DOCSLIB.ORG

Independent Amplification of Two Gene Clusters on Chromosome 4 in Rat Endometrial Cancer: Identification and Molecular Characterization1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

[CANCER RESEARCH 61, 8263–8273, November 15, 2001] Independent Amplification of Two Gene Clusters on Chromosome 4 in Rat Endometrial Cancer: Identification and Molecular Characterization1 Anna Walentinsson,2 Khalil Helou, Ville Wallenius, Hans J. Hedrich, Claude Szpirer, and Go¨ran Levan Department of Cell and Molecular Biology–Genetics, Go¨teborg University, SE-40530 Gothenburg, Sweden [A. W., K. H., G. L.]; Research Centre for Endocrinology and Metabolism, Department of Internal Medicine, Sahlgrenska University Hospital, Go¨teborg University, S-413 45 Gothenburg, Sweden [V. W.]; Laboratory of Animal Science, Medizinische Hochschule, DE-30623 Hannover, Germany [H. J. H.]; and IBMM, Universite´Libre de Bruxelles, BE-6041 Gosselies, Belgium [C. S.] ABSTRACT sequences has been found to be quite simple and consisting of con- tinuous repeats of not much more than the target gene (6, 7). However, The BDII rat is genetically predisposed to hormone-dependent endo- a more common situation is that the amplified sequences are struc- metrial adenocarcinoma and was used to model human cancer. Tumors turally rather complex and sometimes also internally rearranged, arising spontaneously in strain crosses involving BDII rats were analyzed by means of comparative genome hybridization. The most common aber- encompassing two or more coamplified genes, including the target ration was amplification of the proximal region of rat chromosome 4, gene (8, 9). Hence, the prevalence of gene amplification in diverse centered around bands q12-q22. The copy numbers of 15 cancer-related tumor types, as well as its biological and clinical significance in genes from the region were examined in tissue cultures of 11 endometrial neoplastic development, makes amplified chromosomal regions inter- carcinomas (10 endometrial adenocarcinomas and 1 endometrial squa- esting targets for detailed genetic analysis. Identification and charac- mous cell carcinoma) and one peritoneal mesothelioma. Amplification in terization of the amplified genes can provide valuable insights into the rat chromosome 4 was detected in six tumors (50%), five of which carried pathogenesis of cancer and may also yield molecular markers for the two separate amplified regions, situated at 4q12-q13 and 4q21-q22, inter- evaluation of prognosis and therapy. rupted by a nonamplified segment at 4q13-q21.1. The genes Cdk6 (cyclin- Carcinoma of the uterine corpus, also known as endometrial carci- dependent kinase 6) and Met (hepatocyte growth factor receptor) were noma, is the most frequently diagnosed malignancy of the female located in the core of each amplified region and were amplified most reproductive tract and the fourth most common cancer among women recurrently and at the highest levels among the genes tested. Using fluo- 3 rescence in situ hybridization on tumor metaphases, it was observed that (10). Still, the molecular genetic features of this tumor have yet to be the amplified Cdk6 and Met sequences were situated on typical homoge- described in significant detail. The inbred BDII rat strain is genetically 4 neously staining regions (HSRs). In three tumors, both genes were ampli- prone to spontaneous hormone-dependent EAC (11) and may serve fied in the same HSRs, whereas in two tumors, the amplified sequences of as a genetic model system of this tumor type. In a series of uterine each gene were situated in separate HSRs. In addition, Cdk6 and Met tumors (mostly EACs) developed in F1, F2, and backcross progeny amplification was consistently associated with a corresponding increase in from crosses between BDII rats and rats of either of two nonsuscep- gene expression, suggesting that the two genes might represent the targets tible strains (BN and SPRD), a previous cytogenetic investigation for the amplifications. In the sixth tumor, which carried amplified se- disclosed repeatedly occurring manifestations of gene amplification in quences of Met but not of Cdk6, coexpression of Met and the normally the form of HSRs. By using CGH, we could conclude that most silent hepatocyte growth factor gene (Hgf; the ligand of Met) was ob- served. This finding suggests that an autocrine signaling circuit might be commonly, the amplified sequences originated from a region in prox- operating in this particular tumor. Taken together, our findings suggest imal RNO4, centered around bands q12-q22 (12). Similar amplifica- that up-regulation of Cdk6 and/or Met may contribute to the development tion in the proximal part of RNO4 has been detected previously in a of endometrial cancers in the BDII rat. subset of 7, 12-dimethylbenz[a]anthracene-induced rat sarcomas (13– 15), suggesting