DOCSLIB.ORG

Research Article Loss of LLGL1 Expression Correlates with Diffuse Gastric Cancer and Distant Peritoneal Metastases

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Research Article Loss of LLGL1 Expression Correlates with Diffuse Gastric Cancer and Distant Peritoneal Metastases Hindawi Canadian Journal of Gastroenterology and Hepatology Volume 2019, Article ID 2920493, 12 pages https://doi.org/10.1155/2019/2920493 Research Article Loss of LLGL1 Expression Correlates with Diffuse Gastric Cancer and Distant Peritoneal Metastases Alexander Desuki,1,2 Frank Staib ,1,3 Ines Gockel,4 Markus Moehler,1 Hauke Lang,5 Stefan Biesterfeld,6 Annett Maderer,1 Peter R. Galle ,1 Martin R. Berger,7 and Carl C. Schimanski 1,8 1 First Department of Internal Medicine, Johannes Gutenberg University, Langenbeckstraße 1, 55131 Mainz, Germany 2Tird Department of Internal Medicine, Johannes Gutenberg University, 55131 Mainz, Germany 3Department of Internal Medicine, Marienhospital Darmstadt gGmbH, Martinspfad 72, 64285 Darmstadt, Germany 4DepartmentofVisceral,Transplantation,ToracicandVascularSurgery,UniversityofLeipzig,Liebigstraße20, 04103 Leipzig, Germany 5Department of Abdominal and General Surgery, Johannes Gutenberg University, Langenbeckstraße 1, 55131 Mainz, Germany 6Institute of Pathology, Johannes Gutenberg University, Langenbeckstraße 1, 55131 Mainz, Germany 7Toxicology and Chemotherapy Unit, German Cancer Research Center, Im Neuenheimer Feld 280, 69120 Heidelberg, Germany 8Second Department of Internal Medicine, Klinikum Darmstadt GmbH, Grafenstraße 9, 64283 Darmstadt, Germany Correspondence should be addressed to Peter R. Galle; [email protected] and Carl C. Schimanski; [email protected] Received 29 May 2018; Accepted 21 February 2019; Published 1 April 2019 Academic Editor: Masanao Nakamura Copyright © 2019 Alexander Desuki et al. Tis is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background.LossofLLGL1 has been associated with loss of cellular adhesion and dissemination of cells from colorectal cancer and malignant melanoma. Regulation and relevance of LLGL1 were analyzed in gastric cancer patients with lymphatic and distant dissemination. Furthermore, LLGL1 expression was analyzed in relation to the cellular adhesion protein E-cadherin. Methods. LLGL1 and E-cadherin transcription levels were evaluated in 56 gastric cancer patients and fve gastric cancer cell lines. IHC staining for LLGL1 was performed on 39 gastric cancer specimens. LLGL1 was stably transfected into LLGL1 negative gastric cancer cell line SNU16 (del(17) (p11.2)) for functional in vitro assays and a xenograf bioassay. Results. Gastric cancer specimens and cell lines displayed LLGL1 and E-cadherin expression levels with variable intensity. In gastric mucosa, LLGL1 exhibited weak cytoplasmic and strong cortical staining. Loss of LLGL1 expression occurred in 65% of gastric cancers and signifcantly correlated with loss of E-cadherin expression (P=0.00009). Loss of LLGL1 expression was associated with the difuse type of gastric cancer (P=0.029) with peritoneal carcinomatosis (M1; P=0.006) and with female gender (P=0.017). Stable reexpression of LLGL1 in SNU16 cells signifcantly increased both plastic surface adhesion and extracellular matrix proteins laminin and fbronectin, but had no impact on in vitro proliferation, apoptosis, or invasion or on in vivo proliferation or diferentiation in our xenograf bioassay. Conclusion. LLGL1 is coexpressed with E-cadherin. Loss of expression of either protein is associated with difuse gastric cancer and peritoneal metastases. LLGL1 does not impact on proliferation or epithelial-mesenchymal transition (EMT) rather increasing cellular adhesion. 