Independent Amplification of Two Gene Clusters on Chromosome 4 in Rat Endometrial Cancer: Identification and Molecular Characterization1

[CANCER RESEARCH 61, 8263–8273, November 15, 2001] Independent Amplification of Two Gene Clusters on Chromosome 4 in Rat Endometrial Cancer: Identification and Molecular Characterization1

Anna Walentinsson,2 Khalil Helou, Ville Wallenius, Hans J. Hedrich, Claude Szpirer, and Go¨ran Levan Department of Cell and Molecular Biology–Genetics, Go¨teborg University, SE-40530 Gothenburg, Sweden [A. W., K. H., G. L.]; Research Centre for Endocrinology and Metabolism, Department of Internal Medicine, Sahlgrenska University Hospital, Go¨teborg University, S-413 45 Gothenburg, Sweden [V. W.]; Laboratory of Animal Science, Medizinische Hochschule, DE-30623 Hannover, Germany [H. J. H.]; and IBMM, Universite´Libre de Bruxelles, BE-6041 Gosselies, Belgium [C. S.]

ABSTRACT sequences has been found to be quite simple and consisting of continuous repeats of not much more than the target gene (6, 7). However, The BDII rat is genetically predisposed to hormone-dependent endo- a more common situation is that the amplified sequences are struc- metrial adenocarcinoma and was used to model human cancer. Tumors turally rather complex and sometimes also internally rearranged, arising spontaneously in strain crosses involving BDII rats were analyzed by means of comparative genome hybridization. The most common aber- encompassing two or more coamplified genes, including the target ration was amplification of the proximal region of rat chromosome 4, gene (8, 9). Hence, the prevalence of gene amplification in diverse centered around bands q12-q22. The copy numbers of 15 cancer-related tumor types, as well as its biological and clinical significance in genes from the region were examined in tissue cultures of 11 endometrial neoplastic development, makes amplified chromosomal regions inter- carcinomas (10 endometrial adenocarcinomas and 1 endometrial squa- esting targets for detailed genetic analysis. Identification and charac- mous cell carcinoma) and one peritoneal mesothelioma. Amplification in terization of the amplified genes can provide valuable insights into the rat chromosome 4 was detected in six tumors (50%), five of which carried pathogenesis of cancer and may also yield molecular markers for the two separate amplified regions, situated at 4q12-q13 and 4q21-q22, inter- evaluation of prognosis and therapy. rupted by a nonamplified segment at 4q13-q21.1. The genes Cdk6 (cyclin- Carcinoma of the uterine corpus, also known as endometrial carci- dependent kinase 6) and Met (hepatocyte growth factor receptor) were noma, is the most frequently diagnosed malignancy of the female located in the core of each amplified region and were amplified most reproductive tract and the fourth most common cancer among women recurrently and at the highest levels among the genes tested. Using fluo- 3 rescence in situ hybridization on tumor metaphases, it was observed that (10). Still, the molecular genetic features of this tumor have yet to be the amplified Cdk6 and Met sequences were situated on typical homoge- described in significant detail. The inbred BDII rat strain is genetically 4 neously staining regions (HSRs). In three tumors, both genes were ampli- prone to spontaneous hormone-dependent EAC (11) and may serve fied in the same HSRs, whereas in two tumors, the amplified sequences of as a genetic model system of this tumor type. In a series of uterine each gene were situated in separate HSRs. In addition, Cdk6 and Met tumors (mostly EACs) developed in F1, F2, and backcross progeny amplification was consistently associated with a corresponding increase in from crosses between BDII rats and rats of either of two nonsuscep- gene expression, suggesting that the two genes might represent the targets tible strains (BN and SPRD), a previous cytogenetic investigation for the amplifications. In the sixth tumor, which carried amplified se- disclosed repeatedly occurring manifestations of gene amplification in quences of Met but not of Cdk6, coexpression of Met and the normally the form of HSRs. By using CGH, we could conclude that most silent hepatocyte growth factor gene (Hgf; the ligand of Met) was observed. This finding suggests that an autocrine signaling circuit might be commonly, the amplified sequences originated from a region in prox- operating in this particular tumor. Taken together, our findings suggest imal RNO4, centered around bands q12-q22 (12). Similar amplifica- that up-regulation of Cdk6 and/or Met may contribute to the development tion in the proximal part of RNO4 has been detected previously in a of endometrial cancers in the BDII rat. subset of 7, 12-dimethylbenz[a]anthracene-induced rat sarcomas (13– 15), suggesting that involvement of this chromosome region represents a major pathway in a variety of tumor types. In the present INTRODUCTION investigation, we have undertaken a detailed qualitative and quanti- tative characterization of the amplification of RNO4-derived se- Lines of evidence suggest that the development of neoplastic dis- quences. Our findings suggest that at least two subregions are in- ease requires multiple genetic lesions, ranging from single nucleotide volved in independent amplifications in these tumors. Each of the alterations to gross chromosomal changes, occurring sequentially in a regions contains cancer-related genes, which may interact in the cell lineage (1). DNA amplification represents one major molecular development of endometrial cancers. pathway that is thought to play a pivotal role in tumor development, in view of the fact that it provides a mechanism by which tumor cells can trigger enhanced expression of genes whose products are involved MATERIALS AND METHODS in cell proliferation (2). In human cancers, the number of reports on gene amplification, often in relation to progressive tumor growth and Tumor Material. Females of the inbred rat strain BDII/Han are predisposed to cancer in the endometrium of the uterus (EAC; Refs. 11 and 16). poor prognosis, is continually growing (3–5). In the majority of cases Virgin females (Ͼ90%) will develop this neoplasm, usually before 24 months in which the amplified chromosome region has been identified and of age. When BDII/Han rats were interbred with rats from the two nonsus- characterized, a proto-oncogene appears to be the target on which ceptible strains BN/Han and SPRD-Cu3/Han, a large fraction of the F1, F2, selection acts (4). In some tumors, the architecture of the amplified and backcross animals spontaneously developed tumors. Most of these tumors were pathologically characterized as EAC, but in addition, some other types of Received 6/22/01; accepted 9/19/01. uterine and nonuterine tumors were present (see Ref. 12). The main material The costs of publication of this article were defrayed in part by the payment of page for the present investigation was 12 tissue cultures derived from 11 endome- charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 Supported by grants from the European Commission (contract ERBBio4CT960562), 3 Internet address: http://www.cancer.org. the Swedish Cancer Society, the Nilsson-Ehle Foundation, and the IngaBritt and Arne 4 The abbreviations used are: EAC, endometrial adenocarcinoma; HSR, homoge- Lundberg Research Foundation. neously staining region; CGH, comparative genome hybridization; RNO4, rat chromo- 2 To whom requests for reprints should be addressed, at Department of Cell and some 4; ESCC, endometrial squamous cell carcinoma; FISH, fluorescence in situ hybrid- Molecular Biology–Genetics, Go¨teborg Univeristy, Box 462, S-405 30 Gothenburg, ization; PAC, P1 artificial chromosome; RT-PCR, reverse transcription-PCR; HGF, Sweden. Phone: 46-31-7733298; Fax: 46-31-7732599; E-mail: anna.walentinsson@ hepatocyte growth factor; MET, HGF receptor; HSA7, human chromosome 7; DCSE, gen.gu.se. diploid chromosome set equivalent; CDK, cyclin-dependent kinase; SF, scatter factor. 8263

Table 1 Oligonucleotide sequences of primer pairs used in RT-PCR and size in bps of corresponding amplified fragmentsa PCR fragment Gene symbol Gene description Forward primer Reverse primer size (bp) Cdk5 Cyclin-dependent kinase 5 ggaaggtaatggaaccacga gcagggagaatctgccataa 419 Hgf Hepatocyte growth factor (scatter factor) cccaaatgtgacgtgtcaag tgttttgttttggcacagga 335 Dmtf1 Cyclin D binding myb-like transcription factor 1 aggatacctgcaacacaggg gcaatttgccttttgatggt 373 Abcb1 ATP-binding cassette, subfamily B (MDR/TAP/PGY), member 1 catcgacagcttctcaacca actcagaggcaccagtgtca 836 Cyp51 Cytochrome P450, 51 (lanosterol 14-␣-demethylase) ccttcacgcttagccttgtc gtatgcaactcccttcccaa 332 Cdk6 Cyclin-dependent kinase 6 gcctatgggaaggtgttcaa tgaagaaagtccagacctcg 344 Tac1 Tachykinin, precursor 1 (substance K, substance P) gtttgcagaggaaatcggtg gcgcttctttcataagccac 312 Asns Asparagine synthetase ctttccgtgcagtgtctgag tccaggcctcctgataaaag 746 Cav1 Caveolin 1 agattgatctggtcaaccgc atctcttcctgcgtgctgat 392 Met Hepatocyte growth factor receptor (MET proto-oncogene) aaagccaatgtgtcaggagg tcgggagggtaggaagagtt 317 Wnt2 Wingless-type MMTV integration site family member 2 tccttccagctctgttgttg gcctttgtttacgccatctc 262 Cftr Cystic fibrosis transmembrane conductance regulator tgagggcagcagctattttt ttgttccaggtggtagaggc 180 Smoh Smoothened (Drosophila) homolog cacttaccagcctctctcgg ctgaaggtgatgagcacgaa 360 Braf V-raf murine sarcoma viral oncogene homolog B1 gaaagtggcatggtgatgtg aggtatcctcgtcccaccat 601 Arhgef5 Rho guanine nucleotide exchange factor 5 (TIM proto-oncogene) atgctcccttctcctccatt ttggcagtcttgactcgatg 442 a Each gene was coamplified with ␤-actin.