that involvement of this chromosome region repre- sents a major pathway in a variety of tumor types. In the present INTRODUCTION investigation, we have undertaken a detailed qualitative and quanti- tative characterization of the amplification of RNO4-derived se- Lines of evidence suggest that the development of neoplastic dis- quences. Our findings suggest that at least two subregions are in- ease requires multiple genetic lesions, ranging from single nucleotide volved in independent amplifications in these tumors. Each of the alterations to gross chromosomal changes, occurring sequentially in a regions contains cancer-related genes, which may interact in the cell lineage (1). DNA amplification represents one major molecular development of endometrial cancers. pathway that is thought to play a pivotal role in tumor development, in view of the fact that it provides a mechanism by which tumor cells can trigger enhanced expression of genes whose products are involved MATERIALS AND METHODS in cell proliferation (2). In human cancers, the number of reports on gene amplification, often in relation to progressive tumor growth and Tumor Material. Females of the inbred rat strain BDII/Han are predis- posed to cancer in the endometrium of the uterus (EAC; Refs. 11 and 16). poor prognosis, is continually growing (3–5). In the majority of cases Virgin females (Ͼ90%) will develop this neoplasm, usually before 24 months in which the amplified chromosome region has been identified and of age. When BDII/Han rats were interbred with rats from the two nonsus- characterized, a proto-oncogene appears to be the target on which ceptible strains BN/Han and SPRD-Cu3/Han, a large fraction of the F1, F2, selection acts (4). In some tumors, the architecture of the amplified and backcross animals spontaneously developed tumors. Most of these tumors were pathologically characterized as EAC, but in addition, some other types of Received 6/22/01; accepted 9/19/01. uterine and nonuterine tumors were present (see Ref. 12). The main material The costs of publication of this article were defrayed in part by the payment of page for the present investigation was 12 tissue cultures derived from 11 endome- charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 Supported by grants from the European Commission (contract ERBBio4CT960562), 3 Internet address: http://www.cancer.org. the Swedish Cancer Society, the Nilsson-Ehle Foundation, and the IngaBritt and Arne 4 The abbreviations used are: EAC, endometrial adenocarcinoma; HSR, homoge- Lundberg Research Foundation. neously staining region; CGH, comparative genome hybridization; RNO4, rat chromo- 2 To whom requests for reprints should be addressed, at Department of Cell and some 4; ESCC, endometrial squamous cell carcinoma; FISH, fluorescence in situ hybrid- Molecular Biology–Genetics, Go¨teborg Univeristy, Box 462, S-405 30 Gothenburg, ization; PAC, P1 artificial chromosome; RT-PCR, reverse transcription-PCR; HGF, Sweden. Phone: 46-31-7733298; Fax: 46-31-7732599; E-mail: anna.walentinsson@ hepatocyte growth factor; MET, HGF receptor; HSA7, human chromosome 7; DCSE, gen.gu.se. diploid chromosome set equivalent; CDK, cyclin-dependent kinase; SF, scatter factor. 8263 Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 2001 American Association for Cancer Research. GENE AMPLIFICATION IN RAT ENDOMETRIAL CANCER Table 1 Oligonucleotide sequences of primer pairs used in RT-PCR and size in bps of corresponding amplified fragmentsa PCR fragment Gene symbol Gene description Forward primer Reverse primer size (bp) Cdk5 Cyclin-dependent kinase 5 ggaaggtaatggaaccacga gcagggagaatctgccataa 419 Hgf Hepatocyte growth factor (scatter factor) cccaaatgtgacgtgtcaag tgttttgttttggcacagga 335 Dmtf1 Cyclin D binding myb-like transcription factor 1 aggatacctgcaacacaggg gcaatttgccttttgatggt 373 Abcb1 ATP-binding cassette, subfamily B (MDR/TAP/PGY), member 1 catcgacagcttctcaacca actcagaggcaccagtgtca 836 Cyp51 Cytochrome P450, 51 (lanosterol 14-␣-demethylase) ccttcacgcttagccttgtc gtatgcaactcccttcccaa 332 Cdk6 Cyclin-dependent kinase 6 gcctatgggaaggtgttcaa tgaagaaagtccagacctcg 344 Tac1 Tachykinin, precursor 1 (substance K, substance P) gtttgcagaggaaatcggtg gcgcttctttcataagccac 312 Asns Asparagine synthetase ctttccgtgcagtgtctgag tccaggcctcctgataaaag 746 Cav1 Caveolin 1 agattgatctggtcaaccgc atctcttcctgcgtgctgat 392 Met Hepatocyte growth factor receptor (MET proto-oncogene) aaagccaatgtgtcaggagg tcgggagggtaggaagagtt 317 Wnt2 Wingless-type MMTV integration site family member 2 tccttccagctctgttgttg gcctttgtttacgccatctc 262 Cftr Cystic fibrosis transmembrane conductance regulator tgagggcagcagctattttt ttgttccaggtggtagaggc 180 Smoh Smoothened (Drosophila) homolog cacttaccagcctctctcgg ctgaaggtgatgagcacgaa 360 Braf V-raf murine sarcoma viral oncogene homolog B1
Recommended publications
  • Supplementary Data