1. Introduction standard therapy with curative intention is radical surgical resection with standardized D2-lymphadenectomy. Despite Gastric cancer incidence has decreased steadily in industri- considerable improvements achieving R0 resections patients alized countries over the last years. However, gastric cancer still require (neo)adjuvant chemotherapeutic strategies as still ranks among the most common causes of cancer and they are still at high risk for local recurrences and early lymph its mortality rate remains high [1–3]. Te current gold node or systemic metastases [4, 5]. 2 Canadian Journal of Gastroenterology and Hepatology Accepted risk factors for gastric cancer are chronic Regarding LLGL2, reduced expression has been described in atrophic gastritis, chronic H. pylori infection, and hyper- specimens of high grade pancreatic intraepithelial neoplasia, trophic gastropathy among others [6]. Molecular determi- high grade gastric dysplasia, and carcinoma [37–40]. Interest- nants occurring during the development of gastric cancer ingly, reduced basolateral LLGL2 expression was associated include mutations of tumor suppressor genes (E-cadherin, with difuse type gastric cancer and reduced E-cadherin APC, DCC, Rb, p53), oncogenes (K-ras), and mismatch repair expression [38, 41]. Taken together with the data presented genes (MLH-1)[7–10]. in this paper, evidence is accumulating that both human Tumor dissemination results from loss of cellular adhe- homologues of Drosophila l(2)gl are involved in common sion, chemotaxis, and neoangiogenesis. Junctions between human pathways, the inactivation of which promotes cancer epithelial cells have communicating functions such as gap dissemination. junctions, are anchoring junctions such as desmosomes and Te present study was performed to evaluate the role of adherens junctions, or are sealing junctions such as zonula LLGL1 in human gastric carcinogenesis and to analyze the occludens or tight junctions. Adherens junctions segregate association and shared regulation with E-cadherin expres- theapicalfromthebasolateralmembranedomains.Te sion. We screened the transcription profle of LLGL1 and E- predominant protein of adherens junctions is E-cadherin,a cadherin in 5 human gastric cancer cell lines and 56 gastric transmembrane protein stabilizing the basolateral cell-cell carcinomas and performed additional IHC staining of 5 contact. Loss of E-cadherin expression has been linked to gastric mucosal samples and 39 gastric cancers. Functional dissemination of various gastrointestinal malignancies [11, in vitro assays with a stably LLGL1 transfectedcelllinewere 12]. As early as in 1994, loss of E-cadherin expression was performed to characterize the biological features of LLGL1. correlated with difuse type gastric cancer [13]. Since then, We then used the cell lines to induce subcutaneous xenograf multiple reports have described the association between dif- tumors and assessed size and grading with respect to LLGL1 fuse gastric cancer and metastatic disease and also linked the expression. loss of E-cadherin expression with familial gastric cancer [14, 15]. Loss of E-cadherin decreases cellular adhesion, resulting in a critical increase in cellular motility and migration [16]. 2. Material and Methods Another relevant protein for cellular adhesion along 2.1. Cell Culture. For functional analyses, we studied the the basolateral membrane domain is lethal giant larvae human gastric cancer cell lines AGS, NCI-N87, OE33, (l(2)gl)[17].InDrosophila loss of l(2)gl results in loss of MKN45, and SNU16. All cell lines were cultured in DMEM epithelial structure, malignant transformation of the brain supplemented with 10% FCS. hemispheres, and the imaginal discs and in growth of tumor masses resembling human cancers [18]. Tese tumors proliferate and migrate to distant sites upon transplantation 2.2. Tissue Source and Storage. Following ethics committee into wild type Drosophila, thus acting like human metastatic approval and signed informed