trial tumors (10 classified as EACs and 1 classified as ESCC) and from 1 tumor template. PCR was performed according to standard procedures; however, classified as peritoneal mesothelioma. DNA was extracted according to stand- [F]-dUTP R110 (0.4 ␮M; PE Applied Biosystems, Foster City, CA) was added ard procedures using phenol/chloroform extraction. to each 10-␮l reaction mixture. Thermal cycling was performed by initial Chromosome Preparations and Cytogenetic Analysis. Chromosome denaturation at 94°C for 3 min, followed by 28 cycles consisting of 94°C for preparations were made from cultured normal rat embryo fibroblasts, 2n ϭ 42 1 min, 55°C-60°C for 1 min, and 72°C for 2 min and ending by an extension (for single- and dual-color FISH mapping), as well as from the 12 tumor tissue step of 72°C for 7 min. After PCR, a 2-␮l aliquot was collected and subjected cultures (for DNA sequence amplification and cytogenetic analyses). Spreads to electrophoresis on Tris/acetate/EDTA (TAE)-buffered agarose gels. For a with elongated chromosomes (mainly prometaphases) were prepared from the semiquantitative analysis, the remaining 8-␮l aliquot was ethanol precipitated rat embryo fibroblasts by treatment of cells with ICRF-145 [(4,4Ј-(1,2- and subsequently separated by PAGE in a 377 automated fluorescent DNA ethanediyl)bis(2,6-piperazinedione), 25 ␮M; Funakoshi, Tokyo, Japan] during sequencer (PE Applied Biosystems). The data were collected and analyzed the final 60 min and Colcemid (0.05 ␮g/ml; Life Technologies, Inc., Grand with the Genescan Analysis Software (PE Applied Biosystems). Island, NY) during the final 20 min before harvest (17). Tumor tissue cultures Western Blot of the Rat Met Protein. The Western blot experiments were were treated with Colcemid but not with ICRF-145. The cells were harvested performed under reducing conditions, mainly as described previously (13). In by mitotic shake-off, pelleted by centrifugation, and resuspended in 0.075 M brief, proteins were prepared from the cultured tumor cells by sonication. A KCl at room temperature for 30 min. Methanol-acetic acid fixation was carried total amount of 20 ␮g of protein/sample was run on NuPage 4–12% Bis-Tris out as described previously (18). The tumor tissue metaphases were subjected gels, using a Novex Xcell II system (Novex, San Diego, CA), and then to cytogenetic analysis after G-banding (18), and 10–20 cells from each tumor transferred to PVDF membranes (Novex) by electroblotting. The membranes were karyotyped. CGH was performed as described previously (12). were blocked overnight by incubation in 10% dry milk in a Tris-buffered saline Physical Localization of PAC Clones and DNA Sequence Amplification buffer (50 mM Tris-HCl, 137 mM NaCl, and 0.1% Tween 20). The blots were Analysis by FISH. To obtain probes suitable for FISH, genomic DNA clones then probed with a rabbit polyclonal antimouse Met antibody (SP260; Santa were isolated by screening of a rat PAC library, RPCI-31 (BAC-PAC re- Cruz Biotechnology, Santa Cruz, CA) and then with an antirabbit horseradish Ј sources; Roswell Park Cancer Institute, Buffalo, NY), using as probes purified peroxidase-linked F(ab )2 fragment (Amersham). The membranes were PCR-generated 200-1200-bp fragments corresponding to genes of interest or washed and exposed to the enhanced chemiluminescence detection system full-length cDNAs (for Hgf and Met). The isolation and verification of the (Amersham). PACs have been described in detail elsewhere (19). The PACs were used as DNA Sequencing of Exons 17–19 of the Rat Met Gene. To evaluate the probes in single- and dual-color FISH, which was performed essentially occurrence of mutations in Met exons 17, 18, and 19 encoding the tyrosine according to published procedures (19, 20). kinase domain of the Met, a total of 100 ng of cDNA from each of the tumor Southern Blot. Genomic DNA (15 ␮g) from the tumor tissue cultures, as tissue cultures was subjected to PCR amplification, using the primers 5Ј- well as from normal rat BDII liver (included as a control), was digested with ccaccccaatgttctctcac-3Ј and 5Ј-ggtggtgaacttttgcgtct-3Ј. The resulting 382-bp EcoRI. Purified 200-1200-bp PCR products corresponding to the genes, as fragment was purified by gel band purification using GFX spin columns well as the Hgf and Met cDNAs, were radioactively labeled with [␣-32P]dCTP (Amersham Pharmacia Biotech, Piscataway, NJ), and DNA sequencing was by the random priming method (21) and subsequently hybridized one by one performed using the Prism BigDye Terminator chemistry (PE Applied Bio- to the filter. After washing at high stringency, the filter was exposed to X-ray systems). The sequencing products were ethanol precipitated and then sepa- film (Hyperfilm-MP; Amersham, Buckinghamshire, United Kingdom). The rated by PAGE in a 377 automated fluorescent DNA sequencer (PE Applied film was developed, and the approximate level of amplification for each gene Biosystems). DNA sequence analysis was carried out with the Sequencing was calculated by comparison of the hybridization signal intensities (on the Analysis software, ver 3.3 (PE Applied Biosystems). The fragment was se- X-ray films) between tumor and normal control BDII DNA, using the dedi- quenced in both directions, using one or the other of the two PCR primers. cated software Quantity One, ver 4.2.2 (Bio-Rad Laboratories, Hercules, CA).5 cDNA from cultured rat embryonic cells was used as control. To compensate for minor variations in sample loading, signals from a 146-bp ␤-actin control probe (PCR amplified using the primers 5Ј-cacggcattgtaaccaactg-3Ј and 5Ј-ctgggtcatcttttcacggt-3Ј) were used for normalization. RESULTS RT-PCR. Cytoplasmic RNA was extracted from the tumor tissue cultures and from cultured rat embryonic cells using the RNeasy Mini kit (Qiagen, Cytogenetic and CGH Findings in Rat Uterine Tumors. Tissue Valencia, CA), and cDNA was prepared according to standard procedures cultures were established from 11 malignant rat uterine tumors (10 using the Superscript preamplification system (Life Technologies, Inc.). With EACs and 1 ESCC) derived from F1, F2, and backcross animals in the the primer pairs listed in Table 1, each of the 15 genes was coamplified with two crosses. The tissue cultures were subjected to cytogenetic analy- ␤-actin (primers 5Ј-cacggcattgtaaccaactg-3Ј and 5Ј-ctgggtcatcttttcacggt-3Ј, sis, which revealed that most of the EAC tumors displayed chromo- generating a 146-bp fragment) using the tumor cDNAs (100 ng of each) as some numbers in the triploid/hypotetraploid region (2n ϭ 53–69), but RUT2 and RUT7 were near diploid, and NUT51 and NUT82 were 5 Internet address: http://www.bio-rad.com. near tetraploid. The chromosome number of the ESCC culture, RUT5, 8264