    Supplementary Data

    Figure 2S 4 7 A - C 080125 CSCs 080418 CSCs - + IFN-a 48 h + IFN-a 48 h + IFN-a 72 h 6 + IFN-a 72 h 3 5 MRFI 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 7 B 13 080125 FBS - D 080418 FBS - + IFN-a 48 h 12 + IFN-a 48 h + IFN-a 72 h + IFN-a 72 h 6 080125 FBS 11 10 5 9 8 4 7 6 3 MRFI 5 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 Molecule Molecule FIGURE 4S FIGURE 5S Panel A Panel B FIGURE 6S A B C D Supplemental Results Table 1S. Modulation by IFN-α of APM in GBM CSC and FBS tumor cell lines. Molecule * Cell line IFN-α‡ HLA β2-m# HLA LMP TAP1 TAP2 class II A A HC§ 2 7 10 080125 CSCs - 1∞ (1) 3 (65) 2 (91) 1 (2) 6 (47) 2 (61) 1 (3) 1 (2) 1 (3) + 2 (81) 11 (80) 13 (99) 1 (3) 8 (88) 4 (91) 1 (2) 1 (3) 2 (68) 080125 FBS - 2 (81) 4 (63) 4 (83) 1 (3) 6 (80) 3 (67) 2 (86) 1 (3) 2 (75) + 2 (99) 14 (90) 7 (97) 5 (75) 7 (100) 6 (98) 2 (90) 1 (4) 3 (87) 080418 CSCs - 2 (51) 1 (1) 1 (3) 2 (47) 2 (83) 2 (54) 1 (4) 1 (2) 1 (3) + 2 (81) 3 (76) 5 (75) 2 (50) 2 (83) 3 (71) 1 (3) 2 (87) 1 (2) 080418 FBS - 1 (3) 3 (70) 2 (88) 1 (4) 3 (87) 2 (76) 1 (3) 1 (3) 1 (2) + 2 (78) 7 (98) 5 (99) 2 (94) 5 (100) 3 (100) 1 (4) 2 (100) 1 (2) 070104 CSCs - 1 (2) 1 (3) 1 (3) 2 (78) 1 (3) 1 (2) 1 (3) 1 (3) 1 (2) + 2 (98) 8 (100) 10 (88) 4 (89) 3 (98) 3 (94) 1 (4) 2 (86) 2 (79) * expression of APM molecules was evaluated by intracellular staining and cytofluorimetric analysis; ‡ cells were treatead or not (+/-) for 72 h with 1000 IU/ml of IFN-α; # β-2 microglobulin; § β-2 microglobulin-free HLA-A heavy chain; ∞ values are indicated as ratio between the mean of fluorescence intensity of cells stained with the selected mAb and that of the negative control; bold values indicate significant MRFI (≥ 2).
  • Genomic Alterations of Ground-Glass Nodular Lung Adenocarcinoma

