were washed in wash buffer (1 × SSC, 50 % formamide, 0/1 % Tween) at 600C for 15 minutes with rocking. The wash was repeated twice with new buffer for 30 minutes each. After this, the slides were washed

46 in 1 × MABT and incubated at room temperature for 30 minutes, this was repeated. Blocking solution (20 % heat-inactivated sheep serum/2 % blocking reagent in 1 × MABT) was added to sections and incubated at room temperature for at least 1 hour in a humidified box with filter paper saturated with PBS. The blocking solution was then removed and about 150 μl of anti-DIG antibody diluted 1:1500 was added and coverslipped. This was placed in the humidified chamber at 40C overnight. The next day, the slides were transferred to a rack and washed 5 times for 20 minutes each in 1 × MABT at room temperature with rocking. The sections were then equilibrated in staining buffer (without NBT and BCIP) two times at 10 minutes each, with rocking at room temperature. Color reaction was performed by incubating the slides in staining buffer with NBT/ BCIP (20 μl/ml) in the dark at RT. The staining reaction was stopped by washing the slides several times in PBS. Sections hybridized with Msx1 antisense riboprobe were counterstained with eosin and hematoxylin for contrast.

In situ hybridization Negative Controls Negative controls for ISH are twofold. First, hybridization can take place without riboprobe present in the hybridization solution to determine whether the results seen are due to background alone. Second, sense probes are made such that they hybridize to the complementary strand of the gene. In theory, this strand does not encode a gene, and demonstrates that the gene expression pattern seen using the antisense riboprobe is not due to the presence of nucleotides in the hybridization solution.

In the case of Msx1, this homeobox gene is subject to bidirectional transcription.

Therefore, the sense probe would demonstrate a staining pattern. In order to have another negative control, a known non-coding RNA probe can be used.

Materials and Methods for Immunohistochemistry

Antibodies used Sections were prepared in an identical fashion as the sections used for section ISH.

Rabbit anti-murine antibodies directed against FLRT2 were a gift from the Kunkel laboratory

(Harvard). These were generated by injection of the synthetic peptide in the extracellular domain

CDWDGRERVTPPISERIQ linked to KLH as a carrier into female NZW rabbits, and purifying

IgG antibodies with an affinity column (Bio-Rad). A commercially available anti-human FLRT2 antibody from RnD was also used (Catalogue No MAB 8277, RnD Systems Minnesosta MN).

This mouse anti-human monoclonal IgG antibody was synthesized against amino acids 36-539, which is the extracellular region of human FLRT2.

Primary Antibody Coronal sections of the midfacial region of day 9.5 to 15.5 dpc embryos were used.

Sections were washed in PBS then a solution of PBS and normal blocking solution (10% normal goat serum (NGS), 0.01% Saponin, 0.1% BSA in 1xPBS) was added. After excess serum was blotted from the sections, a dilution of 1:1500 rabbit anti-murine antibody against FLRT2 was added and left on overnight at 40C.

Different concentrations were used to test the FLRT2 antibody in immunohistochemistry

(1:500, 1:1000, 1:1500). The concentration used in subsequent experiments would be one that demonstrated specificity and a clear expression pattern (1:1500).

Secondary Antibody The next day, the slides were washed and the secondary antibody (5% biotinylated goat anti-rabbit IgG diluted in 0.01% Saponin, 1.5% NGS, 1xPBS) was added to the sections for 40 minutes at room temperature. After washing, the slides were quenched in 0.03% hydrogen peroxide in absolute methanol followed by amplification of the signal using Vectastain Elite 48

ABC (Vector Labs, California) and detection with diaminobenzidine (DAB; 0.1%). A standard 5 minute incubation time in the DAB was used for all sections. After washing the slides were mounted and analyzed. Negative controls were performed concurrently without the presence of primary antibody.

Controls Omission of the primary antibody was used as controls for the immunohistochemistry staining.

RESULTS

Whole Mount ISH

Negative control at 10.5 dpc In whole mount, no background staining was seen using a no probe control (figure 3.3C).

Flrt1 at 10.5 dpc Flrt1 was expressed in the mid/hindbrain boundary in the whole mount ISH (figure

3.3A). Broad expression was seen in the medial nasal process (MNP), lateral nasal process

(LNP), mandibular process (Mn), and maxillary process (MxP) (figure 3.3A,B). Flrt1 did not appear to exhibit a unique gene expression pattern in the facial region (figure 3.3A,B) and was not investigated further.

Flrt2 from 9.5 – 12.5 dpc At 9.5-11.5 dpc, Flrt2 was expressed in the cephalic mesenchyme and segmental stripes along the body and the lungs (figure 3.1 A, C, E) but becomes less visible as the epithelium thickens with age at 12.5 dpc (figure 3.1 H). At 10.5dpc, Flrt2 was detected in the midfacial region, as well as the lungs, head, and in segmental stripes along the body trunk in a subset of the sclerotome that develops into vertebrae (figure 3.1 C, 3.2 A,C).

In the midfacial region, at 9.5 dpc, Flrt2 was expressed in the developing nasal placodes

(figure 3.1 B). Flrt2 was expressed the medial nasal process (MNP) along the inner nasal pit, maxillary process (MxP), the oral cavity, and both pharyngeal arches (figure 3.1 D, F). At 10.5,

Flrt2 was expressed in the inner portion of the nasal pit in the MNP (figure 3.1 D). At 11.5 dpc, in the roof of the oral cavity, Flrt2 was expressed in a region at the anterior portion, with two areas of more intense staining that correspond to murine incisor development (figure 3.1 G). At

12.5 dpc, Flrt2 was expressed in the hair placodes as they are thickening (figure 3.1 H, I).

Flrt3 at 10.5 dpc Flrt3 gene expression was distinct from that of Flrt2. Flrt3 was expressed in the craniofacial region, forebrain, the apical ectodermal ridge (AER), tail somites, and the interlimb somites (figure 3.2B,D).

Section ISH

Negative control at 10.5 dpc In section ISH, no background staining was seen using a no probe control (figure 3.4A).

Similarly, no staining was seen using the antisense probes for Flrt2 and Flrt3 (figure 3.4 A and B respectively)

Flrt Expression in the Primary Palate

Flrt2 Flrt2 expression was detected at 9.5 dpc in the medial portion of the nasal placodes in both the epithelium and the mesenchyme (arrow showing epithelial expression; figure 3.5). Flrt2 was expressed in the nasal pit of the MNP, the oral cavity, along the outer proximal side of the

MxP and mandible (Mn), and medially along the outer portion of the Mn (figure 3.6). From 10.5 to 12.5 dpc, Flrt2 was expressed in the frontonasal mesenchyme (figures 3.6A, B, C, D, 3.7A,

3.8A, B, C, D, 3.9A, 3.10A, 3.11A), but not the epithelium.

Flrt2 and Msx1 Msx1 was expressed in a mutually exclusive pattern with Flrt2 in the frontonasal prominence (compare figure 3.9A and 3.9B). Msx1 was highly expressed in the mesenchyme of the distal tips of the LNP and MNP, whereas Flrt2 was expressed in the proximal portion of the mesenchyme of the MNP.

Msx2 Msx2 expression was seen at the distal tips of the MNP and LNP at 10.5 dpc (figure

3.10). Staining was faint, and therefore, this probe was not used further.

Flrt3 Flrt3 was found in both the MNP and LNP (figures 3.2BD, 3.7A). Flrt3 was found in the proximal region of the LNP extending along the outer nasal pit of the LNP laterally towards the eye (figures 3.7A). In the MNP at 10.5 dpc, Flrt3 expression was situated along the oral cavity and the intensity was less pronounced from that in the LNP (figure 3.2D). Expression did not extend into the nasal pits in either the MNP or LNP. Flrt3 was expressed in the mesenchyme along the oral edge of the MNP adjacent to the epithelium from 10.5 to 12.5 dpc (figures 3.7B,

3.10B, 3.11B). Similarly, expression was observed in the sub-epithelial mesenchyme of the LNP

(figure 3.7B). Flrt3 expression was also observed in the anterior region of the MxP at 10.5 dpc using whole mount ISH, but did not extend into the oral cavity (figures 3.2B). Mesenchymal expression of Flrt3 was located in the mandible immediately adjacent to the epithelium.

Flrt Expression in the Secondary Palate

Flrt2 Secondary palatogenesis occurs after the development of the primary palate and around

13-15dpc. During this time, Flrt2 was expressed exclusively in the posterior region prior to fusion (figure 3.13). Flrt2 was found in mesenchymal cells adjacent to the epithelium of the secondary palatal shelves when they were extending vertically downwards at 13.5 dpc (figure

3.12A), during palatal shelf elevation and fusion at 14.5 dpc (figure 3.12C), but expression tapered after the shelves have fused at 15.5 dpc. Flrt2 was expressed in the mesenchyme adjacent to the medial edge epithelium (MEE) on the oral side of the palatal shelves (figure

3.12C) before and after the disappearance of the MEE. Flrt2 was also expressed the region of the developing nasal septum cartilage at 14.5 dpc.

Flrt3 Flrt3 was also expressed in the posterior secondary palate, but expression of Flrt3 was spatially exclusive from that of Flrt2. Flrt3 was found in the mesenchyme of the palatal shelves at 13.5 dpc (figure 3.12B), but not the mesenchyme immediately below the epithelial layer where

Flrt2 was expressed (figure 3.12A). Notably, Flrt3 was expressed in the MEE of the palatal shelves at 14.5 dpc but dissipates after mesenchymal confluence (figure 3.12D).

Flrt Expression in the VNO

Flrt2 A restricted portion of the inner nasal pit epithelium of the MNP expressed Flrt2 from

10.5 dpc to 11.5 dpc (figures 3.6 A, B, C, 3.7A, 3.9A). From 13.5 to 15.5 dpc, Flrt2 is expressed on the concave side of the VNO when it becomes a kidney-shaped structure at the base of the nasal septum.

Flrt3 Flrt3 was not detected in the VNO during early embryogenesis (9.5 – 12.5 dpc).

Flrt Expression in the developing Tooth

Flrt2 Tooth development begins around 11dpc when the dental lamina forms. Subsequently, tooth buds begin to appear. Flrt2 expression was noted in whole mount ISH at 11.5 dpc in a region of the oral cavity associated with incisor development (figure 3.1G). Flrt2 expression was found in the epithelial cells associated with the basement membrane of the developing bud from

13.5 dpc and the cells associated with the cap stage basement membrane and outer enamel

53 epithelium from 14.5 to 15.5 dpc, but not in the dental papilla (dep) (figure 3.15A). Expression was higher on the medial side of all tooth buds.

Flrt3 Flrt3 was expressed in the cells of the dental epithelium during bud stage at 12.5 to 13.5 dpc. During cap stage at 14.5 dpc, Flrt3 was found in the dental and inner enamel epithelium, and also in the transient signaling centre responsible for tooth cusp formation and morphogenesis, known as the primary enamel knot (figure 3.15B).

Flrt Expression in the Hair Follicle

Flrt2 At the time when murine vibrissal hair formation commences (12.5 dpc), Flrt2 was observed in the hair follicle placodes using whole mount ISH (figure 3.1H,I). Surrounding the dermal papilla (dp), there is an inner root sheath (IRS), which is surrounded by the outer root sheath (ORS). Flrt2 gene expression was detected in the hair germ stage (13.5 dpc). Flrt2 gene expression was also detected the cells of the IRS and connective tissue surrounding the ORS during peg stage (14.5 to 15.5 dpc) (figure 3.15C).

Flrt3 As opposed to Flrt2, Flrt3 was expressed in the matrix cells of the hair follicle at 14.5 to

15.5 dpc (figure 3.15D). Flrt3 was not found in the dermal papilla, nor the mesenchyme surrounding the hair follicle.

Negative Controls for ISH Negative controls, using no probe and Flrt1, Flrt2 and Flrt3 sense probes did not exhibit expression (figure 3.4A,B,C respectively).

FLRT2 Immunostaining

FLRT2 protein staining was detected at all time points studied (9.5 to 15.5dpc). At 9.5 dpc, FLRT2 staining was seen in the neuroepithelium (figures 3.16A,B,D) and the mesenchyme of the expanding nasal placodes (figures 3.16C,D). At 10.5 to 11.5 dpc, FLRT2 expression is seen in the nuclei of the nasal epithelium (figures 3.16A,B, 3.17A,B), the developing VNO

(figures 3.18A,D), the neuroepithelium (figures 3.18A,F), the oral epithelium (figures 3.17A,D,

3.18A,E) and the fusion site between the MNP and MxP (figures 3.17A,C, 3.18A,C). No staining was seen using no primary antibody as an experimental control (figure 3.20).

At 15.5 dpc (figure 3.19A), FLRT2 was expressed in the nuclei of the developing VNO epithelium (figure 3.19B), the medial side of the developing tooth bud in the basement membrane (figure 3.19C), the tongue epithelium (figure 3.19A), the basement membrane of the oral cavity (figure 3.19C), the ORS of hair follicles surrounding the hair follicle matrix (figure

3.19D), and the mesenchyme surrounding the hair follicles (figure 3.19D).