somes, as well as on interphase chromatin in resting cell nuclei, the chromosomal sublocalization and relative order of 15 loci were determined, as well as the distances between them, as described in detail elsewhere (19). We found that all of the selected genes mapped on RNO4 as predicted, and the following map could be constructed (cytogenetic band position is given in parenthesis): (4cen)–Cdk5 (q11.2)–8–10 Mb–Hgf (q12.1)–7–9Mb–Dmtf1 (q12-q13)–300–500 kb–Abcb1 (q12-q13)–4–6Mb–Cyp51 (q13)–300–500 kb–Cdk6 (q13)–4–7Mb–Tac1 (q13-q21)–50–200 kb–Asns (q13-q21)–4–6 Mb–Cav1 (q21.1-q21.2)–100–300 kb–Met (q21.2)–500–1000 kb– Wnt2 (q21.2-q21.31)–200–500 kb–Cftr (q21.2-q21.31)–10Ϫ15 Mb– Smoh (q22)–10Ϫ15 Mb–Braf (q22-q23)–3–5Mb–Arhgef5 (q23.3)– (4qter; see also Fig. 4). If certain evolutionary events are taken into account, both gene order and distances between loci conform excep- tionally well with the corresponding homologous human genes on HSA7q (19). Gene Copy Number Changes in the RNO4 Proximal Region. To map the amplified region on RNO4 in detail and to be able to define the minimal region/regions of common amplification, the copy number for each of the 15 genes distributed across bands q11-q23 of RNO4 was monitored in the 12 tumor tissue cultures by conventional Southern blot analysis. The PCR-generated probes were hybridized one by one to filters containing equal quantities of digested DNA from each of the tumor samples, along with the normal control sample Fig. 1. Cytogenetic manifestations of gene amplification, represented by HSRs, were seen in 11 of 12 tumors. The chromosomal origin of the amplified sequences was (liver DNA from a BDII animal). Examples of the results are shown determined by CGH analysis (see Table 2). The figure shows a metaphase spread in in Fig. 3. After hybridization, the observed bands were densitometri- G-banding from the near-tetraploid NUT82 tumor. Most of the chromosomes look normal, but markers are apparent, including the two long HSRs (arrowheads). Both HSRs were cally scanned, and the approximate level of amplification was deter- derived from sequences in the proximal region of RNO4. mined for each probe by calculating the ratio between the signal intensity obtained from the individual tumor sample with that obtained from the normal control sample. To distinguish gene amplifi- was also in the near-tetraploid region. For comparison, a tissue culture cation from low-level RNO4 copy number increase (e.g., trisomy), as from a peritoneal mesothelioma was included in the analysis (desig- well as from hyper-diploidy, only gene copy number increases Ն2.5- nated RUT29) and was found to be hyperdiploid (2n Ϸ 44). Cytoge- fold were scored as significant, corresponding to Ն5 copies/DCSE. netic manifestations of gene amplification, represented by HSRs of Significantly elevated copy numbers (amplification) for some of the various sizes, were present in 11 of the 12 tumor cultures (Fig. 1). By 15 genes studied were detected in 6 of the 12 tumor cultures (RUT5, means of CGH analysis, the approximate position of the regions, from 7, 13, 29, NUT51, and 82; Fig. 4). For five of these tumors (RUT7, 13, which the amplified sequences were derived, could be determined for 29, NUT51, and 82), the Southern blot data coincided with the CGH each of the cultured tumors (Table 2; criterion used was a green:red findings, which displayed fluorescence ratios Ͼ2.5 in the RNO4q12- fluorescence ratio Ͼ2.5). As shown, chromosome regions involved in q22 region (Table 2). The CGH analysis of the sixth tumor, RUT5, did amplification were tentatively identified in all tumor cultures display- not disclose any significant DNA copy number change affecting ing HSRs, and the data set suggests that at least eight different RNO4. However, the resolution of CGH is limited, and gain of DNA chromosome regions were involved in amplification in this material, copy number affecting a small region (Յ2–4 Mb) may be undetect- some of them more than one time. The region most commonly exhibiting amplification was RNO4q12-q22 (Fig. 2). This was in Table 2 Signs of gene amplification in the rat tumor tissue cultures studied, as accord with the CGH findings in the primary tumors, from which the determined by cytogenetic analysis and CGH tissue cultures were derived. In fact, moderate- to high-level gain of CGH findings sequences from RNO4 was the most common alteration, affecting 11 Tumor Animala Pathology HSR (FRb Ͼ 2.5) (58%) of 19 primary malignant EACs or totally 12 (55%) of 22 RUT2 SPRD(F1) EAC ϩ 6q13-q21 tumors, including three additional tumors classified as uterine sar- RUT3 SPRD(F2) EAC ϪϪc RUT6 SPRD(F2) EAC ϩ 8cen-q22 coma, uterine carcinoma, and peritoneal mesothelioma, respectively RUT13 SPRD(F2) EAC ϩ 4q12-q22 (12). Furthermore, in 10 (45%) of the 22 primary tumors, the fluo- RUT7 BN(F1) EAC ϩ 4q21-q22 rescence ratio curves were indicative of high-level copy number 5cen-q22 RUT12 BN(F1) EAC ϩ 8q13-q24 increases confined to RNO4q12-q22, which was suggestive of gene Xq13-q21 amplification (defined as Ն5-fold increase in copy number; Ref. 2; RUT25 BN(F2) EAC ϩ Xq12-q21 Fig. 2). RUT30 BN(F2) EAC ϩ 6q13-q21 12cen-q14 Construction of a Physical Framework Map of the RNO4 Prox- NUT51 BN(BC1) EAC ϩ 4q21-q22 imal Region. To be able to define and delimit the amplified RNO4 NUT82 BN(BC1) EAC ϩ 4q12-q22 RUT5 BN(F2) ESCC ϩ 7q31-35 segment, and to pinpoint putative tumor-associated loci, a detailed RUT29 BN(F2) Peritoneal ϩ 4q12-q22 molecular cytogenetic characterization of the region was required. mesothelioma 9q12-q32 Exploiting comparative mapping data from HSA7q21 and 7q31–36 a SPRD(F1), F1 animal from SPRDxBDII cross; SPRD(F2), F2 animal from SPRDx- and mouse chromosomes 5 (0–12 cM) and 6 (0–15 cM), we were able BDII cross; BN(F1), F1 animal from BNxBDII cross; BN(F2), F2 animal from BNxBDII cross; BN(BC1), backcross animal from F1(BNxBDII)xBDII cross. to identify gene candidates for mapping and amplification analysis. b FR, fluorescence ratio (FITC/rhodamine). Using dual-color FISH on rat metaphase and prometaphase chromo- c This tumor exhibited trisomy for the entire RNO4 (FR Ϸ 1.5). 8265

Fig. 2. Examples of CGH fluorescence ratio profiles of RNO4 from the rat uterine tumor material. The 12 sets of profiles represent nine different tumors (ST, solid tumor; TC, tissue culture). A region centered around 4q12-q22 exhibits high- level gain of copy number, indicative of gene amplification. Note that there is a tendency of bimo- dality in some of the profiles.

able (22). Moreover, in the CGH analysis of RUT13, it was observed not uniform; instead, they varied in extension and in amplification that the average fluorescence ratio gave double peaks in the level among different tumors. Among the gene probes exhibiting RNO4q12–22 region. Accordingly, individual metaphases in the com- significantly elevated copy numbers in the RNO4q12-q13 region, posite (FITC/rhodamine) CGH pictures of RUT13 sometimes showed Cdk6 displayed the highest level of amplification, ranging from 10- two distinct regions of elevated green:red signal ratio in the proximal fold in RUT29 to Ͼ50-fold in NUT82 (Fig. 3). In four (RUT13, 29, part of RNO4 (Fig. 5A). A similar hybridization pattern was occa- NUT51, and 82) of the five tumors containing amplified Cdk6 se- sionally seen in individual metaphases of another three of the ana- quences, Cyp51 was coamplified; however, the amplification level lyzed tumors: RUT29, NUT51, and 82. Thus, these observations was considerably lower than that of Cdk6, ranging from 5-fold in suggested that two adjacent or possibly overlapping amplicons might RUT29 to ϳ30-fold in RUT13 and NUT82. Slightly elevated copy be present in these four tumors. The copy numbers detected by numbers were also seen for Abcb1 in NUT82 (ϳ5 copies/DCSE) and Southern blot analysis corroborate the interpretation that there were for both Abcb1 and Dmtf1 in RUT29 (ϳ6 copies/DCSE). two distinct amplified regions, which had been derived from bands The genes Cav1 and Met (Fig. 3) were consistently coamplified in 4q12-q13 and 4q21-q22, respectively. As is shown in Fig. 4, the more all six tumors containing amplicons corresponding to the distal region. distal region (4q21-q22) was amplified in all six tumors, whereas the The levels of amplification of the two genes were closely correlated to more proximal region (4q12-q13) was amplified in five of them (all each other and ranged from 6–7-fold in RUT7 to Ͼ75-fold in RUT13. except RUT7). The two amplified regions were disconnected by a Although the exact copy numbers were more difficult to assess when segment containing the genes Asns and Tac1, both located at the there was high-level amplification, the data suggested that the Cav1 4q13-q21 transition. Thus, the copy numbers of Asns (Fig. 3) and copy number was slightly lower than that of Met in most tumors. The Tac1 were in the normal range (ϳ2 copies/DCSE) in RUT29 but difference in Cav1 and Met copy number was most pronounced in slightly elevated in RUT13 (ϳ3 copies/DCSE) and NUT82 (3–4 RUT29, in which the degree of Cav1 amplification was ϳ33-fold, as copies/DCSE). In RUT5 and NUT51, the analysis showed that there compared with the Ͼ50-fold amplification of Met. In addition to Cav1 was a decrease in copy number (ϳ1 copy/DCSE) of these two genes. and Met amplification, five tumors (RUT7, 13, 29, NUT51, and 82) For both amplified regions, it was obvious that the amplicons were also contained amplified sequences of the Wnt2 gene. The estimated copy numbers of Wnt2 ranged from ϳ4-fold in RUT7 to ϳ30-fold in RUT13. Furthermore, amplification of Cftr was detected in four tumors (RUT7, 13, NUT51, and 82), and the estimated copy numbers were almost identical to those observed for Wnt2. Of the four tumors harboring amplified Cftr sequences, elevated levels of Smoh were seen in RUT7 (ϳ6 copies/DCSE) and in RUT13 (ϳ5 copies/DCSE). Interestingly, low-level amplification (ϳ6 copies/DCSE) of Smoh was also observed in RUT29, a tumor presenting with a normal Cftr copy number (2 copies/DCSE). Although not conclusive, these results suggest that this particular tumor might contain three distinct amplicons. Reduction in copy number from the normal 2 copies/DCSE was detected for some gene probes in the present tumor material (Fig. 4). A common observation was that copy numbers Ͻ1.5 copies/DCSE were scored for gene probes flanking amplified regions, e.g., Hgf, Dmtf1, and Abcb1 were all present at a lower copy number than normal in RUT13, and the same was true for Wnt2, Cftr, and Smoh in RUT5. Likewise, decreased copy numbers of Tac1, Asns, and Smoh were seen in NUT51. The lowest copy numbers of all were recorded in RUT7 for the genes Cdk6, Tac1, and Asns (ϳ0.5 copies/DCSE). As Fig. 3. Examples from the Southern blot analysis of gene amplification for loci in the proximal part of RNO4 in the rat uterine tumors studied. Filters with EcoRI-restricted mentioned previously, this tumor contained only one amplicon, with genomic DNA from 12 tumor tissue cultures and control liver DNA (BDII) were low-level amplification, corresponding to the distal region. Thus, the sequentially subjected to hybridization with probes corresponding to each of the 15 genes. data strongly suggest that in RUT7, there is an interstitial deletion of In addition, a probe corresponding to ␤-actin was hybridized to the filter as a loading control. Subsequently, the relative amount of each gene was determined in the tumor bands 4q13-q21 adjacent to the amplification encompassing bands DNAs as described. Results are shown for 3 of the 15 genes studied (Cdk6, Asns, and 4q21-q22. Met). There are very clear signs of gene amplification (signal intensity increased by Chromosomal Sublocalization of Amplified Sequences. To ob- Ն2.5-fold compared with control levels in normal DNA) for the Met gene, representing the 4q21-q22 amplicon, in six of the tumors (RUT5, 7, 13, 29, NUT51, and 82). For five tain additional information on the chromosomal sublocalization of the of them (all except RUT7), there was amplification also of Cdk6, representing the amplified loci, as well as on the intercellular heterogeneity within 4q12-q13 amplicon. The Asns gene, situated between Cdk6 and Met, was not amplified in any of the tumors. Furthermore, both Cdk6 and Asns display much reduced signal in each tumor, the isolated PAC clones were used one by one as probes RUT7, and the Asns signal is slightly reduced in RUT5 and NUT51. in FISH on chromosome slides prepared from the six tumor tissue 8266