    Genomic Alterations of Ground-Glass Nodular Lung Adenocarcinoma

    www.nature.com/scientificreports OPEN Genomic alterations of ground- glass nodular lung adenocarcinoma Hyun Lee1, Je-Gun Joung2, Hyun-Tae Shin2, Duk-Hwan Kim3, Yujin Kim3, Hojoong Kim1, O. Jung Kwon1, Young Mog Shim4, Ho Yun Lee5, Kyung Soo Lee5, Yoon-La Choi6, 2 7 1 Received: 1 February 2018 Woong-Yang Park , D. Neil Hayes & Sang-Won Um Accepted: 30 April 2018 In-depth molecular pathogenesis of ground-glass nodular lung adenocarcinoma has not been well Published: xx xx xxxx understood. The objectives of this study were to identify genomic alterations in ground-glass nodular lung adenocarcinomas and to investigate whether viral transcripts were detected in these tumors. Nine patients with pure (n = 4) and part-solid (n = 5) ground-glass nodular adenocarcinomas were included. Six were females with a median age of 58 years. We performed targeted exon sequencing and RNA sequencing. EGFR (n = 10), IDH2 (n = 2), TP53 (n = 1), PTEN (n = 1), EPHB4 (n = 1), and BRAF (n = 1) were identifed as driver mutations by targeted exon sequencing. Vasculogenesis-associated genes including NOTCH4 and TGFBR3 expression were signifcantly downregulated in adenocarcinoma tissue versus normal tissue (adjusted P values < 0.001 for both NOTCH4 and TGFBR3). In addition, fve novel fusion gene loci were identifed in four lung adenocarcinomas. However, no signifcant virus-associated transcripts were detected in tumors. In conclusions, EGFR, IDH2, TP53, PTEN, EPHB4, and BRAF were identifed as putative driver mutations of ground-glass nodular adenocarcinomas. Five novel fusion genes were also identifed in four tumors. Viruses do not appear to be involved in the tumorigenesis of ground-glass nodular lung adenocarcinoma.
  • The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid

    The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid

    The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid Leukemia Cells Supported Only by Exogenous Cytokines Is Associated with a Patient Subset with Adverse Outcome Annette K. Brenner, Elise Aasebø, Maria Hernandez-Valladares, Frode Selheim, Frode Berven, Ida-Sofie Grønningsæter, Sushma Bartaula-Brevik and Øystein Bruserud Supplementary Material S2 of S31 Table S1. Detailed information about the 68 AML patients included in the study. # of blasts Viability Proliferation Cytokine Viable cells Change in ID Gender Age Etiology FAB Cytogenetics Mutations CD34 Colonies (109/L) (%) 48 h (cpm) secretion (106) 5 weeks phenotype 1 M 42 de novo 241 M2 normal Flt3 pos 31.0 3848 low 0.24 7 yes 2 M 82 MF 12.4 M2 t(9;22) wt pos 81.6 74,686 low 1.43 969 yes 3 F 49 CML/relapse 149 M2 complex n.d. pos 26.2 3472 low 0.08 n.d. no 4 M 33 de novo 62.0 M2 normal wt pos 67.5 6206 low 0.08 6.5 no 5 M 71 relapse 91.0 M4 normal NPM1 pos 63.5 21,331 low 0.17 n.d. yes 6 M 83 de novo 109 M1 n.d. wt pos 19.1 8764 low 1.65 693 no 7 F 77 MDS 26.4 M1 normal wt pos 89.4 53,799 high 3.43 2746 no 8 M 46 de novo 26.9 M1 normal NPM1 n.d. n.d. 3472 low 1.56 n.d. no 9 M 68 MF 50.8 M4 normal D835 pos 69.4 1640 low 0.08 n.d.
  • Drug Resistance Updates 32 (2017) 23–46

