Trophinin (TRO) (NM 016157) Human Untagged Clone Product Data
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Downloaded from [266]
Patterns of DNA methylation on the human X chromosome and use in analyzing X-chromosome inactivation by Allison Marie Cotton B.Sc., The University of Guelph, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2012 © Allison Marie Cotton, 2012 Abstract The process of X-chromosome inactivation achieves dosage compensation between mammalian males and females. In females one X chromosome is transcriptionally silenced through a variety of epigenetic modifications including DNA methylation. Most X-linked genes are subject to X-chromosome inactivation and only expressed from the active X chromosome. On the inactive X chromosome, the CpG island promoters of genes subject to X-chromosome inactivation are methylated in their promoter regions, while genes which escape from X- chromosome inactivation have unmethylated CpG island promoters on both the active and inactive X chromosomes. The first objective of this thesis was to determine if the DNA methylation of CpG island promoters could be used to accurately predict X chromosome inactivation status. The second objective was to use DNA methylation to predict X-chromosome inactivation status in a variety of tissues. A comparison of blood, muscle, kidney and neural tissues revealed tissue-specific X-chromosome inactivation, in which 12% of genes escaped from X-chromosome inactivation in some, but not all, tissues. X-linked DNA methylation analysis of placental tissues predicted four times higher escape from X-chromosome inactivation than in any other tissue. Despite the hypomethylation of repetitive elements on both the X chromosome and the autosomes, no changes were detected in the frequency or intensity of placental Cot-1 holes. -
1 Supporting Information for a Microrna Network Regulates
Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia. -
Role of RUNX1 in Aberrant Retinal Angiogenesis Jonathan D
Page 1 of 25 Diabetes Identification of RUNX1 as a mediator of aberrant retinal angiogenesis Short Title: Role of RUNX1 in aberrant retinal angiogenesis Jonathan D. Lam,†1 Daniel J. Oh,†1 Lindsay L. Wong,1 Dhanesh Amarnani,1 Cindy Park- Windhol,1 Angie V. Sanchez,1 Jonathan Cardona-Velez,1,2 Declan McGuone,3 Anat O. Stemmer- Rachamimov,3 Dean Eliott,4 Diane R. Bielenberg,5 Tave van Zyl,4 Lishuang Shen,1 Xiaowu Gai,6 Patricia A. D’Amore*,1,7 Leo A. Kim*,1,4 Joseph F. Arboleda-Velasquez*1 Author affiliations: 1Schepens Eye Research Institute/Massachusetts Eye and Ear, Department of Ophthalmology, Harvard Medical School, 20 Staniford St., Boston, MA 02114 2Universidad Pontificia Bolivariana, Medellin, Colombia, #68- a, Cq. 1 #68305, Medellín, Antioquia, Colombia 3C.S. Kubik Laboratory for Neuropathology, Massachusetts General Hospital, 55 Fruit St., Boston, MA 02114 4Retina Service, Massachusetts Eye and Ear Infirmary, Department of Ophthalmology, Harvard Medical School, 243 Charles St., Boston, MA 02114 5Vascular Biology Program, Boston Children’s Hospital, Department of Surgery, Harvard Medical School, 300 Longwood Ave., Boston, MA 02115 6Center for Personalized Medicine, Children’s Hospital Los Angeles, Los Angeles, 4650 Sunset Blvd, Los Angeles, CA 90027, USA 7Department of Pathology, Harvard Medical School, 25 Shattuck St., Boston, MA 02115 Corresponding authors: Joseph F. Arboleda-Velasquez: [email protected] Ph: (617) 912-2517 Leo Kim: [email protected] Ph: (617) 912-2562 Patricia D’Amore: [email protected] Ph: (617) 912-2559 Fax: (617) 912-0128 20 Staniford St. Boston MA, 02114 † These authors contributed equally to this manuscript Word Count: 1905 Tables and Figures: 4 Diabetes Publish Ahead of Print, published online April 11, 2017 Diabetes Page 2 of 25 Abstract Proliferative diabetic retinopathy (PDR) is a common cause of blindness in the developed world’s working adult population, and affects those with type 1 and type 2 diabetes mellitus. -
An Integrated Genomic Analysis of Gene-Function Correlation on Schizophrenia Susceptibility Genes