E/M Flrt2 mRNA FLRT2 Protein Brain (9.5dpc) E neuroepithelium M neuromesenchyme MNP E Inner nasal pit, restricted region MNP M Throughout MNP mesenchyme Fusion point between MNP and MxP LNP E None None LNP M None None MxP E Fusion point between MNP and MxP MxP M None present VNO present present Oral Cavity E present M present Nasal Epithelium E None present Tooth Bud E Enamel epithelium Enamel epithelium M Medial side of tooth buds, Medial side of tooth buds, basement membrane cells of the basement membrane cells of the toothbud toothbud Hair Follicle IRS cells IRS cells

Table 3.1. Comparison between Flrt2 mRNA and FLRT2 protein expression

Comparing Flrt2 mRNA and protein expression from 9.5-15.5 dpc.

Figures

9.5 dpc 10.5 dpc 11.5dpc 12.5 dpc

Figure 3.1. Whole mount ISH showing expression of Flrt2 in murine embryos at 9.5 – 12.5 dpc.

At 9.5-11.5 dpc, Flrt2 was expressed in the cephalic mesenchyme and segmental stripes along the body and the lungs (A, C, E) but becomes less visible as the epithelium thickens with age at 12.5 dpc (H). At 9.5 dpc, Flrt2 was expressed in the developing nasal placodes (B). Flrt2

57 was expressed the medial nasal process (MNP) along the inner nasal pit, maxillary process

(MxP), the oral cavity, and both pharyngeal arches (D, F). At 10.5, Flrt2 was expressed in the inner portion of the nasal pit in the MNP (D). At 11.5 dpc, in the roof of the oral cavity, Flrt2 was expressed in a region at the anterior portion, with two areas of more intense staining that correspond to murine incisor development (G). At 12.5 dpc, Flrt2 was expressed in the hair placodes as they are thickening (H, I).

Figure 3.2. Whole mount ISH showing expression of Flrt2 and Flrt3 in murine embryos at

10.5 dpc.

Expression of Flrt2 (left- shown in figure 3.1) and Flrt3 (right). Flrt2 is expressed in the head, segmental stripes along the body and the lungs (A). In the face, Flrt2 was expressed the medial nasal process (MNP) along the inner nasal pit, maxillary process (MxP), and both pharyngeal arches (C). Flrt3 is expressed in the head, somites along the body and tail, and apical ectodermal ridge (AER) of the limb buds (B). In the face, Flrt3 was expressed lateral nasal process (LNP), MNP along the oral cavity, MxP, and both pharyngeal arches (D).

Figure 3.3. Flrt1 gene expression at 10.5 dpc using whole mount in situ hybridization (ISH).

Flrt1 gene expression appeared to be generalized in the midfacial region (A,B). The negative control with no probe does not show background staining (C).

Figure 3.4. Negative controls.

Frontal sections of 10.5 dpc midface did not exhibit signs of gene expression. (A) no probe, (B) Flrt2 sense probe, and (C) Flrt3 sense probe. Dark spots found within the sections are blood vessels.

Figure 3.5. Transverse section showing the expression of Flrt2 in the developing midface at

9.5 dpc.

Flrt2 expression in the mesenchyme of the nasal placode and the epithelium of the nasal placode

(dark arrow).

Figure 3.6. Transverse section showing the expression of Flrt2 developing midface at 10.5 dpc.

(A) Transverse section through the whole head. (B) Magnification of A. (C)

Magnification of the MNP in B. Flrt2 was expressed in the mesenchyme of the MNP, and in a localized region of the epithelium of the MNP. (D) Magnification of oral mesenchyme in B.

Flrt2 was expressed in the mesenchyme of the oral cavity.

Figure 3.7. Transverse section showing the expression of (A) Flrt2 and (B) Flrt3 in the developing midface of murine embryos.

Expression of Flrt2 (left) and Flrt3 (right). (A) early 10.5 dpc and (B) late 10.5 dpc. Flrt2 was expressed in the mesenchyme of the MNP, epithelium of the inner MNP (dark arrow), whereas Flrt3 was expressed in the LNP and oral mesenchyme.

Figure 3.8. Transverse section showing the expression of Flrt2 in the developing midface at 11.5 dpc.

(A) Left side of the midface. (B) Magnification of A. Flrt2 is clearly expressed on the medial portion of the midface. (C) Magnification of A. Flrt2 was expressed in the mesenchyme of the MNP and epithelium of the inner MNP. (D) Magnification of A. Flrt2 was expressed in the oral mesenchyme.

Figure 3.9. Transverse sections showing the expression of (A) Flrt2 and (B) Msx1 in the developing midface of murine embryos at 11.5 dpc.

Expression of Flrt2 (left) and Msx1 (right). Flrt2 expression in the mesenchyme of the

MNP, epithelium of the inner MNP (dark arrow), whereas Msx1 was expressed in sites exclusive of Flrt2 expression. Msx1 was expressed in the LNP and oral epithelium and mesenchyme.

Figure 3.10. Msx2 riboprobe at 10.5 dpc.

Faint expression is seen at the tips of the MNP and LNP. Transverse section. ne: neuroepithelium

Figure 3.11. Frontal sections showing the expression of (A) Flrt2 and (B) Flrt3 in the developing midface of murine embryos at 12.5 dpc.

Expression of Flrt2 (left) and Flrt3 (right). Flrt2 was expressed in the mesenchyme of the

MNP and vomeronasal organ. Flrt3 was expressed in the oral mesenchyme adjacent to the oral epithelium, as well as the MxP and a portion of the LNP near to the nasal pit.

Figure 3.12. Frontal section showing the expression of (A) Flrt2 and (B) Flrt3 in the developing oral cavity at 12.5 dpc.

Expression of Flrt2 (left) and Flrt3 (right). Magnification of Figure 9. Flrt2 was expressed in the mesenchyme of the oral cavity extending into the mesenchyme of the midface.

Flrt3 expression was localized to the oral mesenchyme adjacent to the oral epithelium.

Figure 3.13. ISH of coronal sections showing expression of Flrt2 and Flrt3 in the palatal shelves

(PS) of murine embryos at 13.5 to 14.5 dpc.

Expression of Flrt2 (left) and Flrt3 (right). Flrt2 was expressed in the mesenchyme below the epithelium of the PS when they are extending (A) and below the medial edge epithelium (MEE) during fusion (C). Epithelial expression of Flrt3 was located in the palatal shelves during vertical growth (B), as well as the nasal and MEE, but disappeared from the MEE after fusion (D).

Figure 3.14. Whole mount ISH of the secondary showing expression of Flrt2 in the palatal shelves (PS) of murine embryos at 14.5 dpc.

Flrt2 was expressed in the posterior palatal mesenchyme, and excluded from the anterior palate.

Figure 3.15. Coronal sections showing expression of Flrt2 and Flrt3 in the developing hair follicle and tooth buds of murine embryos at 14.5 dpc.

Expression of Flrt2 (left) and Flrt3 (right). Flrt2 was expressed in the developing tooth bud in the basement membrane cells (dark arrow in A) and outer enamel epithelium. Flrt3 was expressed in the developing tooth bud in the dental and enamel epithelium, and enamel knot

(outlined arrow in B). Flrt2 was expressed in the inner root sheath (IRS) (χ in C), whereas Flrt3 was expressed in the matrix cells of the developing hair follicle (* in D). dermal papilla (dp), dental papilla (dep)

Figure 3.16. FLRT2 protein expression at 9.5 dpc in a transverse section of the head.

FLRT2 was expressed in the neuroepithelium (B,D) and facial mesenchyme (C).

Figure 3.17. FLRT2 protein expression at 10.5 dpc in a frontal section of the developing murine midface.

FLRT2 expression was observed in the nasal epithelium (A,B), the fusion site between the MNP and MxP (A,C), and oral epithelium (A,D).

Figure 3.18. Frontal section demonstrating FLRT2 protein expression at 11.5 dpc.

FLRT2 expression was observed in the nasal epithelium (A,B), the fusion site between the MNP and MxP (A,C), developing VNO (A,D), oral epithelium (A,E), and neuroepithelium

(A,F).

Figure 3.19. FLRT2 protein expression in the VNO, tooth bud, and hair follicle at 15.5 dpc.

FLRT2 is expressed in a frontal section at 15.5 dpc (A) in the developing VNO (B), the medial side of the developing tooth bud (C), the tongue epithelium (C), the basement membrane of the mouth (C), the ORS of hair follicles surrounding the hair follicle matrix (D), and the mesenchyme surrounding the hair follicles (D).

Figure 3.20. FLRT2 negative control at 10.5 dpc.

No primary antibody.

DISCUSSION

In a microarray screen to identify genes that were highly expressed in the developing midfacial area, a member of the Fibronectin leucine-rich transmembrane protein (Flrt), Flrt2, was identified (Gong, unpublished) (Table 1.2). Flrt genes encode putative single pass transmembrane proteins with conserved domain structure, including a leucine rich repeat domain, a fibronectin-type III (FNIII) domain, a transmembrane domain, and a short intracellular tail (Lacy, Bonnemann et al. 1999). The LLR domain is thought to play a role in homotypic cellular recognition (Haines, Wheldon et al. 2006; Karaulanov, Böttcher et al. 2006), while

FNIII has been shown to bind to FGFR1 in Xenopus (Bottcher, Pollet et al. 2004) and mice

(Haines, Wheldon et al. 2006). After binding to FGF receptors (FGFRs), the intracellular domain in XFLRT3 modulated FGFR signaling (Bottcher, Pollet et al. 2004). Since FLRTs can interact with the FGF signaling pathway, and the FGF signaling pathway has been shown to be critical for craniofacial development, it is possible that FLRTs participate in midfacial development.

Therefore the objective of this thesis was to perform an expression analysis of the three members of the Flrt gene family to determine their spatial and temporal pattern during development of the midfacial region.

Flrt1 Expression

Flrt1 gene expression appeared broad in the midfacial region, but the expression pattern appeared consistent with other published results (Haines, Wheldon et al. 2006; Maretto, Müller et al. 2008). Flrt1 was expressed in a stripe adjacent to the midbrain/hindbrain boundary with lower level expression at the midbrain/forebrain boundary, in the eye, and limb bud. This suggests that FLRT1 may have a role in brain, eye, and limb development.

The expression of Flrt1 was similar to that of FGFRs, where expression is not limited to a particular structure, such that they are available to multiple FGF ligands. The role of FLRT1 in the midface is most likely still to bind FGFRs. However, the function of FLRT1 may not be to bind a particular FGFR and/or regulate a particular FGF-FGFR signaling complex in this region.

In the midface, Flrt1 was non-specifically expressed in the midfacial processes. While

Flrt1 may play a role in brain and eye development, further experimentation of Flrt1 expression was not conducted because the generalized expression pattern of Flrt1 in the craniofacial region suggests that this gene does not have a specific role in the development of a particular facial structure.

Flrt2 and Flrt3 Expression

The expression analysis of Flrt2 and Flrt3 gene family members yielded interesting spatial and temporal expression patterns in the midface. Flrt2 and Flrt3 were synchronously expressed in the same developmental areas, including the primary and secondary palate, tooth bud, and hair follicle. These regions involve EMI as a critical factor for their development, which suggests that FLRTs participate in signaling between the epithelium and mesenchyme. However, both genes appear to have unique and mostly non-overlapping within these expression regions.

The trend of Flrt2 and Flrt3 expression pattern suggests that they are involved with spatial patterning during embryogenesis. The expression patterns of these genes and their possible functions in each region will be discussed further in the following sections.

Region of Expression Flrt2 FGFR associated Flrt3 FGFR associated Primary Palate (1) MNP mesenchyme (1) Fgfr2 (Bachler and (1) LNP mesenchyme Fgfr1 (Bachler and (2) MNP epithelium Neubuser 2001) (2) oral mesenchyme Neubuser 2001), (VNO- see below) associated with sites of Fgf8 expression (Smith and Tickle 2006) Secondary Palate Mesenchyme below the Fgfr2-IIIb, associated (1) MEE cells (1) Fgfr1/Fgfr2, with MEE with sites of Fgf10 (2) PS mesenchyme Fgf2 and Fgf4 as their expression (Rice, cognate ligands Spencer-Dene et al. expressed in the MEE 2004), (Britto, Evans et al. 2002) VNO MNP epithelium on the Fgfr2 (Bachler and none n/a inner portion of nasal pit Neubuser 2001) Tooth bud (1) basement membrane Fgfr1-IIIb/-IIIc and (1) dental and enamel (1) Fgfr1 cells Fgfr2-IIIb/-IIIc epithelium (2) Fgfrs are not (2) outer enamel (Developmental Biology (2) enamel knot expressed in the enamel epithelium Programme of the knot University of Helsinki 1996; Päivi Kettunen 1998) Hair Follicle IRS Fgfr2, associated with matrix cells Fgfr2, associated with sites of expression of its Fgf2 (matrix) and Fgf7 ligand, Fgf22 (Nakatake, (dermal papilla) Hoshikawa et al. 2001) (Rosenquist and Martin 1996)

Table 4.1. Comparing regions of Flrt2 and Flrt3 expression and the FGFR associated with that region.