    Drug Resistance Updates 32 (2017) 23–46

    Drug Resistance Updates 32 (2017) 23–46 Contents lists available at ScienceDirect Drug Resistance Updates journal homepage: www.elsevier.com/locate/drup Not only P-glycoprotein: Amplification of the ABCB1-containing MARK chromosome region 7q21 confers multidrug resistance upon cancer cells by coordinated overexpression of an assortment of resistance-related proteins ⁎ ⁎ Ilaria Genovesea,1, Andrea Ilarib,1, Yehuda G. Assarafc,1, Francesco Fazid, ,1, Gianni Colottib, ,1 a Dept. Biochemical Sciences, Sapienza University, P.le A. Moro 5, 00185 Rome, Italy b Institute of Molecular Biology and Pathology, Italian National Research Council (IBPM-CNR), c/o Dept. Biochemical Sciences, Sapienza University, P.le A. Moro 5, 00185 Rome, Italy c The Fred Wyszkowski Cancer Research Lab, Faculty of Biology, Technion-Israel Institute of Technology, Haifa, Israel d Dept. Anatomical, Histological, Forensic & Orthopedic Sciences, Section of Histology and Medical Embryology, Sapienza University, Via A. Scarpa 14-16, 00161 Rome, Italy ARTICLE INFO ABSTRACT Keywords: The development of drug resistance continues to be a dominant hindrance toward curative cancer treatment. ABC transporters Overexpression of a wide-spectrum of ATP-dependent efflux pumps, and in particular of ABCB1 (P-glycoprotein P-glycoprotein (P-gp) or MDR1) is a well-known resistance mechanism for a plethora of cancer chemotherapeutics including for ex- Cancer ample taxenes, anthracyclines, Vinca alkaloids, and epipodopyllotoxins, demonstrated by a large array of pub- Chemotherapeutic drugs lished papers, both in tumor cell lines and in a variety of tumors, including various solid tumors and hemato- Multidrug resistance logical malignancies. Upon repeated or even single dose treatment of cultured tumor cells or tumors in vivo with 7q21 amplicon Sorcin anti-tumor agents such as paclitaxel and doxorubicin, increased ABCB1 copy number has been demonstrated, resulting from chromosomal amplification events at 7q11.2-21 locus, leading to marked P-glycoprotein over- expression, and multidrug resistance (MDR).
  • RNA Editing at Baseline and Following Endoplasmic Reticulum Stress

    RNA Editing at Baseline and Following Endoplasmic Reticulum Stress

    RNA Editing at Baseline and Following Endoplasmic Reticulum Stress By Allison Leigh Richards A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Human Genetics) in The University of Michigan 2015 Doctoral Committee: Professor Vivian G. Cheung, Chair Assistant Professor Santhi K. Ganesh Professor David Ginsburg Professor Daniel J. Klionsky Dedication To my father, mother, and Matt without whom I would never have made it ii Acknowledgements Thank you first and foremost to my dissertation mentor, Dr. Vivian Cheung. I have learned so much from you over the past several years including presentation skills such as never sighing and never saying “as you can see…” You have taught me how to think outside the box and how to create and explain my story to others. I would not be where I am today without your help and guidance. Thank you to the members of my dissertation committee (Drs. Santhi Ganesh, David Ginsburg and Daniel Klionsky) for all of your advice and support. I would also like to thank the entire Human Genetics Program, and especially JoAnn Sekiguchi and Karen Grahl, for welcoming me to the University of Michigan and making my transition so much easier. Thank you to Michael Boehnke and the Genome Science Training Program for supporting my work. A very special thank you to all of the members of the Cheung lab, past and present. Thank you to Xiaorong Wang for all of your help from the bench to advice on my career. Thank you to Zhengwei Zhu who has helped me immensely throughout my thesis even through my panic.
  • An All-To-All Approach to the Identification of Sequence-Specific Readers for Epigenetic DNA Modifications on Cytosine