consent, samples from the cancers [19, 20]. Homologues of l(2)gl have been identifed center of the tumor were obtained from 56 patients under- in diverse species such as rat, insect, worm, and man [21– going elective surgery for gastric cancer at the Department of 23]. Remarkably, the particular function of l(2)gl is conserved Abdominal- and General Surgery, Johannes Gutenberg Uni- among species, as shown by rescue of the l(2)gl mutation in versity, Mainz, Germany. All tissues were stored in cryovials, shock frozen in liquid nitrogen immediately afer extirpation Drosophila with the human homologue LLGL1 [22, 24]. ∘ Evidence has also been published that mammalian l(2)gl andstoredat-80Cuntilfurtherprocessing. regulates epithelial cell polarity and migration as a member of the polarity complex consisting of Par6/Par3/atypical PKC 2.3. RNA Isolation and RT-PCR. RNA isolation was per- and l(2)gl [25–27]. formed using the Qiagen RNeasy Kit according to the man- In humans, highly related homologues of l(2)gl, LLGL1, ufacturer’s recommendations (Qiagen, Hilden, Germany). and LLGL2 have been identifed, mapping to the short and Gene transcription of ß-actin, LLGL1, and E-cadherin was long arm of chromosome 17. LLGL1 has been located in a analyzed by two-step RT-PCR: Reverse transcription was critical pericentromeric region, 17p11.2-12 containing cancer performed with 2 �g of RNA (20 �l total volume; Ominscript susceptibility genes for primitive neuroectodermal tumors RT Kit, Qiagen) according to the recommendations of the [21]. Furthermore, LLGL1 maps within the 17p interstitial manufacturer. One �l of the cDNA was used as template deletion detected in mentally retarded children with Smith- for PCR-reactions. Primers applied were ß-actin-forward: � � Magenis syndrome [28, 29]. 5 - TGACGGGGTCACCCACACTGTGCCCATCTA - 3 � In 2005, loss of LLGL1 was associated with tumor- and ß-actin-reverse: 5 - CTAGAAGCATTTGCGGTGGAC- � suppressive functions and
Load more

Recommended publications
  • Cell Division Symmetry Control and Cancer Stem Cells
    AIMS Molecular Science, 7(2): 82–98. DOI: 10.3934/molsci.2020006 Received: 15 February 2020 Accepted: 26 April 2020 Published: 06 May 2020 http://www.aimspress.com/journal/Molecular Review Cell division symmetry control and cancer stem cells Sreemita Majumdar and Song-Tao Liu* Department of Biological Sciences, University of Toledo, Toledo, OH 43606, USA * Correspondence: Email: [email protected]; Tel: +14195307853. Table S1. Genes encoding polarity and fate-determinant proteins involved in asymmetric cell division. C. elegans1 D. melanogaster 1 Mammals1 Description2 Associated with/ Interactors 3 Cellular Localization (mammalian cell)4 Serine/threonine protein microtubule-associated protein cell membrane, peripheral and lateral, par-1 par-1 MARK1/2/3/4 kinase MAPT/TAU cytoplasm, dendrite RING, Lipid binding par-2 - - domain PDZ for membrane, cell junction, adherens junction, cell cortex, par-3 baz PARD3 Oligomerization domain at actin, PARD6 endomembrane system, NTD Continued on next page 2 C. elegans1 D. melanogaster 1 Mammals1 Description2 Associated with/ Interactors 3 Cellular Localization (mammalian cell)4 Serine/threonine-protein nucleus, mitochondria, cytoplasm, par-4 Lkb1 STK11/LKB1 STRAD complex kinase membrane 14-3-3 domain binding par-5 14-3-3 YWHAB phosphoserine/ adapter to many proteins cytoplasm phosphothreonine motif cell membrane, centriolar satellite, actin par-6 par-6 PARD6A/B/G PB1, CRIB, PDZ PARD3 cytoskeleton,centrosome, cytoplasm ,ruffles PARD3, and a PARD6 protein PB1, AGC-Kinase (PARD6A, PARD6B or PARD6G) pkc-3 aPKC PRKCI/Z domain, DAG binding, cytoplasm, nucleus, membrane and a GTPase protein (CDC42 or Zinc finger domain RAC1), LLGL1,ECT2 LRR and PDZ protein Cadherin, Scrib-APC-beta-catenin nucleoplasm, basolateral plasma membrane, let-413 scrib SCRIB family.