Expression in the Primary Palate

Based on their expression pattern, both Flrt2 and Flrt3 have important roles in primary

palatogenesis.

Flrt2 in the Primary Palate Flrt2 was expressed in the proximal mesenchyme of the MNP, and in the mesenchyme

directly below the epithelial layer in the oral cavity of the paired MNPs, in areas where members

of the FGF family and their receptors have also been shown to be expressed (Bachler and

Neubuser 2001).

Regions of mesenchymal Flrt2 expression correspond to regions of mesenchymal Fgfr2 expression, which tends to be broadly expressed in the facial mesenchyme (Bachler and

Neubuser 2001), Fgf3 and Fgf17 are expressed in the epithelium lining the MNP (Bachler and

Neubuser 2001), above sites of Flrt2 and Fgfr2 expression. FGF3 and FGF17 are both able to bind FGFR2 (see table 1.1). If FLRT2 is able to bind FGFR2 in the MNP mesenchyme, FLRT2 may have a role in FGF3 or FGF17 signaling and have a role in EMI during development of the orofacial region. It is important to note that co-expression does not imply a physical interaction.

Binding assays and functional assays for modulating signaling would be required to substantiate

an interaction between the proteins.

Flrt3 in the Primary Palate FLRT3 may also have a role in outgrowth of the midfacial processes, the development of

which has been shown to be mediated by EMI. Flrt3 was found in the mesenchyme of the proximal region of the LNP extending along the outer nasal pit of the LNP laterally towards the

eye. In the MNP at 10.5 dpc, Flrt3 expression was situated in the mesenchyme along the oral

cavity and was less pronounced from that in the LNP.

Fgf8 is well documented to play a role in directing outgrowth of the LNP and MNP during embryogenesis (Richman and Tickle 1992; Richman and Lee 2003; MacDonald, Abbott et al. 2004). It is interesting to note that Flrt3 expression overlapped with sites of Fgf8 expression in the murine midface as shown in our study. Flrt3 has also been previously published in Xenopus and chick embryos to overlap with sites of Fgf8 expression (Bottcher,

Pollet et al. 2004; Smith and C. 2006). Fgfr1, the gene for the receptor for FGF8, has also been shown to be expressed in the epithelium of the midface (Bachler and Neubuser 2001). Thus,

FLRT3 could interact with FGFR1 to convey FGF8 triggered outgrowth and patterning of the

LNP and MNP via EMI.

Potential Role of FLRTs in CNCC outgrowth and differentiation

The expression of Flrt2 in the mesenchyme suggests that Flrt2 may contribute to the

promotion of outgrowth and differentiation of CNCC-derived mesenchymal tissues of the

midface. Examples of CNCC-derived tissues include bone, cartilage, and muscle. The role of

Flrt2 in chondrogenesis could be mediated via FGFs, as FGFs have previously been shown to

participate in chondrogenesis.

Moreover, Flrt2 expression was exclusive from sites of Msx1 expression in the midfacial

processes. Msx1 is related to Msx2, which has been shown to be a negative regulator of

chondrogenesis in migrating CNCCs (Takahashi, Nuckolls et al. 2001). As mentioned

previously, BMPs and FGFs appear to be expressed in regions exclusive of one another as well,

in areas like the primary and secondary palate. Since Msx genes are triggered by BMPs (Vainio,

Karavanova et al. 1993), and Flrt gene expression is triggered by FGFs (Haines, Wheldon et al.

2006), it is possible that regulation of regional and mutually exclusive expression patterns exist

between Flrt2 and Msx1.

Flrt2, as well as Flrt3, are expressed in sites that have been shown to exhibit FGF- mediated MAPK pathway activation/inhibition of chondrogenesis, which include the mandibular and frontonasal mesenchyme, and the limb mesenchyme (Bobick and Kulyk 2004; Bobick and

Kulyk 2006; Bobick, Thornhill et al. 2007). FLRT3 has been shown to modulate downstream

FGFR signaling and preferentially activate the MAPK pathway (Bottcher, Pollet et al. 2004).

Therefore, if FLRT2 and FLRT3 have roles in midfacial chondrogenesis, they may act through modulating downstream FGFR signaling.

Expression in the Secondary Palate

FLRTs may also have a role in the development of the secondary palate.

Flrt2 in the Secondary Palate Our data showed that Flrt2 was only expressed in the posterior part of the palatal shelves

(PS). More specifically, Flrt2 was expressed in mesenchymal cells adjacent to the epithelium of

the PS throughout secondary palatogenesis during vertical growth and fusion. Expression of

Flrt2 dissipated after PS fusion.

FGF10/FGFR2-IIIb also exhibit regional expression in the posterior secondary palate.

FGF10/FGFR2-IIIb signaling in the posterior palatal mesenchyme has been shown to be

essential for EMI by maintaining epithelial SHH expression (Rice, Spencer-Dene et al. 2004). As

Flrt2 has overlapping expression patterns with Fgf10, and Fgfr2-IIIb, especially adjacent to the

MEE, FLRT2 may participate in regional growth factor signaling via an interaction with FGFR2-

IIIb. However, it is important to note that although FGFR2 is co-expressed in the same areas in

FLRT2, and FLRT2 has been shown to bind FGFRs, FLRT2 may not necessarily participate in

FGF10/FGFR2-IIIb signaling. Further experimentation is needed to substantiate that claim.

Flrt3 in the Secondary Palate Our data showed Flrt3 was only expressed in the posterior part of the PS. Within PS, the expression of Flrt3 was unique from that of Flrt2. Flrt3 was found in the mesenchyme of the PS, but not the mesenchyme immediately below the epithelial layer where Flrt2 was expressed.

Expression of Flrt3 in the MEE dissipated after PS fusion. Similar to the pattern observed in the frontonasal processes, Flrt2 and Flrt3 expression regions did not appear to overlap in the PS, which further suggests gene-specific roles during development.

Other genes exhibit regional expression and are expressed in the posterior part of the secondary palate in the same regions as Flrt3. Flrt3 shares overlapping expression patterns in the epithelium with Fgf8 in published results (Smith and Tickle 2006). FGF8 signaling has been shown to be significant in the development of the posterior secondary palate (Peters, Neubuser et al. 1998; Xu, Weinstein et al. 1998; Yonei-Tamura, Endo et al. 1999; Rice, Spencer-Dene et al.

2004; Hilliard, Yu et al. 2005). The receptor for FGF8, FGFR1, is also expressed in the MEE

(Britto, Evans et al. 2002).

FGF8 is crucial for the induction of Pax9 expression (Hilliard, Yu et al. 2005) and Pax9 has an important role in secondary palatogenesis, as Pax9-deficient mice exhibit cleft of the secondary palate (Peters, Neubuser et al. 1998). Therefore, FLRT3 may bind an FGFR to mediate FGF8 signaling and triggering Pax9 expression.

Potential Roles of Flrt gene members in Secondary Palatogenesis

Cell Adhesion as a possible function of FLRTs Several lines of evidence mentioned previously suggest that FLRT3 has a role in cell-cell adhesion, and thus, could have a role in the induction, delamination, and migration of cranial

neural crest cells (CNCCs). During this process, Snail/Slug genes are down-regulated in neural

84 crest cells, and CNCCs undergo an epithelial-to-mesenchymal transition (EMT), followed by emigration from the neural tube. As mentioned previously, FLRT3 was thought to be responsible for restricting EMT in the anterior visceral endoderm during early embryonic development.

Consequently, the function of FLRTs could be to provide cellular stabilization to NCCs by limiting EMT in the surrounding non-neural crest cells. A suggested mechanism for this process may be via the homotypic cell adhesion properties that FLRTs are believed to possess, where

FLRTs could aid in stabilization of non-migratory cells.

EMT is postulated occur during the fusion of the secondary palatal shelves. Flrt3 was expressed in the medial edge epithelium (MEE) and dissipated post-fusion. Therefore, it is possible that Flrt3 provided adhesive properties between MEE cells of the PS and was down- regulated after the completion of MEE cells to mesenchymal cells. Similarly, Flrt2 was expressed in the mesenchyme adjacent to the MEE and could have provided structural stabilization of the underlying mesenchyme for EMT to occur.

Spatial Patterning as a possible function of FLRTs Since each member of the Flrt gene family has a unique expression pattern, each FLRT may be regulated by different mechanisms and have a unique role in spatial patterning during embryogenesis. Several different regulatory functions of each Flrt member can be proposed. As

Flrt2 and Flrt3 are expressed in different regions of various organs during development, they may provide specific patterning information to each organ. For example, the axis of Flrt2 expression appears to preferentially be on the medial versus lateral regions in the midfacial region, such as that observed in the nasal processes and the tooth (which will be discussed later).

Flrt3 did not appear to have a spatial pattern that would indicate a trend in axial expression, eg.

85 medial versus lateral regions, except that both Flrt2 and Flrt3 were expressed in the posterior portion of the secondary palate (discussed earlier).

FLRTs modulating FGF signaling specificity FGFR expression in the midfacial processes tended to be more broad, and less restricted than FGF expression (Wilke, Gubbels et al. 1997), so the expression of specific FLRTs may provide specificity for FGFR signaling. As a consequence, aggregation of FLRTs on the cell surface may allow critcal clustering of FGFRs to transduce FGF signaling intracellularly

(Goldstein and Perelson 1984; Chen and Moy 2000).

FLRT2 and FLRT3 have been shown to preferentially bind to particular FGFR isoforms and/or recruit specific intracellular downstream signaling molecules that aid in FGF signaling.

For example, FLRT3 has been shown to preferentially trigger the MAPK pathway, not the

PI(3)K pathway, in Xenopus embryos (Bottcher, Pollet et al. 2004). In addition, each FLRT could be able to trigger the expression of different sets of genes downstream of FGFR activation.

FLRTs possibly acting through the TGFβ signaling pathway FLRTs may not be limited to FGF signaling during secondary palate development. Flrt3-

/- murine embryos display disorganized basement membrane in the anterior visceral endoderm

(AVE) region prior to gastrulation (Egea, Erlacher et al. 2008). Subsequently, adjacent anterior epiblast (or primary ectoderm) cells displayed an epithelial-to-mesenchymal transition (EMT)- like process (Egea, Erlacher et al. 2008). This EMT-like process was characterized by the loss of cell polarity, cell ingression, and the up-regulation of EMT and mesodermal marker genes, such as Fgf8, which eventually becomes limited to the epithelium after gastrulation. As Fgf8 was upregulated despite Flrt3 expression, it is possible that FLRT3 can act independent of the FGF

86 signaling pathway to restrict EMT and mesoderm induction to the posterior epiblast (Egea,

Erlacher et al. 2008).

Flrt3 has been shown previously to mediate deadhesion of blastocoel cells in Xenopus embryos via the TGFβ signaling pathway, as over-expression of Flrt3 using mRNA microinjected into Xenopus embryos caused de-adhesion of blastocoel roof cells from neighbouring cells (Ogata, Morokuma et al. 2007). This effect could not be rescued with addition of activin (Ogata, Morokuma et al. 2007). Members of the TGFβ signaling pathway, have been shown to be expressed in the secondary palate and are also essential for PS development and fusion (Britto, Evans et al. 2002; Hilliard, Yu et al. 2005). TGFβ3 is an essential player in mediating adherence of apposing epithelia of the PS and subsequent confluence of the epithelial seam by EMT (Kaartinen, Cui et al. 1997). TGFβ3 is strongly expressed in the palatal epithelium, including the MEE, before fusion (Pelton, Hogan et al.

1990), which corresponds to Flrt3 expression in the MEE. Flrt3 expression in the MEE dissipated after mesenchymal confluence, which hints that Flrt3 may be involved in the fusion of the PS.

Unlike FLRT3, neither FLRT1 or FLRT2 were shown to be direct targets of activin in

Xenopus gastrulation (Ogata, Morokuma et al. 2007), and therefore they may not aid in TGFβ signaling-mediated development of the secondary palate. Instead, the function of FLRT2 may remain in the FGF signaling cascade. FGF10 is expressed in the posterior secondary palatal mesenchyme (Rice, Spencer-Dene et al. 2004) along with Flrt2. FGF10 has also been shown to be necessary for the survival of MEE cells and for Tgfβ3 expression in the palatal epithelium during secondary palatogenesis (Alappat, Zhang et al. 2005). Thus, it is possible that FLRT2 aids

87 in the FGFR2-IIIb/FGF10 interaction, while FLRT3 may participate in TGFβ3 signaling in the secondary palate in an unknown fashion.