    An All-To-All Approach to the Identification of Sequence-Specific Readers for Epigenetic DNA Modifications on Cytosine

    bioRxiv preprint doi: https://doi.org/10.1101/638700; this version posted May 16, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. An All-to-All Approach to the Identification of Sequence-Specific Readers for Epigenetic DNA Modifications on Cytosine Guang Song1,6, Guohua Wang2,6, Ximei Luo2,3,6, Ying Cheng4, Qifeng Song1, Jun Wan3, Cedric Moore1, Hongjun Song5, Peng Jin4, Jiang Qian3,7,*, Heng Zhu1,7,8,* 1Department of Pharmacology and Molecular Sciences, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA 2School of Computer Science and Technology, Harbin Institute of Technology, Harbin, Heilongjiang 150001, China 3Department of Ophthalmology, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA 4Department of Human Genetics, Emory University School of Medicine, Atlanta, GA 30322, USA 5Department of Neuroscience and Mahoney Institute for Neurosciences, University of Pennsylvania, Philadelphia, PA 19104, USA 6These authors contributed equally 7Senior author 8Lead Contact *Correspondence: [email protected] (H.Z.), [email protected] (J.Q.). 1 bioRxiv preprint doi: https://doi.org/10.1101/638700; this version posted May 16, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. SUMMARY Epigenetic modifications of DNA in mammals play important roles in many biological processes. Identification of readers of these epigenetic marks is a critical step towards understanding the underlying molecular mechanisms. Here, we report the invention and application of an all-to-all approach, dubbed Digital Affinity Profiling via Proximity Ligation (DAPPL), to simultaneously profile human TF-DNA interactions using mixtures of random DNA libraries carrying four different epigenetic modifications (i.e., 5-methylcytosine, 5- hydroxymethylcytosine, 5-formylcytosine, and 5-carboxylcytosine).
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation

    Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation

    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
  • New Breast Cancer Risk Variant Discovered at 10Q25 in East Asian Women

    New Breast Cancer Risk Variant Discovered at 10Q25 in East Asian Women

    Published OnlineFirst May 15, 2013; DOI: 10.1158/1055-9965.EPI-12-1393 Cancer Epidemiology, Research Article Biomarkers & Prevention New Breast Cancer Risk Variant Discovered at 10q25 in East Asian Women Jiajun Shi1, Hyuna Sung2, Ben Zhang1, Wei Lu9, Ji-Yeob Choi2,5, Yong-Bing Xiang10, Mi Kyung Kim8,11, Motoki Iwasaki12, Jirong Long1, Bu-Tian Ji13, Sue K. Park2,3,5, Ying Zheng9, Shoichiro Tsugane12, Keun-Young Yoo3, Wenjing Wang9, Dong-Young Noh4,5, Wonshik Han4,5, Sung-Won Kim6, Min Hyuk Lee7, Jong Won Lee8, Jong-Young Lee14, Chen-Yang Shen15,16, Keitaro Matsuo17, Sei-Hyun Ahn8,11, Yu-Tang Gao10, Xiao Ou Shu1, Qiuyin Cai1, Daehee Kang2,3,5, and Wei Zheng1 Abstract Background: Recently, 41 new genetic susceptibility loci for breast cancer risk were identified in a genome- wide association study (GWAS) conducted in European descendants. Most of these risk variants have not been directly replicated in Asian populations. Methods: We evaluated nine of those nonreplication loci in East Asians to identify new risk variants for breast cancer in these regions. First, we analyzed single-nucleotide polymorphisms (SNP) in these regions using data from two GWAS conducted among Chinese and Korean women, including 5,083 cases and 4,376 controls (stage 1). In each region, we selected an SNP showing the strongest association with breast cancer risk for replication in an independent set of 7,294 cases and 9,404 controls of East Asian descents (stage 2). Logistic regression models were used to calculate adjusted ORs and 95% confidence intervals (CI) as a measure of the association of breast cancer risk and genetic variants.
  • Transcriptional Recapitulation and Subversion Of