    [Show full text]
  • Genes in a Refined Smith-Magenis Syndrome Critical Deletion Interval on Chromosome 17P11.2 and the Syntenic Region of the Mouse
    Downloaded from genome.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Article Genes in a Refined Smith-Magenis Syndrome Critical Deletion Interval on Chromosome 17p11.2 and the Syntenic Region of the Mouse Weimin Bi,1,6 Jiong Yan,1,6 Paweł Stankiewicz,1 Sung-Sup Park,1,7 Katherina Walz,1 Cornelius F. Boerkoel,1 Lorraine Potocki,1,3 Lisa G. Shaffer,1 Koen Devriendt,4 Małgorzata J.M. Nowaczyk,5 Ken Inoue,1 and James R. Lupski1,2,3,8 Departments of 1Molecular & Human Genetics, 2Pediatrics, Baylor College of Medicine, 3Texas Children’s Hospital, Houston, Texas 77030, USA; 4Centre for Human Genetics, University Hospital Gasthuisberg, Catholic University of Leuven, B-3000 Leuven, Belgium; 5Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Ontario L8S 4J9, Canada Smith-Magenis syndrome (SMS) is a multiple congenital anomaly/mental retardation syndrome associated with behavioral abnormalities and sleep disturbance. Most patients have the same ∼4 Mb interstitial genomic deletion within chromosome 17p11.2. To investigate the molecular bases of the SMS phenotype, we constructed BAC/PAC contigs covering the SMS common deletion interval and its syntenic region on mouse chromosome 11. Comparative genome analysis reveals the absence of all three ∼200-kb SMS-REP low-copy repeats in the mouse and indicates that the evolution of SMS-REPs was accompanied by transposition of adjacent genes. Physical and genetic map comparisons in humans reveal reduced recombination in both sexes. Moreover, by examining the deleted regions in SMS patients with unusual-sized deletions, we refined the minimal Smith-Magenis critical region (SMCR) to an ∼1.1-Mb genomic interval that is syntenic to an ∼1.0-Mb region in the mouse.
    [Show full text]
  • Distinct Genetic Alterations in Colorectal Cancer
    Distinct Genetic Alterations in Colorectal Cancer Hassan Ashktorab1*, Alejandro A. Scha¨ffer2, Mohammad Daremipouran3, Duane T. Smoot3, Edward Lee3, Hassan Brim3 1 Department of Medicine and Cancer Center, Howard University, College of Medicine, Washington, DC, United States of America, 2 National Center for Biotechnology Information, National Institutes of Health (NIH), Department of Health and Human Services (DHHS), Bethesda, Maryland, United States of America, 3 Department of Pathology, Howard University, College of Medicine, Washington, DC, United States of America Abstract Background: Colon cancer (CRC) development often includes chromosomal instability (CIN) leading to amplifications and deletions of large DNA segments. Epidemiological, clinical, and cytogenetic studies showed that there are considerable differences between CRC tumors from African Americans (AAs) and Caucasian patients. In this study, we determined genomic copy number aberrations in sporadic CRC tumors from AAs, in order to investigate possible explanations for the observed disparities. Methodology/Principal Findings: We applied genome-wide array comparative genome hybridization (aCGH) using a 105k chip to identify copy number aberrations in samples from 15 AAs. In addition, we did a population comparative analysis with aCGH data in Caucasians as well as with a widely publicized list of colon cancer genes (CAN genes). There was an average of 20 aberrations per patient with more amplifications than deletions. Analysis of DNA copy number of frequently altered chromosomes revealed that deletions occurred primarily in chromosomes 4, 8 and 18. Chromosomal duplications occurred in more than 50% of cases on chromosomes 7, 8, 13, 20 and X. The CIN profile showed some differences when compared to Caucasian alterations. Conclusions/Significance: Chromosome X amplification in male patients and chromosomes 4, 8 and 18 deletions were prominent aberrations in AAs.