Fig. 4. On the left, the ideogram of RNO4 is shown, including higher magnification of the proximal part. The cytogenetic localization of the 15 genes analyzed is indicated. The notches on the thin line immediately to the right of the ideogram shows the approximate physical positions of the genes (not completely to scale; for details, see Ref. 19). The diagrams in the right part of the figure show the copy number level for each studied locus in the six tumors (E connected by ----). Copy number classes refer to the number of copies per DCSE; thus, when there is no amplification or reduction, this value will be 2; when there is amplification, the value should be Ն5. A value Յ1.5 is considered to be indicative of copy number reduction (deletion). Division into classes: A ϭϽ1; B ϭ 1–1.5; C ϭ 1.6–4; D ϭ 5–10; E ϭ 11–25; F ϭ 26–40; G ϭ 41–55; H ϭ 56–70; I ϭ 71–90; and J ϭϾ90 copies/DCSE, of which class C represents the normal range. The diagrams generated resemble the patterns seen in the CGH analysis but give much greater detail. Note that there are some regions which actually show reduction in copy numbers (shaded) suggestive of chromosomal deletion, perhaps occurring during the actual amplification process. The data strongly suggest the involvement of two distinct targets for gene amplification on RNO4 in these tumors. cultures containing RNO4 amplification. In all tumors, distinct hy- areas of the interphase nuclei, whereas the Cdk6 signals in most cells bridization signals at the “native” site of the gene in the RNO4q12- were confined to one cluster (Fig. 5C). In RUT29, the signal counts q22 region were obtained on all intact RNO4 chromosomes. In con- revealed that Cdk6 was present in ϳ20 copies, which was located on cordance with the results from Southern blot analysis, signs of one HSR, whereas high-level amplification of Met was seen on two amplification of some genes were seen in all six tumors. For these HSRs. The distribution of the Met signals on the HSRs was ladder like gene probes, clusters of extensive hybridization were detected in and resembled that observed in RUT13. resting cell nuclei, and in metaphases, the additional signals were In contrast to the situation in RUT13 and RUT29, the Cdk6 and Met located at chromosomal sites separate from the native gene sites at probes yielded hybridization on the same HSRs in RUT5, NUT51, RNO4, usually on typical HSRs. The distribution of the signals over and NUT82. In RUT5, the two probes cohybridized to two HSRs, one the HSRs varied from tightly clustered, forming compact “chromo- large that was situated in a large subtelocentric chromosome and one some paint-like” structures to rather dispersed on elongated HSRs. small that was situated in the distal part of RNO4. It was also observed Although the exact number of signals could not be determined in that the RUT5 cell population was homogenous with respect to the cases of high-level amplification, the signal counts generally corre- Cdk6 copy number and heterogeneous with respect to the Met copy lated well with the copy numbers estimated from the Southern blot. It number. On the basis of the signal counts, the number of Cdk6 copies was also noticed that the intercellular heterogeneity within each tumor was 50–60 in every cell, whereas ϳ15–20 Met copies were present in was considerable, in copy number and organization of probe signals, 90% of the cells while the remaining 10% presented with high-level and, to a lesser extent, in number and size of the HSRs. Met amplification. In the latter fraction of cells, the Met signals To study the chromosomal sublocalization of the amplified se- formed very compact, ladder-like structures on the larger one of the quences derived from the two amplified subregions, cohybridization two HSRs. In contrast, the pattern of Cdk6 signals was quite uniform of differentially labeled PACs representing Cdk6 (located at 4q13) and not very compact on both HSRs in RUT5. In NUT82, the probes and Met (located at 4q21.2), respectively, was performed onto met- corresponding to Cdk6 and Met yielded numerous hybridization sig- aphase spreads from the five tumors containing two amplicons in nals dispersed over the whole length of two long HSRs. The Cdk6 RNO4. In RUT13 and RUT29, the two probes hybridized to separate signal distribution on the HSRs was typically ladder like, whereas the HSRs. In accordance with the Southern blot data, RUT13 contained distribution of Met signals was uniform (Fig. 5, E–G). As could be high-level amplification of sequences corresponding to both Cdk6 and expected from the analysis of metaphases, the Cdk6 and Met signals Met. Notably, the Met signals were more numerous than those of were clustered on top of each other in interphase nuclei (Fig. 5D). A Cdk6. In the majority of metaphase spreads of this tumor, the Cdk6 similar hybridization pattern was observed in NUT51, which also probe gave rise to a uniform and compact hybridization pattern on one contained two long HSRs. However, the signal counts suggested that HSR. The amplified Met sequences in the same tumor were consis- the Cdk6 and Met copy numbers were somewhat lower than those tently located on two HSRs, which were distinct from those harboring observed in NUT82. amplified sequences of Cdk6. In contrast to the uniform Cdk6 signal mRNA Expression. DNA amplification in tumors is usually ac- pattern, the Met signals were unevenly distributed on these HSRs, companied by an elevated expression of the amplified gene (3). Thus, forming regions of very compact hybridization adjacent to regions RT-PCR was used to examine the mRNA levels in the tumor tissue with virtually no hybridization, in a ladder-like fashion (Fig. 5B). cultures. One by one, the genes were coamplified with ␤-actin, using Furthermore, as would be expected from the chromosomal sublocal- equal amounts of each tumor cDNA as template. We found that ization of signals, the Met signals were clustered to two restricted ␤-actin was expressed at equal levels in all tumors. On the basis of the 8267

Fig. 5. A, results from CGH analysis of the RUT13 rat EAC tissue culture. FITC-labeled tumor DNA (green signals) and rhodamine-labeled normal DNA (red signals) were cohybridized onto normal rat metaphase chromosomes. The insert shows the RUT13 average FITC:rhodamine fluorescence ratio profile for RNO4 (12 metaphases were analyzed). In RUT13 (and in four additional tumors), two discrete regions displaying high-level amplification were detected in the proximal region of RNO4, involving bands q12-q13 and q21-q22, respectively. The presence of two amplicons is evident by the two well-separated regions of green (tumor specific) hybridization on both RNO4 ho- mologues in the metaphases (arrowheads), as well as by the bimodal shape of the RNO4 ratio profile. B and C, dual-color FISH in the RUT13 rat EAC tissue culture. FITC-labeled PAC455(Cdk6)(green signals) and rhodamine-labeled PAC252(Met)(red signals) were cohybridized onto RUT13 metaphase spreads and interphase nuclei. In B, hybridization to the “native gene sites” at 4q13 (Cdk6) and 4q21.2 (Met) can be seen on one intact RNO4 (arrowhead). In addition, extensive amplification signals are seen in chromosomally integrated HSRs. The amplified Cdk6 sequences are confined to one HSR, whereas the amplified Met sequences are present in two separate HSRs. The Cdk6 probe yielded a pattern of compact and uniform hybridization, as compared with the discontinuous, ladder-like Met hybridization pattern. Be- cause the two genes were not coamplified in the same HSR, the two amplicons must have originated from two independent amplification processes. In interphase nuclei (C), the Cdk6 and Met signals were clustered in one and two distinct restricted areas, respectively. D–G, dual-color FISH in the NUT82 rat EAC tissue culture. FITC-labeled PAC455(Cdk6) (green signals) and rhodamine-labeled PAC252(Met) (red signals) were cohybridized onto NUT82 metaphase spreads and interphase nuclei. In contrast to the situation in RUT13, the signals in interphase nuclei of NUT82 are overlapping (D). In the metaphase shown (E–G), three intact RNO4 copies are present (arrowheads), all showing hybridization at the native gene sites at 4q13 (Cdk6; E) and 4q21.2 (Met; F). In the composite picture (G), it can be seen that the amplified Cdk6 and Met sequences are confined to the same two HSRs, and in this case, the Cdk6 hybridization pattern is more discontinuous and ladder like, whereas the Met hybridization pattern appears to be essentially uniform.

relative amounts of the fragments representing the tested gene and number in that the expression was strongest in the four tumors having ␤-actin, respectively, the expression in each tumor was classified as the highest Cdk6 copy numbers (RUT5, 13, NUT51, and 82; Fig. 6). very weak ([ϩ]), weak (ϩ), moderate (ϩϩ), or strong (ϩϩϩ; Table Furthermore, the expression of Cyp51 was strongest in RUT13, a 3). When detectable fragments were absent, the outcome was scored tumor having a Ͼ30-fold Cyp51 amplification, and weakest in RUT5 as no expression (Ϫ). and 7. The latter two tumors actually displayed a reduced Cyp51 copy Detectable amounts of mRNA were present for all of the 15 genes number (Յ1.5 copies/DCSE). A close correlation between mRNA in at least one of the 12 tumors (Table 3). Three genes (Hgf, Abcb1, levels and copy numbers was also observed for the Met gene, located and Tac1) were expressed merely in four tumors or less, e.g., Tac1 in the distal amplicon. The Met expression was strongest in four mRNA was present in very low amounts only in RUT25, whereas tumors exhibiting the highest Met copy numbers by Southern blot moderate and low amounts of Hgf mRNA were detected in RUT7 and analysis (RUT13, 29, NUT51, and 82), as well as in RUT7 showing in RUT30, respectively (Fig. 6). Another five genes (Cdk5, Dmtf1, 7-fold Met amplification (Fig. 6). Notably, the Met expression in Asns, Smoh, and Braf) displayed quite low and rather uniform levels RUT5, a tumor displaying 23-fold Met amplification, was moderate of expression among the tumors, e.g., Dmtf1 was weakly expressed in and resembled that of RUT3, a tumor known to have trisomy for all tumors, except in RUT3, in which the level of expression was RNO4 (12). The pattern of Cav1 expression among the tumors was slightly reduced. A similar pattern of weak but ubiquitous expression quite similar to that of Met, in that the strongest expression was was seen for Smoh. Furthermore, the Asns expression was weak in detected in RUT7, 13, 29, and NUT82. However, a very weak Cav1 RUT6, RUT12, and NUT82; absent in RUT5, 7, 13, 29, and 30; and expression was seen in NUT51, a tumor having Ͼ40-fold amplifica- very weak in the rest of the tumors. Arhgef5 was expressed in all tion of Cav1 (Fig. 6). tumors, at moderate levels in RUT7, 12, 25, 29, and 30 and at low or The Wnt2 expression was strongest in RUT2 and NUT82 and very low levels in the rest of the tumors. slightly weaker in RUT7, RUT13, and NUT51 (Fig. 6). Notably, the Strong expression was restricted to those genes displaying signifi- Wnt2 expression was very low in RUT29, a tumor shown to have cantly elevated copy numbers in the Southern blot analysis. The 21-fold amplification of Wnt2. In RUT5, the Wnt2 expression was amount of Cdk6 mRNA corresponded well with the Cdk6 gene copy absent, which was in accordance with the observed Wnt2 copy number 8268