Expression during Vomeronasal Organ development

Flrt2 in the VNO From 10.5 dpc to 11.5 dpc, a restricted portion of the inner nasal pit epithelium of the

MNP expressed Flrt2. From 13.5 to 15.5 dpc, Flrt2 is expressed on the concave side of the VNO

when it becomes a kidney-shaped structure at the base of the nasal septum.

The expression pattern of Flrt2 suggests that this gene may be involved in VNO

development. Perhaps, Flrt2 is involved patterning of the VNO to allow proper development, as

Flrt2 was only expressed on the concave portion of the VNO. FGF signaling has been shown to be significant in VNO morphogenesis (Kawauchi, Shou et al. 2005), which may consequently require Flrt2 to modulate downstream events of FGFR signaling activation. Potential FGF ligand candidates for FGFR1 and FGFR2 include Fgf3 and Fgf17, as both FGFs are expressed in

similar epithelial regions of the MNP as Flrt2 (Bachler and Neubuser 2001).

Flrt3 in the VNO In contrast, the expression pattern of Flrt3 does not infer involvement in VNO

development. At 12.5 dpc, Flrt3 was expressed in the oral mesenchyme adjacent to the oral

epithelium, as well as the MxP and a portion of the LNP near to the nasal pit.

Expression in the Tooth

Flrt2 in the Tooth Expression of Flrt2 and Flrt3 was detected in distinct and mutually exclusive regions of

the developing tooth bud. Flrt2 expression was found in the basement membrane and outer

enamel epithelium of the developing tooth bud at 14.5 dpc with preferential expression on the

88 medial side of all tooth buds, suggesting that Flrt2 may have a role in development and spatial patterning of the tooth bud.

FGFs and their receptors are expressed in restricted regions of the developing tooth bud.

(Jernvall, Kettunen et al. 1994; Thesleff and Sharpe 1997; Bei and Maas 1998; Thesleff and

Aberg 1999; Cobourne and Sharpe 2003; Jackman, Draper et al. 2004). Several FGFs have been shown to be expressed in different regions of the developing tooth bud, including Fgf8 in the dental lamina, Fgf4 in the enamel knot, and Fgf10 in the dental mesenchyme (Jernvall, Kettunen et al. 1994; Thesleff and Sharpe 1997; Bei and Maas 1998; Thesleff and Aberg 1999; Cobourne and Sharpe 2003; Jackman, Draper et al. 2004).

The expression pattern of Flrt2 implicates a unique role in the odontogenic regions.

Based on the expression pattern, Flrt2 may be responsible for relaying FGF signaling from the stellate reticulum or the enamel knot, which secretes several growth factors. FGFR1-IIIb/-IIIc and FGFR2-IIIb/-IIIc are also expressed in similar sites as Flrt2, including the outer enamel epithelium at cap stage (Developmental Biology Programme of the University of Helsinki 1996;

Päivi Kettunen 1998), and could bind FLRT2 to signal in response to secreted FGFs from these sites.

Flrt3 in the Tooth Fgf8, which is responsible for tooth initiation from bud to bell stage, is expressed in the oral epithelium (Developmental Biology Programme of the University of Helsinki 1996) in overlapping regions as Flrt3. Therefore, it is possible that FLRT3 binds FGFR1 in odontogenic regions upon FGF8 binding.

Post- tooth initiation, Flrt3 was expressed at the same time as Flrt2 in the tooth bud and cap stages, but did not appear to overlap in expression regions. Flrt3 was expressed in the oral

89 and dental epithelium and the primary enamel knot, and may have a critical role in the coordination of signaling events that occurs in the enamel knot. Although FGFs are secreted from the enamel knot, there has not been any documentation of FGFR expression in the enamel knot, which is one of the causes for the lack of proliferative capabilities in the enamel knot

(Developmental Biology Programme of the University of Helsinki 1996; Kettunen, Karavanova et al. 1998). Consequently, it is possible that FLRT3 acts independently of FGF signaling in the enamel knot, but aids in FGF signaling in the dental epithelium.

Expression in the Hair Follicles

Flrt2 in the Hair Follicles It is also possible that FLRT2 participates in the FGF10/FGFR2-IIIb interaction during

hair placode formation since Flrt2 was detected in the hair follicle placodes at 12.5 dpc. FGFR2-

IIIb is expressed in the basal keratinocyte layer and its signaling has been suggested to promote

keratinocyte differentiation to initiate hair placode formation (Petiot, Conti et al. 2003). FGF10

is expressed in the mesenchymal cells underneath the future whisker placodes, and in the

surrounding mesenchyme of developing whiskers (Ohuchi, Tao et al. 2003), which mimics Flrt2

expression in this region. Thus, FLRT2, which is also expressed similarly to FGFR2-IIIb, could

interact with FLRT2 in response to FGF10 secretion.

At 14.5 dpc, Flrt2 gene expression was detected in the inner root sheath (IRS) of the

developing hair follicle. The inner root sheath (IRS) surrounds the hair matrix to protect the hair

fiber as it grows in the dermis. Cells in the periphery of the matrix proliferate, differentiate, and

keratinize to become the IRS. FGF signaling has been shown to be involved in hair follicle

patterning and development (Hardy 1992; Rosenquist and Martin 1996) and FLRTs may act via

FGFRs to mediate downstream FGF signaling. FGFR2 is expressed in the same regions as

FLRT2, which is expressed in the IRS of the hair follicle (Nakatake, Hoshikawa et al. 2001).

Consequently, FLRT2 may interact with FGFR2 in response to its ligand, FGF22, which is also expressed in the IRS of the hair follicle (Nakatake, Hoshikawa et al. 2001).

Flrt3 in the Hair Follicles Flrt2 gene expression was detected in the inner root sheath (IRS) of the hair follicle, whereas Flrt3 was expressed in mesenchymal cells of the matrix. This trend is consistent with observations in other tissues where Flrt2 and Flrt3 display unique and restricted expression patterns. Thus, these genes may also have spatially distinct roles and gene expression regulation in response to growth factor signaling.

Flrt3 was expressed in the cortex of the developing hair follicle. The matrix is located in the centre of the hair follicle, surrounding the papilla. Matrix cells generate the hair fibre. FGFR2 has been detected in the hair matrix, and its ligands FGF2 and FGF7 have been detected in the hair matrix and dermal papilla respectively (Rosenquist and Martin 1996). Therefore, FLRT3 could bind FGFR2 in the hair matrix and modulate binding of FGF2, or to FGF7 generated in the dermal papilla in the centre of the hair follicle. This trend could be similar to the FLRT3-FGFR function in the enamel knot of the tooth bud suggested earlier.

Limitations to ISH

There are inherent limitations in the methods used in this study. In situ hybridization

(ISH) was used to visualize the tissue expression patterns of RNA in this study. ISH is based on

annealing of a labeled nucleic acid probe to complementary sequences in fixed tissues. This

allows localization of the target RNA within tissues or cells. To ensure that the results obtained

truly reflect the distribution of target RNA, it is essential that samples are prepared and stored

appropriately.

In order to detect specific expression in tissues, sample preservation is essential. RNA should be intact for probe hybridization, but cross-linking fixatives, such as formaldehyde, result in degradation of RNA with extended fixing time (Jacobson 2007). Methanol, a precipitating fixative, is better for maintaining intact nucleic acid but may increase non-specific binding i.e. higher background (Morel and Cavalier 2001). In this study, embryos were treated with paraformaldehyde for a limited period of time, then either kept in methanol for whole mount ISH or embedded in OCT for cryo-sectioning.

Pretreatment of tissues is used to increase target accessibility and decrease background.

For example, in whole mount ISH, embryos are mildly treated with proteinase K, which will degrade proteins in the embryo to allow penetration of the probe. It is important to note that as embryonic age increases and the epithelium thickens (past 11.5 dpc), proteinase K is no longer effective for thorough probe penetration with whole mount ISH.

In addition, increasing the stringency of the washes can decrease background signal. For instance, increasing the duration and frequency of washes, temperature, and concentration of hybridization solutions, i.e. sodium ions and formamide, will increase the stringency (Jacobson

2007). During my experiments, I used the concentrations of solutions recommended, as well as the duration and frequency of washes. I used a temperature of 65oC to increase the stringency

during washes.

In situ hybridization in this thesis involved the visualization of a riboprobe, which

contained DIG-labeled nucleotides. The riboprobe was detected using an anti-DIG antibody

conjugated to peroxidase. When using an anti-DIG antibody conjugated to alkaline phosphatase,

a colourimetric reaction occurs upon addition of a substrate, 5-bromo-4-chloro-3-indolyl

phosphate-nitro blue tetrazolium salt (BCIP-NBT), in tissues where the gene expression occurs.

Light microscopy was used to detect the colourimetric reaction. Limits in sensitivity occur when using light microscopy due to the limits of visual detection. Using fluorophore-labeled antibodies and fluorescence microscopy allows a more sensitive visualization. Detection of a radioisotope- labeled probe is accomplished through radiography and is also more sensitive to detect lower levels of mRNA expression. Fluorescent microscopy is a more light sensitive procedure, and radiography requires careful use of radioactive isotopes. Therefore, light microscopy was chosen for these experiments.

Since ISH involves a visual observation of gene expression, ISH cannot be used to quantitatively compare expression of different genes, and gene expression cannot be compared between experiments. It is possible to semi-quantitatively compare the expression of a particular mRNA between different sections of the same sample, provided that gene expression is analyzed within the same experiment.

Protein expression pattern

Similarities exist between Flrt2 mRNA and protein expression in sites such as the tooth

(compare figures 3.14A and 3.18A, C) and hair follicles (compare figures 3.14C and 3.18D) at

14.5 dpc. However, serious discrepancies are evident when comparing Flrt2 mRNA and protein

expression in the oral mesenchyme/epithelium (compare figures 3.11A and 3.18D), the fusion

site between the MNP and MXP (compare figures 3.10A and 3.16C/3.17C), and the nasal

epithelium (compare figures 3.10A and 3.16B).

Typically in expression studies, both protein and mRNA expression patterns are

analyzed. This is because protein may not necessarily be expressed although mRNA is present.

Further, following biosynthesis, proteins can be localized to specific regions of a cell or can be secreted and diffuse to other areas where they interact with cells other than those that made them, or become stored in the extracellular matrix. For example, transmembrane proteins, such as FLRTs, while formed within the endoplasmic reticulum of a cell’s cytoplasm, are inserted into the plasma membrane, and will therefore become localized to that region of the cells that synthesize them. FGFs are secreted and can be localized in areas some distance from where they were synthesized.

This thesis utilized immunohistochemistry (IHC) to provide information on the localization of FLRTs. IHC is a process of localizing a specific protein to a specific location within cells or the extracellular matrix of a tissue. It works by the detection of the protein of interest using a specific antibody (primary antibody). This antibody binds to the protein of interest and the location of the bound antibody can be detected through the use of various detection methods. The most common approach to detecting the primary antibody-protein complex is through the use of secondary antibodies, which bind to antibodies that match the immunoglobulin type and species of the primary antibody. The secondary antibodies are conjugated to an enzyme, such as peroxidase, or to a fluorophore, which permits their detection, and the detection of the secondary antibody-primary antibody-protein complex, and thus marks the location of the protein of interest. In this study, we used a method involving biotin-labeled goat anti-rabbit IgG as the secondary antibody. Biotin has a strong affinity for avidin, which is conjugated to peroxidase. The substrate, diaminobenzidine (DAB), is then added and reacts with peroxidase to generate a colorimetric reaction.

A measure to reduce background includes quenching endogenous peroxidase activity by treating sections with dilute hydrogen peroxide prior to signal amplification and detection by

94 addition of DAB. Other steps to reduce background, but were not employed in this study include, addition of levamisole to the substrate solution if alkaline phosphatase activity is present in the tissue section. An avidin/biotin blocking step may also be employed if tissues contain endogenous biotinylated proteins.

IHC requires an antibody generated against the protein, which will work in the appropriate species. Ideally, this antibody is specific to the protein of interest and does not cross react with related (or unrelated) proteins. The rabbit anti-mouse FLRT2 antibody used in this study was a gift from Dr. Kunkel and was used in the first paper on the discovery of the FLRT family (Lacy, Bonnemann et al. 1999). These antibodies directed against FLRT2 were generated by injection of the synthetic peptide in the extracellular domain (near the region of the FNIII domain) CDWDGRERVTPPISERIQ linked to keyhole limpet hemocyanin (KLH), which acts as a carrier for the peptide and stimulates an immune response to the immunogen. The peptide-

KLH conjugate was then injected into female NZW rabbits to induce an immune response, which generated the rabbit anti-mouse FLRT2 antibodies.

At the time of this study, an antibody for FLRT3 was not available, so it was not possible to examine the FLRT3 protein expression.

Although the developmental time of expression and areas of expression were similar between FLRT2 protein as shown by IHC and RNA expression, there were key differences between the two that resulted in a cessation of the investigation of FLRT protein expression with the use of the FLRT2 antibody employed in this study.