    [Show full text]
  • A Model for Profiling the Emolecular Effects of Alcohol
    The Pharmacogenomics Journal (2015) 15, 177–188 © 2015 Macmillan Publishers Limited All rights reserved 1470-269X/15 www.nature.com/tpj ORIGINAL ARTICLE The synaptoneurosome transcriptome: a model for profiling the emolecular effects of alcohol D Most1,2, L Ferguson1,2, Y Blednov1, RD Mayfield1 and RA Harris1 Chronic alcohol consumption changes gene expression, likely causing persistent remodeling of synaptic structures via altered translation of mRNAs within synaptic compartments of the cell. We profiled the transcriptome from synaptoneurosomes (SNs) and paired total homogenates (THs) from mouse amygdala following chronic voluntary alcohol consumption. In SN, both the number of alcohol-responsive mRNAs and the magnitude of fold-change were greater than in THs, including many GABA-related mRNAs upregulated in SNs. Furthermore, SN gene co-expression analysis revealed a highly connected network, demonstrating coordinated patterns of gene expression and highlighting alcohol-responsive biological pathways, such as long-term potentiation, long-term depression, glutamate signaling, RNA processing and upregulation of alcohol-responsive genes within neuroimmune modules. Alterations in these pathways have also been observed in the amygdala of human alcoholics. SNs offer an ideal model for detecting intricate networks of coordinated synaptic gene expression and may provide a unique system for investigating therapeutic targets for the treatment of alcoholism. The Pharmacogenomics Journal (2015) 15, 177–188; doi:10.1038/tpj.2014.43; published online 19 August 2014 INTRODUCTION mRNAs from SN15,16,18,19 and TH samples from mouse amygdala, a Alcohol dependence is a severe and widespread disease. Over 17 brain region known to be involved with the negative reinforce- 20 million Americans suffer from alcohol-related problems; total cost ment of alcohol and other drugs of abuse.
    [Show full text]
  • Genomic Organization of the Approximately 1.5 Mb Smith
    European Journal of Human Genetics (2001) 9, 892 ± 902 ã 2001 Nature Publishing Group All rights reserved 1018-4813/01 $15.00 www.nature.com/ejhg ARTICLE Genomic organisation of the ~1.5 Mb Smith-Magenis syndrome critical interval: Transcription map, genomic contig, and candidate gene analysis Rebecca E Lucas1, Christopher N Vlangos1, Parimal Das4, Pragna I Patel4 and Sarah H Elsea*,1,2,3 1Genetics Graduate Program, Michigan State University, East Lansing, Michigan, MI 48824, USA; 2Department of Zoology, Michigan State University, East Lansing, Michigan, MI 48824, USA; 3Department of Pediatrics and Human Development, Michigan State University, East Lansing, Michigan, MI 48824, USA; 4Department of Neurology, Baylor College of Medicine, Houston, Texas, TX 77030, USA Smith-Magenis syndrome (SMS) is a multiple congenital anomalies/mental retardation syndrome associated with an interstitial deletion of chromosome 17 involving band p11.2. SMS is hypothesised to be a contiguous gene syndrome in which the phenotype arises from the haploinsufficiency of multiple, functionally-unrelated genes in close physical proximity, although the true molecular basis of SMS is not yet known. In this study, we have generated the first overlapping and contiguous transcription map of the SMS critical interval, linking the proximal 17p11.2 region near the SMS-REPM and the distal region near D17S740 in a minimum tiling path of 16 BACs and two PACs. Additional clones provide greater coverage throughout the critical region. Not including the repetitive sequences that flank the critical interval, the map is comprised of 13 known genes, 14 ESTs, and six genomic markers, and is a synthesis of Southern hybridisation and polymerase chain reaction data from gene and marker localisation to BACs and PACs and database sequence analysis from the human genome project high-throughput draft sequence.