Table 3 mRNA and Met protein expression in the rat tumor tissue cultures studied Total RNA and proteins from the 12 rat tumor tissue cultures were used in RT-PCR and Western blot analysis, respectively. In the RT-PCR experiments, each of the 15 genes were coamplified with ␤-actin using the primers listed in Table 1, and the relative mRNA levels were determined after electrophoresis on agarose (see also Fig. 6) and polyacrylamide gels. In the Western blot experiment, the proteins were probed with an antimouse Met antibody (see also Fig. 7). RNA and proteins from cultured rat embryo fibroblasts were included as control. mRNA expressiona

Tumor Cdk5 Hgf Dmtf1 Abcb1 Cyp51 Cdk6 Tac1 Asns Cav1 Met Wnt2 Cftr Smoh Braf Arhgef5 Met protein RUT2 ϩϪ ϩ ϩ ϩ ϩϩϪ[ϩ] ϩϩ ϩϩ ϩϩ ϩ ϩ ϩ ϩ [ϩ] RUT3 ϩϪ[ϩ] ϪϩϩϩϩϪ[ϩ] ϩϩϩ[ϩ] ϩϩϩϩ ϩ RUT6 ϩϩ Ϫ ϩ Ϫ ϩϩ ϩ Ϫ ϩ [ϩ] ϩϩ [ϩ] ϩϩ ϩ ϩ [ϩ][ϩ] RUT13 ϩ Ϫ ϩ Ϫ ϩϩϩ ϩϩϩ Ϫ Ϫ ϩϩϩ ϩϩϩ ϩ ϩϩϩ ϩ ϩ [ϩ] ϩϩϩ RUT7 [ϩ] ϩϩ ϩ Ϫ [ϩ] ϩ Ϫ Ϫ ϩϩϩ ϩϩϩ ϩ ϩϩ ϩ ϩ ϩϩ ϩϩ RUT12 Ϫ Ϫ ϩ Ϫ ϩϩ ϩϩ Ϫ ϩ ϩ ϩ Ϫ ϩ ϩ ϩ ϩϩ [ϩ] RUT25 ϩϪ ϩ Ϫ ϩ [ϩ][ϩ][ϩ] ϩϩϪϩϩϩϩϩϩϪ RUT30 ϩϩ ϩ ϩ ϩϩϩ ϪϪ ϩ [ϩ] Ϫ [ϩ] ϩ ϩ ϩϩ Ϫ NUT51 ϩ Ϫ ϩ ϩ ϩϩ ϩϩϩ Ϫ [ϩ][ϩ] ϩϩϩ ϩ ϩϩ ϩ [ϩ][ϩ] ϩϩϩ NUT82 ϩ Ϫ ϩ Ϫ ϩϩ ϩϩϩ Ϫ ϩ ϩϩϩ ϩϩϩ ϩϩ ϩϩ ϩ [ϩ][ϩ] ϩϩϩ RUT5 ϩϪ ϩ [ϩ][ϩ] ϩϩϩ Ϫ Ϫ ϩϩ ϩϩ Ϫ [ϩ] ϩ [ϩ][ϩ] ϩ RUT29 ϩ Ϫ ϩ Ϫ ϩϩ ϩϩ Ϫ Ϫ ϩϩϩ ϩϩϩ [ϩ][ϩ][ϩ] ϩ ϩϩ ϩϩϩ a The following classification was used: Ϫ, no expression; [ϩ], very weak expression; ϩ, weak expression; ϩϩ, moderate expression; ϩϩϩ, strong expression. reduction (Յ1.5 copies/DCSE). Furthermore, the Cftr expression was nonsusceptible strains (12). Amplification of the proximal region of strong in RUT13, moderate in RUT6, 7, NUT51, and 82, and very RNO4 emerged as the most common aberration, both in primary weak in RUT5 and RUT29. Thus, when comparing the correspond- tumors and in tissue cultures derived from them. To enable positional ence between mRNA expression and gene copy number, the correla- localization of candidate oncogenes, we isolated an array of large tion was higher for Cftr than for Wnt2. insert genomic PAC clones using PCR-generated probe fragments Expression of the Met Protein. In addition to the assessment of representing genes predicted to be located across the region (19). Met mRNA levels in the tumor tissue cultures, the expression status of Using the FISH and Southern blot techniques, we mapped amplified Met, the protein encoded by the Met proto-oncogene, was analyzed. RNO4 regions in detail in a material of tissue cultures of 10 EACs, Using an antimouse Met antibody, Western blot analysis of the six one ESCC, and one peritoneal mesothelioma. Six of the tumors tumors harboring Met amplification and the remaining six nonampli- carried different RNO4-derived amplification units, and we were able fied tumors was carried out. Undetectable or minimally detectable to identify two independent regions of common amplification encom- levels of Met protein were seen in all nonamplified tumors, except in passing 4q13 and 4q21.1-q21.2, respectively, suggesting that selection RUT3, which displayed a low Met protein abundance. This tumor was acts on at least two target genes. A similar situation has been reported known to contain a considerable fraction of cells having trisomy for in human breast carcinomas (25, 26), in which coamplification of two RNO4 (12). In the six tumors with Met amplification, the levels of syntenic, yet separate, regions on HSA17q was observed. Met protein corresponded well with the levels of Met mRNA, as well The more proximal amplified segment comprised up to four of the as the Met gene copy numbers. Large amounts of Met protein were genes tested (Dmtf1, Abcb1, Cyp51, and Cdk6), of which Cdk6, detected in RUT13, 29, NUT51, and 82, whereas RUT7 and RUT5 located at 4q13, was amplified most recurrently. The level of Cdk6 displayed moderate and low amounts of Met protein, respectively amplification was also markedly higher than the amplification levels (Fig. 7). of the coamplified genes in tumor amplicons containing additional Mutation Analysis of the Rat Met Gene. In human cancers, genes. Significantly, the elevated Cdk6 copy numbers were associated activation of the MET proto-oncogene by point mutations in the with elevated levels of Cdk6 mRNA, which was in accord with the tyrosine kinase domain has been reported previously in hereditary and typical relationship between gene amplification and overexpression. sporadic forms of papillary renal carcinoma (23) and in lymph node The human homologue, CDK6, has been localized to chromosome metastases of head and neck squamous cell carcinomas (24). To 7q21-q22 and has been postulated to be an important player in cell determine whether Met was activated by mutation in the present set of cycle control, providing a link between growth factor stimulation and rat tumors, DNA specimens of the 12 cultured tumors were screened onset of cell cycle progression (27). In fact, Harbour et al. (28) for DNA sequence alterations in exons 17–19, containing the tyrosine showed that CDK6 is one of the CDKs causing a sequential phos- kinase domain. Comparison of the obtained DNA sequences with rat Met sequences in the GenBank DNA sequence database revealed a phorylation of the RB1 protein that will progressively block active C3T alteration at the third position of codon 1172 in exon 17 growth suppression by RB1 in the G1 stage and thereby facilitate entry (AAT3AAC), which was present in all tumors. However, because into S phase. Despite the fact that CDK6 has features that are puta- this mutation did not result in an amino acid change (both AAT and tively oncogenic, reports describing CDK6 alterations in human can- AAC code for aspargine), it was interpreted as a silent polymorphism. cer are sparse. Some cases of tumor-associated CDK6 overexpression, In fact, this sequence variant appeared to be typical for all three strains in the absence of CDK6 amplification, have been described, e.g., used in the present investigation. The generated rat Met sequence was CDK6 overexpression was detected in T-cell lymphoblastic lympho- submitted to GenBank and was given the accession no. AF352173. ma/leukemia (29), as well as in splenic marginal zone lymphomas, carrying a specific translocation between HSA2 and 7, in which the HSA7 breakpoint was found to be situated upstream the CDK6 DISCUSSION transcription start site (30). In glioblastomas, overexpression of CDK6 To study the genetic aspects of the development of EAC, the could only be detected in advanced tumors but not in corresponding EAC-prone BDII rat was used to model human cancer. Using cyto- tumors of lower grade (31), suggesting that CDK6 up-regulation genetics and CGH, the pattern chromosomal changes was analyzed in might promote progression of these tumors. The only documentation a set of uterine tumors (mostly EACs), which developed spontane- of CDK6 overexpression in association with CDK6 amplification ously in progeny from crosses between BDII rats and rats from two comes from human gliomas (32). The authors suggested that the 8269