The most significant problem was that IHC results indicated that FLRT2 was localized to the nucleus, whereas the literature has shown that FLRTs are transmembrane proteins. In addition, FLRT2 protein was detected in some areas that the ISH results did not detect Flrt2

95 mRNA, such as the fusion point between the MxP and MNP and the nasal epithelium, but was not expressed some areas shown in the ISH results, such as the MNP mesenchyme.

To examine this further, I conducted some IHC using a fluorophore-labeled secondary antibody. When using the fluorophore fluoroscein (FITC)-label, FLRT2 protein was localized to areas of expression similar to that seen using the DIG-labeled antibodies, such as the fusion point between the MxP and MNP. However, using the FITC label, FLRT2 did not display nuclear expression, but was localized to the plasma membrane expression (results not shown). Sections stained using a fluorescently-labeled secondary antibody exhibited autofluorescence, and efforts to quench the autofluorescence were unsuccessful, and thus, it was not possible to clearly distinguish between specific FITC staining of FLRT2 and non-specific autofluorescence and so

FITC staining was not included in the results.

One possible explanation for these discrepancies is that the murine FLRT2 antibody that we received was not suitable for section IHC, as the original paper describing it used the antibody for Western blot (Lacy, Bonnemann et al. 1999). Currently, there are no papers that have explored FLRT2 protein expression using immunostaining, and therefore, my results cannot be compared to other published results. Alternatively, it is possible that the antibody cross- reacted with other non-FLRT proteins. However, a BLAST search against the peptide sequence used to generate the FLRT2 antibody was highly specific to FLRT2.

In order to test the specificity of the FLRT2 antibody, the antibody can be blocked using

FLRT2 protein prior to its use in binding in section IHC. If the antibody still demonstrates binding, and reveals a signal, then the FLRT2 antibody was not specific. Alternatively, if no signal is detected, this indicates that the antibody was specific to murine FLRT2.

Another possible reason for the staining of FLRT2 in the epithelium, while its mRNA was not detected by ISH is that Flrt2 mRNA was expressed in the epithelium at the fusion between the MNP and MxP at lower levels than the MNP mesenchyme and was not deemed more significant than the background, or that FLRT2 was expressed earlier in the epithelium, but was down-regulated, however the protein already present in the cell membranes remained.

In order to test the half life of FLRT2, a pulse-chase analysis may be conducted to determine how long FLRT2 is found within cells before it is degraded (Takahashi and Ono

2003). A radioactively-labeled methionine (the pulse) can be added to cell extracts to label

FLRT2. Soon after, excess of unlabeled methionine (the chase) is then added. This allows one to follow the labeled FLRT2 and determine the time that is required for radioactivity to dissipate.

In summary, ISH and IHC results overlap in some areas, such as the hair follicles and tooth bud, but do not agree in other areas, such as the MNP mesenchyme, oral epithelium, and nuclear expression in the nasal epithelium.

The initial assumption was that the primary antibody was specific to FLRT2, and would not also detect non-FLRT proteins. Therefore these results should be taken into consideration when determining the tissues where FLRT2 may function as the possibility exists that there may be a temporal or regulatory mechanism that has not been accounted for. However, in order to make a definitive conclusion, a more in depth study should be directed towards not only FLRT2, but FLRT1 and FLRT3, now that commercially available antibodies are available for murine

FLRTs.

Experimental Controls

In situ Hybridization In order to generate a properly controlled experiment, both sense and antisense

riboprobes should be conducted in the same experiment. As well, a no probe control is necessary.

In cases, such as Msx1, where the sense strand also displays a pattern of expression, a riboprobe containing a known non-coding region may be used. For a positive control, a riboprobe that has been shown to work and demonstrates the known patterns of expression should be used. In this case, Fgf8 was used as a positive control, as its expression pattern is well documented.

Colorimetric reactions for control experiments should be ceased at the same time as the experimental probe.

In this thesis, sense probes for Flrt genes and Fgf8 were conducted, but not for Msx genes. The no-probe control was also conducted. All control reactions did not display specific staining, as expected.

Immunohistochemistry Particular controls for immunohistochemistry are required for an experiment. First, the no primary antibody control is required to determine whether the pattern that is seen is not due to the reagents. Next, a positive control is needed. Once again, a primary antibody that is used should have been shown to work previously in the lab, and should detect the expression of a protein whose pattern has been detailed previously (e.g. anti-FGF8).

In this thesis, the no-primary antibody control was conducted and did not display specific signals. However, the detection of another known protein was not conducted.

FUTURE DIRECTIONS

To date, the biological function and mode of functionality of FLRTs remains unknown.

My thesis has investigated the gene expression patterns of Flrt1, Flrt2 and Flrt3 in the

developing craniofacial region of the murine embryo. However, questions regarding FLRTs such

as control of gene expression, protein expression pattern, how FLRTs function, and what

signaling pathways and developmental processes FLRTs aid in, are topics for further exploration.

Investigation of the different roles of FLRT2 and FLRT3

Flrt1 was not expressed in a restricted pattern in the craniofacial region, which suggests that FLRT1 may not have a unique role in specific areas of the midface. However, Flrt2 and

Flrt3 do appear to be expressed in a restricted pattern and are found in the same areas during facial development, but in complementary locations (i.e. FLRT2 is in the mesenchyme, while

FLRT3 is in the overlying epithelium.

This observation suggests that individual FLRTs may have the potential to select which specific genes are expressed after growth factor receptor activation, i.e. the subset of genes

activated may differ when the same receptor is stimulated by the same FGF depending on

whether FLRT2 or FLRT3 is part of the complex. In order to explore this possibility, a

microarray experiment would be performed using RNA extracted from the midfacial processes

of Flrt2 and Flrt3 RNAi-treated and wild-type mice. These RNAi-treated mice would be

Flrt2/Flrt3 knock-down mice generated by tail injections (for the tail injection technique, see

Gratsch, DeBoer et al. 2003). Gene expression patterns would be compared between control and

the experimental tissues. The genes that are not upregulated in the experimental tissues are likely

to be triggered downstream of FGF signaling involving FLRTs. It is important to note that since

these animals are not knock-out mice, the results from the microarray experiment may not be

99 sensitive enough to detect gene expression changes that would be more greatly affected by comparing knock-out to wild-type mice.

Recently, a Flrt3-/- mouse line has become available (Egea, Erlacher et al. 2008;

Maretto, Müller et al. 2008). However, this model is not useful for studying Flrt3 in craniofacial development as Flrt3-/- embryos are embryonic lethal and do not survive beyond 5.5dpc (Egea,

Erlacher et al. 2008).

Proposed studies to investigate the effect of FLRTs on FGF signaling

Investigating the genetic interaction between Flrts and members of the Fgf signaling family A genetic interaction between FGF ligands and FLRTs may exist, where Flrt expression

is stimulated by FGF signaling, and targets of FGF signaling appear to be dependent on Flrt

expression. To investigate this interaction, manipulation of midfacial explants could provide

some insight. Such an experiment would be conducted by treating tissue explants isolated from

the craniofacial region of embryos various FGFs then assessing the expression of Flrt genes

either using ISH, Northern blot, or quantitative RT-PCR to determine which genes are affected by FLRT-mediated FGF signaling (for an example of see Firnberg and Neubuser 2002).

Alternately, FGF mutant embryos can be used for ISH to determine whether Flrt gene

expression has been altered by changes in FGF/FGFR signaling required during development.

Similarly, Flrt mutants could be used to determine whether Fgf expression has been changed.

Since Flrt1 and Flrt2 mutants are not available, and Flrt3 knock-outs are embryonic lethal prior

to craniofacial development, tail injections of RNAi in pregnant mice could also be used (for a

review of such methodoloy, see Wolfe and Budker 2005). However, caution has to be taken

when using RNAi as this method is only a knock-down, not knock-out of gene expression. One

of the reasons for using caution in the case of knock-down mutants is because gene expression

100 still occurs, although at a lower level. This lowered level may still be above the threshold amount required to trigger downstream signaling modification, and therefore, this reaction would not be detected by knock-down mutant experimentation.

Investigating FLRT binding partners As mentioned previously, there is an overlap in gene expression patterns between Flrt3 and Fgf8 and between Flrt2 and Fgf10. Both FGF8 and FGF10 are significant players in EMI during the development of the midface, and it has been suggested that FLRTs mediate their signaling via an interaction with FGFRs. Thus far, it has not been determined whether FLRTs directly interact with FGFRs or whether both are in the signaling complex but do not bind directly to one another.

In order to distinguish between these two possibilities, an immunoprecipitation assay may be conducted. 3’ hemagglutinin (HA)-tagged FLRTs could be used to bind its cognate receptor(s) in whole-embryo lysates. Then after cross-linking the proteins, an anti-HA antibody would be used to immunoprecipitate the HA-FLRT-receptor complexes. Binding partners for

FLRTs would be determined using SDS-PAGE and mass spectrometry.

Another method to determine what other proteins may be involved in this complex would be to use a cell surface binding screen (similar to this recent publication on FLRT3, Karaulanov,

Böttcher et al. 2009). Pools of approximately 250 clones prepared from a mouse embryonic cDNA expression library would be transfected in HEK293T cells. Two days later, the cells would be incubated with a soluble alkaline-phosphatase-FLRT3 ectodomain fusion protein (AP-

FLRT3ΔTM). The TM domain would be deleted to ensure the solubility of this fusion protein.

Then, proteins that interacted with FLRT3 would be screened using a chromogenic assay

(development of colour upon addition of NBT-BCIP) for cell surface bound AP activity.

101

FLRTs have been shown to have a binding preference in FGFR isoform. Haines et al.

(2006) demonstrated that FLRT3 did not bind to FGFR1 as well as FLRT2 and FLRT1. In order to accomplish this, precipitation using a column coated with purified FLRT protein and running all of the seven FGFR isoforms through the column would be conducted. Then relative quantities of each isoform found in the eluate would be determined.

Another method to detect protein-protein interactions is the yeast two-hybrid system

(Y2H). The Y2H system involves binding the DNA-binding domain (BD) of a transcription factor to the protein of interest and the activation domain (AD) of that transcription factor to the bait protein. If the protein of interest, a FLRT protein, interacts with the bait protein, for example

FGFR1, the BD and AD will be in proximity and will transcribe the reporter gene. Several AD- bait protein yeast constructs are required. The Y2H system has a high rate of false positives, and therefore, other protein-protein interaction assays, such as immunoblotting, are required.

When identifying FLRT interacting partners, previously published binding partners may serve as a positive control for an immunoprecipitation experiment. FLRT1/2/3 have been shown to bind to FGFR1 (Bottcher, Pollet et al. 2004; Haines, Wheldon et al. 2006) and FLRT2 has been shown to bind FGFR2 (Wei and Gong, unpublished). As well, Rnd1 has been shown to bind FLRT3 (Ogata, Morokuma et al. 2007). FGFR1 and FGFR2 are the only two FGFRs expressed in the midfacial prominences (Wilke, Gubbels et al. 1997), suggesting that they would be good candidates to test as AD-bait proteins.

Investigating FLRT modulation of FGF signaling How FLRTs function in FGF signaling has yet to be clarified. Researchers have shown that FLRT3 modulates FGF signaling by preferentially activating the MAPK pathway, although

FGF signaling is also able to activate the PI(3)K pathway. In some situations, it is also possible

102 that FLRT3 acts independently of the FGF signaling pathway during morphogenesis. FLRT2 may also serve a similar purpose, but it is possible that FLRT2 may alternatively allow the preferential activation of the PI(3)K pathway instead.

In order to determine whether FLRT2 activates the MAPK pathway, an experiment akin to that performed using Xenopus embryos in the Bottcher et al. (2004) paper should be conducted. If upon addition of Flrt2 cDNA, phospho-ERK levels are higher than in the untreated control embryos, this result suggests that FLRT2 activates the MAPK pathway.

Proposed studies to investigate the role of FLRTs in EMI

Experiments involving Flrt gene expression Given the gene expression pattern of Flrt2 and Flrt3, FLRTs may be involved in key

developmental processes, such as EMI. Also, Haines et al (2006) demonstrated that addition of

FGF2 to cell culture induced expression of Flrt genes. In order to investigate this possibility,

initial experiments could be designed to determine which if any of the FGF ligands are

responsible for activation of Flrt gene expression. As Flrt2 is expressed in the mesenchyme of

the MNP, its expression may depend on FGF expression in the overlying epithelium.

This theory could be tested using FGF-coated beads applied to an explant of MNP

mesenchyme (for an example of similar experiments see Firnberg and Neubuser 2002). Briefly,

dissection of nasal explants involves excising a portion of the midface, resulting in an explant

initially consisting of ectoderm, mesenchyme, and brain tissue. After incubation in a mild

protease, the brain, and as required also the ectoderm, may be removed. Explants consisting of

ectoderm and mesenchyme, mesenchyme alone, or mesenchyme, on which beads soaked in

recombinant FGFs or PBS (negative control) were placed, would then be cultured (Firnberg and

Neubuser 2002). The expression of Flrt2 in the mesenchymal explants could then be monitored.