    [Show full text]
  • In This Table Protein Name, Uniprot Code, Gene Name P-Value
    Supplementary Table S1: In this table protein name, uniprot code, gene name p-value and Fold change (FC) for each comparison are shown, for 299 of the 301 significantly regulated proteins found in both comparisons (p-value<0.01, fold change (FC) >+/-0.37) ALS versus control and FTLD-U versus control. Two uncharacterized proteins have been excluded from this list Protein name Uniprot Gene name p value FC FTLD-U p value FC ALS FTLD-U ALS Cytochrome b-c1 complex P14927 UQCRB 1.534E-03 -1.591E+00 6.005E-04 -1.639E+00 subunit 7 NADH dehydrogenase O95182 NDUFA7 4.127E-04 -9.471E-01 3.467E-05 -1.643E+00 [ubiquinone] 1 alpha subcomplex subunit 7 NADH dehydrogenase O43678 NDUFA2 3.230E-04 -9.145E-01 2.113E-04 -1.450E+00 [ubiquinone] 1 alpha subcomplex subunit 2 NADH dehydrogenase O43920 NDUFS5 1.769E-04 -8.829E-01 3.235E-05 -1.007E+00 [ubiquinone] iron-sulfur protein 5 ARF GTPase-activating A0A0C4DGN6 GIT1 1.306E-03 -8.810E-01 1.115E-03 -7.228E-01 protein GIT1 Methylglutaconyl-CoA Q13825 AUH 6.097E-04 -7.666E-01 5.619E-06 -1.178E+00 hydratase, mitochondrial ADP/ATP translocase 1 P12235 SLC25A4 6.068E-03 -6.095E-01 3.595E-04 -1.011E+00 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 Protein kinase C and casein Q9BY11 PACSIN1 3.837E-03 -5.863E-01 3.680E-06 -1.824E+00 kinase substrate in neurons protein 1 Tubulin polymerization- O94811 TPPP 6.466E-03 -5.755E-01 6.943E-06 -1.169E+00 promoting protein MIC C9JRZ6 CHCHD3 2.912E-02 -6.187E-01 2.195E-03 -9.781E-01 Mitochondrial 2-
    [Show full text]
  • "The Genecards Suite: from Gene Data Mining to Disease Genome Sequence Analyses". In: Current Protocols in Bioinformat
    The GeneCards Suite: From Gene Data UNIT 1.30 Mining to Disease Genome Sequence Analyses Gil Stelzer,1,5 Naomi Rosen,1,5 Inbar Plaschkes,1,2 Shahar Zimmerman,1 Michal Twik,1 Simon Fishilevich,1 Tsippi Iny Stein,1 Ron Nudel,1 Iris Lieder,2 Yaron Mazor,2 Sergey Kaplan,2 Dvir Dahary,2,4 David Warshawsky,3 Yaron Guan-Golan,3 Asher Kohn,3 Noa Rappaport,1 Marilyn Safran,1 and Doron Lancet1,6 1Department of Molecular Genetics, Weizmann Institute of Science, Rehovot, Israel 2LifeMap Sciences Ltd., Tel Aviv, Israel 3LifeMap Sciences Inc., Marshfield, Massachusetts 4Toldot Genetics Ltd., Hod Hasharon, Israel 5These authors contributed equally to the paper 6Corresponding author GeneCards, the human gene compendium, enables researchers to effectively navigate and inter-relate the wide universe of human genes, diseases, variants, proteins, cells, and biological pathways. Our recently launched Version 4 has a revamped infrastructure facilitating faster data updates, better-targeted data queries, and friendlier user experience. It also provides a stronger foundation for the GeneCards suite of companion databases and analysis tools. Improved data unification includes gene-disease links via MalaCards and merged biological pathways via PathCards, as well as drug information and proteome expression. VarElect, another suite member, is a phenotype prioritizer for next-generation sequencing, leveraging the GeneCards and MalaCards knowledgebase. It au- tomatically infers direct and indirect scored associations between hundreds or even thousands of variant-containing genes and disease phenotype terms. Var- Elect’s capabilities, either independently or within TGex, our comprehensive variant analysis pipeline, help prepare for the challenge of clinical projects that involve thousands of exome/genome NGS analyses.