epithelial cells. In contrast, HGF/SF is predominantly expressed in mesenchymal cells and is thought to act on MET-expressing cells in a paracrine fashion (38). The signaling mediated by HGF/SF-MET interactions has been postulated to play an important role in proliferation and motility of epithelial cells in a variety of tissues, including the endometrial epithelium (39, 40). In fact, in vitro studies have shown that HGF/SF can stimulate invasion of endometrial carcinoma cell lines that express MET (41). Hence, on the basis of the postulated functions of CAV1 and MET, we speculate that MET represents a more attractive candidate target for gene amplification than does CAV1. In fact, numerous reports have emerged that implicate MET in tumor development. Specifically, up-regulation of MET transcripts has been observed in a variety of human cancers, suggesting a broad role for this receptor. Although overexpression of MET has been detected in various carcinomas, including gastric (5), ovarian (42), breast (43), thyroid (44), colorectal (45), and even in endometrial carcinomas (46), as well as in mu- coskeletal tumors (47). MET amplification has only been reported from human gastric carcinomas (5) and gliomas (48, 49). Thus, the present study is unique in that it is the first to demonstrate amplification of Met, in addition to overexpression, in endometrial carcinomas. There have also been reports of activating point mutations in human MET in certain tumor types (23, 24). We did not find any Met point mutations in the present material. Actually, this would probably Fig. 6. Analysis of mRNA levels in rat tumor tissue cultures. cDNA from the 12 tumor cultures, as well as from rat embryonic cells (data not shown), was used as template for not be expected, at least not in tumors showing amplification. It is PCR amplification. A 146-bp ␤-actin fragment was coamplified with each of the 15 known that the DNA sequence of amplified genes is seldom altered; analyzed genes, as a relative comparison. The PCR products were analyzed on agarose instead, it appears that it is the up-regulation of the unchanged gels. The panels display the results from RT-PCR of Hgf (335 bp), Cdk6 (344 bp), Tac1 (312 bp), Cav1 (392 bp), Met (317 bp), and Wnt2 (262 bp). The relative levels of wild-type gene that contributes to tumor development (50). expression were estimated from the gel photographs, but in some cases, more exact values Carcinomas are derived from epithelial tissues that normally ex- were obtained by analysis in the ABI 377 instrument using the Genescan software. The press Met. Thus, it is not unexpected that the expression of Met results from the analysis are shown in Table 3. mRNA was seen in all of the rat carcinomas studied. Somewhat surprisingly, the gene for the Met ligand, Hgf, was expressed (in amplification was restricted to CDK6, because no evidence could be absence Hgf amplification) in two tumors. In one of them (RUT30), found of coamplification of additional genes on HSA7, including the Hgf expression was quite weak, and in this tumor, the receptor EGFR at 7p11-p12, MET at 7q31, as well as expressed sequence tags gene appeared to be down-regulated (no Met protein was detectable in mapping near the CDK6 locus. the Western blot; Fig. 7), making an autocrine stimulation mechanism The amplified sequences in the second region encompassed up to less likely in this tumor. In contrast, the other tumor (RUT7) exhibited five of the genes tested (Cav1, Met, Wnt2, Cftr, and Smoh), and the quite strong Hgf expression in conjunction with a 7-fold Met ampli- core of the amplification was centered in the vicinity of Cav1 and Met fication and strong expression of both Met mRNA and Met protein. at 4q21.1–21.2. These two genes were coamplified in all six tumors Thus, one might speculate that an autocrine feedback loop is operating harboring RNO4 amplification; however, Met copy numbers were in this particular tumor, as compared with the paracrine HGF/SF usually slightly higher than those of Cav1. Furthermore, the correla- stimulation generally suggested for cells of epithelial origin. RUT7 tion between gene amplification and gene expression was closer for was also the only tumor displaying amplification of Met but not of Met than for Cav1. In fact, the Met mRNA and protein levels were Cdk6. In fact, there was a reduced copy number and weak expression greatly elevated whenever there was Met amplification. The only of Cdk6 in this tumor. exception was RUT5, which displayed Met mRNA and protein levels Although gene amplification is frequently observed in cancer, the similar to those in the RNO4-trisomic RUT3, despite the fact that it mechanisms underlying the process have yet to be described in had Ͼ20-fold amplification of Met. It should be noted that RUT5 was significant detail. Several models have been proposed to account for classified as an ESCC, whereas the remaining tumors (except RUT29) were EACs. In humans, CAV1 and MET are colocated at 7q31 and have both been assigned functions, which make them supposedly cancer related. The CAV1 product, caveolin, acts as a scaffolding protein, which organizes and concentrates specific lipids and lipid- modified signaling molecules within specialized membrane invagina- tions, called caveoles (33). Lines of observations suggest that caveolin has an inhibitory effect on these signaling molecules (reviewed in Ref. 34), which is in accord with a role of CAV1 as a putative tumor suppressor gene (35). The MET proto-oncogene was originally identified as a transforming gene activated by translocation in a chemi- Fig. 7. Western blot analysis of Met expression in rat tumor tissue cultures. The cally transformed human osteosarcoma cell line (36). MET encodes a membrane was probed with a rabbit polyclonal antimouse Met antibody. Two main bands transmembrane growth factor receptor tyrosine kinase, whose ligand, are visible, corresponding to the single-chain Mr 170,000 Met precursor and the Mr ␤ 140,000 native -chain (generated by cleavage of the Mr 170,000 precursor). The amount a soluble cytokine, is HGF/SF (37). Although expressed in many cell of Met protein is closely correlated to the mRNA expression levels (see Fig. 6 and Table types, the MET receptor tyrosine kinase is found at highest levels in 3) and is particularly high in the cultures that exhibit Met gene amplification. 8270

Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 2001 American Association for Cancer Research. GENE AMPLIFICATION IN RAT ENDOMETRIAL CANCER the formation of intrachromosomal amplification (reviewed in Refs. 2 tion, depth of myometrial invasion, and the occurrence of lymph node and 51). An attractive model, which may, at least in part, explain the metastases (58). In addition, other prognostic factors in endometrial formation of the large and sometimes discontinuously ladder-like carcinoma are currently being investigated, including estrogen and chromosomal configuration of the amplified sequences observed in progesterone receptor status, c-ERBB-2 status, and tumor ploidy (59, the present tumor material, is the one proposed by Coquelle et al. (52). 60). Interestingly, Wagatsuma et al. (46) showed that there was a According to this model, amplification relies on double-stranded correlation between MET expression and prognosis in patients with chromosome breakage at a minimum of two sites, possibly fragile endometrial carcinoma. sites, which bracket the region to become amplified. The initial The major reason to use an animal system to model a human breakage occurs at a site telomeric to the gene destined to become complex disease, such as endometrial cancer, is that the heterogeneity amplified and is followed by a sister-chromatid fusion at the break, in genetic and environmental factors, inherent in the human popula- yielding a dicentric bridge, which undergoes a second breakage during tion, may be greatly reduced in the model. Because the susceptibility mitotic segregation, at a site proximal to the gene. The new chromo- to spontaneously arising EAC tumors is clearly inherited from the some breakage will trigger a new round of fusion and breakage, and, BDII strain, and because the gene pool size and environmental vari- if there is selection pressure favoring multiple copies of the target ation is kept at a minimum, one might expect that the variation in gene, these cycles of breakage-fusion-bridge events could eventually genetic changes within the tumors would also be quite limited. How- give rise to arrays of intrachromosomal amplification, containing ever, gross chromosomal changes, detectable by cytogenetics and/or large regular inverted repeats (52). At later stages during the ampli- CGH, were still found to be quite variable among these tumors (12). fication process, when the selective pressure is relieved, the breakage- In the present study, 15 cases of gene amplification were detected in fusion-bridge cycles may be perpetuated by breakage at random sites 11 tumor cultures, involving eight different chromosomes (Table 2). along the bridge. This could explain a pattern of discontinuous “mixed This gives a clear indication that in cancer development, there must be ladder” organization of amplified sequences, such as that observed in many possible pathways of genetic changes that may lead to the same NUT82 for the Cdk6 gene (Fig. 5E), in which the initial regular end, even in a system of reduced variability, such as the one studied spacing is altered. There are several examples of the occurrence of here. The challenge is to identify and characterize each of these fragile sites flanking amplified regions in tumors. Coamplification of pathways. In our material, one change stood out: amplification in the several genes in band 11q13 is a common finding in many human proximal part of RNO4, which was detected by CGH in five tumors, cancers (9, 53). According to Coquelle et al. (52), at least three fragile but another one (RUT5) was added after the higher resolution analysis sites are located in the vicinity of this chromosome region, including with individual gene probes had been performed. Thus, it seems clear FRA11A at 11q13.3, FRA11F at 11q14.2, and FRA11H at 11q13. that amplifications involving this particular chromosome region are Shuster et al. (53) suggested that FRA11A might be involved in the part of a major pathway toward malignancy in this model. amplification process of 11q13 in oral squamous cell carcinomas. The The six tumors exhibiting amplification in proximal RNO4 be- amplified RNO4 region studied here shares homology with the long longed to three different tumor types, according to the pathological arm of HSA7. Several fragile sites have been suggested to be located analysis. Four of them (RUT7, 13, NUT51, and 82), however, repre- there, including FRA7E at 7q21.2, FRA7F at 7q22, FRA7G at 7q31.2, sented the EAC tumor type that is typical for the BDII strain. Of these, and FRA7H at 7q32.3 (54). CAV1 and MET were found to map near RUT7 exhibited amplification only in the more distal region, and, as FRA7G (35, 54), whereas CDK6, at 7q21-q22, could be located in the mentioned above, the finding of Hgf expression in this tumor provides vicinity of FRA7E and/or FRA7F. a possible growth-stimulating mechanism involving an autocrine loop, The amplified regions delineated in the present set of tumors were, which might contribute to the malignant phenotype. For the remaining in a recurrent manner, flanked by regions displaying reductions in tumors (three EACs, an ESCC, and a peritoneal mesothelioma), the gene copy number, compared with the normal 2 copies/DCSE. Not combination of amplification and overexpression of Cdk6 and Met only was the Asns gene never included in either of the amplicons, the provides suggestive evidence for their interaction in a pathway lead- Asns copy number was actually reduced in three of the six tumors with ing to the malignant transformation, although at this stage, the details RNO4 amplification, implying that a region including the Asns gene of this putative interaction is not clear. Obviously, it cannot be ruled might be deleted in cells from these tumors. Amplifications accom- out that other cancer-related genes might be situated inside the am- panied by adjacent deletions have also been observed in HSA11q13 in plicons and affect the development of these tumors. However, the human head and neck carcinomas (55) and in HSA17q12-q21 in known functions of Cdk6 and Met in cell cycle progression and breast cancer (7). Thus, it would be tempting to speculate that loss of proliferation/motility, respectively, make them attractive candidates to chromosomal material adjacent to amplifications may occur as a part play important roles in the genesis or progression of the rat tumors of the process leading to amplification. However, exactly how this studied. It would be of interest to determine whether the correspond- could take place and whether or not these amplification-associated ing pathways are involved in the development of human endometrial deletions represent pathways for tumor suppressor gene inactivation cancer and other human malignant tumors. remains to be elucidated. The identification of amplified genes in tumors may provide some ACKNOWLEDGMENTS insights into the pathogenesis of the neoplasms and may consequently be of a certain prognostic value. In many human tumors studied to We thank Elisabet Magnusson and Brita Bjo¨nness at the Department of Cell date, gene amplification is often strongly associated with an aggres- and Molecular Biology–Genetics, Go¨teborg University, for excellent technical sive behavior and poor outcome, e.g., MYCN amplification in neuro- assistance. We also thank Anna Danielsson for help with densitometrical blastoma patients has been found to be correlated with an advanced analysis of Southern blot data and Gyo¨rgy Horvath, both at the Department of stage and a rapid disease progression (56, 57) and serves today as a Oncology, Sahlgrenska University Hospital, Go¨teborg University, for com- valuable prognostic marker for this disease. Likewise, MET amplifi- ments on the manuscript. cation and/or overexpression has been correlated with depth of tumor invasion and lymph node metastasis in gastric carcinomas (5). In REFERENCES endometrial carcinoma, pathological features have been used for 1. Vogelstein, B., and Kinzler, K. W. The multistep nature of cancer. Trends Genet., 9: prognostic purposes, such as histological type, grade of differentia- 138–141, 1993. 8271