Journal of Human Genetics (2010) 55, 285–292 & 2010 The Japan Society of Human Genetics All rights reserved 1434-5161/10 $32.00 www.nature.com/jhg ORIGINAL ARTICLE An integrated genomic analysis of gene-function correlation on schizophrenia susceptibility genes Tearina T Chu and Ying Liu Schizophrenia is a highly complex inheritable disease characterized by numerous genetic susceptibility elements, each contributing a modest increase in risk for the disease. Although numerous linkage or association studies have identified a large set of schizophrenia-associated loci, many are controversial. In addition, only a small portion of these loci overlaps with the large cumulative pool of genes that have shown changes of expression in schizophrenia. Here, we applied a genomic gene-function approach to identify susceptibility loci that show direct effect on gene expression, leading to functional abnormalities in schizophrenia. We carried out an integrated analysis by cross-examination of the literature-based susceptibility loci with the schizophrenia-associated expression gene list obtained from our previous microarray study (Journal of Human Genetics (2009) 54: 665–75) using bioinformatic tools, followed by confirmation of gene expression changes using qPCR. We found nine genes (CHGB, SLC18A2, SLC25A27, ESD, C4A/C4B, TCP1, CHL1 and CTNNA2) demonstrate gene-function correlation involving: synapse and neurotransmission; energy metabolism and defense mechanisms; and molecular chaperone and cytoskeleton. Our findings further support the roles of these genes in genetic influence and functional consequences on the development of schizophrenia. It is interesting to note that four of the nine genes are located on chromosome 6, suggesting a special chromosomal vulnerability in schizophrenia. -
Dosage Compensation in Mammals: Fine-Tuning the Expression of the X Chromosome
Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Dosage compensation in mammals: fine-tuning the expression of the X chromosome Edith Heard1,3 and Christine M. Disteche2,4 1CNRS UMR218, Curie Institute, 75248 Paris, Cedex 05, France; 2Department of Pathology and Department of Medicine, University of Washington, Seattle, Washington 98195, USA Mammalian females have two X chromosomes and somes. In eutherians, X-chromosome inactivation (XCI) males have only one. This has led to the evolution of affects the paternal or maternal X chromosome ran- special mechanisms of dosage compensation. The inac- domly during early development, and the inactive state tivation of one X chromosome in females equalizes gene is then stably inherited, giving rise to adults that are expression between the sexes. This process of X-chromo- mosaics for two cell types, expressing one or the other X some inactivation (XCI) is a remarkable example of long- chromosome. The initiation of X inactivation is con- range, monoallelic gene silencing and facultative hetero- trolled by the X-inactivation center (Xic), which pro- chromatin formation, and the questions surrounding it duces the noncoding Xist transcript responsible for trig- have fascinated biologists for decades. How does the in- gering silencing in cis. In marsupials and in the extraem- activation of more than a thousand genes on one X chro- bryonic tissues of some placental mammals such as mosome take place while the other X chromosome, rodents, XCI is imprinted, with the paternal X chromo- present in the same nucleus, remains genetically active? some (Xp) being inactivated. -
Human Tagged ORF Clone – RG212703
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG212703 Trophinin (TRO) (NM_177556) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Trophinin (TRO) (NM_177556) Human Tagged ORF Clone Tag: TurboGFP Symbol: TRO Synonyms: MAGE-d3; MAGED3 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Trophinin (TRO) (NM_177556) Human Tagged ORF Clone – RG212703 ORF Nucleotide >RG212703 representing NM_177556 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATAGGAGAAATGACTACGGATATAGGGTGCCTCTATTTCAGGGCCCTCTGCCTCCCCCGGGGAGCC TGGGGCTTCCCTTCCCTCCAGATATACAGACTGAGACCACAGAAGAGGACAGTGTCCTGCTGATGCATAC CCTGTTGGCGGCAACCAAGGACTCCCTGGCCATGGACCCACCAGTTGTCAACCGGCCTAAGAAAAGCAAG ACCAAGAAGGCCCCTATAAAGACTATTACTAAGGCTGCACCTGCTGCCCCTCCAGTCCCAGCTGCCAATG AGATTGCCACCAACAAGCCCAAAATAACTTGGCAGGCTTTAAACCTGCCAGTCATTACCCAGATCAGCCA GGCTTTACCTACCACTGAGGTAACCAATACTCAGGCTTCTTCAGTCACTGCTCAGCCTAAGAAAGCCAAC AAGATGAAGAGAGTTACTGCCAAGGCAGCCCAAGGCTCCCAATCCCCAACTGGCCATGAGGGTGGCACTA TACAGCTGAAGTCACCCTTGCAGGTCCTAAAGCTACCAGTCATCTCACAGAATATTCACGCTCCAATTGC CAATGAGTCAGCCAGTTCCCAAGCCTTGATAACCTCTATCAAGCCTAAGAAAGCTTCCAAGGCTAAGAAG -
Genetic Technologies for Building a Better Mouse
Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW A most formidable arsenal: genetic technologies for building a better mouse James F. Clark,1 Colin J. Dinsmore,1 and Philippe Soriano Department of Cell, Developmental, and Regenerative Biology, Icahn School of Medicine at Mt. Sinai, New York, New York 10029, USA The mouse is one of the most widely used model organ- scribing Mendelian inheritance for mouse coat color char- isms for genetic study. The tools available to alter the acteristics (Cuénot 1902). Mendel himself had started mouse genome have developed over the preceding decades down this same road fifty years earlier, only for his bishop from forward screens to gene targeting in stem cells to the to snuff out the nascent breeding program because a monk recent influx of CRISPR approaches. In this review, we had no business, frankly, breeding (Paigen 2003). first consider the history of mice in genetic study, the Following Cuénot’s papers (Cuénot 1902), genetic re- development of classic approaches to genome modifica- search using the mouse began in earnest, often through tion, and how such approaches have been used and im- the study of spontaneous mouse mutants. One line of re- proved in recent years. We then turn to the recent surge search further explored the complicated genetics of pig- of nuclease-mediated techniques and how they are chang- mentation and the sometimes-surprising coincident ing the field of mouse genetics. Finally, we survey com- phenotypes. The Dominant white spotting allele W (an al- mon classes of alleles used in mice and discuss how lele of the receptor tyrosine kinase Kit) was found to affect they might be engineered using different methods. -
Uniprot: a Hub for Protein Information the Uniprot Consortium1,2,3,4,*
D204–D212 Nucleic Acids Research, 2015, Vol. 43, Database issue Published online 27 October 2014 doi: 10.1093/nar/gku989 UniProt: a hub for protein information The UniProt Consortium1,2,3,4,* 1European Molecular Biology Laboratory, European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SD, UK, 2SIB Swiss Institute of Bioinformatics, Centre Medical Universitaire, 1 rue Michel Servet, 1211 Geneva 4, Switzerland, 3Protein Information Resource, Georgetown University Medical Center, 3300 Whitehaven Street North West, Suite 1200, Washington, DC 20007, USA and 4Protein Information Resource, University of Delaware, 15 Innovation Way, Suite 205, Newark, DE 19711, USA Received September 16, 2014; Accepted October 04, 2014 ABSTRACT with high-throughput data and automatic annotation ap- Downloaded from proaches to allow it to be fully exploited. UniProt facilitates UniProt is an important collection of protein se- scientific discovery by organizing biological knowledge and quences and their annotations, which has doubled enabling researchers to rapidly comprehend complex areas in size to 80 million sequences during the past year. of biology. This growth in sequences has prompted an exten- In brief, UniProt is composed of several important sion of UniProt accession number space from 6 to 10 component parts. The section of UniProt that con- http://nar.oxfordjournals.org/ characters. An increasing fraction of new sequences tains manually curated and reviewed entries is known as are identical to a sequence that already exists in UniProtKB/Swiss-Prot and currently contains about half a the database with the majority of sequences coming million sequences. This section grows as new proteins are from genome sequencing projects. -
Uniprot: a Hub for Protein Information the Uniprot Consortium1,2,3,4,*
D204–D212 Nucleic Acids Research, 2015, Vol. 43, Database issue Published online 27 October 2014 doi: 10.1093/nar/gku989 UniProt: a hub for protein information The UniProt Consortium1,2,3,4,* 1European Molecular Biology Laboratory, European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SD, UK, 2SIB Swiss Institute of Bioinformatics, Centre Medical Universitaire, 1 rue Michel Servet, 1211 Geneva 4, Switzerland, 3Protein Information Resource, Georgetown University Medical Center, 3300 Whitehaven Street North West, Suite 1200, Washington, DC 20007, USA and 4Protein Information Resource, University of Delaware, 15 Innovation Way, Suite 205, Newark, DE 19711, USA Received September 16, 2014; Accepted October 04, 2014 Downloaded from ABSTRACT with high-throughput data and automatic annotation ap- proaches to allow it to be fully exploited. UniProt facilitates UniProt is an important collection of protein se- scientific discovery by organizing biological knowledge and quences and their annotations, which has doubled enabling researchers to rapidly comprehend complex areas in size to 80 million sequences during the past year. of biology. This growth in sequences has prompted an exten- In brief, UniProt is composed of several important http://nar.oxfordjournals.org/ sion of UniProt accession number space from 6 to 10 component parts. The section of UniProt that con- characters. An increasing fraction of new sequences tains manually curated and reviewed entries is known as are identical to a sequence that already exists in UniProtKB/Swiss-Prot and currently contains about half a the database with the majority of sequences coming million sequences. This section grows as new proteins are from genome sequencing projects. -