    [Show full text]
  • 12159 LLGL1 (D2B5A) Rabbit Mab
    Revision 1 C 0 2 - t LLGL1 (D2B5A) Rabbit mAb a e r o t S Orders: 877-616-CELL (2355) [email protected] 9 Support: 877-678-TECH (8324) 5 1 Web: [email protected] 2 www.cellsignal.com 1 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source/Isotype: UniProt ID: Entrez-Gene Id: WB, IF-IC H Mk Endogenous 130 Rabbit IgG Q15334 3996 Product Usage Information 1. Agrawal, N. et al. (1995) Dev Biol 172, 218-29. 2. Massimi, P. et al. (2008) Exp Cell Res 314, 3306-17. Application Dilution 3. Strand, D. et al. (1995) Oncogene 11, 291-301. 4. Schimanski, C.C. et al. (2005) Oncogene 24, 3100-9. Western Blotting 1:1000 5. Kuphal, S. et al. (2006) Oncogene 25, 103-10. Immunofluorescence (Immunocytochemistry) 1:50 6. Lu, X. et al. (2009) Clin Cancer Res 15, 3287-96. 7. Müsch, A. et al. (2002) Mol Biol Cell 13, 158-68. 8. Yamanaka, T. et al. (2003) Curr Biol 13, 734-43. Storage 9. Mechler, B.M. et al. (1985) EMBO J 4, 1551-7. Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA, 50% 10. Sripathy, S. et al. (2011) Mol Cell Biol 31, 2920-33. glycerol and less than 0.02% sodium azide. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity LLGL1 (D2B5A) Rabbit mAb recognizes endogenous levels of total LLGL1 protein. This antibody does not cross-react with LLGL2.
    [Show full text]
  • LLGL1 Rabbit Pab
    Leader in Biomolecular Solutions for Life Science LLGL1 Rabbit pAb Catalog No.: A20205 Basic Information Background Catalog No. This gene encodes a protein that is similar to a tumor suppressor in Drosophila. The protein A20205 is part of a cytoskeletal network and is associated with nonmuscle myosin II heavy chain and a kinase that specifically phosphorylates this protein at serine residues. The gene is located Observed MW within the Smith-Magenis syndrome region on chromosome 17. 115KDa Calculated MW 112kDa Category Primary antibody Applications WB, IHC, IF Cross-Reactivity Human, Mouse, Rat Recommended Dilutions Immunogen Information WB 1:500 - 1:2000 Gene ID Swiss Prot 3996 Q15334 IHC 1:50 - 1:200 Immunogen IF 1:50 - 1:200 Recombinant fusion protein containing a sequence corresponding to amino acids 945-1064 of human LLGL1 (NP_004131.3). Synonyms DLG4; HUGL; LLGL; Lgl1; Mgl1; HUGL1; HUGL-1 Contact Product Information 400-999-6126 Source Isotype Purification Rabbit IgG Affinity purification [email protected] Storage www.abclonal.com.cn Store at -20℃. Avoid freeze / thaw cycles. Buffer: PBS with 0.02% sodium azide,50% glycerol,pH7.3. Validation Data Western blot analysis of extracts of various cell lines, using LLGL1 antibody (A20205) at 1:1000 dilution. Secondary antibody: HRP Goat Anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution. Lysates/proteins: 25ug per lane. Blocking buffer: 3% nonfat dry milk in TBST. Detection: ECL Basic Kit (RM00020). Exposure time: 10s. Western blot analysis of extracts of Rat testis, using LLGL1 antibody (A20205) at 1:1000 dilution. Secondary antibody: HRP Goat Anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.