    Transcriptional Recapitulation and Subversion Of

    Open Access Research2007KaiseretVolume al. 8, Issue 7, Article R131 Transcriptional recapitulation and subversion of embryonic colon comment development by mouse colon tumor models and human colon cancer Sergio Kaiser¤*, Young-Kyu Park¤†, Jeffrey L Franklin†, Richard B Halberg‡, Ming Yu§, Walter J Jessen*, Johannes Freudenberg*, Xiaodi Chen‡, Kevin Haigis¶, Anil G Jegga*, Sue Kong*, Bhuvaneswari Sakthivel*, Huan Xu*, Timothy Reichling¥, Mohammad Azhar#, Gregory P Boivin**, reviews Reade B Roberts§, Anika C Bissahoyo§, Fausto Gonzales††, Greg C Bloom††, Steven Eschrich††, Scott L Carter‡‡, Jeremy E Aronow*, John Kleimeyer*, Michael Kleimeyer*, Vivek Ramaswamy*, Stephen H Settle†, Braden Boone†, Shawn Levy†, Jonathan M Graff§§, Thomas Doetschman#, Joanna Groden¥, William F Dove‡, David W Threadgill§, Timothy J Yeatman††, reports Robert J Coffey Jr† and Bruce J Aronow* Addresses: *Biomedical Informatics, Cincinnati Children's Hospital Medical Center, Cincinnati, OH 45229, USA. †Departments of Medicine, and Cell and Developmental Biology, Vanderbilt University and Department of Veterans Affairs Medical Center, Nashville, TN 37232, USA. ‡McArdle Laboratory for Cancer Research, University of Wisconsin, Madison, WI 53706, USA. §Department of Genetics and Lineberger Cancer Center, University of North Carolina, Chapel Hill, NC 27599, USA. ¶Molecular Pathology Unit and Center for Cancer Research, Massachusetts deposited research General Hospital, Charlestown, MA 02129, USA. ¥Division of Human Cancer Genetics, The Ohio State University College of Medicine, Columbus, Ohio 43210-2207, USA. #Institute for Collaborative BioResearch, University of Arizona, Tucson, AZ 85721-0036, USA. **University of Cincinnati, Department of Pathology and Laboratory Medicine, Cincinnati, OH 45267, USA. ††H Lee Moffitt Cancer Center and Research Institute, Tampa, FL 33612, USA. ‡‡Children's Hospital Informatics Program at the Harvard-MIT Division of Health Sciences and Technology (CHIP@HST), Harvard Medical School, Boston, Massachusetts 02115, USA.
  • Transcriptional Fates of Human-Specific Segmental Duplications in Brain

    Transcriptional Fates of Human-Specific Segmental Duplications in Brain

    Downloaded from genome.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press Method Transcriptional fates of human-specific segmental duplications in brain Max L. Dougherty,1,7 Jason G. Underwood,1,2,7 Bradley J. Nelson,1 Elizabeth Tseng,2 Katherine M. Munson,1 Osnat Penn,1 Tomasz J. Nowakowski,3,4 Alex A. Pollen,5 and Evan E. Eichler1,6 1Department of Genome Sciences, University of Washington School of Medicine, Seattle, Washington 98195, USA; 2Pacific Biosciences (PacBio) of California, Incorporated, Menlo Park, California 94025, USA; 3Department of Anatomy, 4Department of Psychiatry, 5Department of Neurology, University of California, San Francisco, San Francisco, California 94158, USA; 6Howard Hughes Medical Institute, University of Washington, Seattle, Washington 98195, USA Despite the importance of duplicate genes for evolutionary adaptation, accurate gene annotation is often incomplete, in- correct, or lacking in regions of segmental duplication. We developed an approach combining long-read sequencing and hybridization capture to yield full-length transcript information and confidently distinguish between nearly identical genes/paralogs. We used biotinylated probes to enrich for full-length cDNA from duplicated regions, which were then am- plified, size-fractionated, and sequenced using single-molecule, long-read sequencing technology, permitting us to distin- guish between highly identical genes by virtue of multiple paralogous sequence variants. We examined 19 gene families as expressed in developing and adult human brain, selected for their high sequence identity (average >99%) and overlap with human-specific segmental duplications (SDs). We characterized the transcriptional differences between related paralogs to better understand the birth–death process of duplicate genes and particularly how the process leads to gene innovation.
  • A Temporally Controlled Sequence of X-Chromosome Inactivation and Reactivation Defines Female Mouse in Vitro Germ Cells with Meiotic Potential