2. Schwab, M. Oncogene amplification in solid tumors. Semin. Cancer Biol., 9: 319– 29. Chilosi, M., Doglioni, C., Yan, Z., Lestani, M., Menestrina, F., Sorio, C., Benedetti, 325, 1999. A., Vinante, F., Pizzolo, G., and Inghirami, G. Differential expression of cyclin- 3. Schwab, M., and Amler, L. C. Amplification of cellular oncogenes: a predictor of dependent kinase 6 in cortical thymocytes and T-cell lymphoblastic lymphoma/ clinical outcome in human cancer. Genes Chromosomes Cancer, 1: 181–193, 1990. leukemia. Am. J. Pathol., 152: 209–217, 1998. 4. Brodeur, G. M., and Hogarty, M. D. Gene amplification in human cancers: biological 30. Corcoran, M. M., Mould, S. J., Orchard, J. A., Ibbotson, R. E., Chapman, R. M., and clinical significance. In: B. Vogelstien and K. W. Kinzler (eds.), The Genetic Boright, A. P., Platt, C., Tsui, L. C., Scherer, S. W., and Oscier, D. G. Dysregulation Basis of Human Cancer, pp. 161–172. New York: McGraw-Hill, Inc., 1998. of cyclin dependent kinase 6 expression in splenic marginal zone lymphoma through 5. Nakajima, M., Sawada, H., Yamada, Y., Watanabe, A., Tatsumi, M., Yamashita, J., chromosome 7q translocations. Oncogene, 18: 6271–6277, 1999. Matsuda, M., Sakaguchi, T., Hirao, T., and Nakano, H. The prognostic significance 31. Lam, P. Y., Di Tomaso, E., Ng, H. K., Pang, J. C., Roussel, M. F., and Hjelm, N. M. of amplification and overexpression of c-met and c-erb B-2 in human gastric carci- Expression of p19INK4d, CDK4, CDK6 in glioblastoma multiforme. Br. J. Neuro- nomas. Cancer, 85: 1894–1902, 1999. surg., 14: 28–32, 2000. 6. Amler, L. C., and Schwab, M. Amplified N-myc in human neuroblastoma cells is 32. Costello, J. F., Plass, C., Arap, W., Chapman, V. M., Held, W. A., Berger, M. S., Su often arranged as clustered tandem repeats of differently recombined DNA. Mol. Cell. Huang, H. J., and Cavenee, W. K. Cyclin-dependent kinase 6 (CDK6) amplification Biol., 9: 4903–4913, 1989. in human gliomas identified using two-dimensional separation of genomic DNA. 7. Jarvinen, T. A., Tanner, M., Barlund, M., Borg, A., and Isola, J. Characterization of Cancer Res., 57: 1250–1254, 1997. ␣ topoisomerase II gene amplification and deletion in breast cancer. Genes Chromo- 33. Engelman, J. A., Zhang, X., Galbiati, F., Volonte, D., Sotgia, F., Pestell, R. G., somes Cancer, 26: 142–150, 1999. Minetti, C., Scherer, P. E., Okamoto, T., and Lisanti, M. P. Molecular genetics of the 8. Collins, V. P. Gene amplification in human gliomas. Glia, 15: 289–296, 1995. caveolin gene family: implications for human cancers, diabetes, Alzheimer disease, 9. Schuuring, E. The involvement of the chromosome 11q13 region in human malig- and muscular dystrophy. Am. J. Hum. Genet., 63: 1578–1587, 1998. nancies: Cyclin D1 and EMS1 are two new candidate oncogenes–a review. Gene, 34. Okamoto, T., Schlegel, A., Scherer, P. E., and Lisanti, M. P. Caveolins, a family of 159: 83–96, 1995. scaffolding proteins for organizing “preassembled signaling complexes” at the plasma 10. Press, M. F. Gynecologic cancers. Cancer Suppl., 83: 1751–1756, 1998. membrane. J. Biol. Chem., 273: 5419–5422, 1998. 11. Deerberg, F., and Kaspareit, J. Endometrial carcinoma in BDII/Han rats: model of a 35. Engelman, J. A., Zhang, X. L., and Lisanti, M. P. Genes encoding human caveolin-1 spontaneous hormone-dependent tumor. J. Natl. Cancer Inst. (Bethesda), 78: 1245– and -2 are co-localized to the D7S522 locus (7q31.1), a known fragile site (FRA7G) 1251, 1987. 12. Helou, K., Walentinsson, A., Beckmann, B., Johansson, Å., Hedrich, H. J., Szpirer, that is frequently deleted in human cancers. FEBS Lett., 436: 403–410, 1998. C., Klinga-Levan, K., and Levan, G. Analysis of genetic changes in rat endometrial 36. Cooper, C. S., Park, M., Blair, D. G., Tainsky, M. A., Huebner, K., Croce, C. M., and carcinomas by means of comparative genome hybridization. Cancer Genet. Cyto- Vande Woude, G. F. Molecular cloning of a new transforming gene from a chemi- genet., 127: 118–127, 2001. cally transformed human cell line. Nature (Lond.), 311: 29–33, 1984. 13. Helou, K., Wallenius, V., Qiu, Y., O¨ hman, F., Ståhl, F., Klinga-Levan, K., Kindblom, 37. Maggiora, P., Gambarotta, G., Olivero, M., Giodano, S., Di Renzo, M. F., and L-G., Jansson, J-O., and Levan, G. Amplification and overexpression of the hepato- Comoglio, P. M. Control of invasive growth by the HGF receptor family. J. Cell cyte growth factor receptor (HGFR/MET) in rat DMBA sarcomas. Oncogene, 18: Physiol., 173: 183–186, 1997. 3226–3234, 1999. 38. Gherardi, E., and Stoker, M. Hepatocyte growth factor–scatter factor: mitogen, 14. Walentinsson, A., Sjo¨ling, Å., Helou, K., Klinga-Levan, K., and Levan, G. Genome- motogen, and met. Cancer Cells, 3: 227–232, 1991. wide assessment of genetic alterations in DMBA-induced rat sarcomas: cytogenetic, 39. Weidner, K. M., Sachs, M., and Birchmeier, W. The Met receptor tyrosine kinase CGH and allelotype analyses reveal recurrent DNA copy number changes in rat transduces motility, proliferation, and morphogenic signals of scatter factor/hepato- chromosome 1, 2, 4, and 7. Genes Chromosomes Cancer, 28: 184–195, 2000. cyte growth factor in epithelial cells. J. Cell Biol., 121: 145–154, 1993. 15. Helou, K., Walentinsson, A., Kost-Alimova, M., and Levan, G. Hgfr/Met oncogene 40. Sugawara, J., Fukaya, T., Murakami, T., Yoshida, H., and Yajima, A. Hepatocyte acts as target for gene amplification in DMBA-induced rat sarcomas: free chromatin growth factor stimulated proliferation, migration, and lumen formation of human FISH analysis of amplicon arrays in homogeneously staining regions. Genes Chro- endometrial epithelial cells in vitro. Biol. Reprod., 57: 936–942, 1997. mosomes Cancer, 30: 416–420, 2001. 41. Bae-Jump, V., Segreti, E. M., and Vandermolen, D. Hepatocyte growth factor (HGF) 16. Kaspareit-Rittinghausen, J., Deerberg, F., and Rapp, K. Mortality and incidence of induces invasion of endometrial carcinoma cell lines in vitro. Gynecol. Oncol., 73: spontaneous neoplasms in BDII/Han rats. Z. Verstierkd., 30: 209–216, 1987. 265–272, 1999. 17. Helou, K., Walther, L., Gu¨nther, E., and Levan, G. Cytogenetic orientation of the rat 42. Di Renzo, M. F., Olivero, M., Katsaros, D., Crepaldi, T., Gaglia, P., Zola, P., major histocompatibility complex (MHC) on chromosome 20. Immunogenetics, 47: Sismondi, P., and Comoglio, P. M. Overexpression of the Met/HGF receptor in 166–169, 1998. ovarian cancer. Int. J. Cancer, 58: 658–662, 1994. 18. Islam, M. Q., and Levan, G. A new fixation procedure for improved quality G-bands 43. Beviglia, L., Matsumoto, K., Lin, C. S., Ziober, B. L., and Kramer, R. H. Expression in routine cytogenetic work. Hereditas, 107: 127–130, 1987. of the c-Met/HGF receptor in human breast carcinoma: correlation with tumor 19. Walentinsson, A., Helou, K., and Levan, G. A dual-color FISH gene map of the progression. Int. J. Cancer, 74: 301–309, 1997. proximal region of rat chromosome 4 and comparative analysis in human and mouse. 44. Di Renzo, M. F., Olivero, M., Ferro, S., Prat, M., Bongarzone, I., Pilotti, S., Belfiore, Mamm. Genome, in press, 2001. A., Costantino, A., Vigneri, R., and Pierotti, M. A. Overexpression of the c-MET/ 20. Pinkel, D., Landegent, J., Collins, C., Fuscose, J., Segraves, R., Lucas, J., and Gray, HGF receptor gene in human thyroid carcinomas. Oncogene, 7: 2549–2553, 1992. J. Fluorescence in situ hybridization with human chromosome-specific libraries: 45. Di Renzo, M. F., Olivero, M., Giacomini, A., Porte, H., Chastre, E., Mirossay, L., detection of trisomy 21 and translocations of chromosome 4. Proc. Natl. Acad. Sci. Nordlinger, B., Bretti, S., Bottardi, S., and Giordano, S. Overexpression and ampli- USA, 85: 9138–9142, 1988. fication of the met/HGF receptor gene during the progression of colorectal cancer. 21. Feinberg, A. P., and Vogelstein, B. A technique for radiolabeling DNA restriction Clin. Cancer Res., 1: 147–154, 1995. endonuclease fragments to high specific activity. Anal. Biochem., 132: 6–13, 1983. 46. Wagatsuma, S., Konno, R., Sato, S., and Yajima, A. Tumor angiogenesis, hepatocyte 22. Piper, J., Rutovitz, D., Sudar, D., Kallioniemi, A., Kallioniemi, O. P., Waldman, growth factor, and c-Met expression in endometrial carcinoma. Cancer (Phila.), 82: F. M., Gray, J. W., and Pinkel, D. Computer image analysis of comparative genomic 520–530, 1998. hybridization. Cytometry, 19: 10–26, 1995. 47. Wallenius, V., Hisaoka, M., Helou, K., Levan, G., Mandahl, N., Meis-Kindblom, 23. Schmidt, L., Duh, F-M., Chen, F., Kishida, T., Glenn, G., Choyke, P., Scherer, S. W., J. M., Kindblom, L-G., and Jansson, J-O. Overexpression of the hepatocyte growth Zhuang, Z., Lubensky, I., Dean, M., Allikmets, R., Chidambaram, A., Bergerheim, factor (HGF) receptor (Met) and presence of a truncated and activated intracellular U. R., Feltis, J. T., Casadevall, C., Zamarron, A., Bernues, M., Richard, S., Lips, HGF receptor fragment in locally aggressive/malignant human musculoskeletal tu- C. J. M., Walther, M. M., Tsui, L-C., Geil, L., Orcutt, M. L., Stackhouse, T., Lipan, mors. Am. J. Pathol., 156: 821–829, 2000. J., Slife, L., Brauch, H., Decker, J., Niehans, G., Hughson, M. D., Moch, H., Storkel, 48. Wullich, B., Muller, H. W., Fischer, U., Zang, K. D., and Meese, E. Amplified met S., Lerman, M. I., Linehan, W. M., and Zbar, B. Germline and somatic mutations in the tyrosine kinase domain of the MET proto-oncogene in papillary renal carcinomas. gene linked to double minutes in human glioblastoma. Eur. J. Cancer, 29A: 1991– Nat. Genet., 16: 68–73, 1997. 1995, 1993. 24. Di Renzo, M. F., Olivero, M., Martone, T., Maffe, A., Maggiora, P., Stefani, A. D., 49. Fischer, U., Mu¨ller, H-W., Sattler, H-P., Feiden, K., Zang, K. D., and Meese, E. Valente, G., Giordano, S., Cortesina, G., and Comogli, O. P. M. Somatic mutations Amplification of the MET gene in glioma. Genes Chromosomes Cancer, 12: 63–65, of the MET oncogene are selected during metastatic spread of human HNSC carci- 1995. nomas. Oncogene, 19: 1547–1555, 2000. 50. Schwab, M. Amplification of oncogenes in human cancer cells. Bioessays, 20: 25. Ba¨rlund, M., Tirkkonen, M., Forozan, F., Tanner, M. M., Kallioniemi, O., and 473–479, 1998. Kallioniemi, A. Increased copy number at 17q22–q24 by CGH in breast cancer is due 51. Stark, G. R., Debatisse, M., Giulotto, E., and Wahl, G. M. Recent progress in to high-level amplification of two separate regions. Genes Chromosomes Cancer, 20: understanding mechanisms of mammalian DNA amplification. Cell, 57: 901–908, 372–376, 1997. 1989. 26. Latham, C., Zhang, A., Nalbanti, A., Måne´r, S., Zickert, P., Blegen, H., and 52. Coquelle, A., Pipiras, E., Toledo, F., Buttin, G., and Debatisse, M. Expression of Zetterberg, A. Frequent co-amplification of two different regions on 17q in aneuploid fragile sites triggers intrachromosomal mammalian gene amplification and sets breast carcinomas. Cancer Genet. Cytogenet., 127: 16–23, 2001. boundaries to early amplicons. Cell, 89: 215–225, 1997. 27. Meyerson, M., and Harlow, E. Identification of G1 kinase activity for cdk6, a novel 53. Shuster, M. I., Han, L., Le Beau, M. M., Davis, E., Sawicki, M., Lese, C. M., Park, cyclin D partner. Mol. Cell. Biol., 14: 2077–2086, 1994. N. H., Colicelli, J., and Gollin, S. M. A consistent pattern of RIN1 rearrangements in 28. Harbour, J. W., Luo, R. X., Dei Santi, A., Postigo, A. A., and Dean, D. C. Cdk oral squamous cell carcinoma cell lines supports a breakage-fusion-bridge cycle phosphorylation triggers sequential intramolecular interactions that progressively model for 11q13 amplification. Genes Chromosomes Cancer, 28: 153–163, 2000. block Rb functions as cells move through G1. Cell, 98: 859–869, 1999. 54. Huang, H., Qian, C., Jenkins, R. B., and Smith, D. I. Fish mapping of YAC clones at 8272