103

The same experiment using mesenchymal explants can be repeated for Flrt3 to determine whether Flrt3 also participates in EMI and which specific FGF ligand induces Flrt3 gene expression. Assuming that FLRTs do play a role in EMI, the addition of specific FGF-coated beads would result in expression of Flrts in the underlying mesenchyme if Flrt expression is downstream of FGF stimulation. In contrast, if Flrt expression is upstream of FGF stimulation,

Flrt expression would not be observed in these mesenchymal explants.

Experiments involving FLRT protein expression Although the gene and protein expression pattern for FLRT2 was defined in this study, it is unknown why the two expression patterns do not fully correspond to one another. As noted above, gene and protein expression patterns may not overlap because proteins are not necessarily made even though transcripts are available, or that the sensitivity of one method is greater than the other, or the antibody or ISH probes were non-specific.

Since completion of my experiments, specific antibodies for murine FLRT2 and FLRT3 have been made commercially available at RnD systems. Therefore, these antibodies could be used to confirm the ISH findings.

Co-localization studies of other proteins of interest, eg. FGFR2 can also be performed to determine whether FLRTs are co-expressed with these proteins.

104

CONCLUSION

The pattern of Flrt1, Flrt2 and Flrt3 gene expression is only now being discovered but

their functions in the development of several sites within the embryo are still largely unknown.

Flrt1 was expressed in a broad pattern in the craniofacial region, which suggests that FLRT1 may have overlapping roles with FLRT2 and/or FLRT3 in those areas. However, Flrt2 and Flrt3 appear to be expressed in the same areas of the developing embryo, but appear to have both overlapping and non-overlapping regions of expression. This suggests that individual FLRTs may have unique functions and/or differentially trigger the expression of a subset of genes downstream of FGFR activation. The unique expression patterns of Flrt2 and Flrt3 suggest that they have an essential role during murine craniofacial embryogenesis, which may include participating in spatial patterning, morphogenesis, and EMI. Further experimentation should focus on FLRT function and mechanism of action. Whatever the precise function is, one can speculate that, akin to their gene expression patterns, FLRT2 and FLRT3 are likely to have specific functions in communicating growth factor signaling interactions between the epithelium and mesenchyme.

105

REFERENCES

Abzhanov, A., D. R. Cordero, et al. (2007). "Cross-regulatory interactions between Fgf8 and Shh in the avian frontonasal prominence." Congenital Anomalies 47(4): 136-148. Abzhanov, A. and C. J. Tabin (2004). "Shh and Fgf8 act synergistically to drive cartilage outgrowth during cranial development." Developmental Biology 273(1): 134-148. Alappat, S., Z. Y. Zhang, et al. (2003). "Msx homeobox gene family and craniofacial development." Cell Res 13(6): 429-442. Alappat, S. R., Z. Zhang, et al. (2005). "The cellular and molecular etiology of the cleft secondary palate in Fgf10 mutant mice." Developmental Biology 277(1): 102-113. Bachler, M. and A. Neubuser (2001). "Expression of members of the Fgf family and their receptors during midfacial development." Mechanisms of Development 100(2): 313-316. Barlow, A. J. and P. H. Francis-West (1997). "Ectopic application of recombinant BMP-2 and BMP-4 can change patterning of developing chick facial primordia." Development 124(2): 391-398. Bei, M. and R. Maas (1998). "FGFs and BMP4 induce both Msx1-independent and Msx1- dependent signaling pathways in early tooth development." Development 125(21): 4325- 4333. Bennett, J. H., P. Hunt, et al. (1995). "Bone morphogenetic protein-2 and -4 expression during murine orofacial development." Archives of Oral Biology 40(9): 847-854. Bobick, B. E. and W. M. Kulyk (2004). "The MEK-ERK Signaling Pathway Is a Negative Regulator of Cartilage-specific Gene Expression in Embryonic Limb Mesenchyme." Journal of Biological Chemistry 279(6): 4588-4595. Bobick, B. E. and W. M. Kulyk (2006). "MEK-ERK signaling plays diverse roles in the regulation of facial chondrogenesis." Experimental Cell Research 312(7): 1079-1092. Bobick, B. E., T. M. Thornhill, et al. (2007). "Fibroblast growth factors 2, 4, and 8 exert both negative and positive effects on limb, frontonasal, and mandibular chondrogenesis via MEK-ERK activation." Journal of Cellular Physiology 211(1): 233-243. Bottcher, R. T., N. Pollet, et al. (2004). "The transmembrane protein XFLRT3 forms a complex with FGF receptors and promotes FGF signalling." Nat Cell Biol 6(1): 38-44. Brennan, J., C. C. Lu, et al. (2001). "Nodal signalling in the epiblast patterns the early mouse embryo." Nature 411(6840): 965-969. Britto, J. A., R. D. Evans, et al. (2002). "Toward Pathogenesis of Apert Cleft Palate: FGF, FGFR, and TGFβ Genes Are Differentially Expressed in Sequential Stages of Human Palatal Shelf Fusion." Cleft Palate Craniofac J. 39(3): 8. Bronner-Fraser, M. (1994). "Neural crest cell formation and migration in the developing embryo." FASEB J 8(10): 7. Brugmann, S. A., M. D. Tapadia, et al. (2006). The Molecular Origins of Species-Specific Facial Pattern. Current Topics in Developmental Biology, Academic Press. Volume 73: 1-42. Buchanan, S. G. S. C. and N. J. Gay (1996). "Structural and functional diversity in the leucine- rich repeat family of proteins." Progress in Biophysics and Molecular Biology 65(1-2): 1- 44. Burstyn-Cohen, T., J. Stanleigh, et al. (2004). "Canonical Wnt activity regulates trunk neural crest delamination linking BMP/noggin signaling with G1/S transition." Development 131: 12.

106

Canning, C., L. Lee, et al. (2007). "Sustained interactive Wnt and Fgf signaling is required to maintain isthmic identity." Developmental Biology 305(1): 10. Cano, A., M. Perez-Moreno, et al. (2000). "The transcription factor snail controls epithelial mesenchymal transitions by repressing E-cadherin expression." Nat Cell Biol 2(2): 76– 83. Chai, Y., X. Jiang, et al. (2000). "Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis." Development 127: 8. Chai, Y., J. Maxson, et al. (2006). "Recent advances in craniofacial morphogenesis." Developmental Dynamics 235(9): 2353-2375. Chellaiah, A. T., D. G. McEwen, et al. (1994). "Fibroblast growth factor receptor (FGFR) 3. Alternative splicing in immunoglobulin-like domain III creates a receptor highly specific for acidic FGF/FGF-1." Journal of Biological Chemistry 269(15): 11620-11627. Chen, A. and V. T. Moy (2000). "Cross-Linking of Cell Surface Receptors Enhances Cooperativity of Molecular Adhesion." Biophysical Journal 78(6): 2814-2820. Chisaka, O. and M. Capecchi (1991). "Regionally restricted developmental defects resulting from targeted disruption of the mouse homeobox gene hox-1.5." Nature 350(6318): 6. Cobourne, M. T. and P. T. Sharpe (2003). "Tooth and jaw: molecular mechanisms of patterning in the first branchial arch." Archives of Oral Biology 48(1): 1-14. Colberg-Poley, A. M., S. D. Voss, et al. (1985). "Clustered homeo boxes are differentially expressed during murine development." Cell 43(1): 6. Collignon, J., I. Varlet, et al. (1996). "Relationship between asymmetric nodal expression and the direction of embryonic turning." Nature 381(6578): 155-158. Couly, G., S. Creuzet, et al. (2002). "Interactions between Hox-negative cephalic neural crest cells and the foregut endoderm in patterning the facial skeleton in the vertebrate head." Development 129(4): 1061-1073. Couly, G. F. and N. M. Le Douarin (1985). "Mapping of the early neural primordium in quail- chick chimeras : I. Developmental relationships between placodes, facial ectoderm, and prosencephalon." Developmental Biology 110(2): 422-439. Coutts, J. and J. Gallagher (1995). "Receptors for fibroblast growth factors." Immunoloy and Cell Biology 73(6): 5. Creuzet, S., G. Couly, et al. (2005). "Patterning the neural crest derivatives during development of the vertebrate head: insights from avian studies." Journal of Anatomy 207(5): 447-459. Creuzet, S., G. Couly, et al. (2002). "Negative effect of Hox gene expression on the development of the neural crest-derived facial skeleton." Development 129(18): 4301-4313. Creuzet, S., B. Schuler, et al. (2004). "From the Cover: Reciprocal relationships between Fgf8 and neural crest cells in facial and forebrain development." Proceedings of the National Academy of Sciences of the United States of America 101(14): 4843-4847. Cuervo, R. and L. Covarrubias (2004). "Death is the major fate of medial edge epithelial cells and the cause of basal lamina degradation during palatogenesis." Development 131(1): 15-24. Damian LaGamba, A. N. E. D. H. (2005). "Microarray analysis of gene expression during epithelial-mesenchymal transformation." Developmental Dynamics 234(1): 132-142. DeAngelis, V. and J. Nalbandian (1968). "Ultrastructure of mouse and rat palatal processes prior to and during secondary palate formation." Arch Oral Biol. 13(6): 7. Developmental Biology Programme of the University of Helsinki (1996). Gene expression in tooth, http://bite-it.helsinki.fi.

107

Dhalluin, C., K. S. Yan, et al. (2000). "Structural Basis of SNT PTB Domain Interactions with Distinct Neurotrophic Receptors." Molecular Cell 6(4): 921-929. Dunn, N. R., S. D. Vincent, et al. (2004). "Combinatorial activities of Smad2 and Smad3 regulate mesoderm formation and patterning in the mouse embryo." Development 131(8): 1717-1728. Egea, J., C. Erlacher, et al. (2008). "Genetic ablation of FLRT3 reveals a novel morphogenetic function for the anterior visceral endoderm in suppressing mesoderm differentiation " Genes and Development 22: 13. Eswarakumar, V. P., M. L. Horowitz, R, et al. (2004). "A gain-of-function mutation of FGFR2c demonstrates the roles of this receptor variant in osteogenesis." Proceedings of the National Academy of Sciences of the United States of America 101(34): 5. Eswarakumar, V. P., I. Lax, et al. (2005). "Cellular signaling by fibroblast growth factor receptors." Cytokine & Growth Factor Reviews 16: 10. Farlie, P. G., R. Kerr, et al. (1999). "A Paraxial Exclusion Zone Creates Patterned Cranial Neural Crest Cell Outgrowth Adjacent to Rhombomeres 3 and 5." Developmental Biology 213(1): 70-84. Ferguson, M., L. Honig, et al. (1984). "Differentiation of cultured palatal shelves from alligator, chick, and mouse embryos." Anat Rec 209(2): 18. Firnberg, N. and A. Neubuser (2002). "FGF Signaling Regulates Expression of Tbx2, Erm, Pea3, and Pax3 in the Early Nasal Region." Developmental Biology 247(2): 237-250. Fitchett, J. and E. Hay (1989). "Medial edge epithelium transforms to mesenchyme after embryonic palatal shelves fuse." Developmental Biology 131(2): 19. Forman-Kay, J. D. and T. Pawson (1999). "Diversity in protein recognition by PTB domains." Current Opinion in Structural Biology 9(6): 690-695. Fournier, A. E., T. GrandPre, et al. (2001). "Identification of a receptor mediating Nogo-66 inhibition of axonal regeneration." Nature 409(6818): 341-346. Francis-West, P., R. Ladher, et al. (1998). "Signalling interactions during facial development." Mechanisms of Development 75(1-2): 3-28. Gavalas, A., P. Trainor, et al. (2001). "Synergy between Hoxa1 and Hoxb1: the relationship between arch patterning and the generation of cranial neural crest." Development 128(15): 3017-3027. Gehring, W. J., Y. Q. Qian, et al. (1994). "Homeodomain - DNA recognition." Cell 78: 12. Gendron-Maguire, M., M. Mallo, et al. (1993). "Hoxa-2 mutant mice exhibit homeotic transformation of skeletal elements derived from cranial neural crest." Cell 75(7): 1317- 1331. Goldstein, B. and A. S. Perelson (1984). "Equilibrium theory for the clustering of bivalent cell surface receptors by trivalent ligands. Application to histamine release from basophils." Development 45(6): 1109-1123. Gong, S. (2006). unpublished data, University of Toronto. Gong, S., S. Mai, et al. (2009). "Flrt2 and Flrt3 have overlapping and non-overlapping expression during craniofacial development." Gene Expression Patterns: 7. Graham, A., J. Begbie, et al. (2003). "Significance of the Cranial Neural Crest." Developmental Dynamics 229: 8. Gratsch, T., L. DeBoer, et al. (2003). "RNA inhibition of BMP-4 gene in postimplantation mouse embryos." Genesis 37(1): 5.