    A Temporally Controlled Sequence of X-Chromosome Inactivation and Reactivation Defines Female Mouse in Vitro Germ Cells with Meiotic Potential

    bioRxiv preprint doi: https://doi.org/10.1101/2021.08.11.455976; this version posted August 11, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. A temporally controlled sequence of X-chromosome inactivation and reactivation defines female mouse in vitro germ cells with meiotic potential Jacqueline Severino1†, Moritz Bauer1,9†, Tom Mattimoe1, Niccolò Arecco1, Luca Cozzuto1, Patricia Lorden2, Norio Hamada3, Yoshiaki Nosaka4,5,6, So Nagaoka4,5,6, Holger Heyn2, Katsuhiko Hayashi7, Mitinori Saitou4,5,6 and Bernhard Payer1,8* Abstract The early mammalian germ cell lineage is characterized by extensive epigenetic reprogramming, which is required for the maturation into functional eggs and sperm. In particular, the epigenome needs to be reset before parental marks can be established and then transmitted to the next generation. In the female germ line, reactivation of the inactive X- chromosome is one of the most prominent epigenetic reprogramming events, and despite its scale involving an entire chromosome affecting hundreds of genes, very little is known about its kinetics and biological function. Here we investigate X-chromosome inactivation and reactivation dynamics by employing a tailor-made in vitro system to visualize the X-status during differentiation of primordial germ cell-like cells (PGCLCs) from female mouse embryonic stem cells (ESCs). We find that the degree of X-inactivation in PGCLCs is moderate when compared to somatic cells and characterized by a large number of genes escaping full inactivation.
  • Genetics of Distal Hereditary Motor Neuropathies

    Genetics of Distal Hereditary Motor Neuropathies

    GENETICSOFDISTALHEREDITARY MOTOR NEUROPATHIES By alexander peter drew A thesis submitted for the Degree of Doctor of Philosophy Supervised by Professor Garth A. Nicholson Dr. Ian P. Blair Faculty of Medicine University of Sydney 2012 statement No part of the work described in this thesis has been submitted in fulfilment of the requirements for any other academic degree or qualification. Except where due acknowledgement has been made, all experimental work was performed by the author. Alexander Peter Drew CONTENTS acknowledgements ............................. i summary .................................... ii list of figures ................................ v list of tables ................................ viii acronyms and abbreviations ..................... xi publications ................................. xiv 1 literature review ........................... 1 1.1 Molecular genetics and mechanisms of disease in Distal Hereditary Motor Neuropathies . .1 1.1.1 Small heat shock protein family . .2 1.1.2 Dynactin 1 (DCTN1).....................9 1.1.3 Immunoglobulin mu binding protein 2 gene (IGHMBP2) 11 1.1.4 Senataxin (SETX)....................... 14 1.1.5 Glycyl-tRNA synthase (GARS)............... 16 1.1.6 Berardinelli-Seip congenital lipodystrophy 2 (SEIPIN) gene (BSCL2)......................... 18 1.1.7 ATPase, Cu2+-transporting, alpha polypeptide gene (ATP7A) 20 1.1.8 Pleckstrin homology domain-containing protein, G5 gene (PLEKHG5)........................... 21 1.1.9 Transient receptor potential cation channel, V4 gene (TRPV4) 22 1.1.10 DYNC1H1 ........................... 23 1.1.11 Clinical variability in dHMN . 24 1.1.12 Common disease mechanisms in dHMN . 29 2 general materials and methods ................. 32 2.1 General materials and reagents . 32 2.1.1 Reagents and Enzymes . 32 2.1.2 Equipment . 33 2.1.3 Plasticware . 33 2.2 Study participants . 34 2.3 DNA methods .