human chromosomal band 7q31.2: identification of YACS spanning FRA7G within Hammond, D. Association of multiple copies of the N-myc oncogene with rapid the common region of LOH in breast and prostate cancer. Genes Chromosomes progression of neuroblastomas. N. Engl. J. Med., 313: 1111–1116, 1985. Cancer, 21: 152–159, 1998. 58. Boronow, R. C., Morrow, C. P., Creasman, W. T., Disaia, P. J., Silverberg, S. G., 55. Jin, Y., Hoglund, M., Jin, C., Martins, C., Wennerberg, J., Akervall, J., Mandahl, N., Miller, A., and Blessing, J. A. Surgical staging in endometrial cancer: clinical- Mitelman, F., and Mertens, F. FISH characterization of head and neck carcinomas pathologic findings of a prospective study. Obstet. Gynecol., 63: 825–832, 1984. reveals that amplification of band 11q13 is associated with deletion of distal 11q. 59. Chew, S. H. Prognostic factors in endometrial carcinoma. Ann. Acad. Med. Singap., Genes Chromosomes Cancer, 22: 312–320, 1998. 28: 266–271, 1999. 56. Brodeur, G. M., Seeger, R. C., Schwab, M., Varmus, H. E., and Bishop, J. M. 60. Susini, T., Rapi, S., Massi, D., Savino, L., Amunni, G., Taddei, G. L., and Massi, G. Amplification of N-myc in untreated human neuroblastomas correlates with advanced Preoperative evaluation of tumor ploidy in endometrial carcinoma: an accurate tool to disease stage. Science (Wash. DC), 224: 1121–1124, 1984. identify patients at risk for extrauterine disease and recurrence. Cancer (Phila.), 86: 57. Seeger, R. C., Brodeur, G. M., Sather, H., Dalton, A., Siegel, S. E., Wong, K. Y., and 1005–1012, 1999.

8273

Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 2001 American Association for Cancer Research. Independent Amplification of Two Gene Clusters on Chromosome 4 in Rat Endometrial Cancer: Identification and Molecular Characterization

Anna Walentinsson, Khalil Helou, Ville Wallenius, et al.

Cancer Res 2001;61:8263-8273.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/61/22/8263

Cited articles This article cites 57 articles, 8 of which you can access for free at: http://cancerres.aacrjournals.org/content/61/22/8263.full#ref-list-1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/61/22/8263. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.