108

Griffith, C. M. and E. D. Hay (1992). "Epithelial-mesenchymal transformation during palatal fusion: carboxyfluorescein traces cells at light and electron microscopic levels." Development 116(4): 1087-1099. Gritli-Linde, A. (2007). "Molecular control of secondary palate development." Developmental Biology 301(2): 309-326. Hacohen, N., S. Kramer, et al. (1998). "sprouty Encodes a Novel Antagonist of FGF Signaling that Patterns Apical Branching of the Drosophila Airways." Cell 92(2): 253-263. Haines, B. P., L. M. Wheldon, et al. (2006). "Regulated expression of FLRT genes implies a functional role in the regulation of FGF signalling during mouse development." Developmental Biology 297(1): 14-25. Hanafusa, H., S. Torii, et al. (2002). "Sprouty1 and Sprouty2 provide a control mechanism for the Ras/MAPK signalling pathway." Nat Cell Biol 4(11): 850-858. Hardy, M. H. (1992). "The secret life of the hair follicle." Trends in Genetics 8(2): 55-61. Havens, B. A., D. Velonis, et al. (2008). "Roles of FGFR3 during morphogenesis of Meckel's cartilage and mandibular bones." Developmental Biology 316(2): 336-349. Hilliard, S. A., L. Yu, et al. (2005). "Regional regulation of palatal growth and patterning along the anterior-posterior axis in mice." Journal of Anatomy 207(5): 655-667. Hu, D., R. S. Marcucio, et al. (2003). "A zone of frontonasal ectoderm regulates patterning and growth in the face." Development 130: 9. Huang, X. and J. Saint-Jeannet (2004). "Induction of the neural crest and the opportunities for life on the edge." Developmental Biology 275: 10. Imai, H., N. Osumi-Yamashita, et al. (1996). "Contribution of Early-Emigrating Midbrain Crest Cells to the Dental Mesenchyme of Mandibular Molar Teeth in Rat Embryos." Developmental Biology 176(2): 151-165. Itoh, N. and D. Ornitz (2008). "Functional evolutionary history of the mouse Fgf gene family." Developmental Dynamics 237(2): 9. Jabs, E. W., X. Li, et al. (1994). "Jackson-Weiss and Crouzon syndromes are allelic with mutations in fibroblast growth factor receptor 2." Nat Genet 8(3): 275-279. Jackman, W. R., B. W. Draper, et al. (2004). "Fgf signaling is required for zebrafish tooth development." Developmental Biology 274(1): 139-157. Jacobson, E. R. (2007). Infectious Diseases and Pathology of Reptiles. Boca, Raton, FL, CRC Press. Jernvall, J., P. Kettunen, et al. (1994). "Evidence for the role of the enamel knot as a control center in mammalian tooth cusp formation: non-dividing cells express growth stimulating Fgf-4 gene." Int J Dev Biol. 38: 6. Jernvall, J. and I. Thesleff (2000). "Reiterative signaling and patterning during mammalian tooth morphogenesis." Mechanisms of Development 92(1): 19-29. Jin, J.-Z. and J. Ding (2006). "Analysis of cell migration, transdifferentiation and apoptosis during mouse secondary palate fusion." Development 133(17): 3341-3347. Johnson, D. E., P. L. Lee, et al. (1990). "Diverse forms of a receptor for acidic and basic fibroblast growth factors." Molecular and Cellular Biology 10(9): 4728-4736. Kaartinen, V., X. Cui, et al. (1997). "Transforming growth factor-beta3 regulates transdifferentiation of medial edge epithelium during palatal fusion and associated degradation of the basement membrane." Developmental Dynamics 209: 5. Kanzler, B., R. K. Foreman, et al. (2000). "BMP signaling is essential for development of skeletogenic and neurogenic cranial neural crest." Development 127(5): 1095-1104.

109

Kapadia, H., G. Mues, et al. (2007). "Genes affecting tooth morphogenesis." Orthodontics and Craniofacial Research 10(3): 105-113. Karaulanov, E., R. Böttcher, et al. (2006). "A role for fibronectin-leucine-rich transmembrane cell-surface proteins in homotypic cell adhesion." EMBO reports 7(3): 17. Karaulanov, E., R. Böttcher, et al. (2009). "Unc5B interacts with FLRT3 and Rnd1 to modulate cell adhesion in Xenopus embryos." PLoS ONE 4(5): 9. Karaulanov EE, B. R., Niehrs C (2006). "A role for fibronectin-leucine-rich transmembrane cell- surface proteins in homotypic cell adhesion." EMBO reports 7(3): 17. Kawauchi, S., J. Shou, et al. (2005). "Fgf8 expression defines a morphogenetic center required for olfactory neurogenesis and nasal cavity development in the mouse." Development 132(23): 5211-5223. Kettunen, P., I. Karavanova, et al. (1998). "Responsiveness of developing dental tissues to fibroblast growth factors: expression of splicing alternatives of FGFR1, 2, 3, and of FGFR4; and stimulation of cell proliferation by FGF, 4, 8, and 9." Developmental Genetics 22(4): 9. Knecht, A. K. and M. Bronner-Fraser (2002). "Induction of the neural crest: a multigene process." Nat Rev Genet 3(6): 453-461. Kobe, B. and A. V. Kajava (2001). "The leucine-rich repeat as a protein recognition motif." Current Opinion in Structural Biology 11(6): 725-732. Kontges, G. and A. Lumsden (1996). "Rhombencephalic neural crest segmentation is preserved throughout craniofacial ontogeny." Development 122(10): 3229-3242. Kuja-Panula, J., M. Kiiltomaki, et al. (2003). "AMIGO, a transmembrane protein implicated in axon tract development, defines a novel protein family with leucine-rich repeats." Journal of Cell Biology 160(6): 963-973. Lacy, S. E., C. G. Bonnemann, et al. (1999). "Identification of FLRT1, FLRT2, and FLRT3: A Novel Family of Transmembrane Leucine-Rich Repeat Proteins." Genomics 62(3): 417- 426. Le Douarin, N. M., J. M. Brito, et al. (2007). "Role of the neural crest in face and brain development." Brain Research Reviews 55(2): 237-247. Lee, J.-M., J.-Y. Kim, et al. (2008). "Wnt11/Fgfr1b cross-talk modulates the fate of cells in palate development." Developmental Biology 314(2): 341-350. Levine, M., G. M. Rubin, et al. (1984). "Human DNA sequences homologous to a protein coding region conserved between homeotic genes of Drosophila." Cell 38(3): 6. Liem, K. J., G. Tremml, et al. (1995). "Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm." Cell 82(6): 10. Lin, J. C., W.-H. Ho, et al. (2003). "The netrin-G1 ligand NGL-1 promotes the outgrowth of thalamocortical axons." Nat Neurosci 6(12): 1270-1276. Liu, W., X. Sun, et al. (2005). "Distinct functions for Bmp signaling in lip and palate fusion in mice." Development 132(6): 1453-1461. Lumsden, A. and R. Krumlauf (1996). "Patterning the Vertebrate Neuraxis." Science 274(5290): 1109-1115. MacDonald, M. E., U. K. Abbott, et al. (2004). "Upper beak truncation in chicken embryos with the cleft primary palate mutation is due to an epithelial defect in the frontonasal mass." Developmental Dynamics 230(2): 335-349. Maretto, S., P.-S. Müller, et al. (2008). "Ventral closure, headfold fusion and definitive endoderm migration defects in mouse embryos lacking the fibronectin leucine-rich

110

transmembrane protein FLRT3." Developmental Biology doi:10.1016/j.ydbio.2008.03.021. Martínez-Álvarez, C., R. Bonelli, et al. (200). "Bulging medial edge epithelial cells and palatal fusion." Int. J. Dev. Biol. 44(4): 331. Martínez-Álvarez, C., C. Tudela, et al. (2000). "Medial Edge Epithelial Cell Fate during Palatal Fusion." Developmental Biology 220(2): 343-357. McGinnis, W., C. P. Hart, et al. (1984). "Molecular cloning and chromosome mapping of a mouse DNA sequence homologous to homeotic genes of Drosophila." Cell 37(2): 5. McGinnis, W. and R. Krumlauf (1992). "Homeobox genes and axial patterning." Cell 68: 19. McGinnis, W., M. Levine, et al. (1984). "A conserved DNA sequence in homeotic genes of the Drosophila Antennapedia and bithorax complexes." Nature 308: 5. McGonnell, I. M., Clarke,Jonathan D. W. ,Tickle, Cheryll (1998). "Fate map of the developing chick face: Analysis of expansion of facial primordia and establishment of the primary palate." Developmental Dynamics 212(1): 102-118. Meulemans, D. and M. Bronner-Fraser (2004). "Gene-regulatory interactions in neural crest evolution and development." Dev cell 7: 8. Meyers, G. A., S. J. Orlow, et al. (1995). "Fibroblast growth factor receptor 3 (FGFR3) transmembrane mutation in Crouzon syndrome with acanthosis nigricans." Nature Genetics 11(4): 462-464. Miki, T., D. P. Bottaro, et al. (1992). "Determination of Ligand-Binding Specificity by Alternative Splicing: Two Distinct Growth Factor Receptors Encoded by a Single Gene." Proceedings of the National Academy of Sciences of the United States of America 89(1): 246-250. Millar, S. E. (2002). "Molecular Mechanisms Regulating Hair Follicle Development." Journal of Investigative Dermatology 118(2): 216-225. Mina, M. and E. Kollar (1991). "Role of the early epithelium in the patterning of the teeth and Meckel's cartilage." Journal of Craniofacial Genetics and Developmental Biology 11(4): 5. Mina, M., W. B. Upholt, et al. (1991). "Stage-related chondrogenic potential of avian mandibular ectomesenchymal cells." Differentiation 48: 9–16. Mina, M., Y.-H. Wang, et al. (2002). "Region- and stage-specific effects of FGFs and BMPs in chick mandibular morphogenesis." Developmental Dynamics 223(3): 333-352. Miyazono, K., S. Maeda, et al. (2005). "BMP receptor signaling: transcriptional targets, regulation of signals, and signaling cross-talk." Cytokine & Growth Factor Reviews 16: 12. Morales, A., J. Barbas, et al. (2005). "How to become the neural crest: from segregation to delamination." 2005 16: 655. Morel, G. and A. Cavalier (2001). In Situ Hybridization in Light Microscopy. Boca Raton, FL, CRC Press LLC. Mori, C., N. Nakamura, et al. (1994). "Cytochemical identification of programmed cell death in the fusing fetal mouse palate by specific labelling of DNA fragmentation." Anat Embryol 190(1): 7. Nakatake, Y., M. Hoshikawa, et al. (2001). "Identification of a novel fibroblast growth factor, FGF-22, preferentially expressed in the inner root sheath of the hair follicle." Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression 1517(3): 460-463.

111

Nawshad, A. and E. D. Hay (2003). "TGF{beta}3 signaling activates transcription of the LEF1 gene to induce epithelial mesenchymal transformation during mouse palate development." Journal of Cell Biology 163(6): 1291-1301. Nawshad, A., D. LaGamba, et al. (2004). "Transforming growth factor [beta] (TGF[beta]) signalling in palatal growth, apoptosis and epithelial mesenchymal transformation (EMT)." Archives of Oral Biology 49(9): 675-689. Nawshad, A., D. LaGamba, et al. (2004). "Laser capture microdissection (LCM) for analysis of gene expression in specific tissues during embryonic epithelial-mesenchymal transformation." Developmental Dynamics 230(3): 529-534. Nawshad, A., D. Medici, et al. (2007). "TGFbeta3 inhibits E-cadherin gene expression in palate medial-edge epithelial cells through a Smad2-Smad4-LEF1 transcription complex." Journal of Cell Science 120(9): 1646-1653. Neufeld, G. and D. Gospodrowicz (1986). "Basic and acidic Fibroblast Growth Factors interact with the same cell surface receptors." Journal Biological Chemistry 261(12): 6. Nichols, D. (1986). "Formation and distribution of neural crest mesenchyme to the first pharyngeal arch region of the mouse embryo." Am J Anat. 176(2): 10. Nie X, L. K., Kettunen P. (2006). "BMP signalling in craniofacial development." Int J Dev Biol. 50(6): 10. Nie, X., K. Luukko, et al. (2006). "FGF signalling in craniofacial development and developmental disorders." Oral Diseases 12(2): 102-111. Nieto, M., M. Sargent, et al. (1994). "Control of cell behavior during vertebrate development by slug, a zinc finger gene." Science 264: 835–9. Noden, D. M. (1983). "The role of the neural crest in patterning of avian cranial skeletal, connective, and muscle tissues." Developmental Biology 96(1): 144-165. Noden, D. M. (1988). "Interactions and fates of avian craniofacial mesenchyme." Development 103: 19. Nogai, H., M. Rosowski, et al. (2008). "Follistatin antagonizes transforming growth factor-3- induced epithelial-mesenchymal transition in vitro: implications for murine palatal development supported by microarray analysis." Differentiation 76(4): 404-416. Nohe, A., E. Keating, et al. (2004). "Signal transduction of bone morphogenetic protein receptors." Cellular Signalling 16(3): 291-299. Ogata, S., J. Morokuma, et al. (2007). "TGF-beta signaling-mediated morphogenesis: modulation of cell adhesion via cadherin endocytosis." Genes and Development 21(14): 1817-1831. Ohuchi, H., H. Tao, et al. (2003). "Fibroblast growth factor 10 is required for proper development of the mouse whiskers." Biochemical and Biophysical Research Communications 302(3): 562-567. Ohuchi, H., H. Yoshioka, et al. (1994). "Involvement of Androgen-Induced Growth Factor (FGF-8) Gene in Mouse Embryogenesis and Morphogenesis." Biochemical and Biophysical Research Communications 204(2): 882-888. Ornitz, D. M. and N. Itoh (2001). "Fibroblast growth factors." Genome Biology 2(3): REVIEWS3005. Päivi Kettunen, I. T. (1998). "Expression and function of FGFs-4, -8, and -9 suggest functional redundancy and repetitive use as epithelial signals during tooth morphogenesis." Developmental Dynamics 211(3): 256-268. Partanen, J. (2007). "FGF signalling pathways in development of the midbrain and anterior hindbrain." Journal of Neurochemistry 101: 8.