Literature Mining of Transcription Factors Involved In
Finding biomarkers in non-model species: literature mining of transcription factors involved in bovine embryo development Nicolas Turenne, Evgeniy Tiys, Vladimir Ivanisenko, Nikolay Yudin, Elena Ignatieva, Damien Valour, Severine Degrelle, Isabelle Hue To cite this version: Nicolas Turenne, Evgeniy Tiys, Vladimir Ivanisenko, Nikolay Yudin, Elena Ignatieva, et al.. Finding biomarkers in non-model species: literature mining of transcription factors involved in bovine em- bryo development. BioData Mining, BioMed Central, 2012, 5 (1), pp.12. 10.1186/1756-0381-5-12. inserm-02440326 HAL Id: inserm-02440326 https://www.hal.inserm.fr/inserm-02440326 Submitted on 15 Jan 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Turenne et al. BioData Mining 2012, 5:12 http://www.biodatamining.org/content/5/1/12 BioData Mining METHODOLOGY Open Access Finding biomarkers in non-model species: literature mining of transcription factors involved in bovine embryo development Nicolas Turenne1*†, Evgeniy Tiys2†, Vladimir Ivanisenko2†, Nikolay Yudin5†, Elena Ignatieva6†, -
Reproductive Biology and Endocrinology Biomed Central
Reproductive Biology and Endocrinology BioMed Central Review Open Access The prolactin and growth hormone families: Pregnancy-specific hormones/cytokines at the maternal-fetal interface Michael J Soares* Address: Institute of Maternal-Fetal Biology, Division of Cancer & Developmental Biology, Department of Pathology & Laboratory Medicine, University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, Kansas 66160, USA Email: Michael J Soares* - [email protected] * Corresponding author Published: 05 July 2004 Received: 05 February 2004 Accepted: 05 July 2004 Reproductive Biology and Endocrinology 2004, 2:51 doi:10.1186/1477-7827-2-51 This article is available from: http://www.rbej.com/content/2/1/51 © 2004 Soares; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL. Abstract The prolactin (PRL) and growth hormone (GH) gene families represent species-specific expansions of pregnancy-associated hormones/cytokines. In this review we examine the structure, expression patterns, and biological actions of the pregnancy-specific PRL and GH families. Review their association with pregnancy and regulatory mecha- Prolactin (PRL) and growth hormone (GH) are hor- nisms controlling viviparity. In this minireview we exam- mones/cytokines responsible for the coordination of a ine the structure, expression patterns, and biological wide range of biological processes in vertebrates. They can actions of the PRL and GH families from rodents (prima- act as classic endocrine modulators (hormones) via entry rily rat and mouse), ruminants (primarily ovine and into the circulation or locally (cytokines) through juxta- bovine), and primates (primarily human). -
Genetic Variation Within the Daphnia Pulex Genome Abraham Eaton Tucker University of New Hampshire, Durham
University of New Hampshire University of New Hampshire Scholars' Repository Doctoral Dissertations Student Scholarship Spring 2009 Genetic variation within the Daphnia pulex genome Abraham Eaton Tucker University of New Hampshire, Durham Follow this and additional works at: https://scholars.unh.edu/dissertation Recommended Citation Tucker, Abraham Eaton, "Genetic variation within the Daphnia pulex genome" (2009). Doctoral Dissertations. 490. https://scholars.unh.edu/dissertation/490 This Dissertation is brought to you for free and open access by the Student Scholarship at University of New Hampshire Scholars' Repository. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of University of New Hampshire Scholars' Repository. For more information, please contact [email protected]. GENETIC VARIATION WITHIN THE DAPHNIA PULEX GENOME BY ABRAHAM EATON TUCKER B.S., University of Southern Maine, 2003 DISSERTATION Submitted to the University of New Hampshire in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy In Genetics May, 2009 UMI Number: 3363734 INFORMATION TO USERS The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleed-through, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. UMI UMI Microform 3363734 Copyright 2009 by ProQuest LLC All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code.