    [Show full text]
  • Human Social Genomics in the Multi-Ethnic Study of Atherosclerosis
    Getting “Under the Skin”: Human Social Genomics in the Multi-Ethnic Study of Atherosclerosis by Kristen Monét Brown A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Epidemiological Science) in the University of Michigan 2017 Doctoral Committee: Professor Ana V. Diez-Roux, Co-Chair, Drexel University Professor Sharon R. Kardia, Co-Chair Professor Bhramar Mukherjee Assistant Professor Belinda Needham Assistant Professor Jennifer A. Smith © Kristen Monét Brown, 2017 [email protected] ORCID iD: 0000-0002-9955-0568 Dedication I dedicate this dissertation to my grandmother, Gertrude Delores Hampton. Nanny, no one wanted to see me become “Dr. Brown” more than you. I know that you are standing over the bannister of heaven smiling and beaming with pride. I love you more than my words could ever fully express. ii Acknowledgements First, I give honor to God, who is the head of my life. Truly, without Him, none of this would be possible. Countless times throughout this doctoral journey I have relied my favorite scripture, “And we know that all things work together for good, to them that love God, to them who are called according to His purpose (Romans 8:28).” Secondly, I acknowledge my parents, James and Marilyn Brown. From an early age, you two instilled in me the value of education and have been my biggest cheerleaders throughout my entire life. I thank you for your unconditional love, encouragement, sacrifices, and support. I would not be here today without you. I truly thank God that out of the all of the people in the world that He could have chosen to be my parents, that He chose the two of you.
    [Show full text]
  • Network of Micrornas-Mrnas Interactions in Pancreatic Cancer
    Hindawi Publishing Corporation BioMed Research International Volume 2014, Article ID 534821, 8 pages http://dx.doi.org/10.1155/2014/534821 Research Article Network of microRNAs-mRNAs Interactions in Pancreatic Cancer Elnaz Naderi,1 Mehdi Mostafaei,2 Akram Pourshams,1 and Ashraf Mohamadkhani1 1 Liver and Pancreatobiliary Diseases Research Center, Digestive Diseases Research Institute, Tehran University of Medical Sciences, Tehran, Iran 2 Biotechnology Engineering, Islamic Azad University,Tehran North Branch, Tehran, Iran Correspondence should be addressed to Ashraf Mohamadkhani; [email protected] Received 5 February 2014; Revised 13 April 2014; Accepted 13 April 2014; Published 7 May 2014 Academic Editor: FangXiang Wu Copyright © 2014 Elnaz Naderi et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background. MicroRNAs are small RNA molecules that regulate the expression of certain genes through interaction with mRNA targets and are mainly involved in human cancer. This study was conducted to make the network of miRNAs-mRNAs interactions in pancreatic cancer as the fourth leading cause of cancer death. Methods. 56 miRNAs that were exclusively expressed and 1176 genes that were downregulated or silenced in pancreas cancer were extracted from beforehand investigations. MiRNA–mRNA interactions data analysis and related networks were explored using MAGIA tool and Cytoscape 3 software. Functional annotations of candidate genes in pancreatic cancer were identified by DAVID annotation tool. Results. This network is made of 217 nodes for mRNA, 15 nodes for miRNA, and 241 edges that show 241 regulations between 15 miRNAs and 217 target genes.
    [Show full text]
  • Phenotype Informatics
    Freie Universit¨atBerlin Department of Mathematics and Computer Science Phenotype informatics: Network approaches towards understanding the diseasome Sebastian Kohler¨ Submitted on: 12th September 2012 Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) am Fachbereich Mathematik und Informatik der Freien Universitat¨ Berlin ii 1. Gutachter Prof. Dr. Martin Vingron 2. Gutachter: Prof. Dr. Peter N. Robinson 3. Gutachter: Christopher J. Mungall, Ph.D. Tag der Disputation: 16.05.2013 Preface This thesis presents research work on novel computational approaches to investigate and characterise the association between genes and pheno- typic abnormalities. It demonstrates methods for organisation, integra- tion, and mining of phenotype data in the field of genetics, with special application to human genetics. Here I will describe the parts of this the- sis that have been published in peer-reviewed journals. Often in modern science different people from different institutions contribute to research projects. The same is true for this thesis, and thus I will itemise who was responsible for specific sub-projects. In chapter 2, a new method for associating genes to phenotypes by means of protein-protein-interaction networks is described. I present a strategy to organise disease data and show how this can be used to link diseases to the corresponding genes. I show that global network distance measure in interaction networks of proteins is well suited for investigat- ing genotype-phenotype associations. This work has been published in 2008 in the American Journal of Human Genetics. My contribution here was to plan the project, implement the software, and finally test and evaluate the method on human genetics data; the implementation part was done in close collaboration with Sebastian Bauer.
    [Show full text]