112

Pawson, T. (1995). "Protein modules and signalling networks." Nature 373(6515): 573-580. Pelton, R. W., B. L. M. Hogan, et al. (1990). "Differential expression of genes encoding TGFs [beta]1, [beta]2, and [beta]3 during murine palate formation." Developmental Biology 141(2): 456-460. Peters, H., A. Neubuser, et al. (1998). "Pax9-deficient mice lack pharyngeal pouch derivatives and teeth and exhibit craniofacial and limb abnormalities." Genes and Development 12(17): 2735-2747. Petiot, A., F. J. A. Conti, et al. (2003). "A crucial role for Fgfr2-IIIb signalling in epidermal development and hair follicle patterning." Development 130(22): 5493-5501. Reardon, W., R. M. Winter, et al. (1994). "Mutations in the fibroblast growth factor receptor 2 gene cause Crouzon syndrome." Nat Genet 8(1): 98-103. Regulski, M., K. Harding, et al. (1985). "Homeo box genes of the Antennapedia and Bithorax Complexes of Drosophila." Cell 43(1): 9. Rice, D. P. (2008). "Clinical features of syndromic craniosynostosis." Frontiers of Oral Biology 12: 15. Rice, D. P., T. Aberg, et al. (2000). "Integration of FGF and TWIST in calvarial bone and suture development." Development 127(9): 1845-1855. Rice, R., B. Spencer-Dene, et al. (2004). "Disruption of Fgf10/Fgfr2b-coordinated epithelial- mesenchymal interactions causes cleft palate." J Clin Invest. 113(12): 8. Richman, J. and C. Tickle (1992). "Epithelial-mesenchymal interactions in the outgrowth of limb buds and facial primordia in chick embryos." Developmental Biology 152(2): 9. Richman, J. M., M. Herbert, et al. (1997). "Effect of Fibroblast Growth Factors on Outgrowth of Facial Mesenchyme." Developmental Biology 189(1): 135-147. Richman, J. M. and S.-H. Lee (2003). "About face: Signals and genes controlling jaw patterning and identity in vertebrates." Bioessays 25(6): 554-568. Rijli, F., A. Gavalas, et al. (1998). "Segmentation and specification in the branchial region of the head: the role of the Hox selector genes." The International Journal of Developmental Biology 42(3): 8. Robinson, M., M. C. Parsons Perez, et al. (2004). "FLRT3 is expressed in sensory neurons after peripheral nerve injury and regulates neurite outgrowth." Molecular and Cellular Neuroscience 27(2): 202-214. Rosenquist, T. A. and G. R. Martin (1996). "Fibroblast growth factor signalling in the hair growth cycle: Expression of the fibroblast growth factor receptor and ligand genes in the murine hair follicle." Developmental Dynamics 205(4): 379-386. Ruch, J. (1995). "Tooth crown morphogenesis and cytodifferentiations: candid questions and critical comments." Connective Tissue Research 32(1-4): 7. Saunders, J. J. (1966). "Death in embryonic systems." Science 154(749): 8. Schilling, T., V. Prince, et al. (2001). "Plasticity in zebrafish hox expression in the hindbrain and cranial neural crest." Developmental Biology 231(1): 15. Schlessinger, J. (2004). "Common and Distinct Elements in Cellular Signaling via EGF and FGF Receptors." Science 306(5701): 1506-1507. Schmidt-Ullrich and R. R. Paus (2005). "Molecular principles of hair follicle induction and morphogenesis." Bioessays 27(3): 247-261. Schneider, R. A. and J. A. Helms (2003). "The Cellular and Molecular Origins of Beak Morphology." Science 299(5606): 565-568.

113

Scott, M. P. and A. J. Weiner (1984). "Structural relationships among genes that control development: Sequence homology between the Antennapedia, Ultrabithorax and fushi tarazu loci of Drosophila." Proceedings of the National Academy of Sciences of the United States of America 81: 4. Sela-Donenfeld, D. and C. Kalcheim (1999). "Regulation of the onset of neural crest migration by coordinated activity of BMP4 and Noggin in the dorsal neural tube." Development 126: 13. Shapiro, B. L. and L. Sweney (1969). "Electron Microscopic and Histochemical Examination of Oral Epithelial-Mesenchymal Interaction (Programmed Cell Death)." Jounal of Dental Research 48(5): 652-660. Sharpe, P. T. (2001). "Neural crest and tooth morphogenesis." Advances in Dental Research 15(1): 4-7. Shiang, R., L. Thompson, et al. (1994). "Mutations in the transmembrane domain of FGFR3 cause the most common genetic form of dwarfism, achondroplasia." Cell 78(2): 8. Shigetani, Y., Y. Nobusada, et al. (2000). "Ectodermally Derived FGF8 Defines the Maxillomandibular Region in the Early Chick Embryo: Epithelial-Mesenchymal Interactions in the Specification of the Craniofacial Ectomesenchyme." Developmental Biology 228(1): 73-85. Sirard, C., S. Kim, et al. (2000). "Targeted Disruption in Murine Cells Reveals Variable Requirement for Smad4 in Transforming Growth Factor beta -related Signaling." Journal Biological Chemistry 275(3): 2063-2070. Smiley, G. and A. Dixon (1968). "Fine structure of midline epithelium in the developing palate of the mouse." Anat Rec. 161(3): 17. Smiley, G. and W. Koch (1975). "A comparison of secondary palate development with different in vitro techniques." Anat Rec. 81(4): 12. Smith, A., V. Robinson, et al. (1997). "The EphA4 and EphB1 receptor tyrosine kinases and ephrin-B2 ligand regulate targeted migration of branchial neural crest cells." Current Biology 7(8): 9. Smith, T. and T. C. (2006). "The expression of Flrt3 during chick limb development." Int. J. Dev. Biol. 50(8): 5. Smith TG, T. C. (2006). "The expression of Flrt3 during chick limb development." Int. J. Dev. Biol. 50(8): 5. Smith, T. G. and C. Tickle (2006). "The expression of Flrt3 during chick limb development." Int. J. Dev. Biol. 50: 3. Stanier, P. and G. Moore (2004). "Genetics of cleft lip and palate: syndromic genes contribute to the incidence of non-syndromic clefts." Human Molecular Genetics 1(13): 8. Takahashi, K., G. H. Nuckolls, et al. (2001). "Msx2 is a repressor of chondrogenic differentiation in migratory cranial neural crest cells." Developmental Dynamics 222(2): 252-262. Takahashi, M. and Y. Ono (2003). "Pulse-chase analysis of protein kinase C." Methods in Molecular Biology 233: 7. Tan, D. P., K. Nonaka, et al. (2002). "YY1 activates Msx2 gene independent of bone morphogenetic protein signaling." Nucleic Acids Research 30(5): 1213-1223. Tanigushi, K., N. Sato, et al. (1995). "Apoptosis and heterophagy of medial edge epithelial cells of the secondary palatine shelves during fusion." Arch Histol Cytol 58(2): 12. Thesleff, I. and T. Aberg (1999). "Molecular regulation of tooth development." Bone 25(1): 123- 125.

114

Thesleff, I. and P. Sharpe (1997). "Signalling networks regulating dental development." Mechanisms of Development 67(2): 111-123. Thisse, B. and C. Thisse (2005). "Functions and regulations of fibroblast growth factor signaling during embryonic development." Developmental Biology 287(2): 390-402. Trainor, P. (2003). "DEVELOPMENT: The Bills of Qucks and Duails." Science 299(5606): 523- 524. Trainor, P. A. (2005). "Specification of neural crest cell formation and migration in mouse embryos." Seminars in Cell & Developmental Biology 16(6): 683-693. Trainor, P. A., L. Ariza-McNaughton, et al. (2002). "Role of the Isthmus and FGFs in Resolving the Paradox of Neural Crest Plasticity and Prepatterning." Science 295(5558): 1288- 1291. Trainor, P. A. and R. Krumlauf (2001). "Hox genes, neural crest cells and branchial arch patterning." Current Opinion in Cell Biology 13(6): 698-705. Tribulo, C., M. J. Aybar, et al. (2003). "Regulation of Msx genes by a Bmp gradient is essential for neural crest specification." Development 130(26): 6441-6452. Trumpp, A., M. J. Depew, et al. (1999). "Cre-mediated gene inactivation demonstrates that FGF8 is required for cell survival and patterning of the first branchial arch." Genes and Development 13(23): 3136-3148. Tsuji, L., T. Yamashita, et al. (2004). "FLRT3, a cell surface molecule containing LRR repeats and a FNIII domain, promotes neurite outgrowth." Biochemical and Biophysical Research Communications 313(4): 1086-1091. Tucker, A. S. and P. T. Sharpe (1999). "Molecular genetics of tooth morphogenesis and patterning: the right shape in the right place." Journal of Dental Research 78(4): 826-834. Tyler, M. and W. Koch (1977). "In vitro development of palatal tissues from embryonic mice. III. Interactions between palatal epithelium and heterotypic oral mesenchyme." J Embryol Exp Morphol.(38): 11. Tyler, M. and R. Pratt (1980). "Effect of epidermal growth factor on secondary palatal epithelium in vitro: tissue isolation and recombination studies." J Embryol Exp Morphol. 58: 13. Vaage, S. (1969). "The segmentation of the primitive neural tube in chick embryos (Gallus domesticus). A morphological, histochemical and autoradiographical investigation." Ergeb Anat Entwicklungsgesch. 41(3): 84. Vainio, S., I. Karavanova, et al. (1993). "Identification of BMP-4 as a signal mediating secondary induction between epithelial and mesenchymal tissues during early tooth development." Cell 75: 13. Vaziri Sani, F., K. Hallberg, et al. (2005). "Fate-mapping of the epithelial seam during palatal fusion rules out epithelial-mesenchymal transformation." Developmental Biology 285(2): 490-495. Veitch, E., J. Begbie, et al. (1999). "Pharyngeal arch patterning in the absence of neural crest." Current Biology 9(24): 1481-1484. Vincent, S. D., N. R. Dunn, et al. (2003). "Cell fate decisions within the mouse organizer are governed by graded Nodal signals." Genes and Development 17(13): 1646-1662. Wang, H. and D. Anderson (1997). "Eph family transmembrane ligands can mediate repulsive guidance of trunk neural crest migration and motor axon outgrowth." Neuron 18(3): 13.

115

Welsh, I. C., A. Hagge-Greenberg, et al. (2007). "A dosage-dependent role for Spry2 in growth and patterning during palate development." Mechanisms of Development 124(9-10): 746- 761. Wilke, T. A., S. Gubbels, et al. (1997). "Expression of fibroblast growth factor receptors (FGFR1, FGFR2, FGFR3) in the developing head and face." Developmental Dynamics 210(1): 41-52. Wilkie, A. (1996). "Fibroblast growth factor receptor mutations and craniosynostosis: three receptors, five syndromes." Indian Journal of Pediatrics 63(3): 5. Wolfe, J. and V. Budker (2005). "The mechanism of naked DNA uptake and expression." Advances in Genetics 54: 17. Xu, X., M. Weinstein, et al. (1998). "Fibroblast growth factor receptor 2 (FGFR2)-mediated reciprocal regulation loop between FGF8 and FGF10 is essential for limb induction." Development 125(4): 12. Yonei-Tamura, S., T. Endo, et al. (1999). "FGF7 and FGF10 directly induce the apical ectodermal ridge in chick embryos." Developmental Biology 211(1): 10. Zhang, Z., Y. Song, et al. (2002). "Rescue of cleft palate in Msx1-deficient mice by transgenic Bmp4 reveals a network of BMP and Shh signaling in the regulation of mammalian palatogenesis." Development 129(17): 4135-